#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PTCHD2	57540	broad.mit.edu	37	1	11576212	11576212	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:11576212C>G	ENST00000294484.6	+	6	1881	c.1743C>G	c.(1741-1743)ttC>ttG	p.F581L	PTCHD2_ENST00000389575.3_Missense_Mutation_p.F581L	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	581	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CTAACGTCTTCTCCCAGGTGC	0.622																																							uc001ash.3		NA																	0				skin(3)|ovary(2)|pancreas(1)|breast(1)	7						c.(1741-1743)TTC>TTG		patched domain containing 2							74.0	86.0	82.0					1																	11576212		2164	4256	6420	SO:0001583	missense	57540				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity	g.chr1:11576212C>G	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1743C>G	1.37:g.11576212C>G	ENSP00000294484:p.Phe581Leu		Somatic				PTCHD2_uc001asi.1_Missense_Mutation_p.F581L	p.F581L	NM_020780	NP_065831	WXS	Illumina HiSeq	Unspecified	Q9P2K9	PTHD2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)	6	1881	+	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	581			Helical; (Potential).|SSD.		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	c.1743C>G	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.687646	0.68157	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.95103	-3.61;-3.61	5.5	4.57	0.56435	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.93321	0.7871	L	0.28014	0.82	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.89610	0.3841	10	0.11182	T	0.66	-41.5778	10.0426	0.42166	0.0:0.8449:0.0:0.1551	.	581	Q9P2K9	PTHD2_HUMAN	L	581	ENSP00000294484:F581L;ENSP00000374226:F581L	ENSP00000294484:F581L	F	+	3	2	PTCHD2	11498799	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	2.417000	0.44653	1.300000	0.44818	0.555000	0.69702	TTC		0.622	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561		8	57	0	0	0	0.006214	0	8	57				
USP48	84196	broad.mit.edu	37	1	22032648	22032648	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:22032648G>C	ENST00000308271.9	-	18	2892	c.2244C>G	c.(2242-2244)ttC>ttG	p.F748L	USP48_ENST00000400301.1_Missense_Mutation_p.F748L|USP48_ENST00000374732.3_Missense_Mutation_p.F286L|USP48_ENST00000529637.1_Missense_Mutation_p.F760L	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	748	DUSP 3. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CTTCTACAAAGAACTGAGACA	0.343																																							uc001bfb.2		NA																	0				ovary(1)|lung(1)	2						c.(2242-2244)TTC>TTG		ubiquitin specific protease 48 isoform a							90.0	88.0	89.0					1																	22032648		2203	4300	6503	SO:0001583	missense	84196				ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr1:22032648G>C	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2244C>G	1.37:g.22032648G>C	ENSP00000309262:p.Phe748Leu		Somatic				USP48_uc001bfa.2_Missense_Mutation_p.F286L|USP48_uc010odq.1_Missense_Mutation_p.F760L|USP48_uc009vqc.2_Missense_Mutation_p.F682L|USP48_uc001bfc.2_Missense_Mutation_p.F748L|USP48_uc001bfd.1_5'Flank	p.F748L	NM_032236	NP_115612	WXS	Illumina HiSeq	Unspecified	Q86UV5	UBP48_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)	18	2482	-		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	748			DUSP 3.		B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	c.2244C>G	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	G	9.839	1.190476	0.21954	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	T;T;T	0.04862	3.55;3.54;3.56	5.81	1.35	0.21983	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (1);	0.043717	0.85682	D	0.000000	T	0.05823	0.0152	M	0.63428	1.95	0.51482	D	0.99992	P;B;B;B;P	0.42871	0.512;0.109;0.228;0.278;0.792	B;B;B;B;B	0.35039	0.18;0.021;0.121;0.057;0.194	T	0.44314	-0.9336	10	0.10902	T	0.67	.	10.3796	0.44104	0.3451:0.0:0.6549:0.0	.	760;748;748;748;286	B7ZKS7;B7ZKS3;Q86UV5-2;Q86UV5;Q86UV5-5	.;.;.;UBP48_HUMAN;.	L	748;748;286;760	ENSP00000383157:F748L;ENSP00000309262:F748L;ENSP00000431949:F760L	ENSP00000309262:F748L	F	-	3	2	USP48	21905235	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	0.980000	0.29513	0.384000	0.24942	0.460000	0.39030	TTC		0.343	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236		3	49	0	0	0	0.000248	0	3	49				
ZDHHC18	84243	broad.mit.edu	37	1	27159094	27159094	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:27159094G>A	ENST00000374142.4	+	2	587	c.492G>A	c.(490-492)caG>caA	p.Q164Q		NM_032283.2	NP_115659.1	Q9NUE0	ZDH18_HUMAN	zinc finger, DHHC-type containing 18	164					cellular protein localization (GO:0034613)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)	3		all_cancers(24;5.82e-22)|all_epithelial(13;9.91e-20)|Colorectal(325;0.000147)|Breast(348;0.000706)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;5.71e-53)|Epithelial(14;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(117;1.53e-29)|Colorectal(126;1.9e-09)|COAD - Colon adenocarcinoma(152;4.2e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000548)|STAD - Stomach adenocarcinoma(196;0.00065)|KIRC - Kidney renal clear cell carcinoma(1967;0.000779)|GBM - Glioblastoma multiforme(114;0.0265)|READ - Rectum adenocarcinoma(331;0.0455)|Lung(427;0.163)|LUSC - Lung squamous cell carcinoma(448;0.237)		TGGAGAAACAGATCGGTGAGG	0.557																																							uc001bnb.2		NA																	0					0						c.(490-492)CAG>CAA		zinc finger, DHHC-type containing 18							46.0	49.0	48.0					1																	27159094		2203	4300	6503	SO:0001819	synonymous_variant	84243					integral to membrane	zinc ion binding	g.chr1:27159094G>A	AK056427	CCDS30650.1	1p36.11	2008-05-02			ENSG00000204160	ENSG00000204160		"""Zinc fingers, DHHC-type"""	20712	protein-coding gene	gene with protein product							Standard	NM_032283		Approved	DKFZp667O2416	uc001bnb.3	Q9NUE0	OTTHUMG00000004092	ENST00000374142.4:c.492G>A	1.37:g.27159094G>A			Somatic				ZDHHC18_uc010ofh.1_Silent_p.Q29Q	p.Q164Q	NM_032283	NP_115659	WXS	Illumina HiSeq	Unspecified	Q9NUE0	ZDH18_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;5.71e-53)|Epithelial(14;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(117;1.53e-29)|Colorectal(126;1.9e-09)|COAD - Colon adenocarcinoma(152;4.2e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000548)|STAD - Stomach adenocarcinoma(196;0.00065)|KIRC - Kidney renal clear cell carcinoma(1967;0.000779)|GBM - Glioblastoma multiforme(114;0.0265)|READ - Rectum adenocarcinoma(331;0.0455)|Lung(427;0.163)|LUSC - Lung squamous cell carcinoma(448;0.237)	2	587	+		all_cancers(24;5.82e-22)|all_epithelial(13;9.91e-20)|Colorectal(325;0.000147)|Breast(348;0.000706)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)	164					A6NHY9|B4DQ84|Q5JYH0|Q9H020	Silent	SNP	ENST00000374142.4	37	c.492G>A	CCDS30650.1																																																																																				0.557	ZDHHC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011706.3	NM_032283		7	54	0	0	0	0.001984	0	7	54				
PTPRU	10076	broad.mit.edu	37	1	29618506	29618506	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:29618506C>T	ENST00000345512.3	+	16	2603	c.2474C>T	c.(2473-2475)tCc>tTc	p.S825F	PTPRU_ENST00000428026.2_Missense_Mutation_p.S815F|PTPRU_ENST00000323874.8_Missense_Mutation_p.S815F|PTPRU_ENST00000356870.3_Missense_Mutation_p.S815F|PTPRU_ENST00000460170.2_Missense_Mutation_p.S815F|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000373779.3_Missense_Mutation_p.S815F	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	825	Mediates interaction with CTNNB1. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CTGGGCCTGTCCTTCATGGAC	0.632																																							uc001bru.2		NA																	0				large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7						c.(2473-2475)TCC>TTC		protein tyrosine phosphatase, receptor type, U							66.0	60.0	62.0					1																	29618506		2203	4300	6503	SO:0001583	missense	10076				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:29618506C>T	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2474C>T	1.37:g.29618506C>T	ENSP00000334941:p.Ser825Phe		Somatic				PTPRU_uc001brv.2_Missense_Mutation_p.S815F|PTPRU_uc001brw.2_Missense_Mutation_p.S815F|PTPRU_uc009vtq.2_Missense_Mutation_p.S815F|PTPRU_uc009vtr.2_Missense_Mutation_p.S815F	p.S825F	NM_005704	NP_005695	WXS	Illumina HiSeq	Unspecified	Q92729	PTPRU_HUMAN		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)	16	2584	+		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	825			Mediates interaction with CTNNB1 (By similarity).|Cytoplasmic (Potential).		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	c.2474C>T	CCDS334.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561665	0.86335	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.36157	1.27;1.34;1.34;1.34;1.28;1.34	4.99	4.07	0.47477	.	0.138423	0.50627	D	0.000113	T	0.48314	0.1493	L	0.59436	1.845	0.52501	D	0.999957	D;D;D;D;D	0.61080	0.989;0.989;0.989;0.981;0.981	P;P;P;P;P	0.57152	0.814;0.748;0.814;0.564;0.656	T	0.44605	-0.9317	9	.	.	.	.	12.7559	0.57335	0.0:0.8181:0.1819:0.0	.	815;815;815;815;825	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	F	825;815;815;815;815;815	ENSP00000334941:S825F;ENSP00000362884:S815F;ENSP00000349333:S815F;ENSP00000314987:S815F;ENSP00000392332:S815F;ENSP00000432906:S815F	.	S	+	2	0	PTPRU	29491093	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.765000	0.68834	1.200000	0.43188	0.655000	0.94253	TCC		0.632	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1			7	72	0	0	0	0.006214	0	7	72				
KHDRBS1	10657	broad.mit.edu	37	1	32497185	32497185	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:32497185G>C	ENST00000327300.7	+	3	735	c.568G>C	c.(568-570)Gag>Cag	p.E190Q	KHDRBS1_ENST00000492989.1_Intron|KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ACTGCAGGAAGAGACTGGTGC	0.413																																					Ovarian(173;401 1982 12359 31110 42403)	Ovarian(173;401 1982 12359 31110 42403)	uc001bub.2		NA																	0				ovary(1)	1						c.(568-570)GAG>CAG		KH domain containing, RNA binding, signal							124.0	124.0	124.0					1																	32497185		2203	4300	6503	SO:0001583	missense	10657				cell cycle arrest|cell proliferation|cell surface receptor linked signaling pathway|G2/M transition of mitotic cell cycle|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of RNA export from nucleus|transcription, DNA-dependent	membrane|nucleus	DNA binding|RNA binding|SH3 domain binding|SH3/SH2 adaptor activity	g.chr1:32497185G>C	U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.568G>C	1.37:g.32497185G>C	ENSP00000313829:p.Glu190Gln		Somatic				KHDRBS1_uc001bua.1_Intron|KHDRBS1_uc001buc.1_RNA	p.E190Q	NM_006559	NP_006550	WXS	Illumina HiSeq	Unspecified	Q07666	KHDR1_HUMAN			3	674	+		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)	190			KH.			Missense_Mutation	SNP	ENST00000327300.7	37	c.568G>C	CCDS350.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006353	0.74932	.	.	ENSG00000121774	ENST00000327300;ENST00000355201	T	0.23147	1.92	5.52	5.52	0.82312	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.44519	0.1297	L	0.61387	1.9	0.80722	D	1	D	0.54964	0.969	P	0.55303	0.773	T	0.34004	-0.9846	10	0.87932	D	0	.	18.5774	0.91159	0.0:0.0:1.0:0.0	.	190	Q07666	KHDR1_HUMAN	Q	190;166	ENSP00000313829:E190Q	ENSP00000313829:E190Q	E	+	1	0	KHDRBS1	32269772	1.000000	0.71417	1.000000	0.80357	0.084000	0.17831	9.708000	0.98727	2.775000	0.95449	0.655000	0.94253	GAG		0.413	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011199.4	NM_006559		8	97	0	0	0	0.00308	0	8	97				
MEAF6	64769	broad.mit.edu	37	1	37974889	37974889	+	Silent	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:37974889G>T	ENST00000296214.5	-	4	357	c.330C>A	c.(328-330)ctC>ctA	p.L110L	MEAF6_ENST00000373075.2_Silent_p.L110L|MEAF6_ENST00000475828.1_5'UTR|MEAF6_ENST00000448519.2_Silent_p.L110L|MEAF6_ENST00000373074.1_Silent_p.L88L|MEAF6_ENST00000373073.4_Silent_p.L110L	NM_001270875.1	NP_001257804.1	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6	110					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						TCTTTTCAATGAGCTGGTCCT	0.403																																							uc001cbg.1		NA																	0					0						c.(328-330)CTC>CTA		MYST/Esa1-associated factor 6							161.0	159.0	160.0					1																	37974889		2203	4300	6503	SO:0001819	synonymous_variant	64769				histone H2A acetylation|histone H3-K14 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|NuA4 histone acetyltransferase complex|nucleolus	protein binding	g.chr1:37974889G>T	BC016328	CCDS418.1, CCDS59195.1, CCDS59196.1	1p35.3-p33	2011-08-12	2009-07-13	2009-07-13	ENSG00000163875	ENSG00000163875			25674	protein-coding gene	gene with protein product	"""Esa1p-associated factor 6 homolog (S. cerevisiae)"", ""centromere protein 28"""	611001	"""chromosome 1 open reading frame 149"""	C1orf149		8619474, 9110174, 12963728, 14966270, 16387653	Standard	NM_022756		Approved	NY-SAR-91, FLJ11730, Eaf6, CENP-28	uc001cbe.2	Q9HAF1	OTTHUMG00000004223	ENST00000296214.5:c.330C>A	1.37:g.37974889G>T			Somatic				MEAF6_uc001cbd.1_Silent_p.L88L|MEAF6_uc001cbe.1_Silent_p.L110L|MEAF6_uc009vvd.1_RNA|MEAF6_uc001cbf.1_RNA|MEAF6_uc001cbh.1_Silent_p.L110L	p.L110L	NM_022756	NP_073593	WXS	Illumina HiSeq	Unspecified	Q9HAF1	EAF6_HUMAN			4	347	-			110					B1AK64|Q4F967|Q7Z311|Q86WE3	Silent	SNP	ENST00000296214.5	37	c.330C>A	CCDS59196.1																																																																																				0.403	MEAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012161.1	NM_022756		16	101	1	0	2.32078e-09	0.003163	3.49707e-09	16	101				
GJA9	81025	broad.mit.edu	37	1	39340485	39340485	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:39340485G>C	ENST00000360786.3	-	1	1538	c.1286C>G	c.(1285-1287)tCt>tGt	p.S429C	MYCBP_ENST00000489803.1_5'UTR|RP5-864K19.4_ENST00000443161.1_RNA|GJA9_ENST00000454994.2_Missense_Mutation_p.S429C|RP5-864K19.4_ENST00000456813.1_RNA|GJA9_ENST00000357771.3_Missense_Mutation_p.S429C|MYCBP_ENST00000397572.2_5'Flank|RP5-864K19.4_ENST00000433671.2_RNA			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	429					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			ATGTTCTGTAGAGGAACCCCA	0.512																																							uc001cct.1		NA																	0					0						c.(1285-1287)TCT>TGT		gap junction protein, alpha 9, 59kDa							98.0	96.0	96.0					1																	39340485		2203	4300	6503	SO:0001583	missense	81025				cell communication	connexon complex|integral to membrane		g.chr1:39340485G>C	AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.1286C>G	1.37:g.39340485G>C	ENSP00000354020:p.Ser429Cys		Somatic				RRAGC_uc001ccr.2_5'Flank|MYCBP_uc001ccs.2_5'Flank	p.S429C	NM_030772	NP_110399	WXS	Illumina HiSeq	Unspecified	P57773	CXA9_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)		2	1567	-	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	429			Cytoplasmic (Potential).		B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	ENST00000360786.3	37	c.1286C>G	CCDS432.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.054881	0.36277	.	.	ENSG00000131233	ENST00000454994;ENST00000357771;ENST00000360786	D;D;D	0.98684	-5.0;-5.07;-5.07	4.18	3.27	0.37495	.	25.926200	0.00481	U	0.000128	D	0.97642	0.9227	N	0.24115	0.695	0.09310	N	1	D	0.56521	0.976	P	0.51582	0.674	D	0.93136	0.6537	10	0.87932	D	0	.	11.3369	0.49509	0.0924:0.0:0.9076:0.0	.	429	P57773	CXA9_HUMAN	C	429	ENSP00000406846:S429C;ENSP00000350415:S429C;ENSP00000354020:S429C	ENSP00000350415:S429C	S	-	2	0	GJA9	39113072	0.098000	0.21812	0.002000	0.10522	0.040000	0.13550	2.286000	0.43496	1.076000	0.40961	0.655000	0.94253	TCT		0.512	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001205.1	NM_030772		3	63	0	0	0	0.004672	0	3	63				
MACF1	23499	broad.mit.edu	37	1	39889739	39889739	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:39889739G>A	ENST00000372915.3	+	60	16291	c.16204G>A	c.(16204-16206)Gac>Aac	p.D5402N	MACF1_ENST00000317713.7_Missense_Mutation_p.D3335N|MACF1_ENST00000564288.1_Missense_Mutation_p.D5397N|MACF1_ENST00000567887.1_Missense_Mutation_p.D5434N|MACF1_ENST00000289893.4_Missense_Mutation_p.D3837N|MACF1_ENST00000539005.1_Missense_Mutation_p.D3314N|MACF1_ENST00000361689.2_Missense_Mutation_p.D3335N|MACF1_ENST00000545844.1_Missense_Mutation_p.D3335N			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5402					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGCCACAGTAGACATGCTTCA	0.448																																							uc010oiu.1		NA																	0				ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(11509-11511)GAC>AAC		microfilament and actin filament cross-linker							71.0	72.0	71.0					1																	39889739		2203	4300	6503	SO:0001583	missense	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39889739G>A	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16204G>A	1.37:g.39889739G>A	ENSP00000362006:p.Asp5402Asn		Somatic				MACF1_uc010ois.1_Missense_Mutation_p.D3335N|MACF1_uc001cda.1_Missense_Mutation_p.D3222N|MACF1_uc001cdc.1_Missense_Mutation_p.D2401N	p.D3837N	NM_033044	NP_149033	WXS	Illumina HiSeq	Unspecified	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		25	11640	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	5402			Spectrin 7.		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37	c.11509G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.641334|5.641334	0.96704|0.96704	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893;ENST00000482035|ENST00000372925	T;T;T;T;T;T;T|.	0.36520|.	1.32;1.32;1.32;1.32;1.32;1.32;1.25|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	0.208397|.	0.34777|.	N|.	0.003699|.	T|T	0.65842|0.65842	0.2730|0.2730	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	P;P;P|.	0.49862|.	0.574;0.929;0.835|.	P;P;P|.	0.51415|.	0.455;0.669;0.617|.	T|T	0.60757|0.60757	-0.7200|-0.7200	10|5	0.42905|.	T|.	0.14|.	.|.	19.3488|19.3488	0.94376|0.94376	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	5402;3335;3279|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	N|K	3335;5402;3335;3335;3314;3837;151|2447	ENSP00000439537:D3335N;ENSP00000362006:D5402N;ENSP00000354573:D3335N;ENSP00000313438:D3335N;ENSP00000444364:D3314N;ENSP00000289893:D3837N;ENSP00000433104:D151N|.	ENSP00000289893:D3837N|.	D|R	+|+	1|2	0|0	MACF1|MACF1	39662326|39662326	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.624000|9.624000	0.98398|0.98398	2.569000|2.569000	0.86673|0.86673	0.655000|0.655000	0.94253|0.94253	GAC|AGA		0.448	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		5	64	0	0	0	0.001168	0	5	64				
PIK3R3	8503	broad.mit.edu	37	1	46532698	46532698	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:46532698G>A	ENST00000262741.5	-	4	1069	c.380C>T	c.(379-381)cCt>cTt	p.P127L	PIK3R3_ENST00000420542.1_Missense_Mutation_p.P127L|PIK3R3_ENST00000340332.6_Missense_Mutation_p.P91L|PIK3R3_ENST00000354242.4_Missense_Mutation_p.P127L|PIK3R3_ENST00000540385.1_Missense_Mutation_p.P173L|PIK3R3_ENST00000423209.1_Missense_Mutation_p.P127L|PIK3R3_ENST00000372006.1_Missense_Mutation_p.P127L	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	127	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	AAATGTCAGAGGATCAGAAAA	0.398																																							uc001cpb.3		NA																	0					0						c.(379-381)CCT>CTT		phosphoinositide-3-kinase, regulatory subunit 3							229.0	218.0	222.0					1																	46532698		2203	4300	6503	SO:0001583	missense	8503				insulin receptor signaling pathway|platelet activation|T cell costimulation		1-phosphatidylinositol-3-kinase activity|protein binding	g.chr1:46532698G>A	BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.380C>T	1.37:g.46532698G>A	ENSP00000262741:p.Pro127Leu		Somatic				PIK3R3_uc009vyb.2_Missense_Mutation_p.P127L|PIK3R3_uc009vyc.2_Missense_Mutation_p.P144L|PIK3R3_uc001cpc.3_Missense_Mutation_p.P127L|PIK3R3_uc010olw.1_Missense_Mutation_p.P173L	p.P127L	NM_003629	NP_003620	WXS	Illumina HiSeq	Unspecified	Q92569	P55G_HUMAN			4	1136	-	Acute lymphoblastic leukemia(166;0.155)		127			SH2 1.		B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	Missense_Mutation	SNP	ENST00000262741.5	37	c.380C>T	CCDS529.1	.	.	.	.	.	.	.	.	.	.	G	33	5.229474	0.95173	.	.	ENSG00000117461	ENST00000372006;ENST00000262741;ENST00000420542;ENST00000354242;ENST00000340332;ENST00000540385;ENST00000423209;ENST00000425892	D;D;D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	5.37	5.37	0.77165	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.94248	0.8153	M	0.69823	2.125	0.80722	D	1	P;D;P;P	0.89917	0.942;1.0;0.788;0.823	P;D;P;P	0.91635	0.841;0.999;0.72;0.796	D	0.94622	0.7814	10	0.87932	D	0	.	19.108	0.93305	0.0:0.0:1.0:0.0	.	173;160;127;127	F6TDL0;Q7Z3W2;Q92569-2;Q92569	.;.;.;P55G_HUMAN	L	127;127;127;127;91;173;127;127	ENSP00000361075:P127L;ENSP00000262741:P127L;ENSP00000412546:P127L;ENSP00000346188:P127L;ENSP00000342484:P91L;ENSP00000439913:P173L;ENSP00000391431:P127L;ENSP00000416647:P127L	ENSP00000262741:P127L	P	-	2	0	PIK3R3	46305285	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.828000	0.99408	2.518000	0.84900	0.591000	0.81541	CCT		0.398	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022171.1	NM_003629		14	123	0	0	0	0.001855	0	14	123				
CMPK1	51727	broad.mit.edu	37	1	47838678	47838678	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:47838678G>C	ENST00000371873.5	+	3	519	c.370G>C	c.(370-372)Gat>Cat	p.D124H	CMPK1_ENST00000450808.2_Missense_Mutation_p.D75H	NM_001136140.1|NM_016308.2	NP_001129612.1|NP_057392.1			cytidine monophosphate (UMP-CMP) kinase 1, cytosolic											endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(2)	8						ATTCTTGATTGATGGGTTTCC	0.353																																							uc001cri.2		NA																	0				ovary(1)	1						c.(370-372)GAT>CAT		UMP-CMP kinase 1 isoform a	Gemcitabine(DB00441)						109.0	97.0	101.0					1																	47838678		2203	4300	6503	SO:0001583	missense	51727				nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleus	ATP binding|cytidylate kinase activity|nucleoside phosphate kinase activity|uridine kinase activity	g.chr1:47838678G>C	AF070416	CCDS549.1, CCDS44135.1	1p34.1-p33	2008-02-05	2008-01-25	2008-01-25	ENSG00000162368	ENSG00000162368	2.7.4.14		18170	protein-coding gene	gene with protein product	"""UMP-CMP kinase"", ""Cytidine monophosphate kinase"""	191710	"""cytidylate kinase"""	CMPK		10462544	Standard	NM_016308		Approved	UMP-CMPK	uc001cri.3	P30085	OTTHUMG00000007849	ENST00000371873.5:c.370G>C	1.37:g.47838678G>C	ENSP00000360939:p.Asp124His		Somatic				CMPK1_uc010omp.1_Missense_Mutation_p.D75H|CMPK1_uc010omq.1_RNA	p.D124H	NM_016308	NP_057392	WXS	Illumina HiSeq	Unspecified	P30085	KCY_HUMAN			3	519	+			92						Missense_Mutation	SNP	ENST00000371873.5	37	c.370G>C	CCDS549.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.993444	0.93167	.	.	ENSG00000162368	ENST00000371873;ENST00000450808	D;D	0.82803	-1.65;-1.65	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.95736	0.8613	H	0.99498	4.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97626	1.0139	10	0.87932	D	0	-19.7384	19.6558	0.95837	0.0:0.0:1.0:0.0	.	75;124	E9PGI8;B2R6S5	.;.	H	124;75	ENSP00000360939:D124H;ENSP00000398192:D75H	ENSP00000360937:D124H	D	+	1	0	CMPK1	47611265	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.471000	0.97696	2.631000	0.89168	0.563000	0.77884	GAT		0.353	CMPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021646.2	NM_016308		3	42	0	0	0	0.004672	0	3	42				
LRRC7	57554	broad.mit.edu	37	1	70555443	70555443	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:70555443G>C	ENST00000035383.5	+	23	4402	c.4372G>C	c.(4372-4374)Gga>Cga	p.G1458R	LRRC7_ENST00000310961.5_Missense_Mutation_p.G1416R|LRRC7_ENST00000415775.2_Missense_Mutation_p.G742R	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1458	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TCCTGGCCTTGGATTTAGTAT	0.289																																							uc001dep.2		NA																	0				ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(4372-4374)GGA>CGA		leucine rich repeat containing 7							97.0	100.0	99.0					1																	70555443		2202	4299	6501	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70555443G>C		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4372G>C	1.37:g.70555443G>C	ENSP00000035383:p.Gly1458Arg		Somatic				LRRC7_uc009wbg.2_Missense_Mutation_p.G742R|LRRC7_uc001deq.2_Missense_Mutation_p.G652R	p.G1458R	NM_020794	NP_065845	WXS	Illumina HiSeq	Unspecified	Q96NW7	LRRC7_HUMAN			23	4402	+			1458			PDZ.		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.4372G>C	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766473	0.90020	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.77750	-1.12;-1.12;-1.12	5.48	5.48	0.80851	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	D	0.90769	0.7102	H	0.94620	3.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92945	0.6375	10	0.87932	D	0	.	17.9073	0.88923	0.0:0.0:1.0:0.0	.	742;1411;1458	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	R	1416;1458;742;1234	ENSP00000309245:G1416R;ENSP00000035383:G1458R;ENSP00000394867:G742R	ENSP00000035383:G1458R	G	+	1	0	LRRC7	70328031	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.075000	0.94004	2.569000	0.86673	0.591000	0.81541	GGA		0.289	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		5	33	0	0	0	0.001168	0	5	33				
FPGT-TNNI3K	100526835	broad.mit.edu	37	1	74834796	74834796	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:74834796C>G	ENST00000370899.3	+	16	1752	c.1715C>G	c.(1714-1716)tCa>tGa	p.S572*	RP11-439H8.4_ENST00000415549.2_RNA|FPGT-TNNI3K_ENST00000557284.2_Nonsense_Mutation_p.S585*|FPGT-TNNI3K_ENST00000370895.1_Nonsense_Mutation_p.S572*|TNNI3K_ENST00000326637.3_Nonsense_Mutation_p.S471*|TNNI3K_ENST00000370891.2_Nonsense_Mutation_p.S572*	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		ATTATTGGCTCAGGTAACCta	0.333																																							uc001dgf.1		NA																	0				large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						c.(1411-1413)TCA>TGA		TNNI3 interacting kinase isoform b							33.0	35.0	35.0					1																	74834796		2202	4299	6501	SO:0001587	stop_gained	51086					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding	g.chr1:74834796C>G			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1715C>G	1.37:g.74834796C>G	ENSP00000359936:p.Ser572*		Somatic				TNNI3K_uc001dgc.1_Nonsense_Mutation_p.S572*|TNNI3K_uc001dgd.2_Nonsense_Mutation_p.S572*|TNNI3K_uc001dge.1_Nonsense_Mutation_p.S572*	p.S471*	NM_015978	NP_057062	WXS	Illumina HiSeq	Unspecified	Q59H18	TNI3K_HUMAN			14	1463	+			471			ATP (By similarity).|Protein kinase.			Nonsense_Mutation	SNP	ENST00000370899.3	37	c.1412C>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.358976|6.358976	0.97502|0.97502	.|.	.|.	ENSG00000116783|ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000526236|ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	.|.	.|.	.|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|.	0.71796|.	0.3382|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71567|.	-0.4554|.	3|.	.|0.48119	.|T	.|0.1	.|.	19.4149|19.4149	0.94690|0.94690	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	E|X	18|572;572;572;572;471	.|.	.|ENSP00000322251:S471X	Q|S	+|+	1|2	0|0	AC093158.1|RP11-653A5.2;AC093158.1	74607384|74607384	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.413000|0.413000	0.31143|0.31143	7.359000|7.359000	0.79477|0.79477	2.585000|2.585000	0.87301|0.87301	0.650000|0.650000	0.86243|0.86243	CAG|TCA		0.333	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3			3	23	0	0	0	0.004672	0	3	23				
AGL	178	broad.mit.edu	37	1	100358154	100358154	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:100358154C>G	ENST00000294724.4	+	24	3728	c.3250C>G	c.(3250-3252)Cta>Gta	p.L1084V	AGL_ENST00000361915.3_Missense_Mutation_p.L1084V|AGL_ENST00000361522.4_Missense_Mutation_p.L1067V|AGL_ENST00000370163.3_Missense_Mutation_p.L1084V|AGL_ENST00000361302.3_Missense_Mutation_p.L1068V|AGL_ENST00000370161.2_Missense_Mutation_p.L1068V|AGL_ENST00000370165.3_Missense_Mutation_p.L1084V	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	1084					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TTGTGTTTCTCTAGCTGCAGG	0.343																																							uc001dsi.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(3250-3252)CTA>GTA		amylo-1,6-glucosidase,							84.0	82.0	83.0					1																	100358154		2203	4300	6503	SO:0001583	missense	178				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding	g.chr1:100358154C>G	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.3250C>G	1.37:g.100358154C>G	ENSP00000294724:p.Leu1084Val		Somatic				AGL_uc001dsj.1_Missense_Mutation_p.L1084V|AGL_uc001dsk.1_Missense_Mutation_p.L1084V|AGL_uc001dsl.1_Missense_Mutation_p.L1084V|AGL_uc001dsm.1_Missense_Mutation_p.L1068V|AGL_uc001dsn.1_Missense_Mutation_p.L1067V	p.L1084V	NM_000642	NP_000633	WXS	Illumina HiSeq	Unspecified	P35573	GDE_HUMAN		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)	24	3650	+		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)	1084			4-alpha-glucanotransferase.		A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	c.3250C>G	CCDS759.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.915873	0.52546	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	5.2	0.534	0.17127	Six-hairpin glycosidase-like (1);	0.411149	0.24825	N	0.035289	T	0.57888	0.2084	L	0.60012	1.86	0.52099	D	0.999949	P;P;P	0.45902	0.84;0.84;0.868	P;P;P	0.56648	0.702;0.702;0.803	T	0.60031	-0.7342	10	0.72032	D	0.01	.	4.3199	0.11011	0.1544:0.38:0.0:0.4656	.	1067;1068;1084	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	V	1084;1084;1084;1084;1068;1068;1067	ENSP00000355106:L1084V;ENSP00000359184:L1084V;ENSP00000359182:L1084V;ENSP00000294724:L1084V;ENSP00000354971:L1068V;ENSP00000359180:L1068V;ENSP00000354635:L1067V	ENSP00000294724:L1084V	L	+	1	2	AGL	100130742	0.000000	0.05858	0.765000	0.31456	0.797000	0.45037	-0.322000	0.08007	0.124000	0.18369	0.573000	0.79308	CTA		0.343	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028		4	23	0	0	0	0.000602	0	4	23				
VAV3	10451	broad.mit.edu	37	1	108319902	108319902	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:108319902C>G	ENST00000370056.4	-	4	671	c.397G>C	c.(397-399)Gaa>Caa	p.E133Q	VAV3_ENST00000527011.1_Missense_Mutation_p.E133Q|VAV3_ENST00000343258.4_5'UTR|AL591042.1_ENST00000579317.1_RNA|VAV3_ENST00000371846.4_Missense_Mutation_p.E68Q	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	133					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TTAATGCTTTCTTCTGTTGGG	0.388																																							uc001dvk.1		NA																	0				ovary(5)|lung(2)|breast(2)	9						c.(397-399)GAA>CAA		vav 3 guanine nucleotide exchange factor isoform							115.0	114.0	114.0					1																	108319902		2203	4300	6503	SO:0001583	missense	10451				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity	g.chr1:108319902C>G	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.397G>C	1.37:g.108319902C>G	ENSP00000359073:p.Glu133Gln		Somatic				VAV3_uc010ouw.1_Missense_Mutation_p.E133Q|VAV3_uc001dvl.1_5'UTR|VAV3_uc010oux.1_Missense_Mutation_p.E133Q	p.E133Q	NM_006113	NP_006104	WXS	Illumina HiSeq	Unspecified	Q9UKW4	VAV3_HUMAN		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)	4	451	-		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)	133					B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	c.397G>C	CCDS785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.5|24.5	4.539143|4.539143	0.85917|0.85917	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846|ENST00000490388	T;T;T|.	0.35236|.	1.32;1.32;1.32|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Calponin homology domain (2);|.	0.189372|.	0.48767|.	D|.	0.000170|.	T|T	0.73377|0.73377	0.3579|0.3579	M|M	0.79475|0.79475	2.455|2.455	0.58432|0.58432	D|D	0.999999|0.999999	P;D;D|.	0.89917|.	0.458;1.0;0.984|.	B;D;P|.	0.83275|.	0.23;0.996;0.811|.	T|T	0.73257|0.73257	-0.4040|-0.4040	10|5	0.66056|.	D|.	0.02|.	.|.	18.4647|18.4647	0.90750|0.90750	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	133;133;133|.	B7ZLR1;E9PQ97;Q9UKW4|.	.;.;VAV3_HUMAN|.	Q|N	133;133;68|127	ENSP00000359073:E133Q;ENSP00000432540:E133Q;ENSP00000360912:E68Q|.	ENSP00000359073:E133Q|.	E|K	-|-	1|3	0|2	VAV3|VAV3	108121425|108121425	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.963000|0.963000	0.63663|0.63663	6.226000|6.226000	0.72277|0.72277	2.664000|2.664000	0.90586|0.90586	0.655000|0.655000	0.94253|0.94253	GAA|AAG		0.388	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113		7	51	0	0	0	0.004482	0	7	51				
NBPF10	100132406	broad.mit.edu	37	1	145368669	145368669	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:145368669C>T	ENST00000369339.3	+	17	2254	c.2001C>T	c.(1999-2001)gtC>gtT	p.V667V	NBPF10_ENST00000342960.5_Silent_p.V3549V|NBPF10_ENST00000369338.1_Silent_p.V665V			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	0	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGATGGGAGTCATATTCCCAC	0.448																																							uc001end.3		NA																	0					0						c.(10870-10872)GTC>GTT		hypothetical protein LOC100132406																																				SO:0001819	synonymous_variant	100132406							g.chr1:145368669C>T	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.2001C>T	1.37:g.145368669C>T			Somatic				NBPF9_uc010oye.1_Silent_p.V908V|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Silent_p.V477V|NBPF10_uc010oyk.1_Silent_p.V265V|NBPF10_uc010oyl.1_Silent_p.V265V	p.V3624V	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	86	10907	+	all_hematologic(923;0.032)		3549					Q5RHC0|Q9NWN6	Silent	SNP	ENST00000369339.3	37	c.10872C>T																																																																																					0.448	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703		22	466	0	0	0	0.008361	0	22	466				
HIST2H2AB	317772	broad.mit.edu	37	1	149859277	149859277	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:149859277G>A	ENST00000331128.3	-	1	189	c.190C>T	c.(190-192)Ctg>Ttg	p.L64L	BOLA1_ENST00000369153.2_5'Flank|HIST2H2BE_ENST00000369155.2_5'Flank	NM_175065.2	NP_778235.1	Q8IUE6	H2A2B_HUMAN	histone cluster 2, H2ab	64						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GCCAGCTCCAGAATTTCCGCG	0.632																																							uc001ete.2		NA																	0				ovary(1)|breast(1)	2						c.(190-192)CTG>TTG		histone cluster 2, H2ab							54.0	57.0	56.0					1																	149859277		2203	4300	6503	SO:0001819	synonymous_variant	317772				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr1:149859277G>A	AY131972	CCDS938.1	1q21.2	2011-01-27	2006-10-11		ENSG00000184270	ENSG00000184270		"""Histones / Replication-dependent"""	20508	protein-coding gene	gene with protein product		615014	"""histone 2, H2ab"""			12408966	Standard	NM_175065		Approved		uc001ete.3	Q8IUE6	OTTHUMG00000012085	ENST00000331128.3:c.190C>T	1.37:g.149859277G>A			Somatic				HIST2H2BE_uc001etc.2_5'Flank	p.L64L	NM_175065	NP_778235	WXS	Illumina HiSeq	Unspecified	Q8IUE6	H2A2B_HUMAN	STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)		1	190	-	Breast(34;0.0124)|all_hematologic(923;0.127)		64						Silent	SNP	ENST00000331128.3	37	c.190C>T	CCDS938.1																																																																																				0.632	HIST2H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033440.1	NM_175065		5	67	0	0	0	0.001168	0	5	67				
PRPF3	9129	broad.mit.edu	37	1	150316917	150316917	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:150316917G>A	ENST00000324862.6	+	12	1699	c.1534G>A	c.(1534-1536)Gaa>Aaa	p.E512K	PRPF3_ENST00000414970.2_Missense_Mutation_p.E463K|PRPF3_ENST00000543398.1_3'UTR|PRPF3_ENST00000467329.1_3'UTR	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3	512					mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		CAGAGCGCATGAAGAGGCCAA	0.483																																					Ovarian(168;1070 2670 5178 20729)	Ovarian(168;1070 2670 5178 20729)	uc001eum.3		NA																	0				ovary(1)	1						c.(1534-1536)GAA>AAA		PRP3 pre-mRNA processing factor 3 homolog							101.0	107.0	105.0					1																	150316917		2203	4300	6503	SO:0001583	missense	9129				nuclear mRNA splicing, via spliceosome	Cajal body|cytoplasm|nuclear speck|spliceosomal complex	protein binding	g.chr1:150316917G>A	AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.1534G>A	1.37:g.150316917G>A	ENSP00000315379:p.Glu512Lys		Somatic				PRPF3_uc009wlp.2_RNA|PRPF3_uc010pca.1_Missense_Mutation_p.E471K|PRPF3_uc010pcb.1_Missense_Mutation_p.E463K|PRPF3_uc009wlq.1_RNA	p.E512K	NM_004698	NP_004689	WXS	Illumina HiSeq	Unspecified	O43395	PRPF3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)	12	1696	+	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		512					B4DSY9|O43446|Q5VT54	Missense_Mutation	SNP	ENST00000324862.6	37	c.1534G>A	CCDS951.1	.	.	.	.	.	.	.	.	.	.	G	35	5.468813	0.96274	.	.	ENSG00000117360	ENST00000324862;ENST00000414970	D;D	0.86497	-2.13;-2.13	5.89	5.89	0.94794	Pre-mRNA-splicing factor 3 (1);	0.000000	0.85682	D	0.000000	D	0.94483	0.8224	M	0.91510	3.215	0.80722	D	1	D;D	0.56746	0.977;0.977	D;D	0.65323	0.934;0.934	D	0.94279	0.7518	10	0.59425	D	0.04	-16.565	20.2572	0.98426	0.0:0.0:1.0:0.0	.	463;512	E7EVD1;O43395	.;PRPF3_HUMAN	K	512;463	ENSP00000315379:E512K;ENSP00000387844:E463K	ENSP00000315379:E512K	E	+	1	0	PRPF3	148583541	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.115000	0.94336	2.793000	0.96121	0.650000	0.86243	GAA		0.483	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035836.1	NM_004698		8	107	0	0	0	0.006214	0	8	107				
TCHH	7062	broad.mit.edu	37	1	152081957	152081957	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:152081957C>G	ENST00000368804.1	-	2	3735	c.3736G>C	c.(3736-3738)Gag>Cag	p.E1246Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1246					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTTCATTCTCTCTGCCTTTG	0.512																																							uc001ezp.2		NA																	0				ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(3736-3738)GAG>CAG		trichohyalin							96.0	95.0	95.0					1																	152081957		2030	4183	6213	SO:0001583	missense	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152081957C>G	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3736G>C	1.37:g.152081957C>G	ENSP00000357794:p.Glu1246Gln		Somatic				TCHH_uc009wne.1_Missense_Mutation_p.E1246Q	p.E1246Q	NM_007113	NP_009044	WXS	Illumina HiSeq	Unspecified	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	3736	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1246					Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	c.3736G>C	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.482051	0.26598	.	.	ENSG00000159450	ENST00000368804	T	0.07021	3.23	3.94	3.02	0.34903	.	.	.	.	.	T	0.02230	0.0069	L	0.27053	0.805	0.09310	N	1	P	0.50528	0.936	P	0.48454	0.578	T	0.29119	-1.0022	9	0.10377	T	0.69	.	6.4105	0.21688	0.0:0.7676:0.0:0.2324	.	1246	Q07283	TRHY_HUMAN	Q	1246	ENSP00000357794:E1246Q	ENSP00000357794:E1246Q	E	-	1	0	TCHH	150348581	0.000000	0.05858	0.010000	0.14722	0.421000	0.31385	-0.499000	0.06413	0.652000	0.30806	0.462000	0.41574	GAG		0.512	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		7	87	0	0	0	0.001984	0	7	87				
CD1E	913	broad.mit.edu	37	1	158324255	158324255	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:158324255C>A	ENST00000368167.3	+	2	386	c.147C>A	c.(145-147)agC>agA	p.S49R	CD1E_ENST00000368164.3_Intron|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368160.3_Missense_Mutation_p.S49R|CD1E_ENST00000444681.2_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.S49R|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.S47R|CD1E_ENST00000368165.3_Missense_Mutation_p.S49R|CD1E_ENST00000464822.1_Intron|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368155.3_Missense_Mutation_p.S49R|CD1E_ENST00000368156.1_Missense_Mutation_p.S49R|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368163.3_Missense_Mutation_p.S49R	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	49					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					CCAACCACAGCTGGGCACACA	0.582																																							uc001fse.2		NA																	0				skin(3)	3						c.(145-147)AGC>AGA		CD1E antigen isoform a precursor							89.0	93.0	91.0					1																	158324255		2183	4297	6480	SO:0001583	missense	913				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen		g.chr1:158324255C>A	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.147C>A	1.37:g.158324255C>A	ENSP00000357149:p.Ser49Arg		Somatic				CD1E_uc010pid.1_Missense_Mutation_p.S47R|CD1E_uc010pie.1_Intron|CD1E_uc010pif.1_Intron|CD1E_uc001fsd.2_Missense_Mutation_p.S49R|CD1E_uc001fsk.2_Missense_Mutation_p.S49R|CD1E_uc001fsj.2_Missense_Mutation_p.S49R|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Missense_Mutation_p.S49R|CD1E_uc001fry.2_Missense_Mutation_p.S49R|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Missense_Mutation_p.S49R|CD1E_uc009wsv.2_Intron|CD1E_uc001frz.2_Missense_Mutation_p.S49R|CD1E_uc009wsw.2_5'Flank	p.S49R	NM_030893	NP_112155	WXS	Illumina HiSeq	Unspecified	P15812	CD1E_HUMAN			2	386	+	all_hematologic(112;0.0378)		49					B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	c.147C>A	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863283	0.51482	.	.	ENSG00000158488	ENST00000434258;ENST00000368167;ENST00000368165;ENST00000368163;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155	T;T;T;T;T;T;T;T	0.10763	3.1;3.1;2.97;3.1;3.1;3.1;3.19;2.84	3.62	1.71	0.24356	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.000000	0.44285	D	0.000470	T	0.20536	0.0494	M	0.88640	2.97	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;0.998;0.998;1.0;0.999;1.0;0.998;0.999	D;D;D;D;D;D;D;D	0.77557	0.984;0.961;0.961;0.99;0.984;0.99;0.961;0.979	T	0.01600	-1.1315	10	0.87932	D	0	-21.4198	4.9868	0.14194	0.0:0.6634:0.2169:0.1197	.	47;49;49;49;49;49;49;49	E7ET31;P15812-5;P15812-7;P15812-2;P15812;P15812-3;P15812-6;P15812-4	.;.;.;.;CD1E_HUMAN;.;.;.	R	47;49;49;49;49;49;49;49	ENSP00000401957:S47R;ENSP00000357149:S49R;ENSP00000357147:S49R;ENSP00000357145:S49R;ENSP00000357142:S49R;ENSP00000357143:S49R;ENSP00000357138:S49R;ENSP00000357137:S49R	ENSP00000357137:S49R	S	+	3	2	CD1E	156590879	0.999000	0.42202	0.983000	0.44433	0.869000	0.49853	1.894000	0.39768	0.501000	0.28013	0.563000	0.77884	AGC		0.582	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893		10	106	1	0	9.70103e-10	0.008291	1.47188e-09	10	106				
IFI16	3428	broad.mit.edu	37	1	158988382	158988382	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:158988382G>A	ENST00000295809.7	+	5	1168	c.913G>A	c.(913-915)Gat>Aat	p.D305N	IFI16_ENST00000340979.6_Missense_Mutation_p.D305N|IFI16_ENST00000448393.2_Missense_Mutation_p.D305N|IFI16_ENST00000359709.3_Missense_Mutation_p.D249N|IFI16_ENST00000368132.3_Missense_Mutation_p.D305N|IFI16_ENST00000430894.2_Missense_Mutation_p.D253N|IFI16_ENST00000368131.4_Missense_Mutation_p.D305N			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	305	HIN-200 1. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 C-terminus.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TCTGAAGATTGATATTCTTCA	0.353																																							uc001ftf.1		NA																	0				ovary(1)	1						c.(913-915)GAT>AAT		interferon, gamma-inducible protein 16							74.0	80.0	78.0					1																	158988382		2203	4300	6503	SO:0001583	missense	3428				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding	g.chr1:158988382G>A	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.913G>A	1.37:g.158988382G>A	ENSP00000295809:p.Asp305Asn		Somatic				IFI16_uc001ftg.2_Missense_Mutation_p.D305N|IFI16_uc010pis.1_Missense_Mutation_p.D249N	p.D305N	NM_005531	NP_005522	WXS	Illumina HiSeq	Unspecified	Q16666	IF16_HUMAN			6	1520	+	all_hematologic(112;0.0429)		305			HIN-200 1.		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37	c.913G>A		.	.	.	.	.	.	.	.	.	.	G	8.965	0.971586	0.18736	.	.	ENSG00000163565	ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03	3.09	-5.75	0.02384	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.02230	0.0069	N	0.02391	-0.57	0.09310	N	1	P;P;P	0.41624	0.606;0.551;0.757	P;B;P	0.47015	0.534;0.238;0.534	T	0.16129	-1.0413	8	.	.	.	.	1.015	0.01505	0.2314:0.3104:0.3024:0.1558	.	253;305;305	E7EPR3;Q16666-2;Q16666	.;.;IF16_HUMAN	N	305;305;305;305;253	ENSP00000295809:D305N;ENSP00000342741:D305N;ENSP00000357113:D305N;ENSP00000357114:D305N;ENSP00000394935:D253N	.	D	+	1	0	IFI16	157255006	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.022000	0.01439	-0.912000	0.03837	-0.324000	0.08512	GAT		0.353	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531		11	72	0	0	0	0.001368	0	11	72				
APCS	325	broad.mit.edu	37	1	159558241	159558241	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:159558241C>T	ENST00000255040.2	+	2	512	c.415C>T	c.(415-417)Cga>Tga	p.R139*		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	139	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					AAAGGGTCTGCGACAGGGTTA	0.507																																							uc001ftv.2		NA																	0				ovary(1)|breast(1)	2						c.(415-417)CGA>TGA		serum amyloid P component precursor							74.0	75.0	75.0					1																	159558241		2203	4300	6503	SO:0001587	stop_gained	325				acute-phase response|chaperone-mediated protein complex assembly|protein folding	extracellular space	metal ion binding|sugar binding|unfolded protein binding	g.chr1:159558241C>T		CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.415C>T	1.37:g.159558241C>T	ENSP00000255040:p.Arg139*		Somatic					p.R139*	NM_001639	NP_001630	WXS	Illumina HiSeq	Unspecified	P02743	SAMP_HUMAN			2	511	+	all_hematologic(112;0.0429)		139			Pentaxin.			Nonsense_Mutation	SNP	ENST00000255040.2	37	c.415C>T	CCDS1186.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.238676	0.58995	.	.	ENSG00000132703	ENST00000255040	.	.	.	4.14	1.74	0.24563	.	0.896444	0.09703	N	0.766737	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-1.0268	9.4321	0.38617	0.6149:0.3851:0.0:0.0	.	.	.	.	X	139	.	ENSP00000255040:R139X	R	+	1	2	APCS	157824865	0.014000	0.17966	0.195000	0.23364	0.287000	0.27160	0.835000	0.27531	0.235000	0.21160	-0.262000	0.10625	CGA		0.507	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059024.2	NM_001639		6	56	0	0	0	0.001984	0	6	56				
BLZF1	8548	broad.mit.edu	37	1	169347731	169347731	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:169347731A>C	ENST00000367808.3	+	4	1055	c.632A>C	c.(631-633)cAg>cCg	p.Q211P	BLZF1_ENST00000329281.2_Missense_Mutation_p.Q211P			Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1	211					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|mitotic cell cycle (GO:0000278)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	14	all_hematologic(923;0.208)					ATGTCAATACAGTGTGATGTA	0.383																																							uc001gfx.1		NA																	0				skin(1)	1						c.(631-633)CAG>CCG		basic leucine zipper nuclear factor 1							106.0	107.0	106.0					1																	169347731		2203	4299	6502	SO:0001583	missense	8548				cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding	g.chr1:169347731A>C	U79751	CCDS1278.1	1q24	2008-08-01	2008-08-01		ENSG00000117475	ENSG00000117475			1065	protein-coding gene	gene with protein product		608692				9129147	Standard	NM_003666		Approved	JEM-1	uc001gfy.3	Q9H2G9	OTTHUMG00000035453	ENST00000367808.3:c.632A>C	1.37:g.169347731A>C	ENSP00000356782:p.Gln211Pro		Somatic				BLZF1_uc001gfy.2_Missense_Mutation_p.Q211P|BLZF1_uc009wvp.1_Missense_Mutation_p.Q188P	p.Q211P	NM_003666	NP_003657	WXS	Illumina HiSeq	Unspecified	Q9H2G9	GO45_HUMAN			4	1069	+	all_hematologic(923;0.208)		211			Potential.		O15298|Q5T531|Q5T533|Q9GZX4	Missense_Mutation	SNP	ENST00000367808.3	37	c.632A>C	CCDS1278.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.561010	0.86335	.	.	ENSG00000117475	ENST00000367808;ENST00000329281;ENST00000426663	D;D;D	0.92965	-3.14;-3.14;-3.14	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.94424	0.8206	L	0.58101	1.795	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.94889	0.8046	9	0.66056	D	0.02	-13.8595	16.8222	0.85835	1.0:0.0:0.0:0.0	.	211;211	A8K6R0;Q9H2G9	.;GO45_HUMAN	P	211	ENSP00000356782:Q211P;ENSP00000327541:Q211P;ENSP00000404408:Q211P	ENSP00000327541:Q211P	Q	+	2	0	BLZF1	167614355	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.668000	0.91158	2.371000	0.80710	0.533000	0.62120	CAG		0.383	BLZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086109.1	NM_003666		24	81	0	0	0	0.00333	0	24	81				
DNM3	26052	broad.mit.edu	37	1	172011224	172011224	+	Silent	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:172011224C>G	ENST00000355305.5	+	8	1225	c.1068C>G	c.(1066-1068)ctC>ctG	p.L356L	DNM3_ENST00000520906.1_Silent_p.L356L|DNM3_ENST00000367733.2_Silent_p.L356L|DNM3_ENST00000367731.1_Silent_p.L356L|DNM3_ENST00000358155.4_Silent_p.L356L			Q9UQ16	DYN3_HUMAN	dynamin 3	356					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CCCTGGAACTCTCAGGTGGTG	0.368																																							uc001gie.2		NA																	0				breast(1)	1						c.(1066-1068)CTC>CTG		dynamin 3 isoform a							153.0	150.0	151.0					1																	172011224		1833	4076	5909	SO:0001819	synonymous_variant	26052				endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding	g.chr1:172011224C>G	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1068C>G	1.37:g.172011224C>G			Somatic				DNM3_uc001gid.3_Silent_p.L356L|DNM3_uc009wwb.2_Silent_p.L356L|DNM3_uc001gif.2_Silent_p.L356L	p.L356L	NM_015569	NP_056384	WXS	Illumina HiSeq	Unspecified	Q9UQ16	DYN3_HUMAN			8	1244	+			356					A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Silent	SNP	ENST00000355305.5	37	c.1068C>G																																																																																					0.368	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569		9	82	0	0	0	0.006214	0	9	82				
SUCO	51430	broad.mit.edu	37	1	172579328	172579328	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:172579328G>C	ENST00000263688.3	+	24	3913	c.3694G>C	c.(3694-3696)Gac>Cac	p.D1232H	SUCO_ENST00000608151.1_Missense_Mutation_p.D1384H|SUCO_ENST00000610051.1_Missense_Mutation_p.D861H|SUCO_ENST00000367723.4_Missense_Mutation_p.D1383H	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	1232					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											GAGCCTGCATGACATAATCAA	0.388																																						Colon(43;174 953 11768 38880 47057)	uc001giq.3		NA																	0				ovary(2)	2						c.(3694-3696)GAC>CAC		chromosome 1 open reading frame 9 protein							65.0	68.0	67.0					1																	172579328		2203	4300	6503	SO:0001583	missense	51430				multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane		g.chr1:172579328G>C	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.3694G>C	1.37:g.172579328G>C	ENSP00000263688:p.Asp1232His		Somatic				C1orf9_uc009wwd.2_Missense_Mutation_p.D1188H|C1orf9_uc010pmn.1_Missense_Mutation_p.D861H|C1orf9_uc010pmo.1_RNA	p.D1232H	NM_014283	NP_055098	WXS	Illumina HiSeq	Unspecified	Q9UBS9	OSPT_HUMAN		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)	24	4010	+		Breast(1374;0.212)	1232					B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	c.3694G>C	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.260186	0.59321	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.26	5.26	0.73747	.	0.098719	0.64402	D	0.000002	T	0.73621	0.3610	M	0.65975	2.015	0.50813	D	0.999893	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70716	0.97;0.968;0.968	T	0.76302	-0.3009	9	0.87932	D	0	-13.6092	17.7888	0.88546	0.0:0.0:1.0:0.0	.	861;1384;1232	B4DYM4;Q5H945;Q9UBS9	.;.;OSPT_HUMAN	H	1384;1232	.	ENSP00000263688:D1232H	D	+	1	0	C1orf9	170845951	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.718000	0.61930	2.617000	0.88574	0.650000	0.86243	GAC		0.388	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227		9	35	0	0	0	0.008291	0	9	35				
FASLG	356	broad.mit.edu	37	1	172629280	172629280	+	Splice_Site	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:172629280G>C	ENST00000367721.2	+	2	578	c.394G>C	c.(394-396)Ggc>Cgc	p.G132R	FASLG_ENST00000340030.3_Intron	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	132					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						GAAGCAAATAGGTGAGTCTTT	0.358																																					Ovarian(28;486 876 30334 44033)	Ovarian(28;486 876 30334 44033)	uc001gis.2		NA																	0				lung(2)|breast(1)	3						c.(394-396)GGC>CGC		fas ligand							108.0	107.0	107.0					1																	172629280		2203	4300	6503	SO:0001630	splice_region_variant	356				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of necroptosis by extracellular signals|induction of necroptosis of activated-T cells|necrotic cell death|negative regulation of angiogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane	cytokine activity	g.chr1:172629280G>C	U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.394+1G>C	1.37:g.172629280G>C			Somatic				FASLG_uc001git.2_Intron	p.G132R	NM_000639	NP_000630	WXS	Illumina HiSeq	Unspecified	P48023	TNFL6_HUMAN			2	551	+			132			Extracellular (Potential).		Q9BZP9	Missense_Mutation	SNP	ENST00000367721.2	37	c.394G>C	CCDS1304.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.097064	0.76870	.	.	ENSG00000117560	ENST00000367721	T	0.31247	1.5	4.82	4.82	0.62117	.	0.627020	0.15254	N	0.272167	T	0.27169	0.0666	L	0.34521	1.04	0.80722	D	1	D	0.60160	0.987	P	0.55667	0.781	T	0.01500	-1.1339	10	0.38643	T	0.18	-2.0827	15.0364	0.71751	0.0:0.0:1.0:0.0	.	132	P48023	TNFL6_HUMAN	R	132	ENSP00000356694:G132R	ENSP00000356694:G132R	G	+	1	0	FASLG	170895903	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	2.900000	0.48687	2.396000	0.81511	0.655000	0.94253	GGC		0.358	FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084276.1		Missense_Mutation	3	66	0	0	0	0.000602	0	3	66				
BRINP2	57795	broad.mit.edu	37	1	177245507	177245507	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:177245507G>C	ENST00000361539.4	+	6	1261	c.949G>C	c.(949-951)Gag>Cag	p.E317Q	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	317					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											CCAGGCCATGGAGGACAGCCT	0.577																																							uc001glf.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(949-951)GAG>CAG		family with sequence similarity 5, member B							71.0	60.0	64.0					1																	177245507		2203	4300	6503	SO:0001583	missense	57795					extracellular region		g.chr1:177245507G>C		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.949G>C	1.37:g.177245507G>C	ENSP00000354481:p.Glu317Gln		Somatic				FAM5B_uc010pna.1_Missense_Mutation_p.E67Q|FAM5B_uc001glg.2_Missense_Mutation_p.E212Q	p.E317Q	NM_021165	NP_066988	WXS	Illumina HiSeq	Unspecified	Q9C0B6	FAM5B_HUMAN			6	1261	+			317					O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	37	c.949G>C	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628761	0.87560	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.17528	2.27	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.41396	0.1157	L	0.60845	1.875	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.989	D;D;P	0.70487	0.964;0.969;0.828	T	0.02320	-1.1177	10	0.56958	D	0.05	-25.4537	20.239	0.98366	0.0:0.0:1.0:0.0	.	67;212;317	F5H8E0;Q9C0B6-2;Q9C0B6	.;.;FAM5B_HUMAN	Q	67;317	ENSP00000354481:E317Q	ENSP00000354481:E317Q	E	+	1	0	FAM5B	175512130	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.636000	0.83301	2.884000	0.98904	0.655000	0.94253	GAG		0.577	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165		3	40	0	0	0	0.000248	0	3	40				
TOR1AIP2	163590	broad.mit.edu	37	1	179820418	179820418	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:179820418C>T	ENST00000367612.3	-	4	502	c.115G>A	c.(115-117)Gaa>Aaa	p.E39K	TOR1AIP2_ENST00000609928.1_Missense_Mutation_p.E39K	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						ATCTCAGCTTCTTCAGCATTA	0.413																																							uc001gnk.2		NA																	0				ovary(1)	1						c.(115-117)GAA>AAA		torsin A interacting protein 2							128.0	128.0	128.0					1																	179820418		2203	4300	6503	SO:0001583	missense	163590					endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr1:179820418C>T		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.115G>A	1.37:g.179820418C>T	ENSP00000356584:p.Glu39Lys		Somatic				TOR1AIP2_uc001gnl.2_Missense_Mutation_p.E39K	p.E39K	NM_145034	NP_659471	WXS	Illumina HiSeq	Unspecified	Q8NFQ8	TOIP2_HUMAN			4	503	-			39					Q05BU2	Missense_Mutation	SNP	ENST00000367612.3	37	c.115G>A	CCDS1334.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.777828	0.49786	.	.	ENSG00000169905	ENST00000367612	T	0.23950	1.88	5.26	5.26	0.73747	.	0.251922	0.28151	N	0.016405	T	0.41305	0.1153	M	0.72479	2.2	0.30542	N	0.766331	P	0.45348	0.856	P	0.51055	0.657	T	0.46345	-0.9198	10	0.59425	D	0.04	-7.1744	14.2414	0.65959	0.0:1.0:0.0:0.0	.	39	Q8NFQ8	TOIP2_HUMAN	K	39	ENSP00000356584:E39K	ENSP00000356584:E39K	E	-	1	0	TOR1AIP2	178087041	0.987000	0.35691	0.904000	0.35570	0.023000	0.10783	3.154000	0.50693	2.717000	0.92951	0.650000	0.86243	GAA		0.413	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034		8	85	0	0	0	0.00308	0	8	85				
HMCN1	83872	broad.mit.edu	37	1	186086243	186086243	+	Silent	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:186086243C>G	ENST00000271588.4	+	76	11908	c.11679C>G	c.(11677-11679)gtC>gtG	p.V3893V	HMCN1_ENST00000367492.2_Silent_p.V3893V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3893					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATCTCACTGTCCAAGGTAGAA	0.373																																							uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(11677-11679)GTC>GTG		hemicentin 1 precursor							137.0	126.0	130.0					1																	186086243		2203	4300	6503	SO:0001819	synonymous_variant	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186086243C>G	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11679C>G	1.37:g.186086243C>G			Somatic					p.V3893V	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			76	11908	+			3893					A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	c.11679C>G	CCDS30956.1																																																																																				0.373	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		7	70	0	0	0	0.00308	0	7	70				
ELF3	1999	broad.mit.edu	37	1	201980376	201980376	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:201980376G>C	ENST00000359651.3	+	1	3304	c.112G>C	c.(112-114)Gat>Cat	p.D38H	ELF3_ENST00000367284.5_Missense_Mutation_p.D38H|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000495848.1_3'UTR|ELF3_ENST00000367283.3_Missense_Mutation_p.D38H|RP11-465N4.4_ENST00000419190.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						CTTTGGGGCCGATGACTTGGT	0.572																																							uc001gxg.3		NA																	0					0						c.(112-114)GAT>CAT		E74-like factor 3 (ets domain transcription							100.0	96.0	97.0					1																	201980376		2203	4300	6503	SO:0001583	missense	1999				epidermis development|epithelial cell differentiation|inflammatory response|mammary gland involution|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr1:201980376G>C	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.112G>C	1.37:g.201980376G>C	ENSP00000352673:p.Asp38His		Somatic				ELF3_uc001gxi.3_Missense_Mutation_p.D38H|ELF3_uc001gxh.3_Missense_Mutation_p.D38H	p.D38H	NM_004433	NP_004424	WXS	Illumina HiSeq	Unspecified	P78545	ELF3_HUMAN			1	3304	+			38						Missense_Mutation	SNP	ENST00000359651.3	37	c.112G>C	CCDS1419.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.865338	0.32977	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044;ENST00000446188	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.88	4.02	0.46733	Sterile alpha motif/pointed domain (1);	1.863580	0.02187	N	0.061053	T	0.38480	0.1042	L	0.47716	1.5	0.09310	N	1	P	0.48503	0.911	P	0.44990	0.466	T	0.34502	-0.9826	10	0.72032	D	0.01	.	10.7089	0.45971	0.1462:0.0:0.8538:0.0	.	38	P78545	ELF3_HUMAN	H	38	ENSP00000352673:D38H;ENSP00000356253:D38H;ENSP00000356252:D38H;ENSP00000405162:D38H	ENSP00000311348:D38H	D	+	1	0	ELF3	200246999	0.010000	0.17322	0.016000	0.15963	0.014000	0.08584	0.941000	0.29005	0.825000	0.34637	0.655000	0.94253	GAT		0.572	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433		8	90	0	0	0	0.00308	0	8	90				
MFSD4	148808	broad.mit.edu	37	1	205553109	205553109	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:205553109G>A	ENST00000367147.4	+	4	810	c.717G>A	c.(715-717)atG>atA	p.M239I	MFSD4_ENST00000539267.1_Missense_Mutation_p.M239I|MFSD4_ENST00000536357.1_Missense_Mutation_p.M152I	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4	239					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			CTGTGCTGATGCTGCTGTCCA	0.642																																							uc001hcv.3		NA																	0				skin(2)|central_nervous_system(1)	3						c.(715-717)ATG>ATA		major facilitator superfamily domain containing							60.0	59.0	59.0					1																	205553109		2203	4300	6503	SO:0001583	missense	148808				transmembrane transport	integral to membrane		g.chr1:205553109G>A	BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.717G>A	1.37:g.205553109G>A	ENSP00000356115:p.Met239Ile		Somatic				MFSD4_uc010prk.1_Missense_Mutation_p.M152I|MFSD4_uc010prl.1_RNA|MFSD4_uc010prm.1_Missense_Mutation_p.M184I	p.M239I	NM_181644	NP_857595	WXS	Illumina HiSeq	Unspecified	Q8N468	MFSD4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0908)		4	803	+	Breast(84;0.07)		239			Helical; (Potential).		B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	Missense_Mutation	SNP	ENST00000367147.4	37	c.717G>A	CCDS1455.1	.	.	.	.	.	.	.	.	.	.	G	6.769	0.510876	0.12883	.	.	ENSG00000174514	ENST00000367147;ENST00000539267;ENST00000536357	T;T;T	0.80033	0.45;0.45;-1.33	5.57	-7.34	0.01427	Major facilitator superfamily domain, general substrate transporter (1);	0.567976	0.22054	N	0.065277	T	0.52058	0.1711	N	0.03608	-0.345	0.09310	N	0.999999	B;B;B	0.12630	0.006;0.0;0.006	B;B;B	0.15052	0.006;0.0;0.012	T	0.37709	-0.9694	10	0.23891	T	0.37	-3.794	13.0683	0.59046	0.0:0.6724:0.2138:0.1137	.	184;152;239	B7Z8X0;B7Z8X3;Q8N468	.;.;MFSD4_HUMAN	I	239;239;152	ENSP00000356115:M239I;ENSP00000445329:M239I;ENSP00000440183:M152I	ENSP00000356115:M239I	M	+	3	0	MFSD4	203819732	0.007000	0.16637	0.016000	0.15963	0.413000	0.31143	-0.547000	0.06055	-1.403000	0.02053	-1.224000	0.01588	ATG		0.642	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090391.1	NM_181644		8	61	0	0	0	0.006214	0	8	61				
FAM71A	149647	broad.mit.edu	37	1	212799595	212799595	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:212799595C>T	ENST00000294829.3	+	1	1807	c.1376C>T	c.(1375-1377)tCc>tTc	p.S459F	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	459						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		CAAAAGTCCTCCAGCAGGTCC	0.552																																							uc001hjk.2		NA																	0				skin(3)|ovary(1)|central_nervous_system(1)	5						c.(1375-1377)TCC>TTC		hypothetical protein LOC149647							63.0	77.0	72.0					1																	212799595		2203	4300	6503	SO:0001583	missense	149647							g.chr1:212799595C>T		CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.1376C>T	1.37:g.212799595C>T	ENSP00000294829:p.Ser459Phe		Somatic				uc010pth.1_RNA	p.S459F	NM_153606	NP_705834	WXS	Illumina HiSeq	Unspecified	Q8IYT1	FA71A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)	1	1780	+			459					Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	37	c.1376C>T	CCDS1507.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.442916	0.25987	.	.	ENSG00000162771	ENST00000294829;ENST00000545975	T	0.07216	3.21	3.17	-0.204	0.13200	.	.	.	.	.	T	0.06781	0.0173	L	0.38175	1.15	0.09310	N	1	B	0.15930	0.015	B	0.10450	0.005	T	0.35549	-0.9784	9	0.87932	D	0	-2.1974	5.3707	0.16138	0.0:0.5015:0.0:0.4985	.	459	Q8IYT1	FA71A_HUMAN	F	459;234	ENSP00000294829:S459F	ENSP00000294829:S459F	S	+	2	0	FAM71A	210866218	0.001000	0.12720	0.000000	0.03702	0.040000	0.13550	1.006000	0.29847	-0.031000	0.13781	0.561000	0.74099	TCC		0.552	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606		6	53	0	0	0	0.001168	0	6	53				
RYR2	6262	broad.mit.edu	37	1	237777351	237777351	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:237777351C>T	ENST00000366574.2	+	37	5240	c.4923C>T	c.(4921-4923)atC>atT	p.I1641I	RYR2_ENST00000542537.1_Silent_p.I1625I|RYR2_ENST00000360064.6_Silent_p.I1639I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1641	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGTTGACATCTTAGAGTTGA	0.438																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(4921-4923)ATC>ATT		cardiac muscle ryanodine receptor							52.0	49.0	50.0					1																	237777351		1885	4114	5999	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237777351C>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4923C>T	1.37:g.237777351C>T			Somatic					p.I1641I	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		37	5043	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1641			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.4923C>T	CCDS55691.1																																																																																				0.438	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		5	49	0	0	0	0.000602	0	5	49				
ZP4	57829	broad.mit.edu	37	1	238046082	238046082	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:238046082C>T	ENST00000366570.4	-	11	1613	c.1455G>A	c.(1453-1455)atG>atA	p.M485I	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	485					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GGAGTAGAATCATGGGGCCTT	0.393																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	0				ovary(2)|skin(1)	3						c.(1453-1455)ATG>ATA		zona pellucida glycoprotein 4 preproprotein							126.0	125.0	126.0					1																	238046082		2203	4300	6503	SO:0001583	missense	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238046082C>T	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1455G>A	1.37:g.238046082C>T	ENSP00000355529:p.Met485Ile		Somatic				LOC100130331_uc010pyc.1_Intron	p.M485I	NM_021186	NP_067009	WXS	Illumina HiSeq	Unspecified	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		11	1455	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	485			Extracellular (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.1455G>A	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671909	0.29693	.	.	ENSG00000116996	ENST00000366570	T	0.69435	-0.4	4.09	3.18	0.36537	.	0.282899	0.34088	N	0.004280	T	0.48624	0.1510	L	0.31926	0.97	0.22066	N	0.999382	B	0.06786	0.001	B	0.09377	0.004	T	0.14980	-1.0453	10	0.21540	T	0.41	-22.5153	7.0632	0.25137	0.0:0.8803:0.0:0.1197	.	485	Q12836	ZP4_HUMAN	I	485	ENSP00000355529:M485I	ENSP00000355529:M485I	M	-	3	0	ZP4	236112705	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.253000	0.32886	2.298000	0.77334	0.655000	0.94253	ATG		0.393	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			13	65	0	0	0	0.003163	0	13	65				
OR2T34	127068	broad.mit.edu	37	1	248737462	248737462	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:248737462G>A	ENST00000328782.2	-	1	618	c.597C>T	c.(595-597)ctC>ctT	p.L199L		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCATCTTATAGAGGGAGACGT	0.512																																							uc001iep.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(595-597)CTC>CTT		olfactory receptor, family 2, subfamily T,							169.0	188.0	182.0					1																	248737462		2141	4300	6441	SO:0001819	synonymous_variant	127068				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248737462G>A	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.597C>T	1.37:g.248737462G>A			Somatic					p.L199L	NM_001001821	NP_001001821	WXS	Illumina HiSeq	Unspecified	Q8NGX1	O2T34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	597	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		199			Extracellular (Potential).		B2RNJ8|Q6IEY5|Q96R31	Silent	SNP	ENST00000328782.2	37	c.597C>T	CCDS31120.1																																																																																				0.512	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821		22	275	0	0	0	0.004656	0	22	275				
