#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MXRA8	54587	broad.mit.edu	37	1	1290644	1290644	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:1290644C>A	ENST00000309212.6	-	4	488	c.458G>T	c.(457-459)cGc>cTc	p.R153L	MXRA8_ENST00000342753.4_Missense_Mutation_p.R52L|MXRA8_ENST00000477278.2_Missense_Mutation_p.R144L|MXRA8_ENST00000445648.2_Missense_Mutation_p.R153L	NM_001282582.1|NM_032348.2	NP_001269511.1|NP_115724.1	Q9BRK3	MXRA8_HUMAN	matrix-remodelling associated 8	153	Ig-like V-type 1.				establishment of glial blood-brain barrier (GO:0060857)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GACCTCCAGGCGGACGGCCAG	0.741																																							uc001aew.2		NA																	0					0						c.(457-459)CGC>CTC		matrix-remodelling associated 8 precursor							32.0	27.0	29.0					1																	1290644		2198	4292	6490	SO:0001583	missense	54587					integral to membrane		g.chr1:1290644C>A	BC006213	CCDS24.1, CCDS59950.1, CCDS59951.1, CCDS59952.1	1p36.33	2013-01-11			ENSG00000162576	ENSG00000162576		"""Immunoglobulin superfamily / V-set domain containing"""	7542	protein-coding gene	gene with protein product	"""limitrin"""					14603461	Standard	XM_005244758		Approved	DKFZp586E2023	uc001aew.3	Q9BRK3	OTTHUMG00000002973	ENST00000309212.6:c.458G>T	1.37:g.1290644C>A	ENSP00000307887:p.Arg153Leu		Somatic				MXRA8_uc001aex.3_Missense_Mutation_p.R153L|MXRA8_uc001aey.3_Missense_Mutation_p.R153L|MXRA8_uc010nyl.1_Missense_Mutation_p.R153L|MXRA8_uc001aez.2_Missense_Mutation_p.R52L|MXRA8_uc001afa.2_Missense_Mutation_p.R144L	p.R153L	NM_032348	NP_115724	WXS	Illumina HiSeq	Unspecified	Q9BRK3	MXRA8_HUMAN		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)	4	489	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	153			Extracellular (Potential).|Ig-like V-type 1.		B3KTR6|B4DE34|Q5TA39|Q96KC3	Missense_Mutation	SNP	ENST00000309212.6	37	c.458G>T	CCDS24.1	.	.	.	.	.	.	.	.	.	.	.	8.146	0.786228	0.16189	.	.	ENSG00000162576	ENST00000309212;ENST00000378864;ENST00000342753;ENST00000445648	T;T;T	0.79554	1.66;-1.28;1.66	3.88	1.97	0.26223	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.185130	0.47093	D	0.000255	T	0.69708	0.3141	L	0.50333	1.59	0.27647	N	0.947527	B;B;B;B	0.11235	0.003;0.004;0.002;0.003	B;B;B;B	0.11329	0.006;0.003;0.004;0.006	T	0.59188	-0.7501	10	0.45353	T	0.12	-14.6761	3.3061	0.07001	0.186:0.5134:0.0:0.3006	.	144;52;153;153	B3KTR6;B4DE34;Q9BRK3-2;Q9BRK3	.;.;.;MXRA8_HUMAN	L	153;144;52;153	ENSP00000307887:R153L;ENSP00000344998:R52L;ENSP00000399229:R153L	ENSP00000307887:R153L	R	-	2	0	MXRA8	1280507	0.005000	0.15991	0.021000	0.16686	0.006000	0.05464	-0.084000	0.11268	0.234000	0.21139	-0.652000	0.03908	CGC		0.741	MXRA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008282.2	NM_032348		9	23	1	0	3.07112e-06	0.000978	3.81753e-06	9	23				
CEP104	9731	broad.mit.edu	37	1	3751513	3751513	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:3751513T>A	ENST00000378230.3	-	11	1785	c.1461A>T	c.(1459-1461)agA>agT	p.R487S	CEP104_ENST00000460038.1_5'UTR	NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	487						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						CCTTTATGGCTCTTCTAACGA	0.502																																							uc001aky.2		NA																	0					0						c.(1459-1461)AGA>AGT		glycine-, glutamate-,							129.0	113.0	119.0					1																	3751513		2203	4300	6503	SO:0001583	missense	9731					centriole	binding	g.chr1:3751513T>A	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.1461A>T	1.37:g.3751513T>A	ENSP00000367476:p.Arg487Ser		Somatic				KIAA0562_uc010nzm.1_RNA|KIAA0562_uc001akz.2_Missense_Mutation_p.R487S	p.R487S	NM_014704	NP_055519	WXS	Illumina HiSeq	Unspecified	O60308	CE104_HUMAN		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)	11	1820	-	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)	487					Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	c.1461A>T	CCDS30571.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.700272	0.48307	.	.	ENSG00000116198	ENST00000378230	T	0.66460	-0.21	4.75	3.63	0.41609	Armadillo-like helical (1);Armadillo-type fold (1);	0.112684	0.64402	D	0.000010	T	0.75428	0.3848	M	0.80616	2.505	0.80722	D	1	D;D	0.76494	0.999;0.972	P;P	0.62560	0.904;0.742	T	0.73139	-0.4077	10	0.48119	T	0.1	.	4.062	0.09843	0.153:0.1713:0.0:0.6757	.	487;487	O60308-3;O60308	.;CE104_HUMAN	S	487	ENSP00000367476:R487S	ENSP00000367476:R487S	R	-	3	2	CEP104	3741373	0.989000	0.36119	0.983000	0.44433	0.860000	0.49131	0.290000	0.18975	0.675000	0.31264	0.533000	0.62120	AGA		0.502	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704		4	6	0	0	0	0.000602	0	4	6				
SPATA21	374955	broad.mit.edu	37	1	16725938	16725938	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:16725938C>A	ENST00000335496.1	-	12	1735	c.1253G>T	c.(1252-1254)aGg>aTg	p.R418M	SPATA21_ENST00000540400.1_Missense_Mutation_p.R395M|SPATA21_ENST00000466212.1_5'UTR	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	418							calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		GCTCGGCTGCCTACGGACCAT	0.597																																							uc001ayn.2		NA																	0				ovary(2)|breast(1)	3						c.(1252-1254)AGG>ATG		spermatogenesis associated 21							78.0	63.0	68.0					1																	16725938		2203	4300	6503	SO:0001583	missense	374955						calcium ion binding	g.chr1:16725938C>A		CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.1253G>T	1.37:g.16725938C>A	ENSP00000335612:p.Arg418Met		Somatic				SPATA21_uc001ayl.1_RNA|SPATA21_uc010occ.1_Missense_Mutation_p.R395M	p.R418M	NM_198546	NP_940948	WXS	Illumina HiSeq	Unspecified	Q7Z572	SPT21_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)	12	1736	-		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)	418					B9EK40|F5GXP5	Missense_Mutation	SNP	ENST00000335496.1	37	c.1253G>T	CCDS172.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605290	0.46423	.	.	ENSG00000187144	ENST00000491418;ENST00000335496;ENST00000540400	T;D;D	0.81908	0.24;-1.51;-1.55	5.11	5.11	0.69529	.	0.389254	0.22005	N	0.065956	D	0.86239	0.5885	L	0.36672	1.1	0.38177	D	0.939494	D;D	0.89917	1.0;1.0	D;D	0.69479	0.964;0.921	D	0.87934	0.2712	10	0.87932	D	0	-6.2132	14.2345	0.65916	0.0:1.0:0.0:0.0	.	395;418	F5GXP5;Q7Z572	.;SPT21_HUMAN	M	126;418;395	ENSP00000420753:R126M;ENSP00000335612:R418M;ENSP00000440046:R395M	ENSP00000335612:R418M	R	-	2	0	SPATA21	16598525	0.977000	0.34250	0.918000	0.36340	0.004000	0.04260	1.986000	0.40677	2.826000	0.97356	0.561000	0.74099	AGG		0.597	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006677.2	NM_198546		13	42	1	0	0.000151284	0.001855	0.000176895	13	42				
ZNF436	80818	broad.mit.edu	37	1	23695808	23695808	+	Intron	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:23695808C>G	ENST00000314011.4	-	1	77				C1orf213_ENST00000518821.1_Silent_p.V6V|C1orf213_ENST00000458053.1_Intron|C1orf213_ENST00000335648.3_Silent_p.V6V|Y_RNA_ENST00000364535.1_RNA|C1orf213_ENST00000437367.2_Silent_p.V6V|ZNF436_ENST00000374608.3_5'Flank|C1orf213_ENST00000454117.1_Silent_p.V6V	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		CAGTCCCTGTCCGGTTGAAGG	0.612																																							uc001bgw.2		NA																	0					0						c.(16-18)GTC>GTG		hypothetical protein LOC148898 isoform 1							35.0	39.0	37.0					1																	23695808		2203	4300	6503	SO:0001627	intron_variant	148898							g.chr1:23695808C>G	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.59+50G>C	1.37:g.23695808C>G			Somatic				ZNF436_uc001bgt.2_5'Flank|ZNF436_uc001bgu.2_Intron|C1orf213_uc001bgv.2_Silent_p.V6V	p.V6V	NM_138479	NP_612488	WXS	Illumina HiSeq	Unspecified				UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.97e-26)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;5.23e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)	1	345	+		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)						Q658I9	Silent	SNP	ENST00000314011.4	37	c.18C>G	CCDS233.1																																																																																				0.612	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634		5	53	0	0	0	0.001168	0	5	53				
TCEB3	6924	broad.mit.edu	37	1	24078311	24078311	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:24078311T>A	ENST00000418390.2	+	4	1565	c.1294T>A	c.(1294-1296)Tct>Act	p.S432T	TCEB3_ENST00000609199.1_Missense_Mutation_p.S406T	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	432					gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GCCAACCATGTCTTTTGAATC	0.423											OREG0013232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001bho.2		NA																	0				ovary(1)	1						c.(1294-1296)TCT>ACT		elongin A							116.0	133.0	128.0					1																	24078311		2203	4300	6503	SO:0001583	missense	6924				positive regulation of viral transcription|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|viral reproduction	integral to membrane	DNA binding	g.chr1:24078311T>A	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1294T>A	1.37:g.24078311T>A	ENSP00000395574:p.Ser432Thr		Somatic	OREG0013232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	768		p.S432T	NM_003198	NP_003189	WXS	Illumina HiSeq	Unspecified	Q14241	ELOA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)	4	1354	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)	432					B2R7Q8|Q8IXH1	Missense_Mutation	SNP	ENST00000418390.2	37	c.1294T>A	CCDS239.2	.	.	.	.	.	.	.	.	.	.	T	16.41	3.114729	0.56505	.	.	ENSG00000011007	ENST00000418390	T	0.32753	1.44	5.96	5.96	0.96718	.	0.088781	0.49916	N	0.000124	T	0.52386	0.1731	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.68039	0.955	T	0.49204	-0.8964	10	0.45353	T	0.12	-13.0936	16.4484	0.83959	0.0:0.0:0.0:1.0	.	432	Q14241	ELOA1_HUMAN	T	432	ENSP00000395574:S432T	ENSP00000395574:S432T	S	+	1	0	TCEB3	23950898	1.000000	0.71417	1.000000	0.80357	0.052000	0.14988	6.182000	0.71995	2.285000	0.76669	0.533000	0.62120	TCT		0.423	TCEB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000008230.2	NM_003198		33	239	0	0	0	0.003271	0	33	239				
BAI2	576	broad.mit.edu	37	1	32196416	32196416	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:32196416C>A	ENST00000373658.3	-	29	4706	c.4365G>T	c.(4363-4365)aaG>aaT	p.K1455N	BAI2_ENST00000373655.2_Missense_Mutation_p.K1455N|BAI2_ENST00000257070.4_Missense_Mutation_p.K1422N|BAI2_ENST00000440175.2_Missense_Mutation_p.K1064N|BAI2_ENST00000398556.3_Missense_Mutation_p.K1370N|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000398542.1_Missense_Mutation_p.K1355N|BAI2_ENST00000398547.1_Missense_Mutation_p.K1388N|BAI2_ENST00000398538.1_Missense_Mutation_p.K1443N|BAI2_ENST00000527361.1_Missense_Mutation_p.K1422N	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1455					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGGAGCCCATCTTCATGGTAG	0.672																																							uc001btn.2		NA																	0				lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13						c.(4363-4365)AAG>AAT		brain-specific angiogenesis inhibitor 2							40.0	48.0	45.0					1																	32196416		2196	4295	6491	SO:0001583	missense	576				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr1:32196416C>A	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.4365G>T	1.37:g.32196416C>A	ENSP00000362762:p.Lys1455Asn		Somatic				BAI2_uc001btm.2_Missense_Mutation_p.K449N|BAI2_uc001btp.1_Missense_Mutation_p.K449N|BAI2_uc010ogn.1_Missense_Mutation_p.K425N|BAI2_uc010ogo.1_Missense_Mutation_p.K1064N|BAI2_uc010ogp.1_Missense_Mutation_p.K1388N|BAI2_uc010ogq.1_Missense_Mutation_p.K1422N|BAI2_uc001bto.2_Missense_Mutation_p.K1455N	p.K1455N	NM_001703	NP_001694	WXS	Illumina HiSeq	Unspecified	O60241	BAI2_HUMAN		STAD - Stomach adenocarcinoma(196;0.0557)	29	4719	-		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)	1455			Cytoplasmic (Potential).		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	c.4365G>T	CCDS346.2	.	.	.	.	.	.	.	.	.	.	C	13.73	2.323530	0.41096	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.06142	3.34;3.34;3.34;3.34;3.34;3.34;3.34;3.34;3.34	5.74	4.83	0.62350	.	0.000000	0.45126	D	0.000383	T	0.11239	0.0274	L	0.40543	1.245	0.32876	D	0.509945	P;B;B;B;P;B;B	0.41313	0.745;0.178;0.021;0.23;0.745;0.112;0.059	P;B;B;B;P;B;B	0.52881	0.712;0.07;0.017;0.05;0.712;0.032;0.028	T	0.06481	-1.0824	10	0.59425	D	0.04	.	7.0655	0.25149	0.1412:0.713:0.0:0.1458	.	1422;1443;1064;1370;1455;1455;1443	O60241-4;O60241-3;B4DKC3;A2A3C6;O60241-2;O60241;A2A3C2	.;.;.;.;.;BAI2_HUMAN;.	N	1370;1388;1455;1455;1355;1422;1422;1064;1443	ENSP00000381564:K1370N;ENSP00000381555:K1388N;ENSP00000362762:K1455N;ENSP00000362759:K1455N;ENSP00000381550:K1355N;ENSP00000257070:K1422N;ENSP00000435397:K1422N;ENSP00000391071:K1064N;ENSP00000381548:K1443N	ENSP00000257070:K1422N	K	-	3	2	BAI2	31969003	0.990000	0.36364	1.000000	0.80357	0.996000	0.88848	0.175000	0.16762	1.578000	0.49821	0.655000	0.94253	AAG		0.672	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703		29	66	1	0	3.69857e-22	0.008361	6.35395e-22	29	66				
CSMD2	114784	broad.mit.edu	37	1	34083126	34083126	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:34083126G>T	ENST00000373380.1	-	17	2758	c.2538C>A	c.(2536-2538)ttC>ttA	p.F846L	CSMD2_ENST00000373388.2_Missense_Mutation_p.F72L|CSMD2_ENST00000373377.1_Missense_Mutation_p.F72L|CSMD2_ENST00000373381.4_Missense_Mutation_p.F1973L			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1933	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCTCACACTGGAAAGACACCA	0.587																																							uc001bxn.1		NA																	0				ovary(6)|skin(5)|pancreas(1)	12						c.(5797-5799)TTC>TTA		CUB and Sushi multiple domains 2							119.0	90.0	100.0					1																	34083126		2203	4300	6503	SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34083126G>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2538C>A	1.37:g.34083126G>T	ENSP00000362478:p.Phe846Leu		Somatic				CSMD2_uc001bxm.1_Missense_Mutation_p.F1973L|CSMD2_uc001bxo.1_Missense_Mutation_p.F846L	p.F1933L	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			38	5828	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	1933			Sushi 11.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37	c.5799C>A		.	.	.	.	.	.	.	.	.	.	G	23.4	4.407192	0.83230	.	.	ENSG00000121904	ENST00000373381;ENST00000373380;ENST00000373377;ENST00000373388	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.67	1.18	0.20946	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.81856	0.4911	M	0.88842	2.985	0.54753	D	0.999983	D;D;D	0.76494	0.987;0.999;0.999	D;D;D	0.91635	0.992;0.999;0.999	T	0.83060	-0.0148	10	0.87932	D	0	.	11.1564	0.48491	0.2944:0.0:0.7056:0.0	.	846;1933;1973	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	L	1973;846;72;72	ENSP00000362479:F1973L;ENSP00000362478:F846L;ENSP00000362475:F72L;ENSP00000362486:F72L	ENSP00000241312:F1933L	F	-	3	2	CSMD2	33855713	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.240000	0.32731	0.346000	0.23899	0.655000	0.94253	TTC		0.587	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896		8	37	1	0	5.18039e-06	0.00308	6.4038e-06	8	37				
KIAA0319L	79932	broad.mit.edu	37	1	35940505	35940505	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:35940505T>C	ENST00000325722.3	-	5	1150	c.916A>G	c.(916-918)Ata>Gta	p.I306V		NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	306						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGTTCCTTTATAACTGGAAAC	0.363																																							uc001byx.2		NA																	0				skin(2)	2						c.(916-918)ATA>GTA		dyslexia susceptibility 2-like							84.0	84.0	84.0					1																	35940505		2203	4300	6503	SO:0001583	missense	79932					cytoplasmic vesicle part|integral to membrane	protein binding	g.chr1:35940505T>C	AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.916A>G	1.37:g.35940505T>C	ENSP00000318406:p.Ile306Val		Somatic				KIAA0319L_uc010ohw.1_RNA|KIAA0319L_uc001byz.2_Missense_Mutation_p.I306V|KIAA0319L_uc010ohx.1_Missense_Mutation_p.I306V	p.I306V	NM_024874	NP_079150	WXS	Illumina HiSeq	Unspecified	Q8IZA0	K319L_HUMAN			5	1174	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	306			Extracellular (Potential).		B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	ENST00000325722.3	37	c.916A>G	CCDS390.1	.	.	.	.	.	.	.	.	.	.	T	9.914	1.210196	0.22289	.	.	ENSG00000142687	ENST00000325722;ENST00000426982;ENST00000440579;ENST00000373258	T;T;T;T	0.22134	3.42;3.46;2.96;1.97	5.8	-1.99	0.07457	Fibronectin, type III (1);	0.588926	0.17940	N	0.156875	T	0.07908	0.0198	N	0.11560	0.145	0.23700	N	0.997072	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.40079	-0.9582	10	0.02654	T	1	-0.3039	11.1646	0.48535	0.0:0.4781:0.0:0.5219	.	306;306;306	B4DYG9;B1AN14;Q8IZA0	.;.;K319L_HUMAN	V	306	ENSP00000318406:I306V;ENSP00000395883:I306V;ENSP00000407576:I306V;ENSP00000362355:I306V	ENSP00000318406:I306V	I	-	1	0	KIAA0319L	35713092	0.769000	0.28531	0.993000	0.49108	0.983000	0.72400	0.003000	0.13083	-0.202000	0.10268	0.533000	0.62120	ATA		0.363	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012684.2	NM_024874		5	53	0	0	0	0.000602	0	5	53				
MPL	4352	broad.mit.edu	37	1	43805148	43805148	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:43805148C>A	ENST00000372470.3	+	4	640	c.598C>A	c.(598-600)Cct>Act	p.P200T	MPL_ENST00000413998.2_Missense_Mutation_p.P200T	NM_005373.2	NP_005364.1	P40238	TPOR_HUMAN	MPL proto-oncogene, thrombopoietin receptor	200	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|platelet activation (GO:0030168)|regulation of chemokine production (GO:0032642)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(551)|large_intestine(3)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	567	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			Eltrombopag(DB06210)|Romiplostim(DB05332)	TCTGCAGAGGCCTCACTCAGC	0.572			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia																														NSCLC(52;534 1204 10016 41452 44427)	NSCLC(52;534 1204 10016 41452 44427)	uc001ciw.2		NA	yes	Dom	yes	Familial essential thrombocythemia	1	p34	4352	Mis	"""myeloproliferative leukemia virus oncogene, thrombopoietin receptor"""	yes	congenital amegakaryocytic thrombocytopenia	L		MPD	MPD		0				haematopoietic_and_lymphoid_tissue(361)|upper_aerodigestive_tract(1)|pancreas(1)	363						c.(598-600)CCT>ACT		myeloproliferative leukemia virus oncogene							89.0	86.0	87.0					1																	43805148		2203	4300	6503	SO:0001583	missense	4352				cell proliferation|platelet activation	integral to plasma membrane	cytokine receptor activity	g.chr1:43805148C>A	M90102	CCDS483.1	1p34	2014-09-17	2014-06-26		ENSG00000117400	ENSG00000117400		"""CD molecules"", ""Fibronectin type III domain containing"""	7217	protein-coding gene	gene with protein product		159530	"""myeloproliferative leukemia virus oncogene"""			1608974	Standard	NM_005373		Approved	CD110, TPOR	uc001ciw.3	P40238	OTTHUMG00000007429	ENST00000372470.3:c.598C>A	1.37:g.43805148C>A	ENSP00000361548:p.Pro200Thr		Somatic				MPL_uc001civ.2_Missense_Mutation_p.P200T|MPL_uc009vwr.2_Missense_Mutation_p.P193T	p.P200T	NM_005373	NP_005364	WXS	Illumina HiSeq	Unspecified	P40238	TPOR_HUMAN			4	643	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	200			Extracellular (Potential).|Fibronectin type-III 1.		Q5JUZ0	Missense_Mutation	SNP	ENST00000372470.3	37	c.598C>A	CCDS483.1	.	.	.	.	.	.	.	.	.	.	C	1.614	-0.523251	0.04141	.	.	ENSG00000117400	ENST00000372468;ENST00000372470;ENST00000413998	D;T	0.82711	-1.64;-1.37	5.55	2.45	0.29901	Fibronectin, type III (3);	0.751809	0.11952	N	0.513545	T	0.65207	0.2669	N	0.17082	0.46	0.09310	N	1	B;B;B	0.18013	0.014;0.025;0.015	B;B;B	0.17722	0.008;0.019;0.018	T	0.48906	-0.8993	10	0.05833	T	0.94	-0.0515	7.9217	0.29850	0.3285:0.5126:0.1589:0.0	.	193;200;200	Q308M1;P40238;Q5JUY5	.;TPOR_HUMAN;.	T	200	ENSP00000361548:P200T;ENSP00000414004:P200T	ENSP00000361546:P200T	P	+	1	0	MPL	43577735	0.001000	0.12720	0.001000	0.08648	0.031000	0.12232	0.536000	0.23129	0.691000	0.31592	0.555000	0.69702	CCT		0.572	MPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019522.1	NM_005373		29	70	1	0	1.16021e-09	0.007291	1.6365e-09	29	70				
BEND5	79656	broad.mit.edu	37	1	49224778	49224778	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:49224778C>A	ENST00000371833.3	-	3	625	c.539G>T	c.(538-540)cGg>cTg	p.R180L	BEND5_ENST00000476096.1_5'UTR|AGBL4_ENST00000371839.1_Intron|AGBL4_ENST00000371838.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	180						Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						ATACAGAGCCCGGGGCACCAC	0.622																																							uc001crx.3		NA																	0				skin(1)	1						c.(538-540)CGG>CTG		BEN domain containing 5							73.0	71.0	72.0					1																	49224778		2203	4300	6503	SO:0001583	missense	79656							g.chr1:49224778C>A	BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.539G>T	1.37:g.49224778C>A	ENSP00000360899:p.Arg180Leu		Somatic				AGBL4_uc001cru.2_Intron|AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crw.3_Missense_Mutation_p.R11L	p.R180L	NM_024603	NP_078879	WXS	Illumina HiSeq	Unspecified	Q7L4P6	BEND5_HUMAN			3	583	-			180			Potential.		D3DQ27|Q96A62|Q9HAI3	Missense_Mutation	SNP	ENST00000371833.3	37	c.539G>T	CCDS552.2	.	.	.	.	.	.	.	.	.	.	C	29.4	5.001785	0.93227	.	.	ENSG00000162373	ENST00000371833	.	.	.	5.46	5.46	0.80206	.	0.055211	0.64402	D	0.000002	T	0.66307	0.2776	L	0.29908	0.895	0.58432	D	0.999997	D	0.63880	0.993	D	0.74023	0.982	T	0.62358	-0.6871	8	.	.	.	-3.8503	18.6955	0.91599	0.0:1.0:0.0:0.0	.	180	Q7L4P6	BEND5_HUMAN	L	180	.	.	R	-	2	0	BEND5	48997365	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.335000	0.79234	2.733000	0.93635	0.655000	0.94253	CGG		0.622	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022323.1	NM_024603		25	44	1	0	3.08376e-08	0.00333	4.14884e-08	25	44				
BEND5	79656	broad.mit.edu	37	1	49224782	49224782	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:49224782G>C	ENST00000371833.3	-	3	621	c.535C>G	c.(535-537)Ccc>Gcc	p.P179A	BEND5_ENST00000476096.1_5'UTR|AGBL4_ENST00000371839.1_Intron|AGBL4_ENST00000371838.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	179						Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						AGAGCCCGGGGCACCACAGCA	0.627																																							uc001crx.3		NA																	0				skin(1)	1						c.(535-537)CCC>GCC		BEN domain containing 5							72.0	70.0	71.0					1																	49224782		2203	4300	6503	SO:0001583	missense	79656							g.chr1:49224782G>C	BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.535C>G	1.37:g.49224782G>C	ENSP00000360899:p.Pro179Ala		Somatic				AGBL4_uc001cru.2_Intron|AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crw.3_Missense_Mutation_p.P10A	p.P179A	NM_024603	NP_078879	WXS	Illumina HiSeq	Unspecified	Q7L4P6	BEND5_HUMAN			3	579	-			179					D3DQ27|Q96A62|Q9HAI3	Missense_Mutation	SNP	ENST00000371833.3	37	c.535C>G	CCDS552.2	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446636	0.84101	.	.	ENSG00000162373	ENST00000371833	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.66519	0.2797	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.62914	-0.6753	8	.	.	.	0.2055	18.6955	0.91599	0.0:0.0:1.0:0.0	.	179	Q7L4P6	BEND5_HUMAN	A	179	.	.	P	-	1	0	BEND5	48997369	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.274000	0.95731	2.733000	0.93635	0.655000	0.94253	CCC		0.627	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022323.1	NM_024603		21	47	0	0	0	0.001523	0	21	47				
TXNDC12	51060	broad.mit.edu	37	1	52489195	52489195	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:52489195C>A	ENST00000371626.4	-	6	1481	c.407G>T	c.(406-408)aGc>aTc	p.S136I	TXNDC12_ENST00000471493.1_5'UTR	NM_015913.3	NP_056997.1	O95881	TXD12_HUMAN	thioredoxin domain containing 12 (endoplasmic reticulum)	136					cell redox homeostasis (GO:0045454)	endoplasmic reticulum (GO:0005783)	protein-disulfide reductase (glutathione) activity (GO:0019153)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7					Glutathione(DB00143)	ATACTTGTAGCTGGGGTTTCC	0.418																																							uc001cti.2		NA																	0				ovary(1)	1						c.(406-408)AGC>ATC		thioredoxin domain containing 12 precursor							152.0	139.0	143.0					1																	52489195		2203	4300	6503	SO:0001583	missense	51060				activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding	g.chr1:52489195C>A	AF131758	CCDS561.1	1p32.3	2011-10-19			ENSG00000117862	ENSG00000117862		"""Protein disulfide isomerases"""	24626	protein-coding gene	gene with protein product	"""endoplasmic reticulum thioredoxin superfamily member, 18 kDa"", ""anterior gradient homolog 1 (Xenopus laevis)"", ""protein disulfide isomerase family A, member 16"""	609448				8619474, 9110174	Standard	NM_015913		Approved	TLP19, ERP18, ERP19, hAG-1, AGR1, PDIA16	uc001cti.4	O95881	OTTHUMG00000008629	ENST00000371626.4:c.407G>T	1.37:g.52489195C>A	ENSP00000360688:p.Ser136Ile		Somatic					p.S136I	NM_015913	NP_056997	WXS	Illumina HiSeq	Unspecified	O95831	AIFM1_HUMAN			6	686	-			209			FAD-dependent oxidoreductase (By similarity).		B3KQS0|Q5T1T4|Q96H50	Missense_Mutation	SNP	ENST00000371626.4	37	c.407G>T	CCDS561.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221522	0.58560	.	.	ENSG00000117862	ENST00000371626	T	0.47528	0.84	4.95	4.95	0.65309	Thioredoxin-like fold (3);	0.040458	0.85682	D	0.000000	T	0.50222	0.1603	L	0.53249	1.67	0.50171	D	0.999854	P	0.49696	0.927	P	0.46237	0.508	T	0.50215	-0.8854	10	0.38643	T	0.18	.	16.7149	0.85395	0.0:1.0:0.0:0.0	.	136	O95881	TXD12_HUMAN	I	136	ENSP00000360688:S136I	ENSP00000360688:S136I	S	-	2	0	TXNDC12	52261783	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.077000	0.41557	2.452000	0.82932	0.591000	0.81541	AGC		0.418	TXNDC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023818.1	NM_015913		27	55	1	0	8.16721e-17	0.002096	1.33464e-16	27	55				
CACHD1	57685	broad.mit.edu	37	1	65047888	65047888	+	Missense_Mutation	SNP	A	A	G	rs189517799	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:65047888A>G	ENST00000371073.2	+	3	311	c.311A>G	c.(310-312)aAt>aGt	p.N104S	CACHD1_ENST00000290039.5_Missense_Mutation_p.N53S|MIR4794_ENST00000582305.1_RNA|CACHD1_ENST00000495994.1_3'UTR			Q5VU97	CAHD1_HUMAN	cache domain containing 1	104					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						GATGTGGTCAATCGGAACAAG	0.443													A|||	8	0.00159744	0.0061	0.0	5008	,	,		17303	0.0		0.0	False		,,,				2504	0.0						uc001dbo.1		NA																	0				ovary(2)	2						c.(157-159)AAT>AGT		cache domain containing 1		A	SER/ASN	6,3760		0,6,1877	186.0	169.0	175.0		158	5.9	1.0	1		175	1,8223		0,1,4111	no	missense	CACHD1	NM_020925.2	46	0,7,5988	GG,GA,AA		0.0122,0.1593,0.0584	benign	53/1224	65047888	7,11983	1883	4112	5995	SO:0001583	missense	57685				calcium ion transport	integral to membrane		g.chr1:65047888A>G	AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.311A>G	1.37:g.65047888A>G	ENSP00000360113:p.Asn104Ser		Somatic				CACHD1_uc001dbp.1_5'UTR|CACHD1_uc001dbq.1_5'UTR	p.N53S	NM_020925	NP_065976	WXS	Illumina HiSeq	Unspecified	Q5VU97	CAHD1_HUMAN			3	263	+			104			Extracellular (Potential).		Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	37	c.158A>G		1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	13.35	2.210882	0.39102	0.001593	1.22E-4	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.22336	1.96;1.97	5.87	5.87	0.94306	VWA N-terminal (1);	0.042898	0.85682	D	0.000000	T	0.05456	0.0144	N	0.22421	0.69	0.52501	D	0.999959	B	0.10296	0.003	B	0.11329	0.006	T	0.20974	-1.0259	10	0.09843	T	0.71	-34.1076	12.1693	0.54148	0.8575:0.1425:0.0:0.0	.	104	Q5VU97	CAHD1_HUMAN	S	104;53	ENSP00000360113:N104S;ENSP00000290039:N53S	ENSP00000290039:N53S	N	+	2	0	CACHD1	64820476	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.800000	0.55537	2.248000	0.74166	0.533000	0.62120	AAT		0.443	CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925		15	56	0	0	0	0.003163	0	15	56				
SGIP1	84251	broad.mit.edu	37	1	67195021	67195021	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:67195021C>A	ENST00000371037.4	+	20	1894	c.1817C>A	c.(1816-1818)cCg>cAg	p.P606Q	SGIP1_ENST00000371035.3_Missense_Mutation_p.P396Q|SGIP1_ENST00000435165.2_Missense_Mutation_p.P111Q|AL354978.1_ENST00000408728.2_RNA|SGIP1_ENST00000237247.6_Missense_Mutation_p.P637Q|SGIP1_ENST00000371036.3_Missense_Mutation_p.P408Q|SGIP1_ENST00000371039.1_Missense_Mutation_p.P409Q	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	606	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						GCCAACAACCCGTCCCCAGCT	0.453																																							uc001dcr.2		NA																	0				ovary(3)	3						c.(1816-1818)CCG>CAG		SH3-domain GRB2-like (endophilin) interacting							121.0	116.0	117.0					1																	67195021		2203	4300	6503	SO:0001583	missense	84251				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding	g.chr1:67195021C>A	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1817C>A	1.37:g.67195021C>A	ENSP00000360076:p.Pro606Gln		Somatic				SGIP1_uc010opd.1_Missense_Mutation_p.P206Q|SGIP1_uc001dcs.2_Missense_Mutation_p.P206Q|SGIP1_uc001dct.2_Missense_Mutation_p.P208Q|SGIP1_uc009wat.2_Missense_Mutation_p.P400Q|SGIP1_uc001dcu.2_Missense_Mutation_p.P111Q	p.P606Q	NM_032291	NP_115667	WXS	Illumina HiSeq	Unspecified	Q9BQI5	SGIP1_HUMAN			20	2034	+			606					A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	c.1817C>A	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602712	0.87157	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037;ENST00000435165	T;T;T;T;T;T	0.51574	2.22;2.19;2.19;2.18;2.15;0.7	5.22	5.22	0.72569	Muniscin C-terminal mu homology domain (1);	0.000000	0.85682	D	0.000000	T	0.69415	0.3108	M	0.87180	2.865	0.80722	D	1	D;D;D;D;D	0.71674	0.996;0.998;0.982;0.993;0.981	D;D;P;P;D	0.72982	0.979;0.961;0.889;0.889;0.922	T	0.75958	-0.3134	10	0.87932	D	0	-5.1902	18.7768	0.91913	0.0:1.0:0.0:0.0	.	636;111;208;396;606	A6NEV3;Q6ZV33;B3KR01;B7Z5H8;Q9BQI5	.;.;.;.;SGIP1_HUMAN	Q	637;409;396;636;609;408;606;111	ENSP00000237247:P637Q;ENSP00000360078:P409Q;ENSP00000360074:P396Q;ENSP00000360075:P408Q;ENSP00000360076:P606Q;ENSP00000395525:P111Q	ENSP00000237247:P637Q	P	+	2	0	SGIP1	66967609	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	7.479000	0.81095	2.463000	0.83235	0.491000	0.48974	CCG		0.453	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291		36	92	1	0	4.11147e-13	0.003755	6.23232e-13	36	92				
GIPC2	54810	broad.mit.edu	37	1	78546513	78546513	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:78546513C>A	ENST00000370759.3	+	2	588	c.395C>A	c.(394-396)aCa>aAa	p.T132K	GIPC2_ENST00000476882.1_3'UTR	NM_017655.4	NP_060125.4	Q8TF65	GIPC2_HUMAN	GIPC PDZ domain containing family, member 2	132	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)	20						CTCACCATTACAGATAATGGT	0.338																																							uc001dik.2		NA																	0				ovary(1)	1						c.(394-396)ACA>AAA		PDZ domain protein GIPC2							85.0	87.0	86.0					1																	78546513		2203	4299	6502	SO:0001583	missense	54810					cytoplasm		g.chr1:78546513C>A	AB073737	CCDS685.1	1p31.1	2010-05-28			ENSG00000137960	ENSG00000137960			18177	protein-coding gene	gene with protein product	"""semaphorin cytoplasmic domain associated protein 2"""					11836570	Standard	NM_017655		Approved	FLJ20075, SEMCAP-2	uc001dik.3	Q8TF65	OTTHUMG00000041145	ENST00000370759.3:c.395C>A	1.37:g.78546513C>A	ENSP00000359795:p.Thr132Lys		Somatic					p.T132K	NM_017655	NP_060125	WXS	Illumina HiSeq	Unspecified	Q8TF65	GIPC2_HUMAN			2	585	+			132			PDZ.		Q8IYD3|Q9NXS7	Missense_Mutation	SNP	ENST00000370759.3	37	c.395C>A	CCDS685.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519299	0.85495	.	.	ENSG00000137960	ENST00000370759	T	0.23754	1.89	6.16	6.16	0.99307	PDZ/DHR/GLGF (4);	0.045665	0.85682	D	0.000000	T	0.54967	0.1891	M	0.88450	2.955	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.58194	-0.7679	10	0.56958	D	0.05	-14.6455	20.8598	0.99761	0.0:1.0:0.0:0.0	.	132	Q8TF65	GIPC2_HUMAN	K	132	ENSP00000359795:T132K	ENSP00000359795:T132K	T	+	2	0	GIPC2	78319101	1.000000	0.71417	1.000000	0.80357	0.489000	0.33432	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	ACA		0.338	GIPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098629.1	NM_017655		16	39	1	0	1.15088e-07	0.004007	1.50603e-07	16	39				
BRDT	676	broad.mit.edu	37	1	92441925	92441925	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:92441925A>G	ENST00000362005.3	+	6	966	c.548A>G	c.(547-549)aAg>aGg	p.K183R	BRDT_ENST00000399546.2_Missense_Mutation_p.K183R|BRDT_ENST00000402388.1_Missense_Mutation_p.K183R|BRDT_ENST00000394530.3_Missense_Mutation_p.K137R|BRDT_ENST00000370389.2_Missense_Mutation_p.K110R	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	183					cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		GTATTTCCTAAGACATCTATT	0.388																																							uc001dok.3		NA																	0				stomach(2)|ovary(1)|lung(1)	4						c.(547-549)AAG>AGG		testis-specific bromodomain protein							82.0	80.0	81.0					1																	92441925		2203	4300	6503	SO:0001583	missense	676				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity	g.chr1:92441925A>G	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.548A>G	1.37:g.92441925A>G	ENSP00000354568:p.Lys183Arg		Somatic				BRDT_uc001dol.3_Missense_Mutation_p.K183R|BRDT_uc010osz.1_Missense_Mutation_p.K187R|BRDT_uc009wdf.2_Missense_Mutation_p.K110R|BRDT_uc010ota.1_Missense_Mutation_p.K137R|BRDT_uc010otb.1_Missense_Mutation_p.K137R|BRDT_uc001dom.3_Missense_Mutation_p.K183R	p.K183R	NM_207189	NP_997072	WXS	Illumina HiSeq	Unspecified	Q58F21	BRDT_HUMAN		all cancers(265;0.0228)|Epithelial(280;0.133)	5	897	+		all_lung(203;0.00531)|Lung NSC(277;0.0194)	183					A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	ENST00000362005.3	37	c.548A>G	CCDS735.1	.	.	.	.	.	.	.	.	.	.	A	7.311	0.614970	0.14129	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000539070;ENST00000394530;ENST00000440509;ENST00000426141;ENST00000402388	T;T;T;T;T;T;T	0.19532	3.26;3.26;3.26;3.3;2.14;2.93;3.26	4.81	3.68	0.42216	.	0.536651	0.17970	N	0.155899	T	0.03783	0.0107	N	0.25647	0.755	0.09310	N	1	B;B;B;B	0.23442	0.051;0.085;0.001;0.051	B;B;B;B	0.19666	0.016;0.026;0.0;0.016	T	0.42464	-0.9450	10	0.13108	T	0.6	-3.0187	7.2383	0.26082	0.8984:0.0:0.1016:0.0	.	137;137;187;183	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	R	183;110;183;183;137;183;183;183	ENSP00000354568:K183R;ENSP00000359416:K110R;ENSP00000387822:K183R;ENSP00000378038:K137R;ENSP00000416714:K183R;ENSP00000404969:K183R;ENSP00000384051:K183R	ENSP00000354568:K183R	K	+	2	0	BRDT	92214513	0.038000	0.19896	0.009000	0.14445	0.006000	0.05464	3.022000	0.49659	0.809000	0.34255	0.454000	0.30748	AAG		0.388	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189		19	45	0	0	0	0.007413	0	19	45				
AMY2A	279	broad.mit.edu	37	1	104163185	104163185	+	Missense_Mutation	SNP	G	G	T	rs142529431		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:104163185G>T	ENST00000414303.2	+	5	821	c.757G>T	c.(757-759)Ggt>Tgt	p.G253C		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	253					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	AATTGATCTGGGTGGTGAGCC	0.348																																							uc001dut.2		NA																	0				ovary(1)|skin(1)	2						c.(757-759)GGT>TGT		pancreatic amylase alpha 2A precursor	Acarbose(DB00284)|Bentiromide(DB00522)|Icodextrin(DB00702)|Miglitol(DB00491)|Pancrelipase(DB00085)						78.0	94.0	89.0					1																	104163185		2192	4248	6440	SO:0001583	missense	279				carbohydrate catabolic process|polysaccharide digestion	extracellular space	alpha-amylase activity|calcium ion binding|chloride ion binding	g.chr1:104163185G>T	BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.757G>T	1.37:g.104163185G>T	ENSP00000397582:p.Gly253Cys		Somatic					p.G253C	NM_000699	NP_000690	WXS	Illumina HiSeq	Unspecified	P04746	AMYP_HUMAN		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	5	821	+		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)	253					B9EJG1|Q9UBH3	Missense_Mutation	SNP	ENST00000414303.2	37	c.757G>T	CCDS783.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	16.95|16.95	3.263402|3.263402	0.59431|0.59431	.|.	.|.	ENSG00000243480|ENSG00000243480	ENST00000414303;ENST00000393932|ENST00000423678	D|.	0.98329|.	-4.87|.	2.96|2.96	2.96|2.96	0.34315|0.34315	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.85712|0.85712	0.5760|0.5760	H|H	0.98256|0.98256	4.185|4.185	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	D|D	0.90809|0.90809	0.4700|0.4700	10|6	0.87932|.	D|.	0|.	.|.	13.9731|13.9731	0.64255|0.64255	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	253|.	P04746|.	AMYP_HUMAN|.	C|V	253|174	ENSP00000397582:G253C|.	ENSP00000377509:G253C|.	G|G	+|+	1|2	0|0	AMY2A|AMY2A	103964708|103964708	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.773000|0.773000	0.43773|0.43773	9.181000|9.181000	0.94874|0.94874	1.637000|1.637000	0.50538|0.50538	0.305000|0.305000	0.20034|0.20034	GGT|GGG		0.348	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	NM_000699		27	207	1	0	2.61675e-31	0.003214	4.75129e-31	27	207				
EPS8L3	79574	broad.mit.edu	37	1	110294720	110294720	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:110294720G>C	ENST00000361965.4	-	15	1437	c.1331C>G	c.(1330-1332)tCc>tGc	p.S444C	EPS8L3_ENST00000361852.4_Missense_Mutation_p.S414C|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000369805.3_Missense_Mutation_p.S445C	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	444						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		TTTGGGGCTGGAGGGCCTGGA	0.572																																							uc001dyr.1		NA																	0				ovary(2)|skin(1)	3						c.(1330-1332)TCC>TGC		epidermal growth factor receptor pathway							123.0	137.0	132.0					1																	110294720		2203	4300	6503	SO:0001583	missense	79574					cytoplasm	protein binding	g.chr1:110294720G>C	AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.1331C>G	1.37:g.110294720G>C	ENSP00000355255:p.Ser444Cys		Somatic				EPS8L3_uc001dys.1_Missense_Mutation_p.S414C|EPS8L3_uc001dyq.1_Missense_Mutation_p.S445C|EPS8L3_uc009wfm.1_Missense_Mutation_p.S381C|EPS8L3_uc009wfn.1_Missense_Mutation_p.S389C	p.S444C	NM_133181	NP_573444	WXS	Illumina HiSeq	Unspecified	Q8TE67	ES8L3_HUMAN		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)	15	1476	-		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)	444					A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	c.1331C>G	CCDS814.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.948229	0.34377	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.31510	1.49;1.49;1.49	5.28	1.66	0.24008	Src homology-3 domain (1);	1.750030	0.02886	N	0.133500	T	0.17662	0.0424	L	0.57536	1.79	0.09310	N	1	P;P;P	0.49253	0.697;0.871;0.921	B;B;P	0.46479	0.38;0.237;0.518	T	0.07139	-1.0788	10	0.54805	T	0.06	-1.3024	1.9002	0.03266	0.1184:0.1644:0.45:0.2673	.	414;444;445	Q8TE67-2;Q8TE67;Q8TE67-3	.;ES8L3_HUMAN;.	C	414;445;444	ENSP00000354551:S414C;ENSP00000358820:S445C;ENSP00000355255:S444C	ENSP00000354551:S414C	S	-	2	0	EPS8L3	110096243	0.052000	0.20516	0.025000	0.17156	0.019000	0.09904	0.470000	0.22084	1.093000	0.41377	0.655000	0.94253	TCC		0.572	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526		32	210	0	0	0	0.002836	0	32	210				
AMPD1	270	broad.mit.edu	37	1	115220608	115220608	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:115220608C>A	ENST00000520113.2	-	9	1261	c.1246G>T	c.(1246-1248)Gga>Tga	p.G416*	AMPD1_ENST00000353928.6_Nonsense_Mutation_p.G383*|AMPD1_ENST00000369538.3_Nonsense_Mutation_p.G412*			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	416					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TCACTTGCTCCTACAGGATTA	0.423																																							uc001efe.1		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(1147-1149)GGA>TGA		adenosine monophosphate deaminase 1 (isoform M)	Adenosine monophosphate(DB00131)						147.0	130.0	136.0					1																	115220608		2203	4300	6503	SO:0001587	stop_gained	270				purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr1:115220608C>A	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1246G>T	1.37:g.115220608C>A	ENSP00000430075:p.Gly416*		Somatic				AMPD1_uc001eff.1_Nonsense_Mutation_p.G379*	p.G383*	NM_000036	NP_000027	WXS	Illumina HiSeq	Unspecified	P23109	AMPD1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	9	1231	-	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	383					A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Nonsense_Mutation	SNP	ENST00000520113.2	37	c.1147G>T	CCDS876.2	.	.	.	.	.	.	.	.	.	.	C	38	6.978197	0.97979	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-13.665	18.9913	0.92793	0.0:1.0:0.0:0.0	.	.	.	.	X	416;412;383	.	ENSP00000316520:G383X	G	-	1	0	AMPD1	115022131	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.818000	0.86416	2.493000	0.84123	0.561000	0.74099	GGA		0.423	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4			19	46	1	0	0.00074312	0.006122	0.000848195	19	46				
NGF	4803	broad.mit.edu	37	1	115829133	115829133	+	Missense_Mutation	SNP	C	C	A	rs150136942		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:115829133C>A	ENST00000369512.2	-	3	452	c.284G>T	c.(283-285)cGt>cTt	p.R95L	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	95					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)	p.R95H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	TGCAGCTTCACGGGGAGGCTG	0.602																																							uc001efu.1		NA																	1	Substitution - Missense(1)	p.R95H(1)	upper_aerodigestive_tract(1)	upper_aerodigestive_tract(2)	2						c.(283-285)CGT>CTT		nerve growth factor, beta polypeptide precursor	Clenbuterol(DB01407)						43.0	44.0	44.0					1																	115829133		2203	4300	6503	SO:0001583	missense	4803				activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding	g.chr1:115829133C>A		CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.284G>T	1.37:g.115829133C>A	ENSP00000358525:p.Arg95Leu		Somatic					p.R95L	NM_002506	NP_002497	WXS	Illumina HiSeq	Unspecified	P01138	NGF_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	3	453	-	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)	95					A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Missense_Mutation	SNP	ENST00000369512.2	37	c.284G>T	CCDS882.1	.	.	.	.	.	.	.	.	.	.	G	2.733	-0.263907	0.05754	.	.	ENSG00000134259	ENST00000369512	T	0.60040	0.22	5.27	4.32	0.51571	.	0.239176	0.43747	N	0.000522	T	0.15435	0.0372	N	0.08118	0	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.15983	-1.0418	10	0.32370	T	0.25	-2.7992	9.1273	0.36824	0.0869:0.1466:0.7665:0.0	.	95	P01138	NGF_HUMAN	L	95	ENSP00000358525:R95L	ENSP00000358525:R95L	R	-	2	0	NGF	115630656	1.000000	0.71417	0.012000	0.15200	0.137000	0.21094	5.661000	0.68025	0.662000	0.31006	-0.352000	0.07741	CGT		0.602	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032832.1	NM_002506		17	37	1	0	1.02788e-11	0.00499	1.51359e-11	17	37				
SV2A	9900	broad.mit.edu	37	1	149877572	149877572	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:149877572G>A	ENST00000369146.3	-	12	2395	c.1905C>T	c.(1903-1905)tcC>tcT	p.S635S	SV2A_ENST00000369145.1_Silent_p.S635S	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	635					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	AGGAGACACAGGACATCACGC	0.592																																							uc001etg.2		NA																	0				ovary(6)|pancreas(1)	7						c.(1903-1905)TCC>TCT		synaptic vesicle glycoprotein 2	Levetiracetam(DB01202)						95.0	76.0	83.0					1																	149877572		2203	4300	6503	SO:0001819	synonymous_variant	9900				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr1:149877572G>A	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1905C>T	1.37:g.149877572G>A			Somatic				SV2A_uc009wlk.2_Silent_p.S87S|SV2A_uc001eth.2_Silent_p.S635S	p.S635S	NM_014849	NP_055664	WXS	Illumina HiSeq	Unspecified	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		12	2396	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		635			Helical; (Potential).		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	37	c.1905C>T	CCDS940.1																																																																																				0.592	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			12	49	0	0	0	0.001368	0	12	49				
KPRP	448834	broad.mit.edu	37	1	152733235	152733235	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:152733235T>C	ENST00000606109.1	+	1	1199	c.1171T>C	c.(1171-1173)Tgt>Cgt	p.C391R	KPRP_ENST00000368773.1_Missense_Mutation_p.C391R			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	391	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTTGACCAGTGTCCAGAGTC	0.642																																							uc001fal.1		NA																	0				ovary(4)|pancreas(1)	5						c.(1171-1173)TGT>CGT		keratinocyte proline-rich protein							128.0	124.0	125.0					1																	152733235		2203	4300	6503	SO:0001583	missense	448834					cytoplasm		g.chr1:152733235T>C	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1171T>C	1.37:g.152733235T>C	ENSP00000475216:p.Cys391Arg		Somatic					p.C391R	NM_001025231	NP_001020402	WXS	Illumina HiSeq	Unspecified	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	1229	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		391			Pro-rich.			Missense_Mutation	SNP	ENST00000606109.1	37	c.1171T>C	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	T	0.104	-1.148028	0.01714	.	.	ENSG00000203786	ENST00000368773	T	0.12255	2.7	4.34	-1.06	0.10002	.	0.673695	0.13820	N	0.360470	T	0.01765	0.0056	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.47368	-0.9123	10	0.16420	T	0.52	-0.3707	3.9613	0.09412	0.3909:0.1618:0.0:0.4473	.	391	Q5T749	KPRP_HUMAN	R	391	ENSP00000357762:C391R	ENSP00000357762:C391R	C	+	1	0	KPRP	150999859	0.001000	0.12720	0.002000	0.10522	0.010000	0.07245	0.058000	0.14301	-0.493000	0.06678	-1.777000	0.00654	TGT		0.642	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		20	56	0	0	0	0.001523	0	20	56				
SPRR1A	6698	broad.mit.edu	37	1	152957747	152957747	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:152957747C>A	ENST00000368762.1	+	1	41	c.41C>A	c.(40-42)cCt>cAt	p.P14H	SPRR1A_ENST00000307122.2_Missense_Mutation_p.P14H			P35321	SPR1A_HUMAN	small proline-rich protein 1A	14	2 X 12 AA approximate repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(2)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)	7	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACCCCACCCCCTCAGCCTCAG	0.522																																							uc009wnu.1		NA																	0					0						c.(40-42)CCT>CAT		small proline-rich protein 1A							120.0	120.0	120.0					1																	152957747		2203	4300	6503	SO:0001583	missense	6698				keratinization|peptide cross-linking	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity	g.chr1:152957747C>A	L05187	CCDS1032.1	1q21-q22	2008-02-05			ENSG00000169474	ENSG00000169474			11259	protein-coding gene	gene with protein product		182265				8325635	Standard	NM_005987		Approved		uc001faw.3	P35321	OTTHUMG00000014404	ENST00000368762.1:c.41C>A	1.37:g.152957747C>A	ENSP00000357751:p.Pro14His		Somatic				SPRR1A_uc001faw.2_Missense_Mutation_p.P14H	p.P14H	NM_005987	NP_005978	WXS	Illumina HiSeq	Unspecified	P35321	SPR1A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	119	+	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		14			1.|2 X 12 AA approximate repeats.		B1AN47|D3DV31|Q2M303|Q9UDG4	Missense_Mutation	SNP	ENST00000368762.1	37	c.41C>A	CCDS1032.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.314167	0.40996	.	.	ENSG00000169474	ENST00000307122;ENST00000368762	T;T	0.15834	2.39;2.39	5.5	4.59	0.56863	.	.	.	.	.	T	0.22859	0.0552	.	.	.	0.26068	N	0.981257	D	0.76494	0.999	D	0.64595	0.927	T	0.08700	-1.0709	8	0.87932	D	0	-1.1569	10.2502	0.43364	0.0:0.9084:0.0:0.0916	.	14	P35321	SPR1A_HUMAN	H	14	ENSP00000307340:P14H;ENSP00000357751:P14H	ENSP00000307340:P14H	P	+	2	0	SPRR1A	151224371	0.786000	0.28738	0.901000	0.35422	0.735000	0.41995	3.521000	0.53472	1.315000	0.45114	0.555000	0.69702	CCT		0.522	SPRR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040062.1	NM_005987		45	120	1	0	5.2432e-18	0.00361	8.71699e-18	45	120				