TMEM26	219623	broad.mit.edu	37	10	63212759	63212759	+	Silent	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr10:63212759C>G	ENST00000399298.3	-	1	449	c.81G>C	c.(79-81)gtG>gtC	p.V27V	RP11-809M12.1_ENST00000389640.4_RNA|TMEM26_ENST00000399293.1_Silent_p.V27V	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	27						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					TCACCTCGGTCACTCGCCAGA	0.632																																							uc001jlo.2		NA																	0					0						c.(79-81)GTG>GTC		transmembrane protein 26							66.0	79.0	75.0					10																	63212759		2065	4200	6265	SO:0001819	synonymous_variant	219623					integral to membrane		g.chr10:63212759C>G	BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.81G>C	10.37:g.63212759C>G			Somatic				TMEM26_uc010qij.1_RNA|TMEM26_uc001jlq.2_RNA|uc001jlr.2_RNA	p.V27V	NM_178505	NP_848600	WXS	Illumina HiSeq	Unspecified	Q6ZUK4	TMM26_HUMAN			1	450	-	Prostate(12;0.0112)		27					Q6ZVM0|Q8IVN9	Silent	SNP	ENST00000399298.3	37	c.81G>C	CCDS41530.1																																																																																				0.632	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1	NM_178505		18	114	0	0	0	0.008871	0	18	114				
SORCS1	114815	broad.mit.edu	37	10	108466321	108466321	+	Silent	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr10:108466321C>G	ENST00000263054.6	-	8	1222	c.1215G>C	c.(1213-1215)ccG>ccC	p.P405P	SORCS1_ENST00000344440.6_Silent_p.P405P	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	405					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.P405P(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AAGCATATTTCGGAAGCTTCA	0.458																																							uc001kym.2		NA																	1	Substitution - coding silent(1)		breast(1)	breast(1)|central_nervous_system(1)	2						c.(1213-1215)CCG>CCC		SORCS receptor 1 isoform a							173.0	136.0	149.0					10																	108466321		2203	4300	6503	SO:0001819	synonymous_variant	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108466321C>G	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1215G>C	10.37:g.108466321C>G			Somatic				SORCS1_uc001kyl.2_Silent_p.P405P|SORCS1_uc009xxs.2_Silent_p.P405P|SORCS1_uc001kyn.1_Silent_p.P405P|SORCS1_uc001kyo.2_Silent_p.P405P	p.P405P	NM_052918	NP_443150	WXS	Illumina HiSeq	Unspecified	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	8	1223	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	405			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	ENST00000263054.6	37	c.1215G>C	CCDS7559.1																																																																																				0.458	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		5	55	0	0	0	0.001168	0	5	55				
C10orf120	399814	broad.mit.edu	37	10	124457724	124457724	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr10:124457724C>A	ENST00000329446.4	-	3	564	c.533G>T	c.(532-534)gGa>gTa	p.G178V		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	178								p.G178E(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				CTGATGATTTCCCAGAGCCCG	0.507																																							uc001lgn.2		NA																	1	Substitution - Missense(1)		skin(1)	kidney(1)	1						c.(532-534)GGA>GTA		hypothetical protein LOC399814							148.0	134.0	139.0					10																	124457724		2203	4300	6503	SO:0001583	missense	399814							g.chr10:124457724C>A		CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.533G>T	10.37:g.124457724C>A	ENSP00000331012:p.Gly178Val		Somatic					p.G178V	NM_001010912	NP_001010912	WXS	Illumina HiSeq	Unspecified	Q5SQS8	CJ120_HUMAN			3	565	-		all_neural(114;0.169)|Glioma(114;0.222)	178					B2RU17	Missense_Mutation	SNP	ENST00000329446.4	37	c.533G>T	CCDS31302.1	.	.	.	.	.	.	.	.	.	.	C	10.34	1.322960	0.23994	.	.	ENSG00000183559	ENST00000329446	T	0.30448	1.53	4.71	-0.188	0.13264	.	1.278170	0.05264	N	0.516357	T	0.20780	0.0500	N	0.22421	0.69	0.09310	N	1	B	0.33135	0.399	B	0.31686	0.134	T	0.31024	-0.9958	10	0.54805	T	0.06	-0.6581	6.9655	0.24621	0.0:0.403:0.0:0.597	.	178	Q5SQS8	CJ120_HUMAN	V	178	ENSP00000331012:G178V	ENSP00000331012:G178V	G	-	2	0	C10orf120	124447714	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.068000	0.11561	0.089000	0.17243	0.603000	0.83216	GGA		0.507	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050803.1	NM_001010912		17	104	1	0	1.96292e-10	0.001523	2.98853e-10	17	104				
MUC5B	727897	broad.mit.edu	37	11	1275512	1275512	+	Silent	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:1275512C>G	ENST00000529681.1	+	34	15466	c.15408C>G	c.(15406-15408)ctC>ctG	p.L5136L	MUC5B_ENST00000447027.1_Silent_p.L5139L	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5136	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.L5091L(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCGCGCCCTCAGCATCCACT	0.622																																							uc009ycr.1		NA																	1	Substitution - coding silent(1)		upper_aerodigestive_tract(1)		0						c.(16417-16419)CTC>CTG		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							32.0	41.0	38.0					11																	1275512		2158	4262	6420	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1275512C>G	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.15408C>G	11.37:g.1275512C>G			Somatic				MUC5B_uc001ltb.2_Silent_p.L5139L	p.L5473L	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	56	16545	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	5136			VWFD 4.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.16419C>G	CCDS44515.2																																																																																				0.622	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		4	47	0	0	0	0.000248	0	4	47				
TRIM68	55128	broad.mit.edu	37	11	4621894	4621894	+	Missense_Mutation	SNP	C	C	T	rs139399398		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:4621894C>T	ENST00000300747.5	-	7	1359	c.1070G>A	c.(1069-1071)cGg>cAg	p.R357Q		NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68	357	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCAGTAGTGCCGGCCTGAGGA	0.542																																							uc001lzf.1		NA																	0				ovary(1)	1						c.(1069-1071)CGG>CAG		ring finger protein 137		C	GLN/ARG	1,4401	2.1+/-5.4	0,1,2200	48.0	50.0	50.0		1070	0.8	1.0	11	dbSNP_134	50	0,8596		0,0,4298	no	missense	TRIM68	NM_018073.5	43	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	357/486	4621894	1,12997	2201	4298	6499	SO:0001583	missense	55128				protein autoubiquitination|regulation of androgen receptor signaling pathway	Golgi apparatus|nucleolus|perinuclear region of cytoplasm	androgen receptor binding|histone acetyltransferase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:4621894C>T	AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1		ENST00000300747.5:c.1070G>A	11.37:g.4621894C>T	ENSP00000300747:p.Arg357Gln		Somatic				TRIM68_uc001lzg.1_Missense_Mutation_p.R134Q|TRIM68_uc010qyj.1_RNA	p.R357Q	NM_018073	NP_060543	WXS	Illumina HiSeq	Unspecified	Q6AZZ1	TRI68_HUMAN		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)	7	1308	-		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)	357			B30.2/SPRY.		A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Missense_Mutation	SNP	ENST00000300747.5	37	c.1070G>A	CCDS31356.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179112	0.57800	2.27E-4	0.0	ENSG00000167333	ENST00000300747;ENST00000544055;ENST00000526337	T;T	0.70631	-0.5;-0.13	5.52	0.837	0.18896	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.48286	D	0.000193	T	0.66577	0.2803	M	0.80616	2.505	0.30926	N	0.727454	D	0.59357	0.985	B	0.43386	0.418	T	0.68534	-0.5383	10	0.87932	D	0	.	4.214	0.10526	0.1499:0.4915:0.0:0.3586	.	357	Q6AZZ1	TRI68_HUMAN	Q	357;78;134	ENSP00000300747:R357Q;ENSP00000434681:R134Q	ENSP00000300747:R357Q	R	-	2	0	TRIM68	4578470	0.776000	0.28616	0.996000	0.52242	0.994000	0.84299	1.357000	0.34090	0.281000	0.22233	0.561000	0.74099	CGG		0.542	TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	NM_018073		9	49	0	0	0	0.004482	0	9	49				
OR51S1	119692	broad.mit.edu	37	11	4869844	4869844	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:4869844C>T	ENST00000322101.2	-	1	670	c.595G>A	c.(595-597)Gaa>Aaa	p.E199K	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCCCAAGCTTCTGGGCAGGCC	0.542																																							uc010qyo.1		NA																	0				skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(595-597)GAA>AAA		olfactory receptor, family 51, subfamily S,							71.0	78.0	75.0					11																	4869844		2201	4298	6499	SO:0001583	missense	119692				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4869844C>T	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.595G>A	11.37:g.4869844C>T	ENSP00000322754:p.Glu199Lys		Somatic					p.E199K	NM_001004758	NP_001004758	WXS	Illumina HiSeq	Unspecified	Q8NGJ8	O51S1_HUMAN		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	595	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	199			Extracellular (Potential).		B9EGZ1|Q6IFI2	Missense_Mutation	SNP	ENST00000322101.2	37	c.595G>A	CCDS31362.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640020	0.47153	.	.	ENSG00000176922	ENST00000322101	T	0.37058	1.22	5.25	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.155563	0.30177	N	0.010226	T	0.25827	0.0629	N	0.24115	0.695	0.09310	N	0.999991	B	0.23185	0.081	B	0.26416	0.069	T	0.30475	-0.9977	10	0.87932	D	0	0.2397	11.0718	0.48008	0.0:0.8445:0.0:0.1555	.	199	Q8NGJ8	O51S1_HUMAN	K	199	ENSP00000322754:E199K	ENSP00000322754:E199K	E	-	1	0	OR51S1	4826420	0.000000	0.05858	0.932000	0.37286	0.871000	0.50021	0.547000	0.23299	1.446000	0.47643	0.655000	0.94253	GAA		0.542	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758		10	99	0	0	0	0.008291	0	10	99				
OR51M1	390059	broad.mit.edu	37	11	5411219	5411219	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:5411219A>G	ENST00000328611.3	+	1	613	c.591A>G	c.(589-591)atA>atG	p.I197M	HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	197					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGAAGTGATACAGCTGGCCT	0.507																																							uc010qzc.1		NA																	0					0						c.(589-591)ATA>ATG		olfactory receptor, family 51, subfamily M,							163.0	154.0	157.0					11																	5411219		2015	4199	6214	SO:0001583	missense	390059					integral to membrane	olfactory receptor activity	g.chr11:5411219A>G	BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.591A>G	11.37:g.5411219A>G	ENSP00000333196:p.Ile197Met		Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	p.I197M	NM_001004756	NP_001004756	WXS	Illumina HiSeq	Unspecified	B2RNI9	B2RNI9_HUMAN		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	591	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	197					Q6IF80	Missense_Mutation	SNP	ENST00000328611.3	37	c.591A>G	CCDS53596.1	.	.	.	.	.	.	.	.	.	.	A	3.472	-0.107650	0.06924	.	.	ENSG00000184698	ENST00000328611	T	0.00164	8.64	5.26	-2.01	0.07410	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36703	U	0.002447	T	0.00109	0.0003	N	0.10733	0.035	0.09310	N	1	P	0.46578	0.88	P	0.59115	0.852	T	0.48269	-0.9050	10	0.02654	T	1	.	2.1181	0.03719	0.5146:0.2195:0.1472:0.1187	.	186	Q9H341	O51M1_HUMAN	M	197	ENSP00000333196:I197M	ENSP00000333196:I197M	I	+	3	3	OR51M1	5367795	0.000000	0.05858	0.736000	0.30914	0.856000	0.48823	-0.734000	0.04893	-0.136000	0.11475	0.533000	0.62120	ATA		0.507	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142981.1	NM_001004756		11	136	0	0	0	0.000978	0	11	136				
OR52L1	338751	broad.mit.edu	37	11	6007326	6007326	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:6007326T>A	ENST00000332249.4	-	1	889	c.835A>T	c.(835-837)Act>Tct	p.T279S		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAGCGGTGAGTGAGGAAGGAG	0.502																																					Melanoma(121;653 1666 10547 22796 51255)	Melanoma(121;653 1666 10547 22796 51255)	uc001mcd.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(835-837)ACT>TCT		olfactory receptor, family 52, subfamily L,							112.0	113.0	113.0					11																	6007326		2076	4246	6322	SO:0001583	missense	338751				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6007326T>A	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.835A>T	11.37:g.6007326T>A	ENSP00000330338:p.Thr279Ser		Somatic					p.T279S	NM_001005173	NP_001005173	WXS	Illumina HiSeq	Unspecified	Q8NGH7	O52L1_HUMAN		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	890	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	279			Extracellular (Potential).		B2RPA6|Q6IFK9	Missense_Mutation	SNP	ENST00000332249.4	37	c.835A>T	CCDS44529.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.820121	0.32145	.	.	ENSG00000183313	ENST00000332249	T	0.37058	1.22	4.1	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45126	D	0.000393	T	0.46927	0.1418	L	0.42487	1.325	0.32409	N	0.550862	D	0.76494	0.999	D	0.79108	0.992	T	0.56165	-0.8024	10	0.51188	T	0.08	.	7.9456	0.29985	0.1833:0.0:0.0:0.8167	.	279	Q8NGH7	O52L1_HUMAN	S	279	ENSP00000330338:T279S	ENSP00000330338:T279S	T	-	1	0	OR52L1	5963902	0.000000	0.05858	1.000000	0.80357	0.205000	0.24178	-0.372000	0.07504	1.616000	0.50265	0.260000	0.18958	ACT		0.502	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173		10	59	0	0	0	0.008291	0	10	59				
USP47	55031	broad.mit.edu	37	11	11972026	11972026	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:11972026G>C	ENST00000399455.2	+	25	3760	c.3640G>C	c.(3640-3642)Gat>Cat	p.D1214H	USP47_ENST00000339865.5_Missense_Mutation_p.D1126H|USP47_ENST00000305481.6_3'UTR|USP47_ENST00000527733.1_Missense_Mutation_p.D1194H|USP47_ENST00000539466.1_5'UTR	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	1214					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		TGAAGTTCTTGATGGTATTTT	0.318																																							uc001mjs.2		NA																	0				ovary(1)|skin(1)	2						c.(3580-3582)GAT>CAT		ubiquitin specific protease 47							107.0	99.0	102.0					11																	11972026		1784	4049	5833	SO:0001583	missense	55031				base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding	g.chr11:11972026G>C	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.3640G>C	11.37:g.11972026G>C	ENSP00000382382:p.Asp1214His		Somatic				USP47_uc001mjr.2_Missense_Mutation_p.D1126H|USP47_uc009ygi.2_5'UTR	p.D1194H	NM_017944	NP_060414	WXS	Illumina HiSeq	Unspecified	Q96K76	UBP47_HUMAN		Epithelial(150;0.000339)	24	4343	+			1214					B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	ENST00000399455.2	37	c.3580G>C		.	.	.	.	.	.	.	.	.	.	G	17.03	3.284871	0.59867	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455	T;T;T	0.05319	3.46;3.46;3.46	5.19	5.19	0.71726	.	0.099263	0.64402	D	0.000002	T	0.10078	0.0247	L	0.42245	1.32	0.80722	D	1	P;P	0.44195	0.736;0.828	B;B	0.42593	0.219;0.392	T	0.02829	-1.1105	10	0.59425	D	0.04	.	18.6912	0.91583	0.0:0.0:1.0:0.0	.	1194;1126	E9PM46;Q96K76-2	.;.	H	1126;1194;1214	ENSP00000339957:D1126H;ENSP00000433146:D1194H;ENSP00000382382:D1214H	ENSP00000339957:D1126H	D	+	1	0	USP47	11928602	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.616000	0.67709	2.583000	0.87209	0.655000	0.94253	GAT		0.318	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944		7	73	0	0	0	0.004482	0	7	73				
MRGPRX1	259249	broad.mit.edu	37	11	18956268	18956268	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:18956268G>C	ENST00000302797.3	-	1	288	c.64C>G	c.(64-66)Ctt>Gtt	p.L22V	RP11-583F24.8_ENST00000528646.1_RNA|MRGPRX1_ENST00000526914.1_5'UTR	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	22					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TTGTAGCAAAGAGTCTCCTCA	0.542																																							uc001mpg.2		NA																	0				pancreas(2)|central_nervous_system(1)	3						c.(64-66)CTT>GTT		MAS-related GPR, member X1							258.0	244.0	249.0					11																	18956268		2194	4286	6480	SO:0001583	missense	259249				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18956268G>C		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.64C>G	11.37:g.18956268G>C	ENSP00000305766:p.Leu22Val		Somatic					p.L22V	NM_147199	NP_671732	WXS	Illumina HiSeq	Unspecified	Q96LB2	MRGX1_HUMAN			1	282	-			22			Extracellular (Potential).		Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	ENST00000302797.3	37	c.64C>G	CCDS7846.1	.	.	.	.	.	.	.	.	.	.	.	0.453	-0.892996	0.02491	.	.	ENSG00000170255	ENST00000302797	T	0.20332	2.08	2.23	-1.2	0.09554	.	3.659760	0.00447	N	0.000086	T	0.12732	0.0309	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13522	-1.0506	10	0.15499	T	0.54	.	3.6111	0.08061	0.2636:0.0:0.5425:0.1939	.	22	Q96LB2	MRGX1_HUMAN	V	22	ENSP00000305766:L22V	ENSP00000305766:L22V	L	-	1	0	MRGPRX1	18912844	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.465000	0.02357	-0.289000	0.09038	-0.500000	0.04577	CTT		0.542	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199		21	572	0	0	0	0.00278	0	21	572				
LRRC4C	57689	broad.mit.edu	37	11	40136376	40136376	+	Silent	SNP	C	C	T	rs199976081		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:40136376C>T	ENST00000278198.2	-	2	3430	c.1467G>A	c.(1465-1467)gtG>gtA	p.V489V	LRRC4C_ENST00000528697.1_Silent_p.V489V|LRRC4C_ENST00000527150.1_Silent_p.V489V|LRRC4C_ENST00000530763.1_Silent_p.V489V			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	489					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GAGAGGTGGTCACATTGGTGG	0.522																																							uc001mxa.1		NA																	0				ovary(4)|skin(3)|central_nervous_system(1)	8						c.(1465-1467)GTG>GTA		netrin-G1 ligand precursor							138.0	113.0	121.0					11																	40136376		2203	4300	6503	SO:0001819	synonymous_variant	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136376C>T	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1467G>A	11.37:g.40136376C>T			Somatic				LRRC4C_uc001mxc.1_Silent_p.V485V|LRRC4C_uc001mxd.1_Silent_p.V485V|LRRC4C_uc001mxb.1_Silent_p.V485V	p.V489V	NM_020929	NP_065980	WXS	Illumina HiSeq	Unspecified	Q9HCJ2	LRC4C_HUMAN			2	3431	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	489					A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	c.1467G>A	CCDS31464.1																																																																																				0.522	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		11	38	0	0	0	0.008291	0	11	38				
CKAP5	9793	broad.mit.edu	37	11	46819519	46819519	+	Splice_Site	SNP	T	T	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:46819519T>C	ENST00000529230.1	-	11	1220	c.1174A>G	c.(1174-1176)Acc>Gcc	p.T392A	CKAP5_ENST00000415402.1_Splice_Site_p.T392A|CKAP5_ENST00000532321.1_5'UTR|CKAP5_ENST00000354558.3_Splice_Site_p.T392A|CKAP5_ENST00000312055.5_Splice_Site_p.T392A			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	392					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TGTAGTGTGGTCTTTAGAAAG	0.303																																					Ovarian(4;85 273 2202 4844 13323)	Ovarian(4;85 273 2202 4844 13323)	uc001ndi.1		NA																	0				ovary(1)|skin(1)	2						c.(1174-1176)ACC>GCC		colonic and hepatic tumor over-expressed protein							137.0	132.0	133.0					11																	46819519		2201	4299	6500	SO:0001630	splice_region_variant	9793				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding	g.chr11:46819519T>C		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1174-1A>G	11.37:g.46819519T>C			Somatic				CKAP5_uc009ylg.1_Missense_Mutation_p.T278A|CKAP5_uc001ndj.1_Missense_Mutation_p.T392A	p.T392A	NM_001008938	NP_001008938	WXS	Illumina HiSeq	Unspecified	Q14008	CKAP5_HUMAN			11	1284	-			392			HEAT 2.		Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	c.1174A>G	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.691145	0.88735	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	5.46	5.46	0.80206	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63498	0.2516	M	0.86343	2.81	0.80722	D	1	P;D;D	0.71674	0.921;0.97;0.998	D;D;D	0.70016	0.928;0.954;0.967	T	0.65751	-0.6092	10	0.30078	T	0.28	-0.5471	15.5379	0.76018	0.0:0.0:0.0:1.0	.	392;392;392	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	A	392	ENSP00000432768:T392A;ENSP00000395302:T392A;ENSP00000310227:T392A;ENSP00000346566:T392A	ENSP00000310227:T392A	T	-	1	0	CKAP5	46776095	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.021000	0.88750	2.091000	0.63221	0.528000	0.53228	ACC		0.303	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	Missense_Mutation	11	63	0	0	0	0.001368	0	11	63				
FOLH1	2346	broad.mit.edu	37	11	49207299	49207299	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:49207299C>A	ENST00000256999.2	-	6	1008	c.748G>T	c.(748-750)Gga>Tga	p.G250*	FOLH1_ENST00000340334.7_Nonsense_Mutation_p.G235*|FOLH1_ENST00000356696.3_Nonsense_Mutation_p.G250*|FOLH1_ENST00000343844.4_Intron|FOLH1_ENST00000533034.1_Nonsense_Mutation_p.G235*	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	250					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	ACACCACCTCCAGGAAGATTC	0.512																																							uc001ngy.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(748-750)GGA>TGA		folate hydrolase 1 isoform 1	Capromab(DB00089)|L-Glutamic Acid(DB00142)						48.0	59.0	55.0					11																	49207299		2201	4293	6494	SO:0001587	stop_gained	2346				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity	g.chr11:49207299C>A	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.748G>T	11.37:g.49207299C>A	ENSP00000256999:p.Gly250*		Somatic				FOLH1_uc001ngz.2_Nonsense_Mutation_p.G250*|FOLH1_uc009yly.2_Nonsense_Mutation_p.G235*|FOLH1_uc009ylz.2_Nonsense_Mutation_p.G235*|FOLH1_uc009yma.2_Intron	p.G250*	NM_004476	NP_004467	WXS	Illumina HiSeq	Unspecified	Q04609	FOLH1_HUMAN			6	1009	-			250			Extracellular (Probable).		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Nonsense_Mutation	SNP	ENST00000256999.2	37	c.748G>T	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	C	38	6.914725	0.97932	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	.	.	.	3.01	3.01	0.34805	.	0.000000	0.50627	D	0.000113	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	11.8829	0.52586	0.0:1.0:0.0:0.0	.	.	.	.	X	250;250;235;235;250	.	ENSP00000256999:G250X	G	-	1	0	FOLH1	49163875	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.902000	0.75699	1.723000	0.51488	0.400000	0.26472	GGA		0.512	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476		10	53	1	0	1.76689e-08	0.006214	2.65336e-08	10	53				
OR4C15	81309	broad.mit.edu	37	11	55322305	55322305	+	Missense_Mutation	SNP	C	C	A	rs267602969		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:55322305C>A	ENST00000314644.2	+	1	523	c.523C>A	c.(523-525)Cgt>Agt	p.R175S		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						GGCCTATGATCGTTATGTGGC	0.507										HNSCC(20;0.049)																													uc010rig.1		NA																	0				ovary(1)|skin(1)	2						c.(523-525)CGT>AGT		olfactory receptor, family 4, subfamily C,							124.0	112.0	116.0					11																	55322305		2201	4296	6497	SO:0001583	missense	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322305C>A	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.523C>A	11.37:g.55322305C>A	ENSP00000324958:p.Arg175Ser	HNSCC(20;0.049)	Somatic					p.R175S	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	523	+			121			Cytoplasmic (Potential).		Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	c.523C>A	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.060103	0.55432	.	.	ENSG00000181939	ENST00000314644	T	0.77620	-1.11	5.12	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.84772	0.5546	H	0.98005	4.125	0.26320	N	0.977694	P	0.36065	0.535	B	0.31290	0.127	T	0.82450	-0.0451	9	0.72032	D	0.01	.	12.9126	0.58189	0.1621:0.8379:0.0:0.0	.	121	Q8NGM1	OR4CF_HUMAN	S	175	ENSP00000324958:R175S	ENSP00000324958:R175S	R	+	1	0	OR4C15	55078881	0.184000	0.23200	0.987000	0.45799	0.774000	0.43823	0.952000	0.29149	2.665000	0.90641	0.385000	0.25706	CGT		0.507	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		21	94	1	0	1.50039e-11	0.001882	2.30829e-11	21	94				
OR4D6	219983	broad.mit.edu	37	11	59224838	59224838	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:59224838G>A	ENST00000300127.2	+	1	428	c.405G>A	c.(403-405)atG>atA	p.M135I		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						ATGTGACCATGATGAGGAAAG	0.488																																							uc010rku.1		NA																	0				ovary(1)	1						c.(403-405)ATG>ATA		olfactory receptor, family 4, subfamily D,							274.0	250.0	258.0					11																	59224838		2201	4295	6496	SO:0001583	missense	219983				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59224838G>A	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.405G>A	11.37:g.59224838G>A	ENSP00000300127:p.Met135Ile		Somatic					p.M135I	NM_001004708	NP_001004708	WXS	Illumina HiSeq	Unspecified	Q8NGJ1	OR4D6_HUMAN			1	405	+			135			Cytoplasmic (Potential).		B2RNP7|Q6IFF5|Q96R74	Missense_Mutation	SNP	ENST00000300127.2	37	c.405G>A	CCDS31562.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.772228	0.00645	.	.	ENSG00000166884	ENST00000300127	T	0.00949	5.51	6.0	-6.25	0.02039	GPCR, rhodopsin-like superfamily (1);	0.262142	0.27591	N	0.018686	T	0.00178	0.0005	N	0.00038	-2.515	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38265	-0.9669	10	0.02654	T	1	-12.1943	8.1956	0.31394	0.1021:0.5649:0.1071:0.226	.	135	Q8NGJ1	OR4D6_HUMAN	I	135	ENSP00000300127:M135I	ENSP00000300127:M135I	M	+	3	0	OR4D6	58981414	0.000000	0.05858	0.874000	0.34290	0.235000	0.25334	-1.900000	0.01599	-0.944000	0.03686	-0.275000	0.10095	ATG		0.488	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708		19	181	0	0	0	0.008871	0	19	181				
OR4D11	219986	broad.mit.edu	37	11	59271749	59271749	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:59271749G>T	ENST00000313253.1	+	1	701	c.701G>T	c.(700-702)aGg>aTg	p.R234M		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						GGGGGCAGGAGGAAAGCCATC	0.557																																							uc001noa.1		NA																	0				ovary(1)|skin(1)	2						c.(700-702)AGG>ATG		olfactory receptor, family 4, subfamily D,							210.0	194.0	199.0					11																	59271749		2201	4295	6496	SO:0001583	missense	219986				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59271749G>T	AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.701G>T	11.37:g.59271749G>T	ENSP00000320077:p.Arg234Met		Somatic					p.R234M	NM_001004706	NP_001004706	WXS	Illumina HiSeq	Unspecified	Q8NGI4	OR4DB_HUMAN			1	701	+			234			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000313253.1	37	c.701G>T	CCDS31563.1	.	.	.	.	.	.	.	.	.	.	g	12.21	1.868522	0.32977	.	.	ENSG00000176200	ENST00000313253	T	0.00164	8.64	5.44	0.4	0.16331	GPCR, rhodopsin-like superfamily (1);	0.107637	0.41097	D	0.000946	T	0.00356	0.0011	M	0.81942	2.565	0.09310	N	1	D	0.58970	0.984	D	0.64687	0.928	T	0.39099	-0.9630	10	0.87932	D	0	-2.4052	8.4193	0.32690	0.5629:0.0:0.4371:0.0	.	234	Q8NGI4	OR4DB_HUMAN	M	234	ENSP00000320077:R234M	ENSP00000320077:R234M	R	+	2	0	OR4D11	59028325	0.000000	0.05858	0.813000	0.32504	0.511000	0.34104	-1.549000	0.02182	0.032000	0.15435	0.557000	0.71058	AGG		0.557	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394236.1	NM_001004706		25	173	1	0	1.36565e-18	0.00278	2.13838e-18	25	173				
AHNAK	79026	broad.mit.edu	37	11	62289822	62289822	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:62289822G>C	ENST00000378024.4	-	5	12341	c.12067C>G	c.(12067-12069)Ctg>Gtg	p.L4023V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4023					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ATCTTAGGCAGAGAAACATCC	0.493																																							uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(12067-12069)CTG>GTG		AHNAK nucleoprotein isoform 1							181.0	188.0	186.0					11																	62289822		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62289822G>C	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.12067C>G	11.37:g.62289822G>C	ENSP00000367263:p.Leu4023Val		Somatic				AHNAK_uc001ntk.1_Intron	p.L4023V	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	12367	-		Melanoma(852;0.155)	4023					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.12067C>G	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	0.006	-2.028218	0.00410	.	.	ENSG00000124942	ENST00000378024	T	0.05382	3.45	4.62	-1.43	0.08884	.	0.570675	0.14853	N	0.294588	T	0.02929	0.0087	N	0.20483	0.58	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.45789	-0.9237	10	0.13853	T	0.58	-0.1978	3.2108	0.06682	0.1621:0.3363:0.3822:0.1194	.	4023	Q09666	AHNK_HUMAN	V	4023	ENSP00000367263:L4023V	ENSP00000367263:L4023V	L	-	1	2	AHNAK	62046398	0.000000	0.05858	0.025000	0.17156	0.002000	0.02628	-1.654000	0.01984	0.058000	0.16222	-0.466000	0.05196	CTG		0.493	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		35	238	0	0	0	0.002836	0	35	238				
UBXN1	51035	broad.mit.edu	37	11	62445299	62445299	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:62445299C>G	ENST00000301935.5	-	6	654	c.488G>C	c.(487-489)aGa>aCa	p.R163T	UBXN1_ENST00000524762.1_5'UTR|UBXN1_ENST00000294119.2_Missense_Mutation_p.R163T|UBXN1_ENST00000533000.1_Missense_Mutation_p.R21T|UBXN1_ENST00000529640.1_Missense_Mutation_p.R159T			Q04323	UBXN1_HUMAN	UBX domain protein 1	163	Interaction with BRCA1.				negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|K6-linked polyubiquitin binding (GO:0071796)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|lung(12)	17						TTCTCTAACTCTTTGTCTGAA	0.438																																							uc001nul.1		NA																	0					0						c.(487-489)AGA>ACA		UBX domain protein 1							152.0	122.0	132.0					11																	62445299		2202	4299	6501	SO:0001583	missense	51035				negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process	cytoplasm	ATPase binding|K6-linked polyubiquitin binding	g.chr11:62445299C>G		CCDS8029.1, CCDS66105.1, CCDS73307.1	11q23	2014-02-12	2008-07-25		ENSG00000162191	ENSG00000162191		"""UBX domain containing"""	18402	protein-coding gene	gene with protein product	"""SAPK substrate protein 1"""					12838346, 20351172	Standard	NM_001286078		Approved	LOC51035, 2B28, UBXD10, SAKS1	uc001nuj.3	Q04323	OTTHUMG00000167580	ENST00000301935.5:c.488G>C	11.37:g.62445299C>G	ENSP00000303991:p.Arg163Thr		Somatic				UBXN1_uc001nuj.2_Missense_Mutation_p.R163T|UBXN1_uc001num.1_Missense_Mutation_p.R159T|UBXN1_uc001nuk.2_Missense_Mutation_p.R128T|UBXN1_uc010rme.1_Missense_Mutation_p.R163T	p.R163T	NM_015853	NP_056937	WXS	Illumina HiSeq	Unspecified	Q04323	UBXN1_HUMAN			6	620	-			163			Potential.|Interaction with BRCA1.		Q9BV93|Q9BVV5	Missense_Mutation	SNP	ENST00000301935.5	37	c.488G>C		.	.	.	.	.	.	.	.	.	.	C	20.9	4.063956	0.76187	.	.	ENSG00000162191	ENST00000294119;ENST00000301935;ENST00000533000;ENST00000537534;ENST00000529640;ENST00000534176	T;T;T;T	0.38240	1.15;1.21;1.27;1.22	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.63616	0.2526	M	0.83312	2.635	0.58432	D	0.999999	D;D;D;D	0.89917	0.998;0.998;1.0;1.0	D;D;D;D	0.83275	0.987;0.981;0.946;0.996	T	0.67730	-0.5595	10	0.87932	D	0	-11.0954	16.1533	0.81636	0.0:1.0:0.0:0.0	.	163;159;163;163	B4DNC6;E9PRQ7;Q04323;Q04323-2	.;.;UBXN1_HUMAN;.	T	163;163;21;66;159;163	ENSP00000294119:R163T;ENSP00000303991:R163T;ENSP00000435964:R159T;ENSP00000435625:R163T	ENSP00000294119:R163T	R	-	2	0	UBXN1	62201875	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	5.491000	0.66887	2.941000	0.99782	0.655000	0.94253	AGA		0.438	UBXN1-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000395153.1	NM_015853		10	75	0	0	0	0.006214	0	10	75				
UBXN1	51035	broad.mit.edu	37	11	62445457	62445457	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:62445457C>T	ENST00000301935.5	-	5	590	c.424G>A	c.(424-426)Gag>Aag	p.E142K	UBXN1_ENST00000524762.1_5'UTR|UBXN1_ENST00000294119.2_Missense_Mutation_p.E142K|UBXN1_ENST00000533000.1_5'Flank|UBXN1_ENST00000529640.1_Missense_Mutation_p.E142K			Q04323	UBXN1_HUMAN	UBX domain protein 1	142	Interaction with BRCA1.				negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|K6-linked polyubiquitin binding (GO:0071796)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.E142K(1)		endometrium(5)|lung(12)	17						CGGCGCATCTCATCTTCCTGT	0.577																																							uc001nul.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(424-426)GAG>AAG		UBX domain protein 1							74.0	62.0	66.0					11																	62445457		2202	4299	6501	SO:0001583	missense	51035				negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process	cytoplasm	ATPase binding|K6-linked polyubiquitin binding	g.chr11:62445457C>T		CCDS8029.1, CCDS66105.1, CCDS73307.1	11q23	2014-02-12	2008-07-25		ENSG00000162191	ENSG00000162191		"""UBX domain containing"""	18402	protein-coding gene	gene with protein product	"""SAPK substrate protein 1"""					12838346, 20351172	Standard	NM_001286078		Approved	LOC51035, 2B28, UBXD10, SAKS1	uc001nuj.3	Q04323	OTTHUMG00000167580	ENST00000301935.5:c.424G>A	11.37:g.62445457C>T	ENSP00000303991:p.Glu142Lys		Somatic				UBXN1_uc001nuj.2_Missense_Mutation_p.E142K|UBXN1_uc001num.1_Missense_Mutation_p.E142K|UBXN1_uc001nuk.2_Missense_Mutation_p.E107K|UBXN1_uc010rme.1_Missense_Mutation_p.E142K|UBXN1_uc010rmf.1_3'UTR	p.E142K	NM_015853	NP_056937	WXS	Illumina HiSeq	Unspecified	Q04323	UBXN1_HUMAN			5	556	-			142			Potential.|Interaction with BRCA1.		Q9BV93|Q9BVV5	Missense_Mutation	SNP	ENST00000301935.5	37	c.424G>A		.	.	.	.	.	.	.	.	.	.	C	35	5.534429	0.96460	.	.	ENSG00000162191	ENST00000294119;ENST00000301935;ENST00000537534;ENST00000529640;ENST00000534176	T;T;T;T	0.30981	1.51;1.59;1.55;1.61	5.31	5.31	0.75309	.	0.043806	0.85682	D	0.000000	T	0.49558	0.1564	L	0.52905	1.665	0.80722	D	1	D;D;D;D	0.76494	0.989;0.989;0.999;0.997	P;P;D;D	0.64042	0.714;0.714;0.921;0.921	T	0.37478	-0.9704	10	0.51188	T	0.08	-13.4729	17.291	0.87156	0.0:1.0:0.0:0.0	.	142;142;142;142	B4DNC6;E9PRQ7;Q04323;Q04323-2	.;.;UBXN1_HUMAN;.	K	142;142;45;142;142	ENSP00000294119:E142K;ENSP00000303991:E142K;ENSP00000435964:E142K;ENSP00000435625:E142K	ENSP00000294119:E142K	E	-	1	0	UBXN1	62202033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.538000	0.53597	2.873000	0.98535	0.561000	0.74099	GAG		0.577	UBXN1-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000395153.1	NM_015853		7	33	0	0	0	0.001984	0	7	33				
TMEM179B	374395	broad.mit.edu	37	11	62556550	62556550	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:62556550C>T	ENST00000333449.4	+	2	157	c.152C>T	c.(151-153)tCc>tTc	p.S51F	RP11-727F15.12_ENST00000601484.1_RNA|TMEM223_ENST00000527073.1_Intron|TMEM179B_ENST00000533861.1_Missense_Mutation_p.S51F|TMEM223_ENST00000525631.1_Intron	NM_199337.2	NP_955369.1	Q7Z7N9	T179B_HUMAN	transmembrane protein 179B	51						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|liver(1)|lung(1)	4						AATGGCTCCTCCCTGGCCTTA	0.567																																							uc001nvd.3		NA																	0					0						c.(151-153)TCC>TTC		transmembrane protein 179B							144.0	133.0	137.0					11																	62556550		2201	4299	6500	SO:0001583	missense	374395					integral to membrane		g.chr11:62556550C>T	BC051355	CCDS8036.1	11q12.3	2007-11-26			ENSG00000185475	ENSG00000185475			33744	protein-coding gene	gene with protein product							Standard	NM_199337		Approved		uc001nvd.4	Q7Z7N9	OTTHUMG00000167611	ENST00000333449.4:c.152C>T	11.37:g.62556550C>T	ENSP00000333697:p.Ser51Phe		Somatic					p.S51F	NM_199337	NP_955369	WXS	Illumina HiSeq	Unspecified	Q7Z7N9	T179B_HUMAN			2	182	+			51						Missense_Mutation	SNP	ENST00000333449.4	37	c.152C>T	CCDS8036.1	.	.	.	.	.	.	.	.	.	.	C	7.195	0.592343	0.13812	.	.	ENSG00000185475	ENST00000533861;ENST00000333449	.	.	.	6.0	-1.94	0.07571	.	0.929696	0.09275	N	0.824566	T	0.16300	0.0392	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.27088	-1.0084	9	0.19590	T	0.45	.	0.5912	0.00728	0.2529:0.3325:0.1232:0.2913	.	51	Q7Z7N9	T179B_HUMAN	F	51	.	ENSP00000333697:S51F	S	+	2	0	TMEM179B	62313126	0.000000	0.05858	0.717000	0.30585	0.930000	0.56654	-0.728000	0.04925	-0.064000	0.13043	0.556000	0.70494	TCC		0.567	TMEM179B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395362.2	NM_199337		13	116	0	0	0	0.001368	0	13	116				
STIP1	10963	broad.mit.edu	37	11	63971032	63971032	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:63971032G>C	ENST00000305218.4	+	13	1644	c.1497G>C	c.(1495-1497)atG>atC	p.M499I	STIP1_ENST00000538945.1_Missense_Mutation_p.M475I|STIP1_ENST00000358794.5_Missense_Mutation_p.M546I	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	499	STI1 2.				response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						AGCAGATCATGAGTGACCCAG	0.597																																							uc001nyk.1		NA																	0				ovary(2)|liver(1)	3						c.(1495-1497)ATG>ATC		stress-induced-phosphoprotein 1							63.0	48.0	53.0					11																	63971032		2201	4297	6498	SO:0001583	missense	10963				axon guidance|response to stress	Golgi apparatus|nucleus		g.chr11:63971032G>C	BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.1497G>C	11.37:g.63971032G>C	ENSP00000305958:p.Met499Ile		Somatic				STIP1_uc010rnb.1_Missense_Mutation_p.M475I	p.M499I	NM_006819	NP_006810	WXS	Illumina HiSeq	Unspecified	P31948	STIP1_HUMAN			13	1644	+			499			STI1 2.		B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	ENST00000305218.4	37	c.1497G>C	CCDS8058.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344789	0.61073	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945;ENST00000540887	T;T;T	0.15139	2.45;2.7;2.45	5.36	5.36	0.76844	Heat shock chaperonin-binding (1);	0.036897	0.85682	D	0.000000	T	0.19208	0.0461	L	0.42581	1.335	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.10450	0.005;0.002	T	0.01879	-1.1255	10	0.48119	T	0.1	-25.9146	18.2269	0.89920	0.0:0.0:1.0:0.0	.	475;499	F5H0T1;P31948	.;STIP1_HUMAN	I	546;499;475;98	ENSP00000351646:M546I;ENSP00000305958:M499I;ENSP00000445957:M475I	ENSP00000305958:M499I	M	+	3	0	STIP1	63727608	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.210000	0.77924	2.697000	0.92050	0.491000	0.48974	ATG		0.597	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	NM_006819		5	42	0	0	0	0.000602	0	5	42				
RBM4	5936	broad.mit.edu	37	11	66407528	66407528	+	Missense_Mutation	SNP	G	G	C	rs368114061		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:66407528G>C	ENST00000409406.1	+	1	1123	c.346G>C	c.(346-348)Gta>Cta	p.V116L	RBM4_ENST00000483858.1_Missense_Mutation_p.V116L|RBM4_ENST00000310092.7_Missense_Mutation_p.V116L|RBM4_ENST00000506523.2_Missense_Mutation_p.V116L|RBM4_ENST00000396053.4_Missense_Mutation_p.V116L|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000408993.2_Missense_Mutation_p.V116L|RBM4_ENST00000514361.3_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM4_ENST00000398692.4_Missense_Mutation_p.V116L|RBM4_ENST00000503028.2_Missense_Mutation_p.V116L|RBM4_ENST00000578778.1_Missense_Mutation_p.V116L|RBM4_ENST00000532968.1_Missense_Mutation_p.V116L|RBM4_ENST00000530235.1_Missense_Mutation_p.V116L			Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	116	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cap-independent translational initiation (GO:0002190)|cell differentiation (GO:0030154)|circadian regulation of translation (GO:0097167)|entrainment of circadian clock by photoperiod (GO:0043153)|IRES-dependent translational initiation (GO:0002192)|mRNA processing (GO:0006397)|negative regulation of translation (GO:0017148)|negative regulation of translation in response to stress (GO:0032055)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of nucleocytoplasmic transport (GO:0046822)|response to arsenic-containing substance (GO:0046685)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|stress-activated MAPK cascade (GO:0051403)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	miRNA binding (GO:0035198)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|pre-mRNA intronic pyrimidine-rich binding (GO:0097158)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		TTATGCCTTCGTACACATGGA	0.527																																							uc009yrj.2		NA																	0				ovary(1)	1						c.(346-348)GTA>CTA		RNA binding motif protein 4							126.0	113.0	117.0					11																	66407528		2200	4292	6492	SO:0001583	missense	5936				circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding	g.chr11:66407528G>C	U89505	CCDS41676.1, CCDS55776.1, CCDS55777.1	11q13	2013-02-12			ENSG00000173933	ENSG00000173933		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	9901	protein-coding gene	gene with protein product		602571				9169144, 16260624	Standard	NM_002896		Approved	LARK, RBM4A, ZCRB3A, ZCCHC21		Q9BWF3	OTTHUMG00000154171	ENST00000409406.1:c.346G>C	11.37:g.66407528G>C	ENSP00000386894:p.Val116Leu		Somatic				RBM4_uc009yrk.2_Intron|RBM4_uc001oiv.2_Missense_Mutation_p.V116L|RBM4_uc001oiw.1_Missense_Mutation_p.V116L|RBM4_uc001oix.1_Missense_Mutation_p.V116L|RBM4_uc010rpj.1_Missense_Mutation_p.V116L|RBM4_uc001oiy.1_Missense_Mutation_p.V116L|RBM4_uc001oiz.1_Missense_Mutation_p.V116L	p.V116L	NM_002896	NP_002887	WXS	Illumina HiSeq	Unspecified	Q9BWF3	RBM4_HUMAN		Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)	2	834	+			116			RRM 2.		B3KUN0|B4E1U0|E7EQS3|O02916|Q4VC48|Q6P1P2|Q8WU85	Missense_Mutation	SNP	ENST00000409406.1	37	c.346G>C	CCDS41676.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.906720	0.92107	.	.	ENSG00000248643;ENSG00000248643;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933;ENSG00000173933	ENST00000503028;ENST00000514361;ENST00000310092;ENST00000396053;ENST00000408993;ENST00000483858;ENST00000398692;ENST00000510173;ENST00000506523;ENST00000530235;ENST00000532968;ENST00000409406	D;D;D;D;D;D;D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99	4.95	4.95	0.65309	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	U	0.000001	D	0.91372	0.7278	.	.	.	0.80722	D	1	P;P;D;D	0.57257	0.928;0.926;0.979;0.966	P;P;P;P	0.62435	0.746;0.902;0.866;0.733	D	0.92502	0.6009	9	0.87932	D	0	-4.7613	16.141	0.81522	0.0:0.0:1.0:0.0	.	116;116;116;116	E7EQS3;Q9BWF3-3;Q9BWF3;Q9BWF3-2	.;.;RBM4_HUMAN;.	L	116	ENSP00000425760:V116L;ENSP00000309166:V116L;ENSP00000413497:V116L;ENSP00000386561:V116L;ENSP00000435821:V116L;ENSP00000381680:V116L;ENSP00000422301:V116L;ENSP00000423572:V116L;ENSP00000432150:V116L;ENSP00000432020:V116L;ENSP00000386894:V116L	ENSP00000425760:V116L	V	+	1	0	RBM4;RBM14-RBM4	66164104	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.819000	0.86621	2.485000	0.83878	0.650000	0.86243	GTA		0.527	RBM4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334212.1	NM_002896		12	109	0	0	0	0.00245	0	12	109				
NUMA1	4926	broad.mit.edu	37	11	71717294	71717294	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:71717294C>G	ENST00000393695.3	-	22	5810	c.5479G>C	c.(5479-5481)Gag>Cag	p.E1827Q	NUMA1_ENST00000351960.6_Missense_Mutation_p.E691Q|NUMA1_ENST00000358965.6_Missense_Mutation_p.E1813Q	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CTGTCTGGCTCTTCCACATCT	0.562			T	RARA	APL																																		uc001orl.1		NA		Dom	yes		11	11q13	4926	T	nuclear mitotic apparatus protein 1			L	RARA		APL		0				ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						c.(5479-5481)GAG>CAG		nuclear mitotic apparatus protein 1							73.0	63.0	67.0					11																	71717294		2200	4293	6493	SO:0001583	missense	4926				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity	g.chr11:71717294C>G	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.5479G>C	11.37:g.71717294C>G	ENSP00000377298:p.Glu1827Gln		Somatic				NUMA1_uc001orj.2_Missense_Mutation_p.E9Q|NUMA1_uc009ysw.1_Missense_Mutation_p.E1394Q|NUMA1_uc001ork.1_Missense_Mutation_p.E691Q|NUMA1_uc001orm.1_Missense_Mutation_p.E1813Q	p.E1827Q	NM_006185	NP_006176	WXS	Illumina HiSeq	Unspecified	Q14980	NUMA1_HUMAN			22	5651	-			1827						Missense_Mutation	SNP	ENST00000393695.3	37	c.5479G>C	CCDS31633.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.76|19.76	3.887525|3.887525	0.72410|0.72410	.|.	.|.	ENSG00000137497|ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544|ENST00000541584	T;T;T|.	0.41758|.	2.05;0.99;2.52|.	5.21|5.21	4.3|4.3	0.51218|0.51218	.|.	0.104359|.	0.42682|.	D|.	0.000662|.	T|T	0.47451|0.47451	0.1446|0.1446	L|L	0.29908|0.29908	0.895|0.895	0.34150|0.34150	D|D	0.667409|0.667409	P;B;P;D|.	0.53462|.	0.785;0.358;0.785;0.96|.	B;B;B;P|.	0.53185|.	0.295;0.221;0.295;0.72|.	T|T	0.57849|0.57849	-0.7740|-0.7740	10|5	0.72032|.	D|.	0.01|.	.|.	12.9532|12.9532	0.58413|0.58413	0.0:0.9207:0.0:0.0793|0.0:0.9207:0.0:0.0793	.|.	1833;1813;1827;691|.	Q4LE64;Q14980-2;Q14980;Q9BTE9|.	.;.;NUMA1_HUMAN;.|.	Q|N	691;1813;1827;1376;800|675	ENSP00000260051:E691Q;ENSP00000351851:E1813Q;ENSP00000377298:E1827Q|.	ENSP00000260051:E691Q|.	E|K	-|-	1|3	0|2	NUMA1|NUMA1	71394942|71394942	0.998000|0.998000	0.40836|0.40836	0.993000|0.993000	0.49108|0.49108	0.987000|0.987000	0.75469|0.75469	3.009000|3.009000	0.49552|0.49552	1.420000|1.420000	0.47138|0.47138	0.655000|0.655000	0.94253|0.94253	GAG|AAG		0.562	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1			5	45	0	0	0	0.000602	0	5	45				
GRM5	2915	broad.mit.edu	37	11	88780521	88780521	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:88780521C>T	ENST00000305447.4	-	1	669	c.520G>A	c.(520-522)Gca>Aca	p.A174T	GRM5_ENST00000418177.2_Missense_Mutation_p.A174T|GRM5_ENST00000393297.1_Missense_Mutation_p.A174T|GRM5_ENST00000393294.3_Missense_Mutation_p.A174T|GRM5_ENST00000305432.5_Missense_Mutation_p.A174T|GRM5_ENST00000455756.2_Missense_Mutation_p.A174T	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	174	Glutamate binding.				activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ATGCTGGTTGCTGAGTAAGCA	0.488																																							uc001pcq.2		NA																	0				central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(520-522)GCA>ACA		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						74.0	64.0	68.0					11																	88780521		2201	4299	6500	SO:0001583	missense	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88780521C>T	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.520G>A	11.37:g.88780521C>T	ENSP00000306138:p.Ala174Thr		Somatic				GRM5_uc009yvm.2_Missense_Mutation_p.A174T|GRM5_uc009yvn.1_Missense_Mutation_p.A174T	p.A174T	NM_001143831	NP_001137303	WXS	Illumina HiSeq	Unspecified	P41594	GRM5_HUMAN			1	720	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	174			Extracellular (Potential).		Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	c.520G>A	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515141	0.85389	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297;ENST00000393294	D;D;D;D;D;D	0.85556	-2.0;-2.0;-2.0;-2.0;-2.0;-2.0	5.4	5.4	0.78164	GPCR, family 3, conserved site (1);Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91408	0.7289	M	0.62154	1.92	0.80722	D	1	P;D;D	0.89917	0.919;1.0;0.999	P;D;D	0.85130	0.625;0.976;0.997	D	0.90467	0.4450	9	.	.	.	.	19.1788	0.93614	0.0:1.0:0.0:0.0	.	174;174;174	A8MT20;P41594-2;P41594	.;.;GRM5_HUMAN	T	174	ENSP00000402912:A174T;ENSP00000405690:A174T;ENSP00000305905:A174T;ENSP00000306138:A174T;ENSP00000376975:A174T;ENSP00000376972:A174T	.	A	-	1	0	GRM5	88420169	1.000000	0.71417	0.994000	0.49952	0.936000	0.57629	5.796000	0.69080	2.514000	0.84764	0.563000	0.77884	GCA		0.488	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		7	63	0	0	0	0.001984	0	7	63				
TMEM133	83935	broad.mit.edu	37	11	100863119	100863119	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:100863119G>T	ENST00000303130.2	+	1	309	c.80G>T	c.(79-81)tGt>tTt	p.C27F		NM_032021.2	NP_114410.1	Q9H2Q1	TM133_HUMAN	transmembrane protein 133	27						integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)|lung(1)|prostate(1)	5		Acute lymphoblastic leukemia(157;0.000869)|all_hematologic(158;0.014)		BRCA - Breast invasive adenocarcinoma(274;0.0675)		CTTGACTATTGTCCAGAAGTT	0.438																																							uc001pgf.2		NA																	0					0						c.(79-81)TGT>TTT		transmembrane protein 133							103.0	98.0	99.0					11																	100863119		2203	4300	6503	SO:0001583	missense	83935					integral to membrane		g.chr11:100863119G>T	AF247167	CCDS8309.1	11q22.1	2006-03-09				ENSG00000170647			24033	protein-coding gene	gene with protein product						12477932	Standard	NM_032021		Approved	AD031	uc001pgf.3	Q9H2Q1		ENST00000303130.2:c.80G>T	11.37:g.100863119G>T	ENSP00000303999:p.Cys27Phe		Somatic					p.C27F	NM_032021	NP_114410	WXS	Illumina HiSeq	Unspecified	Q9H2Q1	TM133_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0675)	1	309	+		Acute lymphoblastic leukemia(157;0.000869)|all_hematologic(158;0.014)	27						Missense_Mutation	SNP	ENST00000303130.2	37	c.80G>T	CCDS8309.1	.	.	.	.	.	.	.	.	.	.	G	4.446	0.082510	0.08533	.	.	ENSG00000170647	ENST00000303130	.	.	.	3.84	0.722	0.18225	.	.	.	.	.	T	0.25754	0.0627	N	0.08118	0	0.09310	N	1	D	0.57571	0.98	P	0.59825	0.864	T	0.12142	-1.0559	8	0.87932	D	0	.	5.2169	0.15348	0.47:0.0:0.53:0.0	.	27	Q9H2Q1	TM133_HUMAN	F	27	.	ENSP00000303999:C27F	C	+	2	0	TMEM133	100368329	0.003000	0.15002	0.055000	0.19348	0.054000	0.15201	0.195000	0.17155	0.151000	0.19162	0.655000	0.94253	TGT		0.438	TMEM133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395137.1	NM_032021		23	77	1	0	3.5997e-14	0.002299	5.59671e-14	23	77				
APOA4	337	broad.mit.edu	37	11	116693391	116693391	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:116693391G>A	ENST00000357780.3	-	2	274	c.160C>T	c.(160-162)Ctc>Ttc	p.L54F		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	54	13 X 22 AA approximate tandem repeats.				cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		TGCTGGGTGAGTTCAGATTTC	0.532																																							uc001pps.1		NA																	0					0						c.(160-162)CTC>TTC		apolipoprotein A-IV precursor							262.0	231.0	241.0					11																	116693391		2201	4296	6497	SO:0001583	missense	337							g.chr11:116693391G>A		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.160C>T	11.37:g.116693391G>A	ENSP00000350425:p.Leu54Phe		Somatic					p.L54F	NM_000482	NP_000473	WXS	Illumina HiSeq	Unspecified				BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)	2	264	-	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)						A8MSL6|Q14CW8|Q6Q787	Missense_Mutation	SNP	ENST00000357780.3	37	c.160C>T	CCDS31681.1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043266	0.36085	.	.	ENSG00000110244	ENST00000357780	T	0.78126	-1.15	5.0	0.452	0.16634	Apolipoprotein/apolipophorin (1);	0.501198	0.16463	N	0.213342	T	0.70193	0.3196	M	0.78049	2.395	0.22541	N	0.999004	B	0.32939	0.391	B	0.29598	0.104	T	0.64145	-0.6476	10	0.66056	D	0.02	-10.7642	2.6113	0.04892	0.0891:0.2388:0.285:0.3872	.	54	P06727	APOA4_HUMAN	F	54	ENSP00000350425:L54F	ENSP00000350425:L54F	L	-	1	0	APOA4	116198601	0.309000	0.24518	0.755000	0.31263	0.998000	0.95712	0.466000	0.22019	0.233000	0.21120	0.655000	0.94253	CTC		0.532	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106279.2	NM_000482		28	287	0	0	0	0.008361	0	28	287				
ARHGEF12	23365	broad.mit.edu	37	11	120291464	120291464	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:120291464C>G	ENST00000397843.2	+	5	368	c.202C>G	c.(202-204)Ctt>Gtt	p.L68V	ARHGEF12_ENST00000532993.1_5'UTR|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.L49V	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	68					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TTGTGCAGGTCTTGTTCAGCG	0.403			T	MLL	AML																																		uc001pxl.1		NA		Dom	yes		11	11q23.3	23365	T	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)			L	MLL		AML		0				lung(2)|breast(2)|skin(2)|ovary(1)	7						c.(202-204)CTT>GTT		Rho guanine nucleotide exchange factor (GEF) 12							91.0	84.0	86.0					11																	120291464		1998	4179	6177	SO:0001583	missense	23365				apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr11:120291464C>G	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.202C>G	11.37:g.120291464C>G	ENSP00000380942:p.Leu68Val		Somatic				ARHGEF12_uc009zat.2_Missense_Mutation_p.L49V|ARHGEF12_uc010rzn.1_5'UTR|ARHGEF12_uc009zau.1_5'UTR	p.L68V	NM_015313	NP_056128	WXS	Illumina HiSeq	Unspecified	Q9NZN5	ARHGC_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)	5	209	+		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)	68					O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	c.202C>G	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.330817	0.81690	.	.	ENSG00000196914	ENST00000397843;ENST00000356641	T;T	0.69040	-0.37;1.54	5.66	5.66	0.87406	PDZ/DHR/GLGF (1);	0.000000	0.42964	D	0.000635	T	0.78997	0.4372	M	0.61703	1.905	0.58432	D	0.999992	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.998	T	0.79955	-0.1585	10	0.87932	D	0	-15.3342	13.331	0.60488	0.0:0.9276:0.0:0.0724	.	49;68	Q9NZN5-2;Q9NZN5	.;ARHGC_HUMAN	V	68;49	ENSP00000380942:L68V;ENSP00000349056:L49V	ENSP00000349056:L49V	L	+	1	0	ARHGEF12	119796674	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.621000	0.61233	2.830000	0.97506	0.585000	0.79938	CTT		0.403	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313		4	34	0	0	0	0.000248	0	4	34				
HEPN1	641654	broad.mit.edu	37	11	124789818	124789818	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:124789818G>C	ENST00000408930.5	+	1	673	c.172G>C	c.(172-174)Gat>Cat	p.D58H	HEPACAM_ENST00000298251.4_3'UTR	NM_001037558.2	NP_001032647.2	Q6WQI6	HEPN1_HUMAN	hepatocellular carcinoma, down-regulated 1	58						cytoplasm (GO:0005737)				large_intestine(1)|lung(1)|stomach(1)	3	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0287)		TCACACAGTAGATTACTGCCA	0.493																																							uc001qbj.1		NA																	0					0						c.(172-174)GAT>CAT		HEPACAM opposite strand 1							84.0	86.0	85.0					11																	124789818		1920	4142	6062	SO:0001583	missense	641654					cytoplasm		g.chr11:124789818G>C	BC148521	CCDS41729.1	11q24	2013-07-02	2011-02-11		ENSG00000221932	ENSG00000221932			34400	protein-coding gene	gene with protein product	"""cancer susceptibility gene HEPN1"""	611641	"""HEPACAM opposite strand 1"""			12971969, 23548416	Standard	NM_001037558		Approved		uc001qbj.1	Q6WQI6	OTTHUMG00000165939	ENST00000408930.5:c.172G>C	11.37:g.124789818G>C	ENSP00000386143:p.Asp58His		Somatic				HEPACAM_uc009zbj.2_3'UTR|HEPACAM_uc001qbk.2_3'UTR	p.D58H	NM_001037558	NP_001032647	WXS	Illumina HiSeq	Unspecified	Q6WQI6	HEPN1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0287)	1	673	+	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	58						Missense_Mutation	SNP	ENST00000408930.5	37	c.172G>C	CCDS41729.1	.	.	.	.	.	.	.	.	.	.	G	8.710	0.911892	0.17907	.	.	ENSG00000221932	ENST00000408930	T	0.57436	0.4	3.34	-0.159	0.13379	.	.	.	.	.	T	0.45034	0.1322	.	.	.	0.09310	N	1	P	0.45126	0.851	B	0.44224	0.444	T	0.36286	-0.9754	8	0.87932	D	0	.	5.7432	0.18106	0.0:0.3938:0.3814:0.2248	.	58	Q6WQI6	HEPN1_HUMAN	H	58	ENSP00000386143:D58H	ENSP00000386143:D58H	D	+	1	0	HEPN1	124295028	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.480000	0.22244	-0.136000	0.11475	0.467000	0.42956	GAT		0.493	HEPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387129.1	NM_001037558		7	82	0	0	0	0.001984	0	7	82				
KIRREL3	84623	broad.mit.edu	37	11	126306811	126306811	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:126306811G>C	ENST00000525144.2	-	12	1696	c.1447C>G	c.(1447-1449)Ctg>Gtg	p.L483V	KIRREL3_ENST00000525704.2_Missense_Mutation_p.L483V|KIRREL3_ENST00000529097.2_Missense_Mutation_p.L483V|KIRREL3_ENST00000416561.2_5'UTR	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	483	Ig-like C2-type 5.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CTGATGGTCAGGGTGGAGATG	0.617																																							uc001qea.2		NA																	0				ovary(3)	3						c.(1447-1449)CTG>GTG		kin of IRRE like 3 isoform 1							112.0	124.0	120.0					11																	126306811		2197	4297	6494	SO:0001583	missense	84623				hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding	g.chr11:126306811G>C	AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.1447C>G	11.37:g.126306811G>C	ENSP00000435466:p.Leu483Val		Somatic				KIRREL3_uc001qeb.2_Missense_Mutation_p.L483V|KIRREL3_uc001qec.1_Missense_Mutation_p.L483V|ST3GAL4_uc001qdx.1_Intron	p.L483V	NM_032531	NP_115920	WXS	Illumina HiSeq	Unspecified	Q8IZU9	KIRR3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)	12	1808	-	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)	483			Extracellular (Potential).|Ig-like C2-type 5.		Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	37	c.1447C>G	CCDS53723.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249346	0.39797	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	T;T;T	0.53857	0.6;0.6;0.6	4.05	2.04	0.26737	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.213152	0.31734	N	0.007149	T	0.54398	0.1856	M	0.88906	2.99	0.80722	D	1	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.23275	0.002;0.0;0.045	T	0.52823	-0.8524	10	0.87932	D	0	-6.5849	4.7598	0.13102	0.2719:0.1609:0.5671:0.0	.	483;483;483	Q8IZU9-2;E9PRX9;Q8IZU9	.;.;KIRR3_HUMAN	V	483	ENSP00000435466:L483V;ENSP00000434081:L483V;ENSP00000435094:L483V	ENSP00000435466:L483V	L	-	1	2	KIRREL3	125812021	1.000000	0.71417	0.771000	0.31576	0.986000	0.74619	4.873000	0.63057	0.157000	0.19338	0.407000	0.27541	CTG		0.617	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531		4	33	0	0	0	0.000248	0	4	33				
ERC1	23085	broad.mit.edu	37	12	1221420	1221420	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:1221420C>G	ENST00000397203.2	+	6	1763	c.1357C>G	c.(1357-1359)Caa>Gaa	p.Q453E	ERC1_ENST00000589028.1_Missense_Mutation_p.Q453E|ERC1_ENST00000360905.4_Missense_Mutation_p.Q453E|ERC1_ENST00000536573.2_3'UTR|ERC1_ENST00000546231.2_Missense_Mutation_p.Q453E|ERC1_ENST00000355446.5_Missense_Mutation_p.Q453E|ERC1_ENST00000543086.3_Intron			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	453					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			GAAAGAGGCTCAATGGGAGGA	0.458																																							uc001qjb.2		NA																	0				ovary(2)|lung(2)|breast(1)	5						c.(1357-1359)CAA>GAA		RAB6-interacting protein 2 isoform epsilon							181.0	175.0	177.0					12																	1221420		2203	4300	6503	SO:0001583	missense	23085				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding	g.chr12:1221420C>G	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.1357C>G	12.37:g.1221420C>G	ENSP00000380386:p.Gln453Glu		Somatic				ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Missense_Mutation_p.Q453E|ERC1_uc010sdv.1_Intron|ERC1_uc009zdp.2_Missense_Mutation_p.Q90E	p.Q453E	NM_178040	NP_829884	WXS	Illumina HiSeq	Unspecified	Q8IUD2	RB6I2_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)		6	1598	+	all_epithelial(11;0.0698)|Ovarian(42;0.107)		453			Potential.		A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	37	c.1357C>G	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.540262	0.27563	.	.	ENSG00000082805	ENST00000397203;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000536573	T;T;T;T	0.76316	-1.01;2.09;-1.01;-1.01	5.38	5.38	0.77491	.	0.300499	0.33382	N	0.004961	T	0.65217	0.2670	N	0.25647	0.755	0.32671	N	0.516751	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.59584	-0.7427	10	0.02654	T	1	-16.3021	19.1248	0.93378	0.0:1.0:0.0:0.0	.	90;453	F5GZU8;Q8IUD2	.;RB6I2_HUMAN	E	453;453;453;453;90	ENSP00000380386:Q453E;ENSP00000442739:Q453E;ENSP00000347621:Q453E;ENSP00000354158:Q453E	ENSP00000347621:Q453E	Q	+	1	0	ERC1	1091681	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.532000	0.60608	2.535000	0.85469	0.585000	0.79938	CAA		0.458	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064		12	124	0	0	0	0.00245	0	12	124				
GSG1	83445	broad.mit.edu	37	12	13240941	13240941	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:13240941G>A	ENST00000396302.3	-	4	748	c.550C>T	c.(550-552)Cat>Tat	p.H184Y	GSG1_ENST00000351606.6_Missense_Mutation_p.H220Y|GSG1_ENST00000337630.6_Silent_p.F142F|GSG1_ENST00000432710.2_Silent_p.F155F|GSG1_ENST00000324458.8_Silent_p.F178F|GSG1_ENST00000537302.1_Intron|GSG1_ENST00000396310.2_Intron|GSG1_ENST00000457134.2_Intron	NM_031289.3	NP_112579.2	Q2KHT4	GSG1_HUMAN	germ cell associated 1	0						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(1)	10		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		GGAAGCTGATGAATTGAAGTC	0.512																																							uc001rbn.2		NA																	0					0						c.(532-534)TTC>TTT		germ cell associated 1 isoform 4							147.0	143.0	144.0					12																	13240941		2203	4300	6503	SO:0001583	missense	83445					endoplasmic reticulum membrane|integral to membrane		g.chr12:13240941G>A	BC001796	CCDS8659.2, CCDS44835.1, CCDS44836.1, CCDS55806.1, CCDS55807.1, CCDS55808.1	12p13.31	2007-12-03			ENSG00000111305	ENSG00000111305			19716	protein-coding gene	gene with protein product							Standard	NM_031289		Approved	MGC3146	uc001rbn.3	Q2KHT4	OTTHUMG00000150148	ENST00000396302.3:c.550C>T	12.37:g.13240941G>A	ENSP00000379596:p.His184Tyr		Somatic				GSG1_uc001rbj.2_Silent_p.F142F|GSG1_uc001rbk.2_Missense_Mutation_p.H184Y|GSG1_uc001rbl.2_Intron|GSG1_uc001rbm.2_Intron|GSG1_uc001rbo.2_Missense_Mutation_p.H220Y|GSG1_uc001rbp.2_Silent_p.F155F|GSG1_uc001rbq.1_Missense_Mutation_p.H220Y	p.F178F	NM_001080555	NP_001074024	WXS	Illumina HiSeq	Unspecified	Q2KHT4	GSG1_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.15)	5	707	-		Prostate(47;0.183)	165			Helical; (Potential).		Q8N4M3|Q8NBR4|Q8NBS0|Q8NBT1|Q96LP9|Q96SI6|Q9BUY4	Silent	SNP	ENST00000396302.3	37	c.534C>T	CCDS8659.2	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810599	0.50421	.	.	ENSG00000111305	ENST00000396302;ENST00000351606;ENST00000405543;ENST00000545401	T;T;T	0.35605	1.52;1.3;1.56	5.73	4.79	0.61399	.	.	.	.	.	T	0.47248	0.1435	.	.	.	0.80722	D	1	D;D;P	0.59767	0.986;0.969;0.947	P;P;P	0.51016	0.656;0.656;0.454	T	0.50693	-0.8798	8	0.72032	D	0.01	.	15.2591	0.73606	0.0:0.3228:0.6772:0.0	.	220;220;184	Q2KHT4-7;G3XAB9;F1T0A0	.;.;.	Y	184;220;181;197	ENSP00000379596:H184Y;ENSP00000336857:H220Y;ENSP00000445884:H197Y	ENSP00000336857:H220Y	H	-	1	0	GSG1	13132208	1.000000	0.71417	0.766000	0.31476	0.993000	0.82548	3.185000	0.50934	2.708000	0.92522	0.655000	0.94253	CAT		0.512	GSG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316545.1	NM_031289		16	113	0	0	0	0.006122	0	16	113				
CASC1	55259	broad.mit.edu	37	12	25272230	25272230	+	Silent	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:25272230G>C	ENST00000320267.9	-	11	1308	c.1227C>G	c.(1225-1227)ctC>ctG	p.L409L	CASC1_ENST00000557684.1_5'UTR|CASC1_ENST00000537577.1_Silent_p.L297L|CASC1_ENST00000395987.3_Silent_p.L415L|CASC1_ENST00000354189.5_Silent_p.L473L|CASC1_ENST00000545133.1_Silent_p.L350L|CASC1_ENST00000395990.2_Silent_p.L369L	NM_001082973.1	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1	409										breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(3)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			ATCCTTCTTTGAGTATCTTTT	0.323																																							uc001rgl.2		NA																	0				ovary(2)	2						c.(1225-1227)CTC>CTG		cancer susceptibility candidate 1 isoform b							94.0	89.0	90.0					12																	25272230		2203	4298	6501	SO:0001819	synonymous_variant	55259							g.chr12:25272230G>C	AK093102	CCDS31759.2, CCDS41762.1, CCDS41763.1, CCDS55810.1, CCDS55811.1	12p12.1	2012-04-17			ENSG00000118307	ENSG00000118307		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 54"""					14583591	Standard	NM_018272		Approved	LAS1, FLJ10921, PPP1R54	uc001rgk.3	Q6TDU7	OTTHUMG00000150195	ENST00000320267.9:c.1227C>G	12.37:g.25272230G>C			Somatic				CASC1_uc001rgk.2_Silent_p.L415L|CASC1_uc001rgm.3_Silent_p.L473L|CASC1_uc001rgj.2_Silent_p.L369L|CASC1_uc010sje.1_Silent_p.L350L|CASC1_uc010sjf.1_Silent_p.L297L|CASC1_uc010sjg.1_Silent_p.L409L	p.L409L	NM_001082973	NP_001076442	WXS	Illumina HiSeq	Unspecified	Q6TDU7	CASC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)		11	1309	-	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		409					B4DNP2|F5H6T6|Q17RL2|Q4G171|Q5U5K5|Q9NV50	Silent	SNP	ENST00000320267.9	37	c.1227C>G	CCDS41762.1	.	.	.	.	.	.	.	.	.	.	G	7.561	0.664710	0.14710	.	.	ENSG00000118307	ENST00000556006	.	.	.	4.62	2.7	0.31948	.	.	.	.	.	T	0.56046	0.1959	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51301	-0.8723	4	.	.	.	-2.0597	7.6749	0.28480	0.0921:0.1644:0.7435:0.0	.	.	.	.	E	246	.	.	Q	-	1	0	CASC1	25163497	0.549000	0.26481	1.000000	0.80357	0.991000	0.79684	0.439000	0.21575	1.138000	0.42230	0.655000	0.94253	CAA		0.323	CASC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316761.1	NM_018272		5	71	0	0	0	0.000602	0	5	71				
AAAS	8086	broad.mit.edu	37	12	53709147	53709147	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:53709147A>G	ENST00000209873.4	-	4	536	c.371T>C	c.(370-372)cTc>cCc	p.L124P	AAAS_ENST00000549983.1_5'UTR|AAAS_ENST00000394384.3_Missense_Mutation_p.L124P|AAAS_ENST00000550286.1_Intron	NM_015665.5	NP_056480.1	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency, alacrimia	124					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nucleocytoplasmic transport (GO:0006913)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of nucleocytoplasmic transport (GO:0046822)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	20						GGACCCATGGAGGGAAGAGGC	0.562																																							uc001scr.3		NA																	0				ovary(1)	1						c.(370-372)CTC>CCC		achalasia, adrenocortical insufficiency,							57.0	54.0	55.0					12																	53709147		2203	4300	6503	SO:0001583	missense	8086				carbohydrate metabolic process|glucose transport|nucleocytoplasmic transport|regulation of glucose transport|regulation of nucleocytoplasmic transport|transmembrane transport|viral reproduction	nuclear pore		g.chr12:53709147A>G	AJ289841	CCDS8856.1, CCDS53797.1	12q13	2013-06-27	2010-06-24		ENSG00000094914	ENSG00000094914		"""WD repeat domain containing"""	13666	protein-coding gene	gene with protein product	"""aladin"", ""Allgrove, triple-A"""	605378	"""achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)"""			11062474	Standard	NM_015665		Approved		uc001scr.4	Q9NRG9	OTTHUMG00000169729	ENST00000209873.4:c.371T>C	12.37:g.53709147A>G	ENSP00000209873:p.Leu124Pro		Somatic				AAAS_uc001scs.3_Missense_Mutation_p.L124P	p.L124P	NM_015665	NP_056480	WXS	Illumina HiSeq	Unspecified	Q9NRG9	AAAS_HUMAN			4	534	-			124					Q5JB47|Q9NWI6|Q9UG19	Missense_Mutation	SNP	ENST00000209873.4	37	c.371T>C	CCDS8856.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.359726	0.82353	.	.	ENSG00000094914	ENST00000209873;ENST00000394384;ENST00000547757;ENST00000552161	D;D;T	0.85013	-1.9;-1.93;-1.26	4.74	4.74	0.60224	.	0.215825	0.43110	D	0.000611	D	0.87553	0.6206	L	0.40543	1.245	0.80722	D	1	D;D	0.69078	0.971;0.997	P;D	0.65573	0.641;0.936	D	0.87914	0.2699	10	0.54805	T	0.06	-8.3157	12.5212	0.56060	1.0:0.0:0.0:0.0	.	124;124	Q5JB47;Q9NRG9	.;AAAS_HUMAN	P	124	ENSP00000209873:L124P;ENSP00000377908:L124P;ENSP00000448020:L124P	ENSP00000209873:L124P	L	-	2	0	AAAS	51995414	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	6.136000	0.71703	2.138000	0.66242	0.523000	0.50628	CTC		0.562	AAAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405632.1			4	25	0	0	0	0.001168	0	4	25				
OR6C6	283365	broad.mit.edu	37	12	55688558	55688558	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:55688558G>A	ENST00000358433.2	-	1	458	c.459C>T	c.(457-459)atC>atT	p.I153I		NM_001005493.1	NP_001005493.1	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C, member 6	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GGGGAAATATGATTAAGAATC	0.418																																							uc010sph.1		NA																	0				large_intestine(1)|skin(1)	2						c.(457-459)ATC>ATT		olfactory receptor, family 6, subfamily C,							82.0	77.0	79.0					12																	55688558		2203	4300	6503	SO:0001819	synonymous_variant	283365				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55688558G>A		CCDS31817.1	12q13.13	2012-08-09			ENSG00000188324	ENSG00000188324		"""GPCR / Class A : Olfactory receptors"""	31293	protein-coding gene	gene with protein product							Standard	NM_001005493		Approved		uc010sph.2	A6NF89	OTTHUMG00000168101	ENST00000358433.2:c.459C>T	12.37:g.55688558G>A			Somatic					p.I153I	NM_001005493	NP_001005493	WXS	Illumina HiSeq	Unspecified	A6NF89	OR6C6_HUMAN			1	459	-			153			Helical; Name=4; (Potential).			Silent	SNP	ENST00000358433.2	37	c.459C>T	CCDS31817.1																																																																																				0.418	OR6C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398151.1			6	46	0	0	0	0.001168	0	6	46				