IQGAP3	128239	broad.mit.edu	37	1	156507066	156507066	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:156507066T>A	ENST00000361170.2	-	27	3339	c.3329A>T	c.(3328-3330)gAg>gTg	p.E1110V	IQGAP3_ENST00000498755.1_5'UTR	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1110	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCTCTGGACCTCGGGGTGGCT	0.557																																							uc001fpf.2		NA																	0				ovary(5)|skin(1)	6						c.(3328-3330)GAG>GTG		IQ motif containing GTPase activating protein 3							121.0	100.0	107.0					1																	156507066		2203	4300	6503	SO:0001583	missense	128239				small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity	g.chr1:156507066T>A	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3329A>T	1.37:g.156507066T>A	ENSP00000354451:p.Glu1110Val		Somatic					p.E1110V	NM_178229	NP_839943	WXS	Illumina HiSeq	Unspecified	Q86VI3	IQGA3_HUMAN			27	3404	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		1110			Ras-GAP.		Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	37	c.3329A>T	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.804851	0.90623	.	.	ENSG00000183856	ENST00000361170	T	0.80824	-1.42	4.93	4.93	0.64822	Rho GTPase activation protein (1);Ras GTPase-activating protein (3);	0.000000	0.85682	D	0.000000	D	0.88220	0.6378	M	0.85197	2.74	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.90314	0.4339	10	0.87932	D	0	-30.1934	13.5508	0.61730	0.0:0.0:0.0:1.0	.	1110	Q86VI3	IQGA3_HUMAN	V	1110	ENSP00000354451:E1110V	ENSP00000354451:E1110V	E	-	2	0	IQGAP3	154773690	1.000000	0.71417	0.995000	0.50966	0.948000	0.59901	7.723000	0.84788	2.074000	0.62210	0.459000	0.35465	GAG		0.557	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229		26	49	0	0	0	0.003954	0	26	49				
OR6K2	81448	broad.mit.edu	37	1	158669868	158669868	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:158669868C>A	ENST00000359610.2	-	1	618	c.575G>T	c.(574-576)cGa>cTa	p.R192L		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					GACGATGGCTCGTGTGTCTGT	0.473																																							uc001fsu.1		NA																	0		p.R192*(1)		pancreas(1)	1						c.(574-576)CGA>CTA		olfactory receptor, family 6, subfamily K,							150.0	122.0	131.0					1																	158669868		2203	4300	6503	SO:0001583	missense	81448				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158669868C>A	BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.575G>T	1.37:g.158669868C>A	ENSP00000352626:p.Arg192Leu		Somatic					p.R192L	NM_001005279	NP_001005279	WXS	Illumina HiSeq	Unspecified	Q8NGY2	OR6K2_HUMAN			1	575	-	all_hematologic(112;0.0378)		192			Extracellular (Potential).		B9EH33|Q6IFR6	Missense_Mutation	SNP	ENST00000359610.2	37	c.575G>T	CCDS30902.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.711534	0.30322	.	.	ENSG00000196171	ENST00000359610	T	0.00084	8.75	4.83	0.951	0.19579	GPCR, rhodopsin-like superfamily (1);	0.794940	0.10647	N	0.650352	T	0.00039	0.0001	N	0.21448	0.665	0.09310	N	1	B	0.24483	0.104	B	0.30401	0.115	T	0.07233	-1.0783	10	0.11794	T	0.64	0.0718	4.2419	0.10652	0.1837:0.4617:0.0:0.3546	.	192	Q8NGY2	OR6K2_HUMAN	L	192	ENSP00000352626:R192L	ENSP00000352626:R192L	R	-	2	0	OR6K2	156936492	0.001000	0.12720	0.578000	0.28575	0.977000	0.68977	0.878000	0.28126	0.274000	0.22072	-0.345000	0.07892	CGA		0.473	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279		28	70	1	0	7.41945e-09	0.005443	1.01865e-08	28	70				
ATP1A2	477	broad.mit.edu	37	1	160111106	160111106	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:160111106C>A	ENST00000361216.3	+	23	3146	c.3057C>A	c.(3055-3057)taC>taA	p.Y1019*	ATP1A2_ENST00000459972.1_3'UTR|ATP1A2_ENST00000392233.3_Nonsense_Mutation_p.Y1008*	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	1019					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			AGGAGACATACTACTGACCCC	0.512																																							uc001fvc.2		NA																	0				central_nervous_system(3)|ovary(2)|skin(2)	7						c.(3055-3057)TAC>TAA		Na+/K+ -ATPase alpha 2 subunit proprotein							135.0	121.0	125.0					1																	160111106		2203	4300	6503	SO:0001587	stop_gained	477				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160111106C>A	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.3057C>A	1.37:g.160111106C>A	ENSP00000354490:p.Tyr1019*		Somatic				ATP1A2_uc001fvd.2_Nonsense_Mutation_p.Y738*	p.Y1019*	NM_000702	NP_000693	WXS	Illumina HiSeq	Unspecified	P50993	AT1A2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)		23	3189	+	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		1019			Cytoplasmic (Potential).		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Nonsense_Mutation	SNP	ENST00000361216.3	37	c.3057C>A	CCDS1196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.359028|8.359028	0.98777|0.98777	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000447527|ENST00000361216;ENST00000392233;ENST00000435866	.|.	.|.	.|.	4.54|4.54	2.66|2.66	0.31614|0.31614	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.03739|.	0.0106|.	.|.	.|.	.|.	0.26858|0.26858	N|N	0.968028|0.968028	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.44314|.	-0.9336|.	4|.	.|0.02654	.|T	.|1	.|.	8.7314|8.7314	0.34501|0.34501	0.0:0.8136:0.0:0.1864|0.0:0.8136:0.0:0.1864	.|.	.|.	.|.	.|.	N|X	713|1019;1008;722	.|.	.|ENSP00000354490:Y1019X	T|Y	+|+	2|3	0|2	ATP1A2|ATP1A2	158377730|158377730	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.953000|0.953000	0.61014|0.61014	2.587000|2.587000	0.46128|0.46128	0.653000|0.653000	0.30826|0.30826	0.460000|0.460000	0.39030|0.39030	ACT|TAC		0.512	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702		13	55	1	0	0.000151284	0.001855	0.000176895	13	55				
GORAB	92344	broad.mit.edu	37	1	170521193	170521193	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:170521193G>T	ENST00000367763.3	+	5	795	c.775G>T	c.(775-777)Gca>Tca	p.A259S		NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	259	Necessary for interaction with RCHY1.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						GTACATTGCAGCAAAGCTAGA	0.418																																							uc001gha.2		NA																	0					0						c.(775-777)GCA>TCA		golgin, RAB6-interacting isoform a							111.0	110.0	111.0					1																	170521193		2203	4300	6503	SO:0001583	missense	92344					Golgi apparatus|nucleus		g.chr1:170521193G>T	AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.775G>T	1.37:g.170521193G>T	ENSP00000356737:p.Ala259Ser		Somatic				GORAB_uc009wvx.2_Missense_Mutation_p.A79S|GORAB_uc001ghb.2_Missense_Mutation_p.A79S|GORAB_uc001ghc.2_Missense_Mutation_p.A79S|GORAB_uc001ghd.2_Missense_Mutation_p.A52S	p.A259S	NM_152281	NP_689494	WXS	Illumina HiSeq	Unspecified	Q5T7V8	GORAB_HUMAN			5	802	+			259			Necessary for interaction with RCHY1.|Potential.		Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Missense_Mutation	SNP	ENST00000367763.3	37	c.775G>T	CCDS1289.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059780	0.76074	.	.	ENSG00000120370	ENST00000367763	T	0.63744	-0.06	5.64	4.7	0.59300	.	0.105878	0.64402	D	0.000007	T	0.67581	0.2908	L	0.57536	1.79	0.80722	D	1	D	0.65815	0.995	D	0.62955	0.909	T	0.73496	-0.3964	10	0.87932	D	0	-17.0501	15.9417	0.79758	0.0:0.1356:0.8644:0.0	.	259	Q5T7V8	GORAB_HUMAN	S	259	ENSP00000356737:A259S	ENSP00000356737:A259S	A	+	1	0	GORAB	168787817	1.000000	0.71417	0.769000	0.31535	0.797000	0.45037	6.159000	0.71856	1.331000	0.45412	0.655000	0.94253	GCA		0.418	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085226.1	NM_152281		41	99	1	0	1.32136e-16	0.00874	2.15403e-16	41	99				
TNR	7143	broad.mit.edu	37	1	175332844	175332844	+	Splice_Site	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:175332844C>A	ENST00000367674.2	-	13	3415	c.2707G>T	c.(2707-2709)Gtg>Ttg	p.V903L	TNR_ENST00000263525.2_Splice_Site_p.V903L			Q92752	TENR_HUMAN	tenascin R	903	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					ACTTTGTTACCTTGGGTGGGT	0.448																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(2707-2709)GTG>TTG		tenascin R precursor							134.0	126.0	129.0					1																	175332844		2203	4300	6503	SO:0001630	splice_region_variant	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175332844C>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2707+1G>T	1.37:g.175332844C>A			Somatic				TNR_uc009wwu.1_Missense_Mutation_p.V903L	p.V903L	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			11	2788	-	Renal(580;0.146)		903			Fibronectin type-III 7.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.2707G>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014446	0.75161	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.53206	0.63;0.63	5.5	5.5	0.81552	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000091	T	0.39963	0.1098	L	0.34521	1.04	0.80722	D	1	P	0.34462	0.454	B	0.34931	0.192	T	0.14309	-1.0477	9	.	.	.	.	17.5389	0.87841	0.0:1.0:0.0:0.0	.	903	Q92752	TENR_HUMAN	L	903;903;813	ENSP00000356646:V903L;ENSP00000263525:V903L	.	V	-	1	0	TNR	173599467	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.766000	0.74970	2.735000	0.93741	0.655000	0.94253	GTG		0.448	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	Missense_Mutation	21	56	1	0	9.95505e-16	0.002299	1.59186e-15	21	56				
TNR	7143	broad.mit.edu	37	1	175372666	175372666	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:175372666C>G	ENST00000367674.2	-	4	1294	c.586G>C	c.(586-588)Ggc>Cgc	p.G196R	TNR_ENST00000263525.2_Missense_Mutation_p.G196R			Q92752	TENR_HUMAN	tenascin R	196	Cys-rich.|EGF-like 1.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CAATTCTTGCCAAACCAGCCT	0.577																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(586-588)GGC>CGC		tenascin R precursor							83.0	89.0	87.0					1																	175372666		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175372666C>G	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.586G>C	1.37:g.175372666C>G	ENSP00000356646:p.Gly196Arg		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.G196R|TNR_uc010pmz.1_Missense_Mutation_p.G196R	p.G196R	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			2	667	-	Renal(580;0.146)		196			EGF-like 1.|Cys-rich.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.586G>C	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	34	5.294657	0.95546	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.40225	1.04;1.04	6.11	6.11	0.99139	EGF-like region, conserved site (2);	0.000000	0.85682	D	0.000000	T	0.78578	0.4305	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84576	0.0658	10	0.87932	D	0	.	20.3293	0.98710	0.0:1.0:0.0:0.0	.	196;196	B4DIX8;Q92752	.;TENR_HUMAN	R	196	ENSP00000356646:G196R;ENSP00000263525:G196R	ENSP00000263525:G196R	G	-	1	0	TNR	173639289	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.711000	0.84669	2.906000	0.99361	0.655000	0.94253	GGC		0.577	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		22	134	0	0	0	0.002299	0	22	134				
CACNA1E	777	broad.mit.edu	37	1	181764028	181764028	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:181764028G>T	ENST00000367573.2	+	46	6056	c.6056G>T	c.(6055-6057)cGt>cTt	p.R2019L	CACNA1E_ENST00000367570.1_Missense_Mutation_p.R1976L|CACNA1E_ENST00000526775.1_Missense_Mutation_p.R1957L|CACNA1E_ENST00000367567.4_Missense_Mutation_p.R1583L|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R1970L|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R2000L|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R1908L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2019					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TCCATGAGACGTTCATTTTCC	0.468																																							uc001gow.2		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(5926-5928)CGT>CTT		calcium channel, voltage-dependent, R type,							79.0	75.0	76.0					1																	181764028		1911	4138	6049	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181764028G>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6056G>T	1.37:g.181764028G>T	ENSP00000356545:p.Arg2019Leu		Somatic				CACNA1E_uc009wxs.2_Missense_Mutation_p.R1864L|CACNA1E_uc009wxt.2_Missense_Mutation_p.R1245L	p.R1976L	NM_000721	NP_000712	WXS	Illumina HiSeq	Unspecified	Q15878	CAC1E_HUMAN			45	6092	+			2019			Cytoplasmic (Potential).		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.5927G>T	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	34	5.406516	0.96051	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.99245	-5.2;-5.18;-5.62;-5.17;-5.35;-5.62;-5.62	5.91	5.91	0.95273	.	0.411995	0.25848	N	0.027919	D	0.99165	0.9711	L	0.46157	1.445	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.80764	0.986;0.994	D	0.99920	1.1246	10	0.87932	D	0	.	19.8936	0.96942	0.0:0.0:1.0:0.0	.	1957;1976	Q15878-2;Q15878-3	.;.	L	1976;1957;1970;1908;1583;2000;2019	ENSP00000356542:R1976L;ENSP00000434814:R1957L;ENSP00000350183:R1970L;ENSP00000351101:R1908L;ENSP00000356539:R1583L;ENSP00000353222:R2000L;ENSP00000356545:R2019L	ENSP00000350183:R1970L	R	+	2	0	CACNA1E	180030651	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.603000	0.90871	2.793000	0.96121	0.655000	0.94253	CGT		0.468	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		14	43	1	0	2.48551e-13	0.00499	3.79337e-13	14	43				
BRINP3	339479	broad.mit.edu	37	1	190067356	190067356	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:190067356G>A	ENST00000367462.3	-	8	2324	c.2093C>T	c.(2092-2094)tCa>tTa	p.S698L	BRINP3_ENST00000534846.1_Missense_Mutation_p.S596L	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	698					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CAAAAGTGCTGAATCCTGGGA	0.468																																							uc001gse.1		NA																	0				lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(2092-2094)TCA>TTA		family with sequence similarity 5, member C							103.0	102.0	102.0					1																	190067356		2203	4300	6503	SO:0001583	missense	339479					extracellular region		g.chr1:190067356G>A	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2093C>T	1.37:g.190067356G>A	ENSP00000356432:p.Ser698Leu		Somatic				FAM5C_uc010pot.1_Missense_Mutation_p.S596L	p.S698L	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			8	2325	-	Prostate(682;0.198)		698					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.2093C>T	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.538926	0.65085	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.21932	2.24;1.98	5.72	4.79	0.61399	.	0.210834	0.42420	D	0.000703	T	0.25865	0.0630	M	0.66939	2.045	0.48975	D	0.999738	B;B	0.28291	0.206;0.131	B;B	0.25140	0.058;0.026	T	0.05321	-1.0892	10	0.87932	D	0	.	14.3961	0.67013	0.0:0.149:0.851:0.0	.	596;698	B7Z260;Q76B58	.;FAM5C_HUMAN	L	698;596	ENSP00000356432:S698L;ENSP00000438022:S596L	ENSP00000356432:S698L	S	-	2	0	FAM5C	188333979	1.000000	0.71417	0.889000	0.34880	0.912000	0.54170	9.760000	0.98935	1.382000	0.46385	0.650000	0.86243	TCA		0.468	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		6	100	0	0	0	0.001984	0	6	100				
PTPRC	5788	broad.mit.edu	37	1	198703530	198703530	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:198703530C>A	ENST00000367376.2	+	22	2418	c.2247C>A	c.(2245-2247)gtC>gtA	p.V749V	PTPRC_ENST00000442510.2_Silent_p.V751V|PTPRC_ENST00000594404.1_Silent_p.V588V|PTPRC_ENST00000348564.6_Silent_p.V590V|PTPRC_ENST00000352140.3_Silent_p.V701V	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	749	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TTGTCATGGTCACTCGATGTG	0.418																																							uc001gur.1		NA																	0				breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						c.(2245-2247)GTC>GTA		protein tyrosine phosphatase, receptor type, C							263.0	270.0	268.0					1																	198703530		2203	4300	6503	SO:0001819	synonymous_variant	5788				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:198703530C>A	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.2247C>A	1.37:g.198703530C>A			Somatic				PTPRC_uc001gus.1_Silent_p.V701V|PTPRC_uc001gut.1_Silent_p.V588V|PTPRC_uc010ppg.1_Silent_p.V685V	p.V749V	NM_002838	NP_002829	WXS	Illumina HiSeq	Unspecified	P08575	PTPRC_HUMAN			22	2427	+			749			Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.		A8K7W6|Q16614|Q9H0Y6	Silent	SNP	ENST00000367376.2	37	c.2247C>A																																																																																					0.418	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				104	250	1	0	9.53466e-49	0.00361	1.78442e-48	104	250				
GPR25	2848	broad.mit.edu	37	1	200843050	200843050	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:200843050G>T	ENST00000304244.2	+	1	968	c.885G>T	c.(883-885)ctG>ctT	p.L295L		NM_005298.2	NP_005289.2	O00155	GPR25_HUMAN	G protein-coupled receptor 25	295					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(1)|lung(2)|ovary(1)|skin(1)	5						CCACCTGCCTGGCCTTCGTCA	0.746																																							uc001gvn.1		NA																	0				ovary(1)	1						c.(883-885)CTG>CTT		G protein-coupled receptor 25							19.0	21.0	20.0					1																	200843050		2173	4250	6423	SO:0001819	synonymous_variant	2848					integral to plasma membrane		g.chr1:200843050G>T	U91939	CCDS1405.1	1q32.1	2012-08-21			ENSG00000170128	ENSG00000170128		"""GPCR / Class A : Orphans"""	4480	protein-coding gene	gene with protein product		602174				9020062	Standard	NM_005298		Approved		uc001gvn.2	O00155	OTTHUMG00000035788	ENST00000304244.2:c.885G>T	1.37:g.200843050G>T			Somatic					p.L295L	NM_005298	NP_005289	WXS	Illumina HiSeq	Unspecified	O00155	GPR25_HUMAN			1	885	+			295			Helical; Name=7; (Potential).		A0AVJ5	Silent	SNP	ENST00000304244.2	37	c.885G>T	CCDS1405.1																																																																																				0.746	GPR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087056.1	NM_005298		28	60	1	0	8.4185e-14	0.002445	1.30868e-13	28	60				
KIF21B	23046	broad.mit.edu	37	1	200961498	200961498	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:200961498A>T	ENST00000422435.2	-	16	2613	c.2297T>A	c.(2296-2298)aTg>aAg	p.M766K	KIF21B_ENST00000332129.2_Missense_Mutation_p.M766K|KIF21B_ENST00000461742.2_Missense_Mutation_p.M766K|KIF21B_ENST00000360529.5_Missense_Mutation_p.M766K	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	766					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CTCCTCACGCATCTGCTTCAT	0.642																																							uc001gvs.1		NA																	0				ovary(3)|skin(3)	6						c.(2296-2298)ATG>AAG		kinesin family member 21B							69.0	64.0	66.0					1																	200961498		2203	4300	6503	SO:0001583	missense	23046				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:200961498A>T	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.2297T>A	1.37:g.200961498A>T	ENSP00000411831:p.Met766Lys		Somatic				KIF21B_uc001gvr.1_Missense_Mutation_p.M766K|KIF21B_uc009wzl.1_Missense_Mutation_p.M766K|KIF21B_uc010ppn.1_Missense_Mutation_p.M766K	p.M766K	NM_017596	NP_060066	WXS	Illumina HiSeq	Unspecified	O75037	KI21B_HUMAN			16	2614	-			766			Potential.		B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	c.2297T>A	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.651010	0.88056	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.47985	0.1475	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.60160	0.973;0.987;0.973;0.984	D;D;D;D	0.69479	0.921;0.942;0.921;0.964	T	0.51585	-0.8687	10	0.52906	T	0.07	.	15.0785	0.72096	1.0:0.0:0.0:0.0	.	766;766;766;766	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	K	766	ENSP00000328494:M766K;ENSP00000353724:M766K;ENSP00000433808:M766K;ENSP00000411831:M766K	ENSP00000328494:M766K	M	-	2	0	KIF21B	199228121	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.282000	0.95840	1.960000	0.56953	0.402000	0.26972	ATG		0.642	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332		20	74	0	0	0	0.004656	0	20	74				
PKP1	5317	broad.mit.edu	37	1	201294192	201294192	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:201294192A>T	ENST00000352845.3	+	12	2021	c.2021A>T	c.(2020-2022)cAa>cTa	p.Q674L	PKP1_ENST00000263946.3_Missense_Mutation_p.Q674L|PKP1_ENST00000367324.3_Missense_Mutation_p.Q653L			Q13835	PKP1_HUMAN	plakophilin 1	674					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						TCGCAGCCACAACTGGCCAAG	0.592																																							uc001gwd.2		NA																	0				ovary(2)	2						c.(2020-2022)CAA>CTA		plakophilin 1 isoform 1b							179.0	150.0	160.0					1																	201294192		2203	4300	6503	SO:0001583	missense	5317				cell adhesion|cellular component disassembly involved in apoptosis|multicellular organismal development	desmosome|intermediate filament|nucleus	intermediate filament binding|signal transducer activity|structural constituent of epidermis	g.chr1:201294192A>T	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.2021A>T	1.37:g.201294192A>T	ENSP00000295597:p.Gln674Leu		Somatic				PKP1_uc001gwe.2_Missense_Mutation_p.Q653L|PKP1_uc009wzm.2_Missense_Mutation_p.Q261L	p.Q674L	NM_000299	NP_000290	WXS	Illumina HiSeq	Unspecified	Q13835	PKP1_HUMAN			12	2272	+			674			ARM 9.		O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	c.2021A>T	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.538515	0.45176	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.48522	0.81;0.81;0.81	5.65	4.51	0.55191	Armadillo-like helical (1);Armadillo-type fold (1);	0.302043	0.36628	N	0.002495	T	0.47710	0.1460	L	0.44542	1.39	0.39223	D	0.963536	B;B;B	0.24823	0.039;0.045;0.112	B;B;B	0.38842	0.283;0.046;0.051	T	0.46569	-0.9182	10	0.39692	T	0.17	-19.3604	12.8657	0.57937	0.8637:0.1363:0.0:0.0	.	261;653;674	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	L	653;674;674	ENSP00000356293:Q653L;ENSP00000263946:Q674L;ENSP00000295597:Q674L	ENSP00000263946:Q674L	Q	+	2	0	PKP1	199560815	0.964000	0.33143	0.037000	0.18230	0.839000	0.47603	3.485000	0.53208	0.951000	0.37770	0.533000	0.62120	CAA		0.592	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299		37	158	0	0	0	0.00623	0	37	158				
RYR2	6262	broad.mit.edu	37	1	237982471	237982471	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:237982471A>G	ENST00000366574.2	+	101	14886	c.14569A>G	c.(14569-14571)Att>Gtt	p.I4857V	RYR2_ENST00000360064.6_Missense_Mutation_p.I4863V|RYR2_ENST00000542537.1_Missense_Mutation_p.I4841V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4857					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGTTATTGTCATTCTCTTGGC	0.408																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(14569-14571)ATT>GTT		cardiac muscle ryanodine receptor							222.0	222.0	222.0					1																	237982471		1948	4135	6083	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237982471A>G	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14569A>G	1.37:g.237982471A>G	ENSP00000355533:p.Ile4857Val		Somatic				RYR2_uc010pyb.1_Missense_Mutation_p.I290V	p.I4857V	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		101	14689	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4857			Helical; Name=M10; (Potential).		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.14569A>G	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.529091	0.85706	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000536033	D;D;D	0.98249	-4.82;-4.82;-4.82	5.58	5.58	0.84498	Ion transport (1);	0.000000	0.64402	U	0.000013	D	0.98720	0.9570	M	0.71920	2.185	0.58432	D	0.999997	P;P	0.47604	0.503;0.898	B;D	0.68192	0.376;0.956	D	0.99869	1.1094	10	0.87932	D	0	.	15.7638	0.78110	1.0:0.0:0.0:0.0	.	290;4857	F5H3C7;Q92736	.;RYR2_HUMAN	V	4857;4863;4841;290	ENSP00000355533:I4857V;ENSP00000353174:I4863V;ENSP00000443798:I4841V	ENSP00000353174:I4863V	I	+	1	0	RYR2	236049094	1.000000	0.71417	0.996000	0.52242	0.949000	0.60115	9.287000	0.95975	2.126000	0.65437	0.533000	0.62120	ATT		0.408	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		32	100	0	0	0	0.002836	0	32	100				
KMO	8564	broad.mit.edu	37	1	241729848	241729848	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:241729848A>T	ENST00000366559.4	+	9	1056	c.745A>T	c.(745-747)Acc>Tcc	p.T249S	KMO_ENST00000366557.4_Missense_Mutation_p.T249S|KMO_ENST00000366558.3_Missense_Mutation_p.T249S	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			AAAACTTCTAACCAGTAATGA	0.403																																							uc009xgp.2		NA																	0				ovary(2)	2						c.(745-747)ACC>TCC		kynurenine 3-monooxygenase							130.0	126.0	128.0					1																	241729848		2203	4300	6503	SO:0001583	missense	8564				pyridine nucleotide biosynthetic process|response to salt stress	cytosol|integral to membrane|mitochondrial outer membrane	electron carrier activity|flavin adenine dinucleotide binding|kynurenine 3-monooxygenase activity|NAD(P)H oxidase activity	g.chr1:241729848A>T	AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.745A>T	1.37:g.241729848A>T	ENSP00000355517:p.Thr249Ser		Somatic				KMO_uc001hyy.2_Missense_Mutation_p.T249S|KMO_uc009xgo.1_Missense_Mutation_p.T249S	p.T249S	NM_003679	NP_003670	WXS	Illumina HiSeq	Unspecified	O15229	KMO_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0176)		9	810	+	Ovarian(103;0.103)|all_lung(81;0.23)		249						Missense_Mutation	SNP	ENST00000366559.4	37	c.745A>T	CCDS1618.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.946655	0.73672	.	.	ENSG00000117009	ENST00000366559;ENST00000366558;ENST00000366557	T;T;T	0.48836	0.8;0.81;0.85	5.92	5.92	0.95590	Monooxygenase, FAD-binding (1);	0.043200	0.85682	N	0.000000	T	0.50735	0.1633	L	0.55481	1.735	0.53005	D	0.999963	D;P;D	0.54772	0.968;0.945;0.96	P;P;P	0.48552	0.581;0.581;0.545	T	0.46978	-0.9152	10	0.31617	T	0.26	.	14.3302	0.66550	1.0:0.0:0.0:0.0	.	249;249;249	O15229;A8K693;O15229-2	KMO_HUMAN;.;.	S	249	ENSP00000355517:T249S;ENSP00000355516:T249S;ENSP00000355515:T249S	ENSP00000355515:T249S	T	+	1	0	KMO	239796471	1.000000	0.71417	0.044000	0.18714	0.889000	0.51656	7.433000	0.80362	2.277000	0.76020	0.528000	0.53228	ACC		0.403	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095612.1	NM_003679		23	67	0	0	0	0.001882	0	23	67				
NLRP3	114548	broad.mit.edu	37	1	247588839	247588839	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:247588839C>A	ENST00000336119.3	+	3	2840	c.2094C>A	c.(2092-2094)ggC>ggA	p.G698G	NLRP3_ENST00000366497.2_Silent_p.G698G|NLRP3_ENST00000391828.3_Silent_p.G698G|NLRP3_ENST00000348069.2_Silent_p.G698G|NLRP3_ENST00000391827.2_Silent_p.G698G|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366496.2_Silent_p.G698G	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	698					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AAAAGGAAGGCCGACACCTTG	0.527																																							uc001icr.2		NA																	0				lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(2092-2094)GGC>GGA		NLR family, pyrin domain containing 3 isoform a							132.0	118.0	123.0					1																	247588839		2203	4300	6503	SO:0001819	synonymous_variant	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247588839C>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2094C>A	1.37:g.247588839C>A			Somatic				NLRP3_uc001ics.2_Silent_p.G698G|NLRP3_uc001icu.2_Silent_p.G698G|NLRP3_uc001icw.2_Silent_p.G698G|NLRP3_uc001icv.2_Silent_p.G698G|NLRP3_uc010pyw.1_Silent_p.G696G|NLRP3_uc001ict.1_Silent_p.G696G	p.G698G	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	2232	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	698					B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	37	c.2094C>A	CCDS1632.1																																																																																				0.527	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		8	37	1	0	0.000442599	0.006214	0.000508648	8	37				
OR2W5	441932	broad.mit.edu	37	1	247654603	247654603	+	RNA	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:247654603C>A	ENST00000522351.1	+	0	234							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TCCACACACCCATGTACTTCT	0.498																																							uc001icz.1		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(172-174)CCC>CCA		olfactory receptor, family 2, subfamily W,							138.0	123.0	128.0					1																	247654603		2203	4300	6503			441932				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247654603C>A			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247654603C>A			Somatic					p.P58P	NM_001004698	NP_001004698	WXS	Illumina HiSeq	Unspecified	A6NFC9	OR2W5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	174	+	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	58			Helical; Name=2; (Potential).		B9EH85	Silent	SNP	ENST00000522351.1	37	c.174C>A																																																																																					0.498	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698		18	56	1	0	2.35188e-11	0.006122	3.44805e-11	18	56				
OR2W3	343171	broad.mit.edu	37	1	248059225	248059225	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:248059225C>A	ENST00000360358.3	+	1	337	c.337C>A	c.(337-339)Ctg>Atg	p.L113M	OR2W3_ENST00000537741.1_Missense_Mutation_p.L113M	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGTGGAGTGCCTGCTTCTGGC	0.572																																							uc001idp.1		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(337-339)CTG>ATG		olfactory receptor, family 2, subfamily W,							129.0	101.0	111.0					1																	248059225		2203	4300	6503	SO:0001583	missense	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248059225C>A	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.337C>A	1.37:g.248059225C>A	ENSP00000353516:p.Leu113Met		Somatic				OR2W3_uc010pzb.1_Missense_Mutation_p.L113M	p.L113M	NM_001001957	NP_001001957	WXS	Illumina HiSeq	Unspecified	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	606	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		113			Helical; Name=3; (Potential).		Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	c.337C>A	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704275	0.48412	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.01406	4.93;4.93	5.28	0.0385	0.14200	GPCR, rhodopsin-like superfamily (1);	0.504996	0.16867	N	0.196291	T	0.02727	0.0082	L	0.58810	1.83	0.09310	N	0.999999	P	0.52692	0.955	P	0.50231	0.635	T	0.39800	-0.9596	10	0.66056	D	0.02	.	6.3281	0.21255	0.0:0.4827:0.1248:0.3925	.	113	Q7Z3T1	OR2W3_HUMAN	M	113	ENSP00000445853:L113M;ENSP00000353516:L113M	ENSP00000353516:L113M	L	+	1	2	OR2W3	246125848	0.000000	0.05858	0.917000	0.36280	0.915000	0.54546	-0.224000	0.09164	0.082000	0.17018	0.603000	0.83216	CTG		0.572	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		19	67	1	0	4.35082e-09	0.001523	6.07301e-09	19	67				
OR2L8	391190	broad.mit.edu	37	1	248112950	248112950	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:248112950T>C	ENST00000357191.3	+	1	791	c.791T>C	c.(790-792)cTg>cCg	p.L264P	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CCAAGATCCCTGCGATCTCCA	0.488																																							uc001idt.1		NA																	0				ovary(1)|skin(1)	2						c.(790-792)CTG>CCG		olfactory receptor, family 2, subfamily L,							118.0	91.0	100.0					1																	248112950		2203	4298	6501	SO:0001583	missense	391190				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248112950T>C	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.791T>C	1.37:g.248112950T>C	ENSP00000349719:p.Leu264Pro		Somatic				OR2L13_uc001ids.2_Intron	p.L264P	NM_001001963	NP_001001963	WXS	Illumina HiSeq	Unspecified	Q8NGY9	OR2L8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	791	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		264			Extracellular (Potential).		Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	c.791T>C	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	5.613	0.297802	0.10622	.	.	ENSG00000196936	ENST00000357191	T	0.00107	8.72	1.8	-1.45	0.08828	GPCR, rhodopsin-like superfamily (1);	1.160920	0.07086	U	0.837966	T	0.00241	0.0007	L	0.31578	0.945	0.09310	N	0.999996	D	0.56746	0.977	D	0.65573	0.936	T	0.53222	-0.8469	10	0.56958	D	0.05	.	7.6919	0.28573	0.0:0.0:0.3979:0.6021	.	264	Q8NGY9	OR2L8_HUMAN	P	264	ENSP00000349719:L264P	ENSP00000349719:L264P	L	+	2	0	OR2L8	246179573	0.000000	0.05858	0.020000	0.16555	0.272000	0.26649	-0.606000	0.05654	0.004000	0.14682	-0.509000	0.04479	CTG		0.488	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2			5	126	0	0	0	0.000602	0	5	126				
OR2M5	127059	broad.mit.edu	37	1	248308855	248308855	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:248308855A>T	ENST00000366476.1	+	1	406	c.406A>T	c.(406-408)Atg>Ttg	p.M136L		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CACCAATCTCATGAGACCCAA	0.448																																							uc010pze.1		NA																	0				ovary(2)|kidney(1)	3						c.(406-408)ATG>TTG		olfactory receptor, family 2, subfamily M,							272.0	272.0	272.0					1																	248308855		2203	4300	6503	SO:0001583	missense	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248308855A>T		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.406A>T	1.37:g.248308855A>T	ENSP00000355432:p.Met136Leu		Somatic					p.M136L	NM_001004690	NP_001004690	WXS	Illumina HiSeq	Unspecified	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	406	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		136			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000366476.1	37	c.406A>T	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	a	12.91	2.078654	0.36662	.	.	ENSG00000162727	ENST00000366476	T	0.00578	6.44	3.13	1.92	0.25849	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38605	U	0.001631	T	0.01061	0.0035	M	0.87038	2.855	0.23743	N	0.996965	B	0.32338	0.365	B	0.34346	0.18	T	0.37888	-0.9686	10	0.66056	D	0.02	.	5.5121	0.16886	0.6527:0.1766:0.0:0.1707	.	136	A3KFT3	OR2M5_HUMAN	L	136	ENSP00000355432:M136L	ENSP00000355432:M136L	M	+	1	0	OR2M5	246375478	0.997000	0.39634	0.023000	0.16930	0.054000	0.15201	3.809000	0.55606	0.191000	0.20236	0.403000	0.27427	ATG		0.448	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		67	356	0	0	0	0.00361	0	67	356				
SFMBT2	57713	broad.mit.edu	37	10	7214469	7214469	+	Silent	SNP	C	C	A	rs145957081	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:7214469C>A	ENST00000361972.4	-	18	2229	c.2139G>T	c.(2137-2139)gcG>gcT	p.A713A	SFMBT2_ENST00000397167.1_Silent_p.A713A	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	713					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.A713A(1)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CCCCCGAGCCCGCGGTGAAGT	0.642																																							uc009xio.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						c.(2137-2139)GCG>GCT		Scm-like with four mbt domains 2							40.0	39.0	39.0					10																	7214469		2203	4300	6503	SO:0001819	synonymous_variant	57713				regulation of transcription, DNA-dependent	nucleus		g.chr10:7214469C>A	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2139G>T	10.37:g.7214469C>A			Somatic				SFMBT2_uc001ijn.1_Silent_p.A713A|SFMBT2_uc010qay.1_Silent_p.A548A	p.A713A	NM_001029880	NP_001025051	WXS	Illumina HiSeq	Unspecified	Q5VUG0	SMBT2_HUMAN			18	2230	-			713					A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	37	c.2139G>T	CCDS31138.1																																																																																				0.642	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880		7	17	1	0	0.00198382	0.001984	0.00224141	7	17				
ITIH5	80760	broad.mit.edu	37	10	7618933	7618933	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:7618933G>A	ENST00000256861.6	-	10	1539	c.1461C>T	c.(1459-1461)cgC>cgT	p.R487R	ITIH5_ENST00000298441.6_Silent_p.R273R|ITIH5_ENST00000446830.2_Silent_p.R269R|ITIH5_ENST00000397146.2_Silent_p.R487R|ITIH5_ENST00000397145.2_Silent_p.R487R|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	487					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GATAATCGATGCGGATGTCAG	0.592																																							uc001ijq.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1459-1461)CGC>CGT		inter-alpha trypsin inhibitor heavy chain							71.0	70.0	70.0					10																	7618933		2203	4300	6503	SO:0001819	synonymous_variant	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7618933G>A			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1461C>T	10.37:g.7618933G>A			Somatic				ITIH5_uc001ijp.2_Silent_p.R273R|ITIH5_uc001ijr.1_Silent_p.R487R	p.R487R	NM_030569	NP_085046	WXS	Illumina HiSeq	Unspecified	Q86UX2	ITIH5_HUMAN			10	1540	-			487					Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37	c.1461C>T																																																																																					0.592	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		8	45	0	0	0	0.00308	0	8	45				
ARMC3	219681	broad.mit.edu	37	10	23326202	23326202	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:23326202C>G	ENST00000298032.5	+	19	2497	c.2413C>G	c.(2413-2415)Ctg>Gtg	p.L805V	ARMC3_ENST00000376528.4_Missense_Mutation_p.L542V|ARMC3_ENST00000409983.3_Missense_Mutation_p.L798V	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	805						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CCTGCAGGCTCTGGCTGATAG	0.493																																							uc001irm.3		NA																	0					0						c.(2413-2415)CTG>GTG		armadillo repeat containing 3							92.0	95.0	94.0					10																	23326202		2203	4300	6503	SO:0001583	missense	219681						binding	g.chr10:23326202C>G	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.2413C>G	10.37:g.23326202C>G	ENSP00000298032:p.Leu805Val		Somatic				ARMC3_uc010qcv.1_Missense_Mutation_p.L798V|ARMC3_uc010qcw.1_Missense_Mutation_p.L542V	p.L805V	NM_173081	NP_775104	WXS	Illumina HiSeq	Unspecified	Q5W041	ARMC3_HUMAN			19	2496	+			805					A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	c.2413C>G	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.036460	0.35893	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376528	T;T;T	0.65178	-0.14;-0.12;1.18	5.68	3.59	0.41128	.	0.300889	0.26571	N	0.023634	T	0.67608	0.2911	M	0.82823	2.61	0.48040	D	0.999579	D;P	0.53462	0.96;0.826	P;B	0.49752	0.621;0.338	T	0.69101	-0.5234	10	0.46703	T	0.11	-11.4461	6.9536	0.24558	0.1542:0.6513:0.0:0.1945	.	798;805	Q5W041-4;Q5W041	.;ARMC3_HUMAN	V	805;798;542	ENSP00000298032:L805V;ENSP00000386943:L798V;ENSP00000365711:L542V	ENSP00000298032:L805V	L	+	1	2	ARMC3	23366208	0.154000	0.22792	0.998000	0.56505	0.226000	0.24999	0.555000	0.23422	1.391000	0.46566	0.655000	0.94253	CTG		0.493	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081		10	43	0	0	0	0.001855	0	10	43				
GDF10	2662	broad.mit.edu	37	10	48429282	48429282	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:48429282G>T	ENST00000224605.2	-	2	869	c.604C>A	c.(604-606)Cag>Aag	p.Q202K		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	202					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						TCCTTGGCCTGCCACAGGCCG	0.721																																							uc001jfb.2		NA																	0				lung(1)|central_nervous_system(1)	2						c.(604-606)CAG>AAG		growth differentiation factor 10 precursor							10.0	15.0	14.0					10																	48429282		2143	4201	6344	SO:0001583	missense	2662				growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity	g.chr10:48429282G>T	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.604C>A	10.37:g.48429282G>T	ENSP00000224605:p.Gln202Lys		Somatic				GDF10_uc009xnp.2_Missense_Mutation_p.Q201K|GDF10_uc009xnq.1_Missense_Mutation_p.Q202K	p.Q202K	NM_004962	NP_004953	WXS	Illumina HiSeq	Unspecified	P55107	BMP3B_HUMAN			2	1060	-			202					Q5VSQ8|Q9UCX6	Missense_Mutation	SNP	ENST00000224605.2	37	c.604C>A	CCDS7220.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011963	0.75046	.	.	ENSG00000107623	ENST00000374247;ENST00000224605	T	0.76968	-1.06	5.44	5.44	0.79542	.	0.110577	0.64402	D	0.000006	D	0.86904	0.6045	M	0.75777	2.31	0.80722	D	1	P;D	0.67145	0.877;0.996	B;P	0.62560	0.411;0.904	D	0.87565	0.2474	10	0.56958	D	0.05	.	18.2483	0.89995	0.0:0.0:1.0:0.0	.	12;202	Q8N6T2;P55107	.;BMP3B_HUMAN	K	12;202	ENSP00000224605:Q202K	ENSP00000224605:Q202K	Q	-	1	0	GDF10	48049288	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.710000	0.98732	2.568000	0.86640	0.555000	0.69702	CAG		0.721	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962		4	23	1	0	0.00024832	0.000248	0.000288344	4	23				
ERCC6	2074	broad.mit.edu	37	10	50732561	50732561	+	Silent	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:50732561T>A	ENST00000355832.5	-	5	993	c.915A>T	c.(913-915)ccA>ccT	p.P305P	ERCC6-PGBD3_ENST00000515869.1_Silent_p.P305P|PGBD3_ENST00000374127.3_5'Flank|ERCC6-PGBD3_ENST00000447839.2_Silent_p.P305P|PGBD3_ENST00000603152.1_Silent_p.P305P	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	305					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GCACTGGGGCTGGAGGCGTGA	0.423								Direct reversal of damage;Nucleotide excision repair (NER)																															uc001jhs.3		NA																	0				lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						c.(913-915)CCA>CCT	Direct_reversal_of_damage|NER	excision repair cross-complementing rodent							198.0	194.0	195.0					10																	50732561		2203	4300	6503	SO:0001819	synonymous_variant	2074				base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding	g.chr10:50732561T>A	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.915A>T	10.37:g.50732561T>A			Somatic				PGBD3_uc001jht.2_5'Flank|PGBD3_uc009xoe.2_Silent_p.P305P|PGBD3_uc001jhu.2_Silent_p.P305P	p.P305P	NM_000124	NP_000115	WXS	Illumina HiSeq	Unspecified	Q03468	ERCC6_HUMAN			5	1069	-			305					D3DX94|Q5W0L9	Silent	SNP	ENST00000355832.5	37	c.915A>T	CCDS7229.1																																																																																				0.423	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124		33	103	0	0	0	0.002836	0	33	103				
SLC18A3	6572	broad.mit.edu	37	10	50820375	50820375	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:50820375C>A	ENST00000374115.3	+	1	2029	c.1589C>A	c.(1588-1590)aCc>aAc	p.T530N	CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000395559.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	530					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						TACTACTACACCCGCAGCTAG	0.667																																							uc001jhw.2		NA																	0				ovary(2)	2						c.(1588-1590)ACC>AAC		vesicular acetylcholine transporter							58.0	67.0	64.0					10																	50820375		2194	4279	6473	SO:0001583	missense	6572				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity	g.chr10:50820375C>A	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.1589C>A	10.37:g.50820375C>A	ENSP00000363229:p.Thr530Asn		Somatic				CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	p.T530N	NM_003055	NP_003046	WXS	Illumina HiSeq	Unspecified	Q16572	VACHT_HUMAN			1	2029	+			530			Cytoplasmic (Potential).		B2R7S1	Missense_Mutation	SNP	ENST00000374115.3	37	c.1589C>A	CCDS7231.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.605160	0.28623	.	.	ENSG00000187714	ENST00000374115	T	0.04406	3.63	3.99	3.99	0.46301	.	0.871425	0.09634	U	0.775939	T	0.02571	0.0078	N	0.08118	0	0.21064	N	0.999796	P	0.39480	0.675	B	0.26864	0.074	T	0.39522	-0.9610	10	0.66056	D	0.02	-13.9254	9.817	0.40858	0.2053:0.7947:0.0:0.0	.	530	Q16572	VACHT_HUMAN	N	530	ENSP00000363229:T530N	ENSP00000363229:T530N	T	+	2	0	SLC18A3	50490381	0.038000	0.19896	1.000000	0.80357	0.285000	0.27093	1.430000	0.34914	2.168000	0.68352	0.555000	0.69702	ACC		0.667	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		13	66	1	0	5.50884e-06	0.001368	6.75993e-06	13	66				
PCDH15	65217	broad.mit.edu	37	10	56287577	56287577	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:56287577C>T	ENST00000320301.6	-	3	546	c.152G>A	c.(151-153)cGg>cAg	p.R51Q	PCDH15_ENST00000395432.2_Missense_Mutation_p.R51Q|PCDH15_ENST00000395430.1_Missense_Mutation_p.R51Q|PCDH15_ENST00000395440.1_Missense_Mutation_p.R51Q|PCDH15_ENST00000361849.3_Missense_Mutation_p.R51Q|PCDH15_ENST00000373965.2_Missense_Mutation_p.R51Q|PCDH15_ENST00000395446.1_Missense_Mutation_p.R51Q|PCDH15_ENST00000395433.1_Intron|PCDH15_ENST00000373955.1_Missense_Mutation_p.R51Q|PCDH15_ENST00000414778.1_Missense_Mutation_p.R56Q|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395442.1_Missense_Mutation_p.R51Q|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395438.1_Missense_Mutation_p.R51Q|PCDH15_ENST00000395445.1_Missense_Mutation_p.R51Q|RP11-257I14.1_ENST00000422842.1_RNA|PCDH15_ENST00000437009.1_Missense_Mutation_p.R51Q	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	51	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTTACCATTCCGACTTTCTTC	0.338										HNSCC(58;0.16)																													uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(151-153)CGG>CAG		protocadherin 15 isoform CD1-4 precursor							90.0	90.0	90.0					10																	56287577		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:56287577C>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.152G>A	10.37:g.56287577C>T	ENSP00000322604:p.Arg51Gln	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Missense_Mutation_p.R56Q|PCDH15_uc010qhr.1_Missense_Mutation_p.R51Q|PCDH15_uc010qhs.1_Missense_Mutation_p.R56Q|PCDH15_uc010qht.1_Missense_Mutation_p.R51Q|PCDH15_uc010qhu.1_Missense_Mutation_p.R51Q|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.R51Q|PCDH15_uc010qhw.1_Missense_Mutation_p.R51Q|PCDH15_uc010qhx.1_Missense_Mutation_p.R51Q|PCDH15_uc010qhy.1_Missense_Mutation_p.R56Q|PCDH15_uc010qhz.1_Missense_Mutation_p.R51Q|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Missense_Mutation_p.R51Q	p.R51Q	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			3	547	-		Melanoma(3;0.117)|Lung SC(717;0.238)	51			Cadherin 1.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.152G>A	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791925	0.50102	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955;ENST00000458638	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56103	0.54;0.58;0.53;0.51;0.51;0.76;0.65;0.48;0.49;0.5;0.5;0.52;0.61;0.88	5.74	3.57	0.40892	.	.	.	.	.	T	0.40570	0.1122	N	0.19112	0.55	0.19945	N	0.999947	P;P;D;P;P;P;P;P;P;P;B;P	0.61080	0.814;0.814;0.989;0.882;0.943;0.688;0.8;0.701;0.8;0.8;0.291;0.814	B;B;P;B;B;B;B;B;B;B;B;B	0.47075	0.138;0.138;0.536;0.138;0.311;0.086;0.102;0.102;0.122;0.155;0.147;0.138	T	0.12041	-1.0563	9	0.40728	T	0.16	.	8.0736	0.30704	0.0:0.696:0.1373:0.1667	.	51;56;51;51;51;51;51;51;51;56;51;51	A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	Q	51;56;51;51;51;51;51;51;51;51;51;51;56;51;51;51	ENSP00000363076:R51Q;ENSP00000410304:R56Q;ENSP00000378826:R51Q;ENSP00000378832:R51Q;ENSP00000378833:R51Q;ENSP00000378829:R51Q;ENSP00000378827:R51Q;ENSP00000378820:R51Q;ENSP00000354950:R51Q;ENSP00000322604:R51Q;ENSP00000378818:R51Q;ENSP00000412628:R51Q;ENSP00000363066:R51Q;ENSP00000394465:R51Q	ENSP00000322604:R51Q	R	-	2	0	PCDH15	55957583	0.994000	0.37717	1.000000	0.80357	0.966000	0.64601	2.675000	0.46875	1.435000	0.47434	0.650000	0.86243	CGG		0.338	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		8	37	0	0	0	0.006214	0	8	37				
CRTAC1	55118	broad.mit.edu	37	10	99771078	99771079	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:99771078_99771079GG>AA	ENST00000370597.3	-	2	395_396	c.40_41CC>TT	c.(40-42)CCg>TTg	p.P14L	CRTAC1_ENST00000298819.4_Missense_Mutation_p.P14L|CRTAC1_ENST00000370591.2_Missense_Mutation_p.P14L	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	14						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CAGCAGGAACGGTAACATCCTG	0.51																																							uc001kou.1		NA																	0				ovary(4)|pancreas(1)	5						c.(40-42)CCG>TTG		cartilage acidic protein 1 precursor																																				SO:0001583	missense	55118					proteinaceous extracellular matrix	calcium ion binding	g.chr10:99771078_99771079GG>AA	AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.40_41delinsAA	10.37:g.99771078_99771079delinsAA	ENSP00000359629:p.Pro14Leu		Somatic				CRTAC1_uc001kov.2_Missense_Mutation_p.P3L	p.P14L	NM_018058	NP_060528	WXS	Illumina HiSeq	Unspecified	Q9NQ79	CRAC1_HUMAN		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)	2	396_397	-		Colorectal(252;0.24)	14					B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	DNP	ENST00000370597.3	37	c.40_41CC>TT	CCDS31266.1																																																																																				0.510	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058		16	92	0	0	0	0.004672	0	16	92				
PKD2L1	9033	broad.mit.edu	37	10	102054719	102054719	+	Silent	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:102054719A>G	ENST00000318222.3	-	8	1900	c.1518T>C	c.(1516-1518)ttT>ttC	p.F506F	PKD2L1_ENST00000338519.3_Silent_p.F431F|PKD2L1_ENST00000353274.3_Silent_p.F506F	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	506					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		TGAAAGTGCTAAAGTTTTCCA	0.542																																							uc001kqx.1		NA																	0				ovary(4)	4						c.(1516-1518)TTT>TTC		polycystic kidney disease 2-like 1							126.0	123.0	124.0					10																	102054719		2203	4300	6503	SO:0001819	synonymous_variant	9033				signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding	g.chr10:102054719A>G	AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.1518T>C	10.37:g.102054719A>G			Somatic				PKD2L1_uc009xwm.1_Silent_p.F459F	p.F506F	NM_016112	NP_057196	WXS	Illumina HiSeq	Unspecified	Q9P0L9	PK2L1_HUMAN		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)	8	1901	-		Colorectal(252;0.117)	506			Extracellular (Potential).		O75972|Q5W039|Q9UP35|Q9UPA2	Silent	SNP	ENST00000318222.3	37	c.1518T>C	CCDS7492.1																																																																																				0.542	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112		12	18	0	0	0	0.000978	0	12	18				
ACSL5	51703	broad.mit.edu	37	10	114181795	114181795	+	Splice_Site	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:114181795T>A	ENST00000393081.1	+	16	1783		c.e16+2		ACSL5_ENST00000354273.4_Splice_Site|ACSL5_ENST00000369410.3_Splice_Site|RP11-324O2.6_ENST00000424422.1_RNA|ACSL5_ENST00000354655.4_Splice_Site|ACSL5_ENST00000433418.1_Splice_Site|ACSL5_ENST00000356116.1_Splice_Site	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5						cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		GAAGGAGAGGTGGGTAGGTCA	0.458																																							uc001kzs.2		NA																	0				large_intestine(2)|skin(1)	3						c.e16+2		acyl-CoA synthetase long-chain family member 5							122.0	118.0	120.0					10																	114181795		2203	4300	6503	SO:0001630	splice_region_variant	51703				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr10:114181795T>A	AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.1476+2T>A	10.37:g.114181795T>A			Somatic				ACSL5_uc001kzt.2_Splice_Site_p.E492_splice|ACSL5_uc001kzu.2_Splice_Site_p.E548_splice|ACSL5_uc009xxz.2_Splice_Site_p.E492_splice|ACSL5_uc010qrj.1_Splice_Site_p.E274_splice	p.E492_splice	NM_203379	NP_976313	WXS	Illumina HiSeq	Unspecified	Q9ULC5	ACSL5_HUMAN		Epithelial(162;0.0343)|all cancers(201;0.137)	16	1617	+		Colorectal(252;0.117)|Breast(234;0.222)						A6GV77|D3DRB3|Q6UX44|Q9UIU4	Splice_Site	SNP	ENST00000393081.1	37	c.1476_splice	CCDS7573.1	.	.	.	.	.	.	.	.	.	.	T	18.29	3.591110	0.66219	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273;ENST00000369410	.	.	.	5.86	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5835	0.45269	0.0:0.0729:0.0:0.9271	.	.	.	.	.	-1	.	.	.	+	.	.	ACSL5	114171785	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	5.653000	0.67967	1.037000	0.40024	0.533000	0.62120	.		0.458	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050386.1	NM_016234	Intron	5	62	0	0	0	0.000602	0	5	62				
MKI67	4288	broad.mit.edu	37	10	129913899	129913899	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:129913899A>T	ENST00000368654.3	-	7	1148	c.773T>A	c.(772-774)cTa>cAa	p.L258Q	MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	258					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				ACAATACTGTAGGACATTTTC	0.378																																							uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(772-774)CTA>CAA		antigen identified by monoclonal antibody Ki-67							75.0	75.0	75.0					10																	129913899		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129913899A>T	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.773T>A	10.37:g.129913899A>T	ENSP00000357643:p.Leu258Gln		Somatic				MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	p.L258Q	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			7	968	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	258					Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.773T>A	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	A	7.765	0.706224	0.15239	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.20738	2.05	2.99	-2.18	0.07037	.	1.225860	0.06290	N	0.699058	T	0.17450	0.0419	N	0.24115	0.695	0.09310	N	1	P	0.48694	0.914	P	0.48488	0.579	T	0.20438	-1.0275	10	0.87932	D	0	.	4.4856	0.11788	0.3156:0.0:0.4925:0.1919	.	258	P46013	KI67_HUMAN	Q	258	ENSP00000357643:L258Q	ENSP00000357643:L258Q	L	-	2	0	MKI67	129803889	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.117000	0.03283	-0.500000	0.06614	-0.274000	0.10170	CTA		0.378	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		6	18	0	0	0	0.001168	0	6	18				
PRAP1	118471	broad.mit.edu	37	10	135165895	135165895	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr10:135165895T>A	ENST00000433452.2	+	5	679	c.407T>A	c.(406-408)gTg>gAg	p.V136E	PRAP1_ENST00000463201.1_3'UTR|PRAP1_ENST00000458230.1_Missense_Mutation_p.V127E|ZNF511_ENST00000368554.4_Missense_Mutation_p.V295E|RP11-122K13.7_ENST00000452591.1_RNA|PRAP1_ENST00000423766.1_Missense_Mutation_p.V137E|FUOM_ENST00000465384.1_5'Flank			Q96NZ9	PRAP1_HUMAN	proline-rich acidic protein 1	136						extracellular region (GO:0005576)				large_intestine(1)|lung(2)	3		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)		AATCACCAGGTGCTCCTGGGA	0.662																																							uc001lmp.2		NA																	0					0						c.(406-408)GTG>GAG		proline-rich acidic protein 1 isoform 1							95.0	93.0	94.0					10																	135165895		2203	4300	6503	SO:0001583	missense	118471					extracellular region		g.chr10:135165895T>A	AF421885	CCDS7679.1	10q26.3	2012-10-01			ENSG00000165828	ENSG00000165828			23304	protein-coding gene	gene with protein product		609776				14583459, 20674898	Standard	NM_001145201		Approved	UPA		Q96NZ9	OTTHUMG00000019312	ENST00000433452.2:c.407T>A	10.37:g.135165895T>A	ENSP00000416126:p.Val136Glu		Somatic				PRAP1_uc001lmr.2_Missense_Mutation_p.V127E|PRAP1_uc001lmq.1_Missense_Mutation_p.V108E	p.V136E	NM_145202	NP_660203	WXS	Illumina HiSeq	Unspecified	Q96NZ9	PRAP1_HUMAN		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)	5	485	+		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	136					B7ZL57|B7ZL58|E9KL31|Q5VWY4|Q7Z4X5|Q8IWR3|Q8NCS2	Missense_Mutation	SNP	ENST00000433452.2	37	c.407T>A	CCDS7679.1	.	.	.	.	.	.	.	.	.	.	T	14.89	2.670624	0.47781	.	.	ENSG00000198546;ENSG00000165828;ENSG00000165828;ENSG00000165828	ENST00000368554;ENST00000433452;ENST00000423766;ENST00000458230	T;T;T;T	0.55234	0.7;0.54;0.54;0.53	3.37	2.21	0.28008	.	0.255167	0.20666	N	0.087934	T	0.47414	0.1444	L	0.52573	1.65	0.21220	N	0.999752	P;P;P	0.50943	0.94;0.94;0.851	P;P;B	0.47015	0.534;0.534;0.415	T	0.40194	-0.9576	10	0.72032	D	0.01	-17.497	5.9721	0.19359	0.2303:0.0:0.0:0.7697	.	127;137;136	A6XND8;Q96NZ9-3;Q96NZ9	.;.;PRAP1_HUMAN	E	295;136;137;127	ENSP00000357542:V295E;ENSP00000416126:V136E;ENSP00000409495:V137E;ENSP00000402700:V127E	ENSP00000409495:V137E	V	+	2	0	ZNF511;PRAP1	135015885	0.002000	0.14202	0.577000	0.28562	0.008000	0.06430	-0.117000	0.10708	0.658000	0.30925	0.523000	0.50628	GTG		0.662	PRAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051132.1	NM_145202		12	66	0	0	0	0.003163	0	12	66				
CHID1	66005	broad.mit.edu	37	11	883186	883186	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:883186C>T	ENST00000449825.1	-	10	1277	c.921G>A	c.(919-921)gcG>gcA	p.A307A	CHID1_ENST00000336845.5_Silent_p.A332A|CHID1_ENST00000454838.2_Silent_p.A332A|CHID1_ENST00000528581.1_Silent_p.A332A|CHID1_ENST00000323578.8_Silent_p.A307A|CHID1_ENST00000429789.2_Silent_p.A276A|CHID1_ENST00000323541.7_Silent_p.A337A|CHID1_ENST00000526714.1_5'UTR|CHID1_ENST00000436108.2_Silent_p.A307A	NM_001142675.1	NP_001136147.1	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1	307					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|innate immune response (GO:0045087)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	chitinase activity (GO:0004568)|oligosaccharide binding (GO:0070492)			endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	13		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		CCTTGGAGGTCGCGTAGTCCA	0.632																																					Pancreas(117;992 2327 5172 41921)	Pancreas(117;992 2327 5172 41921)	uc001lsl.2		NA																	0					0						c.(919-921)GCG>GCA		chitinase domain containing 1 isoform a							115.0	106.0	109.0					11																	883186		2203	4299	6502	SO:0001819	synonymous_variant	66005				chitin catabolic process|innate immune response	extracellular region|lysosome	cation binding|chitinase activity	g.chr11:883186C>T	AK124697	CCDS7722.1, CCDS44510.1, CCDS44511.1	11p15.5	2005-10-27			ENSG00000177830	ENSG00000177830			28474	protein-coding gene	gene with protein product		615692					Standard	NM_023947		Approved	MGC3234, FLJ42707	uc001lsm.3	Q9BWS9	OTTHUMG00000133314	ENST00000449825.1:c.921G>A	11.37:g.883186C>T			Somatic				CHID1_uc010qwu.1_Silent_p.A337A|CHID1_uc010qwv.1_Silent_p.A368A|CHID1_uc001lsn.2_Silent_p.A332A|CHID1_uc001lsm.2_Silent_p.A307A|CHID1_uc001lso.2_Silent_p.A307A|CHID1_uc001lsp.2_Silent_p.A276A|CHID1_uc010qww.1_Silent_p.A307A|uc001lsq.1_5'Flank|uc001lsr.1_5'Flank	p.A307A	NM_023947	NP_076436	WXS	Illumina HiSeq	Unspecified	Q9BWS9	CHID1_HUMAN		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)	10	1082	-		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	307					B3KWB0|Q8NBM9|Q96CZ3|Q96S93|Q96SK0|Q9BY52	Silent	SNP	ENST00000449825.1	37	c.921G>A	CCDS7722.1	.	.	.	.	.	.	.	.	.	.	C	6.856	0.527301	0.13066	.	.	ENSG00000177830	ENST00000529539	.	.	.	4.62	-7.92	0.01160	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.20196	N	0.999923	.	.	.	.	.	.	T	0.21655	-1.0239	4	.	.	.	-1.6172	2.3939	0.04385	0.1568:0.1489:0.1807:0.5135	.	.	.	.	N	22	.	.	D	-	1	0	CHID1	873186	0.000000	0.05858	0.003000	0.11579	0.021000	0.10359	-4.175000	0.00280	-1.524000	0.01764	-0.251000	0.11542	GAC		0.632	CHID1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257112.1	NM_023947		34	104	0	0	0	0.002445	0	34	104				
MUC5AC	4586	broad.mit.edu	37	11	1151661	1151661	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:1151661G>A	ENST00000356191.2	+	1	35	c.35G>A	c.(34-36)tGg>tAg	p.W12*				P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming	12					cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		GCCCTGCTCTGGGCCCTGGCT	0.677																																							uc009ycr.1		NA																	0					0						c.(34-36)TGG>TAG		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							12.0	13.0	12.0					11																	1151661		856	1985	2841	SO:0001587	stop_gained	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1151661G>A	AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000356191.2:c.35G>A	11.37:g.1151661G>A	ENSP00000348519:p.Trp12*		Somatic					p.W12*	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	2	161	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	Error:Variant_position_missing_in_Q9HC84_after_alignment					O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	Nonsense_Mutation	SNP	ENST00000356191.2	37	c.35G>A		.	.	.	.	.	.	.	.	.	.	G	16.75	3.209735	0.58343	.	.	ENSG00000215182	ENST00000534821;ENST00000356191	.	.	.	3.01	3.01	0.34805	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.6186	0.39708	0.0:0.0:1.0:0.0	.	.	.	.	X	12	.	ENSP00000348519:W12X	W	+	2	0	MUC5AC	1141661	1.000000	0.71417	0.992000	0.48379	0.101000	0.19017	3.375000	0.52410	1.682000	0.51000	0.443000	0.29094	TGG		0.677	MUC5AC-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_001130382		3	6	0	0	0	0.000248	0	3	6				
ZNF195	7748	broad.mit.edu	37	11	3381280	3381280	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:3381280T>A	ENST00000399602.4	-	6	1084	c.958A>T	c.(958-960)Att>Ttt	p.I320F	ZNF195_ENST00000005082.9_Missense_Mutation_p.I297F|ZNF195_ENST00000429541.2_Missense_Mutation_p.I252F|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000438262.2_3'UTR|ZNF195_ENST00000354599.6_Missense_Mutation_p.I248F|ZNF195_ENST00000526601.1_Missense_Mutation_p.I301F|ZNF195_ENST00000343338.7_Missense_Mutation_p.I252F	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	320					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		CCGGCATAAATTCTATTTTTA	0.393																																							uc001lxt.2		NA																	0					0						c.(958-960)ATT>TTT		zinc finger protein 195 isoform 1							101.0	96.0	98.0					11																	3381280		1874	4120	5994	SO:0001583	missense	7748				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:3381280T>A		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.958A>T	11.37:g.3381280T>A	ENSP00000382511:p.Ile320Phe		Somatic				uc001lxr.2_5'Flank|ZNF195_uc001lxv.2_Missense_Mutation_p.I297F|ZNF195_uc001lxs.2_Missense_Mutation_p.I248F|ZNF195_uc010qxr.1_Missense_Mutation_p.I301F|ZNF195_uc009ydz.2_Missense_Mutation_p.I275F|ZNF195_uc001lxu.2_Missense_Mutation_p.I252F	p.I320F	NM_001130520	NP_001123992	WXS	Illumina HiSeq	Unspecified	O14628	ZN195_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)	6	1136	-		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)	320					A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Missense_Mutation	SNP	ENST00000399602.4	37	c.958A>T	CCDS44522.1	.	.	.	.	.	.	.	.	.	.	t	8.342	0.828893	0.16749	.	.	ENSG00000005801	ENST00000354599;ENST00000399602;ENST00000343338;ENST00000429541;ENST00000005082;ENST00000526601;ENST00000528410	T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;3.67	0.501	-0.687	0.11320	.	.	.	.	.	T	0.70360	0.3215	M	0.85710	2.77	0.24140	N	0.99574	P;D;B;B;B;B	0.54964	0.597;0.969;0.009;0.002;0.006;0.002	P;B;B;B;B;B	0.55345	0.774;0.267;0.009;0.001;0.004;0.001	T	0.60480	-0.7255	9	0.72032	D	0.01	.	3.8685	0.09027	0.0:0.301:0.0:0.699	.	301;179;297;252;320;248	O14628-6;Q59EZ7;O14628-5;O14628-7;O14628;O14628-4	.;.;.;.;ZN195_HUMAN;.	F	248;320;252;252;297;301;275	ENSP00000346613:I248F;ENSP00000382511:I320F;ENSP00000344483:I252F;ENSP00000387998:I252F;ENSP00000005082:I297F;ENSP00000435828:I301F;ENSP00000431937:I275F	ENSP00000005082:I297F	I	-	1	0	ZNF195	3337856	0.002000	0.14202	0.004000	0.12327	0.116000	0.19942	0.624000	0.24462	-0.374000	0.07967	0.254000	0.18369	ATT		0.393	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2			19	105	0	0	0	0.006122	0	19	105				
CHRNA10	57053	broad.mit.edu	37	11	3687438	3687438	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:3687438C>A	ENST00000250699.2	-	5	1323	c.1252G>T	c.(1252-1254)Gac>Tac	p.D418Y	CHRNA10_ENST00000493827.2_5'Flank|CHRNA10_ENST00000534359.1_3'UTR|Y_RNA_ENST00000363331.1_RNA|Y_RNA_ENST00000364409.1_RNA	NM_020402.2	NP_065135.2	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10 (neuronal)	418					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell proliferation (GO:0042127)|synaptic transmission, cholinergic (GO:0007271)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perikaryon (GO:0043204)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(3)|ovary(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Galantamine(DB00674)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Succinylcholine(DB00202)|Trimethaphan(DB01116)	CGCTTCCAGTCCTCATGGCAG	0.637																																					Melanoma(153;17 1869 2949 7120 36888)	Melanoma(153;17 1869 2949 7120 36888)	uc001lyf.2		NA																	0				ovary(1)	1						c.(1252-1254)GAC>TAC		cholinergic receptor, nicotinic, alpha 10	Chloroprocaine(DB01161)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Procaine(DB00721)|Trimethaphan(DB01116)						67.0	68.0	68.0					11																	3687438		2201	4298	6499	SO:0001583	missense	57053				elevation of cytosolic calcium ion concentration|regulation of cell proliferation|synaptic transmission, cholinergic	cell junction|postsynaptic membrane	calcium channel activity|receptor activity|receptor binding	g.chr11:3687438C>A	AF199235	CCDS7745.1	11p15.5	2012-02-11	2012-02-07		ENSG00000129749	ENSG00000129749		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	13800	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 10 (neuronal)"""	606372	"""cholinergic receptor, nicotinic, alpha polypeptide 10"""				Standard	NM_020402		Approved		uc001lyf.3	Q9GZZ6	OTTHUMG00000011844	ENST00000250699.2:c.1252G>T	11.37:g.3687438C>A	ENSP00000250699:p.Asp418Tyr		Somatic				CHRNA10_uc010qxt.1_Missense_Mutation_p.D212Y|CHRNA10_uc010qxu.1_Missense_Mutation_p.D212Y	p.D418Y	NM_020402	NP_065135	WXS	Illumina HiSeq	Unspecified	Q9GZZ6	ACH10_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	5	1324	-		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)	418			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000250699.2	37	c.1252G>T	CCDS7745.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.786331	0.90367	.	.	ENSG00000129749	ENST00000250699	T	0.73681	-0.77	5.76	5.76	0.90799	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.093854	0.46758	D	0.000266	D	0.87192	0.6116	M	0.87971	2.92	0.80722	D	1	D	0.64830	0.994	P	0.60682	0.878	D	0.88917	0.3363	10	0.87932	D	0	.	18.5213	0.90954	0.0:1.0:0.0:0.0	.	418	Q9GZZ6	ACH10_HUMAN	Y	418	ENSP00000250699:D418Y	ENSP00000250699:D418Y	D	-	1	0	CHRNA10	3644014	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.757000	0.85209	2.715000	0.92844	0.561000	0.74099	GAC		0.637	CHRNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032763.2			15	78	1	0	3.45872e-05	0.004007	4.15294e-05	15	78				
TRIM68	55128	broad.mit.edu	37	11	4621864	4621864	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:4621864C>T	ENST00000300747.5	-	7	1389	c.1100G>A	c.(1099-1101)aGg>aAg	p.R367K		NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68	367	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCACTCAGACCTGTCTCCCAC	0.537																																							uc001lzf.1		NA																	0				ovary(1)	1						c.(1099-1101)AGG>AAG		ring finger protein 137							51.0	53.0	52.0					11																	4621864		2201	4298	6499	SO:0001583	missense	55128				protein autoubiquitination|regulation of androgen receptor signaling pathway	Golgi apparatus|nucleolus|perinuclear region of cytoplasm	androgen receptor binding|histone acetyltransferase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:4621864C>T	AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1		ENST00000300747.5:c.1100G>A	11.37:g.4621864C>T	ENSP00000300747:p.Arg367Lys		Somatic				TRIM68_uc001lzg.1_Missense_Mutation_p.R144K|TRIM68_uc010qyj.1_RNA	p.R367K	NM_018073	NP_060543	WXS	Illumina HiSeq	Unspecified	Q6AZZ1	TRI68_HUMAN		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)	7	1338	-		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)	367			B30.2/SPRY.		A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Missense_Mutation	SNP	ENST00000300747.5	37	c.1100G>A	CCDS31356.1	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918343	0.33908	.	.	ENSG00000167333	ENST00000300747;ENST00000544055	T	0.58797	0.31	5.52	3.63	0.41609	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.237482	0.27881	N	0.017466	T	0.21841	0.0526	N	0.01048	-1.04	0.09310	N	1	B	0.20988	0.05	B	0.10450	0.005	T	0.28364	-1.0046	10	0.02654	T	1	.	10.5175	0.44898	0.0:0.8398:0.0:0.1602	.	367	Q6AZZ1	TRI68_HUMAN	K	367;88	ENSP00000300747:R367K	ENSP00000300747:R367K	R	-	2	0	TRIM68	4578440	0.956000	0.32656	0.526000	0.27913	0.923000	0.55619	1.586000	0.36611	0.800000	0.34041	0.561000	0.74099	AGG		0.537	TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	NM_018073		9	43	0	0	0	0.006214	0	9	43				
CCKBR	887	broad.mit.edu	37	11	6292657	6292657	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:6292657C>A	ENST00000334619.2	+	5	1421	c.1228C>A	c.(1228-1230)Ccc>Acc	p.P410T	CCKBR_ENST00000532715.1_Missense_Mutation_p.P326T|CCKBR_ENST00000525462.1_Missense_Mutation_p.P479T	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	410					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TCGCTGCTGCCCCCGGCCTCC	0.642																																							uc001mcp.2		NA																	0				lung(5)|ovary(2)|breast(1)	8						c.(1228-1230)CCC>ACC		cholecystokinin B receptor	Pentagastrin(DB00183)						60.0	56.0	57.0					11																	6292657		2201	4296	6497	SO:0001583	missense	887				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding	g.chr11:6292657C>A	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.1228C>A	11.37:g.6292657C>A	ENSP00000335544:p.Pro410Thr		Somatic				CCKBR_uc001mcq.2_Missense_Mutation_p.P338T|CCKBR_uc001mcr.2_Missense_Mutation_p.P393T|CCKBR_uc001mcs.2_Missense_Mutation_p.P479T	p.P410T	NM_176875	NP_795344	WXS	Illumina HiSeq	Unspecified	P32239	GASR_HUMAN		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	5	1421	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	410			Cytoplasmic (Potential).		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	c.1228C>A	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.513347	0.44660	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.36878	1.23;1.23;1.23	5.24	3.34	0.38264	.	0.314932	0.30252	N	0.010056	T	0.38480	0.1042	L	0.29908	0.895	0.31967	N	0.607683	B;P;P	0.51351	0.355;0.944;0.629	B;P;B	0.59357	0.234;0.856;0.283	T	0.38200	-0.9672	10	0.21540	T	0.41	.	9.5631	0.39383	0.0:0.7774:0.1434:0.0792	.	479;344;410	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	T	410;326;479	ENSP00000335544:P410T;ENSP00000432079:P326T;ENSP00000435534:P479T	ENSP00000335544:P410T	P	+	1	0	CCKBR	6249233	0.001000	0.12720	0.951000	0.38953	0.796000	0.44982	0.960000	0.29253	0.564000	0.29238	0.557000	0.71058	CCC		0.642	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875		12	74	1	0	1.08611e-07	0.000978	1.42406e-07	12	74				
OR2D2	120776	broad.mit.edu	37	11	6913062	6913062	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:6913062T>A	ENST00000299459.2	-	1	768	c.670A>T	c.(670-672)Act>Tct	p.T224S		NM_003700.1	NP_003691.1	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D, member 2	224					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	18		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTGACCACAGTTACTATGATA	0.438																																							uc010rau.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(670-672)ACT>TCT		olfactory receptor, family 2, subfamily D,							86.0	81.0	82.0					11																	6913062		2201	4296	6497	SO:0001583	missense	120776				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6913062T>A	AB065824	CCDS31416.1	11p15.4	2012-08-09			ENSG00000166368	ENSG00000166368		"""GPCR / Class A : Olfactory receptors"""	8244	protein-coding gene	gene with protein product		608494		OR2D1		9787077	Standard	NM_003700		Approved	OR11-610, hg27	uc010rau.2	Q9H210	OTTHUMG00000165741	ENST00000299459.2:c.670A>T	11.37:g.6913062T>A	ENSP00000299459:p.Thr224Ser		Somatic					p.T224S	NM_003700	NP_003691	WXS	Illumina HiSeq	Unspecified	Q9H210	OR2D2_HUMAN		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	670	-		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	224			Cytoplasmic (Potential).		B9EIL5|O95224|Q6IF28|Q8NGH4|Q96R52	Missense_Mutation	SNP	ENST00000299459.2	37	c.670A>T	CCDS31416.1	.	.	.	.	.	.	.	.	.	.	t	10.03	1.238014	0.22711	.	.	ENSG00000166368	ENST00000299459	T	0.00145	8.67	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000105	T	0.00178	0.0005	L	0.46819	1.47	0.24433	N	0.994569	B	0.26363	0.147	B	0.28991	0.097	T	0.43343	-0.9397	10	0.49607	T	0.09	-12.6633	13.2131	0.59836	0.0:0.0:0.0:1.0	.	224	Q9H210	OR2D2_HUMAN	S	224	ENSP00000299459:T224S	ENSP00000299459:T224S	T	-	1	0	OR2D2	6869638	0.008000	0.16893	0.982000	0.44146	0.066000	0.16364	0.613000	0.24299	2.287000	0.76781	0.520000	0.50463	ACT		0.438	OR2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385986.1	NM_003700		18	26	0	0	0	0.007413	0	18	26				
UEVLD	55293	broad.mit.edu	37	11	18591865	18591865	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:18591865G>A	ENST00000396197.3	-	4	281	c.253C>T	c.(253-255)Cct>Tct	p.P85S	UEVLD_ENST00000541984.1_Intron|UEVLD_ENST00000543987.1_Missense_Mutation_p.P85S|UEVLD_ENST00000320750.6_Missense_Mutation_p.P63S|UEVLD_ENST00000379387.4_Missense_Mutation_p.P63S|UEVLD_ENST00000300038.7_Missense_Mutation_p.P85S|UEVLD_ENST00000540666.1_Intron|UEVLD_ENST00000535484.1_Missense_Mutation_p.P47S	NM_001040697.2|NM_001261384.1	NP_001035787.1|NP_001248313.1			UEV and lactate/malate dehyrogenase domains											endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						AAGCAAATAGGGGGAGCGAAA	0.368																																							uc001mot.2		NA																	0					0						c.(253-255)CCT>TCT		ubiquitin-conjugating enzyme E2-like isoform a							92.0	92.0	92.0					11																	18591865		2199	4293	6492	SO:0001583	missense	55293				cellular carbohydrate metabolic process|protein modification process|protein transport		binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor	g.chr11:18591865G>A	AF503350	CCDS7843.1, CCDS41624.1, CCDS58122.1, CCDS58123.1, CCDS58124.1, CCDS58125.1, CCDS73266.1	11p15.1	2006-07-14			ENSG00000151116	ENSG00000151116			30866	protein-coding gene	gene with protein product		610985				12427560	Standard	NM_001040697		Approved	Attp, UEV3	uc001mot.4	Q8IX04	OTTHUMG00000167729	ENST00000396197.3:c.253C>T	11.37:g.18591865G>A	ENSP00000379500:p.Pro85Ser		Somatic				UEVLD_uc001mou.2_Missense_Mutation_p.P85S|UEVLD_uc010rde.1_Intron|UEVLD_uc010rdf.1_Missense_Mutation_p.P63S|UEVLD_uc010rdg.1_Intron|UEVLD_uc001mov.2_Missense_Mutation_p.P63S|UEVLD_uc010rdh.1_Missense_Mutation_p.P85S	p.P85S	NM_001040697	NP_001035787	WXS	Illumina HiSeq	Unspecified	Q8IX04	UEVLD_HUMAN			4	333	-			85			UEV.			Missense_Mutation	SNP	ENST00000396197.3	37	c.253C>T	CCDS41624.1	.	.	.	.	.	.	.	.	.	.	G	35	5.429829	0.96131	.	.	ENSG00000151116	ENST00000543987;ENST00000535484;ENST00000396197;ENST00000320750;ENST00000379387;ENST00000300038	D;D;D;D;D	0.98633	-5.04;-4.73;-3.83;-4.7;-3.54	6.07	6.07	0.98685	Ubiquitin E2 variant, N-terminal (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	D	0.99324	0.9763	M	0.88512	2.96	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0	D	0.99271	1.0893	10	0.87932	D	0	-11.0143	20.6593	0.99626	0.0:0.0:1.0:0.0	.	85;63;63;85;85	Q8IX04-5;B4DL43;Q8IX04-3;Q8IX04-2;Q8IX04	.;.;.;.;UEVLD_HUMAN	S	85;47;85;63;63;85	ENSP00000442974:P85S;ENSP00000441092:P47S;ENSP00000379500:P85S;ENSP00000323353:P63S;ENSP00000368697:P63S	ENSP00000300038:P85S	P	-	1	0	UEVLD	18548441	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.655000	0.98512	2.885000	0.99019	0.655000	0.94253	CCT		0.368	UEVLD-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395923.2	NM_018314		8	26	0	0	0	0.004482	0	8	26				
DCDC1	341019	broad.mit.edu	37	11	31086701	31086701	+	Splice_Site	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:31086701C>A	ENST00000597505.1	-	17	2298		c.e17-1		DCDC1_ENST00000437348.1_Splice_Site			P59894	DCDC1_HUMAN	doublecortin domain containing 1						intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GAGGATAAGCCTGTAAGAAAG	0.393																																							uc009yjk.1		NA																	0					NA						c.e7-1		RecName: Full=Doublecortin domain-containing protein 5;							84.0	76.0	79.0					11																	31086701		1873	4109	5982	SO:0001630	splice_region_variant	0							g.chr11:31086701C>A	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2299-1G>T	11.37:g.31086701C>A			Somatic				uc009yjl.1_Splice_Site_p.A143_splice|DCDC1_uc001msu.1_Splice_Site_p.A386_splice	p.A215_splice			WXS	Illumina HiSeq	Unspecified					7	712	-								A6PVL6|B7WNX6|Q6ZU04	Splice_Site	SNP	ENST00000597505.1	37	c.643_splice																																																																																					0.393	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807	Intron	13	28	1	0	0.00185496	0.001855	0.00209936	13	28				
ABTB2	25841	broad.mit.edu	37	11	34218979	34218979	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:34218979C>A	ENST00000435224.2	-	3	1561	c.1137G>T	c.(1135-1137)tgG>tgT	p.W379C	ABTB2_ENST00000298992.2_Missense_Mutation_p.W193C|ABTB2_ENST00000530814.1_5'UTR	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	379					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				CGTCGGGGGACCAAGTGATGG	0.662																																							uc001mvl.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(577-579)TGG>TGT		ankyrin repeat and BTB (POZ) domain containing							35.0	36.0	36.0					11																	34218979		2202	4298	6500	SO:0001583	missense	25841						DNA binding	g.chr11:34218979C>A	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.1137G>T	11.37:g.34218979C>A	ENSP00000410157:p.Trp379Cys		Somatic					p.W193C	NM_145804	NP_665803	WXS	Illumina HiSeq	Unspecified	Q8N961	ABTB2_HUMAN			3	809	-		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)	193					A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	ENST00000435224.2	37	c.579G>T	CCDS7890.2	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815978	0.90790	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.52983	0.64;0.64	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.67439	0.2893	M	0.69358	2.11	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	T	0.69665	-0.5084	10	0.87932	D	0	-18.2074	19.6195	0.95650	0.0:1.0:0.0:0.0	.	193	Q8N961	ABTB2_HUMAN	C	379;193	ENSP00000410157:W379C;ENSP00000298992:W193C	ENSP00000298992:W193C	W	-	3	0	ABTB2	34175555	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.818000	0.86416	2.633000	0.89246	0.561000	0.74099	TGG		0.662	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388703.3	NM_145804		8	39	1	0	0.00307968	0.00308	0.00347371	8	39				
CHST1	8534	broad.mit.edu	37	11	45672284	45672284	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:45672284G>T	ENST00000308064.2	-	4	860	c.190C>A	c.(190-192)Ctc>Atc	p.L64I	CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	64					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GCCAGGATGAGGATGTGGGTC	0.647																																							uc001mys.1		NA																	0				skin(4)|pancreas(1)	5						c.(190-192)CTC>ATC		carbohydrate (keratan sulfate Gal-6)							84.0	81.0	82.0					11																	45672284		2203	4299	6502	SO:0001583	missense	8534				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity	g.chr11:45672284G>T	U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.190C>A	11.37:g.45672284G>T	ENSP00000309270:p.Leu64Ile		Somatic					p.L64I	NM_003654	NP_003645	WXS	Illumina HiSeq	Unspecified	O43916	CHST1_HUMAN		GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)	4	861	-			64			Lumenal (Potential).		D3DQP2	Missense_Mutation	SNP	ENST00000308064.2	37	c.190C>A	CCDS7913.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493538	0.44352	.	.	ENSG00000175264	ENST00000308064	T	0.80824	-1.42	4.86	4.86	0.63082	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.78426	0.4281	L	0.53249	1.67	0.58432	D	0.99999	B	0.31769	0.339	B	0.38296	0.27	T	0.76429	-0.2962	10	0.35671	T	0.21	-18.8533	12.451	0.55677	0.0812:0.0:0.9188:0.0	.	64	O43916	CHST1_HUMAN	I	64	ENSP00000309270:L64I	ENSP00000309270:L64I	L	-	1	0	CHST1	45628860	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	6.784000	0.75084	2.253000	0.74438	0.462000	0.41574	CTC		0.647	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390127.1	NM_003654		15	63	1	0	0.00316338	0.003163	0.00356212	15	63				
CRY2	1408	broad.mit.edu	37	11	45880390	45880390	+	Missense_Mutation	SNP	A	A	T	rs145426016		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:45880390A>T	ENST00000443527.2	+	3	518	c.496A>T	c.(496-498)Acg>Tcg	p.T166S	CRY2_ENST00000417225.2_Missense_Mutation_p.T84S|CRY2_ENST00000473199.1_3'UTR	NM_021117.3	NP_066940.2	Q49AN0	CRY2_HUMAN	cryptochrome circadian clock 2	145					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|glucose homeostasis (GO:0042593)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of sodium-dependent phosphate transport (GO:2000118)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|FAD binding (GO:0071949)|phosphatase binding (GO:0019902)|single-stranded DNA binding (GO:0003697)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(2)	15						GGAAGTAGTGACGGAGAATTC	0.507																																					Esophageal Squamous(106;91 1499 8126 12599 39610)	Esophageal Squamous(106;91 1499 8126 12599 39610)	uc010rgn.1		NA																	0				central_nervous_system(1)	1						c.(496-498)ACG>TCG		cryptochrome 2 (photolyase-like) isoform 1							129.0	114.0	119.0					11																	45880390		2203	4299	6502	SO:0001583	missense	1408				DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	blue light photoreceptor activity|damaged DNA binding|DNA photolyase activity|nucleotide binding|protein binding|single-stranded DNA binding	g.chr11:45880390A>T	AB014558	CCDS7915.2, CCDS44576.1	11p11.2	2014-01-17	2014-01-17		ENSG00000121671	ENSG00000121671			2385	protein-coding gene	gene with protein product		603732	"""cryptochrome 2 (photolyase-like)"""			8909283	Standard	NM_021117		Approved		uc010rgn.2	Q49AN0	OTTHUMG00000153225	ENST00000443527.2:c.496A>T	11.37:g.45880390A>T	ENSP00000406751:p.Thr166Ser		Somatic				CRY2_uc009ykw.2_Missense_Mutation_p.T84S	p.T166S	NM_021117	NP_066940	WXS	Illumina HiSeq	Unspecified	Q49AN0	CRY2_HUMAN			3	518	+			145			DNA photolyase.		B4DH32|B4DZD6|O75148|Q8IV71	Missense_Mutation	SNP	ENST00000443527.2	37	c.496A>T	CCDS7915.2	.	.	.	.	.	.	.	.	.	.	A	9.230	1.035488	0.19590	.	.	ENSG00000121671	ENST00000417225;ENST00000443527	.	.	.	5.71	5.71	0.89125	.	0.119826	0.56097	D	0.000022	T	0.18173	0.0436	N	0.01817	-0.705	0.36371	D	0.861333	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.25572	-1.0128	9	0.02654	T	1	-19.2743	10.3538	0.43952	0.9273:0.0:0.0727:0.0	.	166;84	B4DZD6;Q49AN0-2	.;.	S	84;166	.	ENSP00000397419:T84S	T	+	1	0	CRY2	45836966	0.999000	0.42202	0.996000	0.52242	0.576000	0.36127	3.815000	0.55651	2.171000	0.68590	0.528000	0.53228	ACG		0.507	CRY2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330235.2	NM_021117		9	33	0	0	0	0.001368	0	9	33				
MAPK8IP1	9479	broad.mit.edu	37	11	45925561	45925561	+	Silent	SNP	C	C	T	rs144563506	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:45925561C>T	ENST00000241014.2	+	7	1685	c.1515C>T	c.(1513-1515)gaC>gaT	p.D505D	RP11-618K13.2_ENST00000533218.1_RNA|MAPK8IP1_ENST00000395629.2_Silent_p.D495D	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	505	Interaction with VRK2.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GACACGAAGACGAACTTGAGC	0.592													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		20736	0.0		0.0	False		,,,				2504	0.0						uc001nbr.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1513-1515)GAC>GAT		mitogen-activated protein kinase 8 interacting		C		13,4393	20.2+/-43.8	0,13,2190	127.0	116.0	120.0		1515	-8.7	0.5	11	dbSNP_134	120	0,8598		0,0,4299	no	coding-synonymous	MAPK8IP1	NM_005456.3		0,13,6489	TT,TC,CC		0.0,0.2951,0.1		505/712	45925561	13,12991	2203	4299	6502	SO:0001819	synonymous_variant	9479				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity	g.chr11:45925561C>T		CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1515C>T	11.37:g.45925561C>T			Somatic					p.D505D	NM_005456	NP_005447	WXS	Illumina HiSeq	Unspecified	Q9UQF2	JIP1_HUMAN		GBM - Glioblastoma multiforme(35;0.231)	7	1685	+			505			SH3.		D3DQP4|O43407	Silent	SNP	ENST00000241014.2	37	c.1515C>T	CCDS7916.1																																																																																				0.592	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456		20	95	0	0	0	0.008871	0	20	95				
AMBRA1	55626	broad.mit.edu	37	11	46430094	46430094	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:46430094C>A	ENST00000458649.2	-	17	3790	c.3372G>T	c.(3370-3372)gaG>gaT	p.E1124D	AMBRA1_ENST00000534300.1_Missense_Mutation_p.E1064D|AMBRA1_ENST00000314845.3_Missense_Mutation_p.E1034D|AMBRA1_ENST00000533727.1_Missense_Mutation_p.E1005D|AMBRA1_ENST00000528950.1_Missense_Mutation_p.E1095D|AMBRA1_ENST00000298834.3_Missense_Mutation_p.E1064D|AMBRA1_ENST00000426438.1_Missense_Mutation_p.E1095D			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1124					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CTGTCCCTGGCTCCGGCACCT	0.637																																							uc010rgu.1		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(3370-3372)GAG>GAT		activating molecule in beclin-1-regulated							51.0	47.0	48.0					11																	46430094		2202	4299	6501	SO:0001583	missense	55626				autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle		g.chr11:46430094C>A	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3372G>T	11.37:g.46430094C>A	ENSP00000415327:p.Glu1124Asp		Somatic				AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Missense_Mutation_p.E1095D|AMBRA1_uc001ncu.1_Missense_Mutation_p.E1034D|AMBRA1_uc001ncv.2_Missense_Mutation_p.E1127D|AMBRA1_uc001ncw.2_Missense_Mutation_p.E1005D|AMBRA1_uc001ncx.2_Missense_Mutation_p.E1064D	p.E1124D	NM_017749	NP_060219	WXS	Illumina HiSeq	Unspecified	Q9C0C7	AMRA1_HUMAN		GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)	17	3732	-			1124					A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	37	c.3372G>T		.	.	.	.	.	.	.	.	.	.	C	19.13	3.768497	0.69878	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000526545;ENST00000528950	T;T;T;T;T;T;T	0.72615	-0.51;-0.67;-0.25;-0.39;-0.25;-0.38;-0.39	5.44	3.55	0.40652	.	0.057204	0.64402	D	0.000002	T	0.71221	0.3314	N	0.24115	0.695	0.40511	D	0.980737	B;D;D;D;D;D	0.67145	0.014;0.99;0.99;0.99;0.996;0.99	B;D;D;D;D;D	0.76071	0.007;0.98;0.98;0.98;0.987;0.98	T	0.70234	-0.4928	10	0.45353	T	0.12	.	9.6154	0.39687	0.0:0.7724:0.0:0.2276	.	1124;1095;1064;1005;1127;1034	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	D	1034;1005;1064;1095;1064;1124;82;1095	ENSP00000318313:E1034D;ENSP00000433372:E1005D;ENSP00000431926:E1064D;ENSP00000410899:E1095D;ENSP00000298834:E1064D;ENSP00000415327:E1124D;ENSP00000433945:E1095D	ENSP00000298834:E1064D	E	-	3	2	AMBRA1	46386670	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	0.874000	0.28065	0.655000	0.30866	0.491000	0.48974	GAG		0.637	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749		19	24	1	0	1.55795e-14	0.001882	2.45029e-14	19	24				
CKAP5	9793	broad.mit.edu	37	11	46839864	46839864	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:46839864C>A	ENST00000529230.1	-	3	294	c.248G>T	c.(247-249)gGa>gTa	p.G83V	CKAP5_ENST00000354558.3_Missense_Mutation_p.G83V|CKAP5_ENST00000415402.1_Missense_Mutation_p.G83V|CKAP5_ENST00000312055.5_Missense_Mutation_p.G83V			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	83					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TACTTACTTTCCTGCTACATG	0.338																																					Ovarian(4;85 273 2202 4844 13323)	Ovarian(4;85 273 2202 4844 13323)	uc001ndi.1		NA																	0				ovary(1)|skin(1)	2						c.(247-249)GGA>GTA		colonic and hepatic tumor over-expressed protein							62.0	62.0	62.0					11																	46839864		2201	4299	6500	SO:0001583	missense	9793				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding	g.chr11:46839864C>A		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.248G>T	11.37:g.46839864C>A	ENSP00000432768:p.Gly83Val		Somatic				CKAP5_uc009ylg.1_5'UTR|CKAP5_uc001ndj.1_Missense_Mutation_p.G83V	p.G83V	NM_001008938	NP_001008938	WXS	Illumina HiSeq	Unspecified	Q14008	CKAP5_HUMAN			3	358	-			83					Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	c.248G>T	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	C	19.47	3.834586	0.71373	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000378629;ENST00000354558;ENST00000526496	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	5.03	5.03	0.67393	Armadillo-like helical (1);Armadillo-type fold (1);	0.151495	0.64402	D	0.000017	T	0.61974	0.2390	M	0.68952	2.095	0.80722	D	1	D;D	0.58970	0.959;0.984	P;P	0.56343	0.563;0.796	T	0.60005	-0.7347	10	0.30854	T	0.27	.	18.3553	0.90355	0.0:1.0:0.0:0.0	.	83;83	Q14008-2;Q14008	.;CKAP5_HUMAN	V	83	ENSP00000432768:G83V;ENSP00000395302:G83V;ENSP00000310227:G83V;ENSP00000346566:G83V;ENSP00000436769:G83V	ENSP00000310227:G83V	G	-	2	0	CKAP5	46796440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.205000	0.51090	2.344000	0.79699	0.655000	0.94253	GGA		0.338	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756		9	69	1	0	0.00448238	0.004482	0.00503048	9	69				
SPI1	6688	broad.mit.edu	37	11	47381421	47381421	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:47381421G>A	ENST00000378538.3	-	3	535	c.313C>T	c.(313-315)Ccc>Tcc	p.P105S	SPI1_ENST00000227163.4_Missense_Mutation_p.P106S|SPI1_ENST00000533968.1_Missense_Mutation_p.P105S|SPI1_ENST00000533030.1_Intron	NM_001080547.1|NM_003120.2	NP_001074016.1|NP_003111.2	P17947	SPI1_HUMAN	Spi-1 proto-oncogene	105					anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|histone H3 acetylation (GO:0043966)|hypermethylation of CpG island (GO:0044027)|lymphocyte differentiation (GO:0030098)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of erythrocyte differentiation (GO:0045646)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somatic stem cell maintenance (GO:0035019)	nuclear chromatin (GO:0000790)	core promoter binding (GO:0001047)|NFAT protein binding (GO:0051525)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(4)|ovary(1)	8				Lung(87;0.0967)		CCAAGACTGGGATGGGGTGGC	0.677																																							uc001nfc.1		NA																	0				lung(1)|central_nervous_system(1)	2						c.(313-315)CCC>TCC		hematopoietic transcription factor PU.1 isoform							65.0	58.0	60.0					11																	47381421		2201	4298	6499	SO:0001583	missense	6688				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of erythrocyte differentiation	nucleus	protein binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:47381421G>A	X52056	CCDS7933.2, CCDS44591.1	11p12-p11.22	2014-06-25	2014-06-25		ENSG00000066336	ENSG00000066336			11241	protein-coding gene	gene with protein product	"""hematopoietic transcription factor PU.1"", ""31 kDa transforming protein"""	165170	"""spleen focus forming virus (SFFV) proviral integration oncogene"""			1693183	Standard	NM_003120		Approved	PU.1, SPI-A, OF, SFPI1, SPI-1	uc001nfb.1	P17947	OTTHUMG00000150150	ENST00000378538.3:c.313C>T	11.37:g.47381421G>A	ENSP00000367799:p.Pro105Ser		Somatic				SPI1_uc001nfb.1_Missense_Mutation_p.P106S|SLC39A13_uc001nfd.2_Intron|SPI1_uc009ylp.1_Missense_Mutation_p.P99S	p.P105S	NM_003120	NP_003111	WXS	Illumina HiSeq	Unspecified	P17947	SPI1_HUMAN		Lung(87;0.0967)	3	536	-			105						Missense_Mutation	SNP	ENST00000378538.3	37	c.313C>T	CCDS7933.2	.	.	.	.	.	.	.	.	.	.	G	3.075	-0.190268	0.06299	.	.	ENSG00000066336	ENST00000378538;ENST00000227163;ENST00000533968	T;T;T	0.34472	1.36;1.36;1.36	4.41	-1.31	0.09230	.	1.414250	0.04348	N	0.355211	T	0.16128	0.0388	N	0.04959	-0.14	0.09310	N	1	B;B;B	0.12630	0.006;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.17899	-1.0354	10	0.10902	T	0.67	-3.3309	6.144	0.20275	0.0:0.2066:0.3716:0.4218	.	105;105;106	F5H3K6;P17947;P17947-2	.;SPI1_HUMAN;.	S	105;106;105	ENSP00000367799:P105S;ENSP00000227163:P106S;ENSP00000438846:P105S	ENSP00000227163:P106S	P	-	1	0	SPI1	47337997	0.188000	0.23250	0.001000	0.08648	0.443000	0.32047	-0.348000	0.07740	-0.338000	0.08413	-0.153000	0.13522	CCC		0.677	SPI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316571.1	NM_003120		22	40	0	0	0	0.004656	0	22	40				
OR4A47	403253	broad.mit.edu	37	11	48510913	48510913	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:48510913C>A	ENST00000446524.1	+	1	645	c.569C>A	c.(568-570)aCc>aAc	p.T190N		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TGCACTGACACCCATGCTATT	0.438																																							uc010rhx.1		NA																	0				ovary(1)|skin(1)	2						c.(568-570)ACC>AAC		olfactory receptor, family 4, subfamily A,							153.0	148.0	150.0					11																	48510913		2200	4298	6498	SO:0001583	missense	403253				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48510913C>A	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.569C>A	11.37:g.48510913C>A	ENSP00000412752:p.Thr190Asn		Somatic					p.T190N	NM_001005512	NP_001005512	WXS	Illumina HiSeq	Unspecified	Q6IF82	O4A47_HUMAN			1	569	+			190			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000446524.1	37	c.569C>A	CCDS31490.1	.	.	.	.	.	.	.	.	.	.	N	9.852	1.193892	0.22037	.	.	ENSG00000237388	ENST00000446524	T	0.00256	8.42	4.59	3.67	0.42095	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000032	T	0.00695	0.0023	M	0.94063	3.49	0.18873	N	0.999982	D	0.76494	0.999	D	0.72982	0.979	T	0.17018	-1.0383	10	0.72032	D	0.01	.	10.609	0.45410	0.0:0.9028:0.0:0.0972	.	190	Q6IF82	O4A47_HUMAN	N	190	ENSP00000412752:T190N	ENSP00000412752:T190N	T	+	2	0	OR4A47	48467489	0.365000	0.25006	0.480000	0.27341	0.084000	0.17831	1.431000	0.34925	0.906000	0.36621	0.205000	0.17691	ACC		0.438	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512		28	107	1	0	3.73148e-12	0.007291	5.56813e-12	28	107				
OR4A16	81327	broad.mit.edu	37	11	55111360	55111360	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:55111360G>A	ENST00000314721.2	+	1	734	c.684G>A	c.(682-684)caG>caA	p.Q228Q		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						CTTACAGTCAGGAAGAGAGGC	0.428																																							uc010rie.1		NA																	0				large_intestine(2)|pancreas(1)	3						c.(682-684)CAG>CAA		olfactory receptor, family 4, subfamily A,							166.0	154.0	158.0					11																	55111360		2201	4296	6497	SO:0001819	synonymous_variant	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55111360G>A	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.684G>A	11.37:g.55111360G>A			Somatic					p.Q228Q	NM_001005274	NP_001005274	WXS	Illumina HiSeq	Unspecified	Q8NH70	O4A16_HUMAN			1	684	+			228			Cytoplasmic (Potential).		Q6IFL3	Silent	SNP	ENST00000314721.2	37	c.684G>A	CCDS31499.1																																																																																				0.428	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		19	104	0	0	0	0.006122	0	19	104				
OR8H3	390152	broad.mit.edu	37	11	55890472	55890472	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:55890472G>T	ENST00000313472.3	+	1	624	c.624G>T	c.(622-624)atG>atT	p.M208I		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					CCACCCTGATGGTGTCCCTTA	0.423																																							uc001nii.1		NA																	0				ovary(2)	2						c.(622-624)ATG>ATT		olfactory receptor, family 8, subfamily H,							200.0	181.0	187.0					11																	55890472		2201	4296	6497	SO:0001583	missense	390152				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55890472G>T	AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.624G>T	11.37:g.55890472G>T	ENSP00000323928:p.Met208Ile		Somatic					p.M208I	NM_001005201	NP_001005201	WXS	Illumina HiSeq	Unspecified	Q8N146	OR8H3_HUMAN			1	624	+	Esophageal squamous(21;0.00693)		208			Helical; Name=5; (Potential).		Q6IFB7	Missense_Mutation	SNP	ENST00000313472.3	37	c.624G>T	CCDS31519.1	.	.	.	.	.	.	.	.	.	.	G	0.028	-1.353887	0.01256	.	.	ENSG00000181761	ENST00000313472	T	0.34275	1.37	3.62	2.61	0.31194	GPCR, rhodopsin-like superfamily (1);	0.546700	0.18310	N	0.145148	T	0.13798	0.0334	N	0.04373	-0.215	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.25328	-1.0135	10	0.02654	T	1	.	10.0518	0.42221	0.0:0.1457:0.7045:0.1497	.	208	Q8N146	OR8H3_HUMAN	I	208	ENSP00000323928:M208I	ENSP00000323928:M208I	M	+	3	0	OR8H3	55647048	0.000000	0.05858	0.004000	0.12327	0.412000	0.31113	-0.791000	0.04599	1.734000	0.51633	0.173000	0.16961	ATG		0.423	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201		25	119	1	0	4.4004e-07	0.00333	5.62647e-07	25	119				
OR5T2	219464	broad.mit.edu	37	11	55999734	55999734	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:55999734C>T	ENST00000313264.4	-	1	1003	c.928G>A	c.(928-930)Gac>Aac	p.D310N		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	310						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					ACTATCATGTCATGGTCCGAA	0.398																																							uc010rjc.1		NA																	0				ovary(2)	2						c.(928-930)GAC>AAC		olfactory receptor, family 5, subfamily T,							191.0	168.0	175.0					11																	55999734		2201	4296	6497	SO:0001583	missense	219464				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55999734C>T	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.928G>A	11.37:g.55999734C>T	ENSP00000323688:p.Asp310Asn		Somatic					p.D310N	NM_001004746	NP_001004746	WXS	Illumina HiSeq	Unspecified	Q8NGG2	OR5T2_HUMAN			1	928	-	Esophageal squamous(21;0.00448)		310			Extracellular (Potential).		B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	c.928G>A	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880675	0.51801	.	.	ENSG00000181718	ENST00000313264	T	0.00216	8.53	5.07	4.15	0.48705	GPCR, rhodopsin-like superfamily (1);	0.156614	0.29493	U	0.011995	T	0.00241	0.0007	L	0.58302	1.8	0.28114	N	0.930862	P	0.36712	0.566	B	0.44163	0.443	T	0.33803	-0.9854	10	0.46703	T	0.11	.	8.5572	0.33489	0.0:0.8264:0.0:0.1736	.	310	Q8NGG2	OR5T2_HUMAN	N	310	ENSP00000323688:D310N	ENSP00000323688:D310N	D	-	1	0	OR5T2	55756310	0.007000	0.16637	1.000000	0.80357	0.185000	0.23345	0.428000	0.21395	2.524000	0.85096	0.478000	0.44815	GAC		0.398	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		22	83	0	0	0	0.002299	0	22	83				