ATP5B	506	broad.mit.edu	37	12	57032983	57032983	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:57032983G>C	ENST00000262030.3	-	9	1446	c.1396C>G	c.(1396-1398)Cag>Gag	p.Q466E	BAZ2A_ENST00000179765.5_5'Flank|BAZ2A_ENST00000551812.1_5'Flank|ATP5B_ENST00000550162.1_5'Flank|ATP5B_ENST00000552919.1_Missense_Mutation_p.Q455E|BAZ2A_ENST00000379441.3_5'Flank	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	466					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGGAATGGCTGAGACAAGAAA	0.498																																							uc001slr.2		NA																	0				ovary(1)	1						c.(1396-1398)CAG>GAG		mitochondrial ATP synthase beta subunit							159.0	147.0	151.0					12																	57032983		2203	4300	6503	SO:0001583	missense	506				angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism	g.chr12:57032983G>C	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1396C>G	12.37:g.57032983G>C	ENSP00000262030:p.Gln466Glu		Somatic				BAZ2A_uc001slq.1_5'Flank|BAZ2A_uc010sqr.1_5'Flank	p.Q466E	NM_001686	NP_001677	WXS	Illumina HiSeq	Unspecified	P06576	ATPB_HUMAN			9	1501	-			466					A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	37	c.1396C>G	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037948	0.93630	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000552104;ENST00000551020	D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32	5.76	5.76	0.90799	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);ATPase, F1 complex beta subunit/V1 complex, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98009	0.9344	H	0.99740	4.74	0.80722	D	1	P	0.43826	0.818	P	0.51806	0.68	D	0.99029	1.0820	10	0.87932	D	0	-3.4757	18.8155	0.92075	0.0:0.0:1.0:0.0	.	466	P06576	ATPB_HUMAN	E	466;455;169;281	ENSP00000262030:Q466E;ENSP00000450297:Q455E;ENSP00000450233:Q169E;ENSP00000446677:Q281E	ENSP00000262030:Q466E	Q	-	1	0	ATP5B	55319250	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.654000	0.98509	2.747000	0.94245	0.644000	0.83932	CAG		0.498	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686		15	156	0	0	0	0.003163	0	15	156				
ATP5B	506	broad.mit.edu	37	12	57036523	57036523	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:57036523G>A	ENST00000262030.3	-	6	935	c.885C>T	c.(883-885)gaC>gaT	p.D295D	SNORD59A_ENST00000384304.1_RNA|ATP5B_ENST00000550162.1_5'UTR|ATP5B_ENST00000552919.1_Silent_p.D295D	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	295					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GACCTTCTTGGTCTCTGAAGT	0.498																																							uc001slr.2		NA																	0				ovary(1)	1						c.(883-885)GAC>GAT		mitochondrial ATP synthase beta subunit							87.0	82.0	84.0					12																	57036523		2203	4300	6503	SO:0001819	synonymous_variant	506				angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism	g.chr12:57036523G>A	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.885C>T	12.37:g.57036523G>A			Somatic					p.D295D	NM_001686	NP_001677	WXS	Illumina HiSeq	Unspecified	P06576	ATPB_HUMAN			6	990	-			295					A8K4X0|Q14283	Silent	SNP	ENST00000262030.3	37	c.885C>T	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	G	8.851	0.944572	0.18356	.	.	ENSG00000110955	ENST00000552959	.	.	.	6.17	4.34	0.51931	.	.	.	.	.	T	0.60457	0.2270	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58869	-0.7560	4	.	.	.	-18.1387	10.1415	0.42738	0.2103:0.0:0.7897:0.0	.	.	.	.	S	232	.	.	P	-	1	0	ATP5B	55322790	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.487000	0.35540	1.626000	0.50381	0.655000	0.94253	CCA		0.498	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686		11	84	0	0	0	0.008291	0	11	84				
BEST3	144453	broad.mit.edu	37	12	70049076	70049076	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:70049076C>T	ENST00000330891.5	-	10	1844	c.1618G>A	c.(1618-1620)Gag>Aag	p.E540K	BEST3_ENST00000331471.4_Intron|BEST3_ENST00000553096.1_Missense_Mutation_p.E434K|BEST3_ENST00000488961.1_Missense_Mutation_p.E327K	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	540					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			TGCTGCTGCTCAGTCTTGCTT	0.597																																							uc001svg.2		NA																	0					0						c.(1618-1620)GAG>AAG		vitelliform macular dystrophy 2-like 3 isoform							85.0	84.0	85.0					12																	70049076		2016	4181	6197	SO:0001583	missense	144453					chloride channel complex|plasma membrane	chloride channel activity	g.chr12:70049076C>T	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1618G>A	12.37:g.70049076C>T	ENSP00000332413:p.Glu540Lys		Somatic				BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.E327K|BEST3_uc010stm.1_Missense_Mutation_p.E434K	p.E540K	NM_032735	NP_116124	WXS	Illumina HiSeq	Unspecified	Q8N1M1	BEST3_HUMAN	Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)		10	1845	-	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		540			Cytoplasmic (Potential).		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	37	c.1618G>A	CCDS8992.2	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319869	0.41096	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.98090	-4.43;-4.71;-4.69	5.16	2.34	0.29019	.	1.299550	0.04695	N	0.414892	D	0.93106	0.7805	N	0.24115	0.695	0.09310	N	0.999999	B;B	0.32245	0.361;0.075	B;B	0.26969	0.075;0.016	D	0.85884	0.1424	10	0.07482	T	0.82	-2.8215	8.4888	0.33086	0.0:0.7559:0.0:0.2441	.	540;327	Q8N1M1;B5MDI8	BEST3_HUMAN;.	K	327;540;434	ENSP00000433213:E327K;ENSP00000332413:E540K;ENSP00000449548:E434K	ENSP00000332413:E540K	E	-	1	0	BEST3	68335343	0.005000	0.15991	0.014000	0.15608	0.350000	0.29205	2.031000	0.41117	0.330000	0.23485	0.563000	0.77884	GAG		0.597	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439		11	424	0	0	0	0.001855	0	11	424				
BEST3	144453	broad.mit.edu	37	12	70065208	70065208	+	Splice_Site	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:70065208C>T	ENST00000330891.5	-	9	1326	c.1100G>A	c.(1099-1101)gGg>gAg	p.G367E	BEST3_ENST00000331471.4_Splice_Site_p.G367E|BEST3_ENST00000476098.1_Splice_Site_p.G154E|BEST3_ENST00000553096.1_Splice_Site_p.G261E|BEST3_ENST00000488961.1_Splice_Site_p.G154E	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	367					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			ATGCACTTACCCCATCTGGAC	0.388																																							uc001svg.2		NA																	0					0						c.(1099-1101)GGG>GAG		vitelliform macular dystrophy 2-like 3 isoform							76.0	75.0	75.0					12																	70065208		1918	4141	6059	SO:0001630	splice_region_variant	144453					chloride channel complex|plasma membrane	chloride channel activity	g.chr12:70065208C>T	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1100+1G>A	12.37:g.70065208C>T			Somatic				BEST3_uc001svd.1_Missense_Mutation_p.G367E|BEST3_uc001sve.1_RNA|BEST3_uc001svf.2_Missense_Mutation_p.G154E|BEST3_uc010stm.1_Missense_Mutation_p.G261E|BEST3_uc001svh.2_Missense_Mutation_p.G154E	p.G367E	NM_032735	NP_116124	WXS	Illumina HiSeq	Unspecified	Q8N1M1	BEST3_HUMAN	Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)		9	1327	-	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		367			Cytoplasmic (Potential).		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	37	c.1100G>A	CCDS8992.2	.	.	.	.	.	.	.	.	.	.	C	17.03	3.283348	0.59867	.	.	ENSG00000127325	ENST00000331471;ENST00000488961;ENST00000330891;ENST00000553096;ENST00000476098	D;D;D;D;D	0.97994	-4.65;-4.31;-4.59;-4.57;-4.54	5.37	3.52	0.40303	.	0.238324	0.42548	N	0.000683	D	0.96284	0.8788	L	0.43923	1.385	0.80722	D	1	P;P;P;P	0.48640	0.76;0.616;0.913;0.73	B;B;P;B	0.50352	0.416;0.258;0.638;0.284	D	0.93948	0.7229	9	.	.	.	-10.7989	10.9319	0.47222	0.0:0.7986:0.1306:0.0707	.	154;367;154;367	E9PNM2;Q8N1M1;B5MDI8;Q8N1M1-1	.;BEST3_HUMAN;.;.	E	367;154;367;261;154	ENSP00000329064:G367E;ENSP00000433213:G154E;ENSP00000332413:G367E;ENSP00000449548:G261E;ENSP00000434713:G154E	.	G	-	2	0	BEST3	68351475	1.000000	0.71417	0.999000	0.59377	0.843000	0.47879	4.017000	0.57167	0.640000	0.30582	0.558000	0.71614	GGG		0.388	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439	Missense_Mutation	10	150	0	0	0	0.001368	0	10	150				
PTPRB	5787	broad.mit.edu	37	12	71002895	71002895	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:71002895G>A	ENST00000261266.5	-	2	308	c.279C>T	c.(277-279)ttC>ttT	p.F93F	PTPRB_ENST00000550857.1_Silent_p.F93F|PTPRB_ENST00000334414.6_Silent_p.F311F|PTPRB_ENST00000551525.1_Silent_p.F310F|PTPRB_ENST00000538708.1_Silent_p.F93F|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000550358.1_Silent_p.F311F|PTPRB_ENST00000451516.2_Silent_p.F93F	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	93	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AAATAATCCTGAAGTTATAGA	0.502																																							uc001swb.3		NA																	0				lung(2)|skin(1)	3						c.(277-279)TTC>TTT		protein tyrosine phosphatase, receptor type, B							141.0	150.0	147.0					12																	71002895		1899	4116	6015	SO:0001819	synonymous_variant	5787				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:71002895G>A	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.279C>T	12.37:g.71002895G>A			Somatic				PTPRB_uc010sto.1_Silent_p.F93F|PTPRB_uc010stp.1_Silent_p.F93F|PTPRB_uc001swc.3_Silent_p.F311F|PTPRB_uc001swa.3_Silent_p.F311F|PTPRB_uc001swd.3_Silent_p.F310F|PTPRB_uc009zrr.1_Silent_p.F190F|PTPRB_uc001swe.2_Silent_p.F311F	p.F93F	NM_002837	NP_002828	WXS	Illumina HiSeq	Unspecified	P23467	PTPRB_HUMAN	GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)		2	309	-	Renal(347;0.236)		93			Fibronectin type-III 1.|Extracellular (Potential).		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	37	c.279C>T	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	G	9.621	1.133821	0.21123	.	.	ENSG00000127329	ENST00000547715	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7808	0.69766	0.0:0.0:1.0:0.0	.	.	.	.	X	85	.	.	Q	-	1	0	PTPRB	69289162	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.606000	0.46291	2.452000	0.82932	0.591000	0.81541	CAG		0.502	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1			7	255	0	0	0	0.00308	0	7	255				
PTPRR	5801	broad.mit.edu	37	12	71139815	71139815	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:71139815C>G	ENST00000283228.2	-	6	1242	c.790G>C	c.(790-792)Gag>Cag	p.E264Q	PTPRR_ENST00000549308.1_Missense_Mutation_p.E19Q|PTPRR_ENST00000342084.4_Missense_Mutation_p.E152Q|PTPRR_ENST00000440835.2_Missense_Mutation_p.E19Q|PTPRR_ENST00000378778.1_Missense_Mutation_p.E58Q	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	264					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E264*(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		TGGTTTTTCTCTTTGTCTTGT	0.423																																							uc001swi.1		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(2)|ovary(1)	3						c.(790-792)GAG>CAG		protein tyrosine phosphatase, receptor type, R							162.0	146.0	151.0					12																	71139815		2203	4300	6503	SO:0001583	missense	5801				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:71139815C>G	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.790G>C	12.37:g.71139815C>G	ENSP00000283228:p.Glu264Gln		Somatic				PTPRR_uc001swh.1_Missense_Mutation_p.E19Q|PTPRR_uc009zrs.2_Missense_Mutation_p.E113Q|PTPRR_uc010stq.1_Missense_Mutation_p.E152Q|PTPRR_uc010str.1_Missense_Mutation_p.E113Q	p.E264Q	NM_002849	NP_002840	WXS	Illumina HiSeq	Unspecified	Q15256	PTPRR_HUMAN	GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)	6	1206	-			264			Cytoplasmic (Potential).		B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	37	c.790G>C	CCDS8998.1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.687659	0.48097	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308;ENST00000550661	T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3	5.12	5.12	0.69794	.	0.000000	0.53938	D	0.000060	T	0.30230	0.0758	L	0.51422	1.61	0.33035	D	0.530725	P;P;B;P	0.38922	0.454;0.493;0.435;0.651	B;B;B;B	0.33620	0.15;0.167;0.167;0.107	T	0.44267	-0.9339	10	0.24483	T	0.36	-18.0741	13.3798	0.60761	0.0:0.8426:0.1574:0.0	.	113;152;58;264	B7Z998;F5GXR7;Q15256-4;Q15256	.;.;.;PTPRR_HUMAN	Q	19;264;58;152;19;19	ENSP00000391750:E19Q;ENSP00000283228:E264Q;ENSP00000368054:E58Q;ENSP00000339605:E152Q;ENSP00000446943:E19Q;ENSP00000449616:E19Q	ENSP00000283228:E264Q	E	-	1	0	PTPRR	69426082	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.745000	0.55119	2.362000	0.80069	0.655000	0.94253	GAG		0.423	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849		5	115	0	0	0	0.001168	0	5	115				
TRHDE	29953	broad.mit.edu	37	12	73046174	73046174	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:73046174C>G	ENST00000261180.4	+	16	2709	c.2613C>G	c.(2611-2613)ttC>ttG	p.F871L		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	871					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TCTGGGAATTCATATGGATGA	0.388																																							uc001sxa.2		NA																	0				ovary(2)|skin(1)	3						c.(2611-2613)TTC>TTG		thyrotropin-releasing hormone degrading enzyme							107.0	103.0	104.0					12																	73046174		2203	4300	6503	SO:0001583	missense	29953				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr12:73046174C>G	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2613C>G	12.37:g.73046174C>G	ENSP00000261180:p.Phe871Leu		Somatic					p.F871L	NM_013381	NP_037513	WXS	Illumina HiSeq	Unspecified	Q9UKU6	TRHDE_HUMAN			16	2643	+			871			Extracellular (Potential).		A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	c.2613C>G	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.246631	0.59103	.	.	ENSG00000072657	ENST00000261180	T	0.04970	3.52	5.04	3.19	0.36642	.	0.101699	0.64402	D	0.000002	T	0.21267	0.0512	M	0.78456	2.415	0.52501	D	0.999959	D	0.64830	0.994	D	0.64506	0.926	T	0.00360	-1.1790	10	0.59425	D	0.04	.	10.9657	0.47410	0.0:0.7861:0.0:0.2139	.	871	Q9UKU6	TRHDE_HUMAN	L	871	ENSP00000261180:F871L	ENSP00000261180:F871L	F	+	3	2	TRHDE	71332441	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.061000	0.41403	0.610000	0.30035	0.561000	0.74099	TTC		0.388	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381		6	83	0	0	0	0.001168	0	6	83				
NAV3	89795	broad.mit.edu	37	12	78444604	78444604	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:78444604C>T	ENST00000397909.2	+	11	2366	c.2193C>T	c.(2191-2193)ccC>ccT	p.P731P	NAV3_ENST00000266692.7_Silent_p.P731P|RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000228327.6_Silent_p.P731P|NAV3_ENST00000536525.2_Silent_p.P731P			Q8IVL0	NAV3_HUMAN	neuron navigator 3	731						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GGACCATACCCAACTTGACAA	0.522										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2191-2193)CCC>CCT		neuron navigator 3							119.0	116.0	117.0					12																	78444604		1972	4149	6121	SO:0001819	synonymous_variant	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78444604C>T	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2193C>T	12.37:g.78444604C>T		HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Silent_p.P731P|NAV3_uc010sub.1_Silent_p.P231P	p.P731P	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			11	2366	+			731					Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37	c.2193C>T																																																																																					0.522	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		6	72	0	0	0	0.001984	0	6	72				
TRPV4	59341	broad.mit.edu	37	12	110232288	110232288	+	Missense_Mutation	SNP	C	C	A	rs143502097	byFrequency	TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:110232288C>A	ENST00000418703.2	-	7	1431	c.1337G>T	c.(1336-1338)cGc>cTc	p.R446L	TRPV4_ENST00000346520.2_Missense_Mutation_p.R386L|TRPV4_ENST00000392719.2_Missense_Mutation_p.R399L|TRPV4_ENST00000537083.1_Missense_Mutation_p.R386L|TRPV4_ENST00000261740.2_Missense_Mutation_p.R446L|TRPV4_ENST00000536838.1_Missense_Mutation_p.R412L|TRPV4_ENST00000541794.1_Missense_Mutation_p.R399L|TRPV4_ENST00000544971.1_Missense_Mutation_p.R339L	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	446					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						CATCTCGTGGCGGTTCTAAGA	0.647													C|||	5	0.000998403	0.0038	0.0	5008	,	,		16300	0.0		0.0	False		,,,				2504	0.0						uc001tpj.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(1336-1338)CGC>CTC		transient receptor potential cation channel,		C	LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG	8,4398	15.5+/-35.6	0,8,2195	95.0	94.0	95.0		1196,1235,1016,1337,1157	4.6	1.0	12	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense,missense,missense	TRPV4	NM_001177428.1,NM_001177431.1,NM_001177433.1,NM_021625.4,NM_147204.2	102,102,102,102,102	0,9,6494	AA,AC,CC		0.0116,0.1816,0.0692	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	399/825,412/838,339/765,446/872,386/812	110232288	9,12997	2203	4300	6503	SO:0001583	missense	59341				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding	g.chr12:110232288C>A	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.1337G>T	12.37:g.110232288C>A	ENSP00000406191:p.Arg446Leu		Somatic				TRPV4_uc001tpg.1_Missense_Mutation_p.R412L|TRPV4_uc001tph.1_Missense_Mutation_p.R399L|TRPV4_uc001tpi.1_Missense_Mutation_p.R339L|TRPV4_uc001tpk.1_Missense_Mutation_p.R446L|TRPV4_uc001tpl.1_Missense_Mutation_p.R386L	p.R446L	NM_021625	NP_067638	WXS	Illumina HiSeq	Unspecified	Q9HBA0	TRPV4_HUMAN			7	1432	-			446			Cytoplasmic (Potential).		B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	c.1337G>T	CCDS9134.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	22.2	4.252110	0.80135	0.001816	1.16E-4	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75;-2.75;-2.75;-2.75;-2.75	4.56	4.56	0.56223	.	0.107611	0.64402	D	0.000003	D	0.94732	0.8300	M	0.74467	2.265	0.80722	D	1	P;D;D;P;D	0.76494	0.937;0.99;0.999;0.908;0.996	P;P;D;P;D	0.72982	0.774;0.796;0.958;0.742;0.979	D	0.94980	0.8125	10	0.56958	D	0.05	-0.356	16.5253	0.84329	0.0:1.0:0.0:0.0	.	386;446;339;399;412	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	L	446;446;399;386;339;386;399;412	ENSP00000406191:R446L;ENSP00000261740:R446L;ENSP00000376480:R399L;ENSP00000319003:R386L;ENSP00000443611:R339L;ENSP00000442738:R386L;ENSP00000442167:R399L;ENSP00000444336:R412L	ENSP00000261740:R446L	R	-	2	0	TRPV4	108716671	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.768000	0.68858	2.363000	0.80096	0.561000	0.74099	CGC		0.647	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625		11	93	1	0	1.61879e-10	0.001368	2.47315e-10	11	93				
MAPKAPK5	8550	broad.mit.edu	37	12	112323825	112323825	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:112323825G>T	ENST00000551404.2	+	10	1062	c.954G>T	c.(952-954)caG>caT	p.Q318H	MAPKAPK5_ENST00000550735.2_Missense_Mutation_p.Q318H			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5	318					activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(11)|ovary(1)	13						CTTCTGCTCAGCTGATGATGG	0.527																																							uc001tta.2		NA																	0				lung(2)|ovary(1)	3						c.(952-954)CAG>CAT		MAP kinase-activated protein kinase 5 isoform 2							159.0	156.0	157.0					12																	112323825		2031	4204	6235	SO:0001583	missense	8550				signal transduction	cytoplasm|nucleus	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity	g.chr12:112323825G>T	AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.954G>T	12.37:g.112323825G>T	ENSP00000449381:p.Gln318His		Somatic				MAPKAPK5_uc001tsz.2_Missense_Mutation_p.Q318H|MAPKAPK5_uc001ttb.2_Missense_Mutation_p.Q251H	p.Q318H	NM_139078	NP_620777	WXS	Illumina HiSeq	Unspecified	Q8IW41	MAPK5_HUMAN			10	1213	+			318					B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Missense_Mutation	SNP	ENST00000551404.2	37	c.954G>T	CCDS44975.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.556789	0.45487	.	.	ENSG00000089022	ENST00000550735;ENST00000202788;ENST00000428907;ENST00000553053;ENST00000551404	T;T	0.50277	0.75;0.75	5.65	-4.01	0.04045	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	N	0.19112	0.55	0.53688	D	0.999972	B;B;D	0.60575	0.016;0.041;0.988	B;B;D	0.72338	0.032;0.005;0.977	T	0.46871	-0.9160	10	0.39692	T	0.17	.	18.1025	0.89510	0.16:0.0:0.84:0.0	.	312;318;318	C9J458;Q8IW41;Q8IW41-2	.;MAPK5_HUMAN;.	H	318;318;318;85;318	ENSP00000449667:Q318H;ENSP00000449381:Q318H	ENSP00000202788:Q318H	Q	+	3	2	MAPKAPK5	110808208	1.000000	0.71417	0.973000	0.42090	0.995000	0.86356	0.564000	0.23563	-0.682000	0.05197	-0.302000	0.09304	CAG		0.527	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078		11	93	1	0	1.58986e-06	0.008291	2.36331e-06	11	93				
KDM2B	84678	broad.mit.edu	37	12	121890993	121890993	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:121890993C>T	ENST00000377071.4	-	13	1961	c.1889G>A	c.(1888-1890)tGc>tAc	p.C630Y	KDM2B_ENST00000536437.1_Missense_Mutation_p.C513Y|KDM2B_ENST00000542973.1_5'UTR|KDM2B_ENST00000377069.4_Missense_Mutation_p.C599Y	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	630					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CATGTCCTTGCAGAAGTGGCA	0.697																																							uc001uat.2		NA																	0				ovary(1)|skin(1)	2						c.(1888-1890)TGC>TAC		F-box and leucine-rich repeat protein 10 isoform							25.0	30.0	28.0					12																	121890993		2040	4191	6231	SO:0001583	missense	84678				embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding	g.chr12:121890993C>T	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1889G>A	12.37:g.121890993C>T	ENSP00000366271:p.Cys630Tyr		Somatic				KDM2B_uc001uaq.2_Missense_Mutation_p.C70Y|KDM2B_uc010szy.1_Missense_Mutation_p.C70Y|KDM2B_uc001uar.2_Missense_Mutation_p.C221Y|KDM2B_uc001uas.2_Missense_Mutation_p.C599Y|KDM2B_uc001uau.2_Missense_Mutation_p.C513Y	p.C630Y	NM_032590	NP_115979	WXS	Illumina HiSeq	Unspecified	Q8NHM5	KDM2B_HUMAN			13	1993	-			630			CXXC-type.		A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	c.1889G>A	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810609	0.90707	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000540043;ENST00000261824	T;D;T	0.81659	-0.87;-1.52;-1.42	5.03	5.03	0.67393	Zinc finger, CXXC-type (2);	0.000000	0.56097	D	0.000021	D	0.92779	0.7704	H	0.94847	3.59	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.992;0.998	D	0.94564	0.7765	10	0.87932	D	0	-19.2876	18.5502	0.91062	0.0:1.0:0.0:0.0	.	70;513;630;599;70	B7ZB05;Q1RLM7;Q8NHM5;A8MRS1;B4DSN4	.;.;KDM2B_HUMAN;.;.	Y	630;599;630;513;630;70;630	ENSP00000366269:C599Y;ENSP00000366271:C630Y;ENSP00000445196:C513Y	ENSP00000261824:C630Y	C	-	2	0	KDM2B	120375376	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.640000	0.83355	2.613000	0.88420	0.555000	0.69702	TGC		0.697	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590		4	40	0	0	0	0.000248	0	4	40				
VPS33A	65082	broad.mit.edu	37	12	122729173	122729173	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:122729173G>T	ENST00000267199.4	-	7	1024	c.912C>A	c.(910-912)ttC>ttA	p.F304L	RP11-512M8.5_ENST00000535844.1_Missense_Mutation_p.F265L	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	304					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		CAACTGCGTTGAAGTTCTTAT	0.507																																							uc001ucd.2		NA																	0				skin(1)	1						c.(910-912)TTC>TTA		vacuolar protein sorting 33A							123.0	108.0	113.0					12																	122729173		2203	4300	6503	SO:0001583	missense	65082				lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding	g.chr12:122729173G>T	AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.912C>A	12.37:g.122729173G>T	ENSP00000267199:p.Phe304Leu		Somatic				VPS33A_uc001ucc.2_RNA	p.F304L	NM_022916	NP_075067	WXS	Illumina HiSeq	Unspecified	Q96AX1	VP33A_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)	7	1025	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		304					Q547V4|Q9H5Q0	Missense_Mutation	SNP	ENST00000267199.4	37	c.912C>A	CCDS9231.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.777214	0.90195	.	.	ENSG00000139719	ENST00000267199;ENST00000536212	T;D	0.82803	0.92;-1.65	5.81	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.91620	0.7352	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92237	0.5797	10	0.62326	D	0.03	-35.4494	14.3117	0.66419	0.0706:0.0:0.9294:0.0	.	304	Q96AX1	VP33A_HUMAN	L	304;109	ENSP00000267199:F304L;ENSP00000439255:F109L	ENSP00000446319:F265L	F	-	3	2	VPS33A	121295126	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	5.468000	0.66743	2.756000	0.94617	0.655000	0.94253	TTC		0.507	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401607.2			16	64	1	0	1.3612e-06	0.003163	2.03027e-06	16	64				
FLT1	2321	broad.mit.edu	37	13	28885795	28885795	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr13:28885795G>A	ENST00000282397.4	-	27	3818	c.3567C>T	c.(3565-3567)ttC>ttT	p.F1189F	FLT1_ENST00000540678.1_Silent_p.F407F|FLT1_ENST00000543394.1_Silent_p.F212F	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	1189					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGTCCTCAGAGAAGGCAGGAG	0.398																																							uc001usb.3		NA																	0				lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24						c.(3565-3567)TTC>TTT		fms-related tyrosine kinase 1 isoform 1	Sunitinib(DB01268)						132.0	120.0	124.0					13																	28885795		2203	4300	6503	SO:0001819	synonymous_variant	2321				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	g.chr13:28885795G>A	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.3567C>T	13.37:g.28885795G>A			Somatic				FLT1_uc010aap.2_Silent_p.F194F|FLT1_uc010aaq.2_Silent_p.F314F|FLT1_uc001usa.3_Silent_p.F407F	p.F1189F	NM_002019	NP_002010	WXS	Illumina HiSeq	Unspecified	P17948	VGFR1_HUMAN	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	27	3852	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	1189			Cytoplasmic (Potential).		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	ENST00000282397.4	37	c.3567C>T	CCDS9330.1																																																																																				0.398	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			6	28	0	0	0	0.001168	0	6	28				
STARD13	90627	broad.mit.edu	37	13	33700248	33700248	+	Silent	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr13:33700248C>A	ENST00000336934.5	-	7	2168	c.2052G>T	c.(2050-2052)ctG>ctT	p.L684L	STARD13_ENST00000255486.4_Silent_p.L676L|STARD13_ENST00000399365.3_Silent_p.L566L	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	684	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		GTAGATATCTCAGTGCTTGCT	0.552																																							uc001uuw.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(2050-2052)CTG>CTT		StAR-related lipid transfer (START) domain							171.0	140.0	150.0					13																	33700248		2203	4300	6503	SO:0001819	synonymous_variant	90627				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding	g.chr13:33700248C>A	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2052G>T	13.37:g.33700248C>A			Somatic				STARD13_uc001uuu.2_Silent_p.L676L|STARD13_uc001uuv.2_Silent_p.L566L|STARD13_uc001uux.2_Silent_p.L649L|STARD13_uc010tec.1_RNA	p.L684L	NM_178006	NP_821074	WXS	Illumina HiSeq	Unspecified	Q9Y3M8	STA13_HUMAN		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)	7	2178	-	all_epithelial(80;0.155)	Lung SC(185;0.0367)	684			Rho-GAP.		A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Silent	SNP	ENST00000336934.5	37	c.2052G>T	CCDS9348.1																																																																																				0.552	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466		12	84	1	0	0.000151284	0.001855	0.000218246	12	84				
TRPC4	7223	broad.mit.edu	37	13	38237715	38237715	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr13:38237715A>G	ENST00000379705.3	-	6	2383	c.1526T>C	c.(1525-1527)cTg>cCg	p.L509P	TRPC4_ENST00000379679.1_Missense_Mutation_p.L336P|TRPC4_ENST00000338947.5_Missense_Mutation_p.L336P|TRPC4_ENST00000355779.2_Missense_Mutation_p.L509P|TRPC4_ENST00000379681.3_Missense_Mutation_p.L509P|TRPC4_ENST00000494529.1_5'UTR|TRPC4_ENST00000426868.2_Intron|TRPC4_ENST00000379673.2_Missense_Mutation_p.L509P|TRPC4_ENST00000358477.2_Missense_Mutation_p.L509P|TRPC4_ENST00000447043.1_Missense_Mutation_p.L509P			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	509					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CATTCTTCCCAGAGATATTTG	0.398																																							uc001uws.2		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(1525-1527)CTG>CCG		transient receptor potential cation channel,							88.0	87.0	87.0					13																	38237715		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38237715A>G	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1526T>C	13.37:g.38237715A>G	ENSP00000369027:p.Leu509Pro		Somatic				TRPC4_uc010abv.2_Missense_Mutation_p.L89P|TRPC4_uc001uwt.2_Missense_Mutation_p.L509P|TRPC4_uc010tey.1_Missense_Mutation_p.L509P|TRPC4_uc010abw.2_Missense_Mutation_p.L336P|TRPC4_uc010abx.2_Missense_Mutation_p.L509P|TRPC4_uc010aby.2_Missense_Mutation_p.L509P	p.L509P	NM_016179	NP_057263	WXS	Illumina HiSeq	Unspecified	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	6	1761	-			509			Cytoplasmic (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.1526T>C	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.551026	0.86127	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D;D	0.99220	-5.58;-5.58;-5.58;-5.58;-5.58;-5.58;-5.58;-5.58	6.08	6.08	0.98989	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99515	0.9827	M	0.90309	3.105	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.998;1.0;1.0;1.0	D	0.98366	1.0551	10	0.87932	D	0	-11.0337	16.6438	0.85155	1.0:0.0:0.0:0.0	.	509;509;509;336;509;509	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	P	509;509;336;336;509;509;509;509	ENSP00000369027:L509P;ENSP00000369003:L509P;ENSP00000342580:L336P;ENSP00000369001:L336P;ENSP00000348025:L509P;ENSP00000351264:L509P;ENSP00000368995:L509P;ENSP00000414316:L509P	ENSP00000342580:L336P	L	-	2	0	TRPC4	37135715	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.331000	0.96430	2.333000	0.79357	0.533000	0.62120	CTG		0.398	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		13	31	0	0	0	0.001855	0	13	31				
LMO7	4008	broad.mit.edu	37	13	76395416	76395416	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr13:76395416G>C	ENST00000321797.8	+	12	2333	c.1612G>C	c.(1612-1614)Gaa>Caa	p.E538Q	LMO7_ENST00000341547.4_Missense_Mutation_p.E489Q|LMO7_ENST00000526202.1_Missense_Mutation_p.E388Q|LMO7_ENST00000465261.2_Missense_Mutation_p.E538Q|LMO7_ENST00000357063.3_Missense_Mutation_p.E823Q|LMO7_ENST00000377534.3_Missense_Mutation_p.E823Q			Q8WWI1	LMO7_HUMAN	LIM domain 7	823					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GACTGTGTCAGAAGCAAGTTA	0.428																																							uc001vjv.2		NA																	0				large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5						c.(1612-1614)GAA>CAA		LIM domain only 7 isoform 2							88.0	84.0	85.0					13																	76395416		2203	4300	6503	SO:0001583	missense	4008					cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding	g.chr13:76395416G>C	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.1612G>C	13.37:g.76395416G>C	ENSP00000317802:p.Glu538Gln		Somatic				LMO7_uc010thv.1_Missense_Mutation_p.E489Q|LMO7_uc001vjt.1_Missense_Mutation_p.E437Q|LMO7_uc010thw.1_Missense_Mutation_p.E388Q|LMO7_uc001vjw.1_Missense_Mutation_p.E444Q	p.E538Q	NM_015842	NP_056667	WXS	Illumina HiSeq	Unspecified	Q8WWI1	LMO7_HUMAN		GBM - Glioblastoma multiforme(99;0.0109)	11	2372	+		Breast(118;0.0992)	823					E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37	c.1612G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.86|17.86	3.493046|3.493046	0.64186|0.64186	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261|ENST00000447038	T;T;T;T;T;T;T|.	0.49139|.	1.38;1.37;1.37;0.79;0.8;0.79;0.79|.	6.05|6.05	3.86|3.86	0.44501|0.44501	.|.	0.404905|.	0.29239|.	N|.	0.012737|.	T|T	0.59715|0.59715	0.2214|0.2214	M|M	0.74881|0.74881	2.28|2.28	0.34261|0.34261	D|D	0.679911|0.679911	P;P;P;P;P|.	0.44429|.	0.546;0.787;0.454;0.546;0.835|.	B;B;B;B;B|.	0.39258|.	0.154;0.295;0.024;0.154;0.234|.	T|T	0.69221|0.69221	-0.5202|-0.5202	10|5	0.87932|.	D|.	0|.	-15.7724|-15.7724	7.0408|7.0408	0.25019|0.25019	0.3199:0.0:0.6801:0.0|0.3199:0.0:0.6801:0.0	.|.	388;489;823;538;771|.	E9PMS6;Q8WWI1-3;Q8WWI1;E9PLH4;F8J2B5|.	.;.;LMO7_HUMAN;.;.|.	Q|T	489;823;823;437;538;388;538|446	ENSP00000342112:E489Q;ENSP00000349571:E823Q;ENSP00000366757:E823Q;ENSP00000366719:E437Q;ENSP00000317802:E538Q;ENSP00000431129:E388Q;ENSP00000433352:E538Q|.	ENSP00000317802:E538Q|.	E|R	+|+	1|2	0|0	LMO7|LMO7	75293417|75293417	0.999000|0.999000	0.42202|0.42202	0.998000|0.998000	0.56505|0.56505	0.937000|0.937000	0.57800|0.57800	1.714000|1.714000	0.37961|0.37961	1.408000|1.408000	0.46895|0.46895	0.650000|0.650000	0.86243|0.86243	GAA|AGA		0.428	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358		6	50	0	0	0	0.001168	0	6	50				
ACIN1	22985	broad.mit.edu	37	14	23532787	23532787	+	Splice_Site	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr14:23532787C>G	ENST00000262710.1	-	13	3097		c.e13-1		ACIN1_ENST00000555053.1_Splice_Site|ACIN1_ENST00000338631.6_Splice_Site|ACIN1_ENST00000457657.1_Splice_Site|ACIN1_ENST00000397341.3_Splice_Site|ACIN1_ENST00000357481.2_Splice_Site|ACIN1_ENST00000557515.1_Splice_Site|ACIN1_ENST00000605057.1_Splice_Site	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CAGGTACTACCTATCAAGGTG	0.502																																							uc001wit.3		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.e13-1		apoptotic chromatin condensation inducer 1							73.0	70.0	71.0					14																	23532787		2203	4300	6503	SO:0001630	splice_region_variant	22985				apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding	g.chr14:23532787C>G	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.2770-1G>C	14.37:g.23532787C>G			Somatic				ACIN1_uc001wio.3_Splice_Site|ACIN1_uc001wip.3_Splice_Site_p.V166_splice|ACIN1_uc001wiq.3_Splice_Site_p.V166_splice|ACIN1_uc001wir.3_Splice_Site_p.V197_splice|ACIN1_uc001wis.3_Splice_Site_p.V605_splice|ACIN1_uc010akg.2_Splice_Site_p.V911_splice	p.V924_splice	NM_014977	NP_055792	WXS	Illumina HiSeq	Unspecified	Q9UKV3	ACINU_HUMAN		GBM - Glioblastoma multiforme(265;0.00816)	13	3098	-	all_cancers(95;1.36e-05)							B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Splice_Site	SNP	ENST00000262710.1	37	c.2770_splice	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869474	0.72065	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053;ENST00000555566	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3756	0.87391	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACIN1	22602627	1.000000	0.71417	0.995000	0.50966	0.906000	0.53458	5.764000	0.68826	2.636000	0.89361	0.655000	0.94253	.		0.502	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	Intron	9	79	0	0	0	0.004482	0	9	79				
RPAP1	26015	broad.mit.edu	37	15	41810036	41810036	+	Missense_Mutation	SNP	C	C	T	rs147536655		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr15:41810036C>T	ENST00000304330.4	-	24	4108	c.3992G>A	c.(3991-3993)cGc>cAc	p.R1331H	RPAP1_ENST00000561603.1_Missense_Mutation_p.A1079T	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	1331						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CATACTCCTGCGGGCAGCTTT	0.567																																							uc001zod.2		NA																	0				large_intestine(1)	1						c.(3991-3993)CGC>CAC		RNA polymerase II associated protein 1		C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	202.0	201.0	201.0		3992	3.3	0.2	15	dbSNP_134	201	0,8600		0,0,4300	no	missense	RPAP1	NM_015540.2	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	1331/1394	41810036	2,13004	2203	4300	6503	SO:0001583	missense	26015					nucleus	DNA binding|DNA-directed RNA polymerase activity	g.chr15:41810036C>T	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.3992G>A	15.37:g.41810036C>T	ENSP00000306123:p.Arg1331His		Somatic				RPAP1_uc001zoc.2_Missense_Mutation_p.R350H	p.R1331H	NM_015540	NP_056355	WXS	Illumina HiSeq	Unspecified	Q9BWH6	RPAP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)	24	4116	-		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	1331					Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	c.3992G>A	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372200	0.24857	4.54E-4	0.0	ENSG00000103932	ENST00000304330	T	0.14144	2.53	5.16	3.28	0.37604	.	0.225306	0.38326	N	0.001739	T	0.19685	0.0473	L	0.50333	1.59	0.42695	D	0.993594	D	0.58970	0.984	P	0.50378	0.639	T	0.01004	-1.1484	10	0.87932	D	0	-20.9261	10.9785	0.47480	0.0:0.8494:0.0:0.1506	.	1331	Q9BWH6	RPAP1_HUMAN	H	1331	ENSP00000306123:R1331H	ENSP00000306123:R1331H	R	-	2	0	RPAP1	39597328	0.922000	0.31269	0.212000	0.23672	0.237000	0.25408	1.745000	0.38278	0.579000	0.29504	0.655000	0.94253	CGC		0.567	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540		39	266	0	0	0	0.006999	0	39	266				
SECISBP2L	9728	broad.mit.edu	37	15	49301449	49301449	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr15:49301449G>T	ENST00000559471.1	-	14	2254	c.1991C>A	c.(1990-1992)tCa>tAa	p.S664*	SECISBP2L_ENST00000261847.3_Nonsense_Mutation_p.S619*	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	664							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						GGTTATTGTTGAAGATGCCAT	0.383																																							uc001zxe.1		NA																	0				breast(1)|skin(1)	2						c.(1990-1992)TCA>TAA		SECIS binding protein 2-like							174.0	153.0	160.0					15																	49301449		2197	4295	6492	SO:0001587	stop_gained	9728							g.chr15:49301449G>T	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1991C>A	15.37:g.49301449G>T	ENSP00000453854:p.Ser664*		Somatic				SECISBP2L_uc001zxd.1_Nonsense_Mutation_p.S619*|SECISBP2L_uc010bep.1_Nonsense_Mutation_p.S426*	p.S664*	NM_014701	NP_055516	WXS	Illumina HiSeq	Unspecified	Q93073	SBP2L_HUMAN			14	2125	-			664					Q8N767	Nonsense_Mutation	SNP	ENST00000559471.1	37	c.1991C>A	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	G	39	7.413584	0.98269	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	.	.	.	4.98	4.98	0.66077	.	0.129709	0.53938	D	0.000049	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7888	0.91965	0.0:0.0:1.0:0.0	.	.	.	.	X	619;664	.	ENSP00000261847:S619X	S	-	2	0	SECISBP2L	47088741	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	5.249000	0.65427	2.757000	0.94681	0.655000	0.94253	TCA		0.383	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701		10	86	1	0	3.86212e-05	0.008291	5.58991e-05	10	86				
HEXA	3073	broad.mit.edu	37	15	72668262	72668262	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr15:72668262C>G	ENST00000268097.5	-	1	555	c.52G>C	c.(52-54)Gga>Cga	p.G18R	HEXA-AS1_ENST00000567598.1_RNA|HEXA_ENST00000567159.1_Missense_Mutation_p.G18R|RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000566304.1_Missense_Mutation_p.G18R|HEXA_ENST00000567213.1_5'UTR|HEXA_ENST00000457859.2_5'Flank|HEXA_ENST00000429918.2_5'UTR	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	18					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						GTCGCCCGTCCTGCGAACGCT	0.627																																							uc002aun.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(52-54)GGA>CGA		hexosaminidase A preproprotein							57.0	66.0	63.0					15																	72668262		2199	4297	6496	SO:0001583	missense	3073				cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity	g.chr15:72668262C>G	M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.52G>C	15.37:g.72668262C>G	ENSP00000268097:p.Gly18Arg		Somatic				CELF6_uc002auk.3_RNA|HEXA_uc010ukn.1_Missense_Mutation_p.G18R|HEXA_uc002auo.3_5'UTR|HEXA_uc010bix.2_Missense_Mutation_p.G18R|HEXA_uc010biy.2_5'UTR|HEXA_uc010uko.1_5'UTR|HEXA_uc010biz.1_RNA|C15orf34_uc010ukp.1_5'Flank	p.G18R	NM_000520	NP_000511	WXS	Illumina HiSeq	Unspecified	P06865	HEXA_HUMAN			1	259	-			18					B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	ENST00000268097.5	37	c.52G>C	CCDS10243.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825598	0.16749	.	.	ENSG00000213614	ENST00000268097	D	0.96830	-4.14	4.58	0.0972	0.14493	.	1.792850	0.02936	N	0.139859	D	0.90338	0.6977	N	0.08118	0	0.09310	N	0.999992	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.82232	-0.0559	10	0.38643	T	0.18	-2.9891	7.3206	0.26526	0.5042:0.3419:0.1539:0.0	.	18;18	B4DVA7;P06865	.;HEXA_HUMAN	R	18	ENSP00000268097:G18R	ENSP00000268097:G18R	G	-	1	0	HEXA	70455316	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.093000	0.15086	-0.135000	0.11495	0.555000	0.69702	GGA		0.627	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2	NM_000520		14	115	0	0	0	0.001855	0	14	115				
UBE2Q2	92912	broad.mit.edu	37	15	76165798	76165798	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr15:76165798G>A	ENST00000267938.4	+	5	859	c.477G>A	c.(475-477)atG>atA	p.M159I	UBE2Q2_ENST00000561851.1_Missense_Mutation_p.M143I|UBE2Q2_ENST00000338677.4_Missense_Mutation_p.M159I|UBE2Q2_ENST00000569423.1_Missense_Mutation_p.M124I	NM_173469.2	NP_775740.1	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q family member 2	159	Glu-rich.				protein K48-linked ubiquitination (GO:0070936)	cytoplasm (GO:0005737)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	12						ACTATGAGATGAAGGAAGAAG	0.333																																							uc002bbg.2		NA																	0				ovary(2)	2						c.(475-477)ATG>ATA		ubiquitin-conjugating enzyme E2Q 2 isoform 1							74.0	75.0	74.0					15																	76165798		2197	4294	6491	SO:0001583	missense	92912				protein K48-linked ubiquitination	cytoplasm	ATP binding|ubiquitin-protein ligase activity	g.chr15:76165798G>A	BC017708	CCDS10286.1, CCDS45309.1, CCDS66839.1	15q24.2	2010-05-12	2008-05-02		ENSG00000140367	ENSG00000140367		"""Ubiquitin-conjugating enzymes E2"""	19248	protein-coding gene	gene with protein product		612501	"""ubiquitin-conjugating enzyme E2Q (putative) 2"""			16300736	Standard	NM_001145335		Approved	DKFZp762C143	uc002bbg.2	Q8WVN8	OTTHUMG00000142839	ENST00000267938.4:c.477G>A	15.37:g.76165798G>A	ENSP00000267938:p.Met159Ile		Somatic				UBE2Q2_uc002bbh.2_Missense_Mutation_p.M124I|UBE2Q2_uc010umn.1_Missense_Mutation_p.M143I|UBE2Q2_uc002bbi.2_Missense_Mutation_p.M40I	p.M159I	NM_173469	NP_775740	WXS	Illumina HiSeq	Unspecified	Q8WVN8	UB2Q2_HUMAN			5	863	+			159			Glu-rich.		B7Z3Q2|H3BRG2|Q8N4G6|Q96J08	Missense_Mutation	SNP	ENST00000267938.4	37	c.477G>A	CCDS10286.1	.	.	.	.	.	.	.	.	.	.	G	18.29	3.590349	0.66105	.	.	ENSG00000140367	ENST00000338677;ENST00000267938;ENST00000426727	.	.	.	4.41	4.41	0.53225	.	0.083472	0.85682	D	0.000000	T	0.62600	0.2441	M	0.78049	2.395	0.80722	D	1	B;P;B;B	0.37548	0.212;0.599;0.126;0.061	B;B;B;B	0.32465	0.04;0.146;0.03;0.04	T	0.69716	-0.5070	9	0.48119	T	0.1	.	16.8832	0.86069	0.0:0.0:1.0:0.0	.	143;159;143;159	E9PHD0;C9JX13;B7Z3Q2;Q8WVN8	.;.;.;UB2Q2_HUMAN	I	159;159;143	.	ENSP00000267938:M159I	M	+	3	0	UBE2Q2	73952853	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.751000	0.98889	2.387000	0.81309	0.637000	0.83480	ATG		0.333	UBE2Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286475.1	NM_173469		4	28	0	0	0	0.000248	0	4	28				
NARFL	64428	broad.mit.edu	37	16	784253	784253	+	Silent	SNP	G	G	C	rs200971952	byFrequency	TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:784253G>C	ENST00000251588.2	-	6	685	c.669C>G	c.(667-669)gtC>gtG	p.V223V	NARFL_ENST00000568545.1_Silent_p.V121V|HAGHL_ENST00000569604.1_3'UTR|NARFL_ENST00000540986.1_Silent_p.V121V|NARFL_ENST00000301694.5_Nonsense_Mutation_p.S179*|NARFL_ENST00000562862.1_5'Flank	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	223					hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				AGAAGTCCTTGACCAGGGAGC	0.642																																							uc002cjr.2		NA																	0					0						c.(667-669)GTC>GTG		nuclear prelamin A recognition factor-like		G		0,4400		0,0,2200	50.0	50.0	50.0		669	3.8	1.0	16		50	1,8597	2.2+/-6.3	0,1,4298	no	coding-synonymous	NARFL	NM_022493.1		0,1,6498	CC,CG,GG		0.0116,0.0,0.0077		223/477	784253	1,12997	2200	4299	6499	SO:0001819	synonymous_variant	64428				iron-sulfur cluster assembly|oxygen homeostasis|regulation of transcription, DNA-dependent|response to hypoxia		4 iron, 4 sulfur cluster binding|metal ion binding	g.chr16:784253G>C	AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.669C>G	16.37:g.784253G>C			Somatic				NARFL_uc002cjp.2_Silent_p.V121V|NARFL_uc002cjq.2_Silent_p.V121V|NARFL_uc002cjs.2_Silent_p.V5V|NARFL_uc010brc.1_3'UTR|NARFL_uc010uur.1_Nonsense_Mutation_p.S179*|NARFL_uc010uuq.1_5'Flank	p.V223V	NM_022493	NP_071938	WXS	Illumina HiSeq	Unspecified	Q9H6Q4	NARFL_HUMAN			6	681	-		Hepatocellular(780;0.0218)	223					A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Silent	SNP	ENST00000251588.2	37	c.669C>G	CCDS10425.1	.	.	.	.	.	.	.	.	.	.	G	31	5.085545	0.94100	0.0	1.16E-4	ENSG00000103245	ENST00000301694	.	.	.	4.83	3.84	0.44239	.	.	.	.	.	.	.	.	.	.	.	0.34753	A	0.731981	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.9718	10.6919	0.45875	0.0:0.1423:0.7104:0.1473	.	.	.	.	X	179	.	ENSP00000301694:S179X	S	-	2	0	NARFL	724254	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	1.537000	0.36083	1.217000	0.43442	0.549000	0.68633	TCA		0.642	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242855.1	NM_022493		7	68	0	0	0	0.001984	0	7	68				
C16orf62	57020	broad.mit.edu	37	16	19663357	19663357	+	Silent	SNP	C	C	A	rs562864979		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:19663357C>A	ENST00000251143.5	+	26	2178	c.2166C>A	c.(2164-2166)ctC>ctA	p.L722L	C16orf62_ENST00000438132.3_Silent_p.L811L|C16orf62_ENST00000417362.2_Silent_p.L629L|C16orf62_ENST00000448695.1_Silent_p.L572L|C16orf62_ENST00000544275.1_3'UTR|C16orf62_ENST00000543152.1_Silent_p.L471L|C16orf62_ENST00000542263.1_Silent_p.L718L			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	722						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						TCACACGTCTCAATCTCTACC	0.547																																							uc002dgn.1		NA																	0				ovary(1)	1						c.(2164-2166)CTC>CTA		hypothetical protein LOC57020							152.0	113.0	126.0					16																	19663357		2197	4300	6497	SO:0001819	synonymous_variant	57020					integral to membrane		g.chr16:19663357C>A		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.2166C>A	16.37:g.19663357C>A			Somatic				C16orf62_uc002dgo.1_Silent_p.L629L|C16orf62_uc002dgp.1_Silent_p.L471L	p.L722L	NM_020314	NP_064710	WXS	Illumina HiSeq	Unspecified	Q7Z3J2	CP062_HUMAN			26	2178	+			722					A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Silent	SNP	ENST00000251143.5	37	c.2166C>A																																																																																					0.547	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314		5	20	1	0	3.59834e-05	0.001168	5.22531e-05	5	20				
DNAH3	55567	broad.mit.edu	37	16	20975656	20975656	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:20975656C>T	ENST00000261383.3	-	53	9549	c.9550G>A	c.(9550-9552)Gaa>Aaa	p.E3184K	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3184	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		ACGGCAACTTCTGGGAGGTAA	0.478																																							uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(9550-9552)GAA>AAA		dynein, axonemal, heavy chain 3							89.0	89.0	89.0					16																	20975656		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:20975656C>T	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.9550G>A	16.37:g.20975656C>T	ENSP00000261383:p.Glu3184Lys		Somatic				DNAH3_uc010vbd.1_Missense_Mutation_p.E619K	p.E3184K	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	53	9550	-			3184			AAA 5 (By similarity).		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.9550G>A	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976037	0.92982	.	.	ENSG00000158486	ENST00000261383	T	0.31247	1.5	6.17	6.17	0.99709	.	0.055611	0.64402	D	0.000001	T	0.76842	0.4044	H	0.99444	4.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86159	0.1592	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	3184	Q8TD57	DYH3_HUMAN	K	3184	ENSP00000261383:E3184K	ENSP00000261383:E3184K	E	-	1	0	DNAH3	20883157	1.000000	0.71417	0.978000	0.43139	0.976000	0.68499	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	GAA		0.478	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		8	80	0	0	0	0.00308	0	8	80				
CDR2	1039	broad.mit.edu	37	16	22358615	22358615	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:22358615G>C	ENST00000268383.2	-	5	1343	c.1036C>G	c.(1036-1038)Ctg>Gtg	p.L346V		NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	346						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		ACTTCGTGCAGAAGGGAGATG	0.567																																							uc002dkn.2		NA																	0				skin(1)	1						c.(1036-1038)CTG>GTG		cerebellar degeneration-related protein 2							103.0	84.0	90.0					16																	22358615		2197	4300	6497	SO:0001583	missense	1039					nucleus	protein binding	g.chr16:22358615G>C	M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.1036C>G	16.37:g.22358615G>C	ENSP00000268383:p.Leu346Val		Somatic					p.L346V	NM_001802	NP_001793	WXS	Illumina HiSeq	Unspecified	Q01850	CDR2_HUMAN		GBM - Glioblastoma multiforme(48;0.0188)	5	1344	-			346			Potential.		A8K8A8|Q13977	Missense_Mutation	SNP	ENST00000268383.2	37	c.1036C>G	CCDS32404.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857749	0.51376	.	.	ENSG00000140743	ENST00000268383	T	0.61742	0.08	5.79	3.82	0.43975	.	0.061993	0.64402	D	0.000003	T	0.72740	0.3498	M	0.79123	2.44	0.49051	D	0.999744	D	0.71674	0.998	D	0.65684	0.937	T	0.74714	-0.3572	10	0.44086	T	0.13	-20.2284	12.8626	0.57922	0.1342:0.0:0.8658:0.0	.	346	Q01850	CDR2_HUMAN	V	346	ENSP00000268383:L346V	ENSP00000268383:L346V	L	-	1	2	CDR2	22266116	1.000000	0.71417	0.999000	0.59377	0.185000	0.23345	7.162000	0.77515	1.449000	0.47699	-0.140000	0.14226	CTG		0.567	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430081.1			8	60	0	0	0	0.004482	0	8	60				
CDR2	1039	broad.mit.edu	37	16	22358863	22358863	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:22358863G>C	ENST00000268383.2	-	5	1095	c.788C>G	c.(787-789)tCa>tGa	p.S263*		NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	263						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		TGGATGCTCTGACTGCAACAT	0.562																																							uc002dkn.2		NA																	0				skin(1)	1						c.(787-789)TCA>TGA		cerebellar degeneration-related protein 2							71.0	71.0	71.0					16																	22358863		2197	4300	6497	SO:0001587	stop_gained	1039					nucleus	protein binding	g.chr16:22358863G>C	M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.788C>G	16.37:g.22358863G>C	ENSP00000268383:p.Ser263*		Somatic					p.S263*	NM_001802	NP_001793	WXS	Illumina HiSeq	Unspecified	Q01850	CDR2_HUMAN		GBM - Glioblastoma multiforme(48;0.0188)	5	1096	-			263			Potential.		A8K8A8|Q13977	Nonsense_Mutation	SNP	ENST00000268383.2	37	c.788C>G	CCDS32404.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.782890	0.49891	.	.	ENSG00000140743	ENST00000268383	.	.	.	5.79	4.84	0.62591	.	0.620757	0.17314	N	0.178751	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-5.0913	14.8836	0.70550	0.0687:0.0:0.9312:0.0	.	.	.	.	X	263	.	ENSP00000268383:S263X	S	-	2	0	CDR2	22266364	0.994000	0.37717	0.184000	0.23157	0.016000	0.09150	4.917000	0.63369	1.449000	0.47699	-0.140000	0.14226	TCA		0.562	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430081.1			5	88	0	0	0	0.001984	0	5	88				
RBBP6	5930	broad.mit.edu	37	16	24573246	24573246	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:24573246G>A	ENST00000319715.4	+	10	1485	c.1053G>A	c.(1051-1053)caG>caA	p.Q351Q	RBBP6_ENST00000381039.3_Silent_p.Q351Q|RBBP6_ENST00000348022.2_Silent_p.Q351Q	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	351					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		CACTGATTCAGAGGAACCTAC	0.428																																							uc002dmh.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1051-1053)CAG>CAA		retinoblastoma-binding protein 6 isoform 1							146.0	143.0	144.0					16																	24573246		2197	4300	6497	SO:0001819	synonymous_variant	5930				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:24573246G>A		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.1053G>A	16.37:g.24573246G>A			Somatic				RBBP6_uc010vcb.1_Silent_p.Q218Q|RBBP6_uc002dmi.2_Silent_p.Q351Q|RBBP6_uc010bxr.2_Silent_p.Q351Q|RBBP6_uc002dmk.2_Silent_p.Q218Q	p.Q351Q	NM_006910	NP_008841	WXS	Illumina HiSeq	Unspecified	Q7Z6E9	RBBP6_HUMAN		GBM - Glioblastoma multiforme(48;0.0518)	10	2093	+			351					Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Silent	SNP	ENST00000319715.4	37	c.1053G>A	CCDS10621.1																																																																																				0.428	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910		4	58	0	0	0	0.000248	0	4	58				
HS3ST4	9951	broad.mit.edu	37	16	26147138	26147138	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:26147138C>A	ENST00000331351.5	+	2	1332	c.940C>A	c.(940-942)Ctg>Atg	p.L314M	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	314					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		CTTTGAGGTGCTGGCCTTCAA	0.527																																							uc002dof.2		NA																	0				large_intestine(1)|breast(1)	2						c.(940-942)CTG>ATG		heparan sulfate D-glucosaminyl							167.0	159.0	162.0					16																	26147138		1568	3582	5150	SO:0001583	missense	9951				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity	g.chr16:26147138C>A	AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.940C>A	16.37:g.26147138C>A	ENSP00000330606:p.Leu314Met		Somatic					p.L314M	NM_006040	NP_006031	WXS	Illumina HiSeq	Unspecified	Q9Y661	HS3S4_HUMAN		GBM - Glioblastoma multiforme(48;0.0988)	2	1332	+			314			Lumenal (Potential).		Q5QI42|Q8NDC2	Missense_Mutation	SNP	ENST00000331351.5	37	c.940C>A	CCDS53995.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504377	0.64410	.	.	ENSG00000182601	ENST00000331351	T	0.58652	0.32	5.35	1.28	0.21552	Sulfotransferase domain (1);	0.000000	0.52532	U	0.000070	T	0.69342	0.3100	M	0.68952	2.095	0.47949	D	0.999551	D	0.76494	0.999	D	0.91635	0.999	T	0.67749	-0.5590	10	0.59425	D	0.04	.	9.4427	0.38679	0.0:0.631:0.0:0.369	.	314	Q9Y661	HS3S4_HUMAN	M	314	ENSP00000330606:L314M	ENSP00000330606:L314M	L	+	1	2	HS3ST4	26054639	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.031000	0.57267	0.258000	0.21686	-0.136000	0.14681	CTG		0.527	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040		26	205	1	0	8.24728e-16	0.004656	1.28681e-15	26	205				
ZNF688	146542	broad.mit.edu	37	16	30582364	30582364	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:30582364C>T	ENST00000223459.6	-	2	1381	c.277G>A	c.(277-279)Gag>Aag	p.E93K	ZNF688_ENST00000563707.1_Intron|ZNF688_ENST00000567855.1_Missense_Mutation_p.E93K|AC002310.7_ENST00000492040.1_RNA|ZNF688_ENST00000395219.1_Missense_Mutation_p.E79K|AC002310.7_ENST00000486926.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	93	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						TCCCCCTTCTCAGGATCCTGG	0.592																																							uc002dyt.2		NA																	0					0						c.(277-279)GAG>AAG		zinc finger protein 688 isoform a							37.0	39.0	38.0					16																	30582364		2197	4300	6497	SO:0001583	missense	146542				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:30582364C>T	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.277G>A	16.37:g.30582364C>T	ENSP00000223459:p.Glu93Lys		Somatic				ZNF688_uc002dys.2_Missense_Mutation_p.E79K|uc002dyu.2_5'Flank	p.E93K	NM_145271	NP_660314	WXS	Illumina HiSeq	Unspecified	P0C7X2	ZN688_HUMAN			2	1055	-			93			KRAB.		A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000223459.6	37	c.277G>A	CCDS10684.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.879908	0.72294	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.04234	3.67;3.98	5.2	4.24	0.50183	Krueppel-associated box (1);	.	.	.	.	T	0.05410	0.0143	N	0.21324	0.655	0.34812	D	0.737794	P;P	0.46784	0.805;0.884	B;P	0.46419	0.275;0.516	T	0.50800	-0.8785	9	0.28530	T	0.3	.	11.3083	0.49349	0.1815:0.8185:0.0:0.0	.	93;79	P0C7X2;A8MV39	ZN688_HUMAN;.	K	79;93	ENSP00000378645:E79K;ENSP00000223459:E93K	ENSP00000223459:E93K	E	-	1	0	ZNF688	30489865	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.016000	0.29976	1.541000	0.49316	0.655000	0.94253	GAG		0.592	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255544.2	NM_145271		5	30	0	0	0	0.001168	0	5	30				
ZNF688	146542	broad.mit.edu	37	16	30582410	30582410	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:30582410C>T	ENST00000223459.6	-	2	1335	c.231G>A	c.(229-231)tgG>tgA	p.W77*	ZNF688_ENST00000563707.1_Intron|ZNF688_ENST00000567855.1_Nonsense_Mutation_p.W77*|AC002310.7_ENST00000492040.1_RNA|ZNF688_ENST00000395219.1_Nonsense_Mutation_p.W63*|AC002310.7_ENST00000486926.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	77	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CCTGTTCCATCCAAGAGATGA	0.632																																							uc002dyt.2		NA																	0					0						c.(229-231)TGG>TGA		zinc finger protein 688 isoform a							37.0	39.0	38.0					16																	30582410		2197	4300	6497	SO:0001587	stop_gained	146542				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:30582410C>T	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.231G>A	16.37:g.30582410C>T	ENSP00000223459:p.Trp77*		Somatic				ZNF688_uc002dys.2_Nonsense_Mutation_p.W63*|uc002dyu.2_5'Flank	p.W77*	NM_145271	NP_660314	WXS	Illumina HiSeq	Unspecified	P0C7X2	ZN688_HUMAN			2	1009	-			77			KRAB.		A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Nonsense_Mutation	SNP	ENST00000223459.6	37	c.231G>A	CCDS10684.1	.	.	.	.	.	.	.	.	.	.	C	39	7.491936	0.98316	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	.	.	.	5.2	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9428	0.41591	0.0:0.9081:0.0:0.0919	.	.	.	.	X	63;77	.	ENSP00000223459:W77X	W	-	3	0	ZNF688	30489911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.756000	0.38390	1.561000	0.49584	0.655000	0.94253	TGG		0.632	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255544.2	NM_145271		5	22	0	0	0	0.001168	0	5	22				
TGFB1I1	7041	broad.mit.edu	37	16	31484844	31484844	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:31484844C>T	ENST00000394863.3	+	2	226	c.96C>T	c.(94-96)ctC>ctT	p.L32L	TGFB1I1_ENST00000394858.2_Silent_p.L15L|TGFB1I1_ENST00000567607.1_Silent_p.L15L|TGFB1I1_ENST00000361773.3_Silent_p.L15L	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	32	Interaction with PTK2B/PYK2.|Transcription activation. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						CGGAGCCTCTCACCCCTCCCC	0.642																																							uc002ecd.1		NA																	0					0						c.(94-96)CTC>CTT		transforming growth factor beta 1 induced							36.0	42.0	40.0					16																	31484844		2197	4300	6497	SO:0001819	synonymous_variant	7041				androgen receptor signaling pathway|cell adhesion|negative regulation of cell proliferation|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|transcription from RNA polymerase II promoter|ubiquitin-dependent SMAD protein catabolic process|Wnt receptor signaling pathway	cytoplasm|cytoskeleton|focal adhesion|nuclear matrix	androgen receptor binding|I-SMAD binding|Roundabout binding|transcription coactivator activity|zinc ion binding	g.chr16:31484844C>T	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.96C>T	16.37:g.31484844C>T			Somatic				TGFB1I1_uc002ece.1_Silent_p.L15L|TGFB1I1_uc010caq.1_5'UTR	p.L32L	NM_001042454	NP_001035919	WXS	Illumina HiSeq	Unspecified	O43294	TGFI1_HUMAN			2	122	+			32			Transcription activation (By similarity).|Interaction with PTK2B.		B2R8D5|Q9BPW3|Q9Y2V5	Silent	SNP	ENST00000394863.3	37	c.96C>T	CCDS42156.1																																																																																				0.642	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3			9	59	0	0	0	0.004482	0	9	59				
RBL2	5934	broad.mit.edu	37	16	53504409	53504409	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:53504409G>C	ENST00000262133.6	+	16	2497	c.2360G>C	c.(2359-2361)gGa>gCa	p.G787A	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Intron	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	787	Pocket; binds E1A.|Spacer.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GCCCTGGCTGGAAGTCTGAGC	0.552																																							uc002ehi.3		NA																	0				ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						c.(2359-2361)GGA>GCA		retinoblastoma-like 2 (p130)							62.0	60.0	60.0					16																	53504409		2198	4300	6498	SO:0001583	missense	5934				cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr16:53504409G>C	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2360G>C	16.37:g.53504409G>C	ENSP00000262133:p.Gly787Ala		Somatic				RBL2_uc002ehj.2_Missense_Mutation_p.G497A|RBL2_uc010vgw.1_Intron	p.G787A	NM_005611	NP_005602	WXS	Illumina HiSeq	Unspecified	Q08999	RBL2_HUMAN			16	2478	+			787			Spacer.|Pocket; binds E1A.		B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	37	c.2360G>C	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409382	0.83340	.	.	ENSG00000103479	ENST00000262133;ENST00000379935	D	0.89939	-2.59	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.92619	0.7655	M	0.66939	2.045	0.80722	D	1	P;D	0.54397	0.946;0.966	P;P	0.55161	0.77;0.505	D	0.92669	0.6148	10	0.62326	D	0.03	-22.3914	19.8354	0.96655	0.0:0.0:1.0:0.0	.	497;787	E9PG04;Q08999	.;RBL2_HUMAN	A	787;497	ENSP00000262133:G787A	ENSP00000262133:G787A	G	+	2	0	RBL2	52061910	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.796000	0.69080	2.686000	0.91538	0.555000	0.69702	GGA		0.552	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611		7	67	0	0	0	0.00308	0	7	67				
MT1X	4501	broad.mit.edu	37	16	56716476	56716476	+	Silent	SNP	G	G	A	rs147291148		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:56716476G>A	ENST00000394485.4	+	1	141	c.24G>A	c.(22-24)tcG>tcA	p.S8S	MT1X_ENST00000562939.1_Silent_p.S8S|RP11-343H19.2_ENST00000567563.1_RNA	NM_005952.3	NP_005943.1	P80297	MT1X_HUMAN	metallothionein 1X	8	Beta.				cellular response to cadmium ion (GO:0071276)|cellular response to erythropoietin (GO:0036018)|cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)|response to metal ion (GO:0010038)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			kidney(2)	2						GCTCCTGCTCGCCTGGTAAGG	0.557																																							uc002ejy.2		NA																	0					0						c.(22-24)TCG>TCA		metallothionein 1X		G		2,4394	4.2+/-10.8	0,2,2196	120.0	121.0	121.0		24	-6.1	0.0	16	dbSNP_134	121	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MT1X	NM_005952.3		0,3,6495	AA,AG,GG		0.0116,0.0455,0.0231		8/62	56716476	3,12993	2198	4300	6498	SO:0001819	synonymous_variant	4501				response to metal ion		metal ion binding	g.chr16:56716476G>A	BC032338	CCDS10768.1	16q13	2010-10-20			ENSG00000187193	ENSG00000187193		"""Metallothioneins"""	7405	protein-coding gene	gene with protein product		156359		MT1		2286373, 8049263	Standard	NM_005952		Approved	MT-1l	uc002ejy.3	P80297	OTTHUMG00000133280	ENST00000394485.4:c.24G>A	16.37:g.56716476G>A			Somatic				MT1X_uc002ejz.2_RNA	p.S8S	NM_005952	NP_005943	WXS	Illumina HiSeq	Unspecified	P80297	MT1X_HUMAN			1	95	+			8			Beta.		A8MUC7	Silent	SNP	ENST00000394485.4	37	c.24G>A	CCDS10768.1																																																																																				0.557	MT1X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257060.1	NM_005952		20	161	0	0	0	0.001523	0	20	161				
ARL2BP	23568	broad.mit.edu	37	16	57286145	57286145	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:57286145C>T	ENST00000219204.3	+	6	728	c.458C>T	c.(457-459)tCt>tTt	p.S153F	ARL2BP_ENST00000562023.1_Missense_Mutation_p.S113F|RP11-407G23.3_ENST00000564376.1_RNA	NM_012106.3	NP_036238.1	Q9Y2Y0	AR2BP_HUMAN	ADP-ribosylation factor-like 2 binding protein	153					maintenance of protein location in nucleus (GO:0051457)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of catalytic activity (GO:0050790)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	centrosome (GO:0005813)|cilium (GO:0005929)|midbody (GO:0030496)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	small GTPase regulator activity (GO:0005083)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|urinary_tract(1)	12						AAATCATCTTCTCTGCCAGCT	0.478																																							uc002elf.1		NA																	0					0						c.(457-459)TCT>TTT		binder of Arl Two							137.0	110.0	119.0					16																	57286145		2198	4300	6498	SO:0001583	missense	23568				maintenance of protein location in nucleus|positive regulation of tyrosine phosphorylation of Stat3 protein|signal transduction	centrosome|midbody|mitochondrial intermembrane space|nucleus|spindle	protein binding|small GTPase regulator activity|transcription coactivator activity	g.chr16:57286145C>T	AF126062	CCDS10776.1	16q13	2014-01-30			ENSG00000102931	ENSG00000102931			17146	protein-coding gene	gene with protein product	"""binder of Arl2"""	615407	"""retinitis pigmentosa 66 (autosomal recessive)"""	RP66		10488091, 18981177, 23849777	Standard	NM_012106		Approved	BART1, BART	uc002elf.1	Q9Y2Y0	OTTHUMG00000133459	ENST00000219204.3:c.458C>T	16.37:g.57286145C>T	ENSP00000219204:p.Ser153Phe		Somatic				ARL2BP_uc010vhl.1_Intron	p.S153F	NM_012106	NP_036238	WXS	Illumina HiSeq	Unspecified	Q9Y2Y0	AR2BP_HUMAN			6	700	+			153					B3KQJ5|Q504R0	Missense_Mutation	SNP	ENST00000219204.3	37	c.458C>T	CCDS10776.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297288	0.60086	.	.	ENSG00000102931	ENST00000219204	T	0.48836	0.8	6.02	6.02	0.97574	.	0.660248	0.13687	U	0.369813	T	0.43411	0.1246	L	0.48642	1.525	0.09310	N	1	P	0.44578	0.838	B	0.38562	0.276	T	0.49698	-0.8912	10	0.87932	D	0	-1.2911	13.3574	0.60635	0.0:0.9278:0.0:0.0722	.	153	Q9Y2Y0	AR2BP_HUMAN	F	153	ENSP00000219204:S153F	ENSP00000219204:S153F	S	+	2	0	ARL2BP	55843646	0.060000	0.20803	0.011000	0.14972	0.601000	0.36947	3.636000	0.54317	2.857000	0.98124	0.650000	0.86243	TCT		0.478	ARL2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257334.2	NM_012106		4	68	0	0	0	0.000602	0	4	68				
GPR56	9289	broad.mit.edu	37	16	57689439	57689439	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:57689439C>T	ENST00000388812.4	+	6	1337	c.897C>T	c.(895-897)ttC>ttT	p.F299F	GPR56_ENST00000568909.1_Silent_p.F299F|GPR56_ENST00000540164.2_Silent_p.F299F|GPR56_ENST00000567835.1_Silent_p.F299F|GPR56_ENST00000562558.1_Silent_p.F299F|GPR56_ENST00000562631.1_Silent_p.F299F|GPR56_ENST00000538815.1_Silent_p.F299F|GPR56_ENST00000379694.4_Silent_p.F129F|GPR56_ENST00000544297.1_Silent_p.F124F|GPR56_ENST00000388813.5_Silent_p.F299F|GPR56_ENST00000568908.1_Silent_p.F299F|GPR56_ENST00000379696.3_Silent_p.F299F|GPR56_ENST00000456916.1_Silent_p.F299F			Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56	299					angiogenesis (GO:0001525)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cerebral cortex radial glia guided migration (GO:0021801)|G-protein coupled receptor signaling pathway (GO:0007186)|layer formation in cerebral cortex (GO:0021819)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron migration (GO:2001223)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell adhesion (GO:0045785)|positive regulation of Rho protein signal transduction (GO:0035025)|protein kinase C signaling (GO:0070528)|Rho protein signal transduction (GO:0007266)|vascular endothelial growth factor production (GO:0010573)	extracellular vesicular exosome (GO:0070062)|glial limiting end-foot (GO:0097451)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	15						AAGCCCTGTTCCAGGTATGGG	0.582																																							uc002emb.2		NA																	0					0						c.(895-897)TTC>TTT		G protein-coupled receptor 56 isoform a							46.0	47.0	47.0					16																	57689439		2198	4300	6498	SO:0001819	synonymous_variant	9289				brain development|cell adhesion|cell-cell signaling|neuropeptide signaling pathway	integral to plasma membrane	G-protein coupled receptor activity	g.chr16:57689439C>T	AJ011001	CCDS32460.1, CCDS32461.1, CCDS73893.1	16q13	2014-08-08				ENSG00000205336		"""-"", ""GPCR / Class B : Orphans"""	4512	protein-coding gene	gene with protein product		604110				10049584, 10100861	Standard	XM_005256237		Approved	TM7LN4, TM7XN1	uc002emb.2	Q9Y653		ENST00000388812.4:c.897C>T	16.37:g.57689439C>T			Somatic				GPR56_uc002elz.1_Silent_p.F129F|GPR56_uc002ema.1_Silent_p.F124F|GPR56_uc002emc.2_Silent_p.F299F|GPR56_uc002emf.2_Silent_p.F299F|GPR56_uc010vhs.1_Silent_p.F299F|GPR56_uc002emd.2_Silent_p.F299F|GPR56_uc002eme.2_Silent_p.F299F|GPR56_uc010vht.1_Silent_p.F304F|GPR56_uc002emg.3_Silent_p.F299F|GPR56_uc010vhu.1_Silent_p.F124F	p.F299F	NM_005682	NP_005673	WXS	Illumina HiSeq	Unspecified	Q9Y653	GPR56_HUMAN			7	1189	+			299			Extracellular (Potential).		A6NIT7|A6NJV9|B0M0K4|B4DR54|O95966|Q6ZMP1|Q8NGB3|Q96HB4	Silent	SNP	ENST00000388812.4	37	c.897C>T	CCDS32460.1																																																																																				0.582	GPR56-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433436.3			5	41	0	0	0	0.001168	0	5	41				