LRRC55	219527	broad.mit.edu	37	11	56954808	56954808	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:56954808C>T	ENST00000497933.1	+	2	1027	c.880C>T	c.(880-882)Ctg>Ttg	p.L294L		NM_001005210.2	NP_001005210.1	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	264					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|skin(2)	25						GGCCTGCCACCTGACCCTGAC	0.582																																							uc001njl.1		NA																	0					0						c.(880-882)CTG>TTG		leucine rich repeat containing 55							157.0	109.0	125.0					11																	56954808		2201	4296	6497	SO:0001819	synonymous_variant	219527					integral to membrane		g.chr11:56954808C>T		CCDS31539.1	11q12.1	2008-02-05			ENSG00000183908	ENSG00000183908			32324	protein-coding gene	gene with protein product		615213					Standard	NM_001005210		Approved	FLJ45686	uc001njl.2	Q6ZSA7	OTTHUMG00000159309	ENST00000497933.1:c.880C>T	11.37:g.56954808C>T			Somatic				LRRC55_uc001njm.1_5'Flank	p.L294L	NM_001005210	NP_001005210	WXS	Illumina HiSeq	Unspecified	Q6ZSA7	LRC55_HUMAN			2	1027	+			264			LRRCT.		A7E2U7|B2RN81	Silent	SNP	ENST00000497933.1	37	c.880C>T	CCDS31539.1																																																																																				0.582	LRRC55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354503.2	NM_001005210		18	78	0	0	0	0.00499	0	18	78				
APLNR	187	broad.mit.edu	37	11	57004438	57004438	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:57004438T>A	ENST00000606794.1	-	1	237	c.41A>T	c.(40-42)gAc>gTc	p.D14V		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	14					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						AGACTGGTTGTCTGCCCCATA	0.582																																							uc001njo.2		NA																	0				lung(5)|ovary(1)	6						c.(40-42)GAC>GTC		apelin receptor							63.0	61.0	62.0					11																	57004438		2197	4286	6483	SO:0001583	missense	187					integral to plasma membrane	G-protein coupled receptor activity	g.chr11:57004438T>A	U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.41A>T	11.37:g.57004438T>A	ENSP00000475344:p.Asp14Val		Somatic				APLNR_uc001njn.3_RNA	p.D14V	NM_005161	NP_005152	WXS	Illumina HiSeq	Unspecified	P35414	APJ_HUMAN			1	490	-			14			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000606794.1	37	c.41A>T	CCDS7950.1	.	.	.	.	.	.	.	.	.	.	T	11.21	1.572993	0.28092	.	.	ENSG00000134817	ENST00000257254;ENST00000326830	T	0.36699	1.24	5.25	5.25	0.73442	.	0.683505	0.14204	N	0.334484	T	0.20088	0.0483	N	0.08118	0	0.58432	D	0.999999	B	0.14438	0.01	B	0.11329	0.006	T	0.07385	-1.0775	10	0.35671	T	0.21	-27.2398	9.4716	0.38847	0.1577:0.0:0.0:0.8423	.	14	P35414	APJ_HUMAN	V	14	ENSP00000257254:D14V	ENSP00000257254:D14V	D	-	2	0	APLNR	56761014	1.000000	0.71417	0.994000	0.49952	0.978000	0.69477	1.911000	0.39937	1.991000	0.58162	0.459000	0.35465	GAC		0.582	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470575.1	NM_005161		27	50	0	0	0	0.00632	0	27	50				
OR9Q1	219956	broad.mit.edu	37	11	57947582	57947582	+	Silent	SNP	C	C	A	rs139135884	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:57947582C>A	ENST00000335397.3	+	3	982	c.666C>A	c.(664-666)atC>atA	p.I222I		NM_001005212.3	NP_001005212.1	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q, member 1	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Breast(21;0.222)				TGTTTATCATCGTGGCCATCA	0.512																																							uc001nmj.2		NA																	0				ovary(1)	1						c.(664-666)ATC>ATA		olfactory receptor, family 9, subfamily Q,							234.0	189.0	204.0					11																	57947582		2201	4296	6497	SO:0001819	synonymous_variant	219956				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57947582C>A	AB065734	CCDS31543.1	11q12.1	2012-08-09				ENSG00000186509		"""GPCR / Class A : Olfactory receptors"""	14724	protein-coding gene	gene with protein product							Standard	NM_001005212		Approved		uc001nmj.3	Q8NGQ5		ENST00000335397.3:c.666C>A	11.37:g.57947582C>A			Somatic					p.I222I	NM_001005212	NP_001005212	WXS	Illumina HiSeq	Unspecified	Q8NGQ5	OR9Q1_HUMAN			3	982	+		Breast(21;0.222)	222			Cytoplasmic (Potential).		Q2TAN3|Q96RA7	Silent	SNP	ENST00000335397.3	37	c.666C>A	CCDS31543.1																																																																																				0.512	OR9Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394538.2	NM_001005212		34	93	1	0	4.39465e-27	0.002836	7.87276e-27	34	93				
OR10W1	81341	broad.mit.edu	37	11	58035220	58035220	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:58035220C>A	ENST00000395079.2	-	1	512	c.111G>T	c.(109-111)gtG>gtT	p.V37V		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				GAATGGACACCACAATGAGAA	0.493																																							uc001nmq.1		NA																	0				ovary(1)	1						c.(109-111)GTG>GTT		olfactory receptor, family 10, subfamily W,							100.0	83.0	89.0					11																	58035220		2201	4295	6496	SO:0001819	synonymous_variant	81341				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58035220C>A	AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.111G>T	11.37:g.58035220C>A			Somatic					p.V37V	NM_207374	NP_997257	WXS	Illumina HiSeq	Unspecified	Q8NGF6	O10W1_HUMAN			1	513	-		Breast(21;0.0589)	37			Helical; Name=1; (Potential).		A2RUD2|A8MTE1|Q6UXQ2	Silent	SNP	ENST00000395079.2	37	c.111G>T	CCDS7968.1																																																																																				0.493	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374		10	62	1	0	0.000442599	0.006214	0.000508648	10	62				
OR4D11	219986	broad.mit.edu	37	11	59271633	59271633	+	Silent	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:59271633T>A	ENST00000313253.1	+	1	585	c.585T>A	c.(583-585)ctT>ctA	p.L195L		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						CTTTTGCTCTTGAGTTCTTGA	0.488																																							uc001noa.1		NA																	0				ovary(1)|skin(1)	2						c.(583-585)CTT>CTA		olfactory receptor, family 4, subfamily D,							228.0	216.0	220.0					11																	59271633		2201	4295	6496	SO:0001819	synonymous_variant	219986				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59271633T>A	AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.585T>A	11.37:g.59271633T>A			Somatic					p.L195L	NM_001004706	NP_001004706	WXS	Illumina HiSeq	Unspecified	Q8NGI4	OR4DB_HUMAN			1	585	+			195			Extracellular (Potential).			Silent	SNP	ENST00000313253.1	37	c.585T>A	CCDS31563.1																																																																																				0.488	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394236.1	NM_001004706		59	138	0	0	0	0.00361	0	59	138				
SLC22A12	116085	broad.mit.edu	37	11	64359046	64359046	+	Silent	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:64359046C>G	ENST00000377574.1	+	1	765	c.18C>G	c.(16-18)ctC>ctG	p.L6L	SLC22A12_ENST00000377567.2_Silent_p.L6L|SLC22A12_ENST00000336464.7_Silent_p.L6L|SLC22A12_ENST00000377572.1_Silent_p.L6L|SLC22A12_ENST00000473690.1_Intron	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	6					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	TTTCTGAACTCCTGGACCTCG	0.592																																							uc001oam.1		NA																	0				ovary(1)	1						c.(16-18)CTC>CTG		urate anion exchanger 1 isoform a							79.0	80.0	80.0					11																	64359046		2201	4296	6497	SO:0001819	synonymous_variant	116085				cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity	g.chr11:64359046C>G	AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.18C>G	11.37:g.64359046C>G			Somatic				SLC22A12_uc009ypr.1_Silent_p.L6L|SLC22A12_uc001oal.1_Intron|SLC22A12_uc009yps.1_Silent_p.L6L|SLC22A12_uc001oan.1_Silent_p.L6L|SLC22A12_uc009ypt.2_5'Flank	p.L6L	NM_144585	NP_653186	WXS	Illumina HiSeq	Unspecified	Q96S37	S22AC_HUMAN			1	765	+			6					B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Silent	SNP	ENST00000377574.1	37	c.18C>G	CCDS8075.1																																																																																				0.592	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	NM_144585		29	128	0	0	0	0.008361	0	29	128				
MUS81	80198	broad.mit.edu	37	11	65631996	65631996	+	Missense_Mutation	SNP	G	G	A	rs367647379		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:65631996G>A	ENST00000308110.4	+	11	1437	c.1088G>A	c.(1087-1089)cGc>cAc	p.R363H	MUS81_ENST00000533035.1_Missense_Mutation_p.R288H|EFEMP2_ENST00000532648.1_5'Flank	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	363	ERCC4.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		GGTCTGGAGCGCCGGGTATAC	0.592								Homologous recombination																															uc001ofv.3		NA																	0					0						c.(1087-1089)CGC>CAC	Homologous_recombination	MUS81 endonuclease homolog		G	HIS/ARG	0,4402		0,0,2201	104.0	81.0	89.0		1088	-4.0	0.0	11		89	1,8591	1.2+/-3.3	0,1,4295	no	missense	MUS81	NM_025128.4	29	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign	363/552	65631996	1,12993	2201	4296	6497	SO:0001583	missense	80198				DNA recombination|DNA repair	nucleolus	3'-flap endonuclease activity|DNA binding|metal ion binding|protein binding	g.chr11:65631996G>A		CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.1088G>A	11.37:g.65631996G>A	ENSP00000307853:p.Arg363His		Somatic				MUS81_uc001ofw.3_RNA|MUS81_uc001ofx.3_5'UTR	p.R363H	NM_025128	NP_079404	WXS	Illumina HiSeq	Unspecified	Q96NY9	MUS81_HUMAN		READ - Rectum adenocarcinoma(159;0.166)	11	1441	+			363			ERCC4.		Q9H7D9	Missense_Mutation	SNP	ENST00000308110.4	37	c.1088G>A	CCDS8115.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.329827	0.24167	0.0	1.16E-4	ENSG00000172732	ENST00000533035;ENST00000308110;ENST00000437855	T;T	0.23552	1.9;1.9	5.91	-3.95	0.04118	DNA repair nuclease, XPF-type/Helicase (1);Restriction endonuclease, type II-like (1);ERCC4 domain (2);	0.627253	0.17122	N	0.186195	T	0.10937	0.0267	N	0.10972	0.075	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.32981	-0.9886	10	0.14252	T	0.57	-2.3639	13.2426	0.60006	0.6499:0.0:0.3501:0.0	.	363	Q96NY9	MUS81_HUMAN	H	288;363;363	ENSP00000432287:R288H;ENSP00000307853:R363H	ENSP00000307853:R363H	R	+	2	0	MUS81	65388572	0.005000	0.15991	0.001000	0.08648	0.957000	0.61999	0.006000	0.13152	-0.546000	0.06216	-0.266000	0.10368	CGC		0.592	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390941.3	NM_025128		6	44	0	0	0	0.001168	0	6	44				
ANO1	55107	broad.mit.edu	37	11	69970497	69970497	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:69970497G>C	ENST00000355303.5	+	9	1244	c.939G>C	c.(937-939)aaG>aaC	p.K313N	ANO1_ENST00000538023.1_Missense_Mutation_p.K313N|ANO1_ENST00000316296.5_Missense_Mutation_p.K285N|ANO1_ENST00000531349.1_Missense_Mutation_p.K48N|ANO1_ENST00000398543.2_Missense_Mutation_p.K197N|ANO1_ENST00000530676.1_Missense_Mutation_p.K197N	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	313					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	TTTTCTATAAGTACCAGCCCA	0.572																																							uc001opj.2		NA																	0				ovary(1)|pancreas(1)	2						c.(937-939)AAG>AAC		anoctamin 1, calcium activated chloride channel							74.0	81.0	79.0					11																	69970497		2041	4161	6202	SO:0001583	missense	55107				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity	g.chr11:69970497G>C	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.939G>C	11.37:g.69970497G>C	ENSP00000347454:p.Lys313Asn		Somatic				ANO1_uc001opk.1_Missense_Mutation_p.K285N|ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Missense_Mutation_p.K48N	p.K313N	NM_018043	NP_060513	WXS	Illumina HiSeq	Unspecified	Q5XXA6	ANO1_HUMAN			9	1244	+			313			Cytoplasmic (Potential).		A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	37	c.939G>C	CCDS44663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.32|17.32	3.360054|3.360054	0.61403|0.61403	.|.	.|.	ENSG00000131620|ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000316296;ENST00000530676;ENST00000531349|ENST00000530480	T;T;T;T;T;T|.	0.70869|.	-0.48;-0.48;-0.48;-0.48;-0.48;-0.52|.	4.79|4.79	1.18|1.18	0.20946|0.20946	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69124|0.69124	0.3076|0.3076	M|M	0.75085|0.75085	2.285|2.285	0.49915|0.49915	D|D	0.999835|0.999835	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.999;0.999|.	T|T	0.66787|0.66787	-0.5835|-0.5835	9|5	.|.	.|.	.|.	.|.	10.3564|10.3564	0.43967|0.43967	0.3971:0.0:0.6029:0.0|0.3971:0.0:0.6029:0.0	.|.	48;285;313|.	E9PNA7;Q5XXA6-3;Q5XXA6|.	.;.;ANO1_HUMAN|.	N|T	313;313;197;97;285;197;48|178	ENSP00000347454:K313N;ENSP00000444689:K313N;ENSP00000381551:K197N;ENSP00000319477:K285N;ENSP00000435797:K197N;ENSP00000432843:K48N|.	.|.	K|S	+|+	3|2	2|0	ANO1|ANO1	69648145|69648145	0.996000|0.996000	0.38824|0.38824	0.999000|0.999000	0.59377|0.59377	0.870000|0.870000	0.49936|0.49936	0.339000|0.339000	0.19875|0.19875	0.305000|0.305000	0.22832|0.22832	0.561000|0.561000	0.74099|0.74099	AAG|AGT		0.572	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043		8	28	0	0	0	0.006214	0	8	28				
WNT11	7481	broad.mit.edu	37	11	75905828	75905828	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:75905828G>A	ENST00000322563.3	-	3	504	c.380C>T	c.(379-381)gCc>gTc	p.A127V	RP11-619A14.2_ENST00000527314.1_RNA	NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	127					adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						GCAGGCCCGGGCGATGGCGTG	0.736																																							uc001oxe.2		NA																	0				lung(1)|skin(1)	2						c.(379-381)GCC>GTC		wingless-type MMTV integration site family,							7.0	8.0	7.0					11																	75905828		2126	4155	6281	SO:0001583	missense	7481				adrenal gland development|anterior/posterior pattern formation|artery morphogenesis|axis specification|bone mineralization|cellular response to retinoic acid|cloacal septation|embryonic skeletal system development|endoderm development|lung-associated mesenchyme development|mesonephric duct development|negative regulation of apoptosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell migration|negative regulation of transcription, DNA-dependent|neuroendocrine cell differentiation|neuron differentiation|osteoblast differentiation|outflow tract morphogenesis|palate development|positive regulation of cell migration|positive regulation of protein kinase C signaling cascade|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor-beta2 production|protein localization at cell surface|protein phosphorylation|tight junction assembly|ureteric bud morphogenesis|ventricular septum morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|protein kinase activator activity|Ras GTPase activator activity|transcription regulatory region DNA binding	g.chr11:75905828G>A	Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.380C>T	11.37:g.75905828G>A	ENSP00000325526:p.Ala127Val		Somatic				WNT11_uc001oxf.1_Missense_Mutation_p.A127V	p.A127V	NM_004626	NP_004617	WXS	Illumina HiSeq	Unspecified	O96014	WNT11_HUMAN			3	503	-			127					B2R8Z6|Q14DE8|Q8WZ98	Missense_Mutation	SNP	ENST00000322563.3	37	c.380C>T	CCDS8242.1	.	.	.	.	.	.	.	.	.	.	G	35	5.429733	0.96131	.	.	ENSG00000085741	ENST00000322563;ENST00000531317;ENST00000447195	T	0.78246	-1.16	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.88232	0.6381	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89918	0.4057	10	0.87932	D	0	.	17.1651	0.86814	0.0:0.0:1.0:0.0	.	127	O96014	WNT11_HUMAN	V	127	ENSP00000325526:A127V	ENSP00000325526:A127V	A	-	2	0	WNT11	75583476	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	9.863000	0.99569	2.287000	0.76781	0.555000	0.69702	GCC		0.736	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383083.1	NM_004626		4	3	0	0	0	0.000248	0	4	3				
MMP7	4316	broad.mit.edu	37	11	102395788	102395788	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:102395788C>A	ENST00000260227.4	-	4	544	c.492G>T	c.(490-492)ggG>ggT	p.G164G		NM_002423.3	NP_002414.1	P09237	MMP7_HUMAN	matrix metallopeptidase 7 (matrilysin, uterine)	164					antibacterial peptide secretion (GO:0002779)|collagen catabolic process (GO:0030574)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)	Marimastat(DB00786)	GGTAGGAGTCCCCATGAGCTG	0.443																																							uc001phb.2		NA																	0				ovary(1)	1						c.(490-492)GGG>GGT		matrix metalloproteinase 7 preproprotein							81.0	70.0	74.0					11																	102395788		2203	4299	6502	SO:0001819	synonymous_variant	4316				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:102395788C>A	Z11887	CCDS8317.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000137673	ENSG00000137673	3.4.24.23		7174	protein-coding gene	gene with protein product		178990	"""matrix metalloproteinase 7 (matrilysin, uterine)"""	MPSL1		8978768	Standard	NM_002423		Approved	PUMP-1	uc001phb.3	P09237	OTTHUMG00000048193	ENST00000260227.4:c.492G>T	11.37:g.102395788C>A			Somatic				MMP7_uc009yxd.2_Silent_p.G164G	p.G164G	NM_002423	NP_002414	WXS	Illumina HiSeq	Unspecified	P09237	MMP7_HUMAN	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)	4	539	-	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	164					Q9BTK9	Silent	SNP	ENST00000260227.4	37	c.492G>T	CCDS8317.1																																																																																				0.443	MMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109633.2			14	28	1	0	6.31663e-08	0.003163	8.36391e-08	14	28				
DSCAML1	57453	broad.mit.edu	37	11	117389380	117389380	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:117389380G>A	ENST00000321322.6	-	7	1492	c.1491C>T	c.(1489-1491)ccC>ccT	p.P497P	DSCAML1_ENST00000527706.1_Silent_p.P227P	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	437	Ig-like C2-type 5.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AGGTGACCGTGGGGGGCGGGG	0.662																																							uc001prh.1		NA																	0				ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(1489-1491)CCC>CCT		Down syndrome cell adhesion molecule like 1							49.0	48.0	49.0					11																	117389380		2201	4296	6497	SO:0001819	synonymous_variant	57453				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity	g.chr11:117389380G>A		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1491C>T	11.37:g.117389380G>A			Somatic				DSCAML1_uc001pri.1_Silent_p.P301P	p.P497P	NM_020693	NP_065744	WXS	Illumina HiSeq	Unspecified	Q8TD84	DSCL1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)	7	1493	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	437			Extracellular (Potential).|Ig-like C2-type 5.		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	37	c.1491C>T	CCDS8384.1																																																																																				0.662	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693		10	27	0	0	0	0.008291	0	10	27				
C2CD2L	9854	broad.mit.edu	37	11	118984983	118984983	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:118984983C>T	ENST00000528586.1	+	9	1131	c.1061C>T	c.(1060-1062)tCg>tTg	p.S354L	C2CD2L_ENST00000336702.3_Missense_Mutation_p.S607L			O14523	C2C2L_HUMAN	C2CD2-like	606						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						ACAACCCGTTCGGATATTTCT	0.577																																							uc001pvo.2		NA																	0					0						c.(1816-1818)TCG>TTG		transmembrane protein 24							131.0	133.0	132.0					11																	118984983		2200	4295	6495	SO:0001583	missense	9854					integral to membrane		g.chr11:118984983C>T	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.1061C>T	11.37:g.118984983C>T	ENSP00000433600:p.Ser354Leu		Somatic				C2CD2L_uc001pvn.2_Missense_Mutation_p.S607L	p.S606L	NM_014807	NP_055622	WXS	Illumina HiSeq	Unspecified	O14523	C2C2L_HUMAN			13	2176	+			606					Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	ENST00000528586.1	37	c.1817C>T		.	.	.	.	.	.	.	.	.	.	C	32	5.154918	0.94686	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.57273	0.41;0.41	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.66366	0.2782	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.57027	-0.7881	10	0.15952	T	0.53	-11.3001	18.3582	0.90365	0.0:1.0:0.0:0.0	.	606;607	O14523;O14523-2	C2C2L_HUMAN;.	L	607;354	ENSP00000338885:S607L;ENSP00000433600:S354L	ENSP00000338885:S607L	S	+	2	0	C2CD2L	118490193	1.000000	0.71417	0.991000	0.47740	0.977000	0.68977	7.130000	0.77235	2.798000	0.96311	0.655000	0.94253	TCG		0.577	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000388199.2	NM_014807		7	179	0	0	0	0.001984	0	7	179				
MCAM	4162	broad.mit.edu	37	11	119182596	119182596	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:119182596C>T	ENST00000264036.4	-	10	1221	c.1207G>A	c.(1207-1209)Ggc>Agc	p.G403S	MCAM_ENST00000392814.1_Missense_Mutation_p.G352S	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	403	Ig-like C2-type 2.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CGATAGCCGCCTCCTGCCTCC	0.617																																							uc001pwf.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(1207-1209)GGC>AGC		melanoma cell adhesion molecule							107.0	107.0	107.0					11																	119182596		2199	4295	6494	SO:0001583	missense	4162				anatomical structure morphogenesis|cell adhesion	integral to membrane|plasma membrane		g.chr11:119182596C>T	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1207G>A	11.37:g.119182596C>T	ENSP00000264036:p.Gly403Ser		Somatic				MCAM_uc001pwg.1_5'Flank	p.G403S	NM_006500	NP_006491	WXS	Illumina HiSeq	Unspecified	P43121	MUC18_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)	10	1236	-		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	403			Ig-like C2-type 2.|Extracellular (Potential).		O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	37	c.1207G>A	CCDS31690.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028613	0.54790	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.47528	0.84;0.84	4.73	4.73	0.59995	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69024	0.3065	M	0.83384	2.64	0.45390	D	0.998371	D	0.76494	0.999	D	0.79108	0.992	T	0.72070	-0.4401	9	0.51188	T	0.08	-18.5926	13.0577	0.58990	0.0:1.0:0.0:0.0	.	403	P43121	MUC18_HUMAN	S	403;352	ENSP00000264036:G403S;ENSP00000376561:G352S	ENSP00000264036:G403S	G	-	1	0	MCAM	118687806	0.014000	0.17966	0.777000	0.31699	0.075000	0.17131	0.739000	0.26173	2.438000	0.82558	0.462000	0.41574	GGC		0.617	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2			51	75	0	0	0	0.00361	0	51	75				
UBASH3B	84959	broad.mit.edu	37	11	122680461	122680461	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:122680461C>T	ENST00000284273.5	+	14	2192	c.1817C>T	c.(1816-1818)cCa>cTa	p.P606L		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	606	Protein tyrosine phosphatase. {ECO:0000250}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		CTTCAGATCCCATATCTGGGA	0.413																																							uc001pyi.3		NA																	0				central_nervous_system(1)	1						c.(1816-1818)CCA>CTA		ubiquitin associated and SH3 domain containing,							65.0	64.0	64.0					11																	122680461		2202	4299	6501	SO:0001583	missense	84959					cytoplasm|nucleus	protein tyrosine phosphatase activity	g.chr11:122680461C>T	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.1817C>T	11.37:g.122680461C>T	ENSP00000284273:p.Pro606Leu		Somatic					p.P606L	NM_032873	NP_116262	WXS	Illumina HiSeq	Unspecified	Q8TF42	UBS3B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)	14	2177	+		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)	606			Protein tyrosine phosphatase (By similarity).		Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	37	c.1817C>T	CCDS31694.1	.	.	.	.	.	.	.	.	.	.	C	34	5.379083	0.95945	.	.	ENSG00000154127	ENST00000284273	T	0.35789	1.29	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.60090	0.2242	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56086	-0.8037	10	0.56958	D	0.05	-24.7511	20.5827	0.99408	0.0:1.0:0.0:0.0	.	606	Q8TF42	UBS3B_HUMAN	L	606	ENSP00000284273:P606L	ENSP00000284273:P606L	P	+	2	0	UBASH3B	122185671	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.739000	0.84976	2.941000	0.99782	0.655000	0.94253	CCA		0.413	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	NM_032873		15	26	0	0	0	0.00245	0	15	26				
OR10G8	219869	broad.mit.edu	37	11	123901174	123901174	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:123901174T>C	ENST00000431524.1	+	1	878	c.845T>C	c.(844-846)cTc>cCc	p.L282P		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		ACGCCCCTTCTCAACCCTGTT	0.498																																							uc001pzp.1		NA																	0				ovary(1)|skin(1)	2						c.(844-846)CTC>CCC		olfactory receptor, family 10, subfamily G,							121.0	116.0	118.0					11																	123901174		2201	4299	6500	SO:0001583	missense	219869				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123901174T>C	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.845T>C	11.37:g.123901174T>C	ENSP00000389072:p.Leu282Pro		Somatic					p.L282P	NM_001004464	NP_001004464	WXS	Illumina HiSeq	Unspecified	Q8NGN5	O10G8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	845	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	282			Helical; Name=7; (Potential).		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	c.845T>C	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	T	13.97	2.394897	0.42512	.	.	ENSG00000234560	ENST00000431524	T	0.50813	0.73	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35040	N	0.003489	T	0.68044	0.2958	M	0.86573	2.825	0.58432	D	0.999998	D	0.56287	0.975	D	0.64687	0.928	T	0.73886	-0.3841	10	0.87932	D	0	.	11.0743	0.48021	0.0:0.0:0.0:1.0	.	282	Q8NGN5	O10G8_HUMAN	P	282	ENSP00000389072:L282P	ENSP00000389072:L282P	L	+	2	0	OR10G8	123406384	0.702000	0.27816	0.901000	0.35422	0.456000	0.32438	5.155000	0.64900	1.319000	0.45190	0.455000	0.32223	CTC		0.498	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464		17	95	0	0	0	0.006122	0	17	95				
ST3GAL4	6484	broad.mit.edu	37	11	126283519	126283519	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:126283519G>T	ENST00000526727.1	+	9	1265	c.891G>T	c.(889-891)gaG>gaT	p.E297D	ST3GAL4_ENST00000444328.2_Missense_Mutation_p.E297D|ST3GAL4_ENST00000356132.4_Missense_Mutation_p.E303D|ST3GAL4_ENST00000227495.6_Missense_Mutation_p.E293D|ST3GAL4_ENST00000449406.2_Missense_Mutation_p.E286D|ST3GAL4_ENST00000532243.1_Missense_Mutation_p.E296D|ST3GAL4_ENST00000530591.1_Missense_Mutation_p.E293D|ST3GAL4_ENST00000392669.2_Missense_Mutation_p.E297D|ST3GAL4_ENST00000534457.1_Missense_Mutation_p.E292D|ST3GAL4_ENST00000534083.1_Missense_Mutation_p.E297D			Q11206	SIA4C_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 4	297					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|monosialoganglioside sialyltransferase activity (GO:0047288)			endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)		ACTACTATGAGCAGATCACGC	0.597																																							uc001qds.2		NA																	0					0						c.(889-891)GAG>GAT		ST3 beta-galactoside alpha-2,3-sialyltransferase							116.0	92.0	100.0					11																	126283519		2201	4297	6498	SO:0001583	missense	6484				post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity	g.chr11:126283519G>T	X74570	CCDS8474.1, CCDS58193.1, CCDS58194.1	11q23-q24	2013-03-01	2003-01-14	2005-02-07	ENSG00000110080	ENSG00000110080	2.4.99.4	"""Sialyltransferases"""	10864	protein-coding gene	gene with protein product	"""ST3Gal IV"""	104240	"""sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase)"""	CGS23, SIAT4, NANTA3, SIAT4C		8557707, 8288606	Standard	NM_006278		Approved	STZ, SAT3, FLJ11867	uc001qds.3	Q11206	OTTHUMG00000165830	ENST00000526727.1:c.891G>T	11.37:g.126283519G>T	ENSP00000436047:p.Glu297Asp		Somatic				ST3GAL4_uc001qdt.2_Missense_Mutation_p.E293D|ST3GAL4_uc009zcc.2_Missense_Mutation_p.E133D|ST3GAL4_uc009zcd.2_Missense_Mutation_p.E286D|ST3GAL4_uc001qdu.2_Missense_Mutation_p.E293D|ST3GAL4_uc001qdv.2_Missense_Mutation_p.E297D|ST3GAL4_uc009zce.2_Missense_Mutation_p.E293D|ST3GAL4_uc001qdw.2_Missense_Mutation_p.E286D|ST3GAL4_uc001qdx.1_Intron|ST3GAL4_uc001qdy.2_Missense_Mutation_p.E133D|ST3GAL4_uc001qdz.2_Missense_Mutation_p.E133D	p.E297D	NM_006278	NP_006269	WXS	Illumina HiSeq	Unspecified	Q11206	SIA4C_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)	10	1110	+	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)	297			Lumenal (Potential).		A8K6B2|O60497|Q8N6A6|Q8NFG7|Q96QQ9	Missense_Mutation	SNP	ENST00000526727.1	37	c.891G>T	CCDS58193.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.807884	0.31961	.	.	ENSG00000110080	ENST00000227495;ENST00000444328;ENST00000356132;ENST00000530591;ENST00000534083;ENST00000392669;ENST00000526727;ENST00000449406;ENST00000532243;ENST00000534457;ENST00000524860	T;T;T;T;T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61	5.33	0.477	0.16784	.	.	.	.	.	T	0.32466	0.0830	L	0.33485	1.01	0.30245	N	0.79465	D;D	0.55800	0.973;0.973	P;P	0.58013	0.831;0.831	T	0.28004	-1.0057	9	0.14252	T	0.57	.	10.0196	0.42035	0.4214:0.0:0.5786:0.0	.	293;297	Q6IBE6;Q11206	.;SIA4C_HUMAN	D	293;297;303;293;297;297;297;286;296;292;133	ENSP00000227495:E293D;ENSP00000394354:E297D;ENSP00000348451:E303D;ENSP00000433989:E293D;ENSP00000433318:E297D;ENSP00000376437:E297D;ENSP00000436047:E297D;ENSP00000399444:E286D;ENSP00000434349:E296D;ENSP00000434668:E292D;ENSP00000431170:E133D	ENSP00000227495:E293D	E	+	3	2	ST3GAL4	125788729	1.000000	0.71417	0.995000	0.50966	0.913000	0.54294	1.273000	0.33121	0.052000	0.16007	0.455000	0.32223	GAG		0.597	ST3GAL4-003	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386470.1	NM_006278		19	68	1	0	4.96729e-08	0.008871	6.60334e-08	19	68				
KCNJ5	3762	broad.mit.edu	37	11	128781554	128781554	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:128781554G>T	ENST00000338350.4	+	3	738	c.386G>T	c.(385-387)tGt>tTt	p.C129F	KCNJ5_ENST00000533599.1_Missense_Mutation_p.C129F|KCNJ5_ENST00000529694.1_Missense_Mutation_p.C129F			P48544	KCNJ5_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 5	129					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			NS(1)|breast(1)|endometrium(4)|large_intestine(4)|liver(2)|lung(9)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glyburide(DB01016)	TGGATTCCTTGTGTTGAAAAC	0.502																																					Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)	Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)	uc001qet.2		NA																	0				skin(1)	1						c.(385-387)TGT>TTT		potassium inwardly-rectifying channel J5	Glibenclamide(DB01016)						152.0	148.0	149.0					11																	128781554		2201	4297	6498	SO:0001583	missense	3762				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr11:128781554G>T	D50134	CCDS8479.1	11q24	2014-09-17				ENSG00000120457		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6266	protein-coding gene	gene with protein product		600734				16382105	Standard	NM_000890		Approved	Kir3.4, CIR, KATP1, GIRK4, LQT13	uc001qet.3	P48544		ENST00000338350.4:c.386G>T	11.37:g.128781554G>T	ENSP00000339960:p.Cys129Phe		Somatic				KCNJ5_uc009zck.2_Missense_Mutation_p.C129F|KCNJ5_uc001qew.2_Missense_Mutation_p.C129F	p.C129F	NM_000890	NP_000881	WXS	Illumina HiSeq	Unspecified	P48544	IRK5_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	2	700	+	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	129			Extracellular (By similarity).		B2R744|Q6DK13|Q6DK14|Q92807	Missense_Mutation	SNP	ENST00000338350.4	37	c.386G>T	CCDS8479.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.139948	0.56936	.	.	ENSG00000120457	ENST00000529694;ENST00000338350;ENST00000533599	D;D;D	0.97378	-4.36;-4.36;-4.36	5.45	5.45	0.79879	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.99137	0.9702	H	0.97732	4.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99063	1.0831	10	0.87932	D	0	.	19.2859	0.94069	0.0:0.0:1.0:0.0	.	129	P48544	IRK5_HUMAN	F	129	ENSP00000433295:C129F;ENSP00000339960:C129F;ENSP00000434266:C129F	ENSP00000339960:C129F	C	+	2	0	KCNJ5	128286764	1.000000	0.71417	0.303000	0.25071	0.381000	0.30169	9.869000	0.99810	2.552000	0.86080	0.555000	0.69702	TGT		0.502	KCNJ5-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386239.1	NM_000890		42	82	1	0	1.52319e-26	0.00874	2.72142e-26	42	82				
ADAMTS15	170689	broad.mit.edu	37	11	130319288	130319288	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:130319288C>T	ENST00000299164.2	+	1	420	c.420C>T	c.(418-420)ccC>ccT	p.P140P		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	140						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GCCCGCTGCCCAATGCTAGCG	0.706																																							uc010scd.1		NA																	0				large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5						c.(418-420)CCC>CCT		a disintegrin-like and metalloprotease							16.0	21.0	19.0					11																	130319288		2182	4277	6459	SO:0001819	synonymous_variant	170689				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:130319288C>T	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.420C>T	11.37:g.130319288C>T			Somatic					p.P140P	NM_139055	NP_620686	WXS	Illumina HiSeq	Unspecified	Q8TE58	ATS15_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)	1	420	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	140					Q32MI6	Silent	SNP	ENST00000299164.2	37	c.420C>T	CCDS8488.1																																																																																				0.706	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055		23	34	0	0	0	0.002299	0	23	34				
SLC6A13	6540	broad.mit.edu	37	12	333641	333641	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:333641C>A	ENST00000343164.4	-	10	1151	c.1099G>T	c.(1099-1101)Gtg>Ttg	p.V367L	SLC6A13_ENST00000539668.1_5'Flank|SLC6A13_ENST00000445055.2_Missense_Mutation_p.V275L	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	367					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GGCAGCATCACCACAGCCCGC	0.622																																							uc001qic.1		NA																	0					0						c.(1099-1101)GTG>TTG		solute carrier family 6 (neurotransmitter							125.0	109.0	115.0					12																	333641		2203	4300	6503	SO:0001583	missense	6540				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr12:333641C>A	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1099G>T	12.37:g.333641C>A	ENSP00000339260:p.Val367Leu		Somatic				SLC6A13_uc009zdj.1_Missense_Mutation_p.V357L|SLC6A13_uc010sdl.1_Missense_Mutation_p.V275L	p.V367L	NM_016615	NP_057699	WXS	Illumina HiSeq	Unspecified	Q9NSD5	S6A13_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)		10	1152	-	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		367			Helical; Name=8; (Potential).		B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	37	c.1099G>T	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.687168	0.48097	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	T;T	0.74315	-0.83;-0.83	5.61	5.61	0.85477	.	0.321061	0.33327	N	0.005034	T	0.60444	0.2269	N	0.11651	0.15	0.33085	D	0.537151	B;B;B	0.28760	0.221;0.001;0.0	B;B;B	0.36030	0.216;0.013;0.021	T	0.68258	-0.5456	10	0.38643	T	0.18	.	12.9159	0.58205	0.0:0.9258:0.0:0.0742	.	275;346;367	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	L	275;346;367	ENSP00000407104:V275L;ENSP00000339260:V367L	ENSP00000318097:V346L	V	-	1	0	SLC6A13	203902	0.994000	0.37717	1.000000	0.80357	0.931000	0.56810	1.961000	0.40432	2.646000	0.89796	0.448000	0.29417	GTG		0.622	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615		10	55	1	0	3.86212e-05	0.008291	4.60431e-05	10	55				
FOXM1	2305	broad.mit.edu	37	12	2968029	2968029	+	Silent	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:2968029A>G	ENST00000359843.3	-	9	2135	c.2067T>C	c.(2065-2067)ttT>ttC	p.F689F	Y_RNA_ENST00000410561.1_RNA|ITFG2_ENST00000545509.1_Intron|FOXM1_ENST00000361953.3_Silent_p.F674F|FOXM1_ENST00000342628.2_Silent_p.F727F|AC005841.1_ENST00000382678.3_5'Flank	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	689					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			AAGAGTTGCCAAAGGGGACGG	0.567																																							uc001qlf.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(2065-2067)TTT>TTC		forkhead box M1 isoform 2							58.0	62.0	61.0					12																	2968029		2203	4300	6503	SO:0001819	synonymous_variant	2305				cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding	g.chr12:2968029A>G	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.2067T>C	12.37:g.2968029A>G			Somatic				uc001qld.2_Intron|FOXM1_uc001qle.2_Silent_p.F727F|FOXM1_uc001qlg.2_Silent_p.F674F|FOXM1_uc009zea.2_Silent_p.F674F|FOXM1_uc009zeb.2_Silent_p.F673F	p.F689F	NM_021953	NP_068772	WXS	Illumina HiSeq	Unspecified	Q08050	FOXM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000622)		9	2332	-			689					O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Silent	SNP	ENST00000359843.3	37	c.2067T>C	CCDS8515.1																																																																																				0.567	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1	NM_021953		8	60	0	0	0	0.00308	0	8	60				
VWF	7450	broad.mit.edu	37	12	6182846	6182846	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:6182846G>T	ENST00000261405.5	-	8	1190	c.936C>A	c.(934-936)tgC>tgA	p.C312*		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	312	TIL 1.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GCAGGCTCTGGCAGGTCCTGG	0.542																																							uc001qnn.1		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12						c.(934-936)TGC>TGA		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)						121.0	99.0	107.0					12																	6182846		2203	4300	6503	SO:0001587	stop_gained	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6182846G>T		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.936C>A	12.37:g.6182846G>T	ENSP00000261405:p.Cys312*		Somatic				VWF_uc010set.1_Nonsense_Mutation_p.C312*	p.C312*	NM_000552	NP_000543	WXS	Illumina HiSeq	Unspecified	P04275	VWF_HUMAN			8	1186	-			312			TIL 1.		Q8TCE8|Q99806	Nonsense_Mutation	SNP	ENST00000261405.5	37	c.936C>A	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	G	39	7.807031	0.98501	.	.	ENSG00000110799	ENST00000261405	.	.	.	5.07	3.2	0.36748	.	0.000000	0.45361	D	0.000371	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.8298	0.46654	0.1429:0.0:0.8571:0.0	.	.	.	.	X	312	.	ENSP00000261405:C312X	C	-	3	2	VWF	6053107	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.432000	0.44784	2.352000	0.79861	0.491000	0.48974	TGC		0.542	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		12	75	1	0	9.05144e-12	0.001855	1.33873e-11	12	75				
GPR162	27239	broad.mit.edu	37	12	6933684	6933684	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:6933684G>T	ENST00000311268.3	+	2	1407	c.620G>T	c.(619-621)tGg>tTg	p.W207L	GPR162_ENST00000428545.2_Intron|GPR162_ENST00000382315.3_Intron	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						CAGACACTGTGGGCCCGGCCC	0.652																																							uc001qqw.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(619-621)TGG>TTG		G protein-coupled receptor 162 isoform 2							61.0	63.0	62.0					12																	6933684		2203	4300	6503	SO:0001583	missense	27239					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:6933684G>T	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.620G>T	12.37:g.6933684G>T	ENSP00000311528:p.Trp207Leu		Somatic				GPR162_uc010sfn.1_Missense_Mutation_p.W207L|GPR162_uc001qqx.1_Intron|GPR162_uc009zfd.1_Intron|GPR162_uc001qqy.1_5'UTR	p.W207L	NM_019858	NP_062832	WXS	Illumina HiSeq	Unspecified	Q16538	GP162_HUMAN			2	1155	+			207			Cytoplasmic (Potential).		Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	ENST00000311268.3	37	c.620G>T	CCDS8563.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548721	0.45383	.	.	ENSG00000250510	ENST00000311268	T	0.31769	1.48	4.48	3.59	0.41128	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.16557	0.0398	N	0.19112	0.55	0.80722	D	1	B;B	0.18461	0.028;0.022	B;B	0.21546	0.035;0.012	T	0.05178	-1.0901	9	0.10111	T	0.7	.	7.5769	0.27942	0.0841:0.0:0.7526:0.1634	.	207;207	B7Z3U3;Q16538	.;GP162_HUMAN	L	207	ENSP00000311528:W207L	ENSP00000311528:W207L	W	+	2	0	GPR162	6803945	.	.	1.000000	0.80357	0.996000	0.88848	.	.	1.117000	0.41842	0.491000	0.48974	TGG		0.652	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	NM_019858		14	77	1	0	2.61681e-11	0.00245	3.82809e-11	14	77				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		6	8	1	0	8.12818e-05	0.001984	9.57097e-05	6	8				
PUS7L	83448	broad.mit.edu	37	12	44124184	44124184	+	Missense_Mutation	SNP	C	C	A	rs142156360	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:44124184C>A	ENST00000416848.2	-	9	2589	c.2101G>T	c.(2101-2103)Gtt>Ttt	p.V701F	PUS7L_ENST00000344862.5_Missense_Mutation_p.V701F|PUS7L_ENST00000431332.3_Missense_Mutation_p.V388F|PUS7L_ENST00000551923.1_Missense_Mutation_p.V701F	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	701					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		CAGTTTTAAACGTCATGCTTC	0.373																																							uc001rnq.3		NA																	0				pancreas(1)	1						c.(2101-2103)GTT>TTT		pseudouridylate synthase 7 homolog (S.							61.0	59.0	60.0					12																	44124184		2203	4299	6502	SO:0001583	missense	83448				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding	g.chr12:44124184C>A	BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.2101G>T	12.37:g.44124184C>A	ENSP00000415899:p.Val701Phe		Somatic				PUS7L_uc001rnr.3_Missense_Mutation_p.V701F|PUS7L_uc001rns.3_Missense_Mutation_p.V701F|PUS7L_uc009zkb.2_Missense_Mutation_p.V388F	p.V701F	NM_001098615	NP_001092085	WXS	Illumina HiSeq	Unspecified	Q9H0K6	PUS7L_HUMAN		GBM - Glioblastoma multiforme(48;0.0402)	9	2590	-	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)	701					B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Missense_Mutation	SNP	ENST00000416848.2	37	c.2101G>T	CCDS8743.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437794	0.43326	.	.	ENSG00000129317	ENST00000416848;ENST00000344862;ENST00000551923;ENST00000431332	T;T;T;T	0.47528	1.77;1.77;1.77;0.84	5.14	-1.45	0.08828	.	0.462162	0.22770	N	0.055858	T	0.13329	0.0323	N	0.00926	-1.1	0.18873	N	0.999981	B	0.06786	0.001	B	0.08055	0.003	T	0.14868	-1.0457	10	0.51188	T	0.08	.	1.6596	0.02788	0.3672:0.3466:0.1477:0.1385	.	701	Q9H0K6	PUS7L_HUMAN	F	701;701;701;388	ENSP00000415899:V701F;ENSP00000343081:V701F;ENSP00000447706:V701F;ENSP00000398497:V388F	ENSP00000343081:V701F	V	-	1	0	PUS7L	42410451	0.006000	0.16342	0.462000	0.27118	0.904000	0.53231	-0.216000	0.09266	-0.040000	0.13580	0.655000	0.94253	GTT		0.373	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292		13	16	1	0	5.50884e-06	0.001368	6.75993e-06	13	16				
KRT5	3852	broad.mit.edu	37	12	52911448	52911448	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:52911448C>A	ENST00000252242.4	-	5	1408	c.1018G>T	c.(1018-1020)Gct>Tct	p.A340S		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	340	Coil 2.|Rod.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		TTGACCTCAGCGATGATGCTA	0.577																																							uc001san.2		NA																	0					0						c.(1018-1020)GCT>TCT		keratin 5							160.0	146.0	151.0					12																	52911448		2203	4300	6503	SO:0001583	missense	3852				epidermis development|hemidesmosome assembly	cytosol|keratin filament	protein binding|structural constituent of cytoskeleton	g.chr12:52911448C>A		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.1018G>T	12.37:g.52911448C>A	ENSP00000252242:p.Ala340Ser		Somatic				KRT5_uc009zmh.2_Missense_Mutation_p.A340S	p.A340S	NM_000424	NP_000415	WXS	Illumina HiSeq	Unspecified	P13647	K2C5_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	5	1181	-			340			Rod.|Coil 2.		Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	37	c.1018G>T	CCDS8830.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.19|11.19	1.566899|1.566899	0.28003|0.28003	.|.	.|.	ENSG00000186081|ENSG00000186081	ENST00000252242;ENST00000456000|ENST00000548409;ENST00000551188	T|.	0.75154|.	-0.91|.	6.03|6.03	3.13|3.13	0.36017|0.36017	Filament (1);|.	0.481081|.	0.19324|.	N|.	0.117074|.	T|T	0.45357|0.45357	0.1338|0.1338	M|M	0.66439|0.66439	2.03|2.03	0.09310|0.09310	N|N	1|1	P|.	0.42556|.	0.783|.	P|.	0.51701|.	0.677|.	T|T	0.34650|0.34650	-0.9820|-0.9820	10|5	0.59425|.	D|.	0.04|.	.|.	6.1072|6.1072	0.20079|0.20079	0.4474:0.3814:0.1089:0.0623|0.4474:0.3814:0.1089:0.0623	.|.	340|.	P13647|.	K2C5_HUMAN|.	S|L	340;305|47;154	ENSP00000252242:A340S|.	ENSP00000252242:A340S|.	A|R	-|-	1|2	0|0	KRT5|KRT5	51197715|51197715	0.002000|0.002000	0.14202|0.14202	0.016000|0.016000	0.15963|0.15963	0.273000|0.273000	0.26683|0.26683	0.110000|0.110000	0.15437|0.15437	0.379000|0.379000	0.24794|0.24794	0.655000|0.655000	0.94253|0.94253	GCT|CGC		0.577	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1			19	127	1	0	2.39187e-15	0.008871	3.80338e-15	19	127				
SMUG1	23583	broad.mit.edu	37	12	54577464	54577464	+	Silent	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:54577464T>A	ENST00000508394.2	-	2	323	c.261A>T	c.(259-261)ggA>ggT	p.G87G	SMUG1_ENST00000505128.1_Silent_p.G87G|SMUG1_ENST00000514196.1_Silent_p.G87G|SMUG1_ENST00000337581.3_Silent_p.G87G|SMUG1_ENST00000401977.2_Silent_p.G87G|SMUG1_ENST00000513838.1_Silent_p.G87G|SMUG1_ENST00000514685.1_Silent_p.G87G|SMUG1_ENST00000506595.1_Silent_p.G87G|SMUG1_ENST00000243112.5_Silent_p.G87G|SMUG1_ENST00000505662.1_Intron	NM_001243787.1|NM_001243788.1|NM_014311.2	NP_001230716.1|NP_001230717.1|NP_055126.1	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional uracil-DNA glycosylase 1	87				Missing (in Ref. 3; BAC03670). {ECO:0000305}.	base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA N-glycosylase activity (GO:0019104)|oxidized pyrimidine nucleobase lesion DNA N-glycosylase activity (GO:0000703)|single-strand selective uracil DNA N-glycosylase activity (GO:0017065)|uracil DNA N-glycosylase activity (GO:0004844)			kidney(1)|large_intestine(4)|lung(1)	6						TGCCAAAAGGTCCAGGGTTCA	0.582								Base excision repair (BER), DNA glycosylases																															uc001sff.1		NA																	0					0						c.(259-261)GGA>GGT	BER_DNA_glycosylases	single-strand-selective monofunctional							66.0	59.0	61.0					12																	54577464		2203	4300	6503	SO:0001819	synonymous_variant	23583				depyrimidination	nucleolus|nucleoplasm	DNA binding|protein binding|single-strand selective uracil DNA N-glycosylase activity	g.chr12:54577464T>A	AF125182	CCDS8874.1, CCDS58239.1	12q13.13	2013-10-28			ENSG00000123415	ENSG00000123415			17148	protein-coding gene	gene with protein product		607753				10074426, 11526119	Standard	NM_014311		Approved	UNG3, FDG, HMUDG	uc009znf.2	Q53HV7	OTTHUMG00000160068	ENST00000508394.2:c.261A>T	12.37:g.54577464T>A			Somatic				SMUG1_uc001sfa.1_5'Flank|SMUG1_uc001sfe.1_Silent_p.G87G|SMUG1_uc001sfg.1_Silent_p.G87G|SMUG1_uc009znf.1_Silent_p.G87G|SMUG1_uc001sfb.3_Silent_p.G87G|SMUG1_uc001sfc.3_Silent_p.G87G|SMUG1_uc001sfd.3_Silent_p.G87G	p.G87G	NM_014311	NP_055126	WXS	Illumina HiSeq	Unspecified	Q53HV7	SMUG1_HUMAN			3	390	-			87	Missing (in Ref. 3; BAC03670).|G->A,S: Impaired the damage-excising activity for U/G, hoU/G, hmU/A and fU/A.|G->F: No damage-excising activity.				A8K2K9|O95862|Q0D2M0|Q8NB71|Q9BWC8	Silent	SNP	ENST00000508394.2	37	c.261A>T	CCDS8874.1																																																																																				0.582	SMUG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359074.3	NM_014311		8	57	0	0	0	0.004482	0	8	57				
ATP5B	506	broad.mit.edu	37	12	57033788	57033788	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:57033788G>A	ENST00000262030.3	-	8	1313	c.1263C>T	c.(1261-1263)gcC>gcT	p.A421A	ATP5B_ENST00000552919.1_Silent_p.A410A|ATP5B_ENST00000550162.1_5'UTR	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	421					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCACCCCACGGGCAACATCGT	0.502																																							uc001slr.2		NA																	0				ovary(1)	1						c.(1261-1263)GCC>GCT		mitochondrial ATP synthase beta subunit							95.0	82.0	87.0					12																	57033788		2203	4300	6503	SO:0001819	synonymous_variant	506				angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism	g.chr12:57033788G>A	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1263C>T	12.37:g.57033788G>A			Somatic					p.A421A	NM_001686	NP_001677	WXS	Illumina HiSeq	Unspecified	P06576	ATPB_HUMAN			8	1368	-			421					A8K4X0|Q14283	Silent	SNP	ENST00000262030.3	37	c.1263C>T	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.411665	0.25465	.	.	ENSG00000110955	ENST00000552959	.	.	.	5.77	1.85	0.25348	.	.	.	.	.	T	0.52837	0.1759	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38607	-0.9653	4	.	.	.	-19.223	5.4156	0.16372	0.2802:0.0:0.591:0.1288	.	.	.	.	S	358	.	.	P	-	1	0	ATP5B	55320055	0.996000	0.38824	0.999000	0.59377	0.997000	0.91878	0.291000	0.18994	0.067000	0.16545	0.655000	0.94253	CCG		0.502	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686		13	59	0	0	0	0.00245	0	13	59				
CYP27B1	1594	broad.mit.edu	37	12	58160787	58160787	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:58160787T>C	ENST00000228606.4	-	1	247	c.38A>G	c.(37-39)cAt>cGt	p.H13R	CYP27B1_ENST00000546496.1_5'Flank	NM_000785.3	NP_000776.1	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B, polypeptide 1	13					bone mineralization (GO:0030282)|calcitriol biosynthetic process from calciol (GO:0036378)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|decidualization (GO:0046697)|G1 to G0 transition (GO:0070314)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of bone mineralization (GO:0030500)|response to estrogen (GO:0043627)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	calcidiol 1-monooxygenase activity (GO:0004498)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|urinary_tract(1)	15	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Alfacalcidol(DB01436)|Calcidiol(DB00146)|Corticotropin(DB01285)|Ergocalciferol(DB00153)	GCGGACGCGATGGAACACTCT	0.617																																							uc001spz.1		NA																	0				central_nervous_system(3)	3						c.(37-39)CAT>CGT		cytochrome P450, family 27, subfamily B,	Calcidiol(DB00146)|Calcitriol(DB00136)|Ergocalciferol(DB00153)						82.0	97.0	92.0					12																	58160787		2203	4300	6503	SO:0001583	missense	1594				bone mineralization|calcium ion homeostasis|calcium ion transport|decidualization|G1 to G0 transition|hormone biosynthetic process|negative regulation of calcidiol 1-monooxygenase activity|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of keratinocyte differentiation|positive regulation of vitamin D 24-hydroxylase activity|positive regulation of vitamin D receptor signaling pathway|regulation of bone mineralization|response to estrogen stimulus|response to interferon-gamma|response to lipopolysaccharide|response to tumor necrosis factor|response to vitamin D|vitamin D biosynthetic process|xenobiotic metabolic process	mitochondrial outer membrane	calcidiol 1-monooxygenase activity|electron carrier activity|heme binding	g.chr12:58160787T>C	AB006987	CCDS8954.1	12q14.1	2013-11-13	2003-01-14		ENSG00000111012	ENSG00000111012		"""Cytochrome P450s"""	2606	protein-coding gene	gene with protein product	"""VDDR I"", ""1alpha(OH)ase"", ""25-Hydroxyvitamin D3 1alpha-hydroxylase"""	609506	"""cytochrome P450, subfamily XXVIIB (25-hydroxyvitamin D-1-alpha-hydroxylase), polypeptide 1"""	VDD1, PDDR		9295274, 9344864	Standard	NM_000785		Approved	CYP1, P450c1	uc001spz.1	O15528	OTTHUMG00000170457	ENST00000228606.4:c.38A>G	12.37:g.58160787T>C	ENSP00000228606:p.His13Arg		Somatic				CYP27B1_uc001sqa.1_5'UTR|CYP27B1_uc001sqb.1_5'Flank|CYP27B1_uc001sqc.1_5'Flank	p.H13R	NM_000785	NP_000776	WXS	Illumina HiSeq	Unspecified	O15528	CP27B_HUMAN	GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		1	190	-	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		13					B2RC61|Q548T3	Missense_Mutation	SNP	ENST00000228606.4	37	c.38A>G	CCDS8954.1	.	.	.	.	.	.	.	.	.	.	T	14.83	2.651281	0.47362	.	.	ENSG00000111012	ENST00000228606	T	0.75260	-0.92	5.26	4.11	0.48088	.	0.371712	0.29152	N	0.013000	T	0.50429	0.1615	N	0.08118	0	0.21897	N	0.999485	B	0.10296	0.003	B	0.04013	0.001	T	0.31998	-0.9923	10	0.22706	T	0.39	.	7.9549	0.30035	0.0:0.1666:0.0:0.8334	.	13	O15528	CP27B_HUMAN	R	13	ENSP00000228606:H13R	ENSP00000228606:H13R	H	-	2	0	CYP27B1	56447054	0.307000	0.24500	0.877000	0.34402	0.399000	0.30720	2.157000	0.42320	1.009000	0.39289	0.533000	0.62120	CAT		0.617	CYP27B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409248.1	NM_000785		24	132	0	0	0	0.003954	0	24	132				
SRGAP1	57522	broad.mit.edu	37	12	64519823	64519823	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:64519823T>G	ENST00000355086.3	+	19	2815	c.2291T>G	c.(2290-2292)tTc>tGc	p.F764C	SRGAP1_ENST00000357825.3_Missense_Mutation_p.F741C|SRGAP1_ENST00000543397.1_Missense_Mutation_p.F701C	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	764	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		GAACTATCCTTCAAGAAGGGT	0.512																																							uc010ssp.1		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(2290-2292)TTC>TGC		SLIT-ROBO Rho GTPase activating protein 1							155.0	128.0	137.0					12																	64519823		2203	4300	6503	SO:0001583	missense	57522				axon guidance	cytosol		g.chr12:64519823T>G	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.2291T>G	12.37:g.64519823T>G	ENSP00000347198:p.Phe764Cys		Somatic				SRGAP1_uc001srv.2_Missense_Mutation_p.F701C	p.F764C	NM_020762	NP_065813	WXS	Illumina HiSeq	Unspecified	Q7Z6B7	SRGP1_HUMAN	GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)	19	2347	+			764			SH3.		Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	37	c.2291T>G	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.679030	0.88542	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.63096	-0.02;-0.02;-0.02	5.69	5.69	0.88448	Src homology-3 domain (4);	0.000000	0.37012	U	0.002282	D	0.84424	0.5469	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88669	0.3194	9	.	.	.	.	15.9458	0.79792	0.0:0.0:0.0:1.0	.	764;701	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	C	764;741;701	ENSP00000347198:F764C;ENSP00000350480:F741C;ENSP00000437948:F701C	.	F	+	2	0	SRGAP1	62806090	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.975000	0.88055	2.162000	0.67917	0.459000	0.35465	TTC		0.512	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1			12	53	0	0	0	0.000978	0	12	53				
NAP1L1	4673	broad.mit.edu	37	12	76444406	76444406	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:76444406C>G	ENST00000261182.8	-	12	1450	c.964G>C	c.(964-966)Gca>Cca	p.A322P	NAP1L1_ENST00000552342.1_Missense_Mutation_p.A333P|NAP1L1_ENST00000544816.1_Missense_Mutation_p.A139P|NAP1L1_ENST00000431879.3_Missense_Mutation_p.A254P|NAP1L1_ENST00000393263.3_Missense_Mutation_p.A322P|NAP1L1_ENST00000542344.1_Missense_Mutation_p.A280P|NAP1L1_ENST00000548044.1_Missense_Mutation_p.A281P|NAP1L1_ENST00000535020.2_Missense_Mutation_p.A322P|NAP1L1_ENST00000549596.1_Missense_Mutation_p.A322P|NAP1L1_ENST00000547773.1_Missense_Mutation_p.A259P|NAP1L1_ENST00000547993.1_Missense_Mutation_p.A139P	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	322					DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				TCGAAGTCTGCAGCAAGGATA	0.348																																							uc001sxw.2		NA																	0				ovary(1)|skin(1)	2						c.(964-966)GCA>CCA		nucleosome assembly protein 1-like 1							76.0	71.0	73.0					12																	76444406		2203	4300	6503	SO:0001583	missense	4673				DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding	g.chr12:76444406C>G		CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.964G>C	12.37:g.76444406C>G	ENSP00000261182:p.Ala322Pro		Somatic				NAP1L1_uc001sxv.2_Missense_Mutation_p.A280P|NAP1L1_uc001sxz.2_Missense_Mutation_p.A253P|NAP1L1_uc001sxx.2_Missense_Mutation_p.A322P|NAP1L1_uc001sxy.2_Missense_Mutation_p.A259P|NAP1L1_uc010sty.1_Missense_Mutation_p.A279P|NAP1L1_uc010stz.1_Missense_Mutation_p.A139P|NAP1L1_uc010sua.1_Missense_Mutation_p.A322P|NAP1L1_uc001syb.2_Missense_Mutation_p.A322P|NAP1L1_uc001sya.2_Missense_Mutation_p.A280P|NAP1L1_uc001syc.2_Missense_Mutation_p.A333P	p.A322P	NM_139207	NP_631946	WXS	Illumina HiSeq	Unspecified	P55209	NP1L1_HUMAN			12	1376	-		Colorectal(145;0.09)	322					B3KNT8	Missense_Mutation	SNP	ENST00000261182.8	37	c.964G>C	CCDS9013.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658697	0.88154	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000431879;ENST00000547773;ENST00000544816;ENST00000542344;ENST00000535020;ENST00000549596;ENST00000547993;ENST00000552342;ENST00000548044	T;T;T;T;T;T;T;T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D;P;D	0.58970	0.98;0.984;0.98;0.984;0.983;0.886;0.983	P;D;P;D;D;P;P	0.66497	0.906;0.944;0.906;0.944;0.944;0.847;0.88	T	0.53222	-0.8469	10	0.35671	T	0.21	.	19.3891	0.94573	0.0:1.0:0.0:0.0	.	322;280;333;322;254;259;322	F5H4R6;B7Z9C2;F8W0J6;B3KNT8;B3KV44;F8W543;P55209	.;.;.;.;.;.;NP1L1_HUMAN	P	322;316;322;254;259;139;280;322;322;139;333;281	ENSP00000261182:A322P;ENSP00000450236:A316P;ENSP00000376947:A322P;ENSP00000409795:A254P;ENSP00000448167:A259P;ENSP00000437507:A139P;ENSP00000444759:A280P;ENSP00000445008:A322P;ENSP00000447793:A322P;ENSP00000448007:A139P;ENSP00000447196:A333P;ENSP00000449649:A281P	ENSP00000261182:A322P	A	-	1	0	NAP1L1	74730673	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.076000	0.57591	2.579000	0.87056	0.591000	0.81541	GCA		0.348	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405850.3	NM_139207		17	24	0	0	0	0.004007	0	17	24				
MYBPC1	4604	broad.mit.edu	37	12	102071069	102071069	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:102071069G>T	ENST00000550270.1	+	26	2985	c.2985G>T	c.(2983-2985)ttG>ttT	p.L995F	MYBPC1_ENST00000361466.2_Missense_Mutation_p.L1002F|MYBPC1_ENST00000551300.1_Missense_Mutation_p.L878F|MYBPC1_ENST00000361685.2_Missense_Mutation_p.L1002F|MYBPC1_ENST00000360610.2_Missense_Mutation_p.L995F|MYBPC1_ENST00000541119.1_Missense_Mutation_p.L965F|MYBPC1_ENST00000441232.1_Missense_Mutation_p.L995F|MYBPC1_ENST00000547405.1_Missense_Mutation_p.L951F|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000545503.2_Missense_Mutation_p.L977F|MYBPC1_ENST00000536007.1_Missense_Mutation_p.L958F|MYBPC1_ENST00000452455.2_Missense_Mutation_p.L995F|MYBPC1_ENST00000553190.1_Missense_Mutation_p.L977F|MYBPC1_ENST00000549145.1_Missense_Mutation_p.L1008F|MYBPC1_ENST00000392934.3_Missense_Mutation_p.L964F|MYBPC1_ENST00000547509.1_Missense_Mutation_p.L963F			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	995	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						TTACTGAATTGGTCATAGGGA	0.408																																							uc001tii.2		NA																	0				ovary(2)|liver(1)|skin(1)	4						c.(2983-2985)TTG>TTT		myosin binding protein C, slow type isoform 3							133.0	123.0	126.0					12																	102071069		2203	4300	6503	SO:0001583	missense	4604				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding	g.chr12:102071069G>T		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.2985G>T	12.37:g.102071069G>T	ENSP00000449702:p.Leu995Phe		Somatic				MYBPC1_uc001tig.2_Missense_Mutation_p.L1002F|MYBPC1_uc010svq.1_Missense_Mutation_p.L964F|MYBPC1_uc001tih.2_Missense_Mutation_p.L1002F|MYBPC1_uc001tij.2_Missense_Mutation_p.L977F|MYBPC1_uc010svr.1_Missense_Mutation_p.L977F|MYBPC1_uc010svs.1_Missense_Mutation_p.L995F|MYBPC1_uc010svt.1_Missense_Mutation_p.L965F|MYBPC1_uc010svu.1_Missense_Mutation_p.L958F|MYBPC1_uc001tik.2_Missense_Mutation_p.L951F|MYBPC1_uc001til.2_Missense_Mutation_p.L20F|MYBPC1_uc001tim.2_Missense_Mutation_p.L20F	p.L995F	NM_206820	NP_996556	WXS	Illumina HiSeq	Unspecified	Q00872	MYPC1_HUMAN			26	3087	+			995			Fibronectin type-III 3.		B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	ENST00000550270.1	37	c.2985G>T	CCDS9085.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.443710	0.63067	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	5.55	3.64	0.41730	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.41001	D	0.000980	D	0.95465	0.8527	H	0.99834	4.825	0.51482	D	0.99992	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999;1.0;0.999;1.0;1.0;1.0	D	0.94880	0.8038	10	0.87932	D	0	.	9.0435	0.36331	0.0:0.1845:0.523:0.2925	.	958;965;995;977;964;951;977;995;1002;1002	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.	F	951;995;995;995;964;963;1002;1008;977;977;958;965;1002;878;995	ENSP00000448175:L951F;ENSP00000400908:L995F;ENSP00000388989:L995F;ENSP00000353822:L995F;ENSP00000376665:L964F;ENSP00000447362:L963F;ENSP00000354845:L1002F;ENSP00000447660:L1008F;ENSP00000447900:L977F;ENSP00000440034:L977F;ENSP00000446128:L958F;ENSP00000442847:L965F;ENSP00000354849:L1002F;ENSP00000447116:L878F;ENSP00000449702:L995F	ENSP00000353822:L995F	L	+	3	2	MYBPC1	100595200	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.530000	0.23036	2.602000	0.87976	0.655000	0.94253	TTG		0.408	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1			28	57	1	0	7.38237e-10	0.00632	1.04792e-09	28	57				
WSCD2	9671	broad.mit.edu	37	12	108634140	108634140	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:108634140C>A	ENST00000332082.4	+	9	1982	c.1164C>A	c.(1162-1164)gaC>gaA	p.D388E	WSCD2_ENST00000549903.1_Missense_Mutation_p.D388E|WSCD2_ENST00000261400.3_Missense_Mutation_p.D388E|WSCD2_ENST00000547525.1_Missense_Mutation_p.D388E			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	388						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						GTGAGCGGGACCACTGGCGCA	0.622																																							uc001tms.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)	3						c.(1162-1164)GAC>GAA		WSC domain containing 2							114.0	122.0	119.0					12																	108634140		2049	4207	6256	SO:0001583	missense	9671					integral to membrane		g.chr12:108634140C>A		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.1164C>A	12.37:g.108634140C>A	ENSP00000331933:p.Asp388Glu		Somatic				WSCD2_uc001tmt.2_Missense_Mutation_p.D388E|WSCD2_uc001tmu.2_Missense_Mutation_p.D136E	p.D388E	NM_014653	NP_055468	WXS	Illumina HiSeq	Unspecified	Q2TBF2	WSCD2_HUMAN			8	1908	+			388					B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	c.1164C>A	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977863	0.34942	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.31247	1.5;4.68;1.5;4.68	4.81	3.92	0.45320	.	0.110348	0.64402	D	0.000003	T	0.19765	0.0475	N	0.21240	0.645	0.47819	D	0.999523	B;B	0.10296	0.003;0.001	B;B	0.10450	0.005;0.002	T	0.04825	-1.0924	10	0.18276	T	0.48	-54.1544	12.0875	0.53706	0.0:0.917:0.0:0.083	.	388;388	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	E	388	ENSP00000448047:D388E;ENSP00000261400:D388E;ENSP00000331933:D388E;ENSP00000447272:D388E	ENSP00000261400:D388E	D	+	3	2	WSCD2	107158270	0.994000	0.37717	1.000000	0.80357	0.996000	0.88848	0.386000	0.20702	1.253000	0.44018	0.650000	0.86243	GAC		0.622	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653		11	144	1	0	7.93312e-07	0.00245	1.00476e-06	11	144				
COQ5	84274	broad.mit.edu	37	12	120966864	120966864	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:120966864G>A	ENST00000288532.6	-	1	121	c.81C>T	c.(79-81)ctC>ctT	p.L27L	COQ5_ENST00000445328.2_Silent_p.L27L	NM_032314.3	NP_115690.3	Q5HYK3	COQ5_HUMAN	coenzyme Q5 homolog, methyltransferase (S. cerevisiae)	27					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	methyltransferase activity (GO:0008168)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(3)	20	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TACGAAGCCCGAGGAGCTGGC	0.637																																							uc001tyn.2		NA																	0				ovary(1)	1						c.(79-81)CTC>CTT		coenzyme Q5 homolog, methyltransferase							46.0	49.0	48.0					12																	120966864		2203	4300	6503	SO:0001819	synonymous_variant	84274				ubiquinone biosynthetic process	mitochondrion	methyltransferase activity	g.chr12:120966864G>A	AK057777	CCDS31912.1	12q24.31	2011-09-16	2006-04-04		ENSG00000110871	ENSG00000110871	2.1.1.201		28722	protein-coding gene	gene with protein product	"""2-methoxy-6-polyprenyl-1,4-benzoquinol methylase"""		"""coenzyme Q5 homolog, methyltransferase (yeast)"""				Standard	NM_032314		Approved	MGC4767	uc001tyn.3	Q5HYK3	OTTHUMG00000169375	ENST00000288532.6:c.81C>T	12.37:g.120966864G>A			Somatic				COQ5_uc001tyo.2_5'UTR|COQ5_uc010szj.1_Silent_p.L27L	p.L27L	NM_032314	NP_115690	WXS	Illumina HiSeq	Unspecified	Q5HYK3	COQ5_HUMAN			1	101	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		27					B4DEJ4|Q32Q28|Q53HH0|Q96LV1|Q9BSP8	Silent	SNP	ENST00000288532.6	37	c.81C>T	CCDS31912.1																																																																																				0.637	COQ5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403767.2	NM_032314		9	71	0	0	0	0.008291	0	9	71				
RNF34	80196	broad.mit.edu	37	12	121855448	121855448	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:121855448C>G	ENST00000392464.2	+	3	436	c.367C>G	c.(367-369)Ctg>Gtg	p.L123V	RNF34_ENST00000392465.3_Missense_Mutation_p.L124V|RNF34_ENST00000555076.1_Intron|RNF34_ENST00000361234.5_Missense_Mutation_p.L123V					ring finger protein 34, E3 ubiquitin protein ligase											breast(1)|large_intestine(1)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		GGTGAAGGACCTGCGGCAGTA	0.433																																							uc001ual.1		NA																	0					0						c.(367-369)CTG>GTG		ring finger protein 34 isoform 2							109.0	101.0	104.0					12																	121855448		2203	4300	6503	SO:0001583	missense	80196				apoptosis	endomembrane system|membrane|nuclear speck	ligase activity|zinc ion binding	g.chr12:121855448C>G	AF306709, AB084914	CCDS9221.1, CCDS31915.1, CCDS73538.1	12q24.31	2012-02-23	2012-02-23			ENSG00000170633		"""RING-type (C3HC4) zinc fingers"""	17297	protein-coding gene	gene with protein product		608299	"""ring finger protein 34"""			12118383	Standard	NM_025126		Approved	RIFF, FLJ21786, RIF	uc001ual.2	Q969K3		ENST00000392464.2:c.367C>G	12.37:g.121855448C>G	ENSP00000376257:p.Leu123Val		Somatic				RNF34_uc010szw.1_Missense_Mutation_p.L124V|RNF34_uc001uak.1_Missense_Mutation_p.L124V|RNF34_uc001uam.1_Missense_Mutation_p.L123V	p.L123V	NM_025126	NP_079402	WXS	Illumina HiSeq	Unspecified	Q969K3	RNF34_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)	3	481	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		123			SAP 1.			Missense_Mutation	SNP	ENST00000392464.2	37	c.367C>G		.	.	.	.	.	.	.	.	.	.	C	25.1	4.602319	0.87157	.	.	ENSG00000170633	ENST00000361234;ENST00000392465;ENST00000554606;ENST00000392464;ENST00000354795	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.87	5.87	0.94306	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.84795	0.5551	M	0.85197	2.74	0.80722	D	1	D;D;D	0.71674	0.998;0.994;0.997	D;P;D	0.69142	0.962;0.89;0.949	D	0.86326	0.1695	10	0.87932	D	0	-13.4264	14.7159	0.69269	0.0:0.931:0.0:0.069	.	116;123;124	G3V504;Q969K3;Q969K3-2	.;RNF34_HUMAN;.	V	123;124;116;123;124	ENSP00000355137:L123V;ENSP00000376258:L124V;ENSP00000452096:L116V;ENSP00000376257:L123V	ENSP00000346850:L124V	L	+	1	2	RNF34	120339831	1.000000	0.71417	0.863000	0.33907	0.979000	0.70002	4.820000	0.62671	2.941000	0.99782	0.655000	0.94253	CTG		0.433	RNF34-005	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000413892.1	NM_194271		16	54	0	0	0	0.003163	0	16	54				
MMP17	4326	broad.mit.edu	37	12	132335517	132335517	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr12:132335517G>T	ENST00000360564.1	+	10	1612	c.1510G>T	c.(1510-1512)Ggc>Tgc	p.G504C	MMP17_ENST00000535004.1_Missense_Mutation_p.G44C|MMP17_ENST00000535291.1_Missense_Mutation_p.G420C	NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	504					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	AGTGCTGGATGGCGAGCTGGA	0.652																																							uc001ujc.1		NA																	0					0						c.(1510-1512)GGC>TGC		matrix metalloproteinase 17 preproprotein							42.0	43.0	43.0					12																	132335517		2203	4300	6503	SO:0001583	missense	4326				proteolysis	anchored to membrane|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding	g.chr12:132335517G>T	X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	ENST00000360564.1:c.1510G>T	12.37:g.132335517G>T	ENSP00000353767:p.Gly504Cys		Somatic				MMP17_uc001ujd.1_Missense_Mutation_p.G420C	p.G504C	NM_016155	NP_057239	WXS	Illumina HiSeq	Unspecified	Q9ULZ9	MMP17_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	10	1609	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		504			Hemopexin-like 4.		Q14850	Missense_Mutation	SNP	ENST00000360564.1	37	c.1510G>T	CCDS31927.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162743	0.57368	.	.	ENSG00000198598	ENST00000360564;ENST00000535291;ENST00000535004	T;T;T	0.02552	4.25;4.25;4.25	4.91	0.582	0.17412	Hemopexin/matrixin (2);	0.262993	0.41938	D	0.000792	T	0.09686	0.0238	M	0.72894	2.215	0.32090	N	0.591979	D	0.67145	0.996	D	0.64506	0.926	T	0.02646	-1.1129	10	0.62326	D	0.03	.	8.4334	0.32773	0.7739:0.0:0.2261:0.0	.	504	Q9ULZ9	MMP17_HUMAN	C	504;420;44	ENSP00000353767:G504C;ENSP00000441106:G420C;ENSP00000445620:G44C	ENSP00000353767:G504C	G	+	1	0	MMP17	130901470	0.985000	0.35326	0.785000	0.31869	0.820000	0.46376	1.405000	0.34635	-0.022000	0.13986	0.491000	0.48974	GGC		0.652	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397757.1	NM_016155		7	18	1	0	0.00621372	0.006214	0.00695023	7	18				
SACS	26278	broad.mit.edu	37	13	23913373	23913373	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:23913373C>A	ENST00000382292.3	-	9	4915	c.4642G>T	c.(4642-4644)Gga>Tga	p.G1548*	SACS_ENST00000382298.3_Nonsense_Mutation_p.G1548*|SACS_ENST00000402364.1_Nonsense_Mutation_p.G798*			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1548					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TCAACTTCTCCCCTTTTTAAA	0.368																																							uc001uon.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(4642-4644)GGA>TGA		sacsin							71.0	73.0	72.0					13																	23913373		2203	4298	6501	SO:0001587	stop_gained	26278				cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding	g.chr13:23913373C>A	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4642G>T	13.37:g.23913373C>A	ENSP00000371729:p.Gly1548*		Somatic				SACS_uc001uoo.2_Nonsense_Mutation_p.G1401*|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	p.G1548*	NM_014363	NP_055178	WXS	Illumina HiSeq	Unspecified	Q9NZJ4	SACS_HUMAN		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)	10	5231	-		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	1548					O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Nonsense_Mutation	SNP	ENST00000382292.3	37	c.4642G>T	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	53	20.529725	0.99931	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	.	.	.	5.96	4.25	0.50352	.	0.758596	0.13114	N	0.412750	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	8.7463	0.34589	0.0:0.6998:0.0:0.3002	.	.	.	.	X	1548;798;1548	.	ENSP00000371729:G1548X	G	-	1	0	SACS	22811373	0.959000	0.32827	0.270000	0.24601	0.271000	0.26615	3.755000	0.55197	0.873000	0.35799	-0.142000	0.14014	GGA		0.368	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		15	42	1	0	1.5739e-10	0.004007	2.2629e-10	15	42				
RFC3	5983	broad.mit.edu	37	13	34404941	34404941	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:34404941G>T	ENST00000380071.3	+	6	789	c.659G>T	c.(658-660)tGt>tTt	p.C220F	RNU5A-4P_ENST00000516588.1_RNA|RFC3_ENST00000434425.1_Missense_Mutation_p.C220F	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	220					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		GAGAAGTCTTGTAGAAATCTC	0.428																																							uc001uuz.2		NA																	0					0						c.(658-660)TGT>TTT		replication factor C 3 isoform 1							83.0	84.0	84.0					13																	34404941		2203	4300	6503	SO:0001583	missense	5983				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|response to organophosphorus|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding	g.chr13:34404941G>T		CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.659G>T	13.37:g.34404941G>T	ENSP00000369411:p.Cys220Phe		Somatic				RFC3_uc001uva.2_Missense_Mutation_p.C220F|RFC3_uc010ted.1_Missense_Mutation_p.C220F	p.C220F	NM_002915	NP_002906	WXS	Illumina HiSeq	Unspecified	P40938	RFC3_HUMAN		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)	6	769	+		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)	220					C9JU95|O15252|Q5W0E8	Missense_Mutation	SNP	ENST00000380071.3	37	c.659G>T	CCDS9352.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505754	0.26949	.	.	ENSG00000133119	ENST00000380071;ENST00000434425	T;T	0.41065	1.01;1.01	5.5	4.65	0.58169	.	0.227364	0.52532	D	0.000063	T	0.31979	0.0814	L	0.29908	0.895	0.29206	N	0.874884	B;B;B	0.19331	0.019;0.035;0.004	B;B;B	0.15052	0.009;0.012;0.004	T	0.30327	-0.9982	10	0.66056	D	0.02	-1.5646	12.8113	0.57641	0.0786:0.0:0.9214:0.0	.	220;220;220	B4DKE6;C9JU95;P40938	.;.;RFC3_HUMAN	F	220	ENSP00000369411:C220F;ENSP00000401001:C220F	ENSP00000369411:C220F	C	+	2	0	RFC3	33302941	1.000000	0.71417	0.998000	0.56505	0.236000	0.25371	5.293000	0.65680	2.591000	0.87537	0.655000	0.94253	TGT		0.428	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044450.2	NM_002915		9	49	1	0	6.40141e-05	0.000978	7.57764e-05	9	49				
DCLK1	9201	broad.mit.edu	37	13	36410270	36410270	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:36410270C>T	ENST00000360631.3	-	8	1340	c.1129G>A	c.(1129-1131)Gag>Aag	p.E377K	DCLK1_ENST00000379893.1_Missense_Mutation_p.E70K|DCLK1_ENST00000255448.4_Missense_Mutation_p.E377K			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	377					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		AAGCCTTCCTCCGACACTTCT	0.358																																							uc001uvf.2		NA																	0				stomach(6)|ovary(2)|skin(1)	9						c.(1129-1131)GAG>AAG		doublecortin-like kinase 1							195.0	186.0	189.0					13																	36410270		2203	4300	6503	SO:0001583	missense	9201				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity	g.chr13:36410270C>T	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1129G>A	13.37:g.36410270C>T	ENSP00000353846:p.Glu377Lys		Somatic				DCLK1_uc001uve.3_Missense_Mutation_p.E70K|DCLK1_uc010teh.1_Missense_Mutation_p.E70K|DCLK1_uc010abk.2_Intron	p.E377K	NM_004734	NP_004725	WXS	Illumina HiSeq	Unspecified	O15075	DCLK1_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)	8	1362	-		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	377					B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37	c.1129G>A		.	.	.	.	.	.	.	.	.	.	C	16.81	3.226982	0.58668	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.67171	-0.2;-0.2;-0.25	6.04	6.04	0.98038	.	0.586701	0.17827	N	0.160642	T	0.58779	0.2146	L	0.34521	1.04	0.80722	D	1	B;B;B	0.28783	0.006;0.222;0.006	B;B;B	0.32624	0.006;0.149;0.006	T	0.54214	-0.8327	10	0.06365	T	0.9	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	70;377;70	O15075-4;O15075-2;O15075-3	.;.;.	K	69;377;377;70;377	ENSP00000255448:E377K;ENSP00000353846:E377K;ENSP00000369223:E70K	ENSP00000255448:E377K	E	-	1	0	DCLK1	35308270	1.000000	0.71417	0.972000	0.41901	0.990000	0.78478	7.034000	0.76511	2.873000	0.98535	0.563000	0.77884	GAG		0.358	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734		31	95	0	0	0	0.002836	0	31	95				
SPG20	23111	broad.mit.edu	37	13	36909680	36909680	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:36909680C>A	ENST00000451493.1	-	2	505	c.288G>T	c.(286-288)gaG>gaT	p.E96D	SPG20_ENST00000438666.2_Missense_Mutation_p.E96D|SPG20_ENST00000494062.2_Missense_Mutation_p.E96D|SPG20_ENST00000495510.1_5'UTR|SPG20_ENST00000355182.4_Missense_Mutation_p.E96D	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	96					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		CAAGACCCTTCTCTAGAATTT	0.448																																							uc001uvn.2		NA																	0					0						c.(286-288)GAG>GAT		spartin							62.0	63.0	62.0					13																	36909680		2203	4300	6503	SO:0001583	missense	23111				cell death	cytoplasm	ubiquitin protein ligase binding	g.chr13:36909680C>A	AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.288G>T	13.37:g.36909680C>A	ENSP00000414147:p.Glu96Asp		Somatic				SPG20_uc010ten.1_Missense_Mutation_p.E96D|SPG20_uc001uvm.2_Missense_Mutation_p.E96D|SPG20_uc001uvo.2_Missense_Mutation_p.E96D|SPG20_uc001uvq.2_Missense_Mutation_p.E96D|SPG20_uc001uvp.2_Missense_Mutation_p.E96D	p.E96D	NM_001142296	NP_001135768	WXS	Illumina HiSeq	Unspecified	Q8N0X7	SPG20_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)	3	558	-		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	96					O60349|Q86Y67|Q9H1T2|Q9H1T3	Missense_Mutation	SNP	ENST00000451493.1	37	c.288G>T	CCDS9356.1	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861765	0.32884	.	.	ENSG00000133104	ENST00000438666;ENST00000355182;ENST00000451493;ENST00000423217	D;D;D	0.90676	-2.71;-2.71;-2.71	5.96	4.19	0.49359	.	0.046407	0.85682	N	0.000000	D	0.87285	0.6139	M	0.72118	2.19	0.42783	D	0.99387	B;B;B	0.21821	0.024;0.061;0.024	B;B;B	0.16289	0.014;0.015;0.014	D	0.84169	0.0433	10	0.54805	T	0.06	-25.562	5.2722	0.15630	0.1274:0.6286:0.1236:0.1204	.	96;96;96	A8K6Q9;B3KMI3;Q8N0X7	.;.;SPG20_HUMAN	D	96	ENSP00000406061:E96D;ENSP00000347314:E96D;ENSP00000414147:E96D	ENSP00000347314:E96D	E	-	3	2	SPG20	35807680	0.976000	0.34144	1.000000	0.80357	0.557000	0.35523	0.140000	0.16056	1.491000	0.48482	0.650000	0.86243	GAG		0.448	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044494.2			23	72	1	0	5.35047e-06	0.00333	6.58973e-06	23	72				
TRPC4	7223	broad.mit.edu	37	13	38320488	38320488	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:38320488C>A	ENST00000379705.3	-	3	1340	c.483G>T	c.(481-483)ttG>ttT	p.L161F	TRPC4_ENST00000338947.5_Intron|TRPC4_ENST00000447043.1_Missense_Mutation_p.L161F|TRPC4_ENST00000379679.1_Intron|TRPC4_ENST00000355779.2_Missense_Mutation_p.L161F|TRPC4_ENST00000426868.2_Missense_Mutation_p.L161F|TRPC4_ENST00000379673.2_Missense_Mutation_p.L161F|TRPC4_ENST00000379681.3_Missense_Mutation_p.L161F|TRPC4_ENST00000358477.2_Missense_Mutation_p.L161F			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	161	Multimerization domain. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CTTTCTGAACCAAGAGTTTTA	0.463																																							uc001uws.2		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(481-483)TTG>TTT		transient receptor potential cation channel,							88.0	97.0	94.0					13																	38320488		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38320488C>A	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.483G>T	13.37:g.38320488C>A	ENSP00000369027:p.Leu161Phe		Somatic				TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Missense_Mutation_p.L161F|TRPC4_uc010tey.1_Missense_Mutation_p.L161F|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Missense_Mutation_p.L161F|TRPC4_uc010aby.2_Missense_Mutation_p.L161F	p.L161F	NM_016179	NP_057263	WXS	Illumina HiSeq	Unspecified	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	3	718	-			161			Cytoplasmic (Potential).|ANK 4.|Multimerization domain (By similarity).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.483G>T	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623225	0.46840	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55;-2.55;-2.55;-2.55	5.82	-0.484	0.12071	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.91486	0.7312	M	0.74647	2.275	0.45946	D	0.998771	D;P;D;D;D	0.89917	1.0;0.907;0.999;1.0;1.0	D;P;D;D;D	0.97110	1.0;0.517;0.996;1.0;1.0	D	0.87546	0.2462	10	0.49607	T	0.09	-17.0016	5.6231	0.17467	0.1974:0.4284:0.0:0.3742	.	161;161;161;161;161	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-2;Q9UBN4	.;.;.;.;TRPC4_HUMAN	F	161	ENSP00000369027:L161F;ENSP00000369003:L161F;ENSP00000410133:L161F;ENSP00000348025:L161F;ENSP00000351264:L161F;ENSP00000368995:L161F;ENSP00000414316:L161F	ENSP00000348025:L161F	L	-	3	2	TRPC4	37218488	0.693000	0.27728	0.944000	0.38274	0.588000	0.36517	-0.147000	0.10234	-0.033000	0.13736	0.467000	0.42956	TTG		0.463	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		36	112	1	0	3.78316e-11	0.00623	5.4983e-11	36	112				
COG6	57511	broad.mit.edu	37	13	40233511	40233511	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:40233511A>T	ENST00000455146.3	+	2	214	c.164A>T	c.(163-165)gAa>gTa	p.E55V	COG6_ENST00000416691.1_Missense_Mutation_p.E55V	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	55					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		GAGATGTTAGAAGCTCTCAAG	0.323																																							uc001uxh.2		NA																	0				kidney(1)|skin(1)	2						c.(163-165)GAA>GTA		component of oligomeric golgi complex 6 isoform							82.0	81.0	82.0					13																	40233511		2203	4300	6503	SO:0001583	missense	57511				protein transport	Golgi membrane|Golgi transport complex		g.chr13:40233511A>T	AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.164A>T	13.37:g.40233511A>T	ENSP00000397441:p.Glu55Val		Somatic				COG6_uc001uxi.2_Missense_Mutation_p.E3V|COG6_uc010acb.2_Missense_Mutation_p.E55V	p.E55V	NM_020751	NP_065802	WXS	Illumina HiSeq	Unspecified	Q9Y2V7	COG6_HUMAN		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)	2	264	+		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)	55					Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	ENST00000455146.3	37	c.164A>T	CCDS9370.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.518268	0.85495	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000422759;ENST00000455146	T;T;T	0.57907	0.37;0.37;0.37	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.70885	0.3275	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.79784	0.993;0.98	T	0.74266	-0.3721	10	0.66056	D	0.02	-28.2956	14.3104	0.66413	1.0:0.0:0.0:0.0	.	76;55	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	V	55;86;55;55	ENSP00000403733:E55V;ENSP00000412877:E55V;ENSP00000397441:E55V	ENSP00000255468:E86V	E	+	2	0	COG6	39131511	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	8.957000	0.93082	2.050000	0.60909	0.528000	0.53228	GAA		0.323	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044622.3			6	26	0	0	0	0.001168	0	6	26				
COG6	57511	broad.mit.edu	37	13	40261879	40261879	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:40261879G>T	ENST00000455146.3	+	10	1002	c.952G>T	c.(952-954)Gct>Tct	p.A318S	COG6_ENST00000416691.1_Missense_Mutation_p.A318S	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	318					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		GCTCCATCAAGCTACTGCTTC	0.378																																							uc001uxh.2		NA																	0				kidney(1)|skin(1)	2						c.(952-954)GCT>TCT		component of oligomeric golgi complex 6 isoform							110.0	103.0	106.0					13																	40261879		2203	4300	6503	SO:0001583	missense	57511				protein transport	Golgi membrane|Golgi transport complex		g.chr13:40261879G>T	AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.952G>T	13.37:g.40261879G>T	ENSP00000397441:p.Ala318Ser		Somatic				COG6_uc001uxi.2_Missense_Mutation_p.A266S|COG6_uc010acb.2_Missense_Mutation_p.A318S	p.A318S	NM_020751	NP_065802	WXS	Illumina HiSeq	Unspecified	Q9Y2V7	COG6_HUMAN		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)	10	1052	+		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)	318					Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	ENST00000455146.3	37	c.952G>T	CCDS9370.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.556189	0.86231	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000455146	T;T	0.57273	0.41;0.41	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.69242	0.3089	M	0.67517	2.055	0.80722	D	1	D;D	0.61080	0.989;0.959	P;P	0.62298	0.9;0.626	T	0.65833	-0.6072	10	0.35671	T	0.21	-10.2994	18.7723	0.91898	0.0:0.0:1.0:0.0	.	339;318	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	S	318;349;318	ENSP00000403733:A318S;ENSP00000397441:A318S	ENSP00000255468:A349S	A	+	1	0	COG6	39159879	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	9.121000	0.94375	2.676000	0.91093	0.591000	0.81541	GCT		0.378	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044622.3			24	48	1	0	4.7796e-09	0.004656	6.63009e-09	24	48				
LCP1	3936	broad.mit.edu	37	13	46716508	46716508	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:46716508G>A	ENST00000398576.2	-	16	1809	c.1421C>T	c.(1420-1422)tCc>tTc	p.S474F	LCP1_ENST00000435666.2_Missense_Mutation_p.S43F|LCP1_ENST00000323076.2_Missense_Mutation_p.S474F			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	474	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		GCCAACCAGGGAGAACTTCGC	0.438			T	BCL6	NHL																																		uc001vaz.3		NA		Dom	yes		13	13q14.1-q14.3	3936	T	lymphocyte cytosolic protein 1 (L-plastin)			L	BCL6		NHL 		0				lung(4)|ovary(3)	7						c.(1420-1422)TCC>TTC		L-plastin							182.0	151.0	161.0					13																	46716508		2203	4300	6503	SO:0001583	missense	3936				regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding	g.chr13:46716508G>A	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1421C>T	13.37:g.46716508G>A	ENSP00000381581:p.Ser474Phe		Somatic				LCP1_uc010ack.2_Missense_Mutation_p.S43F|LCP1_uc001vay.3_Missense_Mutation_p.S71F|LCP1_uc001vba.3_Missense_Mutation_p.S474F	p.S474F	NM_002298	NP_002289	WXS	Illumina HiSeq	Unspecified	P13796	PLSL_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)	13	1547	-		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	474			Actin-binding 2.|CH 3.		B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	ENST00000398576.2	37	c.1421C>T	CCDS9403.1	.	.	.	.	.	.	.	.	.	.	G	31	5.079257	0.94050	.	.	ENSG00000136167	ENST00000323076;ENST00000398576;ENST00000435666	D;D;D	0.96073	-3.9;-3.9;-3.9	5.64	5.64	0.86602	Calponin homology domain (5);	0.048095	0.85682	N	0.000000	D	0.98409	0.9471	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.994;1.0	D	0.99308	1.0903	10	0.87932	D	0	-13.3506	18.6878	0.91571	0.0:0.0:1.0:0.0	.	43;474	B4DUA0;P13796	.;PLSL_HUMAN	F	474;474;43	ENSP00000315757:S474F;ENSP00000381581:S474F;ENSP00000405134:S43F	ENSP00000315757:S474F	S	-	2	0	LCP1	45614509	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	9.869000	0.99810	2.662000	0.90505	0.655000	0.94253	TCC		0.438	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	NM_002298		21	47	0	0	0	0.002299	0	21	47				
SETDB2	83852	broad.mit.edu	37	13	50034254	50034254	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:50034254A>G	ENST00000317257.8	+	3	853	c.28A>G	c.(28-30)Act>Gct	p.T10A	SETDB2_ENST00000258672.5_Missense_Mutation_p.T10A|SETDB2_ENST00000354234.4_Missense_Mutation_p.T10A	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	10					chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		CGATGCAAAAACTTTCTGGAT	0.328																																							uc001vcz.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(28-30)ACT>GCT		SET domain, bifurcated 2 isoform a							97.0	106.0	103.0					13																	50034254		2203	4300	6503	SO:0001583	missense	83852				cell division|chromosome segregation|heart looping|left/right axis specification|mitosis|negative regulation of transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone methyltransferase activity (H3-K9 specific)|zinc ion binding	g.chr13:50034254A>G	AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.28A>G	13.37:g.50034254A>G	ENSP00000326477:p.Thr10Ala		Somatic				SETDB2_uc010adg.2_5'UTR|SETDB2_uc001vcy.3_Missense_Mutation_p.T10A|SETDB2_uc010adh.2_Missense_Mutation_p.T10A|SETDB2_uc001vda.2_Missense_Mutation_p.T10A	p.T10A	NM_031915	NP_114121	WXS	Illumina HiSeq	Unspecified	Q96T68	SETB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)	3	934	+		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	10					Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	ENST00000317257.8	37	c.28A>G	CCDS9417.1	.	.	.	.	.	.	.	.	.	.	A	11.21	1.570293	0.28003	.	.	ENSG00000136169	ENST00000354234;ENST00000317257;ENST00000258672	D;D;T	0.85171	-1.95;-1.93;1.33	5.46	-1.48	0.08745	.	0.611476	0.18189	N	0.148899	T	0.64832	0.2634	N	0.04880	-0.145	0.30011	N	0.815154	P;B;B	0.37207	0.587;0.097;0.059	B;B;B	0.36464	0.225;0.032;0.021	T	0.62737	-0.6791	10	0.25751	T	0.34	.	9.1835	0.37156	0.4479:0.0:0.5521:0.0	.	10;10;10	Q96T68-3;Q96T68-2;Q96T68	.;.;SETB2_HUMAN	A	10	ENSP00000346175:T10A;ENSP00000326477:T10A;ENSP00000258672:T10A	ENSP00000258672:T10A	T	+	1	0	SETDB2	48932255	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	0.816000	0.27267	-0.080000	0.12685	0.533000	0.62120	ACT		0.328	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044925.1	NM_031915		50	108	0	0	0	0.00361	0	50	108				
ATP7B	540	broad.mit.edu	37	13	52544664	52544664	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:52544664C>A	ENST00000242839.4	-	3	1663	c.1507G>T	c.(1507-1509)Gtg>Ttg	p.V503L	ATP7B_ENST00000400366.3_Missense_Mutation_p.V392L|ATP7B_ENST00000542656.1_Missense_Mutation_p.V471L|ATP7B_ENST00000400370.3_Intron|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000418097.2_Missense_Mutation_p.V503L|ATP7B_ENST00000344297.5_Missense_Mutation_p.V503L|ATP7B_ENST00000448424.2_Missense_Mutation_p.V503L	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	503	HMA 5. {ECO:0000255|PROSITE- ProRule:PRU00280}.				cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	ATGTTAGACACACAGGATGCA	0.488									Wilson disease																														uc001vfw.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1507-1509)GTG>TTG		ATPase, Cu++ transporting, beta polypeptide							195.0	191.0	192.0					13																	52544664		2032	4187	6219	SO:0001583	missense	540	Wilson_disease	Familial Cancer Database		ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding	g.chr13:52544664C>A	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1507G>T	13.37:g.52544664C>A	ENSP00000242839:p.Val503Leu		Somatic				ATP7B_uc010adv.2_Intron|ATP7B_uc001vfx.2_Missense_Mutation_p.V503L|ATP7B_uc001vfy.2_Missense_Mutation_p.V392L|ATP7B_uc010tgt.1_Missense_Mutation_p.V503L|ATP7B_uc010tgu.1_Missense_Mutation_p.V503L|ATP7B_uc010tgv.1_Missense_Mutation_p.V503L|ATP7B_uc010tgw.1_Missense_Mutation_p.V471L	p.V503L	NM_000053	NP_000044	WXS	Illumina HiSeq	Unspecified	P35670	ATP7B_HUMAN		GBM - Glioblastoma multiforme(99;5.25e-08)	3	1664	-		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)	503			HMA 5.|Cytoplasmic (Potential).		Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	37	c.1507G>T	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529454	0.44969	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000448424;ENST00000418097;ENST00000542656	D;D;D;D;D;D	0.88509	-2.18;-2.18;-2.18;-2.18;-2.18;-2.39	5.46	4.62	0.57501	Heavy metal-associated domain, HMA (3);Heavy metal-associated domain, copper ion-binding (1);Heavy-metal-associated, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95671	0.8592	M	0.93898	3.47	0.52501	D	0.99995	P;B;P;B;D;B;B	0.89917	0.724;0.022;0.73;0.148;1.0;0.36;0.175	P;B;P;B;D;P;B	0.78314	0.54;0.035;0.776;0.24;0.991;0.485;0.262	D	0.96551	0.9408	10	0.87932	D	0	-22.1051	14.4386	0.67301	0.0:0.9288:0.0:0.0712	.	471;503;503;503;392;503;503	F6XIH0;E7ET55;B7ZLR4;F5H748;P35670-3;P35670-2;P35670	.;.;.;.;.;.;ATP7B_HUMAN	L	503;392;503;503;503;471	ENSP00000242839:V503L;ENSP00000383217:V392L;ENSP00000342559:V503L;ENSP00000416738:V503L;ENSP00000393343:V503L;ENSP00000443128:V471L	ENSP00000242839:V503L	V	-	1	0	ATP7B	51442665	1.000000	0.71417	0.999000	0.59377	0.101000	0.19017	6.090000	0.71397	1.309000	0.44985	-0.143000	0.13931	GTG		0.488	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053		40	160	1	0	1.03484e-13	0.005524	1.60495e-13	40	160				
KLF5	688	broad.mit.edu	37	13	73649905	73649905	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:73649905G>A	ENST00000377687.4	+	4	1791	c.1255G>A	c.(1255-1257)Gag>Aag	p.E419K	KLF5_ENST00000539231.1_Missense_Mutation_p.E328K	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	419					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E419Q(2)		breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		GCGATCGGATGAGCTGACCCG	0.592																																							uc001vje.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)|pancreas(1)	3						c.(1255-1257)GAG>AAG		Kruppel-like factor 5							61.0	60.0	61.0					13																	73649905		2203	4300	6503	SO:0001583	missense	688				transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr13:73649905G>A	D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.1255G>A	13.37:g.73649905G>A	ENSP00000366915:p.Glu419Lys		Somatic				KLF5_uc001vjd.2_Missense_Mutation_p.E328K	p.E419K	NM_001730	NP_001721	WXS	Illumina HiSeq	Unspecified	Q13887	KLF5_HUMAN		GBM - Glioblastoma multiforme(99;0.0011)	4	1579	+		Prostate(6;0.00187)|Breast(118;0.0735)	419			C2H2-type 2.		L0R3U5|L0R4T9|Q9UHP8	Missense_Mutation	SNP	ENST00000377687.4	37	c.1255G>A	CCDS9448.1	.	.	.	.	.	.	.	.	.	.	G	35	5.436306	0.96168	.	.	ENSG00000102554	ENST00000539231;ENST00000377687;ENST00000545883	T;T	0.51071	0.72;0.72	5.93	5.93	0.95920	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.58293	0.2112	N	0.17901	0.54	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62338	-0.6875	10	0.87932	D	0	.	20.3465	0.98790	0.0:0.0:1.0:0.0	.	419	Q13887	KLF5_HUMAN	K	328;419;399	ENSP00000440407:E328K;ENSP00000366915:E419K	ENSP00000366915:E419K	E	+	1	0	KLF5	72547906	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	9.869000	0.99810	2.798000	0.96311	0.655000	0.94253	GAG		0.592	KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045263.1			14	50	0	0	0	0.004007	0	14	50				
DOCK9	23348	broad.mit.edu	37	13	99549811	99549811	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:99549811G>A	ENST00000376460.1	-	15	1720	c.1640C>T	c.(1639-1641)gCc>gTc	p.A547V	DOCK9_ENST00000442173.1_Missense_Mutation_p.A547V|DOCK9_ENST00000448493.2_Missense_Mutation_p.A559V|DOCK9_ENST00000339416.2_Missense_Mutation_p.A548V	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	548					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCTGTAGATGGCAGAAAATCT	0.398																																							uc001vnt.2		NA																	0				central_nervous_system(1)	1						c.(1642-1644)GCC>GTC		dedicator of cytokinesis 9 isoform a							218.0	212.0	214.0					13																	99549811		1872	4106	5978	SO:0001583	missense	23348				blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity	g.chr13:99549811G>A	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.1640C>T	13.37:g.99549811G>A	ENSP00000365643:p.Ala547Val		Somatic				DOCK9_uc001vnw.2_Missense_Mutation_p.A547V|DOCK9_uc001vnv.1_RNA|DOCK9_uc010tir.1_Missense_Mutation_p.A548V|DOCK9_uc010tis.1_Missense_Mutation_p.A547V|DOCK9_uc010tit.1_Missense_Mutation_p.A548V|DOCK9_uc010afu.1_Missense_Mutation_p.A363V	p.A548V	NM_015296	NP_056111	WXS	Illumina HiSeq	Unspecified	Q9BZ29	DOCK9_HUMAN			15	1698	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		548					B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	c.1643C>T	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.964868	0.92791	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.04194	3.68;3.68;3.68;3.68	5.25	5.25	0.73442	.	0.172633	0.51477	D	0.000095	T	0.11367	0.0277	L	0.54323	1.7	0.49687	D	0.999815	B;P;B;B;B	0.39071	0.302;0.658;0.302;0.141;0.262	B;P;B;B;B	0.46026	0.254;0.501;0.254;0.113;0.12	T	0.08126	-1.0737	9	.	.	.	.	18.8671	0.92296	0.0:0.0:1.0:0.0	.	548;547;547;547;548	A6H8Z6;E9PFM9;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;DOCK9_HUMAN	V	547;548;548;548;547;548;559;547	ENSP00000365643:A547V;ENSP00000341086:A548V;ENSP00000401958:A559V;ENSP00000406883:A547V	.	A	-	2	0	DOCK9	98347812	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.467000	0.83353	0.655000	0.94253	GCC		0.398	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296		57	198	0	0	0	0.00361	0	57	198				
NALCN	259232	broad.mit.edu	37	13	101736089	101736089	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:101736089G>C	ENST00000251127.6	-	31	3637	c.3556C>G	c.(3556-3558)Cag>Gag	p.Q1186E		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1186					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGAAGAGGCTGTGCGATCTTC	0.498																																							uc001vox.1		NA																	0				ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(3556-3558)CAG>GAG		voltage gated channel like 1							72.0	72.0	72.0					13																	101736089		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101736089G>C	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3556C>G	13.37:g.101736089G>C	ENSP00000251127:p.Gln1186Glu		Somatic					p.Q1186E	NM_052867	NP_443099	WXS	Illumina HiSeq	Unspecified	Q8IZF0	NALCN_HUMAN			31	3745	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		1186			Cytoplasmic (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.3556C>G	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644129	0.67244	.	.	ENSG00000102452	ENST00000251127	D	0.97731	-4.51	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.97791	0.9275	M	0.74881	2.28	0.80722	D	1	B	0.30605	0.287	B	0.42959	0.403	D	0.98385	1.0560	10	0.87932	D	0	.	16.9487	0.86237	0.0:0.0:1.0:0.0	.	1186	Q8IZF0	NALCN_HUMAN	E	1186	ENSP00000251127:Q1186E	ENSP00000251127:Q1186E	Q	-	1	0	NALCN	100534090	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.357000	0.97099	2.441000	0.82636	0.650000	0.86243	CAG		0.498	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		14	41	0	0	0	0.00245	0	14	41				