KCTD19	146212	broad.mit.edu	37	16	67338468	67338468	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:67338468C>G	ENST00000304372.5	-	3	362	c.307G>C	c.(307-309)Gat>Cat	p.D103H	KCTD19_ENST00000562860.1_Intron	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	103					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		TTCAGGTTATCTAGAGTCTGT	0.418																																							uc002esu.2		NA																	0				skin(1)	1						c.(307-309)GAT>CAT		potassium channel tetramerisation domain							139.0	139.0	139.0					16																	67338468		1965	4164	6129	SO:0001583	missense	146212					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr16:67338468C>G	AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.307G>C	16.37:g.67338468C>G	ENSP00000305702:p.Asp103His		Somatic				KCTD19_uc002est.2_5'UTR|KCTD19_uc010vjj.1_5'UTR	p.D103H	NM_001100915	NP_001094385	WXS	Illumina HiSeq	Unspecified	Q17RG1	KCD19_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)	3	358	-		Ovarian(137;0.192)	103					B4DZ49|Q8N804	Missense_Mutation	SNP	ENST00000304372.5	37	c.307G>C	CCDS42179.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131284	0.77549	.	.	ENSG00000168676	ENST00000304372	T	0.41758	0.99	5.94	5.94	0.96194	BTB/POZ fold (2);	0.253954	0.34338	N	0.004050	T	0.43986	0.1272	N	0.14661	0.345	0.34487	D	0.704516	D	0.69078	0.997	P	0.56865	0.808	T	0.56685	-0.7938	10	0.62326	D	0.03	-14.8008	17.1431	0.86759	0.0:1.0:0.0:0.0	.	103	Q17RG1	KCD19_HUMAN	H	103	ENSP00000305702:D103H	ENSP00000305702:D103H	D	-	1	0	KCTD19	65895969	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.063000	0.64332	2.834000	0.97654	0.650000	0.86243	GAT		0.418	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367		15	74	0	0	0	0.003163	0	15	74				
ZFHX3	463	broad.mit.edu	37	16	72828079	72828079	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:72828079G>C	ENST00000268489.5	-	9	9174	c.8502C>G	c.(8500-8502)gaC>gaG	p.D2834E	ZFHX3_ENST00000397992.5_Missense_Mutation_p.D1920E|RP5-991G20.4_ENST00000569195.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2834					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CAGAGGAACAGTCATCGTTGT	0.468																																							uc002fck.2		NA																	0				ovary(2)|skin(2)	4						c.(8500-8502)GAC>GAG		zinc finger homeobox 3 isoform A							223.0	185.0	197.0					16																	72828079		2198	4300	6498	SO:0001583	missense	463				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr16:72828079G>C	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.8502C>G	16.37:g.72828079G>C	ENSP00000268489:p.Asp2834Glu		Somatic				ZFHX3_uc002fcl.2_Missense_Mutation_p.D1920E	p.D2834E	NM_006885	NP_008816	WXS	Illumina HiSeq	Unspecified	Q15911	ZFHX3_HUMAN			9	9175	-		Ovarian(137;0.13)	2834					D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	c.8502C>G	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396444	0.25205	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.70869	-0.52;-0.49	5.96	5.01	0.66863	.	0.000000	0.52532	D	0.000064	T	0.67942	0.2947	N	0.15975	0.35	0.58432	D	0.999996	D	0.76494	0.999	D	0.78314	0.991	T	0.63902	-0.6532	10	0.02654	T	1	.	15.1583	0.72761	0.0675:0.0:0.9325:0.0	.	2834	Q15911	ZFHX3_HUMAN	E	2834;1920	ENSP00000268489:D2834E;ENSP00000438926:D1920E	ENSP00000268489:D2834E	D	-	3	2	ZFHX3	71385580	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.829000	0.62737	1.530000	0.49136	0.650000	0.86243	GAC		0.468	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885		31	122	0	0	0	0.002096	0	31	122				
PCGF2	7703	broad.mit.edu	37	17	36894636	36894636	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr17:36894636G>A	ENST00000580830.1	-	10	1247	c.546C>T	c.(544-546)cgC>cgT	p.R182R	PCGF2_ENST00000579882.1_Nonsense_Mutation_p.Q184*|PCGF2_ENST00000585100.1_Nonsense_Mutation_p.Q184*|PCGF2_ENST00000360797.2_Silent_p.R182R|PCGF2_ENST00000581345.1_Silent_p.R182R|PCGF2_ENST00000578109.1_Nonsense_Mutation_p.Q130*			P35227	PCGF2_HUMAN	polycomb group ring finger 2	182					anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					CCATCTTGTTGCGGAGAAACT	0.572																																							uc002hqp.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(544-546)CGC>CGT		ring finger protein 110							110.0	88.0	95.0					17																	36894636		2203	4300	6503	SO:0001819	synonymous_variant	7703				negative regulation of transcription from RNA polymerase II promoter	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr17:36894636G>A	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.546C>T	17.37:g.36894636G>A			Somatic				PCGF2_uc002hqn.1_Nonsense_Mutation_p.Q184*|PCGF2_uc002hqo.1_Nonsense_Mutation_p.Q184*|PCGF2_uc010cvo.1_Silent_p.R57R|PCGF2_uc002hqq.1_Nonsense_Mutation_p.Q184*	p.R182R	NM_007144	NP_009075	WXS	Illumina HiSeq	Unspecified	P35227	PCGF2_HUMAN			9	789	-	Breast(7;9.07e-22)		182					A6NGD8	Silent	SNP	ENST00000580830.1	37	c.546C>T	CCDS32638.1																																																																																				0.572	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144		10	42	0	0	0	0.008291	0	10	42				
CNP	1267	broad.mit.edu	37	17	40125654	40125654	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr17:40125654G>A	ENST00000393892.3	+	4	1122	c.978G>A	c.(976-978)ggG>ggA	p.G326G	CNP_ENST00000472031.1_3'UTR|CNP_ENST00000591072.1_Silent_p.G91G|CNP_ENST00000393888.1_Silent_p.G306G	NM_033133.4	NP_149124.3	P09543	CN37_HUMAN	2',3'-cyclic nucleotide 3' phosphodiesterase	326					adult locomotory behavior (GO:0008344)|aging (GO:0007568)|axonogenesis (GO:0007409)|cyclic nucleotide catabolic process (GO:0009214)|microtubule cytoskeleton organization (GO:0000226)|oligodendrocyte differentiation (GO:0048709)|regulation of mitochondrial membrane permeability (GO:0046902)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule (GO:0005874)|microvillus (GO:0005902)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|myelin sheath abaxonal region (GO:0035748)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity (GO:0004113)|cyclic nucleotide binding (GO:0030551)|RNA binding (GO:0003723)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	9		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)		TGCCGCGGGGGAGCCGCGCCC	0.647																																							uc002hyl.1		NA																	0					0						c.(976-978)GGG>GGA		2',3'-cyclic nucleotide 3' phosphodiesterase							37.0	45.0	43.0					17																	40125654		2022	4156	6178	SO:0001819	synonymous_variant	1267				cell killing|cyclic nucleotide catabolic process|RNA metabolic process|synaptic transmission	extracellular space|melanosome	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity|ATP binding|protein binding	g.chr17:40125654G>A		CCDS11414.2	17q21	2008-02-05			ENSG00000173786	ENSG00000173786	3.1.4.37		2158	protein-coding gene	gene with protein product		123830				1322358	Standard	XM_006721701		Approved		uc002hyl.1	P09543	OTTHUMG00000133502	ENST00000393892.3:c.978G>A	17.37:g.40125654G>A			Somatic				CNP_uc010wfz.1_Silent_p.G203G|CNP_uc002hym.1_Silent_p.G306G|CNP_uc010wga.1_Silent_p.G91G|CNP_uc002hyn.1_Silent_p.G91G	p.G326G	NM_033133	NP_149124	WXS	Illumina HiSeq	Unspecified	P09543	CN37_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)	4	1122	+		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)	326						Silent	SNP	ENST00000393892.3	37	c.978G>A	CCDS11414.2																																																																																				0.647	CNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257443.2			9	79	0	0	0	0.004482	0	9	79				
HOXB6	3216	broad.mit.edu	37	17	46674022	46674022	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr17:46674022C>A	ENST00000484302.2	-	3	1050	c.428G>T	c.(427-429)gGg>gTg	p.G143V	HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000474324.1_RNA|HOXB-AS3_ENST00000477144.1_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB5_ENST00000239151.5_5'Flank|HOXB6_ENST00000225648.3_Missense_Mutation_p.G143V|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000492897.3_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000474040.1_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000552000.2_Intron|HOXB6_ENST00000490419.1_5'Flank|HOXB-AS3_ENST00000460041.1_RNA			P17509	HXB6_HUMAN	homeobox B6	143					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte homeostasis (GO:0034101)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(1)|lung(4)	7						GCCGCTGGGCCCAAAGGAGGA	0.652																																							uc002ins.1		NA																	0					0						c.(427-429)GGG>GTG		homeobox B6							49.0	49.0	49.0					17																	46674022		2203	4300	6503	SO:0001583	missense	3216				anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46674022C>A		CCDS11531.1	17q21.32	2011-06-20	2005-12-22		ENSG00000108511	ENSG00000108511		"""Homeoboxes / ANTP class : HOXL subclass"""	5117	protein-coding gene	gene with protein product		142961	"""homeo box B6"""	HOX2, HOX2B		1973146, 1358459	Standard	XM_005257284		Approved		uc002ins.1	P17509	OTTHUMG00000159912	ENST00000484302.2:c.428G>T	17.37:g.46674022C>A	ENSP00000420009:p.Gly143Val		Somatic				HOXB5_uc002inr.2_5'Flank|HOXB6_uc010dbh.1_Missense_Mutation_p.G143V|HOXB6_uc002int.1_3'UTR	p.G143V	NM_018952	NP_061825	WXS	Illumina HiSeq	Unspecified	P17509	HXB6_HUMAN			4	753	-			143					A8K835|D3DTV5|P09068|Q9HB11|Q9UGH2	Missense_Mutation	SNP	ENST00000484302.2	37	c.428G>T	CCDS11531.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648213	0.87958	.	.	ENSG00000108511	ENST00000484302;ENST00000225648	D;D	0.95656	-3.77;-3.77	4.67	4.67	0.58626	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97306	0.9119	M	0.75447	2.3	0.80722	D	1	D	0.76494	0.999	D	0.67725	0.953	D	0.98019	1.0370	10	0.87932	D	0	.	17.3744	0.87387	0.0:1.0:0.0:0.0	.	143	P17509	HXB6_HUMAN	V	143	ENSP00000420009:G143V;ENSP00000225648:G143V	ENSP00000225648:G143V	G	-	2	0	HOXB6	44029021	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.543000	0.82106	2.437000	0.82529	0.563000	0.77884	GGG		0.652	HOXB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358146.2			8	80	1	0	0.000157383	0.00308	0.000226303	8	80				
NOL11	25926	broad.mit.edu	37	17	65734086	65734086	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr17:65734086G>C	ENST00000253247.4	+	13	1642	c.1527G>C	c.(1525-1527)ttG>ttC	p.L509F	NOL11_ENST00000535137.1_Missense_Mutation_p.L327F|SNORA38B_ENST00000363524.1_RNA	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	509					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			AAATTTTCTTGAGGTAAGTTA	0.328																																							uc002jgd.1		NA																	0					0						c.(1525-1527)TTG>TTC		nucleolar protein 11							88.0	92.0	90.0					17																	65734086		2203	4300	6503	SO:0001583	missense	25926					nucleolus		g.chr17:65734086G>C	AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.1527G>C	17.37:g.65734086G>C	ENSP00000253247:p.Leu509Phe		Somatic				NOL11_uc010wql.1_Missense_Mutation_p.L327F|NOL11_uc010deu.1_Missense_Mutation_p.L104F|SNORA38B_uc010dev.2_5'Flank	p.L509F	NM_015462	NP_056277	WXS	Illumina HiSeq	Unspecified	Q9H8H0	NOL11_HUMAN	BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)		13	1530	+	all_cancers(12;1.54e-10)		509					B7Z5V9|Q7L5S1|Q9UG18	Missense_Mutation	SNP	ENST00000253247.4	37	c.1527G>C	CCDS11671.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862633	0.32884	.	.	ENSG00000130935	ENST00000253247;ENST00000535137	T	0.66099	-0.19	5.11	-2.95	0.05564	.	0.259871	0.34025	N	0.004327	T	0.62258	0.2413	M	0.75264	2.295	0.44652	D	0.997637	P	0.51933	0.949	P	0.46718	0.525	T	0.67304	-0.5704	10	0.72032	D	0.01	-4.0679	12.2458	0.54571	0.6286:0.0:0.3714:0.0	.	509	Q9H8H0	NOL11_HUMAN	F	509;327	ENSP00000253247:L509F	ENSP00000253247:L509F	L	+	3	2	NOL11	63164548	0.995000	0.38212	0.963000	0.40424	0.046000	0.14306	0.373000	0.20484	-0.669000	0.05289	-0.897000	0.02905	TTG		0.328	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448074.1	NM_015462		5	99	0	0	0	0.000602	0	5	99				
JMJD6	23210	broad.mit.edu	37	17	74721760	74721760	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr17:74721760C>T	ENST00000397625.4	-	2	421	c.307G>A	c.(307-309)Gag>Aag	p.E103K	JMJD6_ENST00000445478.2_Missense_Mutation_p.E103K|METTL23_ENST00000590964.1_5'Flank|METTL23_ENST00000586752.1_5'Flank|METTL23_ENST00000341249.6_5'Flank|METTL23_ENST00000586200.1_5'Flank|METTL23_ENST00000591571.1_5'Flank|METTL23_ENST00000586738.1_5'Flank|METTL23_ENST00000588302.1_5'Flank|METTL23_ENST00000588783.1_5'Flank|METTL23_ENST00000588822.1_5'Flank|JMJD6_ENST00000585429.1_Missense_Mutation_p.E103K|METTL23_ENST00000589977.1_5'Flank	NM_015167.2	NP_055982.2	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6	103					cell surface receptor signaling pathway (GO:0007166)|erythrocyte development (GO:0048821)|heart development (GO:0007507)|histone H3-R2 demethylation (GO:0070078)|histone H4-R3 demethylation (GO:0070079)|kidney development (GO:0001822)|lung development (GO:0030324)|macrophage activation (GO:0042116)|mRNA processing (GO:0006397)|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine (GO:0018395)|recognition of apoptotic cell (GO:0043654)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|RNA splicing (GO:0008380)|sprouting angiogenesis (GO:0002040)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone demethylase activity (H3-R2 specific) (GO:0033746)|histone demethylase activity (H4-R3 specific) (GO:0033749)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)|peptidyl-lysine 5-dioxygenase activity (GO:0070815)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			endometrium(2)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|skin(2)	16						TCGTTATCCTCACCACACTTG	0.468																																							uc002jso.2		NA																	0				skin(2)|ovary(1)	3						c.(307-309)GAG>AAG		jumonji domain containing 6 isoform 2							175.0	169.0	171.0					17																	74721760		1970	4162	6132	SO:0001583	missense	23210				mRNA processing|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine|regulation of nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|sprouting angiogenesis|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-R2 specific)|histone demethylase activity (H4-R3 specific)|identical protein binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-lysine 5-dioxygenase activity|single-stranded RNA binding	g.chr17:74721760C>T	AB011157	CCDS42383.1, CCDS42384.1	17q25	2007-11-20	2007-02-16	2007-02-16	ENSG00000070495	ENSG00000070495			19355	protein-coding gene	gene with protein product		604914	"""phosphatidylserine receptor"""	PTDSR		11877474	Standard	NM_015167		Approved	PTDSR1, KIAA0585	uc002jsn.1	Q6NYC1	OTTHUMG00000169267	ENST00000397625.4:c.307G>A	17.37:g.74721760C>T	ENSP00000380750:p.Glu103Lys		Somatic				JMJD6_uc002jsn.1_Missense_Mutation_p.E103K|JMJD6_uc010dgz.2_Missense_Mutation_p.E103K|C17orf95_uc002jsp.2_5'Flank|C17orf95_uc002jsq.2_5'Flank|C17orf95_uc002jsr.2_5'Flank|C17orf95_uc002jss.2_5'Flank|C17orf95_uc002jst.2_5'Flank|C17orf95_uc002jsu.2_5'Flank	p.E103K	NM_015167	NP_055982	WXS	Illumina HiSeq	Unspecified	Q6NYC1	JMJD6_HUMAN			2	631	-			103					B3KMN8|B4DGX1|Q86VY0|Q8IUM5|Q9Y4E2	Missense_Mutation	SNP	ENST00000397625.4	37	c.307G>A	CCDS42384.1	.	.	.	.	.	.	.	.	.	.	C	36	5.901004	0.97081	.	.	ENSG00000070495	ENST00000445478;ENST00000344991;ENST00000397625	T;T	0.70986	-0.53;-0.53	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.80449	0.4625	M	0.80847	2.515	0.80722	D	1	D;P;P	0.62365	0.991;0.835;0.867	P;B;B	0.50109	0.631;0.095;0.373	D	0.83591	0.0123	10	0.87932	D	0	-8.7069	19.7472	0.96257	0.0:1.0:0.0:0.0	.	103;103;103	B2WTI3;Q6NYC1;Q6NYC1-3	.;JMJD6_HUMAN;.	K	103	ENSP00000394085:E103K;ENSP00000380750:E103K	ENSP00000302916:E103K	E	-	1	0	JMJD6	72233355	1.000000	0.71417	0.958000	0.39756	0.836000	0.47400	7.806000	0.86020	2.653000	0.90120	0.561000	0.74099	GAG		0.468	JMJD6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403211.1	NM_015167		15	139	0	0	0	0.003163	0	15	139				
CCDC57	284001	broad.mit.edu	37	17	80085740	80085740	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr17:80085740C>G	ENST00000389641.4	-	17	2430	c.2394G>C	c.(2392-2394)caG>caC	p.Q798H	CCDC57_ENST00000392346.2_Missense_Mutation_p.Q155H|CCDC57_ENST00000392347.1_Missense_Mutation_p.Q798H			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	798										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			TGTCTTCTTTCTGCCGAGGTG	0.572																																							uc002kdx.1		NA																	0				ovary(2)	2						c.(2389-2391)CAG>CAC		coiled-coil domain containing 57							151.0	156.0	154.0					17																	80085740		1982	4156	6138	SO:0001583	missense	284001							g.chr17:80085740C>G	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2394G>C	17.37:g.80085740C>G	ENSP00000374292:p.Gln798His		Somatic				CCDC57_uc002kdy.2_Missense_Mutation_p.Q104H	p.Q797H	NM_198082	NP_932348	WXS	Illumina HiSeq	Unspecified	Q2TAC2	CCD57_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)		16	2428	-	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		798					A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	37	c.2391G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.54|13.54	2.267753|2.267753	0.40095|0.40095	.|.	.|.	ENSG00000176155|ENSG00000176155	ENST00000392345;ENST00000419322|ENST00000389641;ENST00000392347;ENST00000392346;ENST00000324808	.|T;T;T	.|0.14893	.|2.66;2.66;2.47	4.63|4.63	4.63|4.63	0.57726|0.57726	.|.	.|0.361453	.|0.20227	.|N	.|0.096574	T|T	0.28499|0.28499	0.0705|0.0705	L|L	0.29908|0.29908	0.895|0.895	0.29657|0.29657	N|N	0.843523|0.843523	.|D;D	.|0.71674	.|0.998;0.998	.|D;D	.|0.79784	.|0.993;0.957	T|T	0.02966|0.02966	-1.1088|-1.1088	5|10	.|0.48119	.|T	.|0.1	-28.1725|-28.1725	12.7977|12.7977	0.57567|0.57567	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|104;798	.|E7ENZ0;Q2TAC2	.|.;CCD57_HUMAN	Q|H	37;255|798;798;155;104	.|ENSP00000374292:Q798H;ENSP00000376158:Q798H;ENSP00000376157:Q155H	.|ENSP00000315223:Q104H	E|Q	-|-	1|3	0|2	CCDC57|CCDC57	77679029|77679029	0.995000|0.995000	0.38212|0.38212	0.999000|0.999000	0.59377|0.59377	0.035000|0.035000	0.12851|0.12851	0.050000|0.050000	0.14120|0.14120	2.379000|2.379000	0.81126|0.81126	0.491000|0.491000	0.48974|0.48974	GAA|CAG		0.572	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082		8	84	0	0	0	0.000978	0	8	84				
EMILIN2	84034	broad.mit.edu	37	18	2892402	2892402	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr18:2892402G>C	ENST00000254528.3	+	4	2436	c.2277G>C	c.(2275-2277)aaG>aaC	p.K759N		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	759					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.K759N(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		CTGGCCTGAAGAATTCAGTCC	0.468																																							uc002kln.2		NA																	1	Substitution - Missense(1)		urinary_tract(1)	skin(2)|ovary(1)	3						c.(2275-2277)AAG>AAC		elastin microfibril interfacer 2 precursor							65.0	60.0	62.0					18																	2892402		2203	4300	6503	SO:0001583	missense	84034				cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding	g.chr18:2892402G>C	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.2277G>C	18.37:g.2892402G>C	ENSP00000254528:p.Lys759Asn		Somatic					p.K759N	NM_032048	NP_114437	WXS	Illumina HiSeq	Unspecified	Q9BXX0	EMIL2_HUMAN		READ - Rectum adenocarcinoma(2;0.1)	4	2436	+			759					B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	c.2277G>C	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628946	0.67015	.	.	ENSG00000132205	ENST00000254528	T	0.33654	1.4	5.47	3.34	0.38264	.	0.224065	0.38326	N	0.001726	T	0.51941	0.1704	M	0.71581	2.175	0.34958	D	0.751872	D	0.59357	0.985	P	0.61477	0.889	T	0.63629	-0.6594	10	0.36615	T	0.2	-28.1167	11.3403	0.49529	0.2237:0.0:0.7763:0.0	.	759	Q9BXX0	EMIL2_HUMAN	N	759	ENSP00000254528:K759N	ENSP00000254528:K759N	K	+	3	2	EMILIN2	2882402	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	1.563000	0.36364	1.303000	0.44873	0.557000	0.71058	AAG		0.468	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048		10	47	0	0	0	0.008291	0	10	47				
ASXL3	80816	broad.mit.edu	37	18	31319901	31319901	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr18:31319901G>A	ENST00000269197.5	+	11	2533	c.2533G>A	c.(2533-2535)Gag>Aag	p.E845K		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	845					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGTTGACACTGAGAAGCCCTA	0.393																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(2533-2535)GAG>AAG		additional sex combs like 3							75.0	74.0	74.0					18																	31319901		1901	4121	6022	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31319901G>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2533G>A	18.37:g.31319901G>A	ENSP00000269197:p.Glu845Lys		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.E552K	p.E845K	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			11	2588	+			845					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.2533G>A	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344193	0.61073	.	.	ENSG00000141431	ENST00000269197	T	0.20738	2.05	6.04	6.04	0.98038	.	1.118960	0.06534	N	0.741940	T	0.37732	0.1014	L	0.34521	1.04	0.43622	D	0.996003	D	0.67145	0.996	P	0.55923	0.787	T	0.21177	-1.0253	10	0.41790	T	0.15	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	845	Q9C0F0	ASXL3_HUMAN	K	845	ENSP00000269197:E845K	ENSP00000269197:E845K	E	+	1	0	ASXL3	29573899	1.000000	0.71417	0.998000	0.56505	0.167000	0.22549	6.778000	0.75043	2.873000	0.98535	0.563000	0.77884	GAG		0.393	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			6	36	0	0	0	0.001984	0	6	36				
SLC39A6	25800	broad.mit.edu	37	18	33692482	33692482	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr18:33692482C>T	ENST00000590986.1	-	8	2195	c.1906G>A	c.(1906-1908)Gag>Aag	p.E636K	SLC39A6_ENST00000269187.5_Missense_Mutation_p.E636K|SLC39A6_ENST00000440549.2_Missense_Mutation_p.E361K			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	636					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						TGAGGCAACTCATGACAGAAC	0.378																																							uc010dmy.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1906-1908)GAG>AAG		solute carrier family 39 (zinc transporter),							169.0	159.0	162.0					18																	33692482		1889	4114	6003	SO:0001583	missense	25800					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity	g.chr18:33692482C>T	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.1906G>A	18.37:g.33692482C>T	ENSP00000465915:p.Glu636Lys		Somatic				SLC39A6_uc002kzj.2_Missense_Mutation_p.E361K	p.E636K	NM_012319	NP_036451	WXS	Illumina HiSeq	Unspecified	Q13433	S39A6_HUMAN			8	2196	-			636			Cytoplasmic (Potential).		B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	ENST00000590986.1	37	c.1906G>A	CCDS42428.1	.	.	.	.	.	.	.	.	.	.	C	35	5.511911	0.96402	.	.	ENSG00000141424	ENST00000269187;ENST00000440549	T;T	0.47869	0.83;0.83	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.69513	0.3119	M	0.72624	2.21	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.994	T	0.70278	-0.4916	10	0.87932	D	0	-18.9142	18.0718	0.89410	0.0:1.0:0.0:0.0	.	636;361	Q13433;Q13433-2	S39A6_HUMAN;.	K	636;361	ENSP00000269187:E636K;ENSP00000401139:E361K	ENSP00000269187:E636K	E	-	1	0	SLC39A6	31946480	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.515000	0.81761	2.941000	0.99782	0.655000	0.94253	GAG		0.378	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000444136.1			6	147	0	0	0	0.00308	0	6	147				
PIK3C3	5289	broad.mit.edu	37	18	39620662	39620662	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr18:39620662C>T	ENST00000262039.4	+	19	2146	c.2060C>T	c.(2059-2061)tCa>tTa	p.S687L	PIK3C3_ENST00000589056.1_Missense_Mutation_p.S34L|PIK3C3_ENST00000593098.1_Missense_Mutation_p.S172L|PIK3C3_ENST00000587402.1_Missense_Mutation_p.S34L|PIK3C3_ENST00000398870.3_Missense_Mutation_p.S624L	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	687	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						TTTATCCAGTCAGTTCCTGTG	0.343										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)	NSCLC(37;552 1060 2683 16430 37914)	uc002lap.2		NA																	0				lung(8)|ovary(1)|breast(1)	10						c.(2059-2061)TCA>TTA		catalytic phosphatidylinositol 3-kinase 3							178.0	168.0	171.0					18																	39620662		2203	4300	6503	SO:0001583	missense	5289				cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding	g.chr18:39620662C>T	Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.2060C>T	18.37:g.39620662C>T	ENSP00000262039:p.Ser687Leu	TSP Lung(28;0.18)	Somatic				PIK3C3_uc010xcl.1_Missense_Mutation_p.S624L|PIK3C3_uc002laq.2_Missense_Mutation_p.S172L|PIK3C3_uc002lar.1_Missense_Mutation_p.S71L	p.S687L	NM_002647	NP_002638	WXS	Illumina HiSeq	Unspecified	Q8NEB9	PK3C3_HUMAN			19	2118	+			687			PI3K/PI4K.		Q15134	Missense_Mutation	SNP	ENST00000262039.4	37	c.2060C>T	CCDS11920.1	.	.	.	.	.	.	.	.	.	.	C	32	5.117749	0.94385	.	.	ENSG00000078142	ENST00000262039;ENST00000398870	D;D	0.81499	-1.5;-1.5	5.74	5.74	0.90152	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.93874	0.8040	H	0.97611	4.04	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.75020	0.982;0.953;0.985	D	0.95473	0.8553	9	.	.	.	.	19.9173	0.97066	0.0:1.0:0.0:0.0	.	624;624;687	A8MYT4;B4DPV9;Q8NEB9	.;.;PK3C3_HUMAN	L	687;624	ENSP00000262039:S687L;ENSP00000381845:S624L	.	S	+	2	0	PIK3C3	37874660	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.218000	0.77991	2.707000	0.92482	0.563000	0.77884	TCA		0.343	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255804.1	NM_002647		9	66	0	0	0	0.008291	0	9	66				
CDH7	1005	broad.mit.edu	37	18	63525118	63525118	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr18:63525118C>T	ENST00000397968.2	+	8	1728	c.1302C>T	c.(1300-1302)atC>atT	p.I434I	CDH7_ENST00000323011.3_Silent_p.I434I|CDH7_ENST00000536984.2_Silent_p.I434I	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	434	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GTGGGGTCATCACAACTGCCA	0.388																																							uc002ljz.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1300-1302)ATC>ATT		cadherin 7, type 2 preproprotein							145.0	129.0	134.0					18																	63525118		2203	4300	6503	SO:0001819	synonymous_variant	1005				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:63525118C>T	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1302C>T	18.37:g.63525118C>T			Somatic				CDH7_uc002lka.2_Silent_p.I434I|CDH7_uc002lkb.2_Silent_p.I434I	p.I434I	NM_033646	NP_387450	WXS	Illumina HiSeq	Unspecified	Q9ULB5	CADH7_HUMAN			8	1627	+		Esophageal squamous(42;0.129)	434			Extracellular (Potential).|Cadherin 4.		Q9H157	Silent	SNP	ENST00000397968.2	37	c.1302C>T	CCDS11993.1																																																																																				0.388	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		9	41	0	0	0	0.008291	0	9	41				
ZNF556	80032	broad.mit.edu	37	19	2876147	2876147	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:2876147G>A	ENST00000307635.2	+	3	274	c.187G>A	c.(187-189)Gaa>Aaa	p.E63K	ZNF556_ENST00000586426.1_Missense_Mutation_p.E63K	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	63	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TACTTCTGGAGAAAAATTATC	0.373																																							uc002lwp.1		NA																	0				skin(3)	3						c.(187-189)GAA>AAA		zinc finger protein 556							127.0	140.0	136.0					19																	2876147		2203	4300	6503	SO:0001583	missense	80032				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:2876147G>A	BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.187G>A	19.37:g.2876147G>A	ENSP00000302603:p.Glu63Lys		Somatic				ZNF556_uc002lwq.2_Missense_Mutation_p.E63K	p.E63K	NM_024967	NP_079243	WXS	Illumina HiSeq	Unspecified	Q9HAH1	ZN556_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	3	274	+			63			KRAB.		Q96GM3	Missense_Mutation	SNP	ENST00000307635.2	37	c.187G>A	CCDS12097.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.380239	0.24944	.	.	ENSG00000172000	ENST00000307635	T	0.06294	3.32	2.44	-3.31	0.04988	Krueppel-associated box (2);	.	.	.	.	T	0.04092	0.0114	L	0.28649	0.875	0.09310	N	1	B	0.13594	0.008	B	0.10450	0.005	T	0.47611	-0.9104	9	0.14656	T	0.56	.	7.7762	0.29039	0.6522:0.0:0.3478:0.0	.	63	Q9HAH1	ZN556_HUMAN	K	63	ENSP00000302603:E63K	ENSP00000302603:E63K	E	+	1	0	ZNF556	2827147	0.000000	0.05858	0.000000	0.03702	0.271000	0.26615	-0.601000	0.05687	-0.819000	0.04323	0.393000	0.25936	GAA		0.373	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451638.2	NM_024967		12	169	0	0	0	0.001368	0	12	169				
STAP2	55620	broad.mit.edu	37	19	4338667	4338667	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:4338667C>T	ENST00000594605.1	-	1	207	c.84G>A	c.(82-84)aaG>aaA	p.K28K	STAP2_ENST00000600324.1_Silent_p.K28K|AC007292.7_ENST00000598582.1_RNA	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	28	PH.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGCCCCTTCTTCTCTAGAA	0.652																																							uc002mab.2		NA																	0				central_nervous_system(1)	1						c.(82-84)AAG>AAA		signal transducing adaptor family member 2							36.0	34.0	35.0					19																	4338667		2203	4300	6503	SO:0001819	synonymous_variant	55620					cytoplasm|nucleus	protein binding	g.chr19:4338667C>T	AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.84G>A	19.37:g.4338667C>T			Somatic				STAP2_uc002mac.2_Silent_p.K28K|STAP2_uc002mad.2_5'UTR	p.K28K	NM_001013841	NP_001013863	WXS	Illumina HiSeq	Unspecified	Q9UGK3	STAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)	1	181	-		Hepatocellular(1079;0.137)	28			PH.		A6NKK3|Q9NXI2	Silent	SNP	ENST00000594605.1	37	c.84G>A	CCDS45926.1																																																																																				0.652	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	NM_001013841		7	41	0	0	0	0.001984	0	7	41				
PLIN3	10226	broad.mit.edu	37	19	4847846	4847846	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:4847846G>A	ENST00000221957.4	-	6	867	c.691C>T	c.(691-693)Cag>Tag	p.Q231*	PLIN3_ENST00000592528.1_Nonsense_Mutation_p.Q219*|PLIN3_ENST00000585479.1_Nonsense_Mutation_p.Q231*	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	231					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	CTCTGTTCCTGCCGCTGCTGC	0.612																																							uc002mbj.2		NA																	0					0						c.(691-693)CAG>TAG		mannose 6 phosphate receptor binding protein 1	Galsulfase(DB01279)|Idursulfase(DB01271)						44.0	36.0	39.0					19																	4847846		2203	4300	6503	SO:0001587	stop_gained	10226				vesicle-mediated transport	endosome membrane|Golgi apparatus|lipid particle	protein binding	g.chr19:4847846G>A	AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.691C>T	19.37:g.4847846G>A	ENSP00000221957:p.Gln231*		Somatic				PLIN3_uc002mbk.2_Nonsense_Mutation_p.Q219*|PLIN3_uc002mbl.3_Nonsense_Mutation_p.Q231*	p.Q231*	NM_005817	NP_005808	WXS	Illumina HiSeq	Unspecified	O60664	PLIN3_HUMAN			6	868	-			231					A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Nonsense_Mutation	SNP	ENST00000221957.4	37	c.691C>T	CCDS12137.1	.	.	.	.	.	.	.	.	.	.	G	36	5.764597	0.96906	.	.	ENSG00000105355	ENST00000221957	.	.	.	4.41	3.25	0.37280	.	0.809186	0.11067	U	0.603383	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-21.1341	9.5408	0.39251	0.0:0.1867:0.6032:0.2101	.	.	.	.	X	231	.	ENSP00000221957:Q231X	Q	-	1	0	PLIN3	4798846	0.988000	0.35896	0.999000	0.59377	0.895000	0.52256	1.569000	0.36428	2.022000	0.59522	0.511000	0.50034	CAG		0.612	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450436.1	NM_005817		6	25	0	0	0	0.004482	0	6	25				
C19orf45	374877	broad.mit.edu	37	19	7570435	7570435	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:7570435G>C	ENST00000361664.2	+	6	1069	c.928G>C	c.(928-930)Gag>Cag	p.E310Q	CTD-2207O23.12_ENST00000599312.1_5'Flank	NM_198534.2	NP_940936.2	Q8NA69	CS045_HUMAN	chromosome 19 open reading frame 45	310										endometrium(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|stomach(1)	8						TCAGACTCCGGAGTCGCACAT	0.627																																							uc002mgm.2		NA																	0					0						c.(928-930)GAG>CAG		hypothetical protein LOC374877							48.0	53.0	51.0					19																	7570435		2203	4300	6503	SO:0001583	missense	374877							g.chr19:7570435G>C	BC029824	CCDS12179.2	19p13.2	2008-02-05			ENSG00000198723	ENSG00000198723			24745	protein-coding gene	gene with protein product						12477932	Standard	NM_198534		Approved	FLJ35784	uc002mgm.2	Q8NA69	OTTHUMG00000157183	ENST00000361664.2:c.928G>C	19.37:g.7570435G>C	ENSP00000355241:p.Glu310Gln		Somatic				C19orf45_uc010xjo.1_5'UTR	p.E310Q	NM_198534	NP_940936	WXS	Illumina HiSeq	Unspecified	Q8NA69	CS045_HUMAN			6	1069	+			310					Q8N115	Missense_Mutation	SNP	ENST00000361664.2	37	c.928G>C	CCDS12179.2	.	.	.	.	.	.	.	.	.	.	G	11.61	1.688993	0.29962	.	.	ENSG00000198723	ENST00000361664	T	0.16897	2.31	3.6	1.43	0.22495	.	1.227620	0.05600	N	0.576244	T	0.26231	0.0640	L	0.56769	1.78	0.09310	N	1	D	0.58620	0.983	P	0.52424	0.698	T	0.14504	-1.0470	10	0.40728	T	0.16	-7.4823	4.9615	0.14068	0.1272:0.2601:0.6127:0.0	.	310	Q8NA69	CS045_HUMAN	Q	310	ENSP00000355241:E310Q	ENSP00000355241:E310Q	E	+	1	0	C19orf45	7476435	0.000000	0.05858	0.004000	0.12327	0.600000	0.36913	-0.279000	0.08479	0.509000	0.28195	0.456000	0.33151	GAG		0.627	C19orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347808.1	NM_198534		12	68	0	0	0	0.000978	0	12	68				
OR7G1	125962	broad.mit.edu	37	19	9226191	9226191	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:9226191C>T	ENST00000541538.1	-	1	248	c.249G>A	c.(247-249)gtG>gtA	p.V83V	OR7G1_ENST00000293614.1_Silent_p.V83V	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	83			V -> A (in dbSNP:rs6511874).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						CTTGGATGTTCACTAGGATCT	0.463																																							uc002mks.1		NA																	0				ovary(2)	2						c.(247-249)GTG>GTA		olfactory receptor, family 7, subfamily G,							230.0	229.0	230.0					19																	9226191		2203	4300	6503	SO:0001819	synonymous_variant	125962				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9226191C>T		CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.249G>A	19.37:g.9226191C>T			Somatic					p.V83V	NM_001005192	NP_001005192	WXS	Illumina HiSeq	Unspecified	Q8NGA0	OR7G1_HUMAN			1	249	-			83			Extracellular (Potential).		Q6IFJ5|Q96RA1	Silent	SNP	ENST00000541538.1	37	c.249G>A	CCDS32898.2																																																																																				0.463	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397912.1			18	160	0	0	0	0.007413	0	18	160				
PPAN	56342	broad.mit.edu	37	19	10221479	10221479	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:10221479G>A	ENST00000253107.7	+	11	1244	c.1138G>A	c.(1138-1140)Gat>Aat	p.D380N	P2RY11_ENST00000321826.4_5'Flank|SNORD105B_ENST00000458770.1_RNA|PPAN-P2RY11_ENST00000428358.1_Missense_Mutation_p.D380N|PPAN_ENST00000556468.1_Missense_Mutation_p.D380N|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.D380N|PPAN_ENST00000393793.1_Missense_Mutation_p.D327N	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	380					RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			TGAGGACGATGATGAACAGGA	0.612																																							uc002mna.2		NA																	0				ovary(2)	2						c.(1138-1140)GAT>AAT		PPAN-P2RY11 protein							113.0	122.0	119.0					19																	10221479		2203	4300	6503	SO:0001583	missense	692312				RNA splicing	nucleolus	protein binding	g.chr19:10221479G>A	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.1138G>A	19.37:g.10221479G>A	ENSP00000253107:p.Asp380Asn		Somatic				PPAN-P2RY11_uc010xla.1_Missense_Mutation_p.D380N|P2RY11_uc002mnc.2_5'Flank|PPAN_uc002mmz.1_Missense_Mutation_p.D380N|PPAN_uc002mnb.1_Missense_Mutation_p.D327N	p.D380N	NM_001040664	NP_001035754	WXS	Illumina HiSeq	Unspecified	Q9NQ55	SSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)		11	1138	+			380					C9J3F9|Q9BW97|Q9H170	Missense_Mutation	SNP	ENST00000253107.7	37	c.1138G>A	CCDS12225.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.574476	0.28092	.	.	ENSG00000243207;ENSG00000243207;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810	ENST00000428358;ENST00000393796;ENST00000253107;ENST00000556468;ENST00000342696;ENST00000393793	T;T;T;T;T	0.65178	1.33;-0.14;1.35;-0.14;1.37	3.18	3.18	0.36537	.	.	.	.	.	T	0.46833	0.1413	L	0.39147	1.195	0.09310	N	1	B;B;B	0.33694	0.421;0.198;0.198	B;B;B	0.26864	0.074;0.038;0.057	T	0.20472	-1.0274	9	0.15952	T	0.53	1.1187	10.5087	0.44849	0.0:0.0:1.0:0.0	.	380;380;380	C9J3F9;C9JW41;Q9NQ55	.;.;SSF1_HUMAN	N	380;380;380;380;380;327	ENSP00000411918:D380N;ENSP00000377385:D380N;ENSP00000253107:D380N;ENSP00000450710:D380N;ENSP00000377382:D327N	ENSP00000253107:D380N	D	+	1	0	PPAN;PPAN-P2RY11	10082479	0.005000	0.15991	0.004000	0.12327	0.003000	0.03518	0.529000	0.23019	1.739000	0.51704	0.313000	0.20887	GAT		0.612	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	NM_020230		34	160	0	0	0	0.004289	0	34	160				
PPAN	56342	broad.mit.edu	37	19	10221527	10221527	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:10221527G>A	ENST00000253107.7	+	11	1292	c.1186G>A	c.(1186-1188)Gag>Aag	p.E396K	P2RY11_ENST00000321826.4_5'Flank|SNORD105B_ENST00000458770.1_RNA|PPAN-P2RY11_ENST00000428358.1_Missense_Mutation_p.E396K|PPAN_ENST00000556468.1_Missense_Mutation_p.E396K|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.E396K|PPAN_ENST00000393793.1_Missense_Mutation_p.E343K	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	396					RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			GGCGGTGGGCGAGGCGCCCAG	0.612																																							uc002mna.2		NA																	0				ovary(2)	2						c.(1186-1188)GAG>AAG		PPAN-P2RY11 protein							91.0	103.0	99.0					19																	10221527		2203	4300	6503	SO:0001583	missense	692312				RNA splicing	nucleolus	protein binding	g.chr19:10221527G>A	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.1186G>A	19.37:g.10221527G>A	ENSP00000253107:p.Glu396Lys		Somatic				PPAN-P2RY11_uc010xla.1_Missense_Mutation_p.E396K|P2RY11_uc002mnc.2_5'Flank|PPAN_uc002mmz.1_Missense_Mutation_p.E396K|PPAN_uc002mnb.1_Missense_Mutation_p.E343K	p.E396K	NM_001040664	NP_001035754	WXS	Illumina HiSeq	Unspecified	Q9NQ55	SSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)		11	1186	+			396					C9J3F9|Q9BW97|Q9H170	Missense_Mutation	SNP	ENST00000253107.7	37	c.1186G>A	CCDS12225.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907173	0.52333	.	.	ENSG00000243207;ENSG00000243207;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810	ENST00000428358;ENST00000393796;ENST00000253107;ENST00000556468;ENST00000342696;ENST00000393793	T;T;T;T;T	0.63913	1.42;-0.07;1.45;-0.07;1.47	4.71	3.67	0.42095	.	.	.	.	.	T	0.64549	0.2608	M	0.66439	2.03	0.38433	D	0.946489	D;D;D	0.62365	0.985;0.983;0.991	B;B;P	0.47786	0.306;0.403;0.557	T	0.69694	-0.5076	9	0.52906	T	0.07	-30.6298	11.8288	0.52282	0.0874:0.0:0.9126:0.0	.	396;396;396	C9J3F9;C9JW41;Q9NQ55	.;.;SSF1_HUMAN	K	396;396;396;396;396;343	ENSP00000411918:E396K;ENSP00000377385:E396K;ENSP00000253107:E396K;ENSP00000450710:E396K;ENSP00000377382:E343K	ENSP00000253107:E396K	E	+	1	0	PPAN;PPAN-P2RY11	10082527	0.965000	0.33210	0.996000	0.52242	0.046000	0.14306	1.588000	0.36633	0.987000	0.38709	0.561000	0.74099	GAG		0.612	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	NM_020230		35	150	0	0	0	0.004289	0	35	150				
C19orf57	79173	broad.mit.edu	37	19	14006310	14006310	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:14006310G>A	ENST00000586783.1	-	2	80	c.81C>T	c.(79-81)gaC>gaT	p.D27D	C19orf57_ENST00000346736.2_Silent_p.D27D|C19orf57_ENST00000591586.1_Silent_p.D27D|C19orf57_ENST00000454313.1_Silent_p.D27D			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	27					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			CCCCATAGAAGTCTCCTAGCC	0.552																																							uc002mxl.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(79-81)GAC>GAT		hypothetical protein LOC79173							173.0	184.0	180.0					19																	14006310		2203	4300	6503	SO:0001819	synonymous_variant	79173				multicellular organismal development		protein binding	g.chr19:14006310G>A	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.81C>T	19.37:g.14006310G>A			Somatic				C19orf57_uc002mxk.1_5'Flank|C19orf57_uc002mxm.1_Silent_p.D27D	p.D27D	NM_024323	NP_077299	WXS	Illumina HiSeq	Unspecified	Q0VDD7	CS057_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;2e-21)		3	140	-			27					Q13411|Q8N825|Q96D63|Q9BU49	Silent	SNP	ENST00000586783.1	37	c.81C>T																																																																																					0.552	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323		22	177	0	0	0	0.002299	0	22	177				
OR7A17	26333	broad.mit.edu	37	19	14992104	14992104	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:14992104C>G	ENST00000327462.2	-	1	160	c.64G>C	c.(64-66)Gaa>Caa	p.E22Q		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					GGCTGCAATTCTGGTTCCTCA	0.413																																							uc010xob.1		NA																	0					0						c.(64-66)GAA>CAA		olfactory receptor, family 7, subfamily A,							39.0	34.0	36.0					19																	14992104		2203	4300	6503	SO:0001583	missense	26333				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:14992104C>G	X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.64G>C	19.37:g.14992104C>G	ENSP00000328144:p.Glu22Gln		Somatic					p.E22Q	NM_030901	NP_112163	WXS	Illumina HiSeq	Unspecified	O14581	OR7AH_HUMAN			1	64	-	Ovarian(108;0.203)		22			Extracellular (Potential).		Q6IFQ6|Q96R98	Missense_Mutation	SNP	ENST00000327462.2	37	c.64G>C	CCDS12319.1	.	.	.	.	.	.	.	.	.	.	c	8.776	0.927175	0.18056	.	.	ENSG00000185385	ENST00000327462	T	0.00444	7.4	2.73	-0.563	0.11778	.	0.911771	0.08881	N	0.880084	T	0.00412	0.0013	L	0.52011	1.625	0.09310	N	1	B	0.29212	0.237	B	0.36719	0.231	T	0.35076	-0.9803	10	0.59425	D	0.04	.	7.4736	0.27363	0.0:0.709:0.0:0.291	.	22	O14581	OR7AH_HUMAN	Q	22	ENSP00000328144:E22Q	ENSP00000328144:E22Q	E	-	1	0	OR7A17	14853104	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.191000	0.09601	-0.015000	0.14150	-1.310000	0.01310	GAA		0.413	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466523.1	NM_030901		5	29	0	0	0	0.001168	0	5	29				
APLP1	333	broad.mit.edu	37	19	36362525	36362525	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:36362525C>T	ENST00000221891.4	+	5	741	c.549C>T	c.(547-549)tcC>tcT	p.S183S	APLP1_ENST00000586861.1_Silent_p.S177S|APLP1_ENST00000537454.2_Silent_p.S144S|NPHS1_ENST00000591817.1_5'Flank	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	183					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCTGCAGCTCCCAGGGCCTCA	0.647																																							uc002oce.2		NA																	0				ovary(2)	2						c.(547-549)TCC>TCT		amyloid precursor-like protein 1 isoform 2							107.0	102.0	104.0					19																	36362525		2203	4300	6503	SO:0001819	synonymous_variant	333				apoptosis|cell adhesion|cellular response to norepinephrine stimulus|endocytosis|negative regulation of cAMP biosynthetic process|nervous system development|organ morphogenesis	basement membrane|integral to membrane|perinuclear region of cytoplasm|plasma membrane	alpha-2A adrenergic receptor binding|alpha-2B adrenergic receptor binding|alpha-2C adrenergic receptor binding|heparin binding|identical protein binding|metal ion binding	g.chr19:36362525C>T	U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.549C>T	19.37:g.36362525C>T			Somatic				APLP1_uc010xsz.1_Silent_p.S144S|APLP1_uc002ocf.2_Silent_p.S183S|APLP1_uc002ocg.2_Silent_p.S86S|APLP1_uc010xta.1_Silent_p.S177S	p.S183S	NM_005166	NP_005157	WXS	Illumina HiSeq	Unspecified	P51693	APLP1_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		5	687	+	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		183			Extracellular (Potential).		O00113|Q96A92	Silent	SNP	ENST00000221891.4	37	c.549C>T	CCDS32997.1																																																																																				0.647	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807		13	63	0	0	0	0.00245	0	13	63				
AKT2	208	broad.mit.edu	37	19	40745969	40745969	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:40745969T>C	ENST00000392038.2	-	7	920	c.622A>G	c.(622-624)Agg>Ggg	p.R208G	AKT2_ENST00000311278.6_Missense_Mutation_p.R208G|AKT2_ENST00000424901.1_Missense_Mutation_p.R208G|AKT2_ENST00000579047.1_Missense_Mutation_p.R146G	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	208	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> K (in dbSNP:rs35817154). {ECO:0000269|PubMed:17344846}.		activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			AACGGGTGCCTGGTGTTCTGG	0.602			A		"""ovarian, pancreatic """																																		uc002onf.2		NA		Dom	yes		19	19q13.1-q13.2	208	A	v-akt murine thymoma viral oncogene homolog 2			E			ovarian|pancreatic 		0				lung(2)	2						c.(622-624)AGG>GGG		AKT2 kinase							179.0	167.0	171.0					19																	40745969		2203	4300	6503	SO:0001583	missense	208				insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr19:40745969T>C	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.622A>G	19.37:g.40745969T>C	ENSP00000375892:p.Arg208Gly		Somatic				AKT2_uc010egs.2_Missense_Mutation_p.R208G|AKT2_uc010egt.2_Missense_Mutation_p.R146G|AKT2_uc010xvj.1_Missense_Mutation_p.R146G|AKT2_uc010egu.1_Missense_Mutation_p.R146G|AKT2_uc010xvk.1_Missense_Mutation_p.R208G|AKT2_uc002one.2_Missense_Mutation_p.R104G	p.R208G	NM_001626	NP_001617	WXS	Illumina HiSeq	Unspecified	P31751	AKT2_HUMAN	Lung(22;0.000499)		7	884	-			208			Protein kinase.		B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	ENST00000392038.2	37	c.622A>G	CCDS12552.1	.	.	.	.	.	.	.	.	.	.	T	14.27	2.485329	0.44147	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278;ENST00000391845;ENST00000537834	T;T;T	0.25749	1.78;1.78;1.78	5.02	5.02	0.67125	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.175318	0.53938	D	0.000052	T	0.32071	0.0817	N	0.21142	0.635	0.49130	D	0.999759	P;B;B;B	0.42993	0.797;0.001;0.006;0.002	P;B;B;B	0.55508	0.777;0.008;0.009;0.008	T	0.07888	-1.0749	10	0.52906	T	0.07	.	13.849	0.63485	0.0:0.0:0.0:1.0	.	208;146;208;208	B7Z8Z9;B4DG79;Q0VAN0;P31751	.;.;.;AKT2_HUMAN	G	208;109;208;208;28;208	ENSP00000375892:R208G;ENSP00000399532:R208G;ENSP00000309428:R208G	ENSP00000309428:R208G	R	-	1	2	AKT2	45437809	0.953000	0.32496	1.000000	0.80357	0.992000	0.81027	1.128000	0.31369	2.104000	0.64026	0.533000	0.62120	AGG		0.602	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626		4	236	0	0	0	0.001168	0	4	236				
IL4I1	259307	broad.mit.edu	37	19	50397678	50397678	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:50397678G>A	ENST00000391826.2	-	5	556	c.414C>T	c.(412-414)ttC>ttT	p.F138F	IL4I1_ENST00000595948.1_Silent_p.F160F|IL4I1_ENST00000341114.3_Silent_p.F160F	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	138						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	CGTACTGGGTGAACTTGGTCA	0.627																																							uc002pqt.1		NA																	0				lung(1)|ovary(1)|prostate(1)	3						c.(412-414)TTC>TTT		interleukin 4 induced 1 isoform 1 precursor							108.0	103.0	105.0					19																	50397678		2203	4300	6503	SO:0001819	synonymous_variant	259307					lysosome	L-amino-acid oxidase activity	g.chr19:50397678G>A	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.414C>T	19.37:g.50397678G>A			Somatic				IL4I1_uc002pqv.1_Silent_p.F147F|IL4I1_uc010eno.1_Silent_p.F146F|IL4I1_uc002pqw.1_Silent_p.F146F|IL4I1_uc002pqu.1_Silent_p.F160F	p.F138F	NM_152899	NP_690863	WXS	Illumina HiSeq	Unspecified	Q96RQ9	OXLA_HUMAN		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	5	492	-		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)	138					Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Silent	SNP	ENST00000391826.2	37	c.414C>T	CCDS12787.1																																																																																				0.627	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1			12	85	0	0	0	0.001368	0	12	85				
ZNF845	91664	broad.mit.edu	37	19	53855272	53855272	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr19:53855272C>T	ENST00000595091.1	+	5	1563	c.1344C>T	c.(1342-1344)ttC>ttT	p.F448F	ZNF845_ENST00000458035.1_Silent_p.F448F			Q96IR2	ZN845_HUMAN	zinc finger protein 845	448					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						ATGAAGCTTTCAGTTTCAAAT	0.403																																							uc010ydv.1		NA																	0					0						c.(1342-1344)TTC>TTT		zinc finger protein 845							25.0	23.0	23.0					19																	53855272		692	1591	2283	SO:0001819	synonymous_variant	91664				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53855272C>T	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.1344C>T	19.37:g.53855272C>T			Somatic				ZNF845_uc010ydw.1_Silent_p.F448F	p.F448F	NM_138374	NP_612383	WXS	Illumina HiSeq	Unspecified	Q96IR2	ZN845_HUMAN			4	1461	+			448			C2H2-type 9.			Silent	SNP	ENST00000595091.1	37	c.1344C>T	CCDS46170.1																																																																																				0.403	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908		7	58	0	0	0	0.001984	0	7	58				
C2orf43	60526	broad.mit.edu	37	2	20939904	20939904	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:20939904C>T	ENST00000237822.3	-	5	609	c.530G>A	c.(529-531)aGa>aAa	p.R177K	C2orf43_ENST00000541941.1_Missense_Mutation_p.R47K|C2orf43_ENST00000440866.2_Intron|C2orf43_ENST00000381090.3_Missense_Mutation_p.R177K|C2orf43_ENST00000403006.2_Missense_Mutation_p.R47K|C2orf43_ENST00000435420.2_Missense_Mutation_p.R129K	NM_001282721.1|NM_021925.2	NP_001269650.1|NP_068744.1	Q9H6V9	CB043_HUMAN	chromosome 2 open reading frame 43	177										endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGTGGCAATTCTGCCATTGGG	0.403																																							uc002rec.2		NA																	0					0						c.(529-531)AGA>AAA		hypothetical protein LOC60526							112.0	109.0	110.0					2																	20939904		2203	4300	6503	SO:0001583	missense	60526							g.chr2:20939904C>T	AK025473	CCDS1702.1, CCDS62864.1, CCDS74488.1, CCDS74489.1	2p24.1	2014-02-07			ENSG00000118961	ENSG00000118961			26145	protein-coding gene	gene with protein product		613570				17135363, 24357060	Standard	NM_001282723		Approved	FLJ21820	uc002rec.3	Q9H6V9	OTTHUMG00000122097	ENST00000237822.3:c.530G>A	2.37:g.20939904C>T	ENSP00000237822:p.Arg177Lys		Somatic				C2orf43_uc002rea.1_Missense_Mutation_p.R177K|C2orf43_uc002reb.1_RNA|C2orf43_uc010yka.1_Intron|C2orf43_uc010ykb.1_Missense_Mutation_p.R47K|C2orf43_uc010ykc.1_Missense_Mutation_p.R129K|C2orf43_uc010ykd.1_Intron|C2orf43_uc010yke.1_Missense_Mutation_p.R135K|C2orf43_uc010ykf.1_Missense_Mutation_p.R47K	p.R177K	NM_021925	NP_068744	WXS	Illumina HiSeq	Unspecified	Q9H6V9	CB043_HUMAN			5	563	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		177					B7ZA47|B7ZAJ5|D6W530|E7ESN0|Q53T37|Q53T58	Missense_Mutation	SNP	ENST00000237822.3	37	c.530G>A	CCDS1702.1	.	.	.	.	.	.	.	.	.	.	C	5.573	0.290497	0.10567	.	.	ENSG00000118961	ENST00000403006;ENST00000381090;ENST00000237822;ENST00000435420;ENST00000541941;ENST00000432947;ENST00000412261	T;T;T	0.70749	1.04;1.04;-0.51	5.61	-2.9	0.05648	.	0.392618	0.32769	N	0.005667	T	0.44623	0.1302	N	0.11818	0.18	0.50313	D	0.999869	B;B;B;B	0.10296	0.002;0.001;0.001;0.003	B;B;B;B	0.16289	0.007;0.005;0.013;0.015	T	0.22871	-1.0204	10	0.10377	T	0.69	-4.8348	12.4265	0.55551	0.0:0.3093:0.0:0.6907	.	135;129;177;177	B4DS38;B7ZAJ5;Q9H6V9;B5MDU6	.;.;CB043_HUMAN;.	K	47;177;177;129;47;47;129	ENSP00000384267:R47K;ENSP00000440570:R47K;ENSP00000396911:R47K	ENSP00000237822:R177K	R	-	2	0	C2orf43	20803385	0.500000	0.26091	0.163000	0.22734	0.971000	0.66376	-0.031000	0.12287	-0.584000	0.05913	0.650000	0.86243	AGA		0.403	C2orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242861.1	NM_021925		9	54	0	0	0	0.006214	0	9	54				
ABHD1	84696	broad.mit.edu	37	2	27351351	27351351	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:27351351G>A	ENST00000316470.4	+	2	271	c.157G>A	c.(157-159)Gag>Aag	p.E53K		NM_032604.3	NP_115993	Q96SE0	ABHD1_HUMAN	abhydrolase domain containing 1	53						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			endometrium(1)|kidney(1)|lung(3)	5	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCCTTCCTGGAGCCACACTG	0.572																																							uc002rit.2		NA																	0					0						c.(157-159)GAG>AAG		abhydrolase domain-containing protein 1							138.0	134.0	135.0					2																	27351351		2203	4300	6503	SO:0001583	missense	84696					integral to membrane	carboxylesterase activity	g.chr2:27351351G>A	AK093447	CCDS1736.1	2p23.3	2011-01-21			ENSG00000143994	ENSG00000143994		"""Abhydrolase domain containing"""	17553	protein-coding gene	gene with protein product		612195				11922611	Standard	NM_032604		Approved	LABH1, FLJ36128	uc002rit.3	Q96SE0	OTTHUMG00000097072	ENST00000316470.4:c.157G>A	2.37:g.27351351G>A	ENSP00000326491:p.Glu53Lys		Somatic				ABHD1_uc002riu.2_RNA|ABHD1_uc002riv.2_Intron	p.E53K	NM_032604	NP_115993	WXS	Illumina HiSeq	Unspecified	Q96SE0	ABHD1_HUMAN			2	317	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		53					B3KSF6|E9PDR9|Q05BY3|Q53SZ1|Q8IXQ7	Missense_Mutation	SNP	ENST00000316470.4	37	c.157G>A	CCDS1736.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931682	0.34096	.	.	ENSG00000143994	ENST00000316470	T	0.09817	2.94	4.91	0.86	0.19042	.	0.549910	0.19272	N	0.118400	T	0.06735	0.0172	L	0.39633	1.23	0.25829	N	0.984192	B	0.02656	0.0	B	0.06405	0.002	T	0.43245	-0.9403	10	0.07990	T	0.79	-44.2744	6.1845	0.20490	0.4411:0.0:0.5589:0.0	.	53	Q96SE0	ABHD1_HUMAN	K	53	ENSP00000326491:E53K	ENSP00000326491:E53K	E	+	1	0	ABHD1	27204855	0.949000	0.32298	0.998000	0.56505	0.865000	0.49528	0.262000	0.18460	0.280000	0.22209	-0.258000	0.10820	GAG		0.572	ABHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214188.1	NM_032604		12	106	0	0	0	0.00245	0	12	106				
NLRC4	58484	broad.mit.edu	37	2	32475393	32475393	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:32475393G>C	ENST00000404025.2	-	5	2028	c.1540C>G	c.(1540-1542)Caa>Gaa	p.Q514E	NLRC4_ENST00000360906.5_Missense_Mutation_p.Q514E|NLRC4_ENST00000402280.1_Missense_Mutation_p.Q514E|NLRC4_ENST00000342905.6_Intron			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	514					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CAGCCGTGTTGATACACTGCT	0.507																																							uc002roi.2		NA																	0				ovary(3)|large_intestine(1)|lung(1)|skin(1)	6						c.(1540-1542)CAA>GAA		caspase recruitment domain protein 12							81.0	77.0	79.0					2																	32475393		2203	4300	6503	SO:0001583	missense	58484				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity	g.chr2:32475393G>C	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1540C>G	2.37:g.32475393G>C	ENSP00000385090:p.Gln514Glu		Somatic				NLRC4_uc002roj.1_Missense_Mutation_p.Q514E|NLRC4_uc010ezt.1_Intron	p.Q514E	NM_021209	NP_067032	WXS	Illumina HiSeq	Unspecified	Q9NPP4	NLRC4_HUMAN			4	1786	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)		514					A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	37	c.1540C>G	CCDS33174.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.404925	0.00195	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.51325	0.71;0.71;0.71	3.4	-1.48	0.08745	.	0.667118	0.12470	N	0.466085	T	0.29945	0.0749	N	0.22421	0.69	0.28655	N	0.906437	B	0.02656	0.0	B	0.01281	0.0	T	0.22977	-1.0201	9	0.31617	T	0.26	.	10.3203	0.43762	0.0:0.5494:0.3099:0.1407	.	514	Q9NPP4	NLRC4_HUMAN	E	514	ENSP00000354159:Q514E;ENSP00000385428:Q514E;ENSP00000385090:Q514E	ENSP00000354159:Q514E	Q	-	1	0	NLRC4	32328897	0.016000	0.18221	0.000000	0.03702	0.099000	0.18886	-0.125000	0.10579	-0.445000	0.07159	0.543000	0.68304	CAA		0.507	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209		8	38	0	0	0	0.004482	0	8	38				
ARHGAP25	9938	broad.mit.edu	37	2	69049530	69049530	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:69049530A>G	ENST00000295381.3	+	10	1675	c.1256A>G	c.(1255-1257)gAg>gGg	p.E419G	ARHGAP25_ENST00000467265.1_Missense_Mutation_p.E380G|ARHGAP25_ENST00000409202.3_Missense_Mutation_p.E420G|ARHGAP25_ENST00000479844.1_Missense_Mutation_p.E113G|ARHGAP25_ENST00000409220.1_Missense_Mutation_p.E413G|ARHGAP25_ENST00000409030.3_Missense_Mutation_p.E412G	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	419					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						GCGTTTCCGGAGGACAGCAGC	0.502																																							uc002seu.2		NA																	0				ovary(2)|breast(2)	4						c.(1255-1257)GAG>GGG		Rho GTPase activating protein 25 isoform a							103.0	109.0	107.0					2																	69049530		2203	4300	6503	SO:0001583	missense	9938				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr2:69049530A>G	D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.1256A>G	2.37:g.69049530A>G	ENSP00000295381:p.Glu419Gly		Somatic				ARHGAP25_uc010fdg.2_Missense_Mutation_p.E420G|ARHGAP25_uc010yql.1_Missense_Mutation_p.E380G|ARHGAP25_uc002sew.2_Missense_Mutation_p.E412G|ARHGAP25_uc002sex.2_Missense_Mutation_p.E413G|ARHGAP25_uc002sey.2_Missense_Mutation_p.E146G	p.E419G	NM_001007231	NP_001007232	WXS	Illumina HiSeq	Unspecified	P42331	RHG25_HUMAN			10	1620	+			419					A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	ENST00000295381.3	37	c.1256A>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.65|13.65	2.300878|2.300878	0.40694|0.40694	.|.	.|.	ENSG00000163219|ENSG00000163219	ENST00000295381;ENST00000409202;ENST00000467265;ENST00000409030;ENST00000409220;ENST00000482106;ENST00000543533;ENST00000479844|ENST00000497259	T;T;T;T;T;T|.	0.20332|.	2.68;2.68;2.4;2.68;2.68;2.08|.	5.38|5.38	1.76|1.76	0.24704|0.24704	.|.	0.693807|.	0.15511|.	N|.	0.258553|.	T|T	0.30417|0.30417	0.0764|0.0764	N|N	0.08118|0.08118	0|0	0.50313|0.50313	D|D	0.999864|0.999864	B;B;P;P;B|.	0.49783|.	0.008;0.013;0.787;0.928;0.001|.	B;B;B;B;B|.	0.44085|.	0.003;0.004;0.322;0.44;0.001|.	T|T	0.03287|0.03287	-1.1052|-1.1052	10|5	0.40728|.	T|.	0.16|.	.|.	7.5096|7.5096	0.27566|0.27566	0.7558:0.0:0.2442:0.0|0.7558:0.0:0.2442:0.0	.|.	380;420;413;412;419|.	E9PFQ7;P42331-4;G5E9G2;P42331-3;P42331|.	.;.;.;.;RHG25_HUMAN|.	G|G	419;420;380;412;413;413;404;113|279	ENSP00000295381:E419G;ENSP00000386911:E420G;ENSP00000420583:E380G;ENSP00000386863:E412G;ENSP00000386241:E413G;ENSP00000417467:E113G|.	ENSP00000295381:E419G|.	E|R	+|+	2|1	0|2	ARHGAP25|ARHGAP25	68903034|68903034	0.958000|0.958000	0.32768|0.32768	0.072000|0.072000	0.20136|0.20136	0.280000|0.280000	0.26924|0.26924	2.548000|2.548000	0.45794|0.45794	0.442000|0.442000	0.26555|0.26555	0.455000|0.455000	0.32223|0.32223	GAG|AGG		0.502	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014882		4	167	0	0	0	0.000248	0	4	167				
CCDC138	165055	broad.mit.edu	37	2	109415023	109415023	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:109415023G>A	ENST00000295124.4	+	6	776	c.716G>A	c.(715-717)aGa>aAa	p.R239K	CCDC138_ENST00000412964.2_Missense_Mutation_p.R239K	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	239										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						GTTCTTACAAGATTTCAAATT	0.303																																							uc002ten.1		NA																	0					0						c.(715-717)AGA>AAA		coiled-coil domain containing 138							50.0	56.0	54.0					2																	109415023		2203	4300	6503	SO:0001583	missense	165055							g.chr2:109415023G>A	AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.716G>A	2.37:g.109415023G>A	ENSP00000295124:p.Arg239Lys		Somatic				CCDC138_uc002teo.1_Missense_Mutation_p.R239K|CCDC138_uc002tep.1_5'UTR|CCDC138_uc010fjm.1_5'UTR	p.R239K	NM_144978	NP_659415	WXS	Illumina HiSeq	Unspecified	Q96M89	CC138_HUMAN			6	776	+			239			Potential.		Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	ENST00000295124.4	37	c.716G>A	CCDS2080.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.650|9.650	1.141243|1.141243	0.21205|0.21205	.|.	.|.	ENSG00000163006|ENSG00000163006	ENST00000456512|ENST00000412964;ENST00000295124	.|D;D	.|0.89746	.|-2.56;-2.56	5.69|5.69	3.66|3.66	0.41972|0.41972	.|.	.|0.234721	.|0.36374	.|N	.|0.002626	T|T	0.74635|0.74635	0.3742|0.3742	N|N	0.19112|0.19112	0.55|0.55	0.25166|0.25166	N|N	0.990316|0.990316	.|B;B	.|0.24258	.|0.037;0.1	.|B;B	.|0.17098	.|0.01;0.017	T|T	0.57347|0.57347	-0.7827|-0.7827	5|10	.|0.10377	.|T	.|0.69	-9.2705|-9.2705	4.7603|4.7603	0.13104|0.13104	0.3974:0.0:0.6026:0.0|0.3974:0.0:0.6026:0.0	.|.	.|239;239	.|Q96M89-2;Q96M89	.|.;CC138_HUMAN	N|K	137|239	.|ENSP00000411800:R239K;ENSP00000295124:R239K	.|ENSP00000295124:R239K	D|R	+|+	1|2	0|0	CCDC138|CCDC138	108781455|108781455	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.856000|0.856000	0.48823|0.48823	1.953000|1.953000	0.40352|0.40352	1.409000|1.409000	0.46915|0.46915	0.655000|0.655000	0.94253|0.94253	GAT|AGA		0.303	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253593.1	NM_144978		6	58	0	0	0	0.001984	0	6	58				
DPP10	57628	broad.mit.edu	37	2	116538488	116538488	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:116538488C>T	ENST00000410059.1	+	16	1880	c.1400C>T	c.(1399-1401)tCa>tTa	p.S467L	DPP10_ENST00000393147.2_Missense_Mutation_p.S471L|DPP10_ENST00000310323.8_Missense_Mutation_p.S460L|DPP10_ENST00000409163.1_Missense_Mutation_p.S417L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	467						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CAATGCATTTCATGTAATTTC	0.323																																							uc002tla.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						c.(1399-1401)TCA>TTA		dipeptidyl peptidase 10 isoform long							121.0	119.0	120.0					2																	116538488		2202	4294	6496	SO:0001583	missense	57628				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity	g.chr2:116538488C>T	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1400C>T	2.37:g.116538488C>T	ENSP00000386565:p.Ser467Leu		Somatic				DPP10_uc002tlb.1_Missense_Mutation_p.S417L|DPP10_uc002tlc.1_Missense_Mutation_p.S463L|DPP10_uc002tle.2_Missense_Mutation_p.S471L|DPP10_uc002tlf.1_Missense_Mutation_p.S460L	p.S467L	NM_020868	NP_065919	WXS	Illumina HiSeq	Unspecified	Q8N608	DPP10_HUMAN			16	1857	+			467			Extracellular (Potential).		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	c.1400C>T	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623425	0.87460	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.86	5.86	0.93980	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.073571	0.52532	D	0.000061	T	0.68430	0.3000	M	0.89601	3.045	0.48830	D	0.999714	D;D;D;D	0.89917	1.0;0.974;1.0;1.0	D;P;D;D	0.83275	0.993;0.8;0.996;0.996	T	0.74375	-0.3686	10	0.87932	D	0	-13.8219	17.3362	0.87282	0.0:1.0:0.0:0.0	.	460;471;463;467	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	L	467;417;471;460;417	ENSP00000386565:S467L;ENSP00000387038:S417L;ENSP00000376855:S471L;ENSP00000309066:S460L	ENSP00000309066:S460L	S	+	2	0	DPP10	116254958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.060000	0.64312	2.777000	0.95525	0.655000	0.94253	TCA		0.323	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		10	93	0	0	0	0.008291	0	10	93				
PLA2R1	22925	broad.mit.edu	37	2	160798460	160798460	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:160798460C>T	ENST00000283243.7	-	30	4427	c.4221G>A	c.(4219-4221)ctG>ctA	p.L1407L	PLA2R1_ENST00000460710.1_5'UTR	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1407					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						CAATGACTATCAGTGTCAGTA	0.408																																							uc002ube.1		NA																	0				skin(2)|ovary(1)	3						c.(4219-4221)CTG>CTA		phospholipase A2 receptor 1 isoform 1 precursor							106.0	104.0	105.0					2																	160798460		2203	4300	6503	SO:0001819	synonymous_variant	22925				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr2:160798460C>T	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.4221G>A	2.37:g.160798460C>T			Somatic				PLA2R1_uc010zcp.1_Silent_p.L1405L	p.L1407L	NM_007366	NP_031392	WXS	Illumina HiSeq	Unspecified	Q13018	PLA2R_HUMAN			30	4428	-			1407			Helical; (Potential).		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	37	c.4221G>A	CCDS33309.1																																																																																				0.408	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1			13	80	0	0	0	0.00245	0	13	80				
SCN3A	6328	broad.mit.edu	37	2	166011088	166011088	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:166011088C>T	ENST00000360093.3	-	11	1745	c.1254G>A	c.(1252-1254)ttG>ttA	p.L418L	SCN3A_ENST00000409101.3_Silent_p.L418L|SCN3A_ENST00000283254.7_Silent_p.L418L	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	418					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGCCAGGATCAAATTCACCA	0.458																																							uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(1252-1254)TTG>TTA		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						82.0	81.0	81.0					2																	166011088		2203	4300	6503	SO:0001819	synonymous_variant	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166011088C>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1254G>A	2.37:g.166011088C>T			Somatic				SCN3A_uc002ucy.2_Silent_p.L418L|SCN3A_uc002ucz.2_Silent_p.L418L|SCN3A_uc002uda.1_Silent_p.L287L|SCN3A_uc002udb.1_Silent_p.L287L	p.L418L	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			11	1746	-			418			Helical; Name=S6 of repeat I; (Potential).		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37	c.1254G>A																																																																																					0.458	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		9	70	0	0	0	0.006214	0	9	70				
LRP2	4036	broad.mit.edu	37	2	170145598	170145598	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:170145598C>G	ENST00000263816.3	-	9	1265	c.980G>C	c.(979-981)gGa>gCa	p.G327A	LRP2_ENST00000443831.1_Missense_Mutation_p.G327A	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	327	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.G327V(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACACGCTCCTCCATACGGCGT	0.483																																							uc002ues.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(979-981)GGA>GCA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						105.0	102.0	103.0					2																	170145598		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170145598C>G		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.980G>C	2.37:g.170145598C>G	ENSP00000263816:p.Gly327Ala		Somatic				LRP2_uc010zdf.1_Missense_Mutation_p.G327A	p.G327A	NM_004525	NP_004516	WXS	Illumina HiSeq	Unspecified	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	9	1193	-			327			EGF-like 1.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.980G>C	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.426052	0.62733	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.88124	-2.34;-2.34	5.06	5.06	0.68205	Epidermal growth factor-like (1);Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (1);	0.000000	0.85682	D	0.000000	D	0.91885	0.7431	L	0.55834	1.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91226	0.5010	9	.	.	.	.	18.4324	0.90630	0.0:1.0:0.0:0.0	.	327;327	E9PC35;P98164	.;LRP2_HUMAN	A	327	ENSP00000263816:G327A;ENSP00000409813:G327A	.	G	-	2	0	LRP2	169853844	1.000000	0.71417	0.997000	0.53966	0.068000	0.16541	6.995000	0.76257	2.346000	0.79739	0.655000	0.94253	GGA		0.483	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		13	105	0	0	0	0.001855	0	13	105				
GORASP2	26003	broad.mit.edu	37	2	171818224	171818224	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:171818224C>G	ENST00000234160.4	+	8	1690	c.875C>G	c.(874-876)tCt>tGt	p.S292C	GORASP2_ENST00000493692.1_3'UTR|GORASP2_ENST00000452526.2_Missense_Mutation_p.S304C	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	292	Pro-rich.				mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						TCCCTCACTTCTGTGCCACCA	0.393																																							uc002ugk.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(874-876)TCT>TGT		golgi reassembly stacking protein 2							263.0	219.0	234.0					2																	171818224		2203	4300	6503	SO:0001583	missense	26003					Golgi membrane		g.chr2:171818224C>G		CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.875C>G	2.37:g.171818224C>G	ENSP00000234160:p.Ser292Cys		Somatic				GORASP2_uc002ugj.2_Missense_Mutation_p.S224C|GORASP2_uc010zdl.1_Missense_Mutation_p.S304C|GORASP2_uc010zdm.1_Missense_Mutation_p.S248C|GORASP2_uc002ugl.2_Missense_Mutation_p.S224C|GORASP2_uc002ugm.2_Missense_Mutation_p.S74C	p.S292C	NM_015530	NP_056345	WXS	Illumina HiSeq	Unspecified	Q9H8Y8	GORS2_HUMAN			8	1015	+			292			Pro-rich.		B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Missense_Mutation	SNP	ENST00000234160.4	37	c.875C>G	CCDS33325.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.147545	0.77888	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	T;T	0.49139	0.81;0.79	6.16	5.27	0.74061	.	0.171432	0.56097	D	0.000036	T	0.53626	0.1808	M	0.65975	2.015	0.43841	D	0.996428	D;D;D	0.60575	0.979;0.988;0.979	B;P;B	0.46975	0.41;0.533;0.319	T	0.60286	-0.7293	10	0.62326	D	0.03	-15.3443	15.1706	0.72869	0.1411:0.8589:0.0:0.0	.	248;304;292	B4DNR1;B4DKT0;Q9H8Y8	.;.;GORS2_HUMAN	C	292;304	ENSP00000234160:S292C;ENSP00000410208:S304C	ENSP00000234160:S292C	S	+	2	0	GORASP2	171526470	0.792000	0.28813	0.996000	0.52242	0.993000	0.82548	3.416000	0.52707	1.580000	0.49851	0.650000	0.86243	TCT		0.393	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333719.2			14	141	0	0	0	0.00245	0	14	141				