NALCN	259232	broad.mit.edu	37	13	101890140	101890140	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:101890140G>A	ENST00000251127.6	-	12	1481	c.1400C>T	c.(1399-1401)cCa>cTa	p.P467L	NALCN_ENST00000376196.3_Missense_Mutation_p.P467L|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	467					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATAAAGATCTGGGTATACATG	0.323																																							uc001vox.1		NA																	0				ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(1399-1401)CCA>CTA		voltage gated channel like 1							167.0	181.0	176.0					13																	101890140		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101890140G>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1400C>T	13.37:g.101890140G>A	ENSP00000251127:p.Pro467Leu		Somatic				NALCN_uc001voy.2_Missense_Mutation_p.P182L|NALCN_uc001voz.2_Missense_Mutation_p.P467L|NALCN_uc001vpa.2_Missense_Mutation_p.P467L	p.P467L	NM_052867	NP_443099	WXS	Illumina HiSeq	Unspecified	Q8IZF0	NALCN_HUMAN			12	1589	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		467			Helical; Name=S3 of repeat II; (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.1400C>T	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490221	0.84962	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.97772	-4.53;-4.53	5.24	5.24	0.73138	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97952	0.9326	L	0.45228	1.405	0.80722	D	1	D;D;D	0.89917	0.993;1.0;0.993	D;D;D	0.79784	0.925;0.993;0.939	D	0.97817	1.0254	10	0.36615	T	0.2	.	19.1638	0.93546	0.0:0.0:1.0:0.0	.	467;467;467	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	L	467	ENSP00000251127:P467L;ENSP00000365367:P467L	ENSP00000251127:P467L	P	-	2	0	NALCN	100688141	1.000000	0.71417	0.997000	0.53966	0.860000	0.49131	9.414000	0.97362	2.593000	0.87608	0.491000	0.48974	CCA		0.323	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		16	228	0	0	0	0.00499	0	16	228				
ERCC5	2073	broad.mit.edu	37	13	103527858	103527858	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:103527858C>T	ENST00000355739.4	+	15	4589	c.3166C>T	c.(3166-3168)Cag>Tag	p.Q1056*	ERCC5_ENST00000375954.1_Nonsense_Mutation_p.Q289*|ERCC5_ENST00000472247.1_3'UTR	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	1056					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AGGAAAAACCCAGAAGAGAGG	0.408			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc001vpw.2		NA	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""			E		skin basal cell|skin squamous cell|melanoma			0				ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						c.(3166-3168)CAG>TAG	Direct_reversal_of_damage|NER	XPG-complementing protein							121.0	132.0	128.0					13																	103527858		2203	4300	6503	SO:0001587	stop_gained	2073	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding	g.chr13:103527858C>T	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.3166C>T	13.37:g.103527858C>T	ENSP00000347978:p.Gln1056*		Somatic					p.Q1056*	NM_000123	NP_000114	WXS	Illumina HiSeq	Unspecified	P28715	ERCC5_HUMAN			15	3609	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		1056					A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Nonsense_Mutation	SNP	ENST00000355739.4	37	c.3166C>T	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	C	52	18.613967	0.99908	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	.	.	.	5.14	3.3	0.37823	.	0.966932	0.08591	N	0.923102	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.8188	7.7522	0.28904	0.0:0.6891:0.155:0.1559	.	.	.	.	X	1481;1056;888;289	.	ENSP00000347978:Q1056X	Q	+	1	0	ERCC5	102325859	0.000000	0.05858	0.923000	0.36655	0.882000	0.50991	0.456000	0.21859	2.561000	0.86390	0.650000	0.86243	CAG		0.408	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1			25	102	0	0	0	0.00333	0	25	102				
F7	2155	broad.mit.edu	37	13	113768231	113768231	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:113768231C>T	ENST00000375581.3	+	5	422	c.387C>T	c.(385-387)atC>atT	p.I129I	F7_ENST00000541084.1_Silent_p.I60I|F7_ENST00000346342.3_Silent_p.I107I|F7_ENST00000473085.1_3'UTR	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	129	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.I129I(1)		large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	AGTCCTATATCTGCTTCTGCC	0.602																																							uc001vsv.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(385-387)ATC>ATT		coagulation factor VII isoform a precursor	Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)						92.0	88.0	89.0					13																	113768231		2203	4300	6503	SO:0001819	synonymous_variant	2155				anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity	g.chr13:113768231C>T		CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.387C>T	13.37:g.113768231C>T			Somatic				F7_uc010agp.1_Silent_p.I122I|F7_uc001vsw.2_Silent_p.I107I|F7_uc010tjt.1_Silent_p.I60I	p.I129I	NM_000131	NP_000122	WXS	Illumina HiSeq	Unspecified	P08709	FA7_HUMAN	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		5	438	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	129			EGF-like 1; calcium-binding (Potential).		B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Silent	SNP	ENST00000375581.3	37	c.387C>T	CCDS9528.1																																																																																				0.602	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045838.4	NM_000131		5	89	0	0	0	0.001168	0	5	89				
CUL4A	8451	broad.mit.edu	37	13	113887578	113887578	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:113887578C>T	ENST00000375440.4	+	6	684	c.600C>T	c.(598-600)atC>atT	p.I200I	CUL4A_ENST00000326335.4_Silent_p.I100I|CUL4A_ENST00000375441.3_Silent_p.I100I|CUL4A_ENST00000451881.1_Silent_p.I100I	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	200					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			TACTGCTGATCGAGCGCGAGA	0.512																																							uc010tjy.1		NA																	0				central_nervous_system(2)|skin(1)	3						c.(598-600)ATC>ATT		cullin 4A isoform 1							86.0	83.0	84.0					13																	113887578		2203	4300	6503	SO:0001819	synonymous_variant	8451				cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	ubiquitin protein ligase binding	g.chr13:113887578C>T	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.600C>T	13.37:g.113887578C>T			Somatic				CUL4A_uc010tjx.1_Silent_p.I100I|CUL4A_uc010agu.2_Silent_p.I61I|CUL4A_uc001vtl.1_5'Flank	p.I200I	NM_001008895	NP_001008895	WXS	Illumina HiSeq	Unspecified	Q13619	CUL4A_HUMAN	all cancers(43;0.112)		7	611	+	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	200					A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Silent	SNP	ENST00000375440.4	37	c.600C>T	CCDS41908.1																																																																																				0.512	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589		7	64	0	0	0	0.001984	0	7	64				
RASA3	22821	broad.mit.edu	37	13	114748770	114748770	+	Silent	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:114748770A>T	ENST00000334062.7	-	24	2614	c.2493T>A	c.(2491-2493)acT>acA	p.T831T	RASA3_ENST00000389544.4_Silent_p.T799T	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	831					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			AAATGGAATGAGTGGAGGTCT	0.592																																							uc001vui.2		NA																	0				lung(3)|skin(1)	4						c.(2491-2493)ACT>ACA		RAS p21 protein activator 3							105.0	104.0	104.0					13																	114748770		2203	4300	6503	SO:0001819	synonymous_variant	22821				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity	g.chr13:114748770A>T		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.2493T>A	13.37:g.114748770A>T			Somatic				RASA3_uc010tkk.1_Silent_p.T799T|RASA3_uc001vuj.2_Silent_p.T448T	p.T831T	NM_007368	NP_031394	WXS	Illumina HiSeq	Unspecified	Q14644	RASA3_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.128)		24	2624	-	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	831					A6NL15|F8W6X8|Q8IUY2	Silent	SNP	ENST00000334062.7	37	c.2493T>A	CCDS32016.1																																																																																				0.592	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368		24	59	0	0	0	0.002836	0	24	59				
RASA3	22821	broad.mit.edu	37	13	114780772	114780772	+	Missense_Mutation	SNP	C	C	T	rs370539205		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr13:114780772C>T	ENST00000334062.7	-	14	1439	c.1318G>A	c.(1318-1320)Gcc>Acc	p.A440T	RASA3_ENST00000389544.4_Missense_Mutation_p.A408T	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	440	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TCAGTGATGGCGTGGAAGACG	0.647																																							uc001vui.2		NA																	0				lung(3)|skin(1)	4						c.(1318-1320)GCC>ACC		RAS p21 protein activator 3		C	THR/ALA	0,4406		0,0,2203	117.0	100.0	106.0		1318	3.3	0.0	13		106	1,8599	1.2+/-3.3	0,1,4299	no	missense	RASA3	NM_007368.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	440/835	114780772	1,13005	2203	4300	6503	SO:0001583	missense	22821				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity	g.chr13:114780772C>T		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1318G>A	13.37:g.114780772C>T	ENSP00000335029:p.Ala440Thr		Somatic				RASA3_uc010tkk.1_Missense_Mutation_p.A408T|RASA3_uc001vuj.2_Missense_Mutation_p.A57T	p.A440T	NM_007368	NP_031394	WXS	Illumina HiSeq	Unspecified	Q14644	RASA3_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.128)		14	1449	-	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	440			Ras-GAP.		A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	37	c.1318G>A	CCDS32016.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720226	0.30503	0.0	1.16E-4	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.80214	-1.35;-1.35	5.07	3.34	0.38264	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.267542	0.35936	N	0.002897	T	0.70535	0.3235	L	0.34521	1.04	0.80722	D	1	B	0.09022	0.002	B	0.28784	0.094	T	0.59016	-0.7533	9	.	.	.	.	10.2263	0.43227	0.0:0.834:0.0:0.166	.	440	Q14644	RASA3_HUMAN	T	440;408	ENSP00000335029:A440T;ENSP00000374195:A408T	.	A	-	1	0	RASA3	113798874	0.991000	0.36638	0.002000	0.10522	0.010000	0.07245	2.982000	0.49337	0.526000	0.28541	0.591000	0.81541	GCC		0.647	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368		10	81	0	0	0	0.008291	0	10	81				
OR4K17	390436	broad.mit.edu	37	14	20586569	20586569	+	Missense_Mutation	SNP	C	C	A	rs560711784		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr14:20586569C>A	ENST00000315543.4	+	1	1004	c.1004C>A	c.(1003-1005)gCt>gAt	p.A335D		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CTCTGGAGAGCTTTTGTGAAT	0.378																																							uc001vwo.1		NA																	0				skin(3)	3						c.(1003-1005)GCT>GAT		olfactory receptor, family 4, subfamily K,							26.0	26.0	26.0					14																	20586569		2198	4296	6494	SO:0001583	missense	390436				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20586569C>A		CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.1004C>A	14.37:g.20586569C>A	ENSP00000319197:p.Ala335Asp		Somatic					p.A335D	NM_001004715	NP_001004715	WXS	Illumina HiSeq	Unspecified	Q8NGC6	OR4KH_HUMAN	Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)	1	1004	+	all_cancers(95;0.00108)		307			Cytoplasmic (Potential).		Q6IF12	Missense_Mutation	SNP	ENST00000315543.4	37	c.1004C>A	CCDS32030.1	.	.	.	.	.	.	.	.	.	.	.	8.066	0.769125	0.15983	.	.	ENSG00000176230	ENST00000315543	T	0.37411	1.2	2.46	0.493	0.16878	.	2.231340	0.03714	U	0.250746	T	0.21921	0.0528	N	0.11560	0.145	0.09310	N	1	B	0.17465	0.022	B	0.23275	0.045	T	0.28396	-1.0045	10	0.62326	D	0.03	.	4.6127	0.12411	0.0:0.6541:0.0:0.3459	.	307	Q8NGC6	OR4KH_HUMAN	D	335	ENSP00000319197:A335D	ENSP00000319197:A335D	A	+	2	0	OR4K17	19656409	0.000000	0.05858	0.003000	0.11579	0.031000	0.12232	-2.295000	0.01143	-0.033000	0.13736	0.404000	0.27445	GCT		0.378	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1			13	15	1	0	1.05317e-09	0.00245	1.48866e-09	13	15				
MYH6	4624	broad.mit.edu	37	14	23869595	23869595	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr14:23869595T>A	ENST00000356287.3	-	13	1480	c.1451A>T	c.(1450-1452)gAg>gTg	p.E484V	MYH6_ENST00000405093.3_Missense_Mutation_p.E484V			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	484	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CTGCAGCTTCTCGTTGGTGAA	0.537																																							uc001wjv.2		NA																	0				pancreas(2)|ovary(1)|skin(1)	4						c.(1450-1452)GAG>GTG		myosin heavy chain 6							130.0	103.0	112.0					14																	23869595		2203	4297	6500	SO:0001583	missense	4624				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle	g.chr14:23869595T>A	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1451A>T	14.37:g.23869595T>A	ENSP00000348634:p.Glu484Val		Somatic				MYH6_uc010akp.1_Missense_Mutation_p.E484V	p.E484V	NM_002471	NP_002462	WXS	Illumina HiSeq	Unspecified	P13533	MYH6_HUMAN		GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)	14	1518	-	all_cancers(95;2.54e-05)		484			Myosin head-like.		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	c.1451A>T	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	.	23.1	4.369333	0.82463	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.83163	-1.69;-1.69	4.06	4.06	0.47325	Myosin head, motor domain (3);	.	.	.	.	D	0.95831	0.8643	H	0.99974	5.145	0.80722	D	1	P;P	0.42203	0.773;0.773	D;D	0.66602	0.945;0.945	D	0.96352	0.9259	9	0.87932	D	0	.	12.5504	0.56223	0.0:0.0:0.0:1.0	.	484;484	D9YZU2;P13533	.;MYH6_HUMAN	V	484	ENSP00000386041:E484V;ENSP00000348634:E484V	ENSP00000348634:E484V	E	-	2	0	MYH6	22939435	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.568000	0.82369	1.619000	0.50296	0.524000	0.50904	GAG		0.537	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3			26	37	0	0	0	0.004656	0	26	37				
NEMF	9147	broad.mit.edu	37	14	50280705	50280705	+	Splice_Site	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr14:50280705C>A	ENST00000298310.5	-	18	2194		c.e18+1		NEMF_ENST00000545773.1_Splice_Site|NEMF_ENST00000546046.1_Intron|NEMF_ENST00000556925.1_Splice_Site			O60524	NEMF_HUMAN	nuclear export mediator factor						nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						AAATATATTACCTGTTGGATT	0.318																																							uc001wxc.2		NA																	0					0						c.e18+1		serologically defined colon cancer antigen 1							54.0	54.0	54.0					14																	50280705		2203	4299	6502	SO:0001630	splice_region_variant	9147					cytoplasm|nucleus		g.chr14:50280705C>A	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.1744+1G>T	14.37:g.50280705C>A			Somatic				SDCCAG1_uc010anj.1_Splice_Site_p.G582_splice|SDCCAG1_uc010tqi.1_Intron|SDCCAG1_uc001wxe.2_Splice_Site_p.G540_splice|SDCCAG1_uc001wxd.1_Splice_Site	p.G582_splice	NM_004713	NP_004704	WXS	Illumina HiSeq	Unspecified	O60524	NEMF_HUMAN		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)	18	1812	-	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)						A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Splice_Site	SNP	ENST00000298310.5	37	c.1744_splice	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075821	0.76415	.	.	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000534912;ENST00000555970	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0375	0.89308	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NEMF	49350455	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	6.568000	0.73987	2.682000	0.91365	0.484000	0.47621	.		0.318	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	Intron	13	18	1	0	0.000151284	0.001855	0.000176895	13	18				
SPTB	6710	broad.mit.edu	37	14	65239306	65239306	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr14:65239306C>A	ENST00000389721.5	-	25	5577	c.5545G>T	c.(5545-5547)Ggt>Tgt	p.G1849C	SPTB_ENST00000542895.1_Missense_Mutation_p.G1849C|SPTB_ENST00000556626.1_Missense_Mutation_p.G1849C|SPTB_ENST00000389720.3_Missense_Mutation_p.G1849C|SPTB_ENST00000389722.3_Missense_Mutation_p.G1849C	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1849					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		ACCTGGACACCCAGCAGGTGG	0.667																																							uc001xht.2		NA																	0				ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11						c.(5545-5547)GGT>TGT		spectrin beta isoform b							25.0	27.0	26.0					14																	65239306		2203	4300	6503	SO:0001583	missense	6710				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton	g.chr14:65239306C>A		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5545G>T	14.37:g.65239306C>A	ENSP00000374371:p.Gly1849Cys		Somatic				SPTB_uc001xhr.2_Missense_Mutation_p.G1849C|SPTB_uc001xhs.2_Missense_Mutation_p.G1849C|SPTB_uc001xhu.2_Missense_Mutation_p.G1849C|SPTB_uc010aqi.2_Missense_Mutation_p.G510C	p.G1849C	NM_000347	NP_000338	WXS	Illumina HiSeq	Unspecified	P11277	SPTB1_HUMAN		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)	25	5599	-		all_lung(585;4.15e-09)	1849			Spectrin 15.		Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	c.5545G>T	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.813014	0.70912	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.68485	0.3006	M	0.72353	2.195	0.80722	D	1	D;D;D	0.76494	0.999;0.993;0.993	D;D;P	0.76575	0.988;0.941;0.821	T	0.72100	-0.4392	10	0.72032	D	0.01	.	17.4315	0.87541	0.0:1.0:0.0:0.0	.	633;1849;1853	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	C	1853;1849;633;514;1849;1849;1849;1849	ENSP00000374372:G1849C;ENSP00000451324:G514C;ENSP00000451752:G1849C;ENSP00000374371:G1849C;ENSP00000443882:G1849C;ENSP00000374370:G1849C	ENSP00000334218:G633C	G	-	1	0	SPTB	64309059	0.953000	0.32496	0.988000	0.46212	0.603000	0.37013	4.944000	0.63561	2.484000	0.83849	0.561000	0.74099	GGT		0.667	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			13	12	1	0	3.27435e-08	0.00245	4.39643e-08	13	12				
VSX2	338917	broad.mit.edu	37	14	74726376	74726376	+	Silent	SNP	G	G	T	rs150792267	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr14:74726376G>T	ENST00000261980.2	+	4	741	c.651G>T	c.(649-651)gcG>gcT	p.A217A		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	217	CVC. {ECO:0000255|PROSITE- ProRule:PRU00829}.				cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		GTGTCATGGCGGAGTATGGGC	0.627																																							uc001xpq.2		NA																	0				ovary(1)	1						c.(649-651)GCG>GCT		visual system homeobox 2							135.0	111.0	119.0					14																	74726376		2203	4300	6503	SO:0001819	synonymous_variant	338917				multicellular organismal development|response to stimulus|visual perception	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:74726376G>T	AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.651G>T	14.37:g.74726376G>T			Somatic					p.A217A	NM_182894	NP_878314	WXS	Illumina HiSeq	Unspecified	P58304	VSX2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00154)	4	741	+			217			CVC.		A1A4X6	Silent	SNP	ENST00000261980.2	37	c.651G>T	CCDS9827.1																																																																																				0.627	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412323.1	NM_182894		17	30	1	0	2.94398e-08	0.007413	3.96875e-08	17	30				
LTBP2	4053	broad.mit.edu	37	14	75022254	75022254	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr14:75022254C>G	ENST00000261978.4	-	4	1359	c.973G>C	c.(973-975)Gat>Cat	p.D325H	CTD-2207P18.1_ENST00000554552.1_lincRNA|LTBP2_ENST00000556690.1_Missense_Mutation_p.D325H|LTBP2_ENST00000557425.1_Intron	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	325					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TGGGTGCCATCTCTCTGCTCA	0.632																																							uc001xqa.2		NA																	0				liver(1)|skin(1)	2						c.(973-975)GAT>CAT		latent transforming growth factor beta binding							95.0	85.0	88.0					14																	75022254		2203	4300	6503	SO:0001583	missense	4053				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding	g.chr14:75022254C>G		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.973G>C	14.37:g.75022254C>G	ENSP00000261978:p.Asp325His		Somatic					p.D325H	NM_000428	NP_000419	WXS	Illumina HiSeq	Unspecified	Q14767	LTBP2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)	4	1360	-			325					Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	37	c.973G>C	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.586767	0.28268	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	T;T	0.78924	-1.21;-1.22	5.21	4.33	0.51752	.	0.401360	0.17819	N	0.160926	T	0.70911	0.3278	L	0.43152	1.355	0.09310	N	1	P	0.43169	0.8	P	0.44772	0.46	T	0.64132	-0.6479	10	0.52906	T	0.07	.	5.3139	0.15845	0.0:0.6205:0.247:0.1325	.	325	Q14767	LTBP2_HUMAN	H	325	ENSP00000261978:D325H;ENSP00000451477:D325H	ENSP00000261978:D325H	D	-	1	0	LTBP2	74092007	0.981000	0.34729	0.134000	0.22075	0.322000	0.28314	2.235000	0.43044	1.413000	0.46997	0.556000	0.70494	GAT		0.632	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428		29	44	0	0	0	0.002096	0	29	44				
CCDC88C	440193	broad.mit.edu	37	14	91739806	91739806	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr14:91739806G>T	ENST00000389857.6	-	30	5336	c.5250C>A	c.(5248-5250)taC>taA	p.Y1750*	CCDC88C_ENST00000331194.7_Nonsense_Mutation_p.Y274*	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1750					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				TTGGCTTTACGTACTGCCCGG	0.667																																							uc010aty.2		NA																	0				ovary(3)	3						c.(5248-5250)TAC>TAA		DVL-binding protein DAPLE							21.0	24.0	23.0					14																	91739806		1943	4109	6052	SO:0001587	stop_gained	440193				microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association	g.chr14:91739806G>T		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.5250C>A	14.37:g.91739806G>T	ENSP00000374507:p.Tyr1750*		Somatic				CCDC88C_uc001xzj.2_Nonsense_Mutation_p.Y274*|CCDC88C_uc001xzi.2_Nonsense_Mutation_p.Y200*	p.Y1750*	NM_001080414	NP_001073883	WXS	Illumina HiSeq	Unspecified	Q9P219	DAPLE_HUMAN			30	5349	-		all_cancers(154;0.0468)	1750					Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Nonsense_Mutation	SNP	ENST00000389857.6	37	c.5250C>A	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	G	37	6.469776	0.97594	.	.	ENSG00000015133	ENST00000389857;ENST00000427583;ENST00000331194	.	.	.	4.94	-9.87	0.00470	.	0.170339	0.27807	U	0.017780	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.6062	19.7194	0.96136	0.353:0.0:0.647:0.0	.	.	.	.	X	1750;274;274	.	ENSP00000330332:Y274X	Y	-	3	2	CCDC88C	90809559	0.114000	0.22134	0.152000	0.22495	0.049000	0.14656	-0.352000	0.07701	-2.068000	0.00884	-0.501000	0.04562	TAC		0.667	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		9	10	1	0	1.76689e-08	0.006214	2.39639e-08	9	10				
SERPINA10	51156	broad.mit.edu	37	14	94756459	94756459	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr14:94756459G>T	ENST00000393096.1	-	2	937	c.472C>A	c.(472-474)Ctg>Atg	p.L158M	SERPINA10_ENST00000554723.1_Missense_Mutation_p.L198M|SERPINA10_ENST00000554173.1_Missense_Mutation_p.L158M|SERPINA10_ENST00000261994.4_Missense_Mutation_p.L158M	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	158			L -> Q (in dbSNP:rs2232699).		blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GTGAGGCCCAGTTCCAGGTTG	0.522																																							uc001yct.2		NA																	0				ovary(2)|skin(1)	3						c.(472-474)CTG>ATG		serine (or cysteine) proteinase inhibitor, clade							58.0	65.0	63.0					14																	94756459		2203	4300	6503	SO:0001583	missense	51156				regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity	g.chr14:94756459G>T	AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.472C>A	14.37:g.94756459G>T	ENSP00000376809:p.Leu158Met		Somatic				SERPINA10_uc001ycu.3_Missense_Mutation_p.L158M	p.L158M	NM_016186	NP_057270	WXS	Illumina HiSeq	Unspecified	Q9UK55	ZPI_HUMAN		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	2	938	-		all_cancers(154;0.105)	158					A5Z2A5|Q6UWX9|Q86U20	Missense_Mutation	SNP	ENST00000393096.1	37	c.472C>A	CCDS9923.1	.	.	.	.	.	.	.	.	.	.	G	10.13	1.266184	0.23136	.	.	ENSG00000140093	ENST00000554723;ENST00000393096;ENST00000261994;ENST00000554173	D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43	4.97	3.12	0.35913	Serpin domain (3);	0.000000	0.49305	D	0.000159	D	0.92612	0.7653	M	0.75884	2.315	0.39700	D	0.971162	D	0.71674	0.998	D	0.73380	0.98	D	0.91576	0.5275	10	0.62326	D	0.03	.	8.7644	0.34694	0.3659:0.0:0.6341:0.0	.	158	Q9UK55	ZPI_HUMAN	M	198;158;158;158	ENSP00000450896:L198M;ENSP00000376809:L158M;ENSP00000261994:L158M;ENSP00000450971:L158M	ENSP00000261994:L158M	L	-	1	2	SERPINA10	93826212	0.773000	0.28580	0.933000	0.37362	0.012000	0.07955	0.663000	0.25053	0.487000	0.27698	-0.671000	0.03813	CTG		0.522	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413061.1	NM_016186		29	41	1	0	9.65021e-13	0.002096	1.45622e-12	29	41				
MKRN3	7681	broad.mit.edu	37	15	23811369	23811369	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:23811369C>A	ENST00000314520.3	+	1	916	c.440C>A	c.(439-441)gCg>gAg	p.A147E	RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000568252.1_Intron|MKRN3_ENST00000564592.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	147					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A147V(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		AGCACGGCTGCGCACATCGAG	0.632																																							uc001ywh.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(6)|large_intestine(2)|ovary(2)	10						c.(439-441)GCG>GAG		makorin ring finger protein 3							30.0	33.0	32.0					15																	23811369		2203	4300	6503	SO:0001583	missense	7681					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding	g.chr15:23811369C>A	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.440C>A	15.37:g.23811369C>A	ENSP00000313881:p.Ala147Glu		Somatic				MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Missense_Mutation_p.A147E	p.A147E	NM_005664	NP_005655	WXS	Illumina HiSeq	Unspecified	Q13064	MKRN3_HUMAN		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)	1	916	+		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)	147						Missense_Mutation	SNP	ENST00000314520.3	37	c.440C>A	CCDS10013.1	.	.	.	.	.	.	.	.	.	.	C	6.576	0.474613	0.12521	.	.	ENSG00000179455	ENST00000314520	T	0.28255	1.62	3.87	2.96	0.34315	.	0.316014	0.32120	N	0.006541	T	0.08537	0.0212	N	0.02721	-0.515	0.29790	N	0.833242	P	0.43231	0.801	B	0.36289	0.221	T	0.25537	-1.0129	10	0.02654	T	1	.	7.3207	0.26526	0.0:0.8827:0.0:0.1173	.	147	Q13064	MKRN3_HUMAN	E	147	ENSP00000313881:A147E	ENSP00000313881:A147E	A	+	2	0	MKRN3	21362462	0.932000	0.31603	0.939000	0.37840	0.292000	0.27327	0.422000	0.21296	1.222000	0.43521	0.655000	0.94253	GCG		0.632	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664		7	29	1	0	5.18039e-06	0.00308	6.4038e-06	7	29				
MAGEL2	54551	broad.mit.edu	37	15	23890121	23890121	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:23890121C>A	ENST00000532292.1	-	1	1054	c.960G>T	c.(958-960)gaG>gaT	p.E320D		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	203	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GGCTTTGGACCTCCCAGTCAC	0.612																																							uc001ywj.3		NA																	0					0						c.(958-960)GAG>GAT		MAGE-like protein 2							57.0	64.0	62.0					15																	23890121		2005	4196	6201	SO:0001583	missense	54551							g.chr15:23890121C>A	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.960G>T	15.37:g.23890121C>A	ENSP00000433433:p.Glu320Asp		Somatic					p.E320D	NM_019066	NP_061939	WXS	Illumina HiSeq	Unspecified				all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)	1	1055	-		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)							Missense_Mutation	SNP	ENST00000532292.1	37	c.960G>T		.	.	.	.	.	.	.	.	.	.	C	9.167	1.020242	0.19433	.	.	ENSG00000254585	ENST00000532292	.	.	.	3.94	0.999	0.19862	.	.	.	.	.	T	0.41743	0.1172	L	0.59436	1.845	0.09310	N	1	.	.	.	.	.	.	T	0.31861	-0.9928	5	.	.	.	.	6.3782	0.21519	0.0:0.6843:0.0:0.3157	.	.	.	.	M	352	.	.	R	-	2	0	MAGEL2	21441214	0.063000	0.20901	0.197000	0.23402	0.099000	0.18886	0.166000	0.16583	0.235000	0.21160	-0.793000	0.03317	AGG		0.612	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066		10	59	1	0	1.58986e-06	0.008291	1.99104e-06	10	59				
HERC2	8924	broad.mit.edu	37	15	28420692	28420692	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:28420692G>A	ENST00000261609.7	-	64	9905	c.9797C>T	c.(9796-9798)gCc>gTc	p.A3266V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCAGTGCAGGGCCCCGACAGC	0.642																																							uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(9796-9798)GCC>GTC		hect domain and RLD 2							48.0	38.0	41.0					15																	28420692		2203	4296	6499	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28420692G>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9797C>T	15.37:g.28420692G>A	ENSP00000261609:p.Ala3266Val		Somatic					p.A3266V	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	64	9903	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	3266			RCC1 11.			Missense_Mutation	SNP	ENST00000261609.7	37	c.9797C>T	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	33	5.246296	0.95305	.	.	ENSG00000128731	ENST00000261609	D	0.85702	-2.02	4.84	4.84	0.62591	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.057563	0.64402	D	0.000002	T	0.81437	0.4822	N	0.25957	0.775	0.80722	D	1	P	0.36683	0.565	B	0.40825	0.341	D	0.83512	0.0081	10	0.62326	D	0.03	.	18.3006	0.90162	0.0:0.0:1.0:0.0	.	3266	O95714	HERC2_HUMAN	V	3266	ENSP00000261609:A3266V	ENSP00000261609:A3266V	A	-	2	0	HERC2	26094287	1.000000	0.71417	0.969000	0.41365	0.951000	0.60555	9.549000	0.98106	2.382000	0.81193	0.561000	0.74099	GCC		0.642	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		7	17	0	0	0	0.001984	0	7	17				
HERC2	8924	broad.mit.edu	37	15	28437249	28437249	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:28437249C>A	ENST00000261609.7	-	53	8417	c.8309G>T	c.(8308-8310)tGc>tTc	p.C2770F		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCTGCTGTGGCAACGCTTCAG	0.527											OREG0022997	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(8308-8310)TGC>TTC		hect domain and RLD 2							123.0	117.0	119.0					15																	28437249		2203	4300	6503	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28437249C>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8309G>T	15.37:g.28437249C>A	ENSP00000261609:p.Cys2770Phe		Somatic	OREG0022997	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	801	HERC2_uc001zbk.1_Missense_Mutation_p.C305F	p.C2770F	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	53	8415	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	2770			DOC.			Missense_Mutation	SNP	ENST00000261609.7	37	c.8309G>T	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.271063	0.40194	.	.	ENSG00000128731	ENST00000261609	T	0.61859	0.07	5.67	4.73	0.59995	Anaphase-promoting complex, subunit 10/DOC domain (1);Galactose-binding domain-like (1);	0.310489	0.34603	N	0.003837	T	0.45316	0.1336	N	0.19112	0.55	0.33672	D	0.611098	B;B	0.24533	0.105;0.044	B;B	0.22601	0.04;0.027	T	0.55134	-0.8188	10	0.51188	T	0.08	.	16.5083	0.84278	0.0:0.869:0.131:0.0	.	237;2770	A8KAQ8;O95714	.;HERC2_HUMAN	F	2770	ENSP00000261609:C2770F	ENSP00000261609:C2770F	C	-	2	0	HERC2	26110844	1.000000	0.71417	0.559000	0.28332	0.990000	0.78478	2.352000	0.44080	1.350000	0.45770	0.471000	0.43371	TGC		0.527	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		31	137	1	0	1.61788e-16	0.002445	2.62465e-16	31	137				
HERC2	8924	broad.mit.edu	37	15	28508211	28508211	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:28508211C>G	ENST00000261609.7	-	15	2083	c.1975G>C	c.(1975-1977)Gtg>Ctg	p.V659L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACTTTGACCACATCCAAGTCT	0.473																																							uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(1975-1977)GTG>CTG		hect domain and RLD 2							157.0	137.0	144.0					15																	28508211		2203	4300	6503	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28508211C>G	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1975G>C	15.37:g.28508211C>G	ENSP00000261609:p.Val659Leu		Somatic				HERC2_uc001zbl.1_Missense_Mutation_p.V354L	p.V659L	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	15	2081	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	659			RCC1 3.			Missense_Mutation	SNP	ENST00000261609.7	37	c.1975G>C	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.749800	0.49257	.	.	ENSG00000128731	ENST00000261609	D	0.88586	-2.4	5.79	3.91	0.45181	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.060310	0.64402	D	0.000008	D	0.86756	0.6009	M	0.78344	2.41	0.32386	N	0.553973	B	0.14012	0.009	B	0.17979	0.02	D	0.86026	0.1510	10	0.72032	D	0.01	.	5.665	0.17690	0.0:0.6432:0.0:0.3568	.	659	O95714	HERC2_HUMAN	L	659	ENSP00000261609:V659L	ENSP00000261609:V659L	V	-	1	0	HERC2	26181806	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	3.012000	0.49575	1.471000	0.48121	0.558000	0.71614	GTG		0.473	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		11	51	0	0	0	0.001368	0	11	51				
TRPM1	4308	broad.mit.edu	37	15	31362303	31362303	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:31362303G>A	ENST00000256552.6	-	4	357	c.210C>T	c.(208-210)acC>acT	p.T70T	TRPM1_ENST00000397795.2_Silent_p.T48T|TRPM1_ENST00000559179.1_Silent_p.T48T|TRPM1_ENST00000542188.1_Silent_p.T87T	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		GGTAGCTCTGGGTGTGCTTGG	0.493																																							uc001zfm.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(142-144)ACC>ACT		transient receptor potential cation channel,							384.0	367.0	372.0					15																	31362303		1956	4154	6110	SO:0001819	synonymous_variant	4308				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity	g.chr15:31362303G>A	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.210C>T	15.37:g.31362303G>A			Somatic				TRPM1_uc010azy.2_5'Flank|TRPM1_uc001zfl.2_5'Flank|TRPM1_uc001zfn.3_Silent_p.T48T|uc010ubn.1_RNA	p.T48T	NM_002420	NP_002411	WXS	Illumina HiSeq	Unspecified	Q7Z4N2	TRPM1_HUMAN		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)	3	272	-		all_lung(180;1.92e-11)	48			Extracellular (Potential).			Silent	SNP	ENST00000256552.6	37	c.144C>T	CCDS58346.1																																																																																				0.493	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420		98	334	0	0	0	0.00361	0	98	334				
AQR	9716	broad.mit.edu	37	15	35174838	35174838	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:35174838T>A	ENST00000156471.5	-	27	3255	c.3030A>T	c.(3028-3030)gaA>gaT	p.E1010D		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	1010					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AGGCTCTGAATTCCTATGGAA	0.378																																							uc001ziv.2		NA																	0				large_intestine(1)	1						c.(3028-3030)GAA>GAT		aquarius							89.0	84.0	85.0					15																	35174838		1832	4086	5918	SO:0001583	missense	9716					catalytic step 2 spliceosome	RNA binding	g.chr15:35174838T>A	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.3030A>T	15.37:g.35174838T>A	ENSP00000156471:p.Glu1010Asp		Somatic					p.E1010D	NM_014691	NP_055506	WXS	Illumina HiSeq	Unspecified	O60306	AQR_HUMAN		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)	27	3211	-		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)	1010					A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	c.3030A>T	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.242545	0.79912	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.82433	-1.61	5.73	2.09	0.27110	.	0.000000	0.85682	D	0.000000	D	0.85509	0.5713	L	0.55017	1.72	0.47905	D	0.999541	D	0.56746	0.977	D	0.65573	0.936	T	0.81545	-0.0884	10	0.35671	T	0.21	-19.6967	8.7527	0.34626	0.0:0.2779:0.0:0.7221	.	1010	O60306	AQR_HUMAN	D	1010	ENSP00000156471:E1010D	ENSP00000156471:E1010D	E	-	3	2	AQR	32962130	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	2.234000	0.43035	0.397000	0.25310	0.482000	0.46254	GAA		0.378	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691		7	30	0	0	0	0.004482	0	7	30				
EIF2AK4	440275	broad.mit.edu	37	15	40269028	40269028	+	Silent	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:40269028C>G	ENST00000263791.5	+	12	2275	c.2232C>G	c.(2230-2232)gtC>gtG	p.V744V	EIF2AK4_ENST00000382727.2_Silent_p.V744V	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	744	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		ACGGTGGCGTCTTCTCCCAGT	0.607																																							uc001zkm.1		NA																	0				lung(2)|stomach(1)|skin(1)	4						c.(2230-2232)GTC>GTG		eukaryotic translation initiation factor 2 alpha							40.0	43.0	42.0					15																	40269028		1759	3823	5582	SO:0001819	synonymous_variant	440275				translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity	g.chr15:40269028C>G	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.2232C>G	15.37:g.40269028C>G			Somatic				EIF2AK4_uc010bbj.1_Silent_p.V473V	p.V744V	NM_001013703	NP_001013725	WXS	Illumina HiSeq	Unspecified	Q9P2K8	E2AK4_HUMAN		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)	12	2282	+		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)	744			Protein kinase 2.		C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Silent	SNP	ENST00000263791.5	37	c.2232C>G	CCDS42016.1																																																																																				0.607	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1			9	64	0	0	0	0.008291	0	9	64				
SPTBN5	51332	broad.mit.edu	37	15	42143102	42143102	+	Missense_Mutation	SNP	G	G	T	rs201539060		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:42143102G>T	ENST00000320955.6	-	66	11098	c.10871C>A	c.(10870-10872)cCg>cAg	p.P3624Q	RNA5SP393_ENST00000363423.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3624	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CTCTTCGGACGGTGCTGCAAA	0.682																																							uc001zos.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(10765-10767)CCG>CAG		spectrin, beta, non-erythrocytic 5							23.0	28.0	27.0					15																	42143102		2159	4267	6426	SO:0001583	missense	51332				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin		g.chr15:42143102G>T	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.10871C>A	15.37:g.42143102G>T	ENSP00000317790:p.Pro3624Gln		Somatic					p.P3589Q	NM_016642	NP_057726	WXS	Illumina HiSeq	Unspecified	Q9NRC6	SPTN5_HUMAN		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)	66	11099	-		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)	3624			PH.			Missense_Mutation	SNP	ENST00000320955.6	37	c.10766C>A		.	.	.	.	.	.	.	.	.	.	.	14.69	2.610558	0.46527	.	.	ENSG00000137877	ENST00000320955	T	0.30182	1.54	3.66	-0.14	0.13456	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.349225	0.22228	N	0.062845	T	0.36744	0.0978	L	0.54323	1.7	0.09310	N	1	D	0.57571	0.98	P	0.56865	0.808	T	0.15235	-1.0444	10	0.45353	T	0.12	.	6.9848	0.24723	0.4143:0.0:0.5857:0.0	.	3624	Q9NRC6	SPTN5_HUMAN	Q	3624	ENSP00000317790:P3624Q	ENSP00000317790:P3624Q	P	-	2	0	SPTBN5	39930394	0.219000	0.23619	0.001000	0.08648	0.110000	0.19582	0.976000	0.29462	-0.009000	0.14296	-0.291000	0.09656	CCG		0.682	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642		3	6	1	0	0.000602214	0.000602	0.000689716	3	6				
HAUS2	55142	broad.mit.edu	37	15	42850469	42850469	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:42850469T>G	ENST00000260372.3	+	2	230	c.167T>G	c.(166-168)aTt>aGt	p.I56S	HAUS2_ENST00000568876.1_Intron|HAUS2_ENST00000568846.2_Intron	NM_018097.2	NP_060567.1	Q9NVX0	HAUS2_HUMAN	HAUS augmin-like complex, subunit 2	56					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleus (GO:0005634)				endometrium(1)|large_intestine(1)|lung(1)	3						ATCACAAATATTCAAGCTGAA	0.333																																							uc001zqe.2		NA																	0					0						c.(166-168)ATT>AGT		centrosomal protein 27kDa isoform 1							56.0	53.0	54.0					15																	42850469		2202	4299	6501	SO:0001583	missense	55142				cell division|centrosome organization|G2/M transition of mitotic cell cycle|mitosis|spindle assembly	centrosome|cytosol|HAUS complex|microtubule|spindle		g.chr15:42850469T>G	AK001322	CCDS10090.1, CCDS45247.1	15q15.1	2014-02-20	2009-04-20	2009-04-20	ENSG00000137814	ENSG00000137814		"""HAUS augmin-like complex subunits"""	25530	protein-coding gene	gene with protein product		613429	"""chromosome 15 open reading frame 25"", ""centrosomal protein 27kDa"""	C15orf25, CEP27		14702039, 14654843, 19427217	Standard	NM_018097		Approved	FLJ10460, HsT17025	uc001zqe.3	Q9NVX0	OTTHUMG00000130678	ENST00000260372.3:c.167T>G	15.37:g.42850469T>G	ENSP00000260372:p.Ile56Ser		Somatic				HAUS2_uc010udi.1_Intron|HAUS2_uc001zqf.2_Intron	p.I56S	NM_018097	NP_060567	WXS	Illumina HiSeq	Unspecified	Q9NVX0	HAUS2_HUMAN			2	227	+			56			Potential.		C9JH36|Q9H9B3	Missense_Mutation	SNP	ENST00000260372.3	37	c.167T>G	CCDS10090.1	.	.	.	.	.	.	.	.	.	.	T	15.23	2.770456	0.49680	.	.	ENSG00000137814	ENST00000260372	T	0.50001	0.76	5.8	5.8	0.92144	.	0.311186	0.32593	N	0.005895	T	0.54775	0.1879	M	0.61703	1.905	0.80722	D	1	P	0.49783	0.928	P	0.48270	0.572	T	0.59637	-0.7417	10	0.66056	D	0.02	-3.1579	15.1422	0.72620	0.0:0.0:0.0:1.0	.	56	Q9NVX0	HAUS2_HUMAN	S	56	ENSP00000260372:I56S	ENSP00000260372:I56S	I	+	2	0	HAUS2	40637761	0.111000	0.22076	0.931000	0.37212	0.234000	0.25298	2.636000	0.46545	2.216000	0.71823	0.533000	0.62120	ATT		0.333	HAUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253173.1	NM_018097		6	15	0	0	0	0.004482	0	6	15				
TGM7	116179	broad.mit.edu	37	15	43568737	43568737	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:43568737C>A	ENST00000452443.2	-	13	2053	c.2049G>T	c.(2047-2049)caG>caT	p.Q683H		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	683					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	GAACCTGGAGCTGGCGGGGTC	0.582																																							uc001zrf.1		NA																	0				ovary(2)	2						c.(2047-2049)CAG>CAT		transglutaminase 7	L-Glutamine(DB00130)						160.0	139.0	146.0					15																	43568737		2202	4299	6501	SO:0001583	missense	116179				peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr15:43568737C>A	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.2049G>T	15.37:g.43568737C>A	ENSP00000389466:p.Gln683His		Somatic					p.Q683H	NM_052955	NP_443187	WXS	Illumina HiSeq	Unspecified	Q96PF1	TGM7_HUMAN		GBM - Glioblastoma multiforme(94;9.14e-07)	13	2054	-		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	683						Missense_Mutation	SNP	ENST00000452443.2	37	c.2049G>T	CCDS32213.1	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667113	0.67814	.	.	ENSG00000159495	ENST00000452443	T	0.69926	-0.44	4.47	3.52	0.40303	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.325553	0.30676	N	0.009115	T	0.80093	0.4560	M	0.81942	2.565	0.35089	D	0.764097	D	0.89917	1.0	D	0.91635	0.999	D	0.85536	0.1212	10	0.56958	D	0.05	-17.3064	10.9898	0.47543	0.0:0.9001:0.0:0.0999	.	683	Q96PF1	TGM7_HUMAN	H	683	ENSP00000389466:Q683H	ENSP00000389466:Q683H	Q	-	3	2	TGM7	41356029	1.000000	0.71417	0.998000	0.56505	0.923000	0.55619	1.407000	0.34657	2.198000	0.70561	0.585000	0.79938	CAG		0.582	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955		30	99	1	0	1.45844e-13	0.002836	2.2567e-13	30	99				
TRPM7	54822	broad.mit.edu	37	15	50886737	50886737	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:50886737A>T	ENST00000313478.7	-	24	3645	c.3364T>A	c.(3364-3366)Tat>Aat	p.Y1122N	TRPM7_ENST00000560955.1_Missense_Mutation_p.Y1122N	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1122					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TTCTCATGATAAGCCATAATA	0.323																																							uc001zyt.3		NA																	0				ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10						c.(3364-3366)TAT>AAT		transient receptor potential cation channel,							105.0	99.0	101.0					15																	50886737		1841	4089	5930	SO:0001583	missense	54822				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity	g.chr15:50886737A>T	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.3364T>A	15.37:g.50886737A>T	ENSP00000320239:p.Tyr1122Asn		Somatic				TRPM7_uc010bew.1_Missense_Mutation_p.Y1122N	p.Y1122N	NM_017672	NP_060142	WXS	Illumina HiSeq	Unspecified	Q96QT4	TRPM7_HUMAN		all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)	24	3628	-			1122			Cytoplasmic (Potential).		Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	c.3364T>A	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.599411	0.87055	.	.	ENSG00000092439	ENST00000313478	T	0.67865	-0.29	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.81588	0.4854	M	0.82823	2.61	0.80722	D	1	D	0.71674	0.998	P	0.62014	0.897	D	0.84892	0.0837	10	0.87932	D	0	-17.8442	15.6487	0.77073	1.0:0.0:0.0:0.0	.	1122	Q96QT4	TRPM7_HUMAN	N	1122	ENSP00000320239:Y1122N	ENSP00000320239:Y1122N	Y	-	1	0	TRPM7	48674029	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.088000	0.63022	0.533000	0.62120	TAT		0.323	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672		10	49	0	0	0	0.006214	0	10	49				
AP4E1	23431	broad.mit.edu	37	15	51250970	51250970	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:51250970C>T	ENST00000261842.5	+	14	1936	c.1830C>T	c.(1828-1830)gaC>gaT	p.D610D	AP4E1_ENST00000560508.1_Silent_p.D535D	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	610					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		TTCCAGTTGACAGGAGTTGTG	0.348																																							uc001zyx.1		NA																	0					0						c.(1828-1830)GAC>GAT		adaptor-related protein complex 4, epsilon 1							151.0	161.0	158.0					15																	51250970		2196	4294	6490	SO:0001819	synonymous_variant	23431				intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity	g.chr15:51250970C>T	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.1830C>T	15.37:g.51250970C>T			Somatic					p.D610D	NM_007347	NP_031373	WXS	Illumina HiSeq	Unspecified	Q9UPM8	AP4E1_HUMAN		all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)	14	1860	+			610					A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Silent	SNP	ENST00000261842.5	37	c.1830C>T	CCDS32240.1																																																																																				0.348	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1			11	49	0	0	0	0.000978	0	11	49				
ICE2	79664	broad.mit.edu	37	15	60760341	60760341	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:60760341C>A	ENST00000261520.4	-	4	561	c.327G>T	c.(325-327)gtG>gtT	p.V109V	NARG2_ENST00000558654.1_5'UTR|NARG2_ENST00000439632.1_5'UTR|NARG2_ENST00000561114.1_Silent_p.V109V	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						CCAACAAGTCCACATAACTCC	0.368																																							uc002agp.2		NA																	0				ovary(1)|lung(1)	2						c.(325-327)GTG>GTT		NMDA receptor regulated 2 isoform a							112.0	101.0	105.0					15																	60760341		2203	4300	6503	SO:0001819	synonymous_variant	79664					nucleus		g.chr15:60760341C>A																												ENST00000261520.4:c.327G>T	15.37:g.60760341C>A			Somatic				NARG2_uc002ago.2_5'UTR|NARG2_uc010bgk.2_Silent_p.V109V|NARG2_uc002agr.1_Silent_p.V109V	p.V109V	NM_024611	NP_078887	WXS	Illumina HiSeq	Unspecified	Q659A1	NARG2_HUMAN			4	562	-			109						Silent	SNP	ENST00000261520.4	37	c.327G>T	CCDS10176.1																																																																																				0.368	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1			9	27	1	0	3.09899e-07	0.004482	3.97762e-07	9	27				
HERC1	8925	broad.mit.edu	37	15	63978575	63978575	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:63978575C>A	ENST00000443617.2	-	34	6295	c.6208G>T	c.(6208-6210)Ggg>Tgg	p.G2070W	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2070	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TGATAGCACCCAGAAGTTACT	0.398																																							uc002amp.2		NA																	0				ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						c.(6208-6210)GGG>TGG		hect domain and RCC1-like domain 1							187.0	185.0	186.0					15																	63978575		1905	4119	6024	SO:0001583	missense	8925				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity	g.chr15:63978575C>A	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.6208G>T	15.37:g.63978575C>A	ENSP00000390158:p.Gly2070Trp		Somatic					p.G2070W	NM_003922	NP_003913	WXS	Illumina HiSeq	Unspecified	Q15751	HERC1_HUMAN			34	6356	-			2070			B30.2/SPRY.		Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	c.6208G>T	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710992	0.89112	.	.	ENSG00000103657	ENST00000443617	D	0.92397	-3.03	5.63	5.63	0.86233	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.96093	0.8727	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96158	0.9113	10	0.87932	D	0	.	19.6801	0.95958	0.0:1.0:0.0:0.0	.	2070	Q15751	HERC1_HUMAN	W	2070	ENSP00000390158:G2070W	ENSP00000390158:G2070W	G	-	1	0	HERC1	61765628	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.818000	0.86416	2.652000	0.90054	0.655000	0.94253	GGG		0.398	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922		22	147	1	0	7.87624e-14	0.00278	1.22723e-13	22	147				
ZNF609	23060	broad.mit.edu	37	15	64966165	64966165	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:64966165G>T	ENST00000326648.3	+	4	1240	c.1112G>T	c.(1111-1113)aGa>aTa	p.R371I	RNU6-549P_ENST00000384433.1_RNA|ZNF609_ENST00000559364.1_3'UTR	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	371						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGCCGGGGTAGAGGCAAACGC	0.498																																							uc002ann.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(1111-1113)AGA>ATA		zinc finger protein 609							76.0	79.0	78.0					15																	64966165		2203	4299	6502	SO:0001583	missense	23060					nucleus	zinc ion binding	g.chr15:64966165G>T	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.1112G>T	15.37:g.64966165G>T	ENSP00000316527:p.Arg371Ile		Somatic					p.R371I	NM_015042	NP_055857	WXS	Illumina HiSeq	Unspecified	O15014	ZN609_HUMAN			4	1112	+			371					Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	c.1112G>T	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374661	0.82573	.	.	ENSG00000180357	ENST00000326648	T	0.67345	-0.26	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.83519	0.5272	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84440	0.0582	10	0.56958	D	0.05	-19.0863	19.534	0.95242	0.0:0.0:1.0:0.0	.	371	O15014	ZN609_HUMAN	I	371	ENSP00000316527:R371I	ENSP00000316527:R371I	R	+	2	0	ZNF609	62753218	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.613000	0.88420	0.655000	0.94253	AGA		0.498	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833		14	80	1	0	2.32078e-09	0.003163	3.25298e-09	14	80				
PML	5371	broad.mit.edu	37	15	74337282	74337282	+	Missense_Mutation	SNP	G	G	T	rs370339805		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:74337282G>T	ENST00000268058.3	+	9	2678	c.2582G>T	c.(2581-2583)cGg>cTg	p.R861L	PML_ENST00000565898.1_Missense_Mutation_p.R813L	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	861					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						GCGCTGGCACGGGCAGAAGGA	0.652			T	"""RARA, PAX5"""	"""APL, ALL"""																																		uc002awv.2		NA		Dom	yes		15	15q22	5371	T	promyelocytic leukemia			L	RARA|PAX5		APL|ALL		0				central_nervous_system(2)|kidney(2)|breast(1)	5						c.(2581-2583)CGG>CTG		promyelocytic leukemia protein isoform 1							41.0	46.0	45.0					15																	74337282		2194	4294	6488	SO:0001583	missense	5371				cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding	g.chr15:74337282G>T	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.2582G>T	15.37:g.74337282G>T	ENSP00000268058:p.Arg861Leu		Somatic				PML_uc002awu.2_Missense_Mutation_p.R813L|PML_uc010ule.1_Missense_Mutation_p.R422L	p.R861L	NM_033238	NP_150241	WXS	Illumina HiSeq	Unspecified	P29590	PML_HUMAN			9	2722	+			861					E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	ENST00000268058.3	37	c.2582G>T	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	G	7.731	0.699328	0.15106	.	.	ENSG00000140464	ENST00000268058;ENST00000417341;ENST00000418568	T	0.43688	0.94	3.21	-6.41	0.01938	.	2.269220	0.01845	N	0.035561	T	0.21427	0.0516	N	0.14661	0.345	0.09310	N	1	B;B	0.12630	0.006;0.002	B;B	0.12156	0.003;0.007	T	0.07809	-1.0753	10	0.44086	T	0.13	3.5024	1.5713	0.02616	0.3033:0.2379:0.339:0.1198	.	861;813	P29590;P29590-11	PML_HUMAN;.	L	861;422;844	ENSP00000268058:R861L	ENSP00000268058:R861L	R	+	2	0	PML	72124335	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.313000	0.00255	-1.899000	0.01098	-1.166000	0.01754	CGG		0.652	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675		10	66	1	0	9.70103e-10	0.008291	1.37414e-09	10	66				
ADAMTS7	11173	broad.mit.edu	37	15	79058942	79058942	+	Missense_Mutation	SNP	G	G	C	rs543268667	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:79058942G>C	ENST00000388820.4	-	19	3521	c.3311C>G	c.(3310-3312)gCg>gGg	p.A1104G	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1104					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGTGGAGGGCGCAGCAGGATG	0.677																																							uc002bej.3		NA																	0					0						c.(3310-3312)GCG>GGG		ADAM metallopeptidase with thrombospondin type 1							11.0	17.0	15.0					15																	79058942		2057	4265	6322	SO:0001583	missense	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79058942G>C	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3311C>G	15.37:g.79058942G>C	ENSP00000373472:p.Ala1104Gly		Somatic				ADAMTS7_uc010und.1_3'UTR	p.A1104G	NM_014272	NP_055087	WXS	Illumina HiSeq	Unspecified	Q9UKP4	ATS7_HUMAN			19	3522	-			1104					Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	c.3311C>G	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	g	4.622	0.115520	0.08831	.	.	ENSG00000136378	ENST00000388820	T	0.45668	0.89	3.77	-5.78	0.02362	.	1.167030	0.06289	N	0.698741	T	0.23054	0.0557	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.22800	-1.0206	10	0.23891	T	0.37	.	7.9752	0.30151	0.2111:0.0:0.4966:0.2924	.	1104	Q9UKP4	ATS7_HUMAN	G	1104	ENSP00000373472:A1104G	ENSP00000373472:A1104G	A	-	2	0	ADAMTS7	76845997	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.375000	0.07475	-0.985000	0.03503	-2.730000	0.00130	GCG		0.677	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		4	27	0	0	0	0.000248	0	4	27				
ADAMTS7	11173	broad.mit.edu	37	15	79059040	79059040	+	Silent	SNP	A	A	G	rs199919711		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:79059040A>G	ENST00000388820.4	-	19	3423	c.3213T>C	c.(3211-3213)aaT>aaC	p.N1071N	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1071					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.N1071N(2)|p.N1071S(2)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CCTCGTGGAAATTGATGAAAT	0.617																																							uc002bej.3		NA																	4	Substitution - Missense(2)|Substitution - coding silent(2)		lung(2)|kidney(2)		0						c.(3211-3213)AAT>AAC		ADAM metallopeptidase with thrombospondin type 1																																				SO:0001819	synonymous_variant	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79059040A>G	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3213T>C	15.37:g.79059040A>G			Somatic				ADAMTS7_uc010und.1_3'UTR	p.N1071N	NM_014272	NP_055087	WXS	Illumina HiSeq	Unspecified	Q9UKP4	ATS7_HUMAN			19	3424	-			1071					Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	c.3213T>C	CCDS32303.1																																																																																				0.617	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		5	56	0	0	0	0.001168	0	5	56				
ADAMTS7	11173	broad.mit.edu	37	15	79059831	79059831	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:79059831T>A	ENST00000388820.4	-	18	2959	c.2749A>T	c.(2749-2751)Agc>Tgc	p.S917C	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	917	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TCCAGGGCGCTCTGCTCATCC	0.701																																							uc002bej.3		NA																	0					0						c.(2749-2751)AGC>TGC		ADAM metallopeptidase with thrombospondin type 1							21.0	25.0	24.0					15																	79059831		2187	4287	6474	SO:0001583	missense	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79059831T>A	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.2749A>T	15.37:g.79059831T>A	ENSP00000373472:p.Ser917Cys		Somatic				ADAMTS7_uc010und.1_Intron	p.S917C	NM_014272	NP_055087	WXS	Illumina HiSeq	Unspecified	Q9UKP4	ATS7_HUMAN			18	2960	-			917			TSP type-1 3.		Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	c.2749A>T	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.688032	0.48097	.	.	ENSG00000136378	ENST00000388820	T	0.60797	0.16	4.59	0.715	0.18186	.	0.648787	0.15332	N	0.267974	T	0.61615	0.2361	M	0.62088	1.915	0.22253	N	0.999258	D	0.58620	0.983	P	0.54759	0.76	T	0.53620	-0.8413	10	0.66056	D	0.02	.	6.8976	0.24265	0.0:0.0886:0.4811:0.4303	.	917	Q9UKP4	ATS7_HUMAN	C	917	ENSP00000373472:S917C	ENSP00000373472:S917C	S	-	1	0	ADAMTS7	76846886	0.741000	0.28217	0.494000	0.27515	0.196000	0.23810	0.547000	0.23299	-0.151000	0.11176	0.391000	0.25812	AGC		0.701	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		8	13	0	0	0	0.00308	0	8	13				
AGBL1	123624	broad.mit.edu	37	15	86807859	86807859	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:86807859C>A	ENST00000441037.2	+	10	1414	c.1319C>A	c.(1318-1320)aCt>aAt	p.T440N	AGBL1_ENST00000421325.2_Missense_Mutation_p.T440N|AGBL1_ENST00000389298.3_Missense_Mutation_p.T171N	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	440					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TCTAATTCCACTAGGACTAGA	0.458																																							uc002blz.1		NA																	0					0						c.(1318-1320)ACT>AAT		ATP/GTP binding protein-like 1							118.0	118.0	118.0					15																	86807859		1870	4113	5983	SO:0001583	missense	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:86807859C>A	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1319C>A	15.37:g.86807859C>A	ENSP00000413001:p.Thr440Asn		Somatic				AGBL1_uc002bma.1_Missense_Mutation_p.T171N|AGBL1_uc002bmb.1_Missense_Mutation_p.T134N	p.T440N	NM_152336	NP_689549	WXS	Illumina HiSeq	Unspecified	Q96MI9	CBPC4_HUMAN			10	1399	+			440					A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	c.1319C>A	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	C	8.662	0.900759	0.17686	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.09911	2.94;2.93	5.25	-0.279	0.12890	Armadillo-type fold (1);	1.221790	0.05468	N	0.552505	T	0.10766	0.0263	L	0.59436	1.845	0.09310	N	1	B;B;B	0.21225	0.053;0.032;0.019	B;B;B	0.20955	0.032;0.008;0.017	T	0.41431	-0.9509	10	0.18710	T	0.47	0.0846	4.1082	0.10047	0.1217:0.2636:0.4616:0.1531	.	139;171;440	Q96MI9-2;Q96MI9-3;Q96MI9	.;.;CBPC4_HUMAN	N	469;440;171	ENSP00000397173:T440N;ENSP00000373949:T171N	ENSP00000373949:T171N	T	+	2	0	AGBL1	84608863	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.749000	0.04813	0.046000	0.15833	-0.156000	0.13503	ACT		0.458	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		21	101	1	0	6.44725e-10	0.002299	9.17125e-10	21	101				
SLCO3A1	28232	broad.mit.edu	37	15	92459340	92459340	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:92459340G>T	ENST00000318445.6	+	2	512	c.298G>T	c.(298-300)Ggg>Tgg	p.G100W	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.G100W	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	100					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GAGCTACTTCGGGGCACGCGG	0.672																																							uc002bqx.2		NA																	0				skin(1)	1						c.(298-300)GGG>TGG		solute carrier organic anion transporter family,							36.0	28.0	31.0					15																	92459340		2194	4294	6488	SO:0001583	missense	28232				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity	g.chr15:92459340G>T	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.298G>T	15.37:g.92459340G>T	ENSP00000320634:p.Gly100Trp		Somatic				SLCO3A1_uc002bqy.2_Missense_Mutation_p.G100W|SLCO3A1_uc010boc.1_RNA|SLCO3A1_uc002bqz.1_Missense_Mutation_p.G42W	p.G100W	NM_013272	NP_037404	WXS	Illumina HiSeq	Unspecified	Q9UIG8	SO3A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0841)		2	499	+	Lung NSC(78;0.0158)|all_lung(78;0.0255)		100			Helical; Name=2; (Potential).		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	c.298G>T	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	G	31	5.070978	0.93950	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000553304	T;T;T	0.58652	0.32;0.32;0.32	5.08	5.08	0.68730	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.83018	0.5163	M	0.94142	3.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88036	0.2778	10	0.87932	D	0	.	17.8234	0.88657	0.0:0.0:1.0:0.0	.	42;100;100	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	W	100;100;42	ENSP00000320634:G100W;ENSP00000387846:G100W;ENSP00000450559:G42W	ENSP00000320634:G100W	G	+	1	0	SLCO3A1	90260344	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.464000	0.97655	2.525000	0.85131	0.655000	0.94253	GGG		0.672	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272		10	37	1	0	7.48243e-07	0.006214	9.49475e-07	10	37				
IGF1R	3480	broad.mit.edu	37	15	99251273	99251273	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr15:99251273G>A	ENST00000268035.6	+	2	1188	c.577G>A	c.(577-579)Gag>Aag	p.E193K	IGF1R_ENST00000558762.1_Missense_Mutation_p.E193K	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	193					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GCCGATGTGTGAGAAGACCAC	0.517																																							uc002bul.2		NA																	0				lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8						c.(577-579)GAG>AAG		insulin-like growth factor 1 receptor precursor	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)						124.0	110.0	114.0					15																	99251273		2197	4297	6494	SO:0001583	missense	3480				anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding	g.chr15:99251273G>A	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.577G>A	15.37:g.99251273G>A	ENSP00000268035:p.Glu193Lys		Somatic				IGF1R_uc010urq.1_Missense_Mutation_p.E193K|IGF1R_uc010bon.2_Missense_Mutation_p.E193K	p.E193K	NM_000875	NP_000866	WXS	Illumina HiSeq	Unspecified	P08069	IGF1R_HUMAN	Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		2	627	+	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		193					B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	37	c.577G>A	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	G	9.857	1.195149	0.22037	.	.	ENSG00000140443	ENST00000268035	D	0.83755	-1.76	5.35	5.35	0.76521	Furin-like cysteine-rich domain (1);	0.000000	0.53938	D	0.000043	T	0.68970	0.3059	N	0.10809	0.05	0.48632	D	0.999681	B;B	0.10296	0.003;0.001	B;B	0.12156	0.003;0.007	T	0.64445	-0.6406	10	0.09843	T	0.71	.	18.4151	0.90567	0.0:0.0:1.0:0.0	.	193;193	C9J5X1;P08069	.;IGF1R_HUMAN	K	193	ENSP00000268035:E193K	ENSP00000268035:E193K	E	+	1	0	IGF1R	97068796	1.000000	0.71417	0.989000	0.46669	0.805000	0.45488	3.561000	0.53770	2.654000	0.90174	0.557000	0.71058	GAG		0.517	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875		5	63	0	0	0	0.001984	0	5	63				
PDIA2	64714	broad.mit.edu	37	16	335128	335128	+	Silent	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:335128C>G	ENST00000219406.6	+	5	741	c.723C>G	c.(721-723)ggC>ggG	p.G241G	PDIA2_ENST00000462950.1_3'UTR|PDIA2_ENST00000404312.1_Silent_p.G238G	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	241					cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				AGGAGCTTGGCCTGGACCTGG	0.662																																							uc002cgn.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(721-723)GGC>GGG		protein disulfide isomerase A2 precursor							28.0	32.0	31.0					16																	335128		2082	4211	6293	SO:0001819	synonymous_variant	64714				apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding	g.chr16:335128C>G	U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.723C>G	16.37:g.335128C>G			Somatic				PDIA2_uc010bqt.1_Silent_p.G86G|PDIA2_uc002cgo.1_Silent_p.G241G	p.G241G	NM_006849	NP_006840	WXS	Illumina HiSeq	Unspecified	Q13087	PDIA2_HUMAN			10	1831	+		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)	241					A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Silent	SNP	ENST00000219406.6	37	c.723C>G	CCDS42089.1	.	.	.	.	.	.	.	.	.	.	c	1.275	-0.611989	0.03690	.	.	ENSG00000185615	ENST00000456379	.	.	.	3.78	1.58	0.23477	.	.	.	.	.	T	0.52256	0.1723	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43956	-0.9359	4	.	.	.	.	5.7058	0.17907	0.2072:0.673:0.0:0.1198	.	.	.	.	G	223	.	.	A	+	2	0	PDIA2	275129	0.768000	0.28519	0.998000	0.56505	0.162000	0.22319	-0.027000	0.12371	0.805000	0.34159	0.457000	0.33378	GCC		0.662	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139315.3	NM_006849		9	27	0	0	0	0.004482	0	9	27				
ZNF200	7752	broad.mit.edu	37	16	3274184	3274184	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:3274184T>A	ENST00000431561.3	-	5	1508	c.896A>T	c.(895-897)gAg>gTg	p.E299V	AJ003147.9_ENST00000576468.1_RNA|ZNF200_ENST00000396871.4_Missense_Mutation_p.E298V|ZNF200_ENST00000396870.4_Missense_Mutation_p.E298V|ZNF200_ENST00000414144.2_Missense_Mutation_p.E299V|ZNF200_ENST00000575948.1_Missense_Mutation_p.E298V|ZNF200_ENST00000396868.3_Missense_Mutation_p.E298V	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	299					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						ATGAATTCGCTCATGTTTATT	0.413																																							uc002cuj.2		NA																	0					0						c.(895-897)GAG>GTG		zinc finger protein 200 isoform 1							104.0	99.0	101.0					16																	3274184		2197	4300	6497	SO:0001583	missense	7752				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr16:3274184T>A	AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.896A>T	16.37:g.3274184T>A	ENSP00000395723:p.Glu299Val		Somatic				ZNF200_uc002cum.3_Missense_Mutation_p.E298V|ZNF200_uc010bti.2_Missense_Mutation_p.E298V|ZNF200_uc002cuk.2_Missense_Mutation_p.E299V|ZNF200_uc002cui.2_Missense_Mutation_p.E298V|ZNF200_uc002cul.3_Missense_Mutation_p.E298V	p.E299V	NM_003454	NP_003445	WXS	Illumina HiSeq	Unspecified	P98182	ZN200_HUMAN			5	1528	-			299			C2H2-type 2.		D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Missense_Mutation	SNP	ENST00000431561.3	37	c.896A>T	CCDS10497.1	.	.	.	.	.	.	.	.	.	.	T	12.12	1.842117	0.32513	.	.	ENSG00000010539	ENST00000396870;ENST00000396868;ENST00000396871;ENST00000414144;ENST00000431561	T;T;T	0.16897	2.31;2.31;2.31	5.02	5.02	0.67125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42682	D	0.000669	T	0.19248	0.0462	N	0.05487	-0.04	0.25178	N	0.990229	D;D;D	0.62365	0.979;0.979;0.991	P;P;P	0.60609	0.877;0.877;0.849	T	0.09228	-1.0684	10	0.87932	D	0	-18.5183	12.7432	0.57266	0.0:0.0:0.0:1.0	.	298;299;298	D3DUB7;P98182;P98182-2	.;ZN200_HUMAN;.	V	299;298;298;298;299	ENSP00000380077:E298V;ENSP00000380080:E298V;ENSP00000395723:E299V	ENSP00000380077:E298V	E	-	2	0	ZNF200	3214185	0.001000	0.12720	0.994000	0.49952	0.136000	0.21042	1.174000	0.31932	2.111000	0.64477	0.455000	0.32223	GAG		0.413	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000437545.1			26	82	0	0	0	0.004656	0	26	82				
OR2C1	4993	broad.mit.edu	37	16	3406235	3406235	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:3406235A>G	ENST00000304936.2	+	1	347	c.295A>G	c.(295-297)Acc>Gcc	p.T99A		NM_012368.2	NP_036500.2	O95371	OR2C1_HUMAN	olfactory receptor, family 2, subfamily C, member 1	99					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)	cell cortex (GO:0005938)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						TGGCTGCATAACCCAGCTCTA	0.567																																							uc002cuw.1		NA																	0				ovary(1)	1						c.(295-297)ACC>GCC		olfactory receptor, family 2, subfamily C,							74.0	59.0	64.0					16																	3406235		2197	4300	6497	SO:0001583	missense	4993				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr16:3406235A>G	AF098664	CCDS10502.1	16p13.3	2012-08-09			ENSG00000168158	ENSG00000168158		"""GPCR / Class A : Olfactory receptors"""	8242	protein-coding gene	gene with protein product				OR2C2P		9847080	Standard	NM_012368		Approved	OLFmf3	uc002cuw.1	O95371	OTTHUMG00000090505	ENST00000304936.2:c.295A>G	16.37:g.3406235A>G	ENSP00000307726:p.Thr99Ala		Somatic					p.T99A	NM_012368	NP_036500	WXS	Illumina HiSeq	Unspecified	O95371	OR2C1_HUMAN			1	347	+			99			Extracellular (Potential).		A0AVA4|Q6IF34|Q6IF55	Missense_Mutation	SNP	ENST00000304936.2	37	c.295A>G	CCDS10502.1	.	.	.	.	.	.	.	.	.	.	a	0.008	-1.906744	0.00512	.	.	ENSG00000168158	ENST00000304936	T	0.01323	5.01	4.63	4.63	0.57726	GPCR, rhodopsin-like superfamily (1);	0.356468	0.20316	N	0.094738	T	0.00754	0.0025	N	0.03154	-0.405	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.47459	-0.9116	10	0.07325	T	0.83	.	8.363	0.32369	0.8007:0.1993:0.0:0.0	.	99	O95371	OR2C1_HUMAN	A	99	ENSP00000307726:T99A	ENSP00000307726:T99A	T	+	1	0	OR2C1	3346236	0.000000	0.05858	0.969000	0.41365	0.308000	0.27856	-0.092000	0.11129	1.947000	0.56498	0.416000	0.27883	ACC		0.567	OR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206993.3			8	70	0	0	0	0.00308	0	8	70				
RBFOX1	54715	broad.mit.edu	37	16	7703849	7703849	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:7703849G>T	ENST00000550418.1	+	12	1778	c.790G>T	c.(790-792)Gcg>Tcg	p.A264S	RBFOX1_ENST00000436368.2_Missense_Mutation_p.A284S|RBFOX1_ENST00000547372.1_Missense_Mutation_p.A307S|RBFOX1_ENST00000553186.1_Missense_Mutation_p.A237S|RBFOX1_ENST00000422070.4_Missense_Mutation_p.A307S|RBFOX1_ENST00000311745.5_Missense_Mutation_p.A284S|RBFOX1_ENST00000552089.1_Missense_Mutation_p.A281S|RBFOX1_ENST00000340209.4_Missense_Mutation_p.A269S|RBFOX1_ENST00000547338.1_Missense_Mutation_p.A264S|RBFOX1_ENST00000535565.2_Missense_Mutation_p.A221S|RBFOX1_ENST00000355637.4_Missense_Mutation_p.A284S	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	264					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						AGCCACCGCCGCGGCCGCCTA	0.711																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	0					0						c.(790-792)GCG>TCG		ataxin 2-binding protein 1 isoform 4							15.0	19.0	18.0					16																	7703849		1675	3605	5280	SO:0001583	missense	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7703849G>T	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.790G>T	16.37:g.7703849G>T	ENSP00000450031:p.Ala264Ser		Somatic				A2BP1_uc010buf.1_Missense_Mutation_p.A264S|A2BP1_uc002cyr.1_Missense_Mutation_p.A263S|A2BP1_uc002cyt.2_Missense_Mutation_p.A237S|A2BP1_uc010uxz.1_Missense_Mutation_p.A307S|A2BP1_uc010uya.1_Missense_Mutation_p.A221S|A2BP1_uc002cyv.1_Missense_Mutation_p.A264S|A2BP1_uc010uyb.1_Missense_Mutation_p.A264S|A2BP1_uc002cyw.2_Missense_Mutation_p.A284S|A2BP1_uc002cyy.2_Missense_Mutation_p.A284S|A2BP1_uc002cyx.2_Missense_Mutation_p.A284S|A2BP1_uc010uyc.1_Missense_Mutation_p.A257S	p.A264S	NM_018723	NP_061193	WXS	Illumina HiSeq	Unspecified	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	12	1778	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	264					Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	c.790G>T	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	g	26.8	4.776704	0.90195	.	.	ENSG00000078328	ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T	0.38722	1.13;1.54;1.37;1.39;1.13;1.25;1.42;1.32;1.12	4.27	4.27	0.50696	.	0.193479	0.44483	D	0.000460	T	0.61850	0.2380	M	0.64997	1.995	0.47905	D	0.999543	D;D;D;B;B;D;D;D;D	0.89917	0.983;1.0;0.993;0.165;0.182;0.999;0.971;0.977;0.987	P;D;D;B;B;D;P;P;P	0.85130	0.877;0.997;0.946;0.058;0.277;0.995;0.814;0.883;0.905	T	0.63346	-0.6658	9	.	.	.	-5.6513	17.0732	0.86580	0.0:0.0:1.0:0.0	.	257;221;307;284;284;284;237;264;307	F8WAC5;F5H0M1;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;.;RFOX1_HUMAN;.	S	264;237;307;307;221;281;264;284;284;284;257;269	ENSP00000450031:A264S;ENSP00000447753:A237S;ENSP00000446842:A307S;ENSP00000391269:A307S;ENSP00000447717:A264S;ENSP00000402745:A284S;ENSP00000309117:A284S;ENSP00000347855:A284S;ENSP00000344196:A269S	.	A	+	1	0	RBFOX1	7643850	1.000000	0.71417	0.803000	0.32268	0.945000	0.59286	5.429000	0.66495	2.071000	0.62044	0.401000	0.26515	GCG		0.711	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		17	63	1	0	2.37509e-13	0.001523	3.63313e-13	17	63				
GRIN2A	2903	broad.mit.edu	37	16	9857957	9857957	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:9857957C>T	ENST00000396573.2	-	14	3753	c.3444G>A	c.(3442-3444)ccG>ccA	p.P1148P	GRIN2A_ENST00000330684.3_Silent_p.P1148P|GRIN2A_ENST00000562109.1_Silent_p.P1148P|GRIN2A_ENST00000535259.1_Silent_p.P991P|GRIN2A_ENST00000396575.2_Silent_p.P1148P|GRIN2A_ENST00000404927.2_Silent_p.P1148P	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1148					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGTAGGGGTCCGGGAAGTCCA	0.527																																							uc002czo.3		NA																	0				skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(3442-3444)CCG>CCA		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						99.0	106.0	104.0					16																	9857957		2197	4300	6497	SO:0001819	synonymous_variant	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9857957C>T		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3444G>A	16.37:g.9857957C>T			Somatic				GRIN2A_uc010uym.1_Silent_p.P1148P|GRIN2A_uc010uyn.1_Silent_p.P991P|GRIN2A_uc002czr.3_Silent_p.P1148P	p.P1148P	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			13	3992	-			1148			Cytoplasmic (Potential).		O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	c.3444G>A	CCDS10539.1																																																																																				0.527	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			50	124	0	0	0	0.00361	0	50	124				
CLEC16A	23274	broad.mit.edu	37	16	11118744	11118744	+	Silent	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:11118744G>C	ENST00000409790.1	+	13	1733	c.1503G>C	c.(1501-1503)gtG>gtC	p.V501V	CLEC16A_ENST00000409552.3_Silent_p.V483V|CLEC16A_ENST00000465491.1_3'UTR	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCCTGTTCGTGCTCTGCCTCC	0.547																																							uc002dao.2		NA																	1	Whole gene deletion(1)	p.0?(1)	haematopoietic_and_lymphoid_tissue(1)	ovary(1)|central_nervous_system(1)	2						c.(1501-1503)GTG>GTC		C-type lectin domain family 16, member A							94.0	96.0	96.0					16																	11118744		2139	4236	6375	SO:0001819	synonymous_variant	23274							g.chr16:11118744G>C	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.1503G>C	16.37:g.11118744G>C			Somatic				CLEC16A_uc002dan.3_Silent_p.V483V	p.V501V	NM_015226	NP_056041	WXS	Illumina HiSeq	Unspecified	Q2KHT3	CL16A_HUMAN			13	1733	+			501						Silent	SNP	ENST00000409790.1	37	c.1503G>C	CCDS45409.1																																																																																				0.547	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226		9	10	0	0	0	0.006214	0	9	10				
XYLT1	64131	broad.mit.edu	37	16	17211743	17211743	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:17211743C>A	ENST00000261381.6	-	11	2401	c.2317G>T	c.(2317-2319)Ggg>Tgg	p.G773W		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	773					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGTCCCTTCCCCCACTTCTGC	0.567																																							uc002dfa.2		NA																	0				ovary(4)	4						c.(2317-2319)GGG>TGG		xylosyltransferase I							163.0	133.0	143.0					16																	17211743		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17211743C>A	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2317G>T	16.37:g.17211743C>A	ENSP00000261381:p.Gly773Trp		Somatic					p.G773W	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			11	2402	-			773			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.2317G>T	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768794	0.69878	.	.	ENSG00000103489	ENST00000261381	T	0.43294	0.95	4.98	4.98	0.66077	.	0.142740	0.64402	D	0.000007	T	0.58148	0.2102	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.60999	-0.7151	10	0.72032	D	0.01	-40.4302	17.5957	0.88011	0.0:1.0:0.0:0.0	.	773	Q86Y38	XYLT1_HUMAN	W	773	ENSP00000261381:G773W	ENSP00000261381:G773W	G	-	1	0	XYLT1	17119244	0.996000	0.38824	1.000000	0.80357	0.926000	0.56050	2.615000	0.46368	2.446000	0.82766	0.462000	0.41574	GGG		0.567	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		23	64	1	0	2.89027e-11	0.002299	4.20974e-11	23	64				
GP2	2813	broad.mit.edu	37	16	20335250	20335250	+	Missense_Mutation	SNP	C	C	A	rs201805318		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:20335250C>A	ENST00000381362.4	-	3	499	c.423G>T	c.(421-423)tgG>tgT	p.W141C	GP2_ENST00000381360.5_Intron|GP2_ENST00000573897.1_5'Flank|GP2_ENST00000341642.5_Intron|GP2_ENST00000302555.5_Missense_Mutation_p.W141C	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	141					antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						AGTTGCCACTCCAATGGGCAC	0.592																																							uc002dgv.2		NA																	0				ovary(3)|skin(1)	4						c.(421-423)TGG>TGT		zymogen granule membrane glycoprotein 2 isoform							70.0	58.0	62.0					16																	20335250		2203	4300	6503	SO:0001583	missense	2813					anchored to membrane|extracellular region|plasma membrane		g.chr16:20335250C>A	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.423G>T	16.37:g.20335250C>A	ENSP00000370767:p.Trp141Cys		Somatic				GP2_uc002dgw.2_Missense_Mutation_p.W141C|GP2_uc002dgx.2_Intron|GP2_uc002dgy.2_Intron	p.W141C	NM_001007240	NP_001007241	WXS	Illumina HiSeq	Unspecified	P55259	GP2_HUMAN			3	506	-			141					A6NFM9|A6NJA8|Q13338|Q9UIF1	Missense_Mutation	SNP	ENST00000381362.4	37	c.423G>T	CCDS42128.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602768	0.46423	.	.	ENSG00000169347	ENST00000302555;ENST00000381362	D;D	0.99706	-6.47;-6.47	4.84	4.84	0.62591	.	.	.	.	.	D	0.99753	0.9901	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.972	D	0.97363	0.9971	9	0.54805	T	0.06	-24.6021	15.4902	0.75600	0.0:1.0:0.0:0.0	.	141;141	P55259-3;P55259	.;GP2_HUMAN	C	141	ENSP00000304044:W141C;ENSP00000370767:W141C	ENSP00000304044:W141C	W	-	3	0	GP2	20242751	0.942000	0.31987	0.988000	0.46212	0.325000	0.28411	1.450000	0.35134	2.489000	0.83994	0.650000	0.86243	TGG		0.592	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295		24	66	1	0	5.35356e-11	0.00278	7.74705e-11	24	66				
DNAH3	55567	broad.mit.edu	37	16	21033313	21033313	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:21033313C>A	ENST00000261383.3	-	40	5755	c.5756G>T	c.(5755-5757)aGa>aTa	p.R1919I	DNAH3_ENST00000415178.1_Intron	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1919					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AGAGTACAGTCTCATCATTGA	0.453																																							uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(5755-5757)AGA>ATA		dynein, axonemal, heavy chain 3							114.0	95.0	101.0					16																	21033313		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:21033313C>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5756G>T	16.37:g.21033313C>A	ENSP00000261383:p.Arg1919Ile		Somatic					p.R1919I	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	40	5756	-			1919					O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.5756G>T	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602557	0.66445	.	.	ENSG00000158486	ENST00000261383	T	0.27104	1.69	4.92	3.74	0.42951	.	0.206931	0.41294	D	0.000903	T	0.37598	0.1009	M	0.90309	3.105	0.80722	D	1	P	0.51791	0.948	P	0.45167	0.472	T	0.43212	-0.9405	10	0.45353	T	0.12	.	9.0127	0.36150	0.0:0.8167:0.0:0.1833	.	1919	Q8TD57	DYH3_HUMAN	I	1919	ENSP00000261383:R1919I	ENSP00000261383:R1919I	R	-	2	0	DNAH3	20940814	0.955000	0.32602	0.997000	0.53966	0.946000	0.59487	1.932000	0.40143	2.265000	0.75225	0.462000	0.41574	AGA		0.453	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		19	38	1	0	8.10497e-08	0.001523	1.07107e-07	19	38				
TNRC6A	27327	broad.mit.edu	37	16	24801933	24801933	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:24801933A>T	ENST00000395799.3	+	6	2099	c.1970A>T	c.(1969-1971)aAt>aTt	p.N657I	TNRC6A_ENST00000315183.7_Missense_Mutation_p.N657I	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	657	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TCTCAGACAAATGAGCAAAGC	0.468																																							uc002dmm.2		NA																	0				ovary(2)	2						c.(1969-1971)AAT>ATT		trinucleotide repeat containing 6A							89.0	79.0	82.0					16																	24801933		2197	4300	6497	SO:0001583	missense	27327				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding	g.chr16:24801933A>T	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1970A>T	16.37:g.24801933A>T	ENSP00000379144:p.Asn657Ile		Somatic				TNRC6A_uc010bxs.2_Missense_Mutation_p.N404I|TNRC6A_uc010vcc.1_Missense_Mutation_p.N404I|TNRC6A_uc002dmn.2_Missense_Mutation_p.N404I|TNRC6A_uc002dmo.2_Missense_Mutation_p.N404I	p.N657I	NM_014494	NP_055309	WXS	Illumina HiSeq	Unspecified	Q8NDV7	TNR6A_HUMAN		GBM - Glioblastoma multiforme(48;0.0394)	6	2084	+			657			Sufficient for interaction with EIF2C2.|Sufficient for interaction with EIF2C1 and EIF2C4.		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	c.1970A>T	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	A	6.766	0.510160	0.12883	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.12569	2.67;2.67	5.54	-2.01	0.07410	.	0.726993	0.14071	N	0.343341	T	0.07773	0.0195	L	0.34521	1.04	0.09310	N	1	B;B;B	0.12013	0.005;0.001;0.001	B;B;B	0.12837	0.008;0.001;0.001	T	0.30416	-0.9979	10	0.32370	T	0.25	-0.5442	3.2599	0.06845	0.2477:0.2825:0.3659:0.1038	.	404;657;657	Q8NDV7-2;Q8NDV7-6;Q8NDV7	.;.;TNR6A_HUMAN	I	657	ENSP00000326900:N657I;ENSP00000379144:N657I	ENSP00000326900:N657I	N	+	2	0	TNRC6A	24709434	0.030000	0.19436	0.013000	0.15412	0.916000	0.54674	1.321000	0.33678	-0.430000	0.07318	0.379000	0.24179	AAT		0.468	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847		21	29	0	0	0	0.002299	0	21	29				
IL21R	50615	broad.mit.edu	37	16	27460293	27460293	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:27460293C>A	ENST00000337929.3	+	9	1779	c.1306C>A	c.(1306-1308)Cct>Act	p.P436T	IL21R_ENST00000395754.4_Missense_Mutation_p.P436T|IL21R_ENST00000395755.1_Missense_Mutation_p.P436T|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000564089.1_Missense_Mutation_p.P436T	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	436					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						AGCTGGCAGCCCTGGGCTAGG	0.672			T	BCL6	NHL																																		uc002doq.1		NA		Dom	yes		16	16p11	50615	T	interleukin 21 receptor			L	BCL6		NHL		0				ovary(2)|lung(1)|breast(1)	4						c.(1306-1308)CCT>ACT		interleukin 21 receptor precursor							34.0	39.0	37.0					16																	27460293		2196	4300	6496	SO:0001583	missense	50615				natural killer cell activation	integral to membrane	interleukin-21 receptor activity	g.chr16:27460293C>A	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1306C>A	16.37:g.27460293C>A	ENSP00000338010:p.Pro436Thr		Somatic				IL21R_uc002dor.1_Missense_Mutation_p.P436T|IL21R_uc002dos.1_Missense_Mutation_p.P436T|uc002dot.2_RNA	p.P436T	NM_181078	NP_851564	WXS	Illumina HiSeq	Unspecified	Q9HBE5	IL21R_HUMAN			9	1539	+			436			Cytoplasmic (Potential).		A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	37	c.1306C>A	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	C	11.96	1.793535	0.31685	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.37058	1.22;1.22;1.22	4.9	4.9	0.64082	.	1.012900	0.07875	N	0.968527	T	0.37919	0.1021	L	0.46157	1.445	0.09310	N	1	P	0.38078	0.617	B	0.39738	0.308	T	0.22347	-1.0219	10	0.26408	T	0.33	-2.8246	13.5917	0.61964	0.0:1.0:0.0:0.0	.	436	Q9HBE5	IL21R_HUMAN	T	436	ENSP00000338010:P436T;ENSP00000379104:P436T;ENSP00000379103:P436T	ENSP00000338010:P436T	P	+	1	0	IL21R	27367794	0.000000	0.05858	0.007000	0.13788	0.066000	0.16364	0.310000	0.19356	2.271000	0.75665	0.561000	0.74099	CCT		0.672	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078		28	61	1	0	1.75199e-13	0.007291	2.68611e-13	28	61				
SBK1	388228	broad.mit.edu	37	16	28328794	28328794	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:28328794G>T	ENST00000341901.4	+	2	871	c.82G>T	c.(82-84)Ggt>Tgt	p.G28C		NM_001024401.2	NP_001019572.1	Q52WX2	SBK1_HUMAN	SH3 domain binding kinase 1	28						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(3)|ovary(1)	5						GCCTGGTGCCGGTGTGCCCCT	0.672											OREG0023701	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002dpd.2		NA																	0				ovary(1)|kidney(1)	2						c.(82-84)GGT>TGT		SH3-binding kinase 1							57.0	55.0	56.0					16																	28328794		2197	4300	6497	SO:0001583	missense	388228					cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr16:28328794G>T		CCDS32416.1	16p11.2	2013-09-27	2013-09-27			ENSG00000188322			17699	protein-coding gene	gene with protein product			"""SH3-binding domain kinase 1"""				Standard	XM_005255315		Approved	Sbk	uc002dpd.3	Q52WX2		ENST00000341901.4:c.82G>T	16.37:g.28328794G>T	ENSP00000343248:p.Gly28Cys		Somatic	OREG0023701	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	801		p.G28C	NM_001024401	NP_001019572	WXS	Illumina HiSeq	Unspecified	Q52WX2	SBK1_HUMAN			2	871	+			28						Missense_Mutation	SNP	ENST00000341901.4	37	c.82G>T	CCDS32416.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.976704	0.34848	.	.	ENSG00000188322	ENST00000341901	T	0.66995	-0.24	4.81	3.86	0.44501	.	0.183277	0.26304	N	0.025150	T	0.59636	0.2208	L	0.29908	0.895	0.24446	N	0.994501	P	0.51449	0.945	P	0.49047	0.599	T	0.54423	-0.8296	10	0.72032	D	0.01	-5.662	8.9627	0.35856	0.1036:0.0:0.8964:0.0	.	28	Q52WX2	SBK1_HUMAN	C	28	ENSP00000343248:G28C	ENSP00000343248:G28C	G	+	1	0	SBK1	28236295	0.982000	0.34865	0.452000	0.26994	0.017000	0.09413	2.351000	0.44071	1.021000	0.39600	0.655000	0.94253	GGT		0.672	SBK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387677.1	XM_370948		25	67	1	0	4.72057e-08	0.003954	6.28784e-08	25	67				
BBS2	583	broad.mit.edu	37	16	56545071	56545071	+	Splice_Site	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:56545071C>G	ENST00000245157.5	-	3	891	c.471G>C	c.(469-471)acG>acC	p.T157T	BBS2_ENST00000568104.1_Splice_Site_p.T157T|BBS2_ENST00000561951.1_5'UTR	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	157					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						TTCTTCATACCGTCCAAAAGA	0.363									Bardet-Biedl syndrome																														uc002ejd.2		NA																	0				ovary(1)	1						c.(469-471)ACG>ACC		Bardet-Biedl syndrome 2 protein							107.0	99.0	102.0					16																	56545071		2198	4300	6498	SO:0001630	splice_region_variant	583	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	adult behavior|brain morphogenesis|cerebral cortex development|cilium morphogenesis|fat cell differentiation|hippocampus development|melanosome transport|negative regulation of multicellular organism growth|photoreceptor cell maintenance|protein localization to organelle|regulation of cilium beat frequency involved in ciliary motility|sperm axoneme assembly|striatum development	BBSome|cilium membrane|microtubule basal body|motile cilium	protein binding	g.chr16:56545071C>G	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.471+1G>C	16.37:g.56545071C>G			Somatic				BBS2_uc010ccg.2_Silent_p.T157T	p.T157T	NM_031885	NP_114091	WXS	Illumina HiSeq	Unspecified	Q9BXC9	BBS2_HUMAN			3	705	-			157					Q96CM0|Q96SN9	Silent	SNP	ENST00000245157.5	37	c.471G>C	CCDS32451.1																																																																																				0.363	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885	Silent	19	30	0	0	0	0.001523	0	19	30				
PSMB10	5699	broad.mit.edu	37	16	67969891	67969891	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:67969891G>T	ENST00000358514.4	-	4	695	c.358C>A	c.(358-360)Cgc>Agc	p.R120S	CTC-479C5.12_ENST00000573493.1_5'Flank	NM_002801.3	NP_002792.1	P40306	PSB10_HUMAN	proteasome (prosome, macropain) subunit, beta type, 10	120					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell morphogenesis (GO:0000902)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|humoral immune response (GO:0006959)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(2)|endometrium(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	Carfilzomib(DB08889)	CGCAGGATGCGAGTGACCGTG	0.662																																							uc002eux.1		NA																	0					0						c.(358-360)CGC>AGC		proteasome beta 10 subunit proprotein							20.0	25.0	23.0					16																	67969891		2186	4278	6464	SO:0001583	missense	5699				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|humoral immune response|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity	g.chr16:67969891G>T	Y13640	CCDS10853.1	16q22.1	2008-02-05			ENSG00000205220	ENSG00000205220		"""Proteasome (prosome, macropain) subunits"""	9538	protein-coding gene	gene with protein product		176847		MECL1		8268911	Standard	NM_002801		Approved	LMP10, MGC1665, beta2i	uc002eux.2	P40306	OTTHUMG00000137553	ENST00000358514.4:c.358C>A	16.37:g.67969891G>T	ENSP00000351314:p.Arg120Ser		Somatic					p.R120S	NM_002801	NP_002792	WXS	Illumina HiSeq	Unspecified	P40306	PSB10_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	4	459	-		Ovarian(137;0.0563)	120					B2R5J4|Q5U098	Missense_Mutation	SNP	ENST00000358514.4	37	c.358C>A	CCDS10853.1	.	.	.	.	.	.	.	.	.	.	g	15.31	2.797075	0.50208	.	.	ENSG00000205220	ENST00000358514	T	0.22336	1.96	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.31949	0.0813	L	0.49640	1.575	0.80722	D	1	D	0.54772	0.968	P	0.54060	0.741	T	0.00768	-1.1574	10	0.28530	T	0.3	-21.34	14.9396	0.70983	0.0:0.0:1.0:0.0	.	120	P40306	PSB10_HUMAN	S	120	ENSP00000351314:R120S	ENSP00000351314:R120S	R	-	1	0	PSMB10	66527392	0.998000	0.40836	0.966000	0.40874	0.113000	0.19764	2.895000	0.48648	2.608000	0.88229	0.651000	0.88453	CGC		0.662	PSMB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268887.1	NM_002801		17	17	1	0	7.05477e-17	0.00499	1.1585e-16	17	17				
HYDIN	54768	broad.mit.edu	37	16	70986483	70986483	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr16:70986483G>T	ENST00000393567.2	-	41	6522	c.6372C>A	c.(6370-6372)gaC>gaA	p.D2124E		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2124					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGCCCAAGGTGTCAGTGCTCA	0.498																																							uc002ezr.2		NA																	0				ovary(1)|skin(1)	2						c.(6367-6369)GAC>GAA		hydrocephalus inducing isoform a							71.0	70.0	70.0					16																	70986483		2055	4206	6261	SO:0001583	missense	54768							g.chr16:70986483G>T	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6372C>A	16.37:g.70986483G>T	ENSP00000377197:p.Asp2124Glu		Somatic					p.D2123E	NM_032821	NP_116210	WXS	Illumina HiSeq	Unspecified	Q4G0P3	HYDIN_HUMAN			41	6497	-		Ovarian(137;0.0654)	2124					A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	c.6369C>A	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	1.278	-0.611043	0.03690	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00760	5.73	3.91	0.797	0.18654	.	0.233794	0.20187	N	0.097385	T	0.00210	0.0006	N	0.00170	-1.935	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33624	-0.9861	10	0.02654	T	1	.	3.7216	0.08459	0.1701:0.5649:0.1664:0.0986	.	2123	F8WD23	.	E	2124;2123	ENSP00000377197:D2124E	ENSP00000313052:D2123E	D	-	3	2	HYDIN	69543984	1.000000	0.71417	0.972000	0.41901	0.157000	0.22087	0.541000	0.23207	0.412000	0.25729	-1.154000	0.01816	GAC		0.498	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			11	33	1	0	3.86212e-05	0.008291	4.60431e-05	11	33				
PRPF8	10594	broad.mit.edu	37	17	1554421	1554421	+	Silent	SNP	C	C	A	rs147050234		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:1554421C>A	ENST00000572621.1	-	41	7099	c.6834G>T	c.(6832-6834)tcG>tcT	p.S2278S	PRPF8_ENST00000575116.1_5'Flank|PRPF8_ENST00000304992.6_Silent_p.S2278S|RILP_ENST00000301336.6_5'Flank			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	2278					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TGTAGTTCCACGAGGACTGGG	0.577																																							uc002fte.2		NA																	0				lung(4)|ovary(2)	6						c.(6832-6834)TCG>TCT		U5 snRNP-specific protein							70.0	58.0	62.0					17																	1554421		2203	4300	6503	SO:0001819	synonymous_variant	10594					catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding	g.chr17:1554421C>A	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.6834G>T	17.37:g.1554421C>A			Somatic				RILP_uc002ftd.2_5'Flank	p.S2278S	NM_006445	NP_006436	WXS	Illumina HiSeq	Unspecified	Q6P2Q9	PRP8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)	42	6948	-			2278					O14547|O75965	Silent	SNP	ENST00000572621.1	37	c.6834G>T	CCDS11010.1																																																																																				0.577	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2			15	20	1	0	1.3612e-06	0.003163	1.71108e-06	15	20				
ARHGAP44	9912	broad.mit.edu	37	17	12844441	12844441	+	Splice_Site	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:12844441G>T	ENST00000379672.5	+	8	951	c.651G>T	c.(649-651)acG>acT	p.T217T	ARHGAP44_ENST00000262444.9_Splice_Site_p.T217T|ARHGAP44_ENST00000340825.3_Splice_Site_p.T217T	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	217	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						ACTTTCAAACGGTAAGTGCCC	0.403																																							uc002gnr.3		NA																	0					0						c.(649-651)ACG>ACT		Rho GTPase-activating protein RICH2							116.0	107.0	110.0					17																	12844441		1880	4128	6008	SO:0001630	splice_region_variant	9912				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr17:12844441G>T		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.651+1G>T	17.37:g.12844441G>T			Somatic				RICH2_uc010vvk.1_Silent_p.T217T|RICH2_uc010vvl.1_Silent_p.T217T|RICH2_uc002gns.3_Silent_p.T17T|RICH2_uc010vvm.1_Silent_p.T217T|RICH2_uc010vvn.1_RNA	p.T217T	NM_014859	NP_055674	WXS	Illumina HiSeq	Unspecified	Q17R89	RHG44_HUMAN			8	978	+			217			BAR.		A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Silent	SNP	ENST00000379672.5	37	c.651G>T	CCDS45616.1																																																																																				0.403	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	Silent	22	29	1	0	2.21704e-12	0.00278	3.31566e-12	22	29				
FLCN	201163	broad.mit.edu	37	17	17117142	17117142	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:17117142T>A	ENST00000285071.4	-	14	2021	c.1567A>T	c.(1567-1569)Aag>Tag	p.K523*	RP11-45M22.4_ENST00000427497.3_Intron	NM_144997.5	NP_659434.2	Q8NFG4	FLCN_HUMAN	folliculin	523					cell-cell junction assembly (GO:0007043)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in kidney development (GO:1901723)|negative regulation of energy homeostasis (GO:2000506)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of gene expression (GO:0010629)|negative regulation of mitochondrion organization (GO:0010823)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of gene expression (GO:0010628)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cytokinesis (GO:0032465)|regulation of histone acetylation (GO:0035065)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|regulation of TOR signaling (GO:0032006)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|stomach(1)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CTGTCCACCTTGGTGAACTTA	0.522									Familial Non-VHL Clear Cell Renal Cancer;Birt-Hogg-Dub syndrome																														uc002gra.3		NA																	0				thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3						c.(1567-1569)AAG>TAG		folliculin isoform 1							215.0	192.0	200.0					17																	17117142		2203	4300	6503	SO:0001587	stop_gained	201163	Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer	Familial Cancer Database	Familial Clear Cell Renal Cell Cancer, FcRCC, Familial Non-VHL Non-Papillary Clear Cell Renal Cancer;BHD, Fibrofolliculomas with Trichodiscomas and Acrochordons, incl.: Hornstein-Knickenberg syndrome, Perifollicular Fibromatosis	regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding	g.chr17:17117142T>A	AF517523	CCDS32579.1, CCDS32580.1	17p11.2	2014-09-17			ENSG00000154803	ENSG00000154803			27310	protein-coding gene	gene with protein product		607273					Standard	NM_144997		Approved	BHD, MGC17998, MGC23445	uc002gra.4	Q8NFG4	OTTHUMG00000059275	ENST00000285071.4:c.1567A>T	17.37:g.17117142T>A	ENSP00000285071:p.Lys523*		Somatic				PLD6_uc010cpn.2_Intron	p.K523*	NM_144997	NP_659434	WXS	Illumina HiSeq	Unspecified	Q8NFG4	FLCN_HUMAN			14	2071	-			523					A6NJJ8|Q6ZRX1|Q96BD2|Q96BE4	Nonsense_Mutation	SNP	ENST00000285071.4	37	c.1567A>T	CCDS32579.1	.	.	.	.	.	.	.	.	.	.	T	42	9.552321	0.99202	.	.	ENSG00000154803	ENST00000285071	.	.	.	5.54	4.47	0.54385	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.4175	11.2164	0.48830	0.0:0.0719:0.0:0.9281	.	.	.	.	X	523	.	ENSP00000285071:K523X	K	-	1	0	FLCN	17057867	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.762000	0.85270	0.946000	0.37632	0.459000	0.35465	AAG		0.522	FLCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131577.1	NM_144606		33	93	0	0	0	0.003271	0	33	93				