NFE2L2	4780	broad.mit.edu	37	2	178095793	178095793	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:178095793T>A	ENST00000397062.3	-	5	2092	c.1538A>T	c.(1537-1539)aAt>aTt	p.N513I	NFE2L2_ENST00000464747.1_Missense_Mutation_p.N497I|NFE2L2_ENST00000397063.4_Missense_Mutation_p.N497I|NFE2L2_ENST00000446151.2_Missense_Mutation_p.N490I	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	513	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTTTCTGCAATTCTGAGCAGC	0.343			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																													uc002ulh.3		NA		Dom	yes		2	2q31	4780	Mis	nuclear factor (erythroid-derived 2)-like 2 (NRF2)			E			NSCLC|HNSCC		0				central_nervous_system(1)	1						c.(1537-1539)AAT>ATT		nuclear factor erythroid 2-like 2 isoform 1							126.0	110.0	115.0					2																	178095793		1823	4081	5904	SO:0001583	missense	4780				transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:178095793T>A		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.1538A>T	2.37:g.178095793T>A	ENSP00000380252:p.Asn513Ile	HNSCC(56;0.16)	Somatic				NFE2L2_uc002ulg.3_Missense_Mutation_p.N497I|NFE2L2_uc010zfa.1_Missense_Mutation_p.N490I|NFE2L2_uc002uli.3_Missense_Mutation_p.N497I	p.N513I	NM_006164	NP_006155	WXS	Illumina HiSeq	Unspecified	Q16236	NF2L2_HUMAN	Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)		5	2093	-			513			Basic motif.		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	c.1538A>T	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	19.46	3.831362	0.71258	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627	T;T;T;D	0.92149	0.97;0.97;0.97;-2.98	5.95	5.95	0.96441	Basic-leucine zipper (bZIP) transcription factor (3);Eukaryotic transcription factor, Skn-1-like, DNA-binding (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	D	0.96423	0.8833	M	0.84511	2.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96952	0.9695	10	0.87932	D	0	-24.6687	16.4069	0.83677	0.0:0.0:0.0:1.0	.	490;513	E9PGJ7;Q16236	.;NF2L2_HUMAN	I	497;513;490;241	ENSP00000380253:N497I;ENSP00000380252:N513I;ENSP00000411575:N490I;ENSP00000391590:N241I	ENSP00000380252:N513I	N	-	2	0	NFE2L2	177804039	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.040000	0.89188	2.272000	0.75746	0.460000	0.39030	AAT		0.343	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164		6	74	0	0	0	0.001984	0	6	74				
TTN	7273	broad.mit.edu	37	2	179429007	179429007	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:179429007G>A	ENST00000591111.1	-	276	77153	c.76929C>T	c.(76927-76929)gtC>gtT	p.V25643V	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Silent_p.V18411V|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Silent_p.V18219V|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Silent_p.V27284V|TTN_ENST00000342992.6_Silent_p.V24716V|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Silent_p.V18344V			Q8WZ42	TITIN_HUMAN	titin	25643	Ig-like 125.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAACAACGATGACATCTTTAT	0.408																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(74146-74148)GTC>GTT		titin isoform N2-A							146.0	143.0	144.0					2																	179429007		1919	4133	6052	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179429007G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76929C>T	2.37:g.179429007G>A			Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.V18411V|TTN_uc010zfi.1_Silent_p.V18344V|TTN_uc010zfj.1_Silent_p.V18219V	p.V24716V	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	74372	-			25643					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.74148C>T																																																																																					0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		18	152	0	0	0	0.00499	0	18	152				
TTN	7273	broad.mit.edu	37	2	179462356	179462356	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:179462356C>G	ENST00000591111.1	-	244	52754	c.52530G>C	c.(52528-52530)aaG>aaC	p.K17510N	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K10278N|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K10086N|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K19151N|TTN_ENST00000342992.6_Missense_Mutation_p.K16583N|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K10211N			Q8WZ42	TITIN_HUMAN	titin	17510	Ig-like 103.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGGCAGTTCTTGATGACCA	0.438																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(49747-49749)AAG>AAC		titin isoform N2-A							128.0	116.0	120.0					2																	179462356		1936	4137	6073	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179462356C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52530G>C	2.37:g.179462356C>G	ENSP00000465570:p.Lys17510Asn		Somatic				uc002umo.2_RNA|uc002ump.1_RNA|TTN_uc010zfh.1_Missense_Mutation_p.K10278N|TTN_uc010zfi.1_Missense_Mutation_p.K10211N|TTN_uc010zfj.1_Missense_Mutation_p.K10086N	p.K16583N	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		243	49973	-			17510					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.49749G>C		.	.	.	.	.	.	.	.	.	.	C	13.81	2.348030	0.41599	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	6.07	3.99	0.46301	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72961	0.3526	L	0.45698	1.435	0.44175	D	0.996982	D;D;D;D	0.58268	0.982;0.982;0.982;0.982	P;P;P;P	0.59825	0.864;0.864;0.864;0.864	T	0.76605	-0.2898	9	0.87932	D	0	.	13.8461	0.63468	0.0:0.8572:0.0:0.1428	.	10086;10211;10278;17510	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	16583;10086;10278;10211;10084	ENSP00000343764:K16583N;ENSP00000434586:K10086N;ENSP00000340554:K10278N;ENSP00000352154:K10211N	ENSP00000340554:K10278N	K	-	3	2	TTN	179170601	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.954000	0.29175	1.584000	0.49913	0.655000	0.94253	AAG		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		7	73	0	0	0	0.00308	0	7	73				
TTN	7273	broad.mit.edu	37	2	179477958	179477958	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:179477958C>G	ENST00000591111.1	-	214	44879	c.44655G>C	c.(44653-44655)ttG>ttC	p.L14885F	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L7653F|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.L7461F|TTN_ENST00000589042.1_Missense_Mutation_p.L16526F|TTN_ENST00000342992.6_Missense_Mutation_p.L13958F|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L7586F			Q8WZ42	TITIN_HUMAN	titin	14885	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATTTTCAGCCAACACACGGA	0.348																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(41872-41874)TTG>TTC		titin isoform N2-A							82.0	79.0	80.0					2																	179477958		1839	4086	5925	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179477958C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.44655G>C	2.37:g.179477958C>G	ENSP00000465570:p.Leu14885Phe		Somatic				uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.L7653F|TTN_uc010zfi.1_Missense_Mutation_p.L7586F|TTN_uc010zfj.1_Missense_Mutation_p.L7461F	p.L13958F	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		213	42098	-			14885					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.41874G>C		.	.	.	.	.	.	.	.	.	.	C	12.68	2.010003	0.35415	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.95	2.69	0.31865	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56202	0.1969	L	0.31526	0.94	0.45979	D	0.998793	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.56323	-0.7998	9	0.87932	D	0	.	7.3006	0.26418	0.1296:0.6614:0.0:0.209	.	7461;7586;7653;14885	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	13958;7461;7653;7586;7461	ENSP00000343764:L13958F;ENSP00000434586:L7461F;ENSP00000340554:L7653F;ENSP00000352154:L7586F	ENSP00000340554:L7653F	L	-	3	2	TTN	179186203	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.870000	0.28010	0.807000	0.34208	-0.244000	0.11960	TTG		0.348	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	26	0	0	0	0.001984	0	4	26				
ZNF804A	91752	broad.mit.edu	37	2	185802056	185802056	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:185802056G>T	ENST00000302277.6	+	4	2527	c.1933G>T	c.(1933-1935)Gct>Tct	p.A645S		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	645							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GCAGTATTTAGCTGCAGAGCA	0.353																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(1933-1935)GCT>TCT		zinc finger protein 804A							92.0	101.0	98.0					2																	185802056		2203	4297	6500	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185802056G>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1933G>T	2.37:g.185802056G>T	ENSP00000303252:p.Ala645Ser		Somatic					p.A645S	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	2527	+			645					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.1933G>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	0.970	-0.700571	0.03279	.	.	ENSG00000170396	ENST00000302277	T	0.04502	3.61	5.65	-3.11	0.05299	.	1.155900	0.06370	N	0.713440	T	0.02848	0.0085	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.47623	-0.9103	10	0.25751	T	0.34	-0.0814	1.0025	0.01480	0.3713:0.112:0.2907:0.226	.	645	Q7Z570	Z804A_HUMAN	S	645	ENSP00000303252:A645S	ENSP00000303252:A645S	A	+	1	0	ZNF804A	185510301	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.165000	0.16564	-0.447000	0.07138	-2.052000	0.00405	GCT		0.353	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		14	127	1	0	2.32078e-09	0.003163	3.49707e-09	14	127				
DNAH7	56171	broad.mit.edu	37	2	196737073	196737073	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:196737073G>A	ENST00000312428.6	-	40	6634	c.6534C>T	c.(6532-6534)ttC>ttT	p.F2178F		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2178	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CACGGAGGTTGAACAAGTAGT	0.403																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(6532-6534)TTC>TTT		dynein, axonemal, heavy chain 7							172.0	159.0	163.0					2																	196737073		1863	4099	5962	SO:0001819	synonymous_variant	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196737073G>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6534C>T	2.37:g.196737073G>A			Somatic					p.F2178F	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			40	6635	-			2178			AAA 3 (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	c.6534C>T	CCDS42794.1																																																																																				0.403	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		7	79	0	0	0	0.00308	0	7	79				
HECW2	57520	broad.mit.edu	37	2	197189815	197189815	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:197189815C>G	ENST00000260983.3	-	6	812	c.630G>C	c.(628-630)aaG>aaC	p.K210N	HECW2_ENST00000409111.1_Intron	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	210	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GAATTGACATCTTAAGATAAG	0.468																																							uc002utm.1		NA																	0				skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						c.(628-630)AAG>AAC		HECT, C2 and WW domain containing E3 ubiquitin							224.0	202.0	210.0					2																	197189815		2203	4300	6503	SO:0001583	missense	57520				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity	g.chr2:197189815C>G	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.630G>C	2.37:g.197189815C>G	ENSP00000260983:p.Lys210Asn		Somatic				HECW2_uc002utl.1_Intron	p.K210N	NM_020760	NP_065811	WXS	Illumina HiSeq	Unspecified	Q9P2P5	HECW2_HUMAN			6	813	-			210			C2.		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	c.630G>C	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531447	0.85706	.	.	ENSG00000138411	ENST00000260983	T	0.71698	-0.59	5.2	5.2	0.72013	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.152805	0.64402	D	0.000018	D	0.85195	0.5641	M	0.80183	2.485	0.58432	D	0.999993	D	0.89917	1.0	D	0.87578	0.998	D	0.85453	0.1162	9	.	.	.	.	18.9309	0.92564	0.0:1.0:0.0:0.0	.	210	Q9P2P5	HECW2_HUMAN	N	210	ENSP00000260983:K210N	.	K	-	3	2	HECW2	196898060	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.307000	0.43682	2.699000	0.92147	0.655000	0.94253	AAG		0.468	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760		22	153	0	0	0	0.001882	0	22	153				
ZDBF2	57683	broad.mit.edu	37	2	207172245	207172245	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:207172245C>G	ENST00000374423.3	+	5	3379	c.2993C>G	c.(2992-2994)tCa>tGa	p.S998*		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	998							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TTCAGTGGTTCAAAAACAAGT	0.373																																							uc002vbp.2		NA																	0				ovary(3)	3						c.(2992-2994)TCA>TGA		zinc finger, DBF-type containing 2							84.0	83.0	83.0					2																	207172245		1869	4094	5963	SO:0001587	stop_gained	57683						nucleic acid binding|zinc ion binding	g.chr2:207172245C>G	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2993C>G	2.37:g.207172245C>G	ENSP00000363545:p.Ser998*		Somatic					p.S998*	NM_020923	NP_065974	WXS	Illumina HiSeq	Unspecified	Q9HCK1	ZDBF2_HUMAN			5	3243	+			998					Q6ZNP7|Q6ZSN8	Nonsense_Mutation	SNP	ENST00000374423.3	37	c.2993C>G	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	C	40	8.474298	0.98827	.	.	ENSG00000204186	ENST00000374423	.	.	.	4.52	3.65	0.41850	.	0.000000	0.39210	N	0.001436	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	8.6305	0.33917	0.0:0.898:0.0:0.102	.	.	.	.	X	998	.	ENSP00000363545:S998X	S	+	2	0	ZDBF2	206880490	0.961000	0.32948	0.320000	0.25306	0.005000	0.04900	1.707000	0.37888	1.519000	0.48950	-0.136000	0.14681	TCA		0.373	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		9	77	0	0	0	0.004482	0	9	77				
CPS1	1373	broad.mit.edu	37	2	211507249	211507249	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:211507249C>T	ENST00000233072.5	+	25	3197	c.3001C>T	c.(3001-3003)Cgc>Tgc	p.R1001C	CPS1_ENST00000497121.1_3'UTR|CPS1_ENST00000430249.2_Missense_Mutation_p.R1007C|CPS1_ENST00000451903.2_Missense_Mutation_p.R550C	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1001					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.R1001S(1)|p.R1007S(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CTCTAGTATCCGCACACTGCG	0.453																																							uc002vee.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(3001-3003)CGC>TGC		carbamoyl-phosphate synthetase 1 isoform b							158.0	141.0	147.0					2																	211507249		2203	4300	6503	SO:0001583	missense	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211507249C>T	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3001C>T	2.37:g.211507249C>T	ENSP00000233072:p.Arg1001Cys		Somatic				CPS1_uc010fur.2_Missense_Mutation_p.R1007C|CPS1_uc010fus.2_Missense_Mutation_p.R550C	p.R1001C	NM_001875	NP_001866	WXS	Illumina HiSeq	Unspecified	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	25	3133	+			1001					B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	c.3001C>T	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644918	0.87859	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.98178	-4.77;-4.77;-4.77	6.16	6.16	0.99307	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99450	0.9805	H	0.97564	4.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98360	1.0548	10	0.87932	D	0	-5.99	20.8598	0.99761	0.0:1.0:0.0:0.0	.	1011;1001	Q59HF8;P31327	.;CPSM_HUMAN	C	1007;1009;1001;550	ENSP00000402608:R1007C;ENSP00000233072:R1001C;ENSP00000406136:R550C	ENSP00000233072:R1001C	R	+	1	0	CPS1	211215494	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.337000	0.59310	2.937000	0.99478	0.650000	0.86243	CGC		0.453	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			9	66	0	0	0	0.004482	0	9	66				
AAMP	14	broad.mit.edu	37	2	219129318	219129318	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:219129318C>A	ENST00000248450.4	-	11	1413	c.1243G>T	c.(1243-1245)Gtg>Ttg	p.V415L	AAMP_ENST00000420660.1_Missense_Mutation_p.V396L|AAMP_ENST00000444053.1_Missense_Mutation_p.V416L			Q13685	AAMP_HUMAN	angio-associated, migratory cell protein	415					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|positive regulation of endothelial cell migration (GO:0010595)|smooth muscle cell migration (GO:0014909)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(4)|ovary(2)|skin(1)	11		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGGTCACCACCAGGGAGGCA	0.582																																							uc002vhk.2		NA																	0				ovary(1)	1						c.(1243-1245)GTG>TTG		angio-associated, migratory cell protein							106.0	104.0	105.0					2																	219129318		2203	4300	6503	SO:0001583	missense	14				angiogenesis|cell differentiation|positive regulation of endothelial cell migration|smooth muscle cell migration	cell surface|cytoplasm|plasma membrane	heparin binding	g.chr2:219129318C>A	AB209790	CCDS33378.1	2q	2013-01-10			ENSG00000127837	ENSG00000127837		"""WD repeat domain containing"""	18	protein-coding gene	gene with protein product		603488				7743515	Standard	XM_005246325		Approved		uc002vhk.3	Q13685	OTTHUMG00000155202	ENST00000248450.4:c.1243G>T	2.37:g.219129318C>A	ENSP00000248450:p.Val415Leu		Somatic				AAMP_uc002vhj.2_Missense_Mutation_p.V396L|AAMP_uc010fvo.2_3'UTR|AAMP_uc002vhl.2_Missense_Mutation_p.V416L	p.V415L	NM_001087	NP_001078	WXS	Illumina HiSeq	Unspecified	Q13685	AAMP_HUMAN		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	11	1327	-		Renal(207;0.0474)	415			WD 8.		Q8WUJ9|Q96H92	Missense_Mutation	SNP	ENST00000248450.4	37	c.1243G>T	CCDS33378.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.84|16.84	3.233893|3.233893	0.58886|0.58886	.|.	.|.	ENSG00000127837|ENSG00000127837	ENST00000248450;ENST00000444053;ENST00000420660|ENST00000422731	T;T;T|.	0.50548|.	0.74;0.74;0.74|.	5.32|5.32	5.32|5.32	0.75619|0.75619	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.059118|.	0.64402|.	D|.	0.000002|.	T|T	0.46541|0.46541	0.1398|0.1398	N|N	0.05414|0.05414	-0.055|-0.055	0.48288|0.48288	D|D	0.999624|0.999624	B;B;B|.	0.21821|.	0.008;0.061;0.061|.	B;B;B|.	0.18561|.	0.01;0.022;0.014|.	T|T	0.42548|0.42548	-0.9445|-0.9445	10|5	0.02654|.	T|.	1|.	-14.0297|-14.0297	18.999|18.999	0.92826|0.92826	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	416;415;396|.	C9JEH3;Q13685;C9JG97|.	.;AAMP_HUMAN;.|.	L|C	415;416;396|169	ENSP00000248450:V415L;ENSP00000403343:V416L;ENSP00000416394:V396L|.	ENSP00000248450:V415L|.	V|W	-|-	1|3	0|0	AAMP|AAMP	218837562|218837562	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.725000|5.725000	0.68507|0.68507	2.492000|2.492000	0.84095|0.84095	0.655000|0.655000	0.94253|0.94253	GTG|TGG		0.582	AAMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338756.1	NM_001087		14	65	1	0	9.31168e-06	0.001855	1.36571e-05	14	65				
COL6A3	1293	broad.mit.edu	37	2	238262013	238262013	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:238262013C>G	ENST00000295550.4	-	25	7113	c.6661G>C	c.(6661-6663)Gag>Cag	p.E2221Q	COL6A3_ENST00000347401.3_Missense_Mutation_p.E2020Q|COL6A3_ENST00000346358.4_Missense_Mutation_p.E2021Q|COL6A3_ENST00000472056.1_Missense_Mutation_p.E1614Q|COL6A3_ENST00000409809.1_Missense_Mutation_p.E2015Q|COL6A3_ENST00000353578.4_Missense_Mutation_p.E2015Q	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2221	Collagen-like 3.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGCTCTCCCTCAAAGCCCGGC	0.512																																							uc002vwl.2		NA																	0				ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(6661-6663)GAG>CAG		alpha 3 type VI collagen isoform 1 precursor							66.0	60.0	62.0					2																	238262013		2203	4300	6503	SO:0001583	missense	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238262013C>G	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6661G>C	2.37:g.238262013C>G	ENSP00000295550:p.Glu2221Gln		Somatic				COL6A3_uc002vwo.2_Missense_Mutation_p.E2015Q|COL6A3_uc010znj.1_Missense_Mutation_p.E1614Q|COL6A3_uc002vwp.1_Missense_Mutation_p.E42Q	p.E2221Q	NM_004369	NP_004360	WXS	Illumina HiSeq	Unspecified	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	25	6946	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	2221			Triple-helical region.|Collagen-like 3.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	c.6661G>C	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	1.026	-0.683276	0.03353	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.93366	-3.21;-3.21;-3.21;-3.21;-3.21;-3.21	5.21	0.645	0.17782	.	0.772746	0.11051	N	0.605002	D	0.84110	0.5400	N	0.05259	-0.085	0.09310	N	1	B;B;B;B	0.09022	0.001;0.002;0.0;0.001	B;B;B;B	0.06405	0.001;0.001;0.002;0.001	T	0.66646	-0.5871	10	0.23302	T	0.38	.	13.8185	0.63306	0.109:0.6157:0.2753:0.0	.	1614;1614;2015;2221	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	Q	2221;2020;2015;1614;2015;2021	ENSP00000295550:E2221Q;ENSP00000315609:E2020Q;ENSP00000315873:E2015Q;ENSP00000418285:E1614Q;ENSP00000386844:E2015Q;ENSP00000295546:E2021Q	ENSP00000295550:E2221Q	E	-	1	0	COL6A3	237926752	0.000000	0.05858	0.001000	0.08648	0.158000	0.22134	0.225000	0.17757	-0.039000	0.13602	-2.241000	0.00287	GAG		0.512	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		6	49	0	0	0	0.001984	0	6	49				
COL6A3	1293	broad.mit.edu	37	2	238283578	238283578	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:238283578C>G	ENST00000295550.4	-	8	3608	c.3156G>C	c.(3154-3156)caG>caC	p.Q1052H	COL6A3_ENST00000347401.3_Missense_Mutation_p.Q851H|COL6A3_ENST00000392003.2_Missense_Mutation_p.Q645H|COL6A3_ENST00000392004.3_Missense_Mutation_p.Q846H|COL6A3_ENST00000346358.4_Missense_Mutation_p.Q852H|COL6A3_ENST00000472056.1_Missense_Mutation_p.Q445H|COL6A3_ENST00000409809.1_Missense_Mutation_p.Q846H|COL6A3_ENST00000353578.4_Missense_Mutation_p.Q846H	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1052	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCACCACTCTCTGGACAAACT	0.582																																							uc002vwl.2		NA																	0				ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(3154-3156)CAG>CAC		alpha 3 type VI collagen isoform 1 precursor							48.0	51.0	50.0					2																	238283578		2203	4300	6503	SO:0001583	missense	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238283578C>G	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3156G>C	2.37:g.238283578C>G	ENSP00000295550:p.Gln1052His		Somatic				COL6A3_uc002vwo.2_Missense_Mutation_p.Q846H|COL6A3_uc010znj.1_Missense_Mutation_p.Q445H|COL6A3_uc002vwq.2_Missense_Mutation_p.Q846H|COL6A3_uc002vwr.2_Missense_Mutation_p.Q645H	p.Q1052H	NM_004369	NP_004360	WXS	Illumina HiSeq	Unspecified	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	8	3441	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	1052			Nonhelical region.|VWFA 6.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	c.3156G>C	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118038	0.56505	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	D;D;D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.33	4.45	0.53987	von Willebrand factor, type A (3);	0.259866	0.27031	N	0.021274	D	0.84955	0.5587	L	0.39147	1.195	0.42982	D	0.994461	D;P;P;D;P	0.71674	0.994;0.922;0.922;0.998;0.896	D;P;P;D;P	0.72982	0.979;0.908;0.866;0.976;0.776	T	0.83117	-0.0120	10	0.35671	T	0.21	.	9.2032	0.37272	0.0:0.7913:0.0:0.2087	.	445;645;846;846;1052	E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;CO6A3_HUMAN	H	1052;851;846;445;846;852;846;645	ENSP00000295550:Q1052H;ENSP00000315609:Q851H;ENSP00000315873:Q846H;ENSP00000418285:Q445H;ENSP00000386844:Q846H;ENSP00000295546:Q852H;ENSP00000375861:Q846H;ENSP00000375860:Q645H	ENSP00000295550:Q1052H	Q	-	3	2	COL6A3	237948317	0.985000	0.35326	0.996000	0.52242	0.764000	0.43329	0.237000	0.17985	1.386000	0.46466	-0.140000	0.14226	CAG		0.582	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		6	82	0	0	0	0.001168	0	6	82				
KLHL30	377007	broad.mit.edu	37	2	239054455	239054455	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:239054455G>C	ENST00000409223.1	+	5	1239	c.1132G>C	c.(1132-1134)Gag>Cag	p.E378Q	KLHL30_ENST00000305959.4_Missense_Mutation_p.E360Q			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	378										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CCTCAATGGGGAGATCTACGT	0.662																																							uc002vxr.1		NA																	0					0						c.(1078-1080)GAG>CAG		kelch-like 30							24.0	33.0	30.0					2																	239054455		2047	4177	6224	SO:0001583	missense	377007							g.chr2:239054455G>C		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1132G>C	2.37:g.239054455G>C	ENSP00000386389:p.Glu378Gln		Somatic					p.E360Q	NM_198582	NP_940984	WXS	Illumina HiSeq	Unspecified	Q0D2K2	KLH30_HUMAN		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)	4	1111	+		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)	378			Kelch 3.		Q6ZUS1	Missense_Mutation	SNP	ENST00000409223.1	37	c.1078G>C	CCDS46555.2	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324542	0.60634	.	.	ENSG00000168427	ENST00000409223;ENST00000305959	T;T	0.78481	-1.18;-1.18	4.62	4.62	0.57501	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.73946	0.3652	N	0.03209	-0.39	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	T	0.77101	-0.2712	10	0.28530	T	0.3	.	16.2395	0.82399	0.0:0.0:1.0:0.0	.	378	Q0D2K2	KLH30_HUMAN	Q	378;360	ENSP00000386389:E378Q;ENSP00000302386:E360Q	ENSP00000302386:E360Q	E	+	1	0	KLHL30	238719194	1.000000	0.71417	0.999000	0.59377	0.717000	0.41224	6.561000	0.73955	2.113000	0.64589	0.542000	0.68232	GAG		0.662	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328518.1	NM_198582		3	22	0	0	0	0.004672	0	3	22				
SEPT2	4735	broad.mit.edu	37	2	242265435	242265435	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:242265435G>A	ENST00000391973.2	+	3	565	c.37G>A	c.(37-39)Gaa>Aaa	p.E13K	SEPT2_ENST00000407971.1_5'UTR|SEPT2_ENST00000401990.1_Missense_Mutation_p.E13K|SEPT2_ENST00000402092.2_Missense_Mutation_p.E13K|SEPT2_ENST00000391971.2_Missense_Mutation_p.E13K|SEPT2_ENST00000360051.3_Missense_Mutation_p.E13K	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	13					cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)			central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		TATAAATCCAGAAACACCTGG	0.348																																							uc002wbc.2		NA																	0				central_nervous_system(1)	1						c.(37-39)GAA>AAA		septin 2							70.0	70.0	70.0					2																	242265435		2203	4300	6503	SO:0001583	missense	4735				cell division|mitosis	actin cytoskeleton|cleavage furrow|condensed chromosome kinetochore|midbody|nucleolus|septin complex|spindle	GTP binding	g.chr2:242265435G>A	D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.37G>A	2.37:g.242265435G>A	ENSP00000375834:p.Glu13Lys		Somatic				SEPT2_uc002wbd.2_Missense_Mutation_p.E13K|SEPT2_uc002wbf.2_Missense_Mutation_p.E13K|SEPT2_uc002wbg.2_Missense_Mutation_p.E13K|SEPT2_uc002wbh.2_Missense_Mutation_p.E13K|SEPT2_uc010zop.1_Missense_Mutation_p.E48K	p.E13K	NM_001008491	NP_001008491	WXS	Illumina HiSeq	Unspecified	Q15019	SEPT2_HUMAN		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)	4	458	+		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)	13					B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Missense_Mutation	SNP	ENST00000391973.2	37	c.37G>A	CCDS2548.1	.	.	.	.	.	.	.	.	.	.	G	18.70	3.680728	0.68042	.	.	ENSG00000168385	ENST00000391973;ENST00000360051;ENST00000428524;ENST00000445030;ENST00000391971;ENST00000401990;ENST00000436795;ENST00000411484;ENST00000434955;ENST00000402092;ENST00000441533;ENST00000437066;ENST00000429791;ENST00000420786;ENST00000391972;ENST00000449239	T;T;T;T;T;T;T;T;T;T	0.63417	0.7;0.7;0.7;0.7;-0.02;-0.04;-0.02;0.7;-0.02;0.56	6.03	5.16	0.70880	.	0.047924	0.85682	D	0.000000	T	0.53061	0.1773	L	0.35723	1.085	0.80722	D	1	B;P	0.45474	0.317;0.859	B;B	0.43680	0.124;0.427	T	0.50491	-0.8822	10	0.08179	T	0.78	.	15.4242	0.75038	0.0664:0.0:0.9336:0.0	.	48;13	Q15019-2;Q15019	.;SEPT2_HUMAN	K	13;13;13;13;13;13;13;24;13;13;13;13;13;13;48;13	ENSP00000375834:E13K;ENSP00000353157:E13K;ENSP00000375832:E13K;ENSP00000385109:E13K;ENSP00000406181:E13K;ENSP00000394666:E24K;ENSP00000399767:E13K;ENSP00000385172:E13K;ENSP00000412434:E13K;ENSP00000391717:E13K	ENSP00000353157:E13K	E	+	1	0	SEPT2	241914108	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.273000	0.95719	1.555000	0.49500	0.655000	0.94253	GAA		0.348	SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323177.3	NM_006155		4	35	0	0	0	0.000602	0	4	35				
THAP4	51078	broad.mit.edu	37	2	242572898	242572898	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr2:242572898C>T	ENST00000407315.1	-	2	1105	c.674G>A	c.(673-675)gGa>gAa	p.G225E		NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	225							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		CGCCCCAGATCCTGGGGGCGT	0.557																																							uc002wbt.2		NA																	0					0						c.(673-675)GGA>GAA		THAP domain containing 4 isoform 1							78.0	89.0	85.0					2																	242572898		2203	4296	6499	SO:0001583	missense	51078						DNA binding|metal ion binding	g.chr2:242572898C>T	AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.674G>A	2.37:g.242572898C>T	ENSP00000385006:p.Gly225Glu		Somatic					p.G225E	NM_015963	NP_057047	WXS	Illumina HiSeq	Unspecified	Q8WY91	THAP4_HUMAN		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)	2	897	-		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)	225					Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Missense_Mutation	SNP	ENST00000407315.1	37	c.674G>A	CCDS2551.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129671	0.56721	.	.	ENSG00000176946	ENST00000407315	D	0.96265	-3.96	5.09	5.09	0.68999	.	0.506503	0.17726	N	0.164079	D	0.95053	0.8398	L	0.29908	0.895	0.47441	D	0.999423	D	0.59767	0.986	P	0.56343	0.796	D	0.94141	0.7397	10	0.72032	D	0.01	-35.2872	9.3358	0.38049	0.1504:0.6834:0.1662:0.0	.	225	Q8WY91	THAP4_HUMAN	E	225	ENSP00000385006:G225E	ENSP00000385006:G225E	G	-	2	0	THAP4	242221571	0.175000	0.23083	0.201000	0.23476	0.972000	0.66771	1.163000	0.31798	2.553000	0.86117	0.655000	0.94253	GGA		0.557	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257267.3	NM_015963		14	112	0	0	0	0.00245	0	14	112				
PLCB1	23236	broad.mit.edu	37	20	8639341	8639341	+	Silent	SNP	C	C	T	rs147648227		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr20:8639341C>T	ENST00000338037.6	+	9	879	c.852C>T	c.(850-852)ctC>ctT	p.L284L	PLCB1_ENST00000378637.2_Silent_p.L284L|PLCB1_ENST00000378641.3_Silent_p.L284L	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	284					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.L284L(1)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						ACAACAGCCTCGCCAGAAAAG	0.443																																							uc002wnb.2		NA																	1	Substitution - coding silent(1)	p.L284L(1)	skin(1)	ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						c.(850-852)CTC>CTT		phosphoinositide-specific phospholipase C beta 1		C	,	1,4405	2.1+/-5.4	0,1,2202	119.0	104.0	109.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	852,852	-3.4	1.0	20	dbSNP_134	109	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PLCB1	NM_015192.2,NM_182734.1	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	284/1217,284/1174	8639341	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23236				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity	g.chr20:8639341C>T	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.852C>T	20.37:g.8639341C>T			Somatic				PLCB1_uc010zrb.1_Silent_p.L183L|PLCB1_uc002wna.2_Silent_p.L284L|PLCB1_uc002wnc.1_Silent_p.L183L	p.L284L	NM_015192	NP_056007	WXS	Illumina HiSeq	Unspecified	Q9NQ66	PLCB1_HUMAN			9	855	+			284					D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	37	c.852C>T	CCDS13102.1																																																																																				0.443	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			6	61	0	0	0	0.00308	0	6	61				
DSTN	11034	broad.mit.edu	37	20	17581458	17581458	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr20:17581458G>C	ENST00000246069.7	+	2	425	c.79G>C	c.(79-81)Gaa>Caa	p.E27Q	DSTN_ENST00000474024.1_Missense_Mutation_p.E10Q	NM_006870.3	NP_006861.1	P60981	DEST_HUMAN	destrin (actin depolymerizing factor)	27	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament depolymerization (GO:0030042)|actin filament severing (GO:0051014)|actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|positive regulation of actin filament depolymerization (GO:0030836)	actin cytoskeleton (GO:0015629)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(5)|lung(8)|skin(1)	15						CTCCACACCAGAAGAAATCAA	0.383																																							uc002wpr.2		NA																	0				large_intestine(1)|skin(1)	2						c.(79-81)GAA>CAA		destrin isoform a							48.0	49.0	49.0					20																	17581458		2203	4298	6501	SO:0001583	missense	11034				actin filament severing|actin polymerization or depolymerization		actin binding	g.chr20:17581458G>C	S65738	CCDS13127.1, CCDS46580.1	20p12.1	2010-08-20			ENSG00000125868	ENSG00000125868			15750	protein-coding gene	gene with protein product		609114				8399167, 2156828	Standard	NM_006870		Approved	ADF, ACTDP	uc002wpr.3	P60981	OTTHUMG00000031947	ENST00000246069.7:c.79G>C	20.37:g.17581458G>C	ENSP00000246069:p.Glu27Gln		Somatic				DSTN_uc002wpq.2_Missense_Mutation_p.E10Q|DSTN_uc010gck.2_Missense_Mutation_p.E10Q	p.E27Q	NM_006870	NP_006861	WXS	Illumina HiSeq	Unspecified	P60981	DEST_HUMAN			2	334	+			27			ADF-H.		B2R6N2|B4DYA6|P18282|Q5W166|Q6IAW2	Missense_Mutation	SNP	ENST00000246069.7	37	c.79G>C	CCDS13127.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.945007	0.92593	.	.	ENSG00000125868	ENST00000246069;ENST00000543261	D;T	0.83837	-1.77;1.36	5.65	5.65	0.86999	Actin-binding, cofilin/tropomyosin type (3);	0.051198	0.85682	D	0.000000	D	0.90923	0.7147	M	0.88570	2.965	0.58432	D	0.999999	P	0.49185	0.92	P	0.53861	0.736	D	0.92266	0.5821	10	0.87932	D	0	-28.0505	18.716	0.91675	0.0:0.0:1.0:0.0	.	27	P60981	DEST_HUMAN	Q	27;10	ENSP00000246069:E27Q;ENSP00000444808:E10Q	ENSP00000246069:E27Q	E	+	1	0	DSTN	17529458	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.771000	0.98977	2.681000	0.91329	0.563000	0.77884	GAA		0.383	DSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078131.6	NM_001011546		8	50	0	0	0	0.00308	0	8	50				
RALGAPA2	57186	broad.mit.edu	37	20	20501653	20501653	+	Missense_Mutation	SNP	T	T	G	rs75943391		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr20:20501653T>G	ENST00000202677.7	-	31	3999	c.3992A>C	c.(3991-3993)gAc>gCc	p.D1331A		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1331					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						CAGGAAGGGGTCATAATCCGT	0.493																																							uc002wrz.2		NA																	0				ovary(1)	1						c.(3991-3993)GAC>GCC		akt substrate AS250							103.0	108.0	106.0					20																	20501653		1996	4188	6184	SO:0001583	missense	57186				activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity	g.chr20:20501653T>G	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.3992A>C	20.37:g.20501653T>G	ENSP00000202677:p.Asp1331Ala		Somatic				RALGAPA2_uc010gcx.2_Missense_Mutation_p.D1035A|RALGAPA2_uc010zsg.1_Missense_Mutation_p.D779A|RALGAPA2_uc002wsa.1_Missense_Mutation_p.D103A	p.D1331A	NM_020343	NP_065076	WXS	Illumina HiSeq	Unspecified	Q2PPJ7	RGPA2_HUMAN			31	4135	-			1331					Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	ENST00000202677.7	37	c.3992A>C	CCDS46584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	29.1|29.1	4.981416|4.981416	0.93044|0.93044	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000202677|ENST00000430436	T|.	0.29917|.	1.55|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.103529|.	0.64402|.	D|.	0.000003|.	T|T	0.77253|0.77253	0.4103|0.4103	M|M	0.79258|0.79258	2.445|2.445	0.58432|0.58432	D|D	0.999993|0.999993	D;D;D|.	0.63880|.	0.993;0.99;0.981|.	P;P;P|.	0.62649|.	0.905;0.779;0.844|.	T|T	0.77627|0.77627	-0.2517|-0.2517	10|5	0.87932|.	D|.	0|.	.|.	16.8222|16.8222	0.85835|0.85835	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1169;1331;1331|.	A8MSM5;Q2PPJ7-2;Q2PPJ7|.	.;.;RGPA2_HUMAN|.	A|P	1331|1148	ENSP00000202677:D1331A|.	ENSP00000202677:D1331A|.	D|T	-|-	2|1	0|0	RALGAPA2|RALGAPA2	20449653|20449653	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.013000|8.013000	0.88655|0.88655	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	GAC|ACC		0.493	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343		10	70	0	0	0	0.002445	0	10	70				
NINL	22981	broad.mit.edu	37	20	25459684	25459684	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr20:25459684G>A	ENST00000278886.6	-	16	2149	c.2076C>T	c.(2074-2076)ggC>ggT	p.G692G	NINL_ENST00000422516.1_Silent_p.G692G	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	692					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GCTCCTGCAGGCCCCAGATGA	0.692																																							uc002wux.1		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(2074-2076)GGC>GGT		ninein-like							41.0	45.0	44.0					20																	25459684		2203	4300	6503	SO:0001819	synonymous_variant	22981				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding	g.chr20:25459684G>A		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.2076C>T	20.37:g.25459684G>A			Somatic				NINL_uc010gdn.1_Silent_p.G692G|NINL_uc010gdo.1_Silent_p.G475G	p.G692G	NM_025176	NP_079452	WXS	Illumina HiSeq	Unspecified	Q9Y2I6	NINL_HUMAN			16	2150	-			692			Potential.		A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	ENST00000278886.6	37	c.2076C>T	CCDS33452.1																																																																																				0.692	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176		7	64	0	0	0	0.004482	0	7	64				
MROH8	140699	broad.mit.edu	37	20	35752146	35752146	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr20:35752146G>A	ENST00000400441.3	-	15	1841	c.1842C>T	c.(1840-1842)ttC>ttT	p.F614F	MROH8_ENST00000441008.2_Silent_p.F600F|MROH8_ENST00000217333.8_Silent_p.F443F			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	0																	GAAAGAGTCGGAACGTAGCTG	0.498																																							uc010zvu.1		NA																	0					0						c.(1870-1872)TTC>TTT		hypothetical protein LOC140699 isoform 1							104.0	103.0	103.0					20																	35752146		2043	4193	6236	SO:0001819	synonymous_variant	140699							g.chr20:35752146G>A	AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1842C>T	20.37:g.35752146G>A			Somatic				C20orf132_uc002xgk.2_Silent_p.F246F	p.F624F	NM_152503	NP_689716	WXS	Illumina HiSeq	Unspecified	Q9H579	CT132_HUMAN			17	1963	-		Myeloproliferative disorder(115;0.00878)	Error:Variant_position_missing_in_Q9H579_after_alignment					Q5JYQ6	Silent	SNP	ENST00000400441.3	37	c.1872C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.244|6.244	0.413064|0.413064	0.11812|0.11812	.|.	.|.	ENSG00000101353|ENSG00000101353	ENST00000417458|ENST00000343811	.|.	.|.	.|.	5.4|5.4	4.25|4.25	0.50352|0.50352	.|.	.|.	.|.	.|.	.|.	T|T	0.60599|0.60599	0.2281|0.2281	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.57418|0.57418	-0.7815|-0.7815	4|4	.|.	.|.	.|.	-9.5265|-9.5265	9.9136|9.9136	0.41421|0.41421	0.1084:0.0:0.8916:0.0|0.1084:0.0:0.8916:0.0	.|.	.|.	.|.	.|.	S|F	242|641	.|.	.|.	P|S	-|-	1|2	0|0	C20orf132|C20orf132	35185560|35185560	0.993000|0.993000	0.37304|0.37304	0.997000|0.997000	0.53966|0.53966	0.656000|0.656000	0.38851|0.38851	1.412000|1.412000	0.34714|0.34714	2.541000|2.541000	0.85698|0.85698	0.491000|0.491000	0.48974|0.48974	CCG|TCC		0.498	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503		8	56	0	0	0	0.00308	0	8	56				
MATN4	8785	broad.mit.edu	37	20	43926892	43926892	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr20:43926892G>A	ENST00000372754.1	-	7	1475	c.1467C>T	c.(1465-1467)aaC>aaT	p.N489N	MATN4_ENST00000372756.1_Silent_p.N448N|MATN4_ENST00000360607.6_Silent_p.N407N|MATN4_ENST00000372751.4_Silent_p.N299N|MATN4_ENST00000353917.5_Silent_p.N366N|MATN4_ENST00000342716.4_Silent_p.N448N|MATN4_ENST00000537548.1_Silent_p.N448N			O95460	MATN4_HUMAN	matrilin 4	489	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				CACGAGGCACGTTAAGGGCAC	0.657																																							uc002xnn.2		NA																	0					0						c.(1342-1344)AAC>AAT		matrilin 4 isoform 1 precursor							67.0	58.0	61.0					20																	43926892		2203	4299	6502	SO:0001819	synonymous_variant	8785					extracellular region	protein binding	g.chr20:43926892G>A	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.1467C>T	20.37:g.43926892G>A			Somatic				MATN4_uc002xno.2_Silent_p.N407N|MATN4_uc002xnp.2_Silent_p.N366N|MATN4_uc010zwr.1_Silent_p.N396N|MATN4_uc002xnr.1_Silent_p.N448N	p.N448N	NM_003833	NP_003824	WXS	Illumina HiSeq	Unspecified	O95460	MATN4_HUMAN			7	1531	-		Myeloproliferative disorder(115;0.0122)	489			VWFA 2.		A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Silent	SNP	ENST00000372754.1	37	c.1344C>T																																																																																					0.657	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1			5	62	0	0	0	0.000602	0	5	62				
CDH22	64405	broad.mit.edu	37	20	44869617	44869617	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr20:44869617C>T	ENST00000372262.3	-	2	935	c.535G>A	c.(535-537)Gag>Aag	p.E179K	CDH22_ENST00000537909.1_Missense_Mutation_p.E179K	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	179	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GGTGAGAGCTCGGCCACGCTG	0.622																																							uc002xrm.2		NA																	0				ovary(4)|skin(1)	5						c.(535-537)GAG>AAG		cadherin 22 precursor							33.0	26.0	29.0					20																	44869617		2203	4300	6503	SO:0001583	missense	64405				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr20:44869617C>T	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.535G>A	20.37:g.44869617C>T	ENSP00000361336:p.Glu179Lys		Somatic				CDH22_uc010ghk.1_Missense_Mutation_p.E179K	p.E179K	NM_021248	NP_067071	WXS	Illumina HiSeq	Unspecified	Q9UJ99	CAD22_HUMAN			2	936	-		Myeloproliferative disorder(115;0.0122)	179			Extracellular (Potential).|Cadherin 2.		B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	c.535G>A	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	17.97	3.518933	0.64634	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.76316	-1.01;-1.01	4.43	4.43	0.53597	Cadherin (4);Cadherin-like (1);	0.125082	0.52532	D	0.000061	D	0.92257	0.7544	H	0.97707	4.06	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94942	0.8092	10	0.87932	D	0	.	16.604	0.84823	0.0:1.0:0.0:0.0	.	179	Q9UJ99	CAD22_HUMAN	K	179	ENSP00000361336:E179K;ENSP00000437790:E179K	ENSP00000361336:E179K	E	-	1	0	CDH22	44303024	1.000000	0.71417	0.986000	0.45419	0.125000	0.20455	7.168000	0.77570	2.480000	0.83734	0.462000	0.41574	GAG		0.622	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248		4	37	0	0	0	0.000248	0	4	37				
TMPRSS15	5651	broad.mit.edu	37	21	19670055	19670055	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr21:19670055G>A	ENST00000284885.3	-	19	2290	c.2257C>T	c.(2257-2259)Ccc>Tcc	p.P753S		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	753	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						ACCCACCTGGGTGTTAGTATT	0.418																																							uc002ykw.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(2257-2259)CCC>TCC		enterokinase precursor							106.0	92.0	96.0					21																	19670055		2203	4300	6503	SO:0001583	missense	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19670055G>A		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2257C>T	21.37:g.19670055G>A	ENSP00000284885:p.Pro753Ser		Somatic					p.P753S	NM_002772	NP_002763	WXS	Illumina HiSeq	Unspecified	P98073	ENTK_HUMAN			19	2288	-			753			Extracellular (Potential).|SRCR.		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.2257C>T	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103017	0.56183	.	.	ENSG00000154646	ENST00000284885	T	0.27104	1.69	5.77	4.89	0.63831	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.218024	0.40144	N	0.001174	T	0.33235	0.0856	M	0.66939	2.045	0.45272	D	0.998274	P	0.38395	0.629	B	0.44315	0.446	T	0.06552	-1.0820	9	.	.	.	.	10.4456	0.44493	0.0884:0.0:0.9116:0.0	.	753	P98073	ENTK_HUMAN	S	753	ENSP00000284885:P753S	.	P	-	1	0	TMPRSS15	18591926	1.000000	0.71417	0.988000	0.46212	0.800000	0.45204	2.079000	0.41577	1.444000	0.47605	0.643000	0.83706	CCC		0.418	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		5	40	0	0	0	0.000602	0	5	40				
CLDN17	26285	broad.mit.edu	37	21	31538736	31538736	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr21:31538736T>C	ENST00000286808.3	-	1	235	c.200A>G	c.(199-201)tAt>tGt	p.Y67C		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	67					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						CAAGGAGCTATAGAACTTGCA	0.542																																							uc011acv.1		NA																	0				ovary(2)	2						c.(199-201)TAT>TGT		claudin 17							81.0	88.0	86.0					21																	31538736		2203	4300	6503	SO:0001583	missense	26285				calcium-independent cell-cell adhesion|tight junction assembly	Golgi apparatus|integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr21:31538736T>C	AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.200A>G	21.37:g.31538736T>C	ENSP00000286808:p.Tyr67Cys		Somatic					p.Y67C	NM_012131	NP_036263	WXS	Illumina HiSeq	Unspecified	P56750	CLD17_HUMAN			1	200	-			67			Extracellular (Potential).		Q3MJB5|Q6UY37	Missense_Mutation	SNP	ENST00000286808.3	37	c.200A>G	CCDS13586.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311042	0.60414	.	.	ENSG00000156282	ENST00000286808	D	0.89485	-2.52	5.22	5.22	0.72569	.	0.122533	0.56097	D	0.000024	D	0.96253	0.8778	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97485	1.0050	10	0.87932	D	0	.	15.2382	0.73447	0.0:0.0:0.0:1.0	.	67	P56750	CLD17_HUMAN	C	67	ENSP00000286808:Y67C	ENSP00000286808:Y67C	Y	-	2	0	CLDN17	30460607	1.000000	0.71417	0.909000	0.35828	0.377000	0.30045	7.783000	0.85696	2.326000	0.78906	0.533000	0.62120	TAT		0.542	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182261.1	NM_012131		20	88	0	0	0	0.008871	0	20	88				
CABIN1	23523	broad.mit.edu	37	22	24509680	24509680	+	Missense_Mutation	SNP	C	C	T	rs181934556		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr22:24509680C>T	ENST00000398319.2	+	27	4650	c.4265C>T	c.(4264-4266)aCg>aTg	p.T1422M	CABIN1_ENST00000405822.2_Missense_Mutation_p.T1343M|CABIN1_ENST00000263119.5_Missense_Mutation_p.T1422M	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1422					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GCAGGAGCGACGGGTAAAGAT	0.517													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20800	0.0		0.0	False		,,,				2504	0.0						uc002zzi.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(4264-4266)ACG>ATG		calcineurin binding protein 1							77.0	78.0	78.0					22																	24509680		2203	4300	6503	SO:0001583	missense	23523				cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity	g.chr22:24509680C>T	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.4265C>T	22.37:g.24509680C>T	ENSP00000381364:p.Thr1422Met		Somatic				CABIN1_uc002zzj.1_Missense_Mutation_p.T1343M|CABIN1_uc002zzl.1_Missense_Mutation_p.T1422M	p.T1422M	NM_012295	NP_036427	WXS	Illumina HiSeq	Unspecified	Q9Y6J0	CABIN_HUMAN			27	4392	+			1422					G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	c.4265C>T	CCDS13823.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	3.709	-0.059906	0.07317	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.64618	0.11;-0.11;0.11	4.23	-1.14	0.09741	.	0.718598	0.13619	N	0.374547	T	0.34629	0.0904	N	0.14661	0.345	0.09310	N	1	P;P	0.47409	0.895;0.832	B;B	0.36666	0.23;0.115	T	0.27123	-1.0083	10	0.46703	T	0.11	.	5.7642	0.18217	0.0:0.4163:0.3285:0.2552	.	1343;1422	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	M	1422;1343;1422	ENSP00000263119:T1422M;ENSP00000384694:T1343M;ENSP00000381364:T1422M	ENSP00000263119:T1422M	T	+	2	0	CABIN1	22839680	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.599000	0.24089	-0.158000	0.11040	-0.143000	0.13931	ACG		0.517	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295		5	111	0	0	0	0.000602	0	5	111				
MORC2	22880	broad.mit.edu	37	22	31328534	31328534	+	Silent	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr22:31328534G>C	ENST00000397641.3	-	23	3153	c.2745C>G	c.(2743-2745)ctC>ctG	p.L915L	MORC2_ENST00000215862.4_Silent_p.L853L|MORC2-AS1_ENST00000441558.1_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	915						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						ACATGTACCGGAGGATCTGGA	0.562																																							uc003aje.1		NA																	0				ovary(1)|pancreas(1)	2						c.(2557-2559)CTC>CTG		MORC family CW-type zinc finger 2							112.0	94.0	100.0					22																	31328534		2203	4300	6503	SO:0001819	synonymous_variant	22880						ATP binding|zinc ion binding	g.chr22:31328534G>C	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2745C>G	22.37:g.31328534G>C			Somatic					p.L853L	NM_014941	NP_055756	WXS	Illumina HiSeq	Unspecified	Q9Y6X9	MORC2_HUMAN			24	3923	-			915					B2RNB1|Q9UF28|Q9Y6V2	Silent	SNP	ENST00000397641.3	37	c.2559C>G		.	.	.	.	.	.	.	.	.	.	G	1.769	-0.484754	0.04352	.	.	ENSG00000133422	ENST00000445980	.	.	.	5.82	-3.31	0.04988	.	.	.	.	.	T	0.51363	0.1670	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50857	-0.8778	4	.	.	.	.	8.1221	0.30978	0.5136:0.1061:0.3803:0.0	.	.	.	.	A	77	.	.	P	-	1	0	MORC2	29658534	0.988000	0.35896	0.995000	0.50966	0.162000	0.22319	0.155000	0.16362	-0.161000	0.10983	-0.291000	0.09656	CCG		0.562	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941		13	61	0	0	0	0.001368	0	13	61				
CBY1	25776	broad.mit.edu	37	22	39069240	39069240	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr22:39069240G>A	ENST00000216029.3	+	5	514	c.380G>A	c.(379-381)tGa>tAa	p.*127*	RP3-508I15.9_ENST00000422408.2_RNA|RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.9_ENST00000412067.1_RNA|RP3-508I15.9_ENST00000444381.1_RNA	NM_015373.3	NP_056188.1	Q9Y3M2	CBY1_HUMAN	chibby homolog 1 (Drosophila)	0					cardiac muscle cell differentiation (GO:0055007)|cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein localization (GO:0008104)	ciliary basal body (GO:0036064)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-catenin binding (GO:0008013)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	Melanoma(58;0.04)					AAGAGAAAATGAAGACCCCAG	0.458																																							uc003awb.2		NA																	0				ovary(1)	1						c.(379-381)TGA>TAA		PKD2 interactor, golgi and endoplasmic reticulum							78.0	70.0	73.0					22																	39069240		2203	4300	6503	SO:0001819	synonymous_variant	25776				cardiac muscle cell differentiation|fat cell differentiation|negative regulation of transcription, DNA-dependent|protein localization	nuclear speck|trans-Golgi network	beta-catenin binding|identical protein binding	g.chr22:39069240G>A	BK005534	CCDS13974.1, CCDS74861.1	22q12	2014-02-06	2007-01-26	2007-01-26	ENSG00000100211	ENSG00000100211			1307	protein-coding gene	gene with protein product	"""chibby CTNNB1-mediated transcription inhibitor"""	607757	"""chromosome 22 open reading frame 2"", ""PKD2 interactor, golgi and endoplasmic reticulum associated 1"""	C22orf2, PGEA1		10591208, 15194699	Standard	NM_015373		Approved	PIGEA14, PIGEA-14, Chibby, Cby	uc003awb.4	Q9Y3M2	OTTHUMG00000150990	ENST00000216029.3:c.380G>A	22.37:g.39069240G>A			Somatic				CBY1_uc003awc.2_Silent_p.*127*|uc003awd.2_Intron	p.*127*	NM_001002880	NP_001002880	WXS	Illumina HiSeq	Unspecified	Q9Y3M2	CBY1_HUMAN			6	656	+	Melanoma(58;0.04)		127					B2R4S2|Q66GT6|Q9UIK9	Silent	SNP	ENST00000216029.3	37	c.380G>A	CCDS13974.1																																																																																				0.458	CBY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320832.1	NM_015373		8	38	0	0	0	0.004482	0	8	38				
APOBEC3D	140564	broad.mit.edu	37	22	39421648	39421648	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr22:39421648C>A	ENST00000216099.8	+	4	984	c.577C>A	c.(577-579)Ctg>Atg	p.L193M	APOBEC3D_ENST00000381568.4_Missense_Mutation_p.L193M|APOBEC3D_ENST00000427494.2_Intron	NM_152426.3	NP_689639.2	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D	193					defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)	11	Melanoma(58;0.04)					TTATGCATCCCTGCACCGCAC	0.522																																							uc011aoe.1		NA																	0					0						c.(577-579)CTG>ATG		apolipoprotein B mRNA editing enzyme, catalytic							304.0	264.0	278.0					22																	39421648		2203	4300	6503	SO:0001583	missense	140564				negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding	g.chr22:39421648C>A	BF832090	CCDS46709.1	22q13.1	2012-10-19	2008-05-01		ENSG00000243811	ENSG00000243811		"""Apolipoprotein B mRNA editing enzymes"""	17354	protein-coding gene	gene with protein product		609900	"""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (putative)"", ""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3E pseudogene"""	APOBEC3E		11863358	Standard	NM_152426		Approved	ARP6, APOBEC3DE	uc003awt.4	Q96AK3	OTTHUMG00000151084	ENST00000216099.8:c.577C>A	22.37:g.39421648C>A	ENSP00000216099:p.Leu193Met		Somatic				APOBEC3D_uc011aod.1_Missense_Mutation_p.L262M|APOBEC3D_uc011aof.1_Intron|APOBEC3D_uc003awu.3_Intron|APOBEC3D_uc003awt.3_Missense_Mutation_p.L193M|APOBEC3D_uc010gxu.2_Intron	p.L193M	NM_152426	NP_689639	WXS	Illumina HiSeq	Unspecified	Q96AK3	ABC3D_HUMAN			4	631	+	Melanoma(58;0.04)		193					Q5JZ91|Q7Z2N2|Q7Z2N5|Q7Z2N6	Missense_Mutation	SNP	ENST00000216099.8	37	c.577C>A	CCDS46709.1	.	.	.	.	.	.	.	.	.	.	.	11.61	1.691309	0.30052	.	.	ENSG00000243811	ENST00000381568;ENST00000216099	T;T	0.65916	-0.18;-0.18	2.44	-2.54	0.06307	APOBEC-like, C-terminal (1);	.	.	.	.	T	0.77226	0.4099	M	0.88906	2.99	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66143	-0.5997	9	0.72032	D	0.01	.	6.3888	0.21576	0.0:0.4128:0.0:0.5872	.	193	Q96AK3	ABC3D_HUMAN	M	193	ENSP00000370980:L193M;ENSP00000216099:L193M	ENSP00000216099:L193M	L	+	1	2	APOBEC3D	37751594	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.338000	0.07842	-0.550000	0.06183	0.536000	0.68110	CTG		0.522	APOBEC3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321232.2	NM_152426		6	212	1	0	0.00198382	0.001984	0.00283403	6	212				
TNFRSF13C	115650	broad.mit.edu	37	22	42321382	42321382	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr22:42321382C>T	ENST00000291232.3	-	3	588	c.544G>A	c.(544-546)Gag>Aag	p.E182K	MIR378I_ENST00000582688.1_RNA|CTA-250D10.23_ENST00000566575.1_lincRNA	NM_052945.3	NP_443177.1	Q96RJ3	TR13C_HUMAN	tumor necrosis factor receptor superfamily, member 13C	182					B cell costimulation (GO:0031296)|B cell homeostasis (GO:0001782)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of germinal center formation (GO:0002636)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				lung(2)|urinary_tract(1)	3						TATTGTTGCTCAGGGCCGGCC	0.637																																							uc003bbl.2		NA																	0					0						c.(544-546)GAG>AAG		BAFF receptor							24.0	25.0	25.0					22																	42321382		2202	4299	6501	SO:0001583	missense	115650					integral to membrane	receptor activity	g.chr22:42321382C>T	AF373846	CCDS14024.1	22q13.1-q13.3	2014-09-17			ENSG00000159958	ENSG00000159958		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	17755	protein-coding gene	gene with protein product		606269				11509692	Standard	NM_052945		Approved	BAFFR, CD268	uc003bbl.2	Q96RJ3	OTTHUMG00000151271	ENST00000291232.3:c.544G>A	22.37:g.42321382C>T	ENSP00000291232:p.Glu182Lys		Somatic				WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|TNFRSF13C_uc010gyp.1_Missense_Mutation_p.E183K	p.E182K	NM_052945	NP_443177	WXS	Illumina HiSeq	Unspecified	Q96RJ3	TR13C_HUMAN			3	588	-			182			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000291232.3	37	c.544G>A	CCDS14024.1	.	.	.	.	.	.	.	.	.	.	C	33	5.200530	0.94997	.	.	ENSG00000159958	ENST00000291232	T	0.41400	1.0	5.22	5.22	0.72569	.	0.000000	0.51477	D	0.000093	T	0.48926	0.1527	L	0.29908	0.895	0.25964	N	0.982586	D;D	0.61697	0.99;0.99	P;P	0.60068	0.868;0.868	T	0.44817	-0.9303	10	0.87932	D	0	-24.1169	14.6456	0.68759	0.0:1.0:0.0:0.0	.	182;182	Q5H8V1;Q96RJ3	.;TR13C_HUMAN	K	182	ENSP00000291232:E182K	ENSP00000291232:E182K	E	-	1	0	TNFRSF13C	40651328	0.814000	0.29104	0.966000	0.40874	0.454000	0.32378	3.436000	0.52856	2.604000	0.88044	0.655000	0.94253	GAG		0.637	TNFRSF13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322046.1			4	22	0	0	0	0.000248	0	4	22				
OXTR	5021	broad.mit.edu	37	3	8809434	8809434	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:8809434G>A	ENST00000316793.3	-	3	1064	c.440C>T	c.(439-441)tCg>tTg	p.S147L	CAV3_ENST00000472766.1_Intron	NM_000916.3	NP_000907.2	P30559	OXYR_HUMAN	oxytocin receptor	147					cell surface receptor signaling pathway (GO:0007166)|digestive tract development (GO:0048565)|eating behavior (GO:0042755)|ERK1 and ERK2 cascade (GO:0070371)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|heart development (GO:0007507)|lactation (GO:0007595)|maternal behavior (GO:0042711)|maternal process involved in parturition (GO:0060137)|memory (GO:0007613)|muscle contraction (GO:0006936)|negative regulation of gastric acid secretion (GO:0060455)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of norepinephrine secretion (GO:0010701)|positive regulation of penile erection (GO:0060406)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of uterine smooth muscle contraction (GO:0070474)|response to amphetamine (GO:0001975)|response to anoxia (GO:0034059)|response to cocaine (GO:0042220)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|sleep (GO:0030431)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|suckling behavior (GO:0001967)|telencephalon development (GO:0021537)	apical plasma membrane (GO:0016324)|cell-cell adherens junction (GO:0005913)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	oxytocin receptor activity (GO:0004990)|peptide hormone binding (GO:0017046)|vasopressin receptor activity (GO:0005000)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)|Oxytocin(DB00107)	GCGGCGCAGCGAGCGCAGCGG	0.692																																							uc003brc.2		NA																	0					0						c.(439-441)TCG>TTG		oxytocin receptor	Carbetocin(DB01282)						12.0	16.0	14.0					3																	8809434		2165	4242	6407	SO:0001583	missense	5021				female pregnancy|lactation|muscle contraction	integral to plasma membrane	oxytocin receptor activity|vasopressin receptor activity	g.chr3:8809434G>A		CCDS2570.1	3p25	2012-08-08			ENSG00000180914	ENSG00000180914		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	8529	protein-coding gene	gene with protein product		167055				1313946	Standard	NM_000916		Approved		uc003brc.3	P30559	OTTHUMG00000090537	ENST00000316793.3:c.440C>T	3.37:g.8809434G>A	ENSP00000324270:p.Ser147Leu		Somatic					p.S147L	NM_000916	NP_000907	WXS	Illumina HiSeq	Unspecified	P30559	OXYR_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.15)	3	1062	-			147			Cytoplasmic (Potential).		Q15071	Missense_Mutation	SNP	ENST00000316793.3	37	c.440C>T	CCDS2570.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781831	0.49891	.	.	ENSG00000180914	ENST00000316793	T	0.37235	1.21	5.02	3.22	0.36961	GPCR, rhodopsin-like superfamily (1);	0.549106	0.21454	N	0.074291	T	0.37758	0.1015	M	0.72479	2.2	0.41194	D	0.986323	B	0.21147	0.052	B	0.21708	0.036	T	0.22730	-1.0208	10	0.54805	T	0.06	-4.1895	10.5463	0.45062	0.1587:0.0:0.8413:0.0	.	147	P30559	OXYR_HUMAN	L	147	ENSP00000324270:S147L	ENSP00000324270:S147L	S	-	2	0	OXTR	8784434	0.999000	0.42202	0.180000	0.23079	0.518000	0.34316	5.666000	0.68059	0.527000	0.28560	0.313000	0.20887	TCG		0.692	OXTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207061.2			4	24	0	0	0	0.000602	0	4	24				
TTLL3	26140	broad.mit.edu	37	3	9870813	9870813	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:9870813G>A	ENST00000547186.1	+	10	1504	c.1288G>A	c.(1288-1290)Gat>Aat	p.D430N	TTLL3_ENST00000466245.1_3'UTR|TTLL3_ENST00000397241.1_Missense_Mutation_p.D218N|TTLL3_ENST00000426895.4_Missense_Mutation_p.D573N|TTLL3_ENST00000430793.1_Missense_Mutation_p.D218N|TTLL3_ENST00000427853.3_Missense_Mutation_p.D218N|ARPC4-TTLL3_ENST00000397256.1_Missense_Mutation_p.D491N|TTLL3_ENST00000383827.1_Missense_Mutation_p.D218N|TTLL3_ENST00000455274.1_Missense_Mutation_p.D218N	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	430	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					TGGCATGAAGGATGCTGTGAT	0.587																																							uc003btg.2		NA																	0				large_intestine(2)	2						c.(1288-1290)GAT>AAT		tubulin tyrosine ligase-like family, member 3							136.0	106.0	116.0					3																	9870813		2203	4300	6503	SO:0001583	missense	26140				axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity	g.chr3:9870813G>A		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.1288G>A	3.37:g.9870813G>A	ENSP00000446659:p.Asp430Asn		Somatic				ARPC4_uc003btc.1_Missense_Mutation_p.D74N|TTLL3_uc003btd.3_Missense_Mutation_p.D397N|TTLL3_uc003btf.3_Missense_Mutation_p.D162N|TTLL3_uc010hco.1_Missense_Mutation_p.D366N|TTLL3_uc003bth.3_Missense_Mutation_p.D218N|TTLL3_uc011atj.1_Missense_Mutation_p.D366N|TTLL3_uc003btj.3_Missense_Mutation_p.D218N|TTLL3_uc003bti.3_Missense_Mutation_p.D218N	p.D430N	NM_001025930	NP_001021100	WXS	Illumina HiSeq	Unspecified	Q9Y4R7	TTLL3_HUMAN			10	1504	+	Medulloblastoma(99;0.227)		430			TTL.		Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Missense_Mutation	SNP	ENST00000547186.1	37	c.1288G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.64|10.64	1.408215|1.408215	0.25378|0.25378	.|.	.|.	ENSG00000250151;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021|ENSG00000214021	ENST00000397256;ENST00000426895;ENST00000547186;ENST00000397241;ENST00000427853;ENST00000443148;ENST00000383827;ENST00000455274;ENST00000430793|ENST00000310252	T;T;T;T;T;T;T;T;T|.	0.08634|.	3.07;3.07;3.07;3.07;3.07;3.07;3.07;3.07;3.07|.	4.93|4.93	4.06|4.06	0.47325|0.47325	.|.	0.323633|.	0.27936|.	U|.	0.017254|.	T|T	0.30039|0.30039	0.0752|0.0752	N|N	0.13327|0.13327	0.33|0.33	0.25637|0.25637	N|N	0.986243|0.986243	B;B;B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0;0.0;0.0|.	B;B;B;B;B;B|.	0.09377|.	0.002;0.0;0.002;0.004;0.0;0.002|.	T|T	0.18398|0.18398	-1.0338|-1.0338	10|5	0.19147|.	T|.	0.46|.	.|.	13.116|13.116	0.59299|0.59299	0.0788:0.0:0.9212:0.0|0.0788:0.0:0.9212:0.0	.|.	369;218;218;430;491;218|.	B4DM47;Q9Y4R7-2;Q9Y4R7-5;Q9Y4R7;E7ETI0;C9JSD3|.	.;.;.;TTLL3_HUMAN;.;.|.	N|E	491;573;430;218;218;368;218;218;218|385	ENSP00000380427:D491N;ENSP00000392549:D573N;ENSP00000446659:D430N;ENSP00000380416:D218N;ENSP00000394462:D218N;ENSP00000398097:D368N;ENSP00000373338:D218N;ENSP00000409632:D218N;ENSP00000403874:D218N|.	ENSP00000380416:D218N|.	D|G	+|+	1|2	0|0	ARPC4-TTLL3;TTLL3|TTLL3	9845813|9845813	0.984000|0.984000	0.35163|0.35163	0.979000|0.979000	0.43373|0.43373	0.730000|0.730000	0.41778|0.41778	1.469000|1.469000	0.35343|0.35343	1.080000|1.080000	0.41073|0.41073	-0.244000|-0.244000	0.11960|0.11960	GAT|GGA		0.587	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2		6	34	0	0	0	0.001168	0	6	34				
SEC13	6396	broad.mit.edu	37	3	10346800	10346800	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:10346800C>G	ENST00000350697.3	-	7	750	c.625G>C	c.(625-627)Gaa>Caa	p.E209Q	SEC13_ENST00000337354.4_Missense_Mutation_p.E212Q|SEC13_ENST00000397117.1_Missense_Mutation_p.E195Q|SEC13_ENST00000397109.3_Missense_Mutation_p.E195Q|SEC13_ENST00000383801.2_Missense_Mutation_p.E255Q|SEC13_ENST00000492602.1_5'Flank	NM_183352.1	NP_899195.1	P55735	SEC13_HUMAN	SEC13 homolog (S. cerevisiae)	209					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17						CTGTGCGCTTCTAGCTTCTGC	0.642																																							uc003bvn.2		NA																	0				ovary(1)	1						c.(625-627)GAA>CAA		SEC13 protein isoform 1							121.0	106.0	111.0					3																	10346800		2203	4300	6503	SO:0001583	missense	6396				COPII vesicle coating|intracellular protein transport|mitotic prometaphase|mRNA transport|post-translational protein modification|protein N-linked glycosylation via asparagine|transmembrane transport	cytosol|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Nup107-160 complex	protein binding	g.chr3:10346800C>G		CCDS2599.1, CCDS46751.1, CCDS63540.1	3p25-p24	2013-01-10	2006-11-07	2006-11-07	ENSG00000157020	ENSG00000157020		"""WD repeat domain containing"""	10697	protein-coding gene	gene with protein product		600152	"""SEC13 (S. cerevisiae)-like 1"", ""SEC13-like 1 (S. cerevisiae)"""	D3S1231E, SEC13L1		7987303	Standard	NM_183352		Approved	SEC13R, npp-20	uc003bvn.3	P55735	OTTHUMG00000128671	ENST00000350697.3:c.625G>C	3.37:g.10346800C>G	ENSP00000312122:p.Glu209Gln		Somatic				SEC13_uc003bvl.2_Missense_Mutation_p.E141Q|SEC13_uc003bvm.2_Missense_Mutation_p.E195Q|SEC13_uc003bvp.2_Missense_Mutation_p.E212Q|SEC13_uc003bvo.2_Missense_Mutation_p.E255Q|SEC13_uc003bvq.1_Missense_Mutation_p.E195Q|SEC13_uc003bvr.1_Missense_Mutation_p.E195Q	p.E209Q	NM_183352	NP_899195	WXS	Illumina HiSeq	Unspecified	P55735	SEC13_HUMAN			7	744	-			209					A8MV37|B4DXJ1|Q5BJF0|Q9BRM6|Q9BUG7	Missense_Mutation	SNP	ENST00000350697.3	37	c.625G>C	CCDS2599.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237216	0.58886	.	.	ENSG00000157020	ENST00000397109;ENST00000337354;ENST00000350697;ENST00000397117;ENST00000383801	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;0.18;0.18	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.47284	0.1437	N	0.20401	0.57	0.80722	D	1	P;B;B;B	0.35348	0.496;0.095;0.256;0.294	B;B;B;B	0.32465	0.146;0.107;0.054;0.144	T	0.42716	-0.9435	9	.	.	.	.	17.1466	0.86767	0.0:1.0:0.0:0.0	.	209;195;255;209	E9PHR5;A8MXL6;B4DXJ1;P55735	.;.;.;SEC13_HUMAN	Q	195;212;209;195;255	ENSP00000380298:E195Q;ENSP00000336566:E212Q;ENSP00000312122:E209Q;ENSP00000380306:E195Q;ENSP00000373312:E255Q	.	E	-	1	0	SEC13	10321800	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	7.709000	0.84645	2.646000	0.89796	0.655000	0.94253	GAA		0.642	SEC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250563.3			7	34	0	0	0	0.001984	0	7	34				
LSM3	27258	broad.mit.edu	37	3	14223145	14223145	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:14223145A>T	ENST00000306024.3	+	2	610	c.107A>T	c.(106-108)gAc>gTc	p.D36V	XPC_ENST00000285021.7_5'Flank	NM_014463.2	NP_055278.1	P62310	LSM3_HUMAN	LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)	36					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|large_intestine(2)|ovary(1)	4						ATGAGAAATGACCGAGAGCTT	0.413																																							uc003byn.2		NA																	0				ovary(1)	1						c.(106-108)GAC>GTC		Lsm3 protein							106.0	113.0	110.0					3																	14223145		2203	4300	6503	SO:0001583	missense	27258				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	catalytic step 2 spliceosome|cytosol	protein binding|RNA binding	g.chr3:14223145A>T	AF182289	CCDS2619.1	3p25.1	2012-08-15			ENSG00000170860	ENSG00000170860			17874	protein-coding gene	gene with protein product		607283				10369684	Standard	NM_014463		Approved	YLR438C, SMX4, USS2	uc003byn.3	P62310	OTTHUMG00000129838	ENST00000306024.3:c.107A>T	3.37:g.14223145A>T	ENSP00000302160:p.Asp36Val		Somatic				XPC_uc011ave.1_5'Flank|XPC_uc011avf.1_5'Flank|XPC_uc011avg.1_5'Flank	p.D36V	NM_014463	NP_055278	WXS	Illumina HiSeq	Unspecified	P62310	LSM3_HUMAN			2	136	+			36					Q6IAH0|Q9Y4Z1	Missense_Mutation	SNP	ENST00000306024.3	37	c.107A>T	CCDS2619.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.828318	0.90955	.	.	ENSG00000170860	ENST00000306024	T	0.47869	0.83	5.5	5.5	0.81552	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.74596	0.3737	M	0.91768	3.24	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.81346	-0.0974	10	0.87932	D	0	-10.2167	15.2865	0.73833	1.0:0.0:0.0:0.0	.	36	P62310	LSM3_HUMAN	V	36	ENSP00000302160:D36V	ENSP00000302160:D36V	D	+	2	0	LSM3	14198149	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.432000	0.90288	2.084000	0.62774	0.533000	0.62120	GAC		0.413	LSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252078.3	NM_014463		17	101	0	0	0	0.004007	0	17	101				
SUSD5	26032	broad.mit.edu	37	3	33194491	33194491	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:33194491C>T	ENST00000309558.3	-	5	2050	c.1633G>A	c.(1633-1635)Gaa>Aaa	p.E545K		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	545					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CCGGGGCCTTCCTGTCCAAAG	0.582																																							uc003cfo.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1633-1635)GAA>AAA		sushi domain containing 5 precursor							76.0	79.0	78.0					3																	33194491		2062	4215	6277	SO:0001583	missense	26032				cell adhesion	integral to membrane	hyaluronic acid binding	g.chr3:33194491C>T	AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.1633G>A	3.37:g.33194491C>T	ENSP00000308727:p.Glu545Lys		Somatic					p.E545K	NM_015551	NP_056366	WXS	Illumina HiSeq	Unspecified	O60279	SUSD5_HUMAN			5	2051	-			545			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000309558.3	37	c.1633G>A	CCDS46787.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.771344	0.49680	.	.	ENSG00000173705	ENST00000309558	T	0.10763	2.84	5.8	4.03	0.46877	.	0.061577	0.64402	D	0.000007	T	0.12646	0.0307	M	0.67953	2.075	0.40052	D	0.975788	P	0.43169	0.8	B	0.36534	0.227	T	0.03130	-1.1069	10	0.59425	D	0.04	-13.567	10.8764	0.46913	0.0:0.8547:0.0:0.1453	.	545	O60279	SUSD5_HUMAN	K	545	ENSP00000308727:E545K	ENSP00000308727:E545K	E	-	1	0	SUSD5	33169495	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	3.893000	0.56243	0.807000	0.34208	-0.142000	0.14014	GAA		0.582	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054		4	16	0	0	0	0.000248	0	4	16				
SLC22A14	9389	broad.mit.edu	37	3	38348012	38348012	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:38348012G>C	ENST00000273173.4	+	1	586	c.495G>C	c.(493-495)aaG>aaC	p.K165N	SLC22A14_ENST00000448498.1_Missense_Mutation_p.K165N|RNU6-235P_ENST00000362644.1_RNA	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	165					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)	p.K165N(1)		central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		CTGACGCTAAGAAGCGATCGC	0.498																																							uc010hhc.1		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(493-495)AAG>AAC		organic cation transporter like 4							119.0	108.0	112.0					3																	38348012		2203	4300	6503	SO:0001583	missense	9389					integral to plasma membrane	organic cation transmembrane transporter activity	g.chr3:38348012G>C	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.495G>C	3.37:g.38348012G>C	ENSP00000273173:p.Lys165Asn		Somatic				SLC22A14_uc003cia.2_Missense_Mutation_p.K165N|SLC22A14_uc003cib.2_Missense_Mutation_p.K165N|SLC22A14_uc011ayo.1_RNA	p.K165N	NM_004803	NP_004794	WXS	Illumina HiSeq	Unspecified	Q9Y267	S22AE_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)	2	537	+			165			Extracellular (Potential).		A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	ENST00000273173.4	37	c.495G>C	CCDS2677.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714431	0.48622	.	.	ENSG00000144671	ENST00000466887;ENST00000448498;ENST00000423219;ENST00000273173	T;T;T	0.66638	-0.22;0.02;0.02	5.06	0.79	0.18613	Major facilitator superfamily domain (1);	0.760161	0.13229	N	0.403775	T	0.63885	0.2549	L	0.55213	1.73	0.09310	N	1	P	0.43662	0.814	P	0.47915	0.561	T	0.53005	-0.8499	10	0.39692	T	0.17	.	6.8334	0.23923	0.1679:0.2739:0.5583:0.0	.	165	Q9Y267	S22AE_HUMAN	N	33;165;165;165	ENSP00000442528:K33N;ENSP00000396283:K165N;ENSP00000273173:K165N	ENSP00000273173:K165N	K	+	3	2	SLC22A14	38323016	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.488000	0.22371	0.017000	0.15025	-0.345000	0.07892	AAG		0.498	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253742.3	NM_004803		16	90	0	0	0	0.00499	0	16	90				
ZKSCAN7	55888	broad.mit.edu	37	3	44611964	44611964	+	Silent	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:44611964C>G	ENST00000273320.3	+	6	1791	c.1362C>G	c.(1360-1362)ctC>ctG	p.L454L	ZKSCAN7_ENST00000341840.3_Intron|RP11-944L7.5_ENST00000419137.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000431636.1_Intron|ZKSCAN7_ENST00000426540.1_Silent_p.L454L	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	454					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCTCCCATCTCATTCAACACC	0.473																																						Esophageal Squamous(121;907 1626 38429 48584 52774)	uc010hin.2		NA																	0				ovary(2)	2						c.(1360-1362)CTC>CTG		zinc finger protein 167 isoform 1							39.0	41.0	40.0					3																	44611964		2200	4297	6497	SO:0001819	synonymous_variant	55888				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:44611964C>G	L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1362C>G	3.37:g.44611964C>G			Somatic				ZNF167_uc003cnh.2_RNA|ZNF167_uc003cni.2_Intron|ZNF167_uc010hio.2_Silent_p.L303L|ZNF167_uc003cnj.2_Silent_p.L454L|ZNF167_uc003cnk.2_Intron	p.L454L	NM_018651	NP_061121	WXS	Illumina HiSeq	Unspecified	Q9P0L1	ZN167_HUMAN		KIRC - Kidney renal clear cell carcinoma(197;0.0486)|Kidney(197;0.0609)	6	1750	+			454			C2H2-type 3.		A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Silent	SNP	ENST00000273320.3	37	c.1362C>G	CCDS2715.1																																																																																				0.473	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651		9	40	0	0	0	0.008291	0	9	40				
FYCO1	79443	broad.mit.edu	37	3	46008734	46008734	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:46008734T>C	ENST00000296137.2	-	8	2297	c.2092A>G	c.(2092-2094)Aag>Gag	p.K698E	FYCO1_ENST00000535325.1_Missense_Mutation_p.K698E	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	698					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		ATGGCCTCCTTCTCTGCCATC	0.622																																							uc003cpb.3		NA																	0				central_nervous_system(1)	1						c.(2092-2094)AAG>GAG		FYVE and coiled-coil domain containing 1							104.0	110.0	108.0					3																	46008734		2203	4300	6503	SO:0001583	missense	79443				transport	integral to membrane	metal ion binding|protein binding	g.chr3:46008734T>C	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2092A>G	3.37:g.46008734T>C	ENSP00000296137:p.Lys698Glu		Somatic				FYCO1_uc011bal.1_Missense_Mutation_p.K698E	p.K698E	NM_024513	NP_078789	WXS	Illumina HiSeq	Unspecified	Q9BQS8	FYCO1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)	8	2298	-			698			Potential.		B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	c.2092A>G	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.990701	0.74589	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.25579	1.79;1.8	5.77	5.77	0.91146	.	0.155179	0.56097	D	0.000027	T	0.42063	0.1186	M	0.64997	1.995	0.40100	D	0.976362	D;D	0.59767	0.986;0.986	P;P	0.56216	0.794;0.79	T	0.29119	-1.0022	10	0.44086	T	0.13	-52.5633	14.6637	0.68891	0.0:0.0:0.0:1.0	.	698;698	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	E	698	ENSP00000296137:K698E;ENSP00000441178:K698E	ENSP00000296137:K698E	K	-	1	0	FYCO1	45983738	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.208000	0.51114	2.208000	0.71279	0.533000	0.62120	AAG		0.622	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513		18	150	0	0	0	0.001523	0	18	150				
XCR1	2829	broad.mit.edu	37	3	46063107	46063107	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:46063107G>A	ENST00000309285.3	-	2	689	c.333C>T	c.(331-333)atC>atT	p.I111I	XCR1_ENST00000542109.1_Silent_p.I111I	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	111					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		TGTAGAGGCTGATGGAGAAGA	0.582																																							uc003cpe.2		NA																	0				ovary(1)	1						c.(331-333)ATC>ATT		XC chemokine receptor 1							70.0	76.0	74.0					3																	46063107		2203	4300	6503	SO:0001819	synonymous_variant	2829				chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity	g.chr3:46063107G>A		CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.333C>T	3.37:g.46063107G>A			Somatic				uc003cpd.1_5'Flank|XCR1_uc003cpf.2_Silent_p.I111I	p.I111I	NM_005283	NP_005274	WXS	Illumina HiSeq	Unspecified	P46094	XCR1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)	3	557	-			111			Helical; Name=3; (Potential).			Silent	SNP	ENST00000309285.3	37	c.333C>T	CCDS2736.1																																																																																				0.582	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257322.2			5	12	0	0	0	0.000602	0	5	12				
EPHA3	2042	broad.mit.edu	37	3	89499479	89499479	+	Silent	SNP	G	G	C	rs145084709	byFrequency	TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:89499479G>C	ENST00000336596.2	+	15	2874	c.2649G>C	c.(2647-2649)cgG>cgC	p.R883R	EPHA3_ENST00000494014.1_Silent_p.R883R	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	883					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AGCTTATCCGGAATCCCGGCA	0.468										TSP Lung(6;0.00050)																													uc003dqy.2		NA																	0				lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(2647-2649)CGG>CGC		ephrin receptor EphA3 isoform a precursor							77.0	70.0	72.0					3																	89499479		2203	4300	6503	SO:0001819	synonymous_variant	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89499479G>C	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2649G>C	3.37:g.89499479G>C		TSP Lung(6;0.00050)	Somatic				EPHA3_uc010hon.1_RNA	p.R883R	NM_005233	NP_005224	WXS	Illumina HiSeq	Unspecified	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	15	2874	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	883			Cytoplasmic (Potential).		Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	c.2649G>C	CCDS2922.1																																																																																				0.468	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		11	68	0	0	0	0.001368	0	11	68				
PARP9	83666	broad.mit.edu	37	3	122269548	122269548	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:122269548C>G	ENST00000360356.2	-	6	1541	c.1314G>C	c.(1312-1314)aaG>aaC	p.K438N	PARP9_ENST00000462315.1_Missense_Mutation_p.K403N|PARP9_ENST00000477522.2_Missense_Mutation_p.K403N|PARP9_ENST00000492382.1_Intron|PARP9_ENST00000471785.1_Missense_Mutation_p.K403N	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	438	Macro 2. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		CTGTTTCCTTCTTTATTTCCA	0.348																																							uc010hri.2		NA																	0				ovary(1)|pancreas(1)|prostate(1)|skin(1)	4						c.(1312-1314)AAG>AAC		poly (ADP-ribose) polymerase family, member 9							105.0	105.0	105.0					3																	122269548		2203	4300	6503	SO:0001583	missense	83666				cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding	g.chr3:122269548C>G	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.1314G>C	3.37:g.122269548C>G	ENSP00000353512:p.Lys438Asn		Somatic				PARP9_uc003eff.3_Missense_Mutation_p.K403N|PARP9_uc011bjs.1_Missense_Mutation_p.K403N|PARP9_uc003efg.2_Intron|PARP9_uc003efi.2_Missense_Mutation_p.K403N|PARP9_uc003efh.2_Missense_Mutation_p.K438N|PARP9_uc003efj.2_Missense_Mutation_p.K403N	p.K438N	NM_001146102	NP_001139574	WXS	Illumina HiSeq	Unspecified	Q8IXQ6	PARP9_HUMAN		GBM - Glioblastoma multiforme(114;0.0519)	6	1459	-			438			Macro 2.		A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Missense_Mutation	SNP	ENST00000360356.2	37	c.1314G>C	CCDS3014.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.312446	0.23908	.	.	ENSG00000138496	ENST00000360356;ENST00000477522;ENST00000471785;ENST00000452457;ENST00000462315	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	4.19	-2.37	0.06643	Appr-1-p processing (3);	5.013630	0.00166	N	0.000000	T	0.15609	0.0376	N	0.24115	0.695	0.09310	N	1	P;B;P	0.44344	0.833;0.014;0.799	P;B;B	0.45971	0.499;0.008;0.297	T	0.06215	-1.0839	10	0.38643	T	0.18	.	0.274	0.00235	0.2874:0.1659:0.2861:0.2606	.	403;438;403	E9PFM7;Q8IXQ6;Q8IXQ6-2	.;PARP9_HUMAN;.	N	438;403;403;361;403	ENSP00000353512:K438N;ENSP00000419506:K403N;ENSP00000419001:K403N;ENSP00000418894:K403N	ENSP00000353512:K438N	K	-	3	2	PARP9	123752238	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-2.971000	0.00668	-0.368000	0.08040	0.655000	0.94253	AAG		0.348	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458		4	33	0	0	0	0.000248	0	4	33				
EIF4G1	1981	broad.mit.edu	37	3	184039405	184039405	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:184039405C>T	ENST00000346169.2	+	10	1304	c.1033C>T	c.(1033-1035)Ctc>Ttc	p.L345F	EIF4G1_ENST00000441154.1_Missense_Mutation_p.L181F|EIF4G1_ENST00000435046.2_Missense_Mutation_p.L149F|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000382330.3_Missense_Mutation_p.L352F|EIF4G1_ENST00000424196.1_Missense_Mutation_p.L352F|EIF4G1_ENST00000319274.6_Missense_Mutation_p.L345F|EIF4G1_ENST00000414031.1_Missense_Mutation_p.L305F|EIF4G1_ENST00000411531.1_Missense_Mutation_p.L305F|EIF4G1_ENST00000434061.2_Missense_Mutation_p.L149F|EIF4G1_ENST00000350481.5_Missense_Mutation_p.L181F|EIF4G1_ENST00000392537.2_Missense_Mutation_p.L258F|EIF4G1_ENST00000342981.4_Missense_Mutation_p.L345F|EIF4G1_ENST00000352767.3_Missense_Mutation_p.L352F|EIF4G1_ENST00000427845.1_Missense_Mutation_p.L258F	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	345					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TTCCAGTCCTCTCCAGGCTCC	0.527																																							uc003fnp.2		NA																	0				lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(1033-1035)CTC>TTC		eukaryotic translation initiation factor 4							93.0	91.0	91.0					3																	184039405		2203	4300	6503	SO:0001583	missense	1981				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity	g.chr3:184039405C>T	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1033C>T	3.37:g.184039405C>T	ENSP00000316879:p.Leu345Phe		Somatic				EIF4G1_uc003fno.1_Missense_Mutation_p.L286F|EIF4G1_uc010hxw.1_Missense_Mutation_p.L181F|EIF4G1_uc003fnt.2_Missense_Mutation_p.L56F|EIF4G1_uc003fnq.2_Missense_Mutation_p.L258F|EIF4G1_uc003fnr.2_Missense_Mutation_p.L181F|EIF4G1_uc010hxx.2_Missense_Mutation_p.L352F|EIF4G1_uc003fns.2_Missense_Mutation_p.L305F|EIF4G1_uc010hxy.2_Missense_Mutation_p.L352F|EIF4G1_uc003fnv.3_Missense_Mutation_p.L345F|EIF4G1_uc003fnu.3_Missense_Mutation_p.L345F|EIF4G1_uc003fnw.2_Missense_Mutation_p.L352F|EIF4G1_uc003fnx.2_Missense_Mutation_p.L149F|EIF4G1_uc003fny.3_Missense_Mutation_p.L149F	p.L345F	NM_198241	NP_937884	WXS	Illumina HiSeq	Unspecified	Q04637	IF4G1_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		10	1231	+	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		345					D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	c.1033C>T	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327375	0.41197	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000427607;ENST00000457456;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.49432	3.95;3.93;3.86;2.82;2.82;3.94;2.98;3.77;3.94;3.86;3.94;3.95;3.94;3.94;2.41;3.77;3.77;0.78;1.21;3.76	5.17	2.17	0.27698	.	0.666305	0.14193	N	0.335202	T	0.34978	0.0916	N	0.24115	0.695	0.33380	D	0.574678	P;P;P;B	0.48162	0.906;0.61;0.906;0.077	B;B;B;B	0.44224	0.444;0.157;0.444;0.034	T	0.47169	-0.9138	10	0.41790	T	0.15	-2.4862	10.0162	0.42016	0.1416:0.5833:0.2752:0.0	.	352;345;345;352	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	F	345;305;258;345;352;352;286;181;352;258;345;345;352;305;181;181;149;149;149;149	ENSP00000316879:L345F;ENSP00000391935:L305F;ENSP00000376320:L258F;ENSP00000391412:L345F;ENSP00000413159:L352F;ENSP00000371767:L352F;ENSP00000403269:L286F;ENSP00000317600:L181F;ENSP00000338020:L352F;ENSP00000407682:L258F;ENSP00000343450:L345F;ENSP00000323737:L345F;ENSP00000416255:L352F;ENSP00000395974:L305F;ENSP00000398145:L181F;ENSP00000399858:L181F;ENSP00000411826:L149F;ENSP00000409545:L149F;ENSP00000399969:L149F;ENSP00000404754:L149F	ENSP00000323737:L345F	L	+	1	0	EIF4G1	185522099	0.992000	0.36948	0.991000	0.47740	0.686000	0.39977	0.511000	0.22739	0.846000	0.35142	0.655000	0.94253	CTC		0.527	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917		14	106	0	0	0	0.00245	0	14	106				
EIF4G1	1981	broad.mit.edu	37	3	184040362	184040362	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:184040362C>T	ENST00000346169.2	+	12	1910	c.1639C>T	c.(1639-1641)Cag>Tag	p.Q547*	EIF4G1_ENST00000441154.1_Nonsense_Mutation_p.Q383*|EIF4G1_ENST00000435046.2_Nonsense_Mutation_p.Q351*|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000382330.3_Nonsense_Mutation_p.Q554*|EIF4G1_ENST00000424196.1_Nonsense_Mutation_p.Q554*|EIF4G1_ENST00000319274.6_Nonsense_Mutation_p.Q547*|EIF4G1_ENST00000414031.1_Nonsense_Mutation_p.Q507*|EIF4G1_ENST00000411531.1_Nonsense_Mutation_p.Q507*|EIF4G1_ENST00000434061.2_Nonsense_Mutation_p.Q351*|EIF4G1_ENST00000350481.5_Nonsense_Mutation_p.Q383*|EIF4G1_ENST00000392537.2_Nonsense_Mutation_p.Q460*|EIF4G1_ENST00000342981.4_Nonsense_Mutation_p.Q547*|EIF4G1_ENST00000352767.3_Nonsense_Mutation_p.Q554*|EIF4G1_ENST00000427845.1_Nonsense_Mutation_p.Q460*	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	547					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGTGGAAAATCAGCCTCCTGC	0.557																																							uc003fnp.2		NA																	0				lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(1639-1641)CAG>TAG		eukaryotic translation initiation factor 4							41.0	41.0	41.0					3																	184040362		2203	4300	6503	SO:0001587	stop_gained	1981				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity	g.chr3:184040362C>T	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1639C>T	3.37:g.184040362C>T	ENSP00000316879:p.Gln547*		Somatic				EIF4G1_uc003fno.1_Nonsense_Mutation_p.Q488*|EIF4G1_uc010hxw.1_Nonsense_Mutation_p.Q383*|EIF4G1_uc003fnt.2_Nonsense_Mutation_p.Q258*|EIF4G1_uc003fnq.2_Nonsense_Mutation_p.Q460*|EIF4G1_uc003fnr.2_Nonsense_Mutation_p.Q383*|EIF4G1_uc010hxx.2_Nonsense_Mutation_p.Q554*|EIF4G1_uc003fns.2_Nonsense_Mutation_p.Q507*|EIF4G1_uc010hxy.2_Nonsense_Mutation_p.Q554*|EIF4G1_uc003fnv.3_Nonsense_Mutation_p.Q547*|EIF4G1_uc003fnu.3_Nonsense_Mutation_p.Q547*|EIF4G1_uc003fnw.2_Nonsense_Mutation_p.Q554*|EIF4G1_uc003fnx.2_Nonsense_Mutation_p.Q351*|EIF4G1_uc003fny.3_Nonsense_Mutation_p.Q351*	p.Q547*	NM_198241	NP_937884	WXS	Illumina HiSeq	Unspecified	Q04637	IF4G1_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		12	1837	+	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		547					D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Nonsense_Mutation	SNP	ENST00000346169.2	37	c.1639C>T	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541881	0.85917	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000435046	.	.	.	5.15	5.15	0.70609	.	0.983825	0.08301	N	0.966875	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-12.1937	11.3658	0.49671	0.229:0.771:0.0:0.0	.	.	.	.	X	547;507;460;547;554;554;488;383;554;460;547;547;554;507;383;383;351;351	.	ENSP00000323737:Q547X	Q	+	1	0	EIF4G1	185523056	0.092000	0.21681	1.000000	0.80357	0.776000	0.43924	0.540000	0.23191	2.697000	0.92050	0.563000	0.77884	CAG		0.557	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917		4	31	0	0	0	0.000248	0	4	31				
CLCN2	1181	broad.mit.edu	37	3	184072029	184072029	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:184072029C>G	ENST00000265593.4	-	15	1752	c.1581G>C	c.(1579-1581)caG>caC	p.Q527H	CLCN2_ENST00000344937.7_Missense_Mutation_p.Q510H|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000457512.1_Missense_Mutation_p.Q527H|CLCN2_ENST00000423355.2_3'UTR|CLCN2_ENST00000434054.2_Missense_Mutation_p.Q483H	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	527					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	TGTGGGCAATCTGGCCTGTGA	0.602											OREG0015949	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003foi.2		NA																	0					0						c.(1579-1581)CAG>CAC		chloride channel 2	Lubiprostone(DB01046)						85.0	69.0	74.0					3																	184072029		2203	4300	6503	SO:0001583	missense	1181					chloride channel complex	voltage-gated chloride channel activity	g.chr3:184072029C>G	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1581G>C	3.37:g.184072029C>G	ENSP00000265593:p.Gln527His		Somatic	OREG0015949	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1989	CLCN2_uc003foh.2_Missense_Mutation_p.Q51H|CLCN2_uc010hya.1_Missense_Mutation_p.Q510H|CLCN2_uc011brl.1_Missense_Mutation_p.Q527H|CLCN2_uc011brm.1_Missense_Mutation_p.Q483H	p.Q527H	NM_004366	NP_004357	WXS	Illumina HiSeq	Unspecified	P51788	CLCN2_HUMAN	Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		15	1705	-	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		527					B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	c.1581G>C	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	c	17.49	3.402154	0.62288	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.14	4.27	0.50696	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.95417	0.8512	M	0.74389	2.26	0.80722	D	1	D;P;B;P;B	0.56968	0.978;0.922;0.045;0.87;0.095	D;P;B;P;B	0.64506	0.926;0.879;0.057;0.879;0.064	D	0.94876	0.8034	10	0.62326	D	0.03	-8.1476	9.7174	0.40283	0.0:0.8401:0.0:0.1599	.	483;527;510;527;483	E9PBD9;E9PCD2;P51788-3;P51788;B4DZ58	.;.;.;CLCN2_HUMAN;.	H	527;510;483;527	ENSP00000265593:Q527H;ENSP00000345056:Q510H;ENSP00000400425:Q483H;ENSP00000391928:Q527H	ENSP00000265593:Q527H	Q	-	3	2	CLCN2	185554723	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.662000	0.46766	1.170000	0.42753	0.563000	0.77884	CAG		0.602	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1			8	35	0	0	0	0.00308	0	8	35				
MB21D2	151963	broad.mit.edu	37	3	192516720	192516720	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr3:192516720G>A	ENST00000392452.2	-	2	1251	c.931C>T	c.(931-933)Cag>Tag	p.Q311*		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	311							protein complex binding (GO:0032403)	p.Q309E(2)		endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						TTGCAGGCCTGATAGGCCTGC	0.557																																							uc011bsp.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(931-933)CAG>TAG		hypothetical protein LOC151963							34.0	35.0	34.0					3																	192516720		2203	4300	6503	SO:0001587	stop_gained	151963							g.chr3:192516720G>A	AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.931C>T	3.37:g.192516720G>A	ENSP00000376246:p.Gln311*		Somatic					p.Q311*	NM_178496	NP_848591	WXS	Illumina HiSeq	Unspecified	Q8IYB1	M21D2_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)	2	1252	-	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		311					Q86VD8	Nonsense_Mutation	SNP	ENST00000392452.2	37	c.931C>T	CCDS3302.2	.	.	.	.	.	.	.	.	.	.	G	38	6.850684	0.97885	.	.	ENSG00000180611	ENST00000392452	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.2403	0.89966	0.0:0.0:1.0:0.0	.	.	.	.	X	311	.	ENSP00000376246:Q311X	Q	-	1	0	MB21D2	193999414	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.869000	0.99810	2.542000	0.85734	0.655000	0.94253	CAG		0.557	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496		5	32	0	0	0	0.001168	0	5	32				
WHSC1	7468	broad.mit.edu	37	4	1962800	1962800	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:1962800C>T	ENST00000382895.3	+	20	3725	c.3294C>T	c.(3292-3294)gaC>gaT	p.D1098D	WHSC1_ENST00000382888.3_Silent_p.D446D|WHSC1_ENST00000382892.2_Silent_p.D1098D|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382891.5_Silent_p.D1098D|WHSC1_ENST00000508803.1_Silent_p.D1098D	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	1098	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		AGCTGATCGACGAGGAGGAGT	0.512			T	IGH@	MM																																		uc003gdz.3		NA		Dom	yes		4	4p16.3	7468	T	Wolf-Hirschhorn syndrome candidate 1(MMSET)			L	IGH@		MM		0				ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.(3292-3294)GAC>GAT		Wolf-Hirschhorn syndrome candidate 1 protein							305.0	235.0	259.0					4																	1962800		2203	4300	6503	SO:0001819	synonymous_variant	7468				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr4:1962800C>T	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.3294C>T	4.37:g.1962800C>T			Somatic				WHSC1_uc003geb.3_Silent_p.D1098D|WHSC1_uc003gec.3_Silent_p.D1098D|WHSC1_uc003ged.3_Silent_p.D1098D|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_Silent_p.D317D|WHSC1_uc011bvh.1_Silent_p.D159D|WHSC1_uc010icf.2_Silent_p.D446D	p.D1098D	NM_001042424	NP_001035889	WXS	Illumina HiSeq	Unspecified	O96028	NSD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)	18	3470	+		all_epithelial(65;1.34e-05)	1098			SET.		A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	ENST00000382895.3	37	c.3294C>T	CCDS33940.1																																																																																				0.512	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330		19	111	0	0	0	0.008871	0	19	111				
ZNF518B	85460	broad.mit.edu	37	4	10446410	10446410	+	Missense_Mutation	SNP	C	C	G	rs142752312	byFrequency	TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:10446410C>G	ENST00000326756.3	-	3	1981	c.1543G>C	c.(1543-1545)Gaa>Caa	p.E515Q		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	515					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						CTTCCACTTTCAGCAAAACAA	0.408																																							uc003gmn.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(1543-1545)GAA>CAA		zinc finger protein 518B							92.0	94.0	93.0					4																	10446410		2203	4300	6503	SO:0001583	missense	85460				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:10446410C>G	AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.1543G>C	4.37:g.10446410C>G	ENSP00000317614:p.Glu515Gln		Somatic					p.E515Q	NM_053042	NP_444270	WXS	Illumina HiSeq	Unspecified	Q9C0D4	Z518B_HUMAN			3	2030	-			515					Q96LN8	Missense_Mutation	SNP	ENST00000326756.3	37	c.1543G>C	CCDS33960.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181221	0.38511	.	.	ENSG00000178163	ENST00000326756	T	0.01725	4.67	5.43	1.43	0.22495	.	0.622389	0.15233	N	0.273295	T	0.01353	0.0044	N	0.19112	0.55	0.09310	N	1	B	0.22346	0.068	B	0.18561	0.022	T	0.46884	-0.9159	10	0.52906	T	0.07	-7.6744	5.6041	0.17369	0.1253:0.5261:0.2707:0.0779	.	515	Q9C0D4	Z518B_HUMAN	Q	515	ENSP00000317614:E515Q	ENSP00000317614:E515Q	E	-	1	0	ZNF518B	10055508	0.850000	0.29656	0.000000	0.03702	0.257000	0.26127	1.986000	0.40677	0.363000	0.24346	0.655000	0.94253	GAA		0.408	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042		14	78	0	0	0	0.00245	0	14	78				
TBC1D1	23216	broad.mit.edu	37	4	38016340	38016340	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:38016340G>A	ENST00000261439.4	+	3	983	c.628G>A	c.(628-630)Gag>Aag	p.E210K	TBC1D1_ENST00000508802.1_Missense_Mutation_p.E210K	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	210					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CCGGGGGTCCGAGAGCCCCCG	0.711																																							uc003gtb.2		NA																	0				ovary(1)	1						c.(628-630)GAG>AAG		TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							18.0	23.0	21.0					4																	38016340		2180	4255	6435	SO:0001583	missense	23216					nucleus	Rab GTPase activator activity	g.chr4:38016340G>A	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.628G>A	4.37:g.38016340G>A	ENSP00000261439:p.Glu210Lys		Somatic				TBC1D1_uc011byd.1_Missense_Mutation_p.E210K|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc011byf.1_Missense_Mutation_p.E81K	p.E210K	NM_015173	NP_055988	WXS	Illumina HiSeq	Unspecified	Q86TI0	TBCD1_HUMAN			3	971	+			210					B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	37	c.628G>A	CCDS33972.1	.	.	.	.	.	.	.	.	.	.	G	9.588	1.125394	0.20959	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000446803	T;T;T	0.18016	3.62;4.01;2.24	5.06	5.06	0.68205	Phosphotyrosine interaction domain (1);	0.797367	0.10918	N	0.619790	T	0.11836	0.0288	N	0.24115	0.695	0.23981	N	0.996278	B;P;B	0.37731	0.033;0.607;0.033	B;B;B	0.24541	0.004;0.054;0.004	T	0.23154	-1.0196	10	0.19590	T	0.45	-1.7927	18.4198	0.90586	0.0:0.0:1.0:0.0	.	210;210;210	B9A6J6;E9PGH8;Q86TI0	.;.;TBCD1_HUMAN	K	210;210;81	ENSP00000423651:E210K;ENSP00000261439:E210K;ENSP00000396877:E81K	ENSP00000261439:E210K	E	+	1	0	TBC1D1	37692735	1.000000	0.71417	0.006000	0.13384	0.008000	0.06430	6.469000	0.73555	2.356000	0.79943	0.561000	0.74099	GAG		0.711	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173		8	47	0	0	0	0.00308	0	8	47				
TLR10	81793	broad.mit.edu	37	4	38776315	38776315	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:38776315C>T	ENST00000308973.4	-	4	1502	c.897G>A	c.(895-897)atG>atA	p.M299I	TLR10_ENST00000506111.1_Missense_Mutation_p.M299I|TLR10_ENST00000361424.2_Missense_Mutation_p.M299I|TLR10_ENST00000507953.1_5'Flank|TLR10_ENST00000508334.1_Missense_Mutation_p.M299I	NM_001017388.2|NM_001195107.1|NM_030956.3	NP_001017388.1|NP_001182036.1|NP_112218.2	Q9BXR5	TLR10_HUMAN	toll-like receptor 10	299					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of inflammatory response (GO:0050729)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(2)	25						TTATAGTTCTCATTACAGTAT	0.343																																							uc003gti.2		NA																	0				lung(1)|breast(1)	2						c.(895-897)ATG>ATA		toll-like receptor 10 precursor							83.0	85.0	84.0					4																	38776315		2203	4300	6503	SO:0001583	missense	81793				inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane	transmembrane receptor activity	g.chr4:38776315C>T	AF296673	CCDS3445.1	4p14	2009-11-23			ENSG00000174123	ENSG00000174123		"""CD molecules"""	15634	protein-coding gene	gene with protein product		606270				11267672	Standard	NM_030956		Approved	CD290	uc003gtk.3	Q9BXR5	OTTHUMG00000128578	ENST00000308973.4:c.897G>A	4.37:g.38776315C>T	ENSP00000308925:p.Met299Ile		Somatic				TLR10_uc003gtj.2_Missense_Mutation_p.M299I|TLR10_uc003gtk.2_Missense_Mutation_p.M299I	p.M299I	NM_030956	NP_112218	WXS	Illumina HiSeq	Unspecified	Q9BXR5	TLR10_HUMAN			2	1276	-			299			LRR 7.|Extracellular (Potential).		A8K7L1|B3Y668|D1CS21|D1CS22|Q32MI7|Q32MI8|Q5FWG4|Q6UXL3	Missense_Mutation	SNP	ENST00000308973.4	37	c.897G>A	CCDS3445.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.494433	0.26774	.	.	ENSG00000174123	ENST00000308973;ENST00000506111;ENST00000361424;ENST00000508334	D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67	5.13	5.13	0.70059	.	0.000000	0.48286	D	0.000193	T	0.79329	0.4427	L	0.55834	1.745	0.34331	D	0.68767	B	0.21520	0.057	B	0.24006	0.05	T	0.80690	-0.1270	10	0.34782	T	0.22	.	12.9592	0.58447	0.0:0.922:0.0:0.078	.	299	Q9BXR5	TLR10_HUMAN	I	299	ENSP00000308925:M299I;ENSP00000421483:M299I;ENSP00000354459:M299I;ENSP00000424923:M299I	ENSP00000308925:M299I	M	-	3	0	TLR10	38452710	0.997000	0.39634	0.857000	0.33713	0.995000	0.86356	1.237000	0.32695	2.390000	0.81377	0.585000	0.79938	ATG		0.343	TLR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250430.1			5	54	0	0	0	0.000602	0	5	54				
PHOX2B	8929	broad.mit.edu	37	4	41747895	41747895	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:41747895C>T	ENST00000226382.2	-	3	1233	c.874G>A	c.(874-876)Gcc>Acc	p.A292T	RP11-227F19.1_ENST00000508038.1_RNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	292				A -> G (in Ref. 1; BAA11555, 2; AAD26698 and 3; BAA82670). {ECO:0000305}.	autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						AGGACGCTGGCGAAGGGACCC	0.677			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														uc003gwf.3		NA	yes	Rec	yes	familial neuroblastoma	4	4p12	8929	Mis|F	paired-like homeobox 2b	yes	congenital central hypoventilation syndrome	O		neuroblastoma	neuroblastoma		0				autonomic_ganglia(7)|lung(2)|ovary(2)|central_nervous_system(1)	12						c.(874-876)GCC>ACC		paired-like homeobox 2b							24.0	33.0	30.0					4																	41747895		2203	4300	6503	SO:0001583	missense	8929	Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity	g.chr4:41747895C>T	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.874G>A	4.37:g.41747895C>T	ENSP00000226382:p.Ala292Thr		Somatic					p.A292T	NM_003924	NP_003915	WXS	Illumina HiSeq	Unspecified	Q99453	PHX2B_HUMAN			3	1234	-			292	A -> G (in Ref. 1; BAA11555, 2; AAD26698 and 3; BAA82670).				Q6PJD9	Missense_Mutation	SNP	ENST00000226382.2	37	c.874G>A	CCDS3463.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.585660	0.66105	.	.	ENSG00000109132	ENST00000226382	D	0.90955	-2.76	3.93	3.93	0.45458	.	0.116409	0.56097	N	0.000023	D	0.90679	0.7076	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	D	0.91448	0.5179	10	0.49607	T	0.09	.	14.8458	0.70259	0.0:1.0:0.0:0.0	.	292	Q99453	PHX2B_HUMAN	T	292	ENSP00000226382:A292T	ENSP00000226382:A292T	A	-	1	0	PHOX2B	41442652	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	2.236000	0.43052	2.019000	0.59389	0.313000	0.20887	GCC		0.677	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216832.2			8	69	0	0	0	0.008291	0	8	69				
ATP10D	57205	broad.mit.edu	37	4	47538713	47538713	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:47538713C>G	ENST00000273859.3	+	9	1423	c.1154C>G	c.(1153-1155)cCt>cGt	p.P385R	ATP10D_ENST00000504445.1_Intron	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	385					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GTCTTGATTCCTATTTCTCTC	0.313																																							uc003gxk.1		NA																	0		p.P385S(1)		ovary(2)|pancreas(1)	3						c.(1153-1155)CCT>CGT		ATPase, class V, type 10D							77.0	79.0	78.0					4																	47538713		2201	4298	6499	SO:0001583	missense	57205				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr4:47538713C>G	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1154C>G	4.37:g.47538713C>G	ENSP00000273859:p.Pro385Arg		Somatic				ATP10D_uc003gxl.1_5'UTR|ATP10D_uc003gxj.3_Intron	p.P385R	NM_020453	NP_065186	WXS	Illumina HiSeq	Unspecified	Q9P241	AT10D_HUMAN			9	1318	+			385			Helical; (Potential).		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	c.1154C>G	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375456	0.82682	.	.	ENSG00000145246	ENST00000273859	D	0.99369	-5.78	5.6	5.6	0.85130	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.99785	0.9910	H	0.99777	4.77	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96671	0.9496	10	0.87932	D	0	-19.8327	18.6065	0.91268	0.0:1.0:0.0:0.0	.	385	Q9P241	AT10D_HUMAN	R	385	ENSP00000273859:P385R	ENSP00000273859:P385R	P	+	2	0	ATP10D	47233470	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.653000	0.90120	0.650000	0.86243	CCT		0.313	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453		6	65	0	0	0	0.001168	0	6	65				
ANKRD17	26057	broad.mit.edu	37	4	73957704	73957704	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:73957704G>A	ENST00000358602.4	-	29	5757	c.5641C>T	c.(5641-5643)Ctt>Ttt	p.L1881F	ANKRD17_ENST00000330838.6_Missense_Mutation_p.L1630F|ANKRD17_ENST00000509867.2_Missense_Mutation_p.L1768F	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1881					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCTAATGGAAGAGAAACTGGA	0.483																																							uc003hgp.2		NA																	0				ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10						c.(5641-5643)CTT>TTT		ankyrin repeat domain protein 17 isoform a							167.0	171.0	170.0					4																	73957704		2203	4300	6503	SO:0001583	missense	26057				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding	g.chr4:73957704G>A	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.5641C>T	4.37:g.73957704G>A	ENSP00000351416:p.Leu1881Phe		Somatic				ANKRD17_uc003hgo.2_Missense_Mutation_p.L1768F|ANKRD17_uc003hgq.2_Missense_Mutation_p.L1630F|ANKRD17_uc003hgr.2_Missense_Mutation_p.L1880F	p.L1881F	NM_032217	NP_115593	WXS	Illumina HiSeq	Unspecified	O75179	ANR17_HUMAN	Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		29	5758	-	Breast(15;0.000295)		1881					E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	c.5641C>T	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731886	0.69189	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.72282	-0.61;-0.6;-0.64	5.55	5.55	0.83447	.	0.000000	0.56097	D	0.000027	T	0.79776	0.4504	L	0.54323	1.7	0.47698	D	0.999497	D;D;D;D	0.64830	0.994;0.994;0.99;0.99	P;P;P;P	0.57776	0.827;0.827;0.676;0.676	T	0.81278	-0.1005	10	0.87932	D	0	.	19.4978	0.95081	0.0:0.0:1.0:0.0	.	1880;1630;1881;1768	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	F	1881;1288;1630;1768;265	ENSP00000351416:L1881F;ENSP00000332265:L1630F;ENSP00000427151:L1768F	ENSP00000332265:L1630F	L	-	1	0	ANKRD17	74176568	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.401000	0.73256	2.617000	0.88574	0.467000	0.42956	CTT		0.483	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217		19	140	0	0	0	0.007413	0	19	140				
CNOT6L	246175	broad.mit.edu	37	4	78663394	78663394	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:78663394C>A	ENST00000504123.1	-	8	903	c.773G>T	c.(772-774)gGa>gTa	p.G258V	CNOT6L_ENST00000264903.4_Missense_Mutation_p.G258V|CNOT6L_ENST00000506166.1_5'UTR			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	258	Nuclease domain.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						TCCATCATATCCACGCTCCTT	0.393																																							uc011ccd.1		NA																	0				large_intestine(1)	1						c.(772-774)GGA>GTA		CCR4-NOT transcription complex, subunit 6-like							75.0	68.0	70.0					4																	78663394		1901	4126	6027	SO:0001583	missense	246175				nuclear-transcribed mRNA poly(A) tail shortening	cytosol	exonuclease activity|protein binding	g.chr4:78663394C>A	AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.773G>T	4.37:g.78663394C>A	ENSP00000424896:p.Gly258Val		Somatic				CNOT6L_uc003hks.2_Missense_Mutation_p.G258V|CNOT6L_uc003hkt.1_Missense_Mutation_p.G101V|CNOT6L_uc011cce.1_Missense_Mutation_p.W205C	p.G258V	NM_144571	NP_653172	WXS	Illumina HiSeq	Unspecified	Q96LI5	CNO6L_HUMAN			8	904	-			258					Q9UF92	Missense_Mutation	SNP	ENST00000504123.1	37	c.773G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.279762|5.279762	0.95489|0.95489	.|.	.|.	ENSG00000138767|ENSG00000138767	ENST00000504123;ENST00000264903;ENST00000512485;ENST00000505983|ENST00000515506	D;D;D;D|.	0.96459|.	-4.02;-4.02;-4.02;-4.02|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Endonuclease/exonuclease/phosphatase (2);|.	0.046287|.	0.85682|.	D|.	0.000000|.	T|T	0.80082|0.80082	0.4558|0.4558	H|H	0.96239|0.96239	3.79|3.79	0.80722|0.80722	D|D	1|1	D;D|P	0.89917|0.50369	1.0;1.0|0.934	D;D|B	0.97110|0.40702	0.999;1.0|0.338	D|D	0.86316|0.86316	0.1689|0.1689	10|7	0.87932|.	D|.	0|.	-8.9302|-8.9302	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	231;258|205	Q96LI5-2;Q96LI5|B4E2S0	.;CNO6L_HUMAN|.	V|C	258;258;265;33|286	ENSP00000424896:G258V;ENSP00000264903:G258V;ENSP00000425571:G265V;ENSP00000426320:G33V|.	ENSP00000264903:G258V|.	G|W	-|-	2|3	0|0	CNOT6L|CNOT6L	78882418|78882418	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.818000|7.818000	0.86416|0.86416	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GGA|TGG		0.393	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362515.1			4	23	1	0	1.23904e-05	0.000602	1.81122e-05	4	23				
ANXA3	306	broad.mit.edu	37	4	79503336	79503336	+	Silent	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:79503336G>T	ENST00000264908.6	+	5	583	c.204G>T	c.(202-204)ctG>ctT	p.L68L	ANXA3_ENST00000512884.1_Silent_p.L29L|ANXA3_ENST00000503570.2_Silent_p.L29L	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	68					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TTTAGGAGCTGAAAGATGACT	0.393																																					GBM(2;126 157 27790 28920 42492)	GBM(2;126 157 27790 28920 42492)	uc003hld.2		NA																	0					0						c.(202-204)CTG>CTT		annexin A3							77.0	74.0	75.0					4																	79503336		2203	4300	6503	SO:0001819	synonymous_variant	306				defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity	g.chr4:79503336G>T	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.204G>T	4.37:g.79503336G>T			Somatic				ANXA3_uc003hle.2_Silent_p.L29L|ANXA3_uc010ijk.2_Silent_p.L29L	p.L68L	NM_005139	NP_005130	WXS	Illumina HiSeq	Unspecified	P12429	ANXA3_HUMAN			5	514	+			68			Annexin 1.		B2R9W6|Q6LET2	Silent	SNP	ENST00000264908.6	37	c.204G>T	CCDS3584.1																																																																																				0.393	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252516.3	NM_005139		9	52	1	0	0.00621372	0.006214	0.00881947	9	52				
PRKG2	5593	broad.mit.edu	37	4	82031655	82031655	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:82031655G>C	ENST00000395578.1	-	15	2003	c.1887C>G	c.(1885-1887)ttC>ttG	p.F629L	PRKG2_ENST00000509169.1_5'UTR|PRKG2_ENST00000545647.1_Missense_Mutation_p.F209L|PRKG2_ENST00000264399.1_Missense_Mutation_p.F629L|PRKG2_ENST00000418486.2_Missense_Mutation_p.F600L			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	629	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						AATCCACACTGAAGTCATGTC	0.438																																							uc003hmh.2		NA																	0				breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						c.(1885-1887)TTC>TTG		protein kinase, cGMP-dependent, type II							122.0	118.0	119.0					4																	82031655		2203	4300	6503	SO:0001583	missense	5593				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity	g.chr4:82031655G>C	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.1887C>G	4.37:g.82031655G>C	ENSP00000378945:p.Phe629Leu		Somatic				PRKG2_uc011ccf.1_Missense_Mutation_p.F209L|PRKG2_uc011ccg.1_Missense_Mutation_p.F209L|PRKG2_uc011cch.1_Missense_Mutation_p.F600L	p.F629L	NM_006259	NP_006250	WXS	Illumina HiSeq	Unspecified	Q13237	KGP2_HUMAN			14	1901	-			629			Protein kinase.		B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	c.1887C>G	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	G	8.467	0.856543	0.17106	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486;ENST00000545647	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.51	3.79	0.43588	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.087605	0.85682	D	0.000000	T	0.39091	0.1065	N	0.11673	0.155	0.53688	D	0.999971	B;B	0.09022	0.002;0.0	B;B	0.15052	0.006;0.012	T	0.11131	-1.0600	10	0.11794	T	0.64	-18.4754	11.6685	0.51387	0.1436:0.0:0.8564:0.0	.	600;629	E7EPE6;Q13237	.;KGP2_HUMAN	L	629;629;600;209	ENSP00000378945:F629L;ENSP00000264399:F629L;ENSP00000389038:F600L;ENSP00000439967:F209L	ENSP00000264399:F629L	F	-	3	2	PRKG2	82250679	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.805000	0.27112	0.702000	0.31825	0.650000	0.86243	TTC		0.438	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259		14	54	0	0	0	0.001855	0	14	54				
THAP9	79725	broad.mit.edu	37	4	83827511	83827511	+	Missense_Mutation	SNP	G	G	C	rs202199242		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:83827511G>C	ENST00000302236.5	+	3	362	c.311G>C	c.(310-312)aGa>aCa	p.R104T		NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	104					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				GGTAAAGCAAGACAAAAAATC	0.318																																							uc003hnt.2		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	5						c.(310-312)AGA>ACA		THAP domain containing 9							111.0	110.0	110.0					4																	83827511		2203	4300	6503	SO:0001583	missense	79725						DNA binding|metal ion binding	g.chr4:83827511G>C	AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.311G>C	4.37:g.83827511G>C	ENSP00000305533:p.Arg104Thr		Somatic				THAP9_uc003hns.1_5'UTR|THAP9_uc003hnu.1_RNA|THAP9_uc003hnv.2_5'UTR	p.R104T	NM_024672	NP_078948	WXS	Illumina HiSeq	Unspecified	Q9H5L6	THAP9_HUMAN			3	430	+		Hepatocellular(203;0.114)	104					B3KRE2|Q59AC9	Missense_Mutation	SNP	ENST00000302236.5	37	c.311G>C	CCDS3598.1	.	.	.	.	.	.	.	.	.	.	G	9.814	1.184063	0.21870	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	T	0.35048	1.33	3.58	-0.0777	0.13717	.	1.884370	0.02493	N	0.089684	T	0.19366	0.0465	N	0.08118	0	0.21915	N	0.999474	B	0.24186	0.099	B	0.22753	0.041	T	0.13791	-1.0496	10	0.20046	T	0.44	-5.3452	6.0949	0.20015	0.4781:0.0:0.5219:0.0	.	104	Q9H5L6	THAP9_HUMAN	T	104	ENSP00000305533:R104T	ENSP00000305533:R104T	R	+	2	0	THAP9	84046535	0.995000	0.38212	0.989000	0.46669	0.895000	0.52256	0.013000	0.13310	-0.066000	0.12998	-0.229000	0.12294	AGA		0.318	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672		7	115	0	0	0	0.001984	0	7	115				
WDFY3	23001	broad.mit.edu	37	4	85722828	85722828	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:85722828G>C	ENST00000295888.4	-	17	3204	c.2797C>G	c.(2797-2799)Cag>Gag	p.Q933E	WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000322366.6_Missense_Mutation_p.Q933E|WDFY3_ENST00000512267.1_5'Flank	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	933					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCCAGAGCCTGAGAGGCTAAT	0.483																																							uc003hpd.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2797-2799)CAG>GAG		WD repeat and FYVE domain containing 3 isoform							115.0	117.0	116.0					4																	85722828		2203	4300	6503	SO:0001583	missense	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85722828G>C	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2797C>G	4.37:g.85722828G>C	ENSP00000295888:p.Gln933Glu		Somatic					p.Q933E	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	17	3205	-		Hepatocellular(203;0.114)	933					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	c.2797C>G	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447300	0.84101	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.51574	0.7;0.7	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.52980	0.1768	M	0.78456	2.415	0.80722	D	1	P	0.40909	0.732	B	0.35182	0.197	T	0.60895	-0.7172	10	0.66056	D	0.02	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	933	Q8IZQ1	WDFY3_HUMAN	E	933	ENSP00000318466:Q933E;ENSP00000295888:Q933E	ENSP00000295888:Q933E	Q	-	1	0	WDFY3	85941852	1.000000	0.71417	0.992000	0.48379	0.956000	0.61745	9.476000	0.97823	2.827000	0.97445	0.650000	0.86243	CAG		0.483	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		10	94	0	0	0	0.001368	0	10	94				
GRID2	2895	broad.mit.edu	37	4	94006245	94006245	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:94006245C>T	ENST00000282020.4	+	3	602	c.344C>T	c.(343-345)cCc>cTc	p.P115L	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Intron	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	115					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		ATGCATATCCCCCACCTCTTC	0.562																																							uc011cdt.1		NA																	0				ovary(3)|skin(2)|large_intestine(1)	6						c.(343-345)CCC>CTC		glutamate receptor, ionotropic, delta 2	L-Glutamic Acid(DB00142)						125.0	104.0	111.0					4																	94006245		2203	4300	6503	SO:0001583	missense	2895				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr4:94006245C>T	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.344C>T	4.37:g.94006245C>T	ENSP00000282020:p.Pro115Leu		Somatic				GRID2_uc010ikx.2_Missense_Mutation_p.P115L|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_RNA	p.P115L	NM_001510	NP_001501	WXS	Illumina HiSeq	Unspecified	O43424	GRID2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	3	602	+		Hepatocellular(203;0.114)|all_hematologic(202;0.177)	115			Extracellular (Potential).		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	c.344C>T	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	C	33	5.219341	0.95139	.	.	ENSG00000152208	ENST00000282020	D	0.91843	-2.92	5.12	5.12	0.69794	Extracellular ligand-binding receptor (1);	0.111170	0.64402	D	0.000006	D	0.94771	0.8312	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95266	0.8373	10	0.87932	D	0	.	18.9145	0.92499	0.0:1.0:0.0:0.0	.	115;56	O43424;B4DYB9	GRID2_HUMAN;.	L	115	ENSP00000282020:P115L	ENSP00000282020:P115L	P	+	2	0	GRID2	94225268	1.000000	0.71417	0.987000	0.45799	0.995000	0.86356	7.776000	0.85560	2.553000	0.86117	0.655000	0.94253	CCC		0.562	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2			11	60	0	0	0	0.008291	0	11	60				
MANBA	4126	broad.mit.edu	37	4	103644166	103644166	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:103644166C>T	ENST00000226578.4	-	4	510	c.411G>A	c.(409-411)gtG>gtA	p.V137V	MANBA_ENST00000505239.1_Intron	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	137					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		CAATGGAGTTCACGTCCCTGA	0.473																																							uc003hwg.2		NA																	0				ovary(1)	1						c.(409-411)GTG>GTA		mannosidase, beta A, lysosomal precursor							104.0	86.0	92.0					4																	103644166		2203	4300	6503	SO:0001819	synonymous_variant	4126				carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding	g.chr4:103644166C>T		CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.411G>A	4.37:g.103644166C>T			Somatic				MANBA_uc011ces.1_Intron	p.V137V	NM_005908	NP_005899	WXS	Illumina HiSeq	Unspecified	O00462	MANBA_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)	4	511	-		Hepatocellular(203;0.217)	137					Q96BC3|Q9NYX9	Silent	SNP	ENST00000226578.4	37	c.411G>A	CCDS3658.1																																																																																				0.473	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2			5	49	0	0	0	0.000602	0	5	49				
LEF1	51176	broad.mit.edu	37	4	109084728	109084728	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:109084728C>T	ENST00000265165.1	-	3	1064	c.410G>A	c.(409-411)aGa>aAa	p.R137K	LEF1_ENST00000379951.2_Missense_Mutation_p.R137K|LEF1_ENST00000512172.1_Missense_Mutation_p.R69K|LEF1_ENST00000510624.1_Missense_Mutation_p.R69K|LEF1_ENST00000438313.2_Missense_Mutation_p.R137K	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	137	Pro-rich.				alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		ACTTACTGTTCTCGGGATGGG	0.383																																							uc003hyt.1		NA																	0				large_intestine(1)	1						c.(409-411)AGA>AAA		lymphoid enhancer-binding factor 1 isoform 1							176.0	160.0	165.0					4																	109084728		2203	4300	6503	SO:0001583	missense	51176				canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding	g.chr4:109084728C>T		CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.410G>A	4.37:g.109084728C>T	ENSP00000265165:p.Arg137Lys		Somatic				LEF1_uc011cfj.1_Missense_Mutation_p.R22K|LEF1_uc011cfk.1_Missense_Mutation_p.R69K|LEF1_uc003hyu.1_Missense_Mutation_p.R137K|LEF1_uc003hyv.1_Missense_Mutation_p.R137K|LEF1_uc010imb.1_RNA	p.R137K	NM_016269	NP_057353	WXS	Illumina HiSeq	Unspecified	Q9UJU2	LEF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000224)	3	1065	-			137			Pro-rich.		B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Missense_Mutation	SNP	ENST00000265165.1	37	c.410G>A	CCDS3679.1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.294935	0.23564	.	.	ENSG00000138795	ENST00000265165;ENST00000379951;ENST00000438313;ENST00000510624;ENST00000515500;ENST00000512172	D;D;D;D	0.99176	-5.52;-5.52;-5.51;-5.5	5.74	5.74	0.90152	CTNNB1 binding, N-teminal (1);	0.000000	0.85682	D	0.000000	D	0.98623	0.9539	L	0.42245	1.32	0.58432	D	0.999998	P;B;B;B;B	0.49185	0.92;0.245;0.102;0.321;0.447	D;B;B;B;B	0.63957	0.92;0.096;0.08;0.138;0.309	D	0.98096	1.0412	10	0.08179	T	0.78	-4.4402	19.9173	0.97066	0.0:1.0:0.0:0.0	.	69;22;137;137;137	E9PDK3;B4DZY5;Q9UJU2-6;Q9UJU2-5;Q9UJU2	.;.;.;.;LEF1_HUMAN	K	137;137;137;69;69;69	ENSP00000265165:R137K;ENSP00000369284:R137K;ENSP00000406176:R137K;ENSP00000422840:R69K	ENSP00000265165:R137K	R	-	2	0	LEF1	109304177	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	7.372000	0.79612	2.707000	0.92482	0.563000	0.77884	AGA		0.383	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2			8	92	0	0	0	0.004482	0	8	92				
ARSJ	79642	broad.mit.edu	37	4	114899776	114899776	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:114899776G>A	ENST00000315366.7	-	1	1081	c.215C>T	c.(214-216)tCc>tTc	p.S72F	ARSJ_ENST00000541197.1_Missense_Mutation_p.S72F|ARSJ_ENST00000503013.2_5'UTR	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	72					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		CTGGGAGGTGGAAGTTGTGCT	0.502																																							uc003ibq.1		NA																	0				ovary(1)	1						c.(214-216)TCC>TTC		arylsulfatase J precursor							66.0	69.0	68.0					4																	114899776		1926	4131	6057	SO:0001583	missense	79642					extracellular region	arylsulfatase activity|metal ion binding	g.chr4:114899776G>A		CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.215C>T	4.37:g.114899776G>A	ENSP00000320219:p.Ser72Phe		Somatic				ARSJ_uc010imu.1_Missense_Mutation_p.S72F|ARSJ_uc010imv.1_5'UTR	p.S72F	NM_024590	NP_078866	WXS	Illumina HiSeq	Unspecified	Q5FYB0	ARSJ_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00194)	1	1103	-		Ovarian(17;0.0035)|Hepatocellular(203;0.217)	72					A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Missense_Mutation	SNP	ENST00000315366.7	37	c.215C>T	CCDS43264.1	.	.	.	.	.	.	.	.	.	.	G	6.476	0.455968	0.12283	.	.	ENSG00000180801	ENST00000315366;ENST00000541197	D;D	0.97404	-4.37;-4.37	4.86	3.11	0.35812	.	1.070240	0.07387	N	0.888487	D	0.91835	0.7416	N	0.08118	0	0.09310	N	1	B;B	0.12630	0.006;0.001	B;B	0.11329	0.006;0.002	D	0.84254	0.0479	10	0.62326	D	0.03	.	7.9212	0.29848	0.0851:0.3078:0.6071:0.0	.	72;72	Q1HA39;Q5FYB0	.;ARSJ_HUMAN	F	72	ENSP00000320219:S72F;ENSP00000438836:S72F	ENSP00000320219:S72F	S	-	2	0	ARSJ	115119225	0.568000	0.26635	0.162000	0.22713	0.262000	0.26303	0.543000	0.23237	0.443000	0.26582	0.655000	0.94253	TCC		0.502	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363650.1	NM_024590		13	62	0	0	0	0.001855	0	13	62				
PLK4	10733	broad.mit.edu	37	4	128802317	128802317	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:128802317G>C	ENST00000270861.5	+	1	302	c.28G>C	c.(28-30)Gag>Cag	p.E10Q	PLK4_ENST00000507249.1_Missense_Mutation_p.E10Q|PLK4_ENST00000513090.1_Missense_Mutation_p.E10Q|PLK4_ENST00000515069.1_Missense_Mutation_p.E10Q|PLK4_ENST00000514379.1_5'Flank|PLK4_ENST00000511942.1_3'UTR	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	10					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						GGAGAAGATCGAGGTGAAAAG	0.607																																					Colon(135;508 1718 19061 31832 42879)	Colon(135;508 1718 19061 31832 42879)	uc003ifo.2		NA																	0					0						c.(28-30)GAG>CAG		polo-like kinase 4							48.0	50.0	49.0					4																	128802317		2203	4300	6503	SO:0001583	missense	10733				G2/M transition of mitotic cell cycle|positive regulation of centriole replication|trophoblast giant cell differentiation	centriole|cleavage furrow|cytosol|nucleolus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr4:128802317G>C	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.28G>C	4.37:g.128802317G>C	ENSP00000270861:p.Glu10Gln		Somatic				PLK4_uc011cgs.1_Missense_Mutation_p.E10Q|PLK4_uc011cgt.1_5'Flank	p.E10Q	NM_014264	NP_055079	WXS	Illumina HiSeq	Unspecified	O00444	PLK4_HUMAN			1	273	+			10					B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	37	c.28G>C	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860658	0.71834	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	4.23	4.23	0.50019	Protein kinase-like domain (1);	0.056960	0.64402	D	0.000002	T	0.20536	0.0494	N	0.11023	0.085	0.80722	D	1	B;B	0.31383	0.304;0.321	B;B	0.39904	0.313;0.115	T	0.20405	-1.0276	10	0.46703	T	0.11	-6.6049	16.8103	0.85717	0.0:0.0:1.0:0.0	.	10;10	O00444-2;O00444	.;PLK4_HUMAN	Q	10	ENSP00000270861:E10Q;ENSP00000421774:E10Q;ENSP00000427554:E10Q;ENSP00000423412:E10Q	ENSP00000270861:E10Q	E	+	1	0	PLK4	129021767	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.613000	0.67688	2.187000	0.69744	0.561000	0.74099	GAG		0.607	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3			4	41	0	0	0	0.000248	0	4	41				
MAB21L2	10586	broad.mit.edu	37	4	151504343	151504343	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:151504343C>T	ENST00000317605.4	+	1	1267	c.162C>T	c.(160-162)agC>agT	p.S54S	LRBA_ENST00000510413.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000503716.1_5'Flank|LRBA_ENST00000357115.3_Intron|LRBA_ENST00000535741.1_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	54					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		GCTTCATCAGCTCCTTGAGCG	0.587																																							uc003ilw.2		NA																	0				ovary(1)	1						c.(160-162)AGC>AGT		mab-21-like protein 2							57.0	50.0	52.0					4																	151504343		2203	4300	6503	SO:0001819	synonymous_variant	10586				nervous system development	nucleus		g.chr4:151504343C>T	AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.162C>T	4.37:g.151504343C>T			Somatic				LRBA_uc003ils.3_5'Flank|LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron|LRBA_uc010ipj.2_Intron	p.S54S	NM_006439	NP_006430	WXS	Illumina HiSeq	Unspecified	Q9Y586	MB212_HUMAN		GBM - Glioblastoma multiforme(119;0.159)	1	1267	+	all_hematologic(180;0.151)		54					B3KP37|Q9HBA7	Silent	SNP	ENST00000317605.4	37	c.162C>T	CCDS3774.1																																																																																				0.587	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1	NM_006439		6	27	0	0	0	0.001168	0	6	27				
LRBA	987	broad.mit.edu	37	4	151773315	151773315	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr4:151773315T>C	ENST00000357115.3	-	23	3790	c.3547A>G	c.(3547-3549)Aca>Gca	p.T1183A	LRBA_ENST00000510413.1_Missense_Mutation_p.T1183A|LRBA_ENST00000507224.1_Missense_Mutation_p.T1183A|LRBA_ENST00000535741.1_Missense_Mutation_p.T1183A	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1183						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CCTGATGCTGTCATAGTCTGA	0.383																																							uc010ipj.2		NA																	0				ovary(3)|breast(3)|skin(1)	7						c.(3547-3549)ACA>GCA		LPS-responsive vesicle trafficking, beach and							85.0	83.0	84.0					4																	151773315		2203	4300	6503	SO:0001583	missense	987					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding	g.chr4:151773315T>C	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.3547A>G	4.37:g.151773315T>C	ENSP00000349629:p.Thr1183Ala		Somatic				LRBA_uc003ilt.3_5'Flank|LRBA_uc003ilu.3_Missense_Mutation_p.T1183A	p.T1183A	NM_006726	NP_006717	WXS	Illumina HiSeq	Unspecified	P50851	LRBA_HUMAN			23	4021	-	all_hematologic(180;0.151)		1183					Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	c.3547A>G	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	T	7.365	0.625594	0.14257	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.53640	1.03;1.18;1.03;0.61	5.01	0.0778	0.14409	.	0.369498	0.23874	N	0.043715	T	0.23171	0.0560	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17107	-1.0380	10	0.10377	T	0.69	.	5.3463	0.16010	0.0:0.2151:0.2604:0.5245	.	1183;1183	P50851;P50851-2	LRBA_HUMAN;.	A	1183	ENSP00000446299:T1183A;ENSP00000421552:T1183A;ENSP00000349629:T1183A;ENSP00000422180:T1183A	ENSP00000349629:T1183A	T	-	1	0	LRBA	151992765	0.000000	0.05858	0.007000	0.13788	0.705000	0.40729	0.239000	0.18023	0.138000	0.18790	0.533000	0.62120	ACA		0.383	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			14	88	0	0	0	0.00245	0	14	88				
SLC12A7	10723	broad.mit.edu	37	5	1089171	1089171	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:1089171G>A	ENST00000264930.5	-	4	458	c.415C>T	c.(415-417)Ctg>Ttg	p.L139L		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	139					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GTCAGGCGCAGGAAGAGGATG	0.647																																							uc003jbu.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(415-417)CTG>TTG		solute carrier family 12 (potassium/chloride	Potassium Chloride(DB00761)						182.0	149.0	160.0					5																	1089171		2202	4300	6502	SO:0001819	synonymous_variant	10723				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity	g.chr5:1089171G>A	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.415C>T	5.37:g.1089171G>A			Somatic					p.L139L	NM_006598	NP_006589	WXS	Illumina HiSeq	Unspecified	Q9Y666	S12A7_HUMAN	Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		4	481	-	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		139			Helical; (Potential).		A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	ENST00000264930.5	37	c.415C>T	CCDS34129.1																																																																																				0.647	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598		18	249	0	0	0	0.008871	0	18	249				
ADAMTS16	170690	broad.mit.edu	37	5	5182332	5182332	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:5182332G>T	ENST00000274181.7	+	4	815	c.677G>T	c.(676-678)tGg>tTg	p.W226L	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.W226L	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	226					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TCAAGGACATGGGAGCTGGCA	0.577																																							uc003jdl.2		NA																	0				ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.(676-678)TGG>TTG		ADAM metallopeptidase with thrombospondin type 1							67.0	71.0	70.0					5																	5182332		2054	4196	6250	SO:0001583	missense	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5182332G>T	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.677G>T	5.37:g.5182332G>T	ENSP00000274181:p.Trp226Leu		Somatic				ADAMTS16_uc003jdk.1_Missense_Mutation_p.W226L|ADAMTS16_uc003jdj.1_Missense_Mutation_p.W226L	p.W226L	NM_139056	NP_620687	WXS	Illumina HiSeq	Unspecified	Q8TE57	ATS16_HUMAN			4	815	+			226					C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	c.677G>T	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	G	4.598	0.111200	0.08831	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.60672	0.27;0.17	5.37	1.53	0.23141	.	1.505420	0.04174	N	0.325350	T	0.32041	0.0816	N	0.08118	0	0.09310	N	1	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.15093	-1.0449	10	0.10902	T	0.67	.	2.0858	0.03645	0.2232:0.1348:0.5028:0.1393	.	226;226;226	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	L	226	ENSP00000274181:W226L;ENSP00000421631:W226L	ENSP00000274181:W226L	W	+	2	0	ADAMTS16	5235332	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.133000	0.15912	-0.005000	0.14395	-0.907000	0.02831	TGG		0.577	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		7	147	1	0	2.0095e-06	0.001984	2.96704e-06	7	147				
MTRR	4552	broad.mit.edu	37	5	7878244	7878244	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:7878244G>C	ENST00000264668.2	+	5	700	c.670G>C	c.(670-672)Gat>Cat	p.D224H	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Missense_Mutation_p.D197H	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	224	Hinge.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	TCTGAGATTCGATGATTCAGG	0.468																																							uc003jed.2		NA																	0				ovary(1)	1						c.(670-672)GAT>CAT		methionine synthase reductase isoform 2	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)						105.0	100.0	102.0					5																	7878244		2203	4300	6503	SO:0001583	missense	4552				methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding	g.chr5:7878244G>C	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.670G>C	5.37:g.7878244G>C	ENSP00000264668:p.Asp224His		Somatic				MTRR_uc010itn.1_RNA|MTRR_uc003jee.3_Missense_Mutation_p.D197H|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_RNA	p.D224H	NM_024010	NP_076915	WXS	Illumina HiSeq	Unspecified	Q9UBK8	MTRR_HUMAN			5	700	+			224			Hinge.		O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	c.670G>C	CCDS3874.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.64|16.64	3.178925|3.178925	0.57692|0.57692	.|.	.|.	ENSG00000124275|ENSG00000124275	ENST00000264668;ENST00000440940|ENST00000514220	T;T|.	0.02236|.	4.38;4.38|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.949400|.	0.08941|.	N|.	0.871620|.	T|T	0.73265|0.73265	0.3565|0.3565	M|M	0.67953|0.67953	2.075|2.075	0.58432|0.58432	D|D	0.999997|0.999997	P|.	0.43094|.	0.799|.	B|.	0.40702|.	0.338|.	T|T	0.71371|0.71371	-0.4613|-0.4613	10|5	0.48119|.	T|.	0.1|.	-11.1899|-11.1899	15.7421|15.7421	0.77905|0.77905	0.0:0.1357:0.8643:0.0|0.0:0.1357:0.8643:0.0	.|.	224|.	Q9UBK8|.	MTRR_HUMAN|.	H|P	224;197|125	ENSP00000264668:D224H;ENSP00000402510:D197H|.	ENSP00000264668:D224H|.	D|R	+|+	1|2	0|0	MTRR|MTRR	7931244|7931244	0.983000|0.983000	0.35010|0.35010	0.010000|0.010000	0.14722|0.14722	0.880000|0.880000	0.50808|0.50808	2.591000|2.591000	0.46163|0.46163	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GAT|CGA		0.468	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1			13	106	0	0	0	0.00245	0	13	106				
MTRR	4552	broad.mit.edu	37	5	7878333	7878333	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:7878333C>T	ENST00000264668.2	+	5	789	c.759C>T	c.(757-759)tcC>tcT	p.S253S	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Silent_p.S226S	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	253	Hinge.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ACTTTGAGTCCTCACTTACCC	0.443																																							uc003jed.2		NA																	0				ovary(1)	1						c.(757-759)TCC>TCT		methionine synthase reductase isoform 2	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)						147.0	146.0	147.0					5																	7878333		2203	4300	6503	SO:0001819	synonymous_variant	4552				methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding	g.chr5:7878333C>T	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.759C>T	5.37:g.7878333C>T			Somatic				MTRR_uc010itn.1_RNA|MTRR_uc003jee.3_Silent_p.S226S|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_RNA	p.S253S	NM_024010	NP_076915	WXS	Illumina HiSeq	Unspecified	Q9UBK8	MTRR_HUMAN			5	789	+			253			Hinge.		O60471|Q32MA9|Q7Z4M8	Silent	SNP	ENST00000264668.2	37	c.759C>T	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	C	4.834	0.155038	0.09236	.	.	ENSG00000124275	ENST00000514220	.	.	.	5.91	-1.42	0.08913	.	.	.	.	.	T	0.41558	0.1164	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25398	-1.0133	4	.	.	.	-0.8458	2.4116	0.04426	0.1281:0.2543:0.1263:0.4914	.	.	.	.	F	155	.	.	L	+	1	0	MTRR	7931333	0.998000	0.40836	0.004000	0.12327	0.015000	0.08874	0.671000	0.25172	-0.360000	0.08138	-0.182000	0.12963	CTC		0.443	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1			10	194	0	0	0	0.006214	0	10	194				
SEMA5A	9037	broad.mit.edu	37	5	9043069	9043069	+	Silent	SNP	G	G	C	rs373907002		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:9043069G>C	ENST00000382496.5	-	23	3830	c.3165C>G	c.(3163-3165)ctC>ctG	p.L1055L	CTD-2215L10.1_ENST00000506519.1_RNA	NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	1055					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						TCTTCCCAGTGAGATGTGGGT	0.338																																							uc003jek.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(3163-3165)CTC>CTG		semaphorin 5A precursor							212.0	208.0	209.0					5																	9043069		2203	4300	6503	SO:0001819	synonymous_variant	9037				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane		g.chr5:9043069G>C	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.3165C>G	5.37:g.9043069G>C			Somatic					p.L1055L	NM_003966	NP_003957	WXS	Illumina HiSeq	Unspecified	Q13591	SEM5A_HUMAN			23	3877	-			1055			Cytoplasmic (Potential).		D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	37	c.3165C>G	CCDS3875.1																																																																																				0.338	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			7	47	0	0	0	0.001984	0	7	47				
FBXL7	23194	broad.mit.edu	37	5	15937263	15937263	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:15937263G>A	ENST00000504595.1	+	4	1925	c.1444G>A	c.(1444-1446)Gtc>Atc	p.V482I	MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000329673.7_Missense_Mutation_p.V470I|FBXL7_ENST00000510662.1_Missense_Mutation_p.V435I	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	482					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CAAGCGCTGCGTCATCGAGCA	0.542																																							uc003jfn.1		NA																	0				ovary(2)|lung(1)	3						c.(1444-1446)GTC>ATC		F-box and leucine-rich repeat protein 7							16.0	18.0	18.0					5																	15937263		2113	4242	6355	SO:0001583	missense	23194				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:15937263G>A	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.1444G>A	5.37:g.15937263G>A	ENSP00000423630:p.Val482Ile		Somatic					p.V482I	NM_012304	NP_036436	WXS	Illumina HiSeq	Unspecified	Q9UJT9	FBXL7_HUMAN			4	1925	+			482					B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	c.1444G>A	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	G	4.030	0.003114	0.07866	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.52754	0.65;0.65;0.65	5.36	4.37	0.52481	.	0.141198	0.47852	D	0.000204	T	0.19327	0.0464	N	0.10972	0.075	0.32999	D	0.52596	B	0.02656	0.0	B	0.04013	0.001	T	0.33292	-0.9874	10	0.02654	T	1	.	3.4838	0.07611	0.3689:0.0:0.6311:0.0	.	482	Q9UJT9	FBXL7_HUMAN	I	482;435;470	ENSP00000423630:V482I;ENSP00000425184:V435I;ENSP00000329632:V470I	ENSP00000329632:V470I	V	+	1	0	FBXL7	15990263	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	4.415000	0.59809	2.521000	0.84997	0.650000	0.86243	GTC		0.542	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304		6	26	0	0	0	0.001168	0	6	26				
GAPT	202309	broad.mit.edu	37	5	57790482	57790482	+	Missense_Mutation	SNP	G	G	A	rs370924428		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:57790482G>A	ENST00000396776.2	+	3	581	c.119G>A	c.(118-120)cGa>cAa	p.R40Q	GAPT_ENST00000318469.2_Missense_Mutation_p.R40Q	NM_152687.2	NP_689900.1	Q8N292	GAPT_HUMAN	GRB2-binding adaptor protein, transmembrane	40					B cell activation (GO:0042113)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R40Q(1)		NS(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7						GTTGCCACACGATTTACCTTA	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		17811	0.0		0.0	False		,,,				2504	0.001						uc003jro.1		NA																	1	Substitution - Missense(1)		skin(1)		0						c.(118-120)CGA>CAA		GRB2-binding adaptor protein, transmembrane		G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	82.0	81.0	81.0		119	0.8	0.0	5		81	0,8600		0,0,4300	no	missense	GAPT	NM_152687.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	40/158	57790482	1,13005	2203	4300	6503	SO:0001583	missense	202309				B cell activation	integral to membrane|plasma membrane		g.chr5:57790482G>A	AK090960	CCDS3975.1	5q11.2	2011-11-01	2008-10-07	2008-10-07	ENSG00000175857	ENSG00000175857			26588	protein-coding gene	gene with protein product	"""GRB2-binding transmembrane adaptor"""		"""chromosome 5 open reading frame 29"""	C5orf29			Standard	NM_152687		Approved	FLJ33641	uc003jro.1	Q8N292	OTTHUMG00000131219	ENST00000396776.2:c.119G>A	5.37:g.57790482G>A	ENSP00000379997:p.Arg40Gln		Somatic					p.R40Q	NM_152687	NP_689900	WXS	Illumina HiSeq	Unspecified	Q8N292	GAPT_HUMAN			3	513	+			40						Missense_Mutation	SNP	ENST00000396776.2	37	c.119G>A	CCDS3975.1	.	.	.	.	.	.	.	.	.	.	G	8.482	0.859974	0.17178	2.27E-4	0.0	ENSG00000175857	ENST00000502276;ENST00000396776;ENST00000511930;ENST00000318469	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	4.96	0.757	0.18427	.	1.579880	0.03733	N	0.253800	T	0.24005	0.0581	N	0.04880	-0.145	0.09310	N	1	B	0.24576	0.106	B	0.15484	0.013	T	0.13308	-1.0514	10	0.20046	T	0.44	0.06	4.2422	0.10654	0.2991:0.2084:0.4925:0.0	.	40	Q8N292	GAPT_HUMAN	Q	40	ENSP00000423113:R40Q;ENSP00000379997:R40Q;ENSP00000422645:R40Q;ENSP00000323075:R40Q	ENSP00000323075:R40Q	R	+	2	0	GAPT	57826239	0.000000	0.05858	0.001000	0.08648	0.199000	0.23934	-0.006000	0.12833	0.257000	0.21650	0.591000	0.81541	CGA		0.433	GAPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253963.1	NM_152687		10	58	0	0	0	0.008291	0	10	58				
OTP	23440	broad.mit.edu	37	5	76932692	76932692	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:76932692C>G	ENST00000306422.3	-	2	1539	c.401G>C	c.(400-402)cGt>cCt	p.R134P	OTP_ENST00000515716.1_5'UTR	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	134					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		CAGCTCCTCACGCATAAAGAT	0.612																																							uc003kfg.2		NA																	0				pancreas(1)	1						c.(400-402)CGT>CCT		orthopedia homeobox							96.0	92.0	93.0					5																	76932692		2203	4300	6503	SO:0001583	missense	23440					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:76932692C>G		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.401G>C	5.37:g.76932692C>G	ENSP00000302814:p.Arg134Pro		Somatic					p.R134P	NM_032109	NP_115485	WXS	Illumina HiSeq	Unspecified	Q5XKR4	OTP_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)	2	549	-		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)	134			Homeobox.			Missense_Mutation	SNP	ENST00000306422.3	37	c.401G>C	CCDS4039.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792290	0.90453	.	.	ENSG00000171540	ENST00000306422	D	0.97505	-4.41	5.18	5.18	0.71444	Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99429	0.9798	H	0.99989	5.295	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	D	0.97615	1.0132	10	0.87932	D	0	.	18.6559	0.91453	0.0:1.0:0.0:0.0	.	134	Q5XKR4	OTP_HUMAN	P	134	ENSP00000302814:R134P	ENSP00000302814:R134P	R	-	2	0	OTP	76968448	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.703000	0.84585	2.589000	0.87451	0.655000	0.94253	CGT		0.612	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220016.2			8	107	0	0	0	0.00308	0	8	107				
OTP	23440	broad.mit.edu	37	5	76932712	76932712	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:76932712G>C	ENST00000306422.3	-	2	1519	c.381C>G	c.(379-381)caC>caG	p.H127Q	OTP_ENST00000515716.1_5'UTR	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	127					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		TGTCGGGGTAGTGAGTCTTGG	0.622																																							uc003kfg.2		NA																	0				pancreas(1)	1						c.(379-381)CAC>CAG		orthopedia homeobox							110.0	107.0	108.0					5																	76932712		2203	4300	6503	SO:0001583	missense	23440					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:76932712G>C		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.381C>G	5.37:g.76932712G>C	ENSP00000302814:p.His127Gln		Somatic					p.H127Q	NM_032109	NP_115485	WXS	Illumina HiSeq	Unspecified	Q5XKR4	OTP_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)	2	529	-		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)	127			Homeobox.			Missense_Mutation	SNP	ENST00000306422.3	37	c.381C>G	CCDS4039.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526755	0.85706	.	.	ENSG00000171540	ENST00000306422	D	0.95885	-3.84	5.18	4.29	0.51040	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.94892	0.8349	N	0.17278	0.47	0.80722	D	1	D	0.65815	0.995	D	0.68483	0.958	D	0.95847	0.8871	10	0.87932	D	0	.	14.8809	0.70531	0.0:0.0:0.855:0.145	.	127	Q5XKR4	OTP_HUMAN	Q	127	ENSP00000302814:H127Q	ENSP00000302814:H127Q	H	-	3	2	OTP	76968468	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.813000	0.55636	1.290000	0.44636	0.655000	0.94253	CAC		0.622	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220016.2			15	123	0	0	0	0.003163	0	15	123				
ACOT12	134526	broad.mit.edu	37	5	80626663	80626663	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:80626663G>A	ENST00000307624.3	-	14	1516	c.1488C>T	c.(1486-1488)ctC>ctT	p.L496L	ACOT12_ENST00000508234.1_5'UTR	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	496	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		TAGCATGGATGAGAAATCCGG	0.433																																							uc003khl.3		NA																	0				ovary(1)|kidney(1)	2						c.(1486-1488)CTC>CTT		acyl-CoA thioesterase 12							91.0	85.0	87.0					5																	80626663		2203	4300	6503	SO:0001819	synonymous_variant	134526				acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity	g.chr5:80626663G>A	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.1488C>T	5.37:g.80626663G>A			Somatic				RNU5E_uc011cto.1_Intron	p.L496L	NM_130767	NP_570123	WXS	Illumina HiSeq	Unspecified	Q8WYK0	ACO12_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)	14	1543	-		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)	496			START.		B3KVK9|Q5FWE9	Silent	SNP	ENST00000307624.3	37	c.1488C>T	CCDS4055.1																																																																																				0.433	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254074.1	NM_130767		4	39	0	0	0	0.000248	0	4	39				
TTC37	9652	broad.mit.edu	37	5	94857809	94857809	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:94857809G>C	ENST00000358746.2	-	19	2258	c.1960C>G	c.(1960-1962)Caa>Gaa	p.Q654E	RNU6-308P_ENST00000390957.1_RNA	NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	654						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						ATCTGGTATTGAGCTACAGCC	0.358																																							uc003klb.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1960-1962)CAA>GAA		tetratricopeptide repeat domain 37							152.0	141.0	145.0					5																	94857809		2203	4300	6503	SO:0001583	missense	9652						binding	g.chr5:94857809G>C	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.1960C>G	5.37:g.94857809G>C	ENSP00000351596:p.Gln654Glu		Somatic				TTC37_uc010jbf.1_Missense_Mutation_p.Q606E	p.Q654E	NM_014639	NP_055454	WXS	Illumina HiSeq	Unspecified	Q6PGP7	TTC37_HUMAN			19	2230	-			654			TPR 11.		O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	37	c.1960C>G	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	G	0.997	-0.692099	0.03303	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.73469	0.75;-0.75	4.72	4.72	0.59763	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.201508	0.42420	D	0.000708	T	0.39118	0.1066	N	0.01410	-0.885	0.31538	N	0.660349	B;B	0.12630	0.006;0.001	B;B	0.04013	0.001;0.0	T	0.44283	-0.9338	10	0.02654	T	1	.	8.7667	0.34706	0.0:0.2598:0.5805:0.1597	.	606;654	D6RCE2;Q6PGP7	.;TTC37_HUMAN	E	654;606	ENSP00000351596:Q654E;ENSP00000423742:Q606E	ENSP00000351596:Q654E	Q	-	1	0	TTC37	94883565	1.000000	0.71417	0.787000	0.31911	0.965000	0.64279	5.333000	0.65917	2.336000	0.79503	0.467000	0.42956	CAA		0.358	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639		7	89	0	0	0	0.004482	0	7	89				
MEGF10	84466	broad.mit.edu	37	5	126792896	126792896	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:126792896G>A	ENST00000274473.6	+	26	3576	c.3309G>A	c.(3307-3309)aaG>aaA	p.K1103K	MEGF10_ENST00000503335.2_Silent_p.K1103K	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	1103	Necessary for formation of large intracellular vacuoles.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ACCTCCCAAAGAACAGTCACA	0.488																																							uc003kuh.3		NA																	0				ovary(4)	4						c.(3307-3309)AAG>AAA		multiple EGF-like-domains 10 precursor							178.0	149.0	159.0					5																	126792896		2203	4300	6503	SO:0001819	synonymous_variant	84466				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup		g.chr5:126792896G>A	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.3309G>A	5.37:g.126792896G>A			Somatic				MEGF10_uc003kui.3_Silent_p.K1103K	p.K1103K	NM_032446	NP_115822	WXS	Illumina HiSeq	Unspecified	Q96KG7	MEG10_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)	26	3671	+		Prostate(80;0.165)	1103			Cytoplasmic (Potential).|Necessary for formation of large intracellular vacuoles.		Q68DE5|Q8WUL3	Silent	SNP	ENST00000274473.6	37	c.3309G>A	CCDS4142.1																																																																																				0.488	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446		11	110	0	0	0	0.000978	0	11	110				
KDM3B	51780	broad.mit.edu	37	5	137754766	137754766	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:137754766G>A	ENST00000314358.5	+	14	3760	c.3560G>A	c.(3559-3561)aGa>aAa	p.R1187K	KDM3B_ENST00000508386.1_3'UTR|KDM3B_ENST00000394866.1_Missense_Mutation_p.R843K|KDM3B_ENST00000542866.1_Missense_Mutation_p.R219K	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1187					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						ACTGACATCAGATCTGAAGAG	0.537																																							uc003lcy.1		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						c.(3559-3561)AGA>AAA		jumonji domain containing 1B							87.0	81.0	83.0					5																	137754766		2203	4300	6503	SO:0001583	missense	51780				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr5:137754766G>A	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.3560G>A	5.37:g.137754766G>A	ENSP00000326563:p.Arg1187Lys		Somatic				KDM3B_uc010jew.1_Missense_Mutation_p.R843K|KDM3B_uc011cys.1_Missense_Mutation_p.R219K	p.R1187K	NM_016604	NP_057688	WXS	Illumina HiSeq	Unspecified	Q7LBC6	KDM3B_HUMAN			14	3760	+			1187					A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	c.3560G>A	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	G	9.039	0.989149	0.18966	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.69040	0.21;-0.37;-0.34	5.63	5.63	0.86233	.	0.212707	0.52532	D	0.000072	T	0.51398	0.1672	L	0.36672	1.1	0.27715	N	0.945334	B;B	0.11235	0.001;0.004	B;B	0.06405	0.001;0.002	T	0.36456	-0.9747	10	0.02654	T	1	-22.8299	12.9513	0.58403	0.0739:0.0:0.9261:0.0	.	843;1187	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	K	1187;977;843;219	ENSP00000326563:R1187K;ENSP00000378335:R843K;ENSP00000439462:R219K	ENSP00000326563:R1187K	R	+	2	0	KDM3B	137782665	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	5.090000	0.64498	2.665000	0.90641	0.650000	0.86243	AGA		0.537	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604		11	71	0	0	0	0.008291	0	11	71				
PCDHGA6	56109	broad.mit.edu	37	5	140755330	140755330	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:140755330C>T	ENST00000517434.1	+	1	1680	c.1680C>T	c.(1678-1680)ccC>ccT	p.P560P	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	560	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P560P(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAATGCGCCCGAGATCCTGT	0.657																																							uc003ljy.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1678-1680)CCC>CCT		protocadherin gamma subfamily A, 6 isoform 1							124.0	142.0	136.0					5																	140755330		2203	4300	6503	SO:0001819	synonymous_variant	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140755330C>T	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1680C>T	5.37:g.140755330C>T			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.P560P	p.P560P	NM_018919	NP_061742	WXS	Illumina HiSeq	Unspecified	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1680	+			560			Extracellular (Potential).|Cadherin 5.		A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	ENST00000517434.1	37	c.1680C>T	CCDS54926.1																																																																																				0.657	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		29	176	0	0	0	0.008361	0	29	176				
HTR4	3360	broad.mit.edu	37	5	147830796	147830796	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:147830796C>G	ENST00000521530.1	-	6	1121	c.1116G>C	c.(1114-1116)gaG>gaC	p.E372D	HTR4_ENST00000314512.6_3'UTR|HTR4_ENST00000354217.2_Missense_Mutation_p.E372D|HTR4_ENST00000521735.1_3'UTR	NM_001040169.2	NP_001035259.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	0			C -> Y (in dbSNP:rs34826744).		G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	TGGGCAGTTTCTCGAGTTCCT	0.473																																					GBM(120;370 1604 14007 17804 41573)	GBM(120;370 1604 14007 17804 41573)	uc003lpj.1		NA																	0				ovary(1)	1						c.(1114-1116)GAG>GAC		serotonin 5-HT4 receptor isoform a	Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)						425.0	365.0	385.0					5																	147830796		2203	4300	6503	SO:0001583	missense	3360				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity	g.chr5:147830796C>G	Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000521530.1:c.1116G>C	5.37:g.147830796C>G	ENSP00000428320:p.Glu372Asp		Somatic				HTR4_uc010jgu.1_RNA|HTR4_uc003lpi.1_3'UTR	p.E372D	NM_001040169	NP_001035259	WXS	Illumina HiSeq	Unspecified	Q13639	5HT4R_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		7	1280	-			Error:Variant_position_missing_in_Q13639_after_alignment					C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Missense_Mutation	SNP	ENST00000521530.1	37	c.1116G>C	CCDS34270.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.094195	0.36952	.	.	ENSG00000164270	ENST00000521530;ENST00000354217	T;T	0.71103	-0.54;-0.54	5.25	5.25	0.73442	.	.	.	.	.	T	0.77239	0.4101	.	.	.	0.80722	D	1	P	0.49696	0.927	D	0.67725	0.953	T	0.69982	-0.4997	8	0.12766	T	0.61	.	14.234	0.65913	0.0:1.0:0.0:0.0	.	372	Q13639-2	.	D	372	ENSP00000428320:E372D;ENSP00000346156:E372D	ENSP00000346156:E372D	E	-	3	2	HTR4	147810989	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.215000	0.51169	2.729000	0.93468	0.650000	0.86243	GAG		0.473	HTR4-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374174.3	NM_000870		36	322	0	0	0	0.007835	0	36	322				
LCP2	3937	broad.mit.edu	37	5	169683535	169683535	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:169683535G>C	ENST00000046794.5	-	17	1760	c.1145C>G	c.(1144-1146)tCt>tGt	p.S382C	LCP2_ENST00000521416.1_Missense_Mutation_p.S177C	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	382					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		CAAACCTTGAGAGAAGTATGG	0.453																																							uc003man.1		NA																	0				ovary(1)	1						c.(1144-1146)TCT>TGT		lymphocyte cytosolic protein 2							92.0	98.0	96.0					5																	169683535		1913	4139	6052	SO:0001583	missense	3937				immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding	g.chr5:169683535G>C		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.1145C>G	5.37:g.169683535G>C	ENSP00000046794:p.Ser382Cys		Somatic				LCP2_uc011des.1_Missense_Mutation_p.S177C|LCP2_uc011det.1_Missense_Mutation_p.S211C	p.S382C	NM_005565	NP_005556	WXS	Illumina HiSeq	Unspecified	Q13094	LCP2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)	17	1352	-	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	382					A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	c.1145C>G	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026381	0.54683	.	.	ENSG00000043462	ENST00000046794;ENST00000521416	T;T	0.46819	0.86;0.86	5.05	5.05	0.67936	.	0.220332	0.40222	N	0.001141	T	0.55257	0.1909	L	0.56769	1.78	0.37969	D	0.933213	P;D	0.63046	0.933;0.992	P;P	0.52309	0.471;0.695	T	0.60566	-0.7238	9	.	.	.	-10.5038	15.1391	0.72595	0.0:0.0:1.0:0.0	.	177;382	E7ESF6;Q13094	.;LCP2_HUMAN	C	382;177	ENSP00000046794:S382C;ENSP00000428871:S177C	.	S	-	2	0	LCP2	169616113	1.000000	0.71417	1.000000	0.80357	0.418000	0.31294	2.109000	0.41863	2.337000	0.79520	0.557000	0.71058	TCT		0.453	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565		4	63	0	0	0	0.000602	0	4	63				
FGFR4	2264	broad.mit.edu	37	5	176520438	176520438	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:176520438C>T	ENST00000292408.4	+	10	1528	c.1283C>T	c.(1282-1284)tCa>tTa	p.S428L	FGFR4_ENST00000393637.1_Missense_Mutation_p.S388L|FGFR4_ENST00000502906.1_Missense_Mutation_p.S428L|FGFR4_ENST00000292410.3_Missense_Mutation_p.S388L|FGFR4_ENST00000393648.2_Nonsense_Mutation_p.Q377*	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	428					alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	TCCGGCAAGTCAAGCTCATCC	0.622										TSP Lung(9;0.080)																													uc003mfl.2		NA																	0				lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16						c.(1282-1284)TCA>TTA		fibroblast growth factor receptor 4 isoform 1	Palifermin(DB00039)						81.0	83.0	82.0					5																	176520438		2203	4300	6503	SO:0001583	missense	2264				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity	g.chr5:176520438C>T	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1283C>T	5.37:g.176520438C>T	ENSP00000292408:p.Ser428Leu	TSP Lung(9;0.080)	Somatic				FGFR4_uc003mfm.2_Missense_Mutation_p.S428L|FGFR4_uc011dfu.1_Nonsense_Mutation_p.Q377*|FGFR4_uc003mfo.2_Missense_Mutation_p.S388L	p.S428L	NM_002011	NP_002002	WXS	Illumina HiSeq	Unspecified	P22455	FGFR4_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		10	1450	+	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	428			Cytoplasmic (Potential).		G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	37	c.1283C>T	CCDS4410.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.651582|5.651582	0.96714|0.96714	.|.	.|.	ENSG00000160867|ENSG00000160867	ENST00000393648|ENST00000292408;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	.|D;D;D;D	.|0.90385	.|-2.66;-2.66;-2.66;-2.66	4.76|4.76	3.8|3.8	0.43715|0.43715	.|.	.|0.132729	.|0.52532	.|D	.|0.000063	.|D	.|0.89301	.|0.6676	M|M	0.75264|0.75264	2.295|2.295	0.45621|0.45621	D|D	0.998554|0.998554	.|B;B	.|0.17038	.|0.02;0.012	.|B;B	.|0.16722	.|0.016;0.006	.|D	.|0.87095	.|0.2175	.|10	0.25106|0.42905	T|T	0.35|0.14	.|.	13.2226|13.2226	0.59896|0.59896	0.0:0.9082:0.0:0.0918|0.0:0.9082:0.0:0.0918	.|.	.|388;428	.|P22455-2;P22455	.|.;FGFR4_HUMAN	X|L	377|428;428;388;388;656	.|ENSP00000292408:S428L;ENSP00000424960:S428L;ENSP00000292410:S388L;ENSP00000377254:S388L	ENSP00000377259:Q377X|ENSP00000292408:S428L	Q|S	+|+	1|2	0|0	FGFR4|FGFR4	176453044|176453044	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.589000|0.589000	0.36550|0.36550	4.723000|4.723000	0.61965|0.61965	2.488000|2.488000	0.83962|0.83962	0.555000|0.555000	0.69702|0.69702	CAA|TCA		0.622	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1			15	124	0	0	0	0.00245	0	15	124				
OR2V2	285659	broad.mit.edu	37	5	180582116	180582116	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:180582116C>T	ENST00000328275.1	+	1	174	c.174C>T	c.(172-174)acC>acT	p.T58T		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCTTCACACCCCCATGTACT	0.537																																							uc011dhj.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(172-174)ACC>ACT		olfactory receptor, family 2, subfamily V,							221.0	201.0	208.0					5																	180582116		2203	4300	6503	SO:0001819	synonymous_variant	285659				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr5:180582116C>T	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.174C>T	5.37:g.180582116C>T			Somatic					p.T58T	NM_206880	NP_996763	WXS	Illumina HiSeq	Unspecified	Q96R30	OR2V2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		1	174	+	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	58			Cytoplasmic (Potential).		Q6IFL6|Q8NGV1	Silent	SNP	ENST00000328275.1	37	c.174C>T	CCDS4461.1																																																																																				0.537	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253529.1			41	167	0	0	0	0.00874	0	41	167				
CDYL	9425	broad.mit.edu	37	6	4892238	4892238	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:4892238G>T	ENST00000328908.5	+	4	609	c.478G>T	c.(478-480)Gaa>Taa	p.E160*	CDYL_ENST00000397588.3_Nonsense_Mutation_p.E106*|CDYL_ENST00000472453.1_Intron|CDYL_ENST00000449732.2_5'UTR|CDYL_ENST00000343762.5_5'UTR			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	160	Interaction with EZH2.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		GAAAGACCACGAATCCAAAAA	0.502																																							uc003mwi.2		NA																	0					0						c.(478-480)GAA>TAA		chromodomain protein, Y chromosome-like isoform							99.0	108.0	105.0					6																	4892238		2203	4300	6503	SO:0001587	stop_gained	9425				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity	g.chr6:4892238G>T	AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.478G>T	6.37:g.4892238G>T	ENSP00000330512:p.Glu160*		Somatic				CDYL_uc003mwj.2_Nonsense_Mutation_p.E106*|CDYL_uc003mwk.2_Intron|CDYL_uc011dhx.1_5'UTR|CDYL_uc011dhy.1_5'UTR	p.E160*	NM_001143971	NP_001137443	WXS	Illumina HiSeq	Unspecified	Q9Y232	CDYL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.182)	4	609	+	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)	160					A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Nonsense_Mutation	SNP	ENST00000328908.5	37	c.478G>T		.	.	.	.	.	.	.	.	.	.	G	38	6.777287	0.97829	.	.	ENSG00000153046	ENST00000328908;ENST00000397588	.	.	.	5.79	5.79	0.91817	.	0.363846	0.28683	N	0.014486	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	19.0316	0.92959	0.0:0.0:1.0:0.0	.	.	.	.	X	160;106	.	ENSP00000330512:E160X	E	+	1	0	CDYL	4837237	1.000000	0.71417	0.815000	0.32552	0.846000	0.48090	6.077000	0.71275	2.731000	0.93534	0.650000	0.86243	GAA		0.502	CDYL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000039736.1	NM_004824		16	95	1	0	6.72482e-11	0.003163	1.03098e-10	16	95				
ATXN1	6310	broad.mit.edu	37	6	16327156	16327156	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:16327156G>A	ENST00000244769.4	-	8	2322	c.1386C>T	c.(1384-1386)atC>atT	p.I462I	ATXN1_ENST00000436367.1_Silent_p.I462I	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	462					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				TCAGGTAGCCGATGACAGGGG	0.657																																							uc003nbt.2		NA																	0				skin(3)|central_nervous_system(1)	4						c.(1384-1386)ATC>ATT		ataxin 1							83.0	91.0	88.0					6																	16327156		2203	4300	6503	SO:0001819	synonymous_variant	6310				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association	g.chr6:16327156G>A	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.1386C>T	6.37:g.16327156G>A			Somatic				ATXN1_uc010jpi.2_Silent_p.I462I|ATXN1_uc010jpj.1_Intron	p.I462I	NM_000332	NP_000323	WXS	Illumina HiSeq	Unspecified	P54253	ATX1_HUMAN			8	2357	-	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)	462					Q17S02|Q9UJG2|Q9Y4J1	Silent	SNP	ENST00000244769.4	37	c.1386C>T	CCDS34342.1																																																																																				0.657	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332		21	154	0	0	0	0.008871	0	21	154				
PGBD1	84547	broad.mit.edu	37	6	28269471	28269471	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:28269471C>G	ENST00000405948.2	+	7	2260	c.1840C>G	c.(1840-1842)Ctt>Gtt	p.L614V	PGBD1_ENST00000259883.3_Missense_Mutation_p.L614V	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	614						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						CGCTGATGTTCTTTTAGAGAG	0.418																																							uc003nky.2		NA																	0				ovary(4)	4						c.(1840-1842)CTT>GTT		piggyBac transposable element derived 1							162.0	160.0	161.0					6																	28269471		2203	4300	6503	SO:0001583	missense	84547				viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity	g.chr6:28269471C>G	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1840C>G	6.37:g.28269471C>G	ENSP00000385213:p.Leu614Val		Somatic				PGBD1_uc003nkz.2_Missense_Mutation_p.L614V	p.L614V	NM_032507	NP_115896	WXS	Illumina HiSeq	Unspecified	Q96JS3	PGBD1_HUMAN			7	2210	+			614					Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	c.1840C>G	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.965164	0.53507	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.20738	2.05;2.05	4.66	4.66	0.58398	.	0.188667	0.23539	N	0.047093	T	0.30135	0.0755	L	0.60455	1.87	0.27831	N	0.941462	P	0.50156	0.932	D	0.70227	0.968	T	0.01814	-1.1268	10	0.66056	D	0.02	-6.5976	13.256	0.60079	0.0:1.0:0.0:0.0	.	614	Q96JS3	PGBD1_HUMAN	V	614	ENSP00000385213:L614V;ENSP00000259883:L614V	ENSP00000259883:L614V	L	+	1	0	PGBD1	28377450	0.963000	0.33076	1.000000	0.80357	0.996000	0.88848	1.244000	0.32778	2.581000	0.87130	0.655000	0.94253	CTT		0.418	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2			15	109	0	0	0	0.00499	0	15	109				
HLA-DQB1	3119	broad.mit.edu	37	6	32632765	32632765	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:32632765G>C	ENST00000399084.1	-	3	367	c.189C>G	c.(187-189)atC>atG	p.I63M	XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.I63M|HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.I63M|HLA-DQB1_ENST00000399082.3_Intron|HLA-DQB1_ENST00000399079.3_Missense_Mutation_p.I63M			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	63	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	CTCGGTTATAGATGTATCTGG	0.617									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												Esophageal Squamous(151;720 1825 15000 40336 43415)	Esophageal Squamous(151;720 1825 15000 40336 43415)	uc003obw.2		NA																	0					0						c.(187-189)ATC>ATG		major histocompatibility complex, class II, DQ	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						34.0	35.0	34.0					6																	32632765		2127	4222	6349	SO:0001583	missense	3119	Melanoma_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia|T-cell_Lymphoma_(Cutaneous)__Familial_Clustering_of|Sj_gren_syndrome	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial	antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity	g.chr6:32632765G>C		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399084.1:c.189C>G	6.37:g.32632765G>C	ENSP00000382034:p.Ile63Met		Somatic				HLA-DQB1_uc010juc.1_Missense_Mutation_p.I18M|HLA-DQB1_uc003obv.2_Missense_Mutation_p.I63M|HLA-DQB1_uc011dqd.1_Missense_Mutation_p.I63M|HLA-DQB1_uc011dqe.1_Missense_Mutation_p.I63M	p.I63M	NM_002123	NP_002114	WXS	Illumina HiSeq	Unspecified	P01920	DQB1_HUMAN			2	271	-			63			Extracellular (Potential).|Beta-1.		A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	ENST00000399084.1	37	c.189C>G	CCDS43451.1	.	.	.	.	.	.	.	.	.	.	.	11.52	1.664558	0.29604	.	.	ENSG00000179344	ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084	T;T;T;T	0.00372	7.73;7.73;7.73;7.73	3.91	2.98	0.34508	.	0.579977	0.16255	U	0.222527	T	0.00637	0.0021	H	0.94582	3.555	0.29105	N	0.881241	D;P;P;B;P	0.63046	0.992;0.721;0.841;0.237;0.721	D;P;P;B;P	0.71656	0.974;0.823;0.734;0.179;0.823	T	0.21655	-1.0239	10	0.87932	D	0	.	9.0479	0.36358	0.0:0.0:0.6383:0.3617	.	73;63;28;63;63	Q59F80;A2AAZ0;A2VCT9;Q5Y7D6;Q5Y7A9	.;.;.;.;.	M	63	ENSP00000382029:I63M;ENSP00000364080:I63M;ENSP00000407332:I63M;ENSP00000382034:I63M	ENSP00000364080:I63M	I	-	3	3	HLA-DQB1	32740743	0.999000	0.42202	0.826000	0.32828	0.019000	0.09904	0.818000	0.27295	2.041000	0.60428	0.305000	0.20034	ATC		0.617	HLA-DQB1-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276127.1	NM_002123		19	61	0	0	0	0.007413	0	19	61				
ITPR3	3710	broad.mit.edu	37	6	33654857	33654857	+	Silent	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:33654857C>G	ENST00000374316.5	+	45	7111	c.6051C>G	c.(6049-6051)ctC>ctG	p.L2017L	ITPR3_ENST00000605930.1_Silent_p.L2017L			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2017					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	AGCGAATCCTCATCAGCCTGC	0.667																																							uc011drk.1		NA																	0				ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						c.(6049-6051)CTC>CTG		inositol 1,4,5-triphosphate receptor, type 3							53.0	51.0	52.0					6																	33654857		2203	4296	6499	SO:0001819	synonymous_variant	3710				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding	g.chr6:33654857C>G	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6051C>G	6.37:g.33654857C>G			Somatic				ITPR3_uc003oey.2_Silent_p.L104L	p.L2017L	NM_002224	NP_002215	WXS	Illumina HiSeq	Unspecified	Q14573	ITPR3_HUMAN			44	6270	+			2017			Cytoplasmic (Potential).		Q14649|Q5TAQ2	Silent	SNP	ENST00000374316.5	37	c.6051C>G	CCDS4783.1																																																																																				0.667	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224		15	68	0	0	0	0.003163	0	15	68				
PTK7	5754	broad.mit.edu	37	6	43109431	43109431	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:43109431G>A	ENST00000230419.4	+	11	1865	c.1644G>A	c.(1642-1644)gtG>gtA	p.V548V	PTK7_ENST00000352931.2_Silent_p.V548V|PTK7_ENST00000345201.2_Silent_p.V508V|PTK7_ENST00000481273.1_Silent_p.V556V|PTK7_ENST00000349241.2_Silent_p.V418V	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	548	Ig-like C2-type 6.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			CAGAGTGGGTGACAGACAACG	0.572																																							uc003oub.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(1642-1644)GTG>GTA		PTK7 protein tyrosine kinase 7 isoform a							132.0	129.0	130.0					6																	43109431		2203	4300	6503	SO:0001819	synonymous_variant	5754				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr6:43109431G>A	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.1644G>A	6.37:g.43109431G>A			Somatic				PTK7_uc003ouc.1_Silent_p.V548V|PTK7_uc003oud.1_Silent_p.V508V|PTK7_uc003oue.1_Silent_p.V418V|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Silent_p.V556V|PTK7_uc010jyj.1_Intron	p.V548V	NM_002821	NP_002812	WXS	Illumina HiSeq	Unspecified	Q13308	PTK7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)		11	1842	+			548			Ig-like C2-type 6.|Extracellular (Potential).		A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Silent	SNP	ENST00000230419.4	37	c.1644G>A	CCDS4884.1																																																																																				0.572	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2			9	135	0	0	0	0.006214	0	9	135				
SMPDL3A	10924	broad.mit.edu	37	6	123118004	123118004	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:123118004C>T	ENST00000368440.4	+	3	539	c.362C>T	c.(361-363)tCa>tTa	p.S121L	SMPDL3A_ENST00000539041.1_5'UTR|SMPDL3A_ENST00000487215.1_3'UTR	NM_006714.3	NP_006705.1	Q92484	ASM3A_HUMAN	sphingomyelin phosphodiesterase, acid-like 3A	121					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|cervix(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	10				GBM - Glioblastoma multiforme(226;0.236)		CCTGAACTCTCAACAGACACT	0.393																																							uc003pzg.2		NA																	0					0						c.(361-363)TCA>TTA		acid sphingomyelinase-like phosphodiesterase 3A							129.0	113.0	119.0					6																	123118004		2203	4300	6503	SO:0001583	missense	10924				sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|protein binding|sphingomyelin phosphodiesterase activity	g.chr6:123118004C>T	AK000184	CCDS5128.1, CCDS69190.1	6q22.32	2006-04-12			ENSG00000172594	ENSG00000172594			17389	protein-coding gene	gene with protein product	"""acid sphingomyelinase-like phosphodiesterase 3a"""	610728				12442002	Standard	XM_005266798		Approved	FLJ20177, ASM3A, ASML3a, yR36GH4.1	uc003pzg.3	Q92484	OTTHUMG00000015490	ENST00000368440.4:c.362C>T	6.37:g.123118004C>T	ENSP00000357425:p.Ser121Leu		Somatic				SMPDL3A_uc003pzh.2_5'UTR	p.S121L	NM_006714	NP_006705	WXS	Illumina HiSeq	Unspecified	Q92484	ASM3A_HUMAN		GBM - Glioblastoma multiforme(226;0.236)	3	883	+			121					B7Z729|Q8WV13	Missense_Mutation	SNP	ENST00000368440.4	37	c.362C>T	CCDS5128.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023634	0.75390	.	.	ENSG00000172594	ENST00000368440	D	0.84873	-1.91	5.61	5.61	0.85477	Metallophosphoesterase domain (1);	0.051188	0.85682	D	0.000000	D	0.92309	0.7560	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91816	0.5463	10	0.59425	D	0.04	-16.114	19.9997	0.97405	0.0:1.0:0.0:0.0	.	121	Q92484	ASM3A_HUMAN	L	121	ENSP00000357425:S121L	ENSP00000357425:S121L	S	+	2	0	SMPDL3A	123159703	1.000000	0.71417	0.996000	0.52242	0.184000	0.23303	7.445000	0.80570	2.813000	0.96785	0.655000	0.94253	TCA		0.393	SMPDL3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042039.1	NM_006714		5	50	0	0	0	0.001168	0	5	50				
IL20RA	53832	broad.mit.edu	37	6	137322794	137322794	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:137322794G>A	ENST00000316649.5	-	7	1798	c.1563C>T	c.(1561-1563)ctC>ctT	p.L521L	IL20RA_ENST00000468393.1_5'Flank|IL20RA_ENST00000367748.1_Silent_p.L410L|RP11-204P2.3_ENST00000458017.1_RNA|IL20RA_ENST00000541547.1_Silent_p.L472L	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	521					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		GCTCCTCATAGAGTCTAGATA	0.527																																							uc003qhj.2		NA																	0				ovary(2)|skin(2)	4						c.(1561-1563)CTC>CTT		interleukin 20 receptor, alpha precursor							99.0	105.0	103.0					6																	137322794		2203	4300	6503	SO:0001819	synonymous_variant	53832					integral to membrane	receptor activity	g.chr6:137322794G>A	AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.1563C>T	6.37:g.137322794G>A			Somatic				IL20RA_uc011edl.1_Silent_p.L472L|IL20RA_uc003qhk.2_Silent_p.L410L|IL20RA_uc003qhi.2_Silent_p.L253L	p.L521L	NM_014432	NP_055247	WXS	Illumina HiSeq	Unspecified	Q9UHF4	I20RA_HUMAN		GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)	7	1996	-	Colorectal(23;0.24)		521			Cytoplasmic (Potential).		B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Silent	SNP	ENST00000316649.5	37	c.1563C>T	CCDS5181.1																																																																																				0.527	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432		11	121	0	0	0	0.000978	0	11	121				
ARID1B	57492	broad.mit.edu	37	6	157528089	157528090	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:157528089_157528090GG>TT	ENST00000350026.5	+	19	5776_5777	c.5775_5776GG>TT	c.(5773-5778)caGGac>caTTac	p.1925_1926QD>HY	ARID1B_ENST00000346085.5_Missense_Mutation_p.1938_1939QD>HY|ARID1B_ENST00000275248.4_Missense_Mutation_p.1920_1921QD>HY|ARID1B_ENST00000367148.1_Missense_Mutation_p.1978_1979QD>HY	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1925					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CGCACTGGCAGGACTCGCTGGC	0.55																																							uc003qqn.2		NA																	0				ovary(1)|breast(1)	2						c.(5758-5763)CAGGAC>CATTAC		AT rich interactive domain 1B (SWI1-like)																																				SO:0001583	missense	57492				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity	g.chr6:157528089_157528090GG>TT	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	Exception_encountered	6.37:g.157528089_157528090delinsTT	ENSP00000055163:p.Q1925_D1926delinsHY		Somatic				ARID1B_uc003qqo.2_Missense_Mutation_p.1880_1881QD>HY|ARID1B_uc003qqp.2_Missense_Mutation_p.1867_1868QD>HY	p.1920_1921QD>HY	NM_017519	NP_059989	WXS	Illumina HiSeq	Unspecified	Q8NFD5	ARI1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)	20	5912_5913	+		Breast(66;0.000162)|Ovarian(120;0.0265)	1925_1926					Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	DNP	ENST00000350026.5	37	c.5760_5761GG>TT	CCDS5251.2																																																																																				0.550	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732		16	137	0	0	0	0.004672	0	16	137				
CCR6	1235	broad.mit.edu	37	6	167550322	167550322	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:167550322C>A	ENST00000341935.5	+	3	1156	c.604C>A	c.(604-606)Cag>Aag	p.Q202K	CCR6_ENST00000349984.4_Missense_Mutation_p.Q202K|CCR6_ENST00000400926.2_Missense_Mutation_p.Q202K|RP11-517H2.6_ENST00000609590.1_RNA	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	202					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		ACCCAAGTACCAGACTGTCTC	0.468																																							uc003qvl.2		NA																	0				ovary(1)	1						c.(604-606)CAG>AAG		chemokine (C-C motif) receptor 6							123.0	109.0	114.0					6																	167550322		2203	4300	6503	SO:0001583	missense	1235				cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|humoral immune response	integral to plasma membrane	C-C chemokine receptor activity	g.chr6:167550322C>A	U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.604C>A	6.37:g.167550322C>A	ENSP00000343952:p.Gln202Lys		Somatic				CCR6_uc010kkm.2_Missense_Mutation_p.Q202K|CCR6_uc003qvn.3_Missense_Mutation_p.Q202K|CCR6_uc003qvm.3_Missense_Mutation_p.Q202K	p.Q202K	NM_031409	NP_113597	WXS	Illumina HiSeq	Unspecified	P51684	CCR6_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)	13	3080	+		Breast(66;1.53e-05)|Ovarian(120;0.0606)	202			Extracellular (Potential).		E1P5C6|P78553|Q92846	Missense_Mutation	SNP	ENST00000341935.5	37	c.604C>A	CCDS5298.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.175113	0.00312	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	T;T;T	0.34472	1.36;1.36;1.36	4.94	1.97	0.26223	GPCR, rhodopsin-like superfamily (1);	3.581300	0.00837	N	0.001701	T	0.04724	0.0128	N	0.04636	-0.2	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23762	-1.0179	10	0.05351	T	0.99	.	8.9486	0.35773	0.2382:0.4945:0.2673:0.0	.	202	P51684	CCR6_HUMAN	K	202	ENSP00000383715:Q202K;ENSP00000343952:Q202K;ENSP00000339393:Q202K	ENSP00000343952:Q202K	Q	+	1	0	CCR6	167470312	0.001000	0.12720	0.005000	0.12908	0.006000	0.05464	-0.132000	0.10467	0.067000	0.16545	-0.165000	0.13383	CAG		0.468	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043118.1			8	69	1	0	0.00448238	0.004482	0.00638268	8	69				
GPR31	2853	broad.mit.edu	37	6	167570790	167570790	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:167570790C>G	ENST00000366834.1	-	1	1027	c.530G>C	c.(529-531)tGg>tCg	p.W177S		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	177					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		TGCTTCCTGCCAGATGATGCT	0.592																																							uc011egq.1		NA																	0					0						c.(529-531)TGG>TCG		G protein-coupled receptor 31							92.0	99.0	97.0					6																	167570790		2203	4300	6503	SO:0001583	missense	2853					integral to plasma membrane	G-protein coupled receptor activity	g.chr6:167570790C>G	U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.530G>C	6.37:g.167570790C>G	ENSP00000355799:p.Trp177Ser		Somatic					p.W177S	NM_005299	NP_005290	WXS	Illumina HiSeq	Unspecified	O00270	GPR31_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)	1	530	-		Breast(66;1.53e-05)|Ovarian(120;0.0606)	177			Extracellular (Potential).		B0M0K2|Q4VBL3|Q9NQ20	Missense_Mutation	SNP	ENST00000366834.1	37	c.530G>C	CCDS5299.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.904861	0.33628	.	.	ENSG00000120436	ENST00000366834	T	0.36340	1.26	3.65	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.221785	0.23241	U	0.050359	T	0.47078	0.1426	M	0.69823	2.125	0.42978	D	0.994453	D	0.67145	0.996	D	0.69142	0.962	T	0.46498	-0.9187	10	0.40728	T	0.16	-16.4389	14.1576	0.65428	0.0:1.0:0.0:0.0	.	177	O00270	GPR31_HUMAN	S	177	ENSP00000355799:W177S	ENSP00000355799:W177S	W	-	2	0	GPR31	167490780	0.283000	0.24277	0.028000	0.17463	0.058000	0.15608	1.281000	0.33214	1.890000	0.54733	0.306000	0.20318	TGG		0.592	GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043111.1	NM_005299		17	149	0	0	0	0.004007	0	17	149				
CARD11	84433	broad.mit.edu	37	7	2953041	2953041	+	Missense_Mutation	SNP	G	G	A	rs149857605	byFrequency	TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:2953041G>A	ENST00000396946.4	-	22	3302	c.2899C>T	c.(2899-2901)Cgc>Tgc	p.R967C		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	967					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TAGAAGGCGCGTACCAGGCTG	0.677			Mis		DLBCL																																		uc003smv.2		NA		Dom	yes		7	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50						c.(2899-2901)CGC>TGC		caspase recruitment domain family, member 11		G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	73.0	63.0	67.0		2899	4.4	1.0	7	dbSNP_134	67	2,8598	1.2+/-3.3	0,2,4298	yes	missense	CARD11	NM_032415.4	180	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	967/1155	2953041	3,13003	2203	4300	6503	SO:0001583	missense	84433				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	g.chr7:2953041G>A	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2899C>T	7.37:g.2953041G>A	ENSP00000380150:p.Arg967Cys		Somatic					p.R967C	NM_032415	NP_115791	WXS	Illumina HiSeq	Unspecified	Q9BXL7	CAR11_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)	22	3303	-		Ovarian(82;0.0115)	967					A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	c.2899C>T	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396246	0.42512	2.27E-4	2.33E-4	ENSG00000198286	ENST00000396946	T	0.33216	1.42	4.36	4.36	0.52297	.	0.334784	0.27231	N	0.020313	T	0.24661	0.0598	N	0.24115	0.695	0.49483	D	0.999792	P	0.50819	0.939	B	0.44163	0.443	T	0.06698	-1.0812	10	0.87932	D	0	-24.9651	12.952	0.58407	0.0:0.0:0.8269:0.1731	.	967	Q9BXL7	CAR11_HUMAN	C	967	ENSP00000380150:R967C	ENSP00000380150:R967C	R	-	1	0	CARD11	2919567	0.986000	0.35501	0.986000	0.45419	0.565000	0.35776	4.627000	0.61276	1.985000	0.57927	0.484000	0.47621	CGC		0.677	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		6	67	0	0	0	0.001984	0	6	67				
PMS2	5395	broad.mit.edu	37	7	6043687	6043687	+	Missense_Mutation	SNP	G	G	C	rs371011390		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:6043687G>C	ENST00000265849.7	-	3	271	c.166C>G	c.(166-168)Cta>Gta	p.L56V	PMS2_ENST00000441476.2_5'Flank|Y_RNA_ENST00000365120.1_RNA|PMS2_ENST00000406569.3_Missense_Mutation_p.L56V|PMS2_ENST00000382321.4_Missense_Mutation_p.L56V|PMS2_ENST00000469652.1_Intron	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	56					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TTAAGCTTTAGATCTAGAAAG	0.299			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc003spl.2		NA	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	Mis|N|F	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)			E		colorectal|endometrial|ovarian|medulloblastoma|glioma			0				lung(1)|central_nervous_system(1)	2						c.(166-168)CTA>GTA	Direct_reversal_of_damage|MMR	PMS2 postmeiotic segregation increased 2 isoform							65.0	69.0	68.0					7																	6043687		2197	4294	6491	SO:0001583	missense	5395	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding	g.chr7:6043687G>C		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.166C>G	7.37:g.6043687G>C	ENSP00000265849:p.Leu56Val		Somatic				PMS2_uc003spj.2_Translation_Start_Site|PMS2_uc003spk.2_Translation_Start_Site|PMS2_uc011jwl.1_Translation_Start_Site|PMS2_uc010ktg.2_Translation_Start_Site|PMS2_uc010kte.2_Missense_Mutation_p.L56V|PMS2_uc010ktf.1_Missense_Mutation_p.L56V	p.L56V	NM_000535	NP_000526	WXS	Illumina HiSeq	Unspecified	P54278	PMS2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)	3	253	-		Ovarian(82;0.0694)	56					B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	ENST00000265849.7	37	c.166C>G	CCDS5343.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.813|0.813	-0.751383|-0.751383	0.03041|0.03041	.|.	.|.	ENSG00000122512|ENSG00000122512	ENST00000265849;ENST00000382321;ENST00000406569|ENST00000382322	T;T;T|.	0.68765|.	-0.35;-0.35;-0.35|.	5.53|5.53	1.46|1.46	0.22682|0.22682	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (4);|.	0.344773|.	0.27345|.	N|.	0.019799|.	T|T	0.13030|0.13030	0.0316|0.0316	N|N	0.00808|0.00808	-1.17|-1.17	0.80722|0.80722	D|D	1|1	B;D;B|.	0.76494|.	0.015;0.999;0.022|.	B;D;B|.	0.80764|.	0.026;0.994;0.094|.	T|T	0.07328|0.07328	-1.0778|-1.0778	10|6	0.02654|0.87932	T|D	1|0	-3.085|-3.085	1.9629|1.9629	0.03390|0.03390	0.1355:0.2676:0.2973:0.2996|0.1355:0.2676:0.2973:0.2996	.|.	56;56;56|.	P54278-3;P54278-2;P54278|.	.;.;PMS2_HUMAN|.	V|C	56|9	ENSP00000265849:L56V;ENSP00000371758:L56V;ENSP00000384308:L56V|.	ENSP00000265849:L56V|ENSP00000371759:S9C	L|S	-|-	1|2	2|0	PMS2|PMS2	6010213|6010213	0.045000|0.045000	0.20229|0.20229	0.935000|0.935000	0.37517|0.37517	0.544000|0.544000	0.35116|0.35116	0.036000|0.036000	0.13819|0.13819	0.239000|0.239000	0.21243|0.21243	-0.494000|-0.494000	0.04653|0.04653	CTA|TCT		0.299	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535		11	60	0	0	0	0.000978	0	11	60				
AHR	196	broad.mit.edu	37	7	17367416	17367416	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:17367416G>A	ENST00000242057.4	+	4	1037	c.394G>A	c.(394-396)Gat>Aat	p.D132N		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	132	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	TGTCACTACAGATGCTTTGGT	0.279																																							uc011jxz.1		NA																	0				urinary_tract(1)|kidney(1)|pancreas(1)	3						c.(394-396)GAT>AAT		aryl hydrocarbon receptor precursor							157.0	155.0	156.0					7																	17367416		2203	4295	6498	SO:0001583	missense	196				apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding	g.chr7:17367416G>A	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.394G>A	7.37:g.17367416G>A	ENSP00000242057:p.Asp132Asn		Somatic				AHR_uc003stt.3_RNA	p.D132N	NM_001621	NP_001612	WXS	Illumina HiSeq	Unspecified	P35869	AHR_HUMAN			4	1007	+	Lung NSC(10;0.0392)|all_lung(11;0.0754)		132			PAS 1.		A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	c.394G>A	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.800817	0.90538	.	.	ENSG00000106546	ENST00000242057	T	0.22945	1.93	5.64	5.64	0.86602	PAS (2);PAS fold (1);	0.065375	0.64402	D	0.000015	T	0.49508	0.1561	M	0.69248	2.105	0.49213	D	0.999765	D	0.60575	0.988	P	0.61722	0.893	T	0.46762	-0.9168	10	0.66056	D	0.02	.	19.7048	0.96068	0.0:0.0:1.0:0.0	.	132	P35869	AHR_HUMAN	N	132	ENSP00000242057:D132N	ENSP00000242057:D132N	D	+	1	0	AHR	17333941	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	3.786000	0.55431	2.662000	0.90505	0.563000	0.77884	GAT		0.279	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621		10	108	0	0	0	0.000978	0	10	108				
CLK2P1	1197	broad.mit.edu	37	7	23625387	23625387	+	IGR	SNP	T	T	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:23625387T>A								TRA2A (53727 upstream) : CCDC126 (11610 downstream)																							GTGCACTTGGTGGATGGGGTA	0.507																																							uc003swk.2		NA																	0					0						c.(109-111)CAC>CTC		SubName: Full=cDNA FLJ61616, highly similar to Dual specificity protein kinase CLK2 (EC 2.7.12.1); SubName: Full=CDC-like kinase 2, isoform CRA_c; SubName: Full=Putative uncharacterized protein CLK2;																																				SO:0001628	intergenic_variant	1197							g.chr7:23625387T>A																													7.37:g.23625387T>A			Somatic					p.H37L	NR_002711		WXS	Illumina HiSeq	Unspecified					1	760	-									Missense_Mutation	SNP		37	c.110A>T																																																																																				0	0.507									14	61	0	0	0	0.001855	0	14	61				
ADCYAP1R1	117	broad.mit.edu	37	7	31142970	31142970	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:31142970G>T	ENST00000304166.4	+	14	1455	c.1166G>T	c.(1165-1167)gGc>gTc	p.G389V	ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.G445V|ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.G368V|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.G417V	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	389					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						CTGGGGCTGGGCTCCTTCCAG	0.547																																					Ovarian(44;225 1186 2158 11092)	Ovarian(44;225 1186 2158 11092)	uc003tca.1		NA																	0				ovary(1)	1						c.(1165-1167)GGC>GTC		adenylate cyclase activating polypeptide 1							100.0	92.0	94.0					7																	31142970		2203	4300	6503	SO:0001583	missense	117				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity	g.chr7:31142970G>T		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.1166G>T	7.37:g.31142970G>T	ENSP00000306620:p.Gly389Val		Somatic				ADCYAP1R1_uc003tcb.1_Missense_Mutation_p.G368V|ADCYAP1R1_uc003tcc.1_Missense_Mutation_p.G417V|ADCYAP1R1_uc003tcd.1_Missense_Mutation_p.G417V|ADCYAP1R1_uc003tce.1_Missense_Mutation_p.G416V|ADCYAP1R1_uc003tcf.1_Missense_Mutation_p.G147V	p.G389V	NM_001118	NP_001109	WXS	Illumina HiSeq	Unspecified	P41586	PACR_HUMAN			14	1389	+			389			Helical; Name=7; (Potential).		A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	37	c.1166G>T	CCDS5433.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962131	0.74016	.	.	ENSG00000078549	ENST00000304166;ENST00000409363;ENST00000396211;ENST00000409489	T;T;T;T	0.44881	1.21;0.91;0.91;0.91	5.58	4.7	0.59300	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.63283	0.2498	M	0.75447	2.3	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;0.999;0.988;0.995	D;D;D;D;D	0.87578	0.985;0.998;0.988;0.934;0.934	T	0.67473	-0.5662	10	0.72032	D	0.01	.	12.5611	0.56281	0.0805:0.0:0.9195:0.0	.	416;417;445;368;389	B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.;.;.;.;PACR_HUMAN	V	389;368;417;445	ENSP00000306620:G389V;ENSP00000387335:G368V;ENSP00000379514:G417V;ENSP00000386395:G445V	ENSP00000306620:G389V	G	+	2	0	ADCYAP1R1	31109495	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.869000	0.99810	1.509000	0.48786	-0.136000	0.14681	GGC		0.547	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118		12	61	1	0	1.08611e-07	0.000978	1.62547e-07	12	61				
ZNF107	51427	broad.mit.edu	37	7	64168600	64168600	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:64168600G>A	ENST00000395391.1	+	4	3293	c.1918G>A	c.(1918-1920)Gaa>Aaa	p.E640K	ZNF107_ENST00000423627.1_Missense_Mutation_p.E640K|ZNF107_ENST00000344930.3_Missense_Mutation_p.E640K			Q9UII5	ZN107_HUMAN	zinc finger protein 107	640					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				CCAATGTGCAGAATGTGGCAA	0.373																																							uc003ttd.2		NA																	0				ovary(1)	1						c.(1918-1920)GAA>AAA		zinc finger protein 107							38.0	43.0	41.0					7																	64168600		2202	4299	6501	SO:0001583	missense	51427				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:64168600G>A	AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.1918G>A	7.37:g.64168600G>A	ENSP00000378789:p.Glu640Lys		Somatic				ZNF107_uc003tte.2_Missense_Mutation_p.E640K	p.E640K	NM_016220	NP_057304	WXS	Illumina HiSeq	Unspecified	Q9UII5	ZN107_HUMAN			7	2704	+		Lung NSC(55;0.00948)|all_lung(88;0.0249)	640			C2H2-type 21.			Missense_Mutation	SNP	ENST00000395391.1	37	c.1918G>A	CCDS5527.1	.	.	.	.	.	.	.	.	.	.	.	18.62	3.662300	0.67700	.	.	ENSG00000196247	ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.07327	3.2;3.2;3.2	1.27	1.27	0.21489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09113	0.0225	L	0.37697	1.125	0.09310	N	1	P	0.50272	0.933	P	0.49597	0.616	T	0.25606	-1.0127	8	.	.	.	.	3.6571	0.08225	0.2769:0.0:0.723:0.0	.	640	Q9UII5	ZN107_HUMAN	K	640	ENSP00000343443:E640K;ENSP00000400037:E640K;ENSP00000378789:E640K	.	E	+	1	0	ZNF107	63806035	0.000000	0.05858	0.880000	0.34516	0.983000	0.72400	-0.004000	0.12878	0.635000	0.30488	0.313000	0.20887	GAA		0.373	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220		5	48	0	0	0	0.001168	0	5	48				
FKBP6	8468	broad.mit.edu	37	7	72744349	72744349	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:72744349C>T	ENST00000252037.4	+	4	531	c.462C>T	c.(460-462)ctC>ctT	p.L154L	FKBP6_ENST00000413573.2_Silent_p.L124L|TRIM50_ENST00000493498.1_5'Flank|FKBP6_ENST00000431982.2_Silent_p.L149L|TRIM50_ENST00000333149.2_5'Flank	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa	154					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				TTTGTGCTCTCTCAGCTGTAA	0.498																																							uc003tya.2		NA																	0					0						c.(460-462)CTC>CTT		FK506 binding protein 6 isoform a							77.0	70.0	72.0					7																	72744349		2203	4300	6503	SO:0001819	synonymous_variant	8468				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr7:72744349C>T	AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.462C>T	7.37:g.72744349C>T			Somatic				FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Silent_p.L149L|FKBP6_uc010lbe.1_RNA|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank	p.L154L	NM_003602	NP_003593	WXS	Illumina HiSeq	Unspecified	O75344	FKBP6_HUMAN			4	594	+		Lung NSC(55;0.0908)|all_lung(88;0.198)	154					B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Silent	SNP	ENST00000252037.4	37	c.462C>T	CCDS43595.1																																																																																				0.498	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318723.1	NM_003602		10	75	0	0	0	0.006214	0	10	75				
HIP1	3092	broad.mit.edu	37	7	75228554	75228554	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:75228554G>C	ENST00000336926.6	-	2	158	c.132C>G	c.(130-132)atC>atG	p.I44M	HIP1_ENST00000434438.2_Missense_Mutation_p.I44M	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	44	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.I44M(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGGCCTTATTGATGCTGACAG	0.507			T	PDGFRB	CMML																																		uc003uds.1		NA		Dom	yes		7	7q11.23	3092	T	huntingtin interacting protein 1			L	PDGFRB		CMML		1	Substitution - Missense(1)		lung(1)	lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						c.(130-132)ATC>ATG		huntingtin interacting protein 1							123.0	128.0	126.0					7																	75228554		2203	4300	6503	SO:0001583	missense	3092				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton	g.chr7:75228554G>C	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.132C>G	7.37:g.75228554G>C	ENSP00000336747:p.Ile44Met		Somatic					p.I44M	NM_005338	NP_005329	WXS	Illumina HiSeq	Unspecified	O00291	HIP1_HUMAN			2	173	-			44			ENTH.		B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	c.132C>G	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278885	0.59758	.	.	ENSG00000127946	ENST00000336926;ENST00000434438;ENST00000420909	T;T;T	0.42131	0.98;0.98;0.98	5.13	4.24	0.50183	ENTH/VHS (2);ANTH (1);Epsin-like, N-terminal (2);	0.094156	0.64402	D	0.000001	T	0.57902	0.2085	M	0.71206	2.165	0.42978	D	0.994452	P	0.48350	0.909	D	0.63957	0.92	T	0.61043	-0.7142	10	0.87932	D	0	-22.0486	7.8602	0.29506	0.0813:0.0:0.7588:0.16	.	44	O00291	HIP1_HUMAN	M	44;44;15	ENSP00000336747:I44M;ENSP00000410300:I44M;ENSP00000414280:I15M	ENSP00000336747:I44M	I	-	3	3	HIP1	75066490	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.096000	0.64535	1.381000	0.46364	0.561000	0.74099	ATC		0.507	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338		17	168	0	0	0	0.002299	0	17	168				
HGF	3082	broad.mit.edu	37	7	81335005	81335005	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:81335005C>T	ENST00000222390.5	-	16	2048	c.1822G>A	c.(1822-1824)Gaa>Aaa	p.E608K	HGF_ENST00000457544.2_Missense_Mutation_p.E603K	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	608	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						CTGGTCTTTTCAGGAATTGTG	0.358																																							uc003uhl.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1822-1824)GAA>AAA		hepatocyte growth factor isoform 1							90.0	84.0	86.0					7																	81335005		2203	4300	6503	SO:0001583	missense	3082				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity	g.chr7:81335005C>T		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1822G>A	7.37:g.81335005C>T	ENSP00000222390:p.Glu608Lys		Somatic				HGF_uc003uhm.2_Missense_Mutation_p.E603K	p.E608K	NM_000601	NP_000592	WXS	Illumina HiSeq	Unspecified	P14210	HGF_HUMAN			16	1987	-			608			Peptidase S1.		A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	ENST00000222390.5	37	c.1822G>A	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491968	0.84962	.	.	ENSG00000019991	ENST00000222390;ENST00000457544	D;D	0.88896	-2.44;-2.44	4.74	4.74	0.60224	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.91317	0.7262	L	0.41079	1.255	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.76071	0.978;0.987	D	0.89346	0.3657	10	0.25106	T	0.35	.	17.0863	0.86611	0.0:1.0:0.0:0.0	.	603;608	P14210-3;P14210	.;HGF_HUMAN	K	608;603	ENSP00000222390:E608K;ENSP00000391238:E603K	ENSP00000222390:E608K	E	-	1	0	HGF	81172941	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.145000	0.58065	2.331000	0.79229	0.585000	0.79938	GAA		0.358	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601		4	35	0	0	0	0.000602	0	4	35				
ZSCAN25	221785	broad.mit.edu	37	7	99217442	99217442	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:99217442G>A	ENST00000394152.2	+	4	540	c.213G>A	c.(211-213)ctG>ctA	p.L71L	ZSCAN25_ENST00000334715.3_Silent_p.L71L|ZSCAN25_ENST00000262941.6_Silent_p.L71L|ZSCAN25_ENST00000466948.1_3'UTR	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	71	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTCGGTGGCTGAGGCCCGAGT	0.622																																							uc003url.1		NA																	0				ovary(2)	2						c.(211-213)CTG>CTA		zinc finger and SCAN domain containing 25							67.0	73.0	71.0					7																	99217442		2203	4300	6503	SO:0001819	synonymous_variant	221785				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:99217442G>A	AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.213G>A	7.37:g.99217442G>A			Somatic				ZNF498_uc003urm.1_5'UTR|ZNF498_uc010lge.1_5'UTR|ZNF498_uc003urn.2_RNA|ZNF498_uc010lgf.1_Silent_p.L71L|ZNF498_uc003uro.1_5'Flank	p.L71L	NM_145115	NP_660090	WXS	Illumina HiSeq	Unspecified	Q6NSZ9	ZN498_HUMAN			4	540	+	all_epithelial(64;1.95e-08)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)		71			SCAN box.		A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Silent	SNP	ENST00000394152.2	37	c.213G>A	CCDS5671.2																																																																																				0.622	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157203.4	NM_145115		16	90	0	0	0	0.00499	0	16	90				
PNPLA8	50640	broad.mit.edu	37	7	108155227	108155227	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:108155227C>T	ENST00000422087.1	-	4	1115	c.709G>A	c.(709-711)Gaa>Aaa	p.E237K	PNPLA8_ENST00000453144.1_Missense_Mutation_p.E137K|PNPLA8_ENST00000483879.1_Intron|PNPLA8_ENST00000388728.5_Missense_Mutation_p.E237K|PNPLA8_ENST00000257694.8_Missense_Mutation_p.E237K|PNPLA8_ENST00000436062.1_Missense_Mutation_p.E237K|PNPLA8_ENST00000426128.2_Missense_Mutation_p.E237K	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	237					arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)			breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						TTTTTATCTTCAAGTTCTGAT	0.363																																							uc003vff.1		NA																	0				breast(2)	2						c.(709-711)GAA>AAA		patatin-like phospholipase domain containing 8							63.0	60.0	61.0					7																	108155227		2203	4300	6503	SO:0001583	missense	50640				fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity	g.chr7:108155227C>T	AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.709G>A	7.37:g.108155227C>T	ENSP00000410804:p.Glu237Lys		Somatic				PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Missense_Mutation_p.E237K|PNPLA8_uc003vfi.1_Missense_Mutation_p.E137K|PNPLA8_uc003vfj.1_Missense_Mutation_p.E237K|PNPLA8_uc003vfk.1_Missense_Mutation_p.E137K	p.E237K	NM_015723	NP_056538	WXS	Illumina HiSeq	Unspecified	Q9NP80	PLPL8_HUMAN			4	1116	-			237					A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	Missense_Mutation	SNP	ENST00000422087.1	37	c.709G>A	CCDS34733.1	.	.	.	.	.	.	.	.	.	.	C	3.576	-0.086548	0.07097	.	.	ENSG00000135241	ENST00000426128;ENST00000257694;ENST00000388728;ENST00000422087;ENST00000453144;ENST00000436062;ENST00000453085	D;D;D;D;D;D;D	0.97772	-3.31;-4.53;-3.31;-4.53;-4.52;-4.53;-4.51	5.78	2.59	0.31030	.	0.592724	0.18318	N	0.144885	D	0.93138	0.7815	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	D	0.86025	0.1509	10	0.35671	T	0.21	.	6.8921	0.24234	0.0:0.586:0.1247:0.2893	.	237	Q9NP80	PLPL8_HUMAN	K	237;237;237;237;137;237;137	ENSP00000394988:E237K;ENSP00000257694:E237K;ENSP00000373380:E237K;ENSP00000410804:E237K;ENSP00000387789:E137K;ENSP00000406779:E237K;ENSP00000402274:E137K	ENSP00000257694:E237K	E	-	1	0	PNPLA8	107942463	0.020000	0.18652	0.084000	0.20598	0.098000	0.18820	0.127000	0.15790	0.796000	0.33947	0.591000	0.81541	GAA		0.363	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337475.1	NM_015723		5	34	0	0	0	0.001168	0	5	34				
TMEM209	84928	broad.mit.edu	37	7	129843654	129843654	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:129843654A>C	ENST00000397622.2	-	3	295	c.173T>G	c.(172-174)gTg>gGg	p.V58G	TMEM209_ENST00000462753.1_Missense_Mutation_p.V57G|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000336804.8_Missense_Mutation_p.V57G|TMEM209_ENST00000473456.1_Missense_Mutation_p.V58G	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	58						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					CCAGTATGTCACATTGTAGTA	0.313																																							uc003vpn.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(172-174)GTG>GGG		transmembrane protein 209							42.0	40.0	41.0					7																	129843654		1799	4066	5865	SO:0001583	missense	84928					integral to membrane		g.chr7:129843654A>C		CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.173T>G	7.37:g.129843654A>C	ENSP00000380747:p.Val58Gly		Somatic				TMEM209_uc010lmc.1_Missense_Mutation_p.V58G|TMEM209_uc003vpo.2_Missense_Mutation_p.V58G	p.V58G	NM_032842	NP_116231	WXS	Illumina HiSeq	Unspecified	Q96SK2	TM209_HUMAN			3	296	-	Melanoma(18;0.0435)		58					A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	ENST00000397622.2	37	c.173T>G	CCDS47712.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.156954	0.78114	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804;ENST00000484249;ENST00000471985	T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43	5.52	5.52	0.82312	.	0.047302	0.85682	D	0.000000	T	0.26048	0.0635	N	0.08118	0	0.80722	D	1	B;P;P	0.48503	0.437;0.911;0.492	B;P;B	0.49421	0.329;0.61;0.336	T	0.18999	-1.0319	10	0.72032	D	0.01	-17.5023	15.1186	0.72423	1.0:0.0:0.0:0.0	.	58;58;58	Q96SK2-3;Q96SK2-4;Q96SK2	.;.;TM209_HUMAN	G	58;57;58;57;58;101	ENSP00000380747:V58G;ENSP00000419697:V57G;ENSP00000417258:V58G;ENSP00000338388:V57G;ENSP00000419852:V101G	ENSP00000338388:V57G	V	-	2	0	TMEM209	129630890	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.533000	0.90617	2.222000	0.72286	0.533000	0.62120	GTG		0.313	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349339.1	NM_032842		3	11	0	0	0	0.000248	0	3	11				
DENND2A	27147	broad.mit.edu	37	7	140221722	140221722	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:140221722G>A	ENST00000275884.6	-	17	3261	c.2844C>T	c.(2842-2844)gtC>gtT	p.V948V	DENND2A_ENST00000496613.1_Silent_p.V948V|DENND2A_ENST00000537639.1_Silent_p.V948V			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	948	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					TCTCCATGAAGACCTCCAGGA	0.617																																							uc010lnj.2		NA																	0				ovary(3)|breast(1)	4						c.(2842-2844)GTC>GTT		DENN/MADD domain containing 2A							36.0	41.0	39.0					7																	140221722		2022	4211	6233	SO:0001819	synonymous_variant	27147							g.chr7:140221722G>A	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.2844C>T	7.37:g.140221722G>A			Somatic				DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Silent_p.V948V|DENND2A_uc003vvw.2_Silent_p.V948V	p.V948V	NM_015689	NP_056504	WXS	Illumina HiSeq	Unspecified	Q9ULE3	DEN2A_HUMAN			16	2989	-	Melanoma(164;0.00956)		948			dDENN.		C9JUI3|Q1RMD5|Q86XY0	Silent	SNP	ENST00000275884.6	37	c.2844C>T	CCDS43659.1																																																																																				0.617	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689		4	47	0	0	0	0.000248	0	4	47				
CLCN1	1180	broad.mit.edu	37	7	143047716	143047716	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:143047716G>T	ENST00000343257.2	+	22	2651	c.2564G>T	c.(2563-2565)gGg>gTg	p.G855V		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	855	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					ACCAGCATGGGGAAGCTCAGG	0.582																																							uc003wcr.1		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(2563-2565)GGG>GTG		chloride channel 1, skeletal muscle							214.0	176.0	189.0					7																	143047716		2203	4300	6503	SO:0001583	missense	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143047716G>T	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2564G>T	7.37:g.143047716G>T	ENSP00000339867:p.Gly855Val		Somatic				CLCN1_uc011ktc.1_Missense_Mutation_p.G467V	p.G855V	NM_000083	NP_000074	WXS	Illumina HiSeq	Unspecified	P35523	CLCN1_HUMAN			22	2651	+	Melanoma(164;0.205)		855			CBS 2.|Cytoplasmic (By similarity).		A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	c.2564G>T	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420454	0.83559	.	.	ENSG00000188037	ENST00000343257	D	0.92149	-2.98	4.16	4.16	0.48862	Cystathionine beta-synthase, core (1);	0.052712	0.85682	D	0.000000	D	0.97256	0.9103	H	0.95328	3.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.98616	1.0665	10	0.87932	D	0	.	17.0049	0.86390	0.0:0.0:1.0:0.0	.	54;855	Q75L28;P35523	.;CLCN1_HUMAN	V	855	ENSP00000339867:G855V	ENSP00000339867:G855V	G	+	2	0	CLCN1	142757838	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.884000	0.92432	2.331000	0.79229	0.462000	0.41574	GGG		0.582	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		19	173	1	0	2.37509e-13	0.001523	3.66681e-13	19	173				
OR2A25	392138	broad.mit.edu	37	7	143771395	143771395	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:143771395G>A	ENST00000408898.2	+	1	121	c.83G>A	c.(82-84)gGg>gAg	p.G28E		NM_001004488.1	NP_001004488.1	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A, member 25	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(16)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	24	Melanoma(164;0.0783)					CTCCTCTTTGGGCTCTTCTCC	0.507																																							uc011ktx.1		NA																	0					0						c.(82-84)GGG>GAG		olfactory receptor, family 2, subfamily A,							80.0	85.0	83.0					7																	143771395		2203	4300	6503	SO:0001583	missense	392138				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143771395G>A		CCDS43669.1	7q35	2012-08-09		2004-03-10	ENSG00000221933	ENSG00000221933		"""GPCR / Class A : Olfactory receptors"""	19562	protein-coding gene	gene with protein product				OR2A25P, OR2A27			Standard	NM_001004488		Approved		uc011ktx.2	A4D2G3	OTTHUMG00000158013	ENST00000408898.2:c.83G>A	7.37:g.143771395G>A	ENSP00000386167:p.Gly28Glu		Somatic					p.G28E	NM_001004488	NP_001004488	WXS	Illumina HiSeq	Unspecified	A4D2G3	O2A25_HUMAN			1	83	+	Melanoma(164;0.0783)		28			Helical; Name=1; (Potential).		B2RNC9	Missense_Mutation	SNP	ENST00000408898.2	37	c.83G>A	CCDS43669.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052482	0.36181	.	.	ENSG00000221933	ENST00000408898	T	0.00433	7.43	4.88	3.03	0.35002	.	.	.	.	.	T	0.00608	0.0020	M	0.89095	3.005	0.26630	N	0.972489	P	0.50066	0.931	B	0.44224	0.444	T	0.43475	-0.9389	9	0.30854	T	0.27	-0.9076	7.4842	0.27423	0.0:0.164:0.4978:0.3382	.	28	A4D2G3	O2A25_HUMAN	E	28	ENSP00000386167:G28E	ENSP00000386167:G28E	G	+	2	0	OR2A25	143402328	0.000000	0.05858	0.864000	0.33941	0.919000	0.55068	0.000000	0.12993	0.625000	0.30304	0.563000	0.77884	GGG		0.507	OR2A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350000.1			11	91	0	0	0	0.008291	0	11	91				
ARHGEF5	7984	broad.mit.edu	37	7	144070344	144070344	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:144070344C>T	ENST00000056217.5	+	10	4281	c.4107C>T	c.(4105-4107)atC>atT	p.I1369I	ARHGEF5_ENST00000471847.2_Silent_p.I291I	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	1369					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					AGGAACTAATCTACCTGAGCC	0.532																																							uc003wel.2		NA																	0				skin(2)	2						c.(4105-4107)ATC>ATT		rho guanine nucleotide exchange factor 5							145.0	131.0	136.0					7																	144070344		1999	4015	6014	SO:0001819	synonymous_variant	7984				intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr7:144070344C>T	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.4107C>T	7.37:g.144070344C>T			Somatic				ARHGEF5_uc003wek.2_Silent_p.I1369I|ARHGEF5_uc003wem.2_Silent_p.I224I	p.I1369I	NM_005435	NP_005426	WXS	Illumina HiSeq	Unspecified	Q12774	ARHG5_HUMAN			10	4225	+	Melanoma(164;0.14)		1369					A6NNJ2|Q6ZML7	Silent	SNP	ENST00000056217.5	37	c.4107C>T	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	C	8.768	0.925187	0.18056	.	.	ENSG00000050327	ENST00000474817	.	.	.	4.53	3.62	0.41486	.	.	.	.	.	T	0.62159	0.2405	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59894	-0.7368	4	.	.	.	-20.2205	11.4731	0.50282	0.181:0.819:0.0:0.0	.	.	.	.	F	623	.	.	S	+	2	0	ARHGEF5	143701277	0.998000	0.40836	1.000000	0.80357	0.878000	0.50629	0.649000	0.24843	1.075000	0.40932	0.650000	0.86243	TCT		0.532	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435		13	198	0	0	0	0.00245	0	13	198				
ARHGEF10	9639	broad.mit.edu	37	8	1905296	1905296	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:1905296C>A	ENST00000398564.1	+	29	3977	c.3977C>A	c.(3976-3978)gCc>gAc	p.A1326D	ARHGEF10_ENST00000349830.3_Missense_Mutation_p.A1301D|ARHGEF10_ENST00000262112.6_Missense_Mutation_p.A1297D|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.A1263D|ARHGEF10_ENST00000521927.1_3'UTR|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.A1325D			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	1326					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GCCAAGAAAGCCAAGGCCAGC	0.647																																							uc003wpr.2		NA																	0				large_intestine(1)	1						c.(3901-3903)GCC>GAC		Rho guanine nucleotide exchange factor 10							31.0	31.0	31.0					8																	1905296		2202	4299	6501	SO:0001583	missense	9639				centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity	g.chr8:1905296C>A	AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.3977C>A	8.37:g.1905296C>A	ENSP00000381571:p.Ala1326Asp		Somatic				ARHGEF10_uc003wps.2_Missense_Mutation_p.A1263D|ARHGEF10_uc010lre.2_Missense_Mutation_p.A952D	p.A1301D	NM_014629	NP_055444	WXS	Illumina HiSeq	Unspecified	O15013	ARHGA_HUMAN		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)	29	4080	+		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)	1326					O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	37	c.3902C>A		.	.	.	.	.	.	.	.	.	.	C	2.240	-0.374115	0.05034	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T	0.57752	0.38;0.39;0.38;0.38;0.4;0.49	5.71	3.85	0.44370	.	0.509990	0.21269	N	0.077348	T	0.33440	0.0863	L	0.34521	1.04	0.18873	N	0.999982	B;B	0.24258	0.1;0.004	B;B	0.16289	0.015;0.007	T	0.11941	-1.0567	10	0.15066	T	0.55	-23.0872	5.2917	0.15731	0.0:0.4916:0.2867:0.2217	.	1263;1301	O15013-7;O15013-5	.;.	D	1301;1263;1325;1326;1297;945	ENSP00000340297:A1301D;ENSP00000427909:A1263D;ENSP00000431012:A1325D;ENSP00000381571:A1326D;ENSP00000262112:A1297D;ENSP00000427768:A945D	ENSP00000262112:A1297D	A	+	2	0	ARHGEF10	1892703	0.745000	0.28261	0.014000	0.15608	0.134000	0.20937	1.110000	0.31147	1.401000	0.46761	-0.140000	0.14226	GCC		0.647	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding				5	49	1	0	0.00198382	0.001984	0.00283403	5	49				
CSMD1	64478	broad.mit.edu	37	8	2965255	2965255	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:2965255C>T	ENST00000520002.1	-	46	7378	c.6823G>A	c.(6823-6825)Gat>Aat	p.D2275N	CSMD1_ENST00000602557.1_Missense_Mutation_p.D2275N|CSMD1_ENST00000537824.1_Missense_Mutation_p.D2274N|CSMD1_ENST00000602723.1_Missense_Mutation_p.D2275N|CSMD1_ENST00000542608.1_Missense_Mutation_p.D2274N|CSMD1_ENST00000400186.3_Missense_Mutation_p.D2275N			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2275	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCGAAATCATCATCCTCAGTA	0.358																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(6823-6825)GAT>AAT		CUB and Sushi multiple domains 1 precursor							146.0	139.0	142.0					8																	2965255		1859	4089	5948	SO:0001583	missense	64478					integral to membrane		g.chr8:2965255C>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6823G>A	8.37:g.2965255C>T	ENSP00000430733:p.Asp2275Asn		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.D1667N|CSMD1_uc010lrg.2_Missense_Mutation_p.D343N	p.D2275N	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	45	7213	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2275			Extracellular (Potential).|Sushi 13.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.6823G>A		.	.	.	.	.	.	.	.	.	.	C	9.181	1.023608	0.19433	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.24	4.17	0.49024	Complement control module (2);Sushi/SCR/CCP (3);	0.367857	0.26373	N	0.024742	T	0.51822	0.1697	L	0.31926	0.97	0.80722	D	1	B;B;B	0.25048	0.117;0.0;0.002	B;B;B	0.29942	0.109;0.005;0.007	T	0.46911	-0.9157	10	0.23302	T	0.38	.	14.7089	0.69211	0.0:0.9173:0.0:0.0827	.	2275;2275;2274	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	N	2275;2275;2136;2274;2274	ENSP00000383047:D2275N;ENSP00000430733:D2275N;ENSP00000441462:D2274N;ENSP00000446243:D2274N	ENSP00000320445:D2136N	D	-	1	0	CSMD1	2952662	1.000000	0.71417	0.998000	0.56505	0.108000	0.19459	2.595000	0.46197	2.436000	0.82500	0.551000	0.68910	GAT		0.358	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		8	89	0	0	0	0.001368	0	8	89				
CSMD1	64478	broad.mit.edu	37	8	2965273	2965273	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:2965273C>G	ENST00000520002.1	-	46	7360	c.6805G>C	c.(6805-6807)Gaa>Caa	p.E2269Q	CSMD1_ENST00000602557.1_Missense_Mutation_p.E2269Q|CSMD1_ENST00000537824.1_Missense_Mutation_p.E2268Q|CSMD1_ENST00000602723.1_Missense_Mutation_p.E2269Q|CSMD1_ENST00000542608.1_Missense_Mutation_p.E2268Q|CSMD1_ENST00000400186.3_Missense_Mutation_p.E2269Q			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2269	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTAAGCATTTCTGCCTGTGGA	0.353																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(6805-6807)GAA>CAA		CUB and Sushi multiple domains 1 precursor							146.0	139.0	141.0					8																	2965273		1854	4084	5938	SO:0001583	missense	64478					integral to membrane		g.chr8:2965273C>G			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6805G>C	8.37:g.2965273C>G	ENSP00000430733:p.Glu2269Gln		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.E1661Q|CSMD1_uc010lrg.2_Missense_Mutation_p.E337Q	p.E2269Q	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	45	7195	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2269			Extracellular (Potential).|Sushi 13.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.6805G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.76|17.76	3.468180|3.468180	0.63625|0.63625	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.23950|.	1.88;1.88;1.88;1.88|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Complement control module (2);Sushi/SCR/CCP (3);|.	0.205179|.	0.40640|.	N|.	0.001047|.	T|T	0.72684|0.72684	0.3491|0.3491	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	B;B;P|.	0.42010|.	0.117;0.43;0.768|.	B;P;P|.	0.52627|.	0.207;0.704;0.5|.	T|T	0.70626|0.70626	-0.4820|-0.4820	10|5	0.23891|.	T|.	0.37|.	.|.	18.8255|18.8255	0.92117|0.92117	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2269;2269;2268|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	Q|T	2269;2269;2130;2268;2268|1748	ENSP00000383047:E2269Q;ENSP00000430733:E2269Q;ENSP00000441462:E2268Q;ENSP00000446243:E2268Q|.	ENSP00000320445:E2130Q|.	E|R	-|-	1|2	0|0	CSMD1|CSMD1	2952680|2952680	1.000000|1.000000	0.71417|0.71417	0.501000|0.501000	0.27601|0.27601	0.116000|0.116000	0.19942|0.19942	5.239000|5.239000	0.65371|0.65371	2.436000|2.436000	0.82500|0.82500	0.551000|0.551000	0.68910|0.68910	GAA|AGA		0.353	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		11	100	0	0	0	0.007413	0	11	100				
SOX7	83595	broad.mit.edu	37	8	10583724	10583724	+	Missense_Mutation	SNP	G	G	A	rs555676321	byFrequency	TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:10583724G>A	ENST00000304501.1	-	2	769	c.691C>T	c.(691-693)Ccc>Tcc	p.P231S	SOX7_ENST00000554914.1_Missense_Mutation_p.P283S|SOX7_ENST00000553390.1_Missense_Mutation_p.P283S	NM_031439.2	NP_113627.1	Q9BT81	SOX7_HUMAN	SRY (sex determining region Y)-box 7	231					endoderm formation (GO:0001706)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|regulation of canonical Wnt signaling pathway (GO:0060828)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				COAD - Colon adenocarcinoma(149;0.0732)		ATGCGGCGGGGATGGCCATGC	0.687																																							uc003wtf.2		NA																	0				breast(1)	1						c.(691-693)CCC>TCC		SRY-box 7							24.0	31.0	28.0					8																	10583724		2196	4280	6476	SO:0001583	missense	83595				endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding	g.chr8:10583724G>A	AJ409320	CCDS5977.1	8p22	2013-01-25			ENSG00000171056	ENSG00000171056		"""SRY (sex determining region Y)-boxes"""	18196	protein-coding gene	gene with protein product		612202				11691915	Standard	NM_031439		Approved		uc003wtf.3	Q9BT81	OTTHUMG00000090585	ENST00000304501.1:c.691C>T	8.37:g.10583724G>A	ENSP00000301921:p.Pro231Ser		Somatic				SOX7_uc011kwz.1_Missense_Mutation_p.P283S	p.P231S	NM_031439	NP_113627	WXS	Illumina HiSeq	Unspecified	Q9BT81	SOX7_HUMAN		COAD - Colon adenocarcinoma(149;0.0732)	2	770	-			231					B4DKV0|Q53YD0	Missense_Mutation	SNP	ENST00000304501.1	37	c.691C>T	CCDS5977.1	.	.	.	.	.	.	.	.	.	.	G	1.403	-0.577651	0.03854	.	.	ENSG00000171056;ENSG00000171056;ENSG00000258724	ENST00000304501;ENST00000553390;ENST00000554914	T;T;T	0.75704	-0.96;-0.96;-0.96	4.87	3.84	0.44239	.	0.332238	0.27604	N	0.018639	T	0.50154	0.1599	N	0.12182	0.205	0.42141	D	0.991516	B;B	0.14438	0.01;0.0	B;B	0.14023	0.01;0.001	T	0.32079	-0.9920	10	0.21540	T	0.41	.	4.2688	0.10776	0.5986:0.0:0.4014:0.0	.	283;231	B4DKV0;Q9BT81	.;SOX7_HUMAN	S	231;283;283	ENSP00000301921:P231S;ENSP00000452017:P283S;ENSP00000451145:P283S	ENSP00000346908:P283S	P	-	1	0	SOX7;CTD-2135J3.4	10621134	0.990000	0.36364	0.992000	0.48379	0.246000	0.25737	0.727000	0.25999	0.865000	0.35603	0.448000	0.29417	CCC		0.687	SOX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207131.1			9	41	0	0	0	0.000978	0	9	41				
FGL1	2267	broad.mit.edu	37	8	17739550	17739550	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:17739550C>T	ENST00000398056.2	-	5	1017	c.202G>A	c.(202-204)Gag>Aag	p.E68K	FGL1_ENST00000518650.1_Missense_Mutation_p.E68K|RP11-156K13.2_ENST00000519368.1_RNA|FGL1_ENST00000398054.1_Missense_Mutation_p.E68K|FGL1_ENST00000381841.2_Missense_Mutation_p.E68K|FGL1_ENST00000381840.2_Missense_Mutation_p.E68K|FGL1_ENST00000427924.1_Missense_Mutation_p.E68K|FGL1_ENST00000522444.1_Missense_Mutation_p.E68K			Q08830	FGL1_HUMAN	fibrinogen-like 1	68					adipose tissue development (GO:0060612)|cholesterol metabolic process (GO:0008203)|regulation of glucose metabolic process (GO:0010906)|response to stilbenoid (GO:0035634)	extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)	13				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		ACAGTATTCTCATCTCCTTTA	0.448																																							uc003wxx.2		NA																	0					0						c.(202-204)GAG>AAG		fibrinogen-like 1 precursor							130.0	120.0	123.0					8																	17739550		2203	4300	6503	SO:0001583	missense	2267				signal transduction	fibrinogen complex	receptor binding	g.chr8:17739550C>T	D14446	CCDS6004.1	8p22	2013-02-06			ENSG00000104760	ENSG00000104760		"""Fibrinogen C domain containing"""	3695	protein-coding gene	gene with protein product		605776				8390249	Standard	NM_004467		Approved	HFREP-1	uc003wyb.3	Q08830	OTTHUMG00000096989	ENST00000398056.2:c.202G>A	8.37:g.17739550C>T	ENSP00000381133:p.Glu68Lys		Somatic				FGL1_uc003wxy.2_Missense_Mutation_p.E68K|FGL1_uc003wxz.2_Missense_Mutation_p.E68K|FGL1_uc003wya.2_Missense_Mutation_p.E68K|FGL1_uc003wyb.2_Missense_Mutation_p.E68K|FGL1_uc003wyc.2_Missense_Mutation_p.E68K|FGL1_uc003wyd.2_RNA|FGL1_uc003wye.2_Missense_Mutation_p.E118K|FGL1_uc003wyf.2_Missense_Mutation_p.E38K	p.E68K	NM_201553	NP_963847	WXS	Illumina HiSeq	Unspecified	Q08830	FGL1_HUMAN		Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)	4	526	-			68					A6NKU4|Q4PJH9|Q53YF1|Q8NG32|Q96KW6|Q96QM6	Missense_Mutation	SNP	ENST00000398056.2	37	c.202G>A	CCDS6004.1	.	.	.	.	.	.	.	.	.	.	C	9.046	0.990806	0.18966	.	.	ENSG00000104760	ENST00000221204;ENST00000398056;ENST00000521427;ENST00000522444;ENST00000381841;ENST00000427924;ENST00000398054;ENST00000381840;ENST00000518650	T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.8	4.92	0.64577	.	0.480158	0.24107	N	0.041483	T	0.34687	0.0906	N	0.20986	0.625	0.41555	D	0.988593	B;B;B	0.15141	0.012;0.006;0.012	B;B;B	0.15052	0.009;0.005;0.012	T	0.12811	-1.0533	10	0.14252	T	0.57	.	16.7616	0.85513	0.1301:0.8699:0.0:0.0	.	38;68;68	E7ERS0;Q8NG32;Q08830	.;.;FGL1_HUMAN	K	68;68;38;68;68;68;68;68;68	ENSP00000381133:E68K;ENSP00000429757:E68K;ENSP00000371263:E68K;ENSP00000401952:E68K;ENSP00000381131:E68K;ENSP00000371262:E68K;ENSP00000428430:E68K	ENSP00000221204:E68K	E	-	1	0	FGL1	17783830	0.991000	0.36638	0.826000	0.32828	0.002000	0.02628	3.583000	0.53928	1.608000	0.50180	-0.182000	0.12963	GAG		0.448	FGL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375254.1	NM_004467		9	56	0	0	0	0.008291	0	9	56				
TMEM67	91147	broad.mit.edu	37	8	94767363	94767363	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:94767363G>A	ENST00000453321.3	+	1	279	c.221G>A	c.(220-222)cGa>cAa	p.R74Q	TMEM67_ENST00000409623.3_5'UTR	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	74					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			CAAGATGCCCGAGGTAAGACG	0.552																																							uc011lgk.1		NA																	0				ovary(2)	2						c.(220-222)CGA>CAA		meckelin isoform 1							83.0	81.0	82.0					8																	94767363		2203	4300	6503	SO:0001583	missense	91147				cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding	g.chr8:94767363G>A	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.221G>A	8.37:g.94767363G>A	ENSP00000389998:p.Arg74Gln		Somatic				TMEM67_uc010mau.2_Missense_Mutation_p.R74Q|TMEM67_uc010mav.2_Missense_Mutation_p.R74Q|TMEM67_uc010mat.1_5'UTR|TMEM67_uc010maw.2_Missense_Mutation_p.R74Q|TMEM67_uc003yga.3_5'UTR	p.R74Q	NM_153704	NP_714915	WXS	Illumina HiSeq	Unspecified	Q5HYA8	MKS3_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00896)		1	292	+	Breast(36;4.14e-07)		74					B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	ENST00000453321.3	37	c.221G>A	CCDS6258.2	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570690	0.28003	.	.	ENSG00000164953	ENST00000453321;ENST00000453906	D;D	0.97232	-4.3;-3.76	5.35	2.53	0.30540	Growth factor, receptor (1);	0.907118	0.09652	N	0.773578	D	0.91905	0.7437	L	0.36672	1.1	0.34886	D	0.745105	P;P;D	0.57571	0.456;0.855;0.98	B;B;B	0.38106	0.057;0.129;0.265	D	0.87344	0.2333	10	0.13470	T	0.59	1.5014	5.6454	0.17586	0.1663:0.0:0.6718:0.1619	.	74;74;74	Q5HYA8;F8WCQ6;E5RH38	MKS3_HUMAN;.;.	Q	74	ENSP00000389998:R74Q;ENSP00000403035:R74Q	ENSP00000314488:R64Q	R	+	2	0	TMEM67	94836539	0.646000	0.27295	0.070000	0.20053	0.831000	0.47069	0.914000	0.28624	0.362000	0.24319	0.585000	0.79938	CGA		0.552	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704		5	121	0	0	0	0.001168	0	5	121				
ABRA	137735	broad.mit.edu	37	8	107773358	107773358	+	Silent	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:107773358G>C	ENST00000311955.3	-	2	1107	c.1053C>G	c.(1051-1053)ctC>ctG	p.L351L		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TGGCACGCATGAGAATGCCCA	0.468																																							uc003ymm.3		NA																	0				ovary(2)	2						c.(1051-1053)CTC>CTG		actin-binding Rho activating protein							184.0	166.0	172.0					8																	107773358		2203	4300	6503	SO:0001819	synonymous_variant	137735				positive regulation of Rho protein signal transduction|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent|transmembrane transport	actin cytoskeleton|plasma membrane|sarcomere	actin binding	g.chr8:107773358G>C	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.1053C>G	8.37:g.107773358G>C			Somatic					p.L351L	NM_139166	NP_631905	WXS	Illumina HiSeq	Unspecified	Q8N0Z2	ABRA_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)		2	1107	-			351						Silent	SNP	ENST00000311955.3	37	c.1053C>G	CCDS6305.1																																																																																				0.468	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166		4	184	0	0	0	0.000248	0	4	184				
RSPO2	340419	broad.mit.edu	37	8	109001387	109001387	+	Missense_Mutation	SNP	G	G	C	rs149399382		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:109001387G>C	ENST00000276659.5	-	3	800	c.180C>G	c.(178-180)ttC>ttG	p.F60L	RSPO2_ENST00000517939.1_5'UTR|RSPO2_ENST00000378439.2_Intron|RSPO2_ENST00000517781.1_Intron	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	60					bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			GAAGGAAGAAGAACAACTTCT	0.463																																							uc003yms.2		NA																	0				skin(3)|ovary(2)|pancreas(1)|lung(1)	7						c.(178-180)TTC>TTG		R-spondin family, member 2 precursor		G	LEU/PHE	1,4405	2.1+/-5.4	0,1,2202	118.0	97.0	104.0		180	4.2	1.0	8	dbSNP_134	104	0,8600		0,0,4300	no	missense	RSPO2	NM_178565.4	22	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	probably-damaging	60/244	109001387	1,13005	2203	4300	6503	SO:0001583	missense	340419				Wnt receptor signaling pathway	extracellular region	heparin binding	g.chr8:109001387G>C	AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.180C>G	8.37:g.109001387G>C	ENSP00000276659:p.Phe60Leu		Somatic				RSPO2_uc003ymq.2_5'UTR|RSPO2_uc003ymr.2_Intron	p.F60L	NM_178565	NP_848660	WXS	Illumina HiSeq	Unspecified	Q6UXX9	RSPO2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)		3	838	-			60					B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	ENST00000276659.5	37	c.180C>G	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413442	0.83449	2.27E-4	0.0	ENSG00000147655	ENST00000276659;ENST00000521956;ENST00000520026;ENST00000522333	D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62	5.04	4.16	0.48862	Growth factor, receptor (1);	0.093957	0.85682	D	0.000000	D	0.85720	0.5762	L	0.42487	1.325	0.80722	D	1	D	0.56035	0.974	D	0.70487	0.969	D	0.84347	0.0530	10	0.42905	T	0.14	-1.9741	9.9709	0.41754	0.1561:0.0:0.8439:0.0	.	60	Q6UXX9	RSPO2_HUMAN	L	60;60;32;60	ENSP00000276659:F60L;ENSP00000430010:F60L;ENSP00000429159:F32L;ENSP00000430973:F60L	ENSP00000276659:F60L	F	-	3	2	RSPO2	109070563	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.705000	0.54823	1.251000	0.43983	0.557000	0.71058	TTC		0.463	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565		6	54	0	0	0	0.001168	0	6	54				
TRHR	7201	broad.mit.edu	37	8	110131366	110131366	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:110131366C>T	ENST00000518632.1	+	3	1230	c.879C>T	c.(877-879)tcC>tcT	p.S293S	TRHR_ENST00000311762.2_Silent_p.S293S			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	293					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CATTTCTCTCCAGTCCTTTCC	0.423																																							uc003ymz.3		NA																	0				skin(2)|lung(1)	3						c.(877-879)TCC>TCT		thyrotropin-releasing hormone receptor							244.0	240.0	241.0					8																	110131366		2203	4300	6503	SO:0001819	synonymous_variant	7201					integral to plasma membrane	thyrotropin-releasing hormone receptor activity	g.chr8:110131366C>T		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.879C>T	8.37:g.110131366C>T			Somatic					p.S293S	NM_003301	NP_003292	WXS	Illumina HiSeq	Unspecified	P34981	TRFR_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)		2	895	+			293			Extracellular (Potential).		Q2M339	Silent	SNP	ENST00000518632.1	37	c.879C>T	CCDS6311.1																																																																																				0.423	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1			24	247	0	0	0	0.003954	0	24	247				
ADCY8	114	broad.mit.edu	37	8	132052045	132052045	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr8:132052045G>A	ENST00000286355.5	-	1	2627	c.535C>T	c.(535-537)Cgc>Tgc	p.R179C	ADCY8_ENST00000377928.3_Missense_Mutation_p.R179C	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	179					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TCCGATTTGCGCCTTTGGCCC	0.567										HNSCC(32;0.087)																													uc003ytd.3		NA																	0				skin(4)|large_intestine(1)|central_nervous_system(1)	6						c.(535-537)CGC>TGC		adenylate cyclase 8							81.0	82.0	82.0					8																	132052045		2203	4300	6503	SO:0001583	missense	114				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding	g.chr8:132052045G>A	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.535C>T	8.37:g.132052045G>A	ENSP00000286355:p.Arg179Cys	HNSCC(32;0.087)	Somatic				ADCY8_uc010mds.2_Missense_Mutation_p.R179C	p.R179C	NM_001115	NP_001106	WXS	Illumina HiSeq	Unspecified	P40145	ADCY8_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000538)		1	791	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		179			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000286355.5	37	c.535C>T	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554126	0.86231	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.66815	-0.23;-0.23	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.77011	0.4068	L	0.48642	1.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	T	0.76570	-0.2911	10	0.44086	T	0.13	.	17.6088	0.88046	0.0:0.0:1.0:0.0	.	179;179	E7EVL1;P40145	.;ADCY8_HUMAN	C	179	ENSP00000286355:R179C;ENSP00000367161:R179C	ENSP00000286355:R179C	R	-	1	0	ADCY8	132121227	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.167000	0.94773	2.412000	0.81896	0.455000	0.32223	CGC		0.567	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			14	62	0	0	0	0.004007	0	14	62				
TLN1	7094	broad.mit.edu	37	9	35706061	35706061	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr9:35706061C>T	ENST00000314888.9	-	41	5762	c.5409G>A	c.(5407-5409)atG>atA	p.M1803I	TLN1_ENST00000464379.1_Intron|TLN1_ENST00000540444.1_Intron	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1803	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CGGCCTCGGTCATCATCTGCA	0.607																																							uc003zxt.2		NA																	0				lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13						c.(5407-5409)ATG>ATA		talin 1							112.0	113.0	113.0					9																	35706061		2203	4300	6503	SO:0001583	missense	7094				axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding	g.chr9:35706061C>T	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.5409G>A	9.37:g.35706061C>T	ENSP00000316029:p.Met1803Ile		Somatic					p.M1803I	NM_006289	NP_006280	WXS	Illumina HiSeq	Unspecified	Q9Y490	TLN1_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		41	5763	-	all_epithelial(49;0.167)		1803			Interaction with SYNM.		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	c.5409G>A	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062519	0.55432	.	.	ENSG00000137076	ENST00000314888	T	0.11821	2.74	5.66	3.72	0.42706	.	0.080570	0.85682	D	0.000000	T	0.15609	0.0376	M	0.67397	2.05	0.80722	D	1	B	0.15473	0.013	B	0.12837	0.008	T	0.02766	-1.1113	10	0.27785	T	0.31	-23.4392	11.835	0.52319	0.0:0.8047:0.1248:0.0705	.	1803	Q9Y490	TLN1_HUMAN	I	1803	ENSP00000316029:M1803I	ENSP00000316029:M1803I	M	-	3	0	TLN1	35696061	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.864000	0.62990	2.662000	0.90505	0.555000	0.69702	ATG		0.607	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289		16	103	0	0	0	0.004007	0	16	103				
GCNT1	2650	broad.mit.edu	37	9	79118113	79118113	+	Silent	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr9:79118113C>G	ENST00000376730.4	+	4	1299	c.816C>G	c.(814-816)gtC>gtG	p.V272V	GCNT1_ENST00000442371.1_Silent_p.V272V|GCNT1_ENST00000444201.2_Silent_p.V272V|GCNT1_ENST00000536223.1_Silent_p.V272V	NM_001097636.1|NM_001490.4	NP_001091105.1|NP_001481.2	Q02742	GCNT1_HUMAN	glucosaminyl (N-acetyl) transferase 1, core 2	272	Catalytic. {ECO:0000250}.				cell adhesion molecule production (GO:0060352)|cellular protein metabolic process (GO:0044267)|glycoprotein biosynthetic process (GO:0009101)|kidney morphogenesis (GO:0060993)|leukocyte tethering or rolling (GO:0050901)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to insulin (GO:0032868)|tissue morphogenesis (GO:0048729)	extracellular space (GO:0005615)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(11)|prostate(2)|urinary_tract(1)	30						CAGGGACTGTCAAAATGCTTC	0.458																																							uc010mpf.2		NA																	0					0						c.(814-816)GTC>GTG		beta-1,3-galactosyl-O-glycosyl-glycoprotein							121.0	95.0	104.0					9																	79118113		2203	4300	6503	SO:0001819	synonymous_variant	2650				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity	g.chr9:79118113C>G	L41415	CCDS6653.1	9q13	2013-02-25	2010-03-16		ENSG00000187210	ENSG00000187210	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4203	protein-coding gene	gene with protein product	"""core 2 beta1,6 N-acetylglucosaminyltransferase-I"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N--acetylglucosaminyltransferase"""	600391	"""glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""	NACGT2		8449405, 9915862	Standard	NM_001490		Approved	C2GNT, NAGCT2	uc004akf.4	Q02742	OTTHUMG00000020044	ENST00000376730.4:c.816C>G	9.37:g.79118113C>G			Somatic				GCNT1_uc010mpg.2_Silent_p.V272V|GCNT1_uc010mph.2_Silent_p.V272V|GCNT1_uc004akf.3_Silent_p.V272V|GCNT1_uc010mpi.2_Silent_p.V272V|GCNT1_uc004akh.3_Silent_p.V272V	p.V272V	NM_001490	NP_001481	WXS	Illumina HiSeq	Unspecified	Q02742	GCNT1_HUMAN			3	1157	+			272			Lumenal (Potential).|Catalytic (By similarity).		Q6DJZ4	Silent	SNP	ENST00000376730.4	37	c.816C>G	CCDS6653.1																																																																																				0.458	GCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052725.1	NM_001097634		9	91	0	0	0	0.008291	0	9	91				
SPATA31D1	389763	broad.mit.edu	37	9	84608772	84608772	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr9:84608772G>C	ENST00000344803.2	+	4	3434	c.3387G>C	c.(3385-3387)aaG>aaC	p.K1129N		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1129					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CATGGGATAAGAGAAAGAGTT	0.468																																							uc004amn.2		NA																	0					0						c.(3385-3387)AAG>AAC		hypothetical protein LOC389763							70.0	69.0	70.0					9																	84608772		1967	4157	6124	SO:0001583	missense	389763					integral to membrane		g.chr9:84608772G>C		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3387G>C	9.37:g.84608772G>C	ENSP00000341988:p.Lys1129Asn		Somatic					p.K1129N	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	3434	+			1129						Missense_Mutation	SNP	ENST00000344803.2	37	c.3387G>C	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279018	0.23307	.	.	ENSG00000214929	ENST00000344803	T	0.05996	3.36	2.17	1.26	0.21427	.	.	.	.	.	T	0.08088	0.0202	N	0.19112	0.55	0.09310	N	1	D	0.65815	0.995	P	0.61003	0.882	T	0.37079	-0.9721	9	0.25751	T	0.34	-6.8389	4.7853	0.13222	0.1845:0.0:0.8155:0.0	.	1129	Q6ZQQ2	F75D1_HUMAN	N	1129	ENSP00000341988:K1129N	ENSP00000341988:K1129N	K	+	3	2	FAM75D1	83798592	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	0.147000	0.16202	0.489000	0.27749	0.603000	0.83216	AAG		0.468	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		7	62	0	0	0	0.00308	0	7	62				
HNRNPK	3190	broad.mit.edu	37	9	86587088	86587088	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr9:86587088C>T	ENST00000376264.2	-	11	920	c.662G>A	c.(661-663)cGt>cAt	p.R221H	HNRNPK_ENST00000376263.3_Missense_Mutation_p.R221H|HNRNPK_ENST00000360384.5_Missense_Mutation_p.R221H|RP11-575L7.8_ENST00000448389.1_RNA|MIR7-1_ENST00000384871.1_RNA|HNRNPK_ENST00000351839.3_Missense_Mutation_p.R221H|HNRNPK_ENST00000376281.4_Missense_Mutation_p.R221H	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	221	2 X 22 AA approximate repeats.|5 X 4 AA repeats of G-X-G-G.|Interaction with ZIK1. {ECO:0000250}.|Necessary for interaction with DDX1.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						AGGCTGTGCACGTCCTTTGAT	0.418																																							uc004ang.3		NA																	0				skin(1)	1						c.(661-663)CGT>CAT		heterogeneous nuclear ribonucleoprotein K							54.0	53.0	53.0					9																	86587088		2203	4300	6503	SO:0001583	missense	3190				interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding	g.chr9:86587088C>T		CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.662G>A	9.37:g.86587088C>T	ENSP00000365440:p.Arg221His		Somatic				HNRNPK_uc011lsw.1_Translation_Start_Site|HNRNPK_uc004and.3_Translation_Start_Site|HNRNPK_uc004ank.3_Missense_Mutation_p.R221H|HNRNPK_uc004anf.3_Missense_Mutation_p.R221H|HNRNPK_uc004anh.3_Missense_Mutation_p.R197H|HNRNPK_uc011lsx.1_Missense_Mutation_p.R197H|HNRNPK_uc004ani.3_Missense_Mutation_p.R221H|HNRNPK_uc004anj.3_Missense_Mutation_p.R221H|HNRNPK_uc004ann.3_Missense_Mutation_p.R197H|HNRNPK_uc004anl.3_Missense_Mutation_p.R221H|HNRNPK_uc004anm.3_Missense_Mutation_p.R221H|uc004ano.1_5'Flank|MIR7-1_hsa-mir-7-1|MI0000263_5'Flank	p.R221H	NM_031262	NP_112552	WXS	Illumina HiSeq	Unspecified	P61978	HNRPK_HUMAN			11	886	-			221			5 X 4 AA repeats of G-X-G-G.|Necessary for interaction with DDX1.|2 X 22 AA approximate repeats.|Interaction with ZIK1 (By similarity).		Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Missense_Mutation	SNP	ENST00000376264.2	37	c.662G>A	CCDS6667.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172861	0.38413	.	.	ENSG00000165119	ENST00000376281;ENST00000376264;ENST00000376263;ENST00000376268;ENST00000351839;ENST00000435158;ENST00000360384;ENST00000376258;ENST00000457156;ENST00000376256	T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;-0.03	5.04	5.04	0.67666	.	0.166261	0.56097	D	0.000033	T	0.51652	0.1687	L	0.27053	0.805	0.58432	D	0.999997	B;B;B;B;B;B;B;B	0.15473	0.001;0.004;0.002;0.002;0.013;0.003;0.002;0.008	B;B;B;B;B;B;B;B	0.13407	0.001;0.002;0.001;0.001;0.009;0.001;0.001;0.004	T	0.47983	-0.9074	10	0.46703	T	0.11	-3.3738	16.9459	0.86230	0.0:1.0:0.0:0.0	.	197;186;221;216;221;197;221;221	B4DUQ1;Q5T6W5;Q5EC54;B4DFF1;P61978-2;P61978-3;P61978;Q6IBN1	.;.;.;.;.;.;HNRPK_HUMAN;.	H	221;221;221;221;221;186;221;216;197;152	ENSP00000365458:R221H;ENSP00000365440:R221H;ENSP00000365439:R221H;ENSP00000317788:R221H;ENSP00000353552:R221H;ENSP00000409456:R197H	ENSP00000317788:R221H	R	-	2	0	HNRNPK	85776908	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.332000	0.79203	2.486000	0.83907	0.655000	0.94253	CGT		0.418	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052846.2			6	41	0	0	0	0.001984	0	6	41				
ASPN	54829	broad.mit.edu	37	9	95222019	95222019	+	Silent	SNP	G	G	A	rs373562694		TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr9:95222019G>A	ENST00000375544.3	-	7	1083	c.840C>T	c.(838-840)atC>atT	p.I280I	CENPP_ENST00000375587.3_Intron|ASPN_ENST00000375543.1_Intron	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	280					bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						TCCCATTTTCGATATCTGTGA	0.358																																							uc004ase.1		NA																	0					0						c.(838-840)ATC>ATT		asporin precursor		G	,,	1,4403	2.1+/-5.4	0,1,2201	108.0	99.0	102.0		,,840	-8.1	0.8	9		102	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,coding-synonymous	ASPN,CENPP	NM_001012267.1,NM_001193335.1,NM_017680.4	,,	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	,,	,,280/381	95222019	2,13002	2202	4300	6502	SO:0001819	synonymous_variant	54829				bone mineralization|negative regulation of tooth mineralization|negative regulation of transforming growth factor beta receptor signaling pathway	proteinaceous extracellular matrix	calcium ion binding	g.chr9:95222019G>A	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.840C>T	9.37:g.95222019G>A			Somatic				CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ASPN_uc010mqy.1_Intron	p.I280I	NM_017680	NP_060150	WXS	Illumina HiSeq	Unspecified	Q9BXN1	ASPN_HUMAN			7	1084	-			280			LRR 7.		Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Silent	SNP	ENST00000375544.3	37	c.840C>T																																																																																					0.358	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680		4	20	0	0	0	0.000248	0	4	20				
TDRD7	23424	broad.mit.edu	37	9	100245169	100245169	+	Silent	SNP	T	T	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr9:100245169T>C	ENST00000355295.4	+	15	2746	c.2451T>C	c.(2449-2451)gtT>gtC	p.V817V	TDRD7_ENST00000492428.1_3'UTR|TDRD7_ENST00000540902.1_Silent_p.V137V|TDRD7_ENST00000422139.2_Silent_p.V743V	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	817					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				TCGCACATGTTTATTTATTTA	0.368																																							uc004axj.2		NA																	0				ovary(2)|pancreas(1)	3						c.(2449-2451)GTT>GTC		tudor domain containing 7							84.0	85.0	85.0					9																	100245169		2203	4300	6503	SO:0001819	synonymous_variant	23424				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding	g.chr9:100245169T>C	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.2451T>C	9.37:g.100245169T>C			Somatic				TDRD7_uc011lux.1_Silent_p.V743V|TDRD7_uc010msp.1_Silent_p.V69V|TDRD7_uc011luy.1_Silent_p.V137V	p.V817V	NM_014290	NP_055105	WXS	Illumina HiSeq	Unspecified	Q8NHU6	TDRD7_HUMAN			15	2676	+		Acute lymphoblastic leukemia(62;0.158)	817					A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Silent	SNP	ENST00000355295.4	37	c.2451T>C	CCDS6725.1																																																																																				0.368	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290		15	69	0	0	0	0.003163	0	15	69				
RC3H2	54542	broad.mit.edu	37	9	125642152	125642152	+	Splice_Site	SNP	T	T	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr9:125642152T>G	ENST00000373670.1	-	7	1694	c.1094A>C	c.(1093-1095)gAc>gCc	p.D365A	RC3H2_ENST00000373665.2_Splice_Site_p.D365A|SNORD90_ENST00000391145.1_RNA|RC3H2_ENST00000423239.2_Splice_Site_p.D365A|RC3H2_ENST00000357244.2_Splice_Site_p.D365A|RC3H2_ENST00000335387.5_Splice_Site_p.D365A			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	365					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						TGAAACAGCGTCTAAAATAAG	0.398																																							uc010mwc.1		NA																	0				ovary(2)|lung(2)	4						c.(1093-1095)GAC>GCC		ring finger and CCCH-type zinc finger domains 2							62.0	62.0	62.0					9																	125642152		1864	4104	5968	SO:0001630	splice_region_variant	54542					cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding	g.chr9:125642152T>G	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.1094-1A>C	9.37:g.125642152T>G			Somatic				RC3H2_uc004bnc.2_RNA|RC3H2_uc004bnd.1_Missense_Mutation_p.D365A|RC3H2_uc004bne.3_Missense_Mutation_p.D365A|RC3H2_uc011lzf.1_Missense_Mutation_p.D102A|RC3H2_uc011lzg.1_Missense_Mutation_p.D365A	p.D365A	NM_001100588	NP_001094058	WXS	Illumina HiSeq	Unspecified	Q9HBD1	RC3H2_HUMAN			8	1335	-			365					Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	ENST00000373670.1	37	c.1094A>C	CCDS43874.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.522032	0.85600	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239;ENST00000373665;ENST00000335387	D;D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39;-3.39	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.95671	0.8592	L	0.57536	1.79	0.80722	D	1	P;P;D;D	0.67145	0.638;0.877;0.993;0.996	B;P;D;D	0.75484	0.23;0.709;0.968;0.986	D	0.96034	0.9019	10	0.72032	D	0.01	.	15.0165	0.71588	0.0:0.0:0.0:1.0	.	365;236;365;365	A6NHN2;Q4VXB0;Q9HBD1;Q9HBD1-4	.;.;RC3H2_HUMAN;.	A	365;365;236;365;365;365	ENSP00000362774:D365A;ENSP00000349783:D365A;ENSP00000411767:D365A;ENSP00000362769:D365A;ENSP00000335150:D365A	ENSP00000335150:D365A	D	-	2	0	RC3H2	124681973	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	6.252000	0.72447	2.206000	0.71126	0.455000	0.32223	GAC		0.398	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835	Missense_Mutation	4	41	0	0	0	0.000248	0	4	41				
TUBBP5	643224	broad.mit.edu	37	9	141070915	141070915	+	RNA	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr9:141070915C>G	ENST00000503395.1	+	0	1690									tubulin, beta pseudogene 5									p.T178T(1)									TGTCAGACACCGTGGTGGAGC	0.522																																							uc004com.2		NA																	1	Substitution - coding silent(1)		prostate(1)		0						c.(316-318)ACC>ACG		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141070915C>G	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070915C>G			Somatic				TUBBP5_uc010ncq.2_3'UTR	p.T106T			WXS	Illumina HiSeq	Unspecified					4	579	+									Silent	SNP	ENST00000503395.1	37	c.318C>G																																																																																					0.522	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		5	84	0	0	0	0.001168	0	5	84				
TUBBP5	643224	broad.mit.edu	37	9	141071097	141071097	+	RNA	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr9:141071097G>A	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5																		GTCACCACGTGCCTGCGCTTC	0.577																																							uc004com.2		NA																	0					0						c.(499-501)TGC>TAC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141071097G>A	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071097G>A			Somatic				TUBBP5_uc010ncq.2_3'UTR	p.C167Y			WXS	Illumina HiSeq	Unspecified					4	761	+									Missense_Mutation	SNP	ENST00000503395.1	37	c.500G>A																																																																																					0.577	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		6	45	0	0	0	0.001984	0	6	45				
TLR7	51284	broad.mit.edu	37	X	12904782	12904782	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chrX:12904782G>C	ENST00000380659.3	+	3	1294	c.1155G>C	c.(1153-1155)ttG>ttC	p.L385F		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	385					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	TTAAAGAGTTGAAAAGCTTTA	0.348																																							uc004cvc.2		NA																	0				ovary(2)|lung(2)|breast(1)	5						c.(1153-1155)TTG>TTC		toll-like receptor 7 precursor	Imiquimod(DB00724)						68.0	75.0	73.0					X																	12904782		2203	4299	6502	SO:0001583	missense	51284				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity	g.chrX:12904782G>C	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.1155G>C	X.37:g.12904782G>C	ENSP00000370034:p.Leu385Phe		Somatic					p.L385F	NM_016562	NP_057646	WXS	Illumina HiSeq	Unspecified	Q9NYK1	TLR7_HUMAN			3	1294	+			385			Extracellular (Potential).|LRR 13.		D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	c.1155G>C	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	G	7.193	0.591986	0.13812	.	.	ENSG00000196664	ENST00000380659	T	0.58506	0.33	5.79	4.01	0.46588	.	0.000000	0.64402	D	0.000008	T	0.73961	0.3654	M	0.83312	2.635	0.23238	N	0.998062	D	0.89917	1.0	D	0.80764	0.994	T	0.65776	-0.6086	10	0.87932	D	0	.	7.9027	0.29744	0.1477:0.131:0.7213:0.0	.	385	Q9NYK1	TLR7_HUMAN	F	385	ENSP00000370034:L385F	ENSP00000370034:L385F	L	+	3	2	TLR7	12814703	0.966000	0.33281	0.010000	0.14722	0.000000	0.00434	0.740000	0.26188	0.584000	0.29591	-0.218000	0.12543	TTG		0.348	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562		9	128	0	0	0	0.008291	0	9	128				
TRO	7216	broad.mit.edu	37	X	54955044	54955044	+	Silent	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chrX:54955044G>A	ENST00000173898.7	+	12	1999	c.1887G>A	c.(1885-1887)aaG>aaA	p.K629K	TRO_ENST00000420798.2_Silent_p.K160K|TRO_ENST00000375022.4_Silent_p.K629K|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000375041.2_Silent_p.K232K|TRO_ENST00000399736.1_Silent_p.K232K|TRO_ENST00000319167.8_Silent_p.K629K	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	629	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						AGGTGCAGAAGAAAGACCCCA	0.478																																							uc004dtq.2		NA																	0				ovary(1)	1						c.(1885-1887)AAG>AAA		trophinin isoform 5							51.0	53.0	53.0					X																	54955044		2028	4188	6216	SO:0001819	synonymous_variant	7216				embryo implantation|homophilic cell adhesion	integral to plasma membrane		g.chrX:54955044G>A	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1887G>A	X.37:g.54955044G>A			Somatic				TRO_uc004dts.2_Silent_p.K629K|TRO_uc004dtr.2_Silent_p.K629K|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_RNA|TRO_uc004dtv.2_Silent_p.K232K|TRO_uc011mok.1_Silent_p.K160K|TRO_uc004dtw.2_Silent_p.K232K|TRO_uc004dtx.2_Silent_p.K12K	p.K629K	NM_001039705	NP_001034794	WXS	Illumina HiSeq	Unspecified	Q12816	TROP_HUMAN			12	1994	+			629			MAGE.		B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	37	c.1887G>A	CCDS43959.1																																																																																				0.478	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157		9	102	0	0	0	0.004482	0	9	102				
EFNB1	1947	broad.mit.edu	37	X	68060218	68060218	+	Silent	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chrX:68060218C>T	ENST00000204961.4	+	5	1542	c.762C>T	c.(760-762)atC>atT	p.I254I		NM_004429.4	NP_004420.1	P98172	EFNB1_HUMAN	ephrin-B1	254					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|embryonic pattern specification (GO:0009880)|ephrin receptor signaling pathway (GO:0048013)|neural crest cell migration (GO:0001755)|positive regulation of T cell proliferation (GO:0042102)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ephrin receptor binding (GO:0046875)			breast(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	22						TCCTGCTCATCATCATCTTCC	0.617																																							uc004dxd.3		NA																	0					0						c.(760-762)ATC>ATT		ephrin-B1 precursor							65.0	60.0	61.0					X																	68060218		2203	4300	6503	SO:0001819	synonymous_variant	1947				cell adhesion|cell-cell signaling	integral to plasma membrane|soluble fraction|synapse	ephrin receptor binding	g.chrX:68060218C>T	U09303	CCDS14391.1	Xq12	2011-03-09			ENSG00000090776	ENSG00000090776		"""Ephrins"""	3226	protein-coding gene	gene with protein product		300035	"""craniofrontonasal syndrome (craniofrontonasal dysplasia)"""	EPLG2, CFNS		7774950, 16526919	Standard	NM_004429		Approved	LERK2, Elk-L	uc004dxd.4	P98172	OTTHUMG00000021751	ENST00000204961.4:c.762C>T	X.37:g.68060218C>T			Somatic				EFNB1_uc004dxe.2_Silent_p.I254I	p.I254I	NM_004429	NP_004420	WXS	Illumina HiSeq	Unspecified	P98172	EFNB1_HUMAN			5	1542	+			254			Helical; (Potential).		D3DVU0	Silent	SNP	ENST00000204961.4	37	c.762C>T	CCDS14391.1																																																																																				0.617	EFNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057029.1	NM_004429		7	33	0	0	0	0.001984	0	7	33				
ARMCX6	54470	broad.mit.edu	37	X	100871496	100871496	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chrX:100871496C>G	ENST00000361910.4	-	3	459	c.115G>C	c.(115-117)Gag>Cag	p.E39Q	ARMCX6_ENST00000539247.1_Missense_Mutation_p.E39Q|ARMCX6_ENST00000538627.1_Missense_Mutation_p.E39Q|ARMCX6_ENST00000497931.1_Intron	NM_019007.3	NP_061880.2	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	39						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|liver(2)|lung(3)	9						tccccctcctcctccagcttc	0.542																																							uc004ehx.2		NA																	0					0						c.(115-117)GAG>CAG		armadillo repeat containing, X-linked 6							80.0	74.0	76.0					X																	100871496		2203	4300	6503	SO:0001583	missense	54470					integral to membrane		g.chrX:100871496C>G	BC007677	CCDS14488.1	Xq21.33-q22.3	2014-03-21			ENSG00000198960	ENSG00000198960		"""Armadillo repeat containing"""	26094	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_001184768		Approved	FLJ20811, GASP10	uc004ehy.3	Q7L4S7	OTTHUMG00000022034	ENST00000361910.4:c.115G>C	X.37:g.100871496C>G	ENSP00000354708:p.Glu39Gln		Somatic				ARMCX6_uc004ehy.2_Missense_Mutation_p.E39Q	p.E39Q	NM_019007	NP_061880	WXS	Illumina HiSeq	Unspecified	Q7L4S7	ARMX6_HUMAN			3	460	-			39					Q9NWJ3	Missense_Mutation	SNP	ENST00000361910.4	37	c.115G>C	CCDS14488.1	.	.	.	.	.	.	.	.	.	.	.	12.74	2.029696	0.35797	.	.	ENSG00000198960	ENST00000361910;ENST00000539247;ENST00000538627	T;T;T	0.48522	0.81;0.81;0.81	3.48	2.6	0.31112	.	0.354855	0.20622	N	0.088753	T	0.31451	0.0797	N	0.22421	0.69	0.22819	N	0.998697	P	0.52316	0.952	B	0.43445	0.42	T	0.11299	-1.0593	10	0.51188	T	0.08	-0.5412	6.4106	0.21688	0.0:0.8601:0.0:0.1399	.	39	Q7L4S7	ARMX6_HUMAN	Q	39	ENSP00000354708:E39Q;ENSP00000444537:E39Q;ENSP00000440648:E39Q	ENSP00000354708:E39Q	E	-	1	0	ARMCX6	100758152	0.979000	0.34478	0.999000	0.59377	0.877000	0.50540	0.290000	0.18975	0.846000	0.35142	0.472000	0.43445	GAG		0.542	ARMCX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057562.1	NM_019007		6	37	0	0	0	0.001984	0	6	37				
GPR112	139378	broad.mit.edu	37	X	135405147	135405147	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chrX:135405147G>A	ENST00000394143.1	+	5	572	c.281G>A	c.(280-282)gGa>gAa	p.G94E	GPR112_ENST00000287534.4_Missense_Mutation_p.G31E|GPR112_ENST00000394141.1_Intron|GPR112_ENST00000370652.1_Missense_Mutation_p.G94E|GPR112_ENST00000412101.1_Intron	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	94					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GGACTTGCAGGAGACCATCAG	0.433																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(280-282)GGA>GAA		G-protein coupled receptor 112							171.0	154.0	159.0					X																	135405147		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135405147G>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.281G>A	X.37:g.135405147G>A	ENSP00000377699:p.Gly94Glu		Somatic				GPR112_uc010nsb.1_Intron	p.G94E	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			5	572	+	Acute lymphoblastic leukemia(192;0.000127)		94			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.281G>A	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.366985	0.61513	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000287534	T;T;T	0.63096	3.51;3.51;-0.02	5.62	3.75	0.43078	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.59252	0.2180	L	0.55481	1.735	0.22684	N	0.998853	P	0.42078	0.77	B	0.44108	0.441	T	0.54132	-0.8339	9	0.72032	D	0.01	.	6.8948	0.24251	0.092:0.0:0.7358:0.1722	.	94	Q8IZF6	GP112_HUMAN	E	94;94;31	ENSP00000377699:G94E;ENSP00000359686:G94E;ENSP00000287534:G31E	ENSP00000287534:G31E	G	+	2	0	GPR112	135232813	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	2.357000	0.44125	1.131000	0.42111	0.513000	0.50165	GGA		0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			20	132	0	0	0	0.001523	0	20	132				
VMA21	203547	broad.mit.edu	37	X	150572114	150572114	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chrX:150572114C>T	ENST00000330374.6	+	2	170	c.65C>T	c.(64-66)tCa>tTa	p.S22L	VMA21_ENST00000370361.1_Missense_Mutation_p.S77L|VMA21_ENST00000477649.1_3'UTR	NM_001017980.3	NP_001017980.1			VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	7						AATGAAAGCTCATTAGCATCT	0.353																																							uc004feu.2		NA																	0					0						c.(64-66)TCA>TTA		VMA21 vacuolar H+-ATPase homolog							194.0	187.0	189.0					X																	150572114		2203	4300	6503	SO:0001583	missense	203547				vacuolar proton-transporting V-type ATPase complex assembly	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane|lysosome		g.chrX:150572114C>T	AK096835	CCDS35430.1	Xq28	2014-09-17			ENSG00000160131	ENSG00000160131			22082	protein-coding gene	gene with protein product		300913	"""myopathy with excessive autophagy"""	MEAX		2892402, 10757644, 19379691	Standard	NM_001017980		Approved	XMEA	uc004feu.3	Q3ZAQ7	OTTHUMG00000024168	ENST00000330374.6:c.65C>T	X.37:g.150572114C>T	ENSP00000333255:p.Ser22Leu		Somatic					p.S22L	NM_001017980	NP_001017980	WXS	Illumina HiSeq	Unspecified	Q3ZAQ7	VMA21_HUMAN			2	141	+			22						Missense_Mutation	SNP	ENST00000330374.6	37	c.65C>T	CCDS35430.1	.	.	.	.	.	.	.	.	.	.	c	32	5.129795	0.94473	.	.	ENSG00000160131	ENST00000370361;ENST00000330374	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.66790	0.2825	L	0.32530	0.975	0.80722	D	1	D	0.57899	0.981	D	0.67231	0.95	T	0.68880	-0.5292	9	0.66056	D	0.02	-8.9588	16.3955	0.83604	0.0:1.0:0.0:0.0	.	22	Q3ZAQ7	VMA21_HUMAN	L	77;22	.	ENSP00000333255:S22L	S	+	2	0	VMA21	150322772	1.000000	0.71417	0.764000	0.31436	0.989000	0.77384	7.768000	0.85345	2.478000	0.83669	0.594000	0.82650	TCA		0.353	VMA21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060876.1	NM_001017980		23	179	0	0	0	0.00278	0	23	179				
PAQR6	79957	broad.mit.edu	37	1	156214968	156214969	+	Frame_Shift_Ins	INS	-	-	ATAGGCT			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr1:156214968_156214969insATAGGCT	ENST00000292291.5	-	6	731_732	c.573_574insAGCCTAT	c.(571-576)tatccafs	p.P192fs	PAQR6_ENST00000540423.1_Frame_Shift_Ins_p.P189fs|PAQR6_ENST00000368270.1_Frame_Shift_Ins_p.P168fs|PAQR6_ENST00000356983.2_Frame_Shift_Ins_p.P86fs|PAQR6_ENST00000335852.1_Frame_Shift_Ins_p.P86fs|PAQR6_ENST00000492619.1_5'UTR	NM_001272104.1|NM_001272105.1|NM_198406.2	NP_001259033.1|NP_001259034.1|NP_940798.1	Q6TCH4	PAQR6_HUMAN	progestin and adipoQ receptor family member VI	192						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			lung(4)|ovary(1)	5	Hepatocellular(266;0.158)					AACAGGAATGGATAGGCGAAGG	0.604																																					GBM(16;219 398 12385 32425 38531)	GBM(16;219 398 12385 32425 38531)	uc001fnu.1		NA																	0					0						c.(571-576)TATCCAfs		progestin and adipoQ receptor family member VI																																				SO:0001589	frameshift_variant	79957					integral to membrane	receptor activity	g.chr1:156214968_156214969insATAGGCT	AF455045	CCDS1135.1, CCDS1136.1, CCDS60301.1, CCDS72945.1, CCDS72946.1	1q23	2008-02-05			ENSG00000160781	ENSG00000160781			30132	protein-coding gene	gene with protein product		614579				12477932	Standard	NM_024897		Approved	FLJ22672	uc010phh.2	Q6TCH4	OTTHUMG00000017490	ENST00000292291.5:c.573_574insAGCCTAT	1.37:g.156214968_156214969insATAGGCT	ENSP00000292291:p.Pro192fs		Somatic				PAQR6_uc010phf.1_Frame_Shift_Ins_p.I58fs|PAQR6_uc001fny.1_5'UTR|PAQR6_uc001fnv.1_Frame_Shift_Ins_p.Y167fs|PAQR6_uc010phg.1_Frame_Shift_Ins_p.Y188fs|PAQR6_uc001fnx.1_Frame_Shift_Ins_p.Y85fs|PAQR6_uc001fnw.1_Frame_Shift_Ins_p.Y85fs|PAQR6_uc001fnz.1_Frame_Shift_Ins_p.Y85fs|PAQR6_uc010phh.1_Frame_Shift_Ins_p.Y191fs|PAQR6_uc001foa.1_Frame_Shift_Ins_p.Y85fs|PAQR6_uc001fob.1_RNA	p.Y191fs	NM_198406	NP_940798	WXS	Illumina HiSeq	Unspecified	Q6TCH4	PAQR6_HUMAN			6	643_644	-	Hepatocellular(266;0.158)		191_192			Cytoplasmic (Potential).		B7Z9R9|D3DVB4|D3DVB6|Q5TCK9|Q6PDU0|Q7Z4Q7|Q7Z4Q9|Q8N121|Q8N3M2|Q9H621	Frame_Shift_Ins	INS	ENST00000292291.5	37	c.573_574insAGCCTAT	CCDS1136.1																																																																																				0.604	PAQR6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046297.2	NM_024897		9	103	NA	NA	NA	NA	NA	9	103	---	---	---	---
KNDC1	85442	broad.mit.edu	37	10	135009286	135009286	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr10:135009286delC	ENST00000304613.3	+	10	1716	c.1695delC	c.(1693-1695)cgcfs	p.R565fs	KNDC1_ENST00000368572.2_Frame_Shift_Del_p.R565fs|KNDC1_ENST00000368571.2_Frame_Shift_Del_p.R500fs			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	565	KIND 2. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TGGCCAGGCGCAGTGCCCCGG	0.692																																							uc001llz.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1693-1695)CGCfs		kinase non-catalytic C-lobe domain (KIND)							34.0	30.0	31.0					10																	135009286		2195	4295	6490	SO:0001589	frameshift_variant	85442				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction			g.chr10:135009286delC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1695delC	10.37:g.135009286delC	ENSP00000304437:p.Arg565fs		Somatic				KNDC1_uc001lma.1_Frame_Shift_Del_p.R500fs|KNDC1_uc001lmb.1_5'Flank	p.R565fs	NM_152643	NP_689856	WXS	Illumina HiSeq	Unspecified	Q76NI1	VKIND_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)	10	1696	+		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)	565			KIND 2.		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Frame_Shift_Del	DEL	ENST00000304613.3	37	c.1695delC	CCDS7674.1																																																																																				0.692	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643		3	5	NA	NA	NA	NA	NA	3	5	---	---	---	---
KCNQ1	3784	broad.mit.edu	37	11	2869199	2869199	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr11:2869199delC	ENST00000155840.5	+	16	2105	c.1997delC	c.(1996-1998)accfs	p.T666fs	KCNQ1-AS1_ENST00000440887.2_RNA|KCNQ1_ENST00000335475.5_Frame_Shift_Del_p.T539fs|KCNQ1_ENST00000526095.1_3'UTR	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	666					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	GAGCAGCTGACCGTGCCCAGG	0.716																																							uc001lwn.2		NA																	0				ovary(1)	1						c.(1996-1998)ACCfs		potassium voltage-gated channel, KQT-like	Bepridil(DB01244)|Indapamide(DB00808)						8.0	9.0	9.0					11																	2869199		2153	4249	6402	SO:0001589	frameshift_variant	3784				blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding	g.chr11:2869199delC	AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1997delC	11.37:g.2869199delC	ENSP00000155840:p.Thr666fs		Somatic				KCNQ1_uc001lwo.2_Frame_Shift_Del_p.T539fs	p.T666fs	NM_000218	NP_000209	WXS	Illumina HiSeq	Unspecified	P51787	KCNQ1_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	16	2105	+		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)	666			Cytoplasmic (Potential).		O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Frame_Shift_Del	DEL	ENST00000155840.5	37	c.1997delC	CCDS7736.1																																																																																				0.716	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
VPS33A	65082	broad.mit.edu	37	12	122729162	122729162	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr12:122729162delC	ENST00000267199.4	-	7	1035	c.923delG	c.(922-924)ggcfs	p.G308fs	RP11-512M8.5_ENST00000535844.1_Frame_Shift_Del_p.G269fs	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	308					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		GAGCACAGAGCCAACTGCGTT	0.507																																							uc001ucd.2		NA																	0				skin(1)	1						c.(922-924)GGCfs		vacuolar protein sorting 33A							125.0	109.0	115.0					12																	122729162		2203	4300	6503	SO:0001589	frameshift_variant	65082				lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding	g.chr12:122729162delC	AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.923delG	12.37:g.122729162delC	ENSP00000267199:p.Gly308fs		Somatic				VPS33A_uc001ucc.2_RNA	p.G308fs	NM_022916	NP_075067	WXS	Illumina HiSeq	Unspecified	Q96AX1	VP33A_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)	7	1036	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		308					Q547V4|Q9H5Q0	Frame_Shift_Del	DEL	ENST00000267199.4	37	c.923delG	CCDS9231.1																																																																																				0.507	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401607.2			16	69	NA	NA	NA	NA	NA	16	69	---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	10274229	10274229	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr16:10274229delC	ENST00000396573.2	-	3	349	c.40delG	c.(40-42)gccfs	p.A14fs	GRIN2A_ENST00000562109.1_Frame_Shift_Del_p.A14fs|GRIN2A_ENST00000330684.3_Frame_Shift_Del_p.A14fs|GRIN2A_ENST00000396575.2_Frame_Shift_Del_p.A14fs|GRIN2A_ENST00000404927.2_Frame_Shift_Del_p.A14fs	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	14					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ACCAGAAGGGCCGGCAGCACC	0.677																																							uc002czo.3		NA																	0				skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(40-42)GCCfs		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						14.0	17.0	16.0					16																	10274229		2185	4279	6464	SO:0001589	frameshift_variant	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:10274229delC		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.40delG	16.37:g.10274229delC	ENSP00000379818:p.Ala14fs		Somatic				GRIN2A_uc010uym.1_Frame_Shift_Del_p.A14fs|GRIN2A_uc002czr.3_Frame_Shift_Del_p.A14fs|GRIN2A_uc010buk.2_Frame_Shift_Del_p.A14fs	p.A14fs	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			2	588	-			14					O00669|Q17RZ6	Frame_Shift_Del	DEL	ENST00000396573.2	37	c.40delG	CCDS10539.1																																																																																				0.677	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			7	35	NA	NA	NA	NA	NA	7	35	---	---	---	---
ANKFN1	162282	broad.mit.edu	37	17	54452001	54452002	+	In_Frame_Ins	INS	-	-	CAG			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr17:54452001_54452002insCAG	ENST00000318698.2	+	7	880_881	c.845_846insCAG	c.(844-849)accagc>acCAGcagc	p.284_285insS	ANKFN1_ENST00000566473.2_In_Frame_Ins_p.284_285insS	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	284	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.							p.T282S(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						CTCATGGTAACCAGCAGCACAT	0.46																																							uc002iun.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	large_intestine(1)|ovary(1)	2						c.(844-846)ACC>ACCAGC		ankyrin-repeat and fibronectin type III domain																																				SO:0001652	inframe_insertion	162282							g.chr17:54452001_54452002insCAG	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.849_851dupCAG	17.37:g.54452005_54452007dupCAG	ENSP00000321627:p.Ser285_Ser286dup		Somatic					p.284_285insS	NM_153228	NP_694960	WXS	Illumina HiSeq	Unspecified	Q8N957	ANKF1_HUMAN			7	880_881	+			284_285			Fibronectin type-III.			In_Frame_Ins	INS	ENST00000318698.2	37	c.845_846insCAG	CCDS32686.1																																																																																				0.460	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228		42	231	NA	NA	NA	NA	NA	42	231	---	---	---	---
CPXM1	56265	broad.mit.edu	37	20	2779492	2779492	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr20:2779492delC	ENST00000380605.2	-	2	284	c.220delG	c.(220-222)gtcfs	p.V74fs		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	74					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TTCATAATGACCTTTTTCTTC	0.577																																							uc002wgu.2		NA																	0				ovary(2)|skin(2)	4						c.(220-222)GTCfs		carboxypeptidase X, member 1 precursor							143.0	140.0	141.0					20																	2779492		2203	4300	6503	SO:0001589	frameshift_variant	56265				cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding	g.chr20:2779492delC	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.220delG	20.37:g.2779492delC	ENSP00000369979:p.Val74fs		Somatic				CPXM1_uc010gas.2_Frame_Shift_Del_p.V74fs	p.V74fs	NM_019609	NP_062555	WXS	Illumina HiSeq	Unspecified	Q96SM3	CPXM1_HUMAN			2	284	-			74					Q6P4G8|Q6UW65|Q9NUB5	Frame_Shift_Del	DEL	ENST00000380605.2	37	c.220delG	CCDS13033.1																																																																																				0.577	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609		28	121	NA	NA	NA	NA	NA	28	121	---	---	---	---
MYH9	4627	broad.mit.edu	37	22	36696948	36696950	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	CTC	CTC	-	-	CTC	CTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr22:36696948_36696950delCTC	ENST00000216181.5	-	22	3015_3017	c.2785_2787delGAG	c.(2785-2787)gagdel	p.E929del		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	929					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GCTGGCAGCGCTCCTCCTCCTCC	0.665			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														uc003apg.2		NA		Dom	yes		22	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome	L	ALK		ALCL		0				breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						c.(2785-2787)GAGdel		myosin, heavy polypeptide 9, non-muscle																																				SO:0001651	inframe_deletion	4627	Hereditary_Macrothrombocytopenia_MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	g.chr22:36696948_36696950delCTC		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2785_2787delGAG	22.37:g.36696957_36696959delCTC	ENSP00000216181:p.Glu929del		Somatic				MYH9_uc003aph.1_In_Frame_Del_p.E793del	p.E929del	NM_002473	NP_002464	WXS	Illumina HiSeq	Unspecified	P35579	MYH9_HUMAN			22	3016_3018	-			929			Potential.		A8K6E4|O60805|Q60FE2|Q86T83	In_Frame_Del	DEL	ENST00000216181.5	37	c.2785_2787delGAG	CCDS13927.1																																																																																				0.665	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		7	139	NA	NA	NA	NA	NA	7	139	---	---	---	---
ICE1	23379	broad.mit.edu	37	5	5461386	5461388	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	TCT	TCT	-	-	TCT	TCT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr5:5461386_5461388delTCT	ENST00000296564.7	+	13	2161_2163	c.1939_1941delTCT	c.(1939-1941)tctdel	p.S649del		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		649					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TAATCCCCAGTCTTCTTCTGGGT	0.389																																							uc003jdm.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1939-1941)TCTdel		hypothetical protein LOC23379																																				SO:0001651	inframe_deletion	23379							g.chr5:5461386_5461388delTCT																												ENST00000296564.7:c.1939_1941delTCT	5.37:g.5461392_5461394delTCT	ENSP00000296564:p.Ser649del		Somatic					p.S649del	NM_015325	NP_056140	WXS	Illumina HiSeq	Unspecified	Q9Y2F5	K0947_HUMAN			13	2161_2163	+			649					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	In_Frame_Del	DEL	ENST00000296564.7	37	c.1939_1941delTCT	CCDS47187.1																																																																																				0.389	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			9	205	NA	NA	NA	NA	NA	9	205	---	---	---	---
EXOC2	55770	broad.mit.edu	37	6	637794	637794	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr6:637794delG	ENST00000230449.4	-	2	160	c.25delC	c.(25-27)cttfs	p.L9fs	EXOC2_ENST00000448181.3_Intron	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	9	IPT/TIG.				cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.Q6fs*28(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		CCGGTCACAAGGGGGGGTTGT	0.483																																							uc003mtd.2		NA																	1	Deletion - Frameshift(1)		ovary(1)	breast(4)|ovary(2)|pancreas(1)	7						c.(25-27)CTTfs		Sec5 protein							119.0	118.0	118.0					6																	637794		2203	4300	6503	SO:0001589	frameshift_variant	55770				exocytosis|protein transport			g.chr6:637794delG	AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.25delC	6.37:g.637794delG	ENSP00000230449:p.Leu9fs		Somatic				EXOC2_uc003mte.2_Frame_Shift_Del_p.L9fs|EXOC2_uc011dho.1_Intron	p.L9fs	NM_018303	NP_060773	WXS	Illumina HiSeq	Unspecified	Q96KP1	EXOC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)	2	159	-	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)	9			IPT/TIG.		B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Frame_Shift_Del	DEL	ENST00000230449.4	37	c.25delC	CCDS34327.1																																																																																				0.483	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303		25	209	NA	NA	NA	NA	NA	25	209	---	---	---	---
INHBA	3624	broad.mit.edu	37	7	41729440	41729440	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:41729440delC	ENST00000242208.4	-	3	1335	c.1089delG	c.(1087-1089)gggfs	p.G363fs	INHBA_ENST00000442711.1_Frame_Shift_Del_p.G363fs|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	363					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						ACAGTGAGGACCCGGACGTGC	0.567										TSP Lung(11;0.080)																													uc003thq.2		NA																	0				lung(5)|ovary(1)	6						c.(1087-1089)GGGfs		inhibin beta A precursor							127.0	115.0	119.0					7																	41729440		2203	4300	6503	SO:0001589	frameshift_variant	3624				cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity	g.chr7:41729440delC		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.1089delG	7.37:g.41729440delC	ENSP00000242208:p.Gly363fs	TSP Lung(11;0.080)	Somatic				INHBA_uc003thr.2_Frame_Shift_Del_p.G363fs	p.G363fs	NM_002192	NP_002183	WXS	Illumina HiSeq	Unspecified	P08476	INHBA_HUMAN			2	1324	-			363					Q14599	Frame_Shift_Del	DEL	ENST00000242208.4	37	c.1089delG	CCDS5464.1																																																																																				0.567	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1			13	92	NA	NA	NA	NA	NA	13	92	---	---	---	---
MET	4233	broad.mit.edu	37	7	116412042	116412047	+	Splice_Site	DEL	AGGTAT	AGGTAT	-			TCGA-55-6982-01A-11D-1945-08	TCGA-55-6982-11A-01D-1945-08	AGGTAT	AGGTAT	-	-	AGGTAT	AGGTAT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b7f11036-7ac4-41bc-a9a4-64162725fdfc	48a02a49-e77f-4a18-a2a2-3e28f13b25da	g.chr7:116412042_116412047delAGGTAT	ENST00000318493.6	+	14	3268_3269	c.3081_3082delAGGTAT	c.(3079-3084)gaaggt>gagt	p.G1028del	MET_ENST00000397752.3_Splice_Site_p.G1010del			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.?(6)|p.982_1028del47(4)|p.L982_D1028del(3)|p.D981_D1028del(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CTTTTCCAGAAGGTATATTTCAGTTT	0.35			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		14	Unknown(8)|Deletion - In frame(6)	p.982_1028del47(4)|p.L982_D1028del(3)|p.?(3)|p.D981_D1028del(1)	lung(11)|stomach(2)|central_nervous_system(1)	upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.e14+1		met proto-oncogene isoform b precursor																																				SO:0001630	splice_region_variant	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116412042_116412047delAGGTAT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3082+1AGGTAT>-	7.37:g.116412042_116412047delAGGTAT			Somatic				MET_uc010lkh.2_Splice_Site_p.D1028_splice|MET_uc011knj.1_Splice_Site_p.D580_splice	p.D1010_splice	NM_000245	NP_000236	WXS	Illumina HiSeq	Unspecified	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		14	3215	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)						A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Splice_Site	DEL	ENST00000318493.6	37	c.3028_splice	CCDS47689.1																																																																																				0.350	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		In_Frame_Del	7	49	NA	NA	NA	NA	NA	7	49	---	---	---	---