NOS2	4843	broad.mit.edu	37	17	26109099	26109099	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:26109099C>T	ENST00000313735.6	-	7	897	c.664G>A	c.(664-666)Gaa>Aaa	p.E222K		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	222					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TCAAACATTTCCCGGGCAGTG	0.557																																							uc002gzu.2		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(664-666)GAA>AAA		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)						163.0	115.0	132.0					17																	26109099		2203	4300	6503	SO:0001583	missense	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26109099C>T	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.664G>A	17.37:g.26109099C>T	ENSP00000327251:p.Glu222Lys		Somatic				NOS2_uc010crh.1_Missense_Mutation_p.E222K|NOS2_uc010wab.1_Missense_Mutation_p.E222K	p.E222K	NM_000625	NP_000616	WXS	Illumina HiSeq	Unspecified	P35228	NOS2_HUMAN			7	928	-			222					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	c.664G>A	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.576496	0.86645	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.25085	1.82	5.38	5.38	0.77491	Nitric oxide synthase, oxygenase domain (3);	0.058397	0.64402	D	0.000003	T	0.54791	0.1880	M	0.86343	2.81	0.58432	D	0.999997	P;D	0.64830	0.903;0.994	B;D	0.64144	0.411;0.922	T	0.56257	-0.8009	10	0.31617	T	0.26	.	18.1087	0.89528	0.0:1.0:0.0:0.0	.	222;222	F8WEM3;P35228	.;NOS2_HUMAN	K	222	ENSP00000327251:E222K	ENSP00000305638:E222K	E	-	1	0	NOS2	23133226	1.000000	0.71417	0.994000	0.49952	0.559000	0.35586	7.818000	0.86416	2.526000	0.85167	0.484000	0.47621	GAA		0.557	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		11	40	0	0	0	0.000978	0	11	40				
PIGS	94005	broad.mit.edu	37	17	26890891	26890891	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:26890891G>T	ENST00000308360.7	-	4	696	c.321C>A	c.(319-321)gcC>gcA	p.A107A	PIGS_ENST00000543734.1_Silent_p.A46A|PIGS_ENST00000395346.2_Silent_p.A99A|PIGS_ENST00000465444.1_5'Flank	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	107					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					CCCTCCGATAGGCCTTCTGGA	0.507																																							uc002hbo.2		NA																	0				breast(2)|urinary_tract(1)|kidney(1)	4						c.(319-321)GCC>GCA		phosphatidylinositol glycan anchor biosynthesis,							191.0	173.0	179.0					17																	26890891		2203	4300	6503	SO:0001819	synonymous_variant	94005				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding	g.chr17:26890891G>T		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.321C>A	17.37:g.26890891G>T			Somatic				PIGS_uc002hbn.2_Silent_p.A99A|PIGS_uc010wap.1_Silent_p.A46A	p.A107A	NM_033198	NP_149975	WXS	Illumina HiSeq	Unspecified	Q96S52	PIGS_HUMAN			4	694	-	Lung NSC(42;0.00431)		107			Lumenal (Potential).		Q6UVX6	Silent	SNP	ENST00000308360.7	37	c.321C>A	CCDS11235.1																																																																																				0.507	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198		38	108	1	0	8.01111e-26	0.002522	1.41996e-25	38	108				
LRRC37B	114659	broad.mit.edu	37	17	30348293	30348293	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:30348293G>T	ENST00000341671.7	+	1	133	c.128G>T	c.(127-129)gGg>gTg	p.G43V	LRRC37B_ENST00000327564.7_Missense_Mutation_p.G70V|LRRC37B_ENST00000584368.1_Missense_Mutation_p.G55V|LRRC37B_ENST00000394713.3_Missense_Mutation_p.G43V|LRRC37B_ENST00000543378.2_Intron	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	43						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				AACCCCCTGGGGCCACCTGAG	0.622																																							uc002hgu.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(127-129)GGG>GTG		leucine rich repeat containing 37B precursor							56.0	64.0	62.0					17																	30348293		2203	4300	6503	SO:0001583	missense	114659					integral to membrane		g.chr17:30348293G>T	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.128G>T	17.37:g.30348293G>T	ENSP00000340519:p.Gly43Val		Somatic				LRRC37B_uc010wbx.1_Intron|LRRC37B_uc010csu.2_Missense_Mutation_p.G43V	p.G43V	NM_052888	NP_443120	WXS	Illumina HiSeq	Unspecified	Q96QE4	LR37B_HUMAN			1	139	+		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)	43			Extracellular (Potential).		Q17RC9|Q5YKG6	Missense_Mutation	SNP	ENST00000341671.7	37	c.128G>T	CCDS32609.1	.	.	.	.	.	.	.	.	.	.	N	11.26	1.585781	0.28268	.	.	ENSG00000185158	ENST00000327564;ENST00000394713;ENST00000341671	T;T;T	0.65732	-0.17;0.97;-0.14	1.84	-0.287	0.12858	.	.	.	.	.	T	0.59514	0.2199	L	0.32530	0.975	0.09310	N	1	D;D	0.65815	0.991;0.995	P;P	0.59115	0.68;0.852	T	0.49978	-0.8881	9	0.87932	D	0	.	4.1314	0.10151	0.4017:0.0:0.5983:0.0	.	43;43	Q17RC9;Q96QE4	.;LR37B_HUMAN	V	70;43;43	ENSP00000332536:G70V;ENSP00000378202:G43V;ENSP00000340519:G43V	ENSP00000332536:G70V	G	+	2	0	LRRC37B	27372406	0.000000	0.05858	0.000000	0.03702	0.467000	0.32768	-0.330000	0.07925	-0.044000	0.13491	0.299000	0.19835	GGG		0.622	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888		25	117	1	0	4.26978e-12	0.00333	6.35722e-12	25	117				
KRTAP1-5	83895	broad.mit.edu	37	17	39183195	39183195	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:39183195G>A	ENST00000361883.5	-	1	259	c.213C>T	c.(211-213)tgC>tgT	p.C71C		NM_031957.1	NP_114163.1	Q9BYS1	KRA15_HUMAN	keratin associated protein 1-5	71	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(2)|kidney(1)|lung(9)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	17		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCTTGGCTGGCAGCAGCTGG	0.612																																							uc002hvu.2		NA																	0					0						c.(211-213)TGC>TGT		keratin associated protein 1.5							22.0	28.0	26.0					17																	39183195		2039	4190	6229	SO:0001819	synonymous_variant	83895					keratin filament		g.chr17:39183195G>A	AJ406928	CCDS42321.1	17q21.2	2013-06-25			ENSG00000221852	ENSG00000221852		"""Keratin associated proteins"""	16777	protein-coding gene	gene with protein product		608822				11279113	Standard	NM_031957		Approved	KAP1.5	uc002hvu.3	Q9BYS1	OTTHUMG00000133587	ENST00000361883.5:c.213C>T	17.37:g.39183195G>A			Somatic					p.C71C	NM_031957	NP_114163	WXS	Illumina HiSeq	Unspecified	Q9BYS1	KRA15_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	260	-		Breast(137;0.00043)	71			15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].		A6NJW6|A6NLZ6|B6ZDR1|Q52LP6	Silent	SNP	ENST00000361883.5	37	c.213C>T	CCDS42321.1																																																																																				0.612	KRTAP1-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257691.1			21	63	0	0	0	0.008871	0	21	63				
KRT34	3885	broad.mit.edu	37	17	39535834	39535834	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:39535834C>G	ENST00000394001.1	-	4	894	c.864G>C	c.(862-864)tgG>tgC	p.W288C		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	288	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				GCGTGGCGAACCATTGCTCCA	0.592																																							uc002hwm.2		NA																	0				central_nervous_system(1)	1						c.(862-864)TGG>TGC		keratin 34							142.0	110.0	121.0					17																	39535834		2203	4300	6503	SO:0001583	missense	3885				epidermis development	intermediate filament	protein binding|structural molecule activity	g.chr17:39535834C>G	Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.864G>C	17.37:g.39535834C>G	ENSP00000377570:p.Trp288Cys		Somatic					p.W288C	NM_021013	NP_066293	WXS	Illumina HiSeq	Unspecified	O76011	KRT34_HUMAN			4	876	-		Breast(137;0.000496)	288			Rod.|Coil 2.		Q8IUT8|Q8N4W2	Missense_Mutation	SNP	ENST00000394001.1	37	c.864G>C	CCDS11390.1	.	.	.	.	.	.	.	.	.	.	c	18.82	3.705752	0.68615	.	.	ENSG00000131737	ENST00000394001;ENST00000251648	.	.	.	4.6	4.6	0.57074	Filament (1);	0.000000	0.56097	D	0.000022	D	0.87501	0.6193	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91851	0.5491	9	0.87932	D	0	.	16.7532	0.85492	0.0:1.0:0.0:0.0	.	288	O76011	KRT34_HUMAN	C	246;288	.	ENSP00000251648:W288C	W	-	3	0	KRT34	36789360	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	4.685000	0.61693	2.257000	0.74773	0.603000	0.83216	TGG		0.592	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257304.3	NM_021013		17	127	0	0	0	0.00499	0	17	127				
EZH1	2145	broad.mit.edu	37	17	40858171	40858171	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:40858171T>C	ENST00000428826.2	-	16	1814	c.1693A>G	c.(1693-1695)Acc>Gcc	p.T565A	EZH1_ENST00000585893.1_Missense_Mutation_p.T525A|EZH1_ENST00000435174.1_Missense_Mutation_p.T426A|EZH1_ENST00000590078.1_Missense_Mutation_p.T495A|EZH1_ENST00000592743.1_Missense_Mutation_p.T565A|EZH1_ENST00000590783.1_Intron|EZH1_ENST00000415827.2_Missense_Mutation_p.T556A			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	565	CXC. {ECO:0000255|PROSITE- ProRule:PRU00970}.|Cys-rich.				anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)			breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		TTGCACTGGGTCTTACAGCGA	0.517																																							uc002iaz.2		NA																	0				ovary(3)	3						c.(1693-1695)ACC>GCC		enhancer of zeste homolog 1							158.0	119.0	132.0					17																	40858171		2203	4300	6503	SO:0001583	missense	2145				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding	g.chr17:40858171T>C		CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.1693A>G	17.37:g.40858171T>C	ENSP00000404658:p.Thr565Ala		Somatic				EZH1_uc002iba.2_Missense_Mutation_p.T556A|EZH1_uc010wgt.1_Missense_Mutation_p.T495A|EZH1_uc010wgu.1_Missense_Mutation_p.T571A|EZH1_uc010wgv.1_Missense_Mutation_p.T525A|EZH1_uc010wgw.1_Missense_Mutation_p.T426A|EZH1_uc010cyp.2_Missense_Mutation_p.T466A|EZH1_uc010cyq.2_Missense_Mutation_p.T482A|EZH1_uc010cyo.1_Missense_Mutation_p.T228A	p.T565A	NM_001991	NP_001982	WXS	Illumina HiSeq	Unspecified	Q92800	EZH1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0784)	16	1838	-		Breast(137;0.00104)	565			Cys-rich.		A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	ENST00000428826.2	37	c.1693A>G	CCDS32659.1	.	.	.	.	.	.	.	.	.	.	T	7.068	0.567773	0.13560	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	T;T;T	0.79554	-1.28;-1.28;-1.28	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.48429	0.1499	N	0.00387	-1.565	0.58432	D	0.999999	B;B;B;B;B	0.12630	0.006;0.006;0.006;0.0;0.003	B;B;B;B;B	0.17979	0.02;0.004;0.004;0.002;0.003	T	0.59627	-0.7419	10	0.02654	T	1	.	15.4593	0.75342	0.0:0.0:0.0:1.0	.	426;525;571;495;565	Q92800-5;Q92800-3;Q92800-2;Q92800-4;Q92800	.;.;.;.;EZH1_HUMAN	A	568;565;525;426	ENSP00000404658:T565A;ENSP00000407869:T525A;ENSP00000404071:T426A	ENSP00000264646:T568A	T	-	1	0	EZH1	38111697	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	4.109000	0.57824	2.229000	0.72834	0.533000	0.62120	ACC		0.517	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452347.1	NM_001991		6	101	0	0	0	0.001984	0	6	101				
BRCA1	672	broad.mit.edu	37	17	41209101	41209101	+	Missense_Mutation	SNP	G	G	A	rs273901753|rs397509244		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:41209101G>A	ENST00000357654.3	-	19	5363	c.5245C>T	c.(5245-5247)Cca>Tca	p.P1749S	BRCA1_ENST00000346315.3_Missense_Mutation_p.P1510S|BRCA1_ENST00000354071.3_Missense_Mutation_p.P1484S|BRCA1_ENST00000493795.1_Missense_Mutation_p.P1702S|BRCA1_ENST00000471181.2_Missense_Mutation_p.P1770S|BRCA1_ENST00000468300.1_Missense_Mutation_p.P645S|BRCA1_ENST00000591534.1_Missense_Mutation_p.P240S|BRCA1_ENST00000586385.1_Missense_Mutation_p.P59S|BRCA1_ENST00000352993.3_Missense_Mutation_p.P607S|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000351666.3_Missense_Mutation_p.P566S|BRCA1_ENST00000309486.4_Missense_Mutation_p.P1453S|BRCA1_ENST00000491747.2_Missense_Mutation_p.P645S	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1749			P -> R (in ovarian cancer; unknown pathological significance; abolishes ACACA binding and strongly reduces BRIP1 binding). {ECO:0000269|PubMed:10486320}.		androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GCTCGCTTTGGACCTTGGTGG	0.463			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													uc002icq.2		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	D|Mis|N|F|S	familial breast/ovarian cancer gene 1			E		breast|ovarian	ovarian		0				ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52	GRCh37	CM030005	BRCA1	M		c.(5245-5247)CCA>TCA	Homologous_recombination	breast cancer 1, early onset isoform 1							374.0	349.0	358.0					17																	41209101		2203	4300	6503	SO:0001583	missense	672	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	Familial Cancer Database		androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr17:41209101G>A	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.5245C>T	17.37:g.41209101G>A	ENSP00000350283:p.Pro1749Ser	TCGA Ovarian(2;0.000030)	Somatic				BRCA1_uc010whp.1_Missense_Mutation_p.P598S|BRCA1_uc010whl.1_Missense_Mutation_p.P645S|BRCA1_uc010whm.1_Missense_Mutation_p.P59S|BRCA1_uc002icp.3_Missense_Mutation_p.P1678S|BRCA1_uc002icu.2_Missense_Mutation_p.P645S|BRCA1_uc010cyx.2_Missense_Mutation_p.P1702S|BRCA1_uc002ict.2_Missense_Mutation_p.P1770S|BRCA1_uc010whn.1_Missense_Mutation_p.P240S|BRCA1_uc010who.1_Intron	p.P1749S	NM_007294	NP_009225	WXS	Illumina HiSeq	Unspecified	P38398	BRCA1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.126)	19	5477	-		Breast(137;0.000717)	1749		P -> R (in ovarian cancer; could be a polymorphism; abolishes ACACA binding and strongly reduces BRIP1 binding).			O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	c.5245C>T	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392551	0.83011	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747	D;D;D;T;D;D;D;D;D	0.98914	-2.05;-5.23;-2.05;0.95;-2.05;-2.05;-2.05;-2.05;-2.05	5.07	5.07	0.68467	BRCT (1);	0.000000	0.45361	D	0.000380	D	0.98261	0.9424	L	0.34521	1.04	0.46849	D	0.999223	D;D;D;D;D;P;D	0.89917	1.0;1.0;1.0;0.999;1.0;0.935;1.0	D;D;D;D;D;B;D	0.97110	0.998;1.0;0.998;0.996;0.999;0.11;1.0	D	0.98614	1.0664	10	0.87932	D	0	.	13.8227	0.63333	0.0:0.0:1.0:0.0	.	598;59;644;645;1771;1749;1749	B4DES0;C6YB45;E7ETR2;Q6IN79;E9PFC7;P38398;P38398-2	.;.;.;.;.;BRCA1_HUMAN;.	S	1749;1770;1484;607;1510;566;1453;645;598;1771;1702;644	ENSP00000350283:P1749S;ENSP00000326002:P1484S;ENSP00000312236:P607S;ENSP00000246907:P1510S;ENSP00000338007:P566S;ENSP00000310938:P1453S;ENSP00000417148:P645S;ENSP00000377294:P598S;ENSP00000418775:P1702S	ENSP00000310938:P1453S	P	-	1	0	BRCA1	38462627	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	6.253000	0.72453	2.648000	0.89879	0.557000	0.71058	CCA		0.463	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		40	242	0	0	0	0.002222	0	40	242				
SLC4A1	6521	broad.mit.edu	37	17	42328949	42328949	+	Silent	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:42328949G>C	ENST00000262418.6	-	18	2474	c.2319C>G	c.(2317-2319)tcC>tcG	p.S773S	AC003102.1_ENST00000399246.2_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	773	Membrane (anion exchange).		S -> P (in dRTA-NRC). {ECO:0000269|PubMed:15211439}.		anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CCATGAGGATGGACAGGCCTG	0.627																																							uc002igf.3		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2317-2319)TCC>TCG		solute carrier family 4, anion exchanger, member							60.0	58.0	58.0					17																	42328949		2203	4300	6503	SO:0001819	synonymous_variant	6521				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity	g.chr17:42328949G>C		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.2319C>G	17.37:g.42328949G>C			Somatic					p.S773S	NM_000342	NP_000333	WXS	Illumina HiSeq	Unspecified	P02730	B3AT_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.115)	18	2468	-		Breast(137;0.014)|Prostate(33;0.0181)	773		S -> P (in AR-dRTA; with normal red cell morphology).	Helical; (Potential).|Membrane (anion exchange).		G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Silent	SNP	ENST00000262418.6	37	c.2319C>G	CCDS11481.1																																																																																				0.627	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342		11	34	0	0	0	0.000978	0	11	34				
HOXB3	3213	broad.mit.edu	37	17	46627892	46627892	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:46627892C>A	ENST00000470495.1	-	2	2547	c.1100G>T	c.(1099-1101)gGc>gTc	p.G367V	HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS1_ENST00000508688.1_RNA|HOXB3_ENST00000460160.1_Missense_Mutation_p.G235V|HOXB3_ENST00000472863.1_Missense_Mutation_p.G294V|HOXB3_ENST00000490677.1_Missense_Mutation_p.G233V|HOXB-AS1_ENST00000435312.1_RNA|HOXB3_ENST00000476342.1_Missense_Mutation_p.G367V|HOXB3_ENST00000311626.4_Missense_Mutation_p.G367V|HOXB3_ENST00000498678.1_Missense_Mutation_p.G367V|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000489475.1_Missense_Mutation_p.G294V|HOXB3_ENST00000485909.2_Missense_Mutation_p.G235V			P14651	HXB3_HUMAN	homeobox B3	367					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						GAGGGAGGGGCCGGCAGGGGG	0.716											OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002inn.2		NA																	0					0						c.(1099-1101)GGC>GTC		homeobox B3							17.0	23.0	21.0					17																	46627892		2146	4239	6385	SO:0001583	missense	3213				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46627892C>A		CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.1100G>T	17.37:g.46627892C>A	ENSP00000417207:p.Gly367Val		Somatic	OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	940	HOXB3_uc010wlm.1_Missense_Mutation_p.G294V|HOXB3_uc010dbf.2_Missense_Mutation_p.G367V|HOXB3_uc010dbg.2_Missense_Mutation_p.G367V|HOXB3_uc002ino.2_Missense_Mutation_p.G367V|HOXB3_uc010wlk.1_Missense_Mutation_p.G235V|HOXB3_uc010wll.1_Missense_Mutation_p.G294V	p.G367V	NM_002146	NP_002137	WXS	Illumina HiSeq	Unspecified	P14651	HXB3_HUMAN			2	1500	-			367					A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Missense_Mutation	SNP	ENST00000470495.1	37	c.1100G>T	CCDS11528.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962268	0.74016	.	.	ENSG00000120093	ENST00000470495;ENST00000472863;ENST00000311626;ENST00000498678;ENST00000490677;ENST00000460160;ENST00000485909;ENST00000489475;ENST00000476342	D;D;D;D;D;D;D;D;D	0.92495	-2.87;-2.9;-2.87;-2.87;-3.01;-3.05;-3.05;-2.9;-2.87	4.35	3.37	0.38596	.	0.108223	0.64402	D	0.000006	D	0.95981	0.8691	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96179	0.9129	10	0.87932	D	0	.	12.3278	0.55022	0.0:0.9172:0.0:0.0828	.	367	P14651	HXB3_HUMAN	V	367;294;367;367;233;235;235;294;367	ENSP00000417207:G367V;ENSP00000419676:G294V;ENSP00000308252:G367V;ENSP00000420595:G367V;ENSP00000449977:G233V;ENSP00000418035:G235V;ENSP00000438747:G235V;ENSP00000418729:G294V;ENSP00000418892:G367V	ENSP00000308252:G367V	G	-	2	0	HOXB3	43982891	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.529000	0.81952	1.186000	0.42985	0.462000	0.41574	GGC		0.716	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358261.1			17	29	1	0	1.5739e-10	0.004007	2.2629e-10	17	29				
SPATA20	64847	broad.mit.edu	37	17	48628411	48628411	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:48628411T>C	ENST00000356488.4	+	11	1471	c.1388T>C	c.(1387-1389)cTg>cCg	p.L463P	SPATA20_ENST00000393244.3_Missense_Mutation_p.L419P|SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000006658.6_Missense_Mutation_p.L479P	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	463					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			CGGTACTCGCTGGAGCTGACT	0.642											OREG0024568	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002irf.2		NA																	0					0						c.(1387-1389)CTG>CCG		spermatogenesis associated 20							38.0	40.0	39.0					17																	48628411		2202	4300	6502	SO:0001583	missense	64847				cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding	g.chr17:48628411T>C		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1388T>C	17.37:g.48628411T>C	ENSP00000348878:p.Leu463Pro		Somatic	OREG0024568	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	119	SPATA20_uc002irc.2_Missense_Mutation_p.L130P|SPATA20_uc002ire.2_Missense_Mutation_p.L419P|SPATA20_uc002ird.2_Missense_Mutation_p.L479P|SPATA20_uc002irg.2_RNA	p.L463P	NM_022827	NP_073738	WXS	Illumina HiSeq	Unspecified	Q8TB22	SPT20_HUMAN	BRCA - Breast invasive adenocarcinoma(22;9.38e-09)		11	1529	+	Breast(11;1.23e-18)		463					Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	37	c.1388T>C	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	T	13.40	2.225568	0.39300	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.26373	1.74;1.74;1.74	5.95	4.85	0.62838	Six-hairpin glycosidase-like (1);	0.398183	0.25747	N	0.028575	T	0.16727	0.0402	L	0.27975	0.815	0.58432	D	0.999995	B;B	0.13594	0.004;0.008	B;B	0.17722	0.005;0.019	T	0.07271	-1.0781	10	0.32370	T	0.25	-36.5904	7.1259	0.25471	0.1328:0.0753:0.0:0.7919	.	463;479	Q8TB22;Q8TB22-2	SPT20_HUMAN;.	P	479;463;419	ENSP00000006658:L479P;ENSP00000348878:L463P;ENSP00000376935:L419P	ENSP00000006658:L479P	L	+	2	0	SPATA20	45983410	0.964000	0.33143	0.992000	0.48379	0.993000	0.82548	0.755000	0.26405	1.037000	0.40024	0.533000	0.62120	CTG		0.642	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827		11	36	0	0	0	0.000978	0	11	36				
AKAP1	8165	broad.mit.edu	37	17	55183651	55183651	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:55183651C>G	ENST00000337714.3	+	2	1059	c.826C>G	c.(826-828)Cac>Gac	p.H276D	AKAP1_ENST00000539273.1_Missense_Mutation_p.H276D|AKAP1_ENST00000572557.1_Missense_Mutation_p.H276D|AKAP1_ENST00000571629.1_Missense_Mutation_p.H276D|AKAP1_ENST00000314126.3_Missense_Mutation_p.H276D	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	276					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					CGAGTCGGCTCACACAGAGCT	0.582																																							uc002iux.2		NA																	0				ovary(1)	1						c.(826-828)CAC>GAC		A-kinase anchor protein 1 precursor							102.0	100.0	101.0					17																	55183651		2203	4300	6503	SO:0001583	missense	8165				blood coagulation	cytosol|integral to membrane|mitochondrial outer membrane	protein binding|RNA binding	g.chr17:55183651C>G	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.826C>G	17.37:g.55183651C>G	ENSP00000337736:p.His276Asp		Somatic				AKAP1_uc010wnl.1_Missense_Mutation_p.H276D|AKAP1_uc002iuy.2_RNA|AKAP1_uc010dcm.2_Missense_Mutation_p.H276D	p.H276D	NM_003488	NP_003479	WXS	Illumina HiSeq	Unspecified	Q92667	AKAP1_HUMAN			2	1057	+	Breast(9;5.46e-08)		276					A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	ENST00000337714.3	37	c.826C>G	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.242964	0.39697	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.18338	2.46;2.22;2.46	5.48	2.19	0.27852	.	1.105990	0.06464	N	0.729875	T	0.16385	0.0394	M	0.62723	1.935	0.09310	N	1	P	0.34462	0.454	B	0.26614	0.071	T	0.28038	-1.0056	10	0.37606	T	0.19	0.1465	5.0667	0.14585	0.0:0.4808:0.3349:0.1843	.	276	Q92667	AKAP1_HUMAN	D	276;276;318;276	ENSP00000337736:H276D;ENSP00000314075:H276D;ENSP00000443139:H276D	ENSP00000314075:H276D	H	+	1	0	AKAP1	52538650	0.000000	0.05858	0.023000	0.16930	0.031000	0.12232	-0.005000	0.12855	0.676000	0.31285	0.561000	0.74099	CAC		0.582	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1			22	97	0	0	0	0.00278	0	22	97				
TEX14	56155	broad.mit.edu	37	17	56665328	56665328	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:56665328A>T	ENST00000240361.8	-	16	2734	c.2649T>A	c.(2647-2649)agT>agA	p.S883R	TEX14_ENST00000349033.5_Missense_Mutation_p.S877R|TEX14_ENST00000389934.3_Missense_Mutation_p.S877R			Q8IWB6	TEX14_HUMAN	testis expressed 14	883					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGAAGAGTGcactattaaact	0.493											OREG0024616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010dcz.1		NA																	0				stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17						c.(2647-2649)AGT>AGA		testis expressed sequence 14 isoform a							137.0	116.0	123.0					17																	56665328		2203	4300	6503	SO:0001583	missense	56155					cytoplasm	ATP binding|protein kinase activity	g.chr17:56665328A>T	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.2649T>A	17.37:g.56665328A>T	ENSP00000240361:p.Ser883Arg		Somatic	OREG0024616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1017	TEX14_uc002iwr.1_Missense_Mutation_p.S877R|TEX14_uc002iws.1_Missense_Mutation_p.S877R|TEX14_uc010dda.1_Missense_Mutation_p.S657R	p.S883R	NM_198393	NP_938207	WXS	Illumina HiSeq	Unspecified	Q8IWB6	TEX14_HUMAN			16	2767	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		883					A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	c.2649T>A	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	A	7.774	0.707994	0.15239	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.79141	-1.24;-1.24;-1.2	4.44	1.03	0.20045	.	0.296720	0.34507	N	0.003910	T	0.58850	0.2151	N	0.16478	0.41	0.09310	N	1	B;B;B	0.19073	0.02;0.033;0.033	B;B;B	0.22601	0.018;0.04;0.04	T	0.51593	-0.8686	10	0.59425	D	0.04	-1.8826	6.4134	0.21704	0.7045:0.0:0.2955:0.0	.	883;877;877	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	R	883;877;877	ENSP00000240361:S883R;ENSP00000374584:S877R;ENSP00000268910:S877R	ENSP00000240361:S883R	S	-	3	2	TEX14	54020327	0.038000	0.19896	0.007000	0.13788	0.057000	0.15508	0.887000	0.28254	0.131000	0.18576	0.455000	0.32223	AGT		0.493	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1			12	56	0	0	0	0.000978	0	12	56				
TBX4	9496	broad.mit.edu	37	17	59556073	59556073	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:59556073C>A	ENST00000240335.1	+	5	680	c.635C>A	c.(634-636)aCt>aAt	p.T212N	TBX4_ENST00000589449.1_3'UTR|TBX4_ENST00000393853.4_Missense_Mutation_p.T212N	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	212					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TCCAAAAACACTGCTTTCTGC	0.537																																							uc002izi.2		NA																	0				skin(2)	2						c.(634-636)ACT>AAT		T-box 4							225.0	184.0	198.0					17																	59556073		2203	4300	6503	SO:0001583	missense	9496				leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:59556073C>A	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.635C>A	17.37:g.59556073C>A	ENSP00000240335:p.Thr212Asn		Somatic				TBX4_uc010ddo.2_Missense_Mutation_p.T212N|TBX4_uc010woy.1_Missense_Mutation_p.T212N	p.T212N	NM_018488	NP_060958	WXS	Illumina HiSeq	Unspecified	P57082	TBX4_HUMAN			5	680	+			212			T-box.		A5PKU7|B2RMT1|B7ZLV3	Missense_Mutation	SNP	ENST00000240335.1	37	c.635C>A	CCDS11629.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055456	0.75960	.	.	ENSG00000121075	ENST00000393853;ENST00000240335	D;D	0.87491	-2.26;-2.26	5.94	5.94	0.96194	p53-like transcription factor, DNA-binding (1);	0.044457	0.85682	D	0.000000	D	0.92463	0.7607	M	0.62723	1.935	0.80722	D	1	B;P	0.51537	0.343;0.946	B;D	0.68765	0.174;0.96	D	0.90970	0.4819	9	.	.	.	.	18.9413	0.92607	0.0:1.0:0.0:0.0	.	212;212	A5PKU7;P57082	.;TBX4_HUMAN	N	212	ENSP00000377435:T212N;ENSP00000240335:T212N	.	T	+	2	0	TBX4	56910855	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.920000	0.70017	2.826000	0.97356	0.561000	0.74099	ACT		0.537	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488		28	128	1	0	1.75199e-13	0.007291	2.68611e-13	28	128				
BRIP1	83990	broad.mit.edu	37	17	59938841	59938841	+	Silent	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:59938841T>C	ENST00000259008.2	-	2	327	c.60A>G	c.(58-60)aaA>aaG	p.K20K	BRIP1_ENST00000577598.1_Silent_p.K20K	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	20	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						ACGGGTAAGCTTTATAAGGAA	0.328			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																															uc002izk.1		NA	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	F|N|Mis	BRCA1 interacting protein C-terminal helicase 1			"""L, E"""		AML|leukemia|breast			0				ovary(1)	1						c.(58-60)AAA>AAG	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	BRCA1 interacting protein C-terminal helicase 1							114.0	103.0	106.0					17																	59938841		2203	4300	6503	SO:0001819	synonymous_variant	83990	FanconAnemia			DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding	g.chr17:59938841T>C	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.60A>G	17.37:g.59938841T>C			Somatic					p.K20K	NM_032043	NP_114432	WXS	Illumina HiSeq	Unspecified	Q9BX63	FANCJ_HUMAN			2	201	-			20			Helicase ATP-binding.		Q3MJE2|Q8NCI5	Silent	SNP	ENST00000259008.2	37	c.60A>G	CCDS11631.1																																																																																				0.328	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043		18	41	0	0	0	0.007413	0	18	41				
TBC1D3P2	440452	broad.mit.edu	37	17	60351457	60351457	+	Silent	SNP	G	G	A	rs4968502	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:60351457G>A	ENST00000602932.1	-	2	234	c.204C>T	c.(202-204)cgC>cgT	p.R68R	TBC1D3P2_ENST00000581291.1_RNA																							CCAACTACCCGCGACCTCTAC	0.537													.|||	1576	0.314696	0.0408	0.4308	5008	,	,		19650	0.6518		0.2714	False		,,,				2504	0.2996						uc002izq.2		NA																	0					0						c.(19-21)GCG>GTG		SubName: Full=Putative uncharacterized protein TBC1D3E;																																				SO:0001819	synonymous_variant	440452							g.chr17:60351457G>A																												ENST00000602932.1:c.204C>T	17.37:g.60351457G>A			Somatic				TBC1D3P2_uc010woz.1_RNA	p.A7V			WXS	Illumina HiSeq	Unspecified					2	132	-									Missense_Mutation	SNP	ENST00000602932.1	37	c.20C>T		725	0.33195970695970695	24	0.04878048780487805	127	0.35082872928176795	364	0.6363636363636364	210	0.2770448548812665	.	1.325	-0.598290	0.03744	.	.	ENSG00000188755	ENST00000339120	.	.	.	.	.	.	.	0.296144	0.28151	U	0.016414	T	0.00012	0.0000	.	.	.	.	.	.	P	0.40032	0.699	B	0.33295	0.161	T	0.37361	-0.9709	5	0.07325	T	0.83	.	.	.	.	rs4968502;rs17857478	7	F8WD16	.	V	7	.	ENSP00000339793:A7V	A	-	2	0	AC053481.1	57706239	0.073000	0.21202	0.194000	0.23346	0.195000	0.23768	0.780000	0.26760	0.064000	0.16427	0.064000	0.15345	GCG		0.537	RP11-51L5.7-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000467667.1			13	623	0	0	0	0.00245	0	13	623				
CSH2	1443	broad.mit.edu	37	17	61949552	61949552	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:61949552C>A	ENST00000392886.2	-	5	739	c.588G>T	c.(586-588)atG>atT	p.M196I	CSH2_ENST00000336844.5_3'UTR|CSH2_ENST00000345366.7_Missense_Mutation_p.M101I|CSH2_ENST00000560142.1_Missense_Mutation_p.M139I	NM_020991.3	NP_066271.1	P0DML3	CSH2_HUMAN	chorionic somatomammotropin hormone 2	196						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(1)|lung(3)	6						CGACCTTGTCCATGTCCTTCC	0.562																																							uc002jch.2		NA																	0					0						c.(586-588)ATG>ATT		chorionic somatomammotropin hormone 2 isoform 1							145.0	126.0	132.0					17																	61949552		2203	4298	6501	SO:0001583	missense	1443				female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding	g.chr17:61949552C>A	V00573	CCDS11646.1, CCDS42368.1, CCDS42369.1	17q22-q24	2012-10-02							2441	protein-coding gene	gene with protein product	"""placental lactogen"", ""chorionic somatomammotropin B"""	118820				593368, 6208192	Standard	NM_020991		Approved	hCS-B, CSB, CS-2	uc002jch.3	P0DML3		ENST00000392886.2:c.588G>T	17.37:g.61949552C>A	ENSP00000376623:p.Met196Ile		Somatic				CSH2_uc002jcg.2_Missense_Mutation_p.M101I|CSH2_uc002jci.2_3'UTR|GH2_uc002jcj.2_Missense_Mutation_p.W195L|CSH2_uc002jck.2_Missense_Mutation_p.M196I	p.M196I	NM_020991	NP_066271	WXS	Illumina HiSeq	Unspecified	P01243	CSH_HUMAN			5	703	-			196					P01243|Q0VDB1|Q14407	Missense_Mutation	SNP	ENST00000392886.2	37	c.588G>T	CCDS42369.1	.	.	.	.	.	.	.	.	.	.	N	7.933	0.741155	0.15642	.	.	ENSG00000213218	ENST00000345366;ENST00000392886	D;D	0.88509	-2.39;-2.39	3.97	0.674	0.17946	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	5.385890	0.00559	N	0.000278	D	0.93344	0.7878	M	0.79123	2.44	0.30964	N	0.723287	P;P;P	0.50943	0.94;0.94;0.917	D;D;P	0.63703	0.917;0.917;0.677	T	0.77062	-0.2727	10	0.62326	D	0.03	.	4.331	0.11064	0.1601:0.5943:0.1551:0.0906	.	196;196;101	P01243;A8K6C2;B1A4H9	CSH_HUMAN;.;.	I	101;196	ENSP00000308396:M101I;ENSP00000376623:M196I	ENSP00000308396:M101I	M	-	3	0	CSH2	59303284	1.000000	0.71417	0.954000	0.39281	0.001000	0.01503	2.738000	0.47401	0.001000	0.14605	-0.521000	0.04368	ATG		0.562	CSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417657.1	NM_020991		6	152	1	0	3.59834e-05	0.001168	4.31285e-05	6	152				
ABCA6	23460	broad.mit.edu	37	17	67108373	67108373	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:67108373C>T	ENST00000284425.2	-	16	2257	c.2083G>A	c.(2083-2085)Ggt>Agt	p.G695S		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	695	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					ATAGAAGAACCTGCACACTTC	0.368																																							uc002jhw.1		NA																	0				upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7						c.(2083-2085)GGT>AGT		ATP-binding cassette, sub-family A, member 6							156.0	164.0	162.0					17																	67108373		2203	4300	6503	SO:0001583	missense	23460				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67108373C>T	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.2083G>A	17.37:g.67108373C>T	ENSP00000284425:p.Gly695Ser		Somatic				ABCA6_uc002jhx.1_Missense_Mutation_p.G148S	p.G695S	NM_080284	NP_525023	WXS	Illumina HiSeq	Unspecified	Q8N139	ABCA6_HUMAN			16	2258	-	Breast(10;5.65e-12)		695			ABC transporter 1.		Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	c.2083G>A	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599754	0.87055	.	.	ENSG00000154262	ENST00000284425	T	0.80393	-1.37	4.65	4.65	0.58169	ABC transporter-like (1);	0.116516	0.38058	N	0.001826	D	0.94308	0.8171	H	0.99261	4.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96675	0.9499	10	0.87932	D	0	.	17.0385	0.86483	0.0:1.0:0.0:0.0	.	695	Q8N139	ABCA6_HUMAN	S	695	ENSP00000284425:G695S	ENSP00000284425:G695S	G	-	1	0	ABCA6	64619968	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	6.512000	0.73737	2.568000	0.86640	0.655000	0.94253	GGT		0.368	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284		49	183	0	0	0	0.00361	0	49	183				
KIF19	124602	broad.mit.edu	37	17	72347009	72347009	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:72347009C>A	ENST00000389916.4	+	12	1690	c.1552C>A	c.(1552-1554)Ctg>Atg	p.L518M	AC103809.2_ENST00000599136.1_Missense_Mutation_p.R101M	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	518					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CATTGCAGCCCTGGTGGACGA	0.612																																							uc002jkm.3		NA																	0					0						c.(1552-1554)CTG>ATG		kinesin family member 19							112.0	112.0	112.0					17																	72347009		2203	4300	6503	SO:0001583	missense	124602				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr17:72347009C>A	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1552C>A	17.37:g.72347009C>A	ENSP00000374566:p.Leu518Met		Somatic				KIF19_uc002jkj.2_Missense_Mutation_p.L518M|KIF19_uc002jkk.2_Missense_Mutation_p.L476M|KIF19_uc002jkl.2_Missense_Mutation_p.L476M	p.L518M	NM_153209	NP_694941	WXS	Illumina HiSeq	Unspecified	Q2TAC6	KIF19_HUMAN			12	1690	+			518			Potential.		A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	c.1552C>A	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	c	13.57	2.277816	0.40294	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.75938	-0.98;-0.81	5.62	2.59	0.31030	.	.	.	.	.	D	0.82825	0.5121	M	0.73217	2.22	0.42892	D	0.994208	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.991;1.0;0.998;0.998	T	0.82337	-0.0507	9	0.56958	D	0.05	.	9.9951	0.41893	0.0:0.776:0.0:0.224	.	518;476;476;518	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	M	476;518	ENSP00000449134:L476M;ENSP00000374566:L518M	ENSP00000374566:L518M	L	+	1	2	KIF19	69858604	0.993000	0.37304	0.333000	0.25482	0.001000	0.01503	2.520000	0.45554	0.764000	0.33197	-0.124000	0.14976	CTG		0.612	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209		51	120	1	0	2.23044e-30	0.00361	4.02801e-30	51	120				
GPR142	350383	broad.mit.edu	37	17	72368049	72368049	+	Silent	SNP	G	G	T	rs368419154		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:72368049G>T	ENST00000335666.4	+	4	747	c.699G>T	c.(697-699)acG>acT	p.T233T		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	233						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						TGGTGCGCACGGCCAACATCC	0.642																																							uc010wqy.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(697-699)ACG>ACT		G protein-coupled receptor 142							76.0	57.0	63.0					17																	72368049		2203	4300	6503	SO:0001819	synonymous_variant	350383					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity	g.chr17:72368049G>T	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.699G>T	17.37:g.72368049G>T			Somatic				GPR142_uc010wqx.1_Silent_p.T145T	p.T233T	NM_181790	NP_861455	WXS	Illumina HiSeq	Unspecified	Q7Z601	GP142_HUMAN			4	699	+			233			Extracellular (Potential).		A4CYJ8|Q86SL3	Silent	SNP	ENST00000335666.4	37	c.699G>T	CCDS11698.1																																																																																				0.642	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790		9	25	1	0	0.000274275	0.004482	0.000316835	9	25				
FDXR	2232	broad.mit.edu	37	17	72860303	72860303	+	Silent	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:72860303T>A	ENST00000293195.5	-	9	1047	c.969A>T	c.(967-969)gcA>gcT	p.A323A	FDXR_ENST00000582944.1_Silent_p.A315A|GRIN2C_ENST00000578159.1_5'Flank|FDXR_ENST00000413947.2_Silent_p.A354A|FDXR_ENST00000420580.2_Silent_p.A283A|FDXR_ENST00000442102.2_Silent_p.A366A|FDXR_ENST00000544854.1_Silent_p.A271A|FDXR_ENST00000581530.1_Silent_p.A329A|FDXR_ENST00000581969.1_5'Flank|FDXR_ENST00000583917.1_Silent_p.A295A|FDXR_ENST00000455107.2_Silent_p.A279A	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	323					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	GGACACCTGCTGCCCGCCGCC	0.667																																							uc002jly.2		NA																	0					0						c.(967-969)GCA>GCT		ferredoxin reductase isoform 1 precursor							24.0	28.0	27.0					17																	72860303		2201	4295	6496	SO:0001819	synonymous_variant	2232				cholesterol metabolic process|electron transport chain|steroid biosynthetic process|transport	mitochondrial matrix	ferredoxin-NADP+ reductase activity|protein binding	g.chr17:72860303T>A	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.969A>T	17.37:g.72860303T>A			Somatic				FDXR_uc010wri.1_Silent_p.A271A|FDXR_uc010wrj.1_Silent_p.A321A|FDXR_uc002jlw.2_Silent_p.A80A|FDXR_uc002jlx.2_Silent_p.A329A|FDXR_uc002jmc.2_Silent_p.A295A|FDXR_uc010wrk.1_Silent_p.A354A|FDXR_uc010wrl.1_Silent_p.A366A|FDXR_uc002jma.2_Silent_p.A324A|FDXR_uc010wrm.1_Silent_p.A283A|FDXR_uc002jlz.2_Silent_p.A315A|FDXR_uc002jmb.2_RNA	p.A323A	NM_024417	NP_077728	WXS	Illumina HiSeq	Unspecified	P22570	ADRO_HUMAN			9	1056	-	all_lung(278;0.172)|Lung NSC(278;0.207)		323					B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Silent	SNP	ENST00000293195.5	37	c.969A>T	CCDS58593.1																																																																																				0.667	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110		8	49	0	0	0	0.004482	0	8	49				
GAA	2548	broad.mit.edu	37	17	78086452	78086452	+	Silent	SNP	C	C	T	rs61736896	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:78086452C>T	ENST00000302262.3	+	13	2049	c.1830C>T	c.(1828-1830)gcC>gcT	p.A610A	GAA_ENST00000390015.3_Silent_p.A610A	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	610			A -> V (in GSD2). {ECO:0000269|PubMed:17643989}.|Missing (in GSD2). {ECO:0000269|PubMed:11071489}.		cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	GCCGATACGCCGGCCACTGGA	0.687													C|||	3	0.000599042	0.0	0.0	5008	,	,		15662	0.0		0.003	False		,,,				2504	0.0						uc002jxo.2		NA																	0				ovary(1)	1						c.(1828-1830)GCC>GCT		acid alpha-glucosidase preproprotein	Acarbose(DB00284)	C	,,	0,4378		0,0,2189	19.0	20.0	19.0		1830,1830,1830	-6.9	0.0	17	dbSNP_129	19	10,8556		0,10,4273	no	coding-synonymous,coding-synonymous,coding-synonymous	GAA	NM_000152.3,NM_001079803.1,NM_001079804.1	,,	0,10,6462	TT,TC,CC		0.1167,0.0,0.0773	,,	610/953,610/953,610/953	78086452	10,12934	2189	4283	6472	SO:0001819	synonymous_variant	2548				cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity	g.chr17:78086452C>T		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.1830C>T	17.37:g.78086452C>T			Somatic				GAA_uc002jxp.2_Silent_p.A610A|GAA_uc002jxq.2_Silent_p.A610A	p.A610A	NM_001079803	NP_001073271	WXS	Illumina HiSeq	Unspecified	P10253	LYAG_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		14	2012	+	all_neural(118;0.117)		610		Missing (in GSD2).			Q09GN4|Q14351|Q16302|Q8IWE7	Silent	SNP	ENST00000302262.3	37	c.1830C>T	CCDS32760.1																																																																																				0.687	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1			3	32	0	0	0	0.000248	0	3	32				
COLEC12	81035	broad.mit.edu	37	18	346601	346601	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr18:346601T>A	ENST00000400256.3	-	5	1228	c.1021A>T	c.(1021-1023)Acg>Tcg	p.T341S		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	341					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				ACAATATCCGTCTCAAAGAGC	0.473																																							uc002kkm.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1021-1023)ACG>TCG		collectin sub-family member 12							170.0	138.0	149.0					18																	346601		2203	4300	6503	SO:0001583	missense	81035				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity	g.chr18:346601T>A	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1021A>T	18.37:g.346601T>A	ENSP00000383115:p.Thr341Ser		Somatic					p.T341S	NM_130386	NP_569057	WXS	Illumina HiSeq	Unspecified	Q5KU26	COL12_HUMAN			5	1236	-		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)	341			Extracellular (Potential).		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000400256.3	37	c.1021A>T	CCDS32782.1	.	.	.	.	.	.	.	.	.	.	T	9.279	1.047565	0.19827	.	.	ENSG00000158270	ENST00000400256	T	0.18338	2.22	5.86	1.89	0.25635	.	0.410278	0.30820	N	0.008804	T	0.06280	0.0162	N	0.08118	0	0.28110	N	0.931037	B	0.02656	0.0	B	0.04013	0.001	T	0.38693	-0.9649	10	0.09843	T	0.71	-10.0357	5.8856	0.18880	0.3454:0.0669:0.0:0.5876	.	341	Q5KU26	COL12_HUMAN	S	341	ENSP00000383115:T341S	ENSP00000383115:T341S	T	-	1	0	COLEC12	336601	0.989000	0.36119	0.942000	0.38095	0.985000	0.73830	0.401000	0.20948	0.452000	0.26830	0.533000	0.62120	ACG		0.473	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1			22	26	0	0	0	0.001882	0	22	26				
ASXL3	80816	broad.mit.edu	37	18	31326431	31326431	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr18:31326431G>A	ENST00000269197.5	+	12	6619	c.6619G>A	c.(6619-6621)Gat>Aat	p.D2207N		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	2207					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CAGCAATGCAGATGAATTGGA	0.517																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(6619-6621)GAT>AAT		additional sex combs like 3							94.0	95.0	95.0					18																	31326431		1965	4169	6134	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31326431G>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.6619G>A	18.37:g.31326431G>A	ENSP00000269197:p.Asp2207Asn		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.D1914N	p.D2207N	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	6674	+			2207					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.6619G>A	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585271	0.86748	.	.	ENSG00000141431	ENST00000269197	T	0.16743	2.32	6.17	6.17	0.99709	.	.	.	.	.	T	0.26448	0.0646	N	0.19112	0.55	0.58432	D	0.999993	D	0.56968	0.978	P	0.56916	0.809	T	0.00768	-1.1574	9	0.56958	D	0.05	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	2207	Q9C0F0	ASXL3_HUMAN	N	2207	ENSP00000269197:D2207N	ENSP00000269197:D2207N	D	+	1	0	ASXL3	29580429	1.000000	0.71417	0.186000	0.23195	0.942000	0.58702	9.434000	0.97515	2.941000	0.99782	0.655000	0.94253	GAT		0.517	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			4	84	0	0	0	0.000248	0	4	84				
TPGS2	25941	broad.mit.edu	37	18	34385371	34385371	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr18:34385371G>A	ENST00000334295.4	-	4	775	c.348C>T	c.(346-348)ccC>ccT	p.P116P	TPGS2_ENST00000590842.1_Silent_p.P116P|TPGS2_ENST00000589049.1_Silent_p.P116P|TPGS2_ENST00000587129.1_Silent_p.P116P|TPGS2_ENST00000593035.1_Intron|TPGS2_ENST00000383056.3_Intron	NM_015476.2	NP_056291.2	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2	116						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CTGCCAGAGTGGGTGCATTAG	0.493																																							uc002kzw.1		NA																	0				skin(1)	1						c.(346-348)CCC>CCT		tubulin polyglutamylase complex subunit 2							276.0	228.0	244.0					18																	34385371		2203	4300	6503	SO:0001819	synonymous_variant	25941					cytoplasm|microtubule		g.chr18:34385371G>A	BC015178	CCDS32817.1, CCDS62421.1, CCDS62422.1, CCDS62423.1, CCDS62424.1, CCDS74214.1, CCDS74215.1	18q12.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134779	ENSG00000134779			24561	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 10"""	C18orf10		12477932	Standard	NM_015476		Approved	DKFZP586M1523, HsT3006	uc031rhw.1	Q68CL5		ENST00000334295.4:c.348C>T	18.37:g.34385371G>A			Somatic				C18orf10_uc002kzv.1_Silent_p.P116P|C18orf10_uc010xci.1_Intron|C18orf10_uc002kzx.1_Intron|C18orf10_uc002kzy.3_Silent_p.P116P	p.P116P	NM_015476	NP_056291	WXS	Illumina HiSeq	Unspecified	Q68CL5	TPGS2_HUMAN			4	776	-			116					B4DIX2|K7EIJ9|Q4KN59|Q8WTU3|Q96BT9|Q9Y435	Silent	SNP	ENST00000334295.4	37	c.348C>T	CCDS32817.1																																																																																				0.493	TPGS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000440410.2	NM_015476		41	66	0	0	0	0.002522	0	41	66				
RIT2	6014	broad.mit.edu	37	18	40503615	40503615	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr18:40503615G>A	ENST00000326695.5	-	4	519	c.348C>T	c.(346-348)ctC>ctT	p.L116L	RIT2_ENST00000589109.1_Silent_p.L116L|RIT2_ENST00000282028.4_Silent_p.L116L|RIT2_ENST00000590910.1_Missense_Mutation_p.S137L	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	116					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCTGAAAAATGAGCTCTTTAA	0.507																																							uc002lav.2		NA																	0				ovary(1)	1						c.(346-348)CTC>CTT		Ras-like without CAAX 2							217.0	218.0	218.0					18																	40503615		2203	4300	6503	SO:0001819	synonymous_variant	6014				nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity	g.chr18:40503615G>A	BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.348C>T	18.37:g.40503615G>A			Somatic				RIT2_uc010dnf.2_Silent_p.L116L	p.L116L	NM_002930	NP_002921	WXS	Illumina HiSeq	Unspecified	Q99578	RIT2_HUMAN			4	521	-			116					B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Silent	SNP	ENST00000326695.5	37	c.348C>T	CCDS11921.1																																																																																				0.507	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255852.1	NM_002930		97	138	0	0	0	0.00361	0	97	138				
SETBP1	26040	broad.mit.edu	37	18	42531648	42531648	+	Silent	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr18:42531648A>G	ENST00000282030.5	+	4	2639	c.2343A>G	c.(2341-2343)acA>acG	p.T781T		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	781						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CACTTTCAACACAGTTAGGTG	0.522									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(2341-2343)ACA>ACG		SET binding protein 1 isoform a							63.0	64.0	64.0					18																	42531648		2203	4300	6503	SO:0001819	synonymous_variant	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42531648A>G	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2343A>G	18.37:g.42531648A>G			Somatic					p.T781T	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	2639	+			781					A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	37	c.2343A>G	CCDS11923.2																																																																																				0.522	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		36	32	0	0	0	0.004289	0	36	32				
ST8SIA5	29906	broad.mit.edu	37	18	44260100	44260100	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr18:44260100C>A	ENST00000315087.7	-	7	1696	c.1036G>T	c.(1036-1038)Ggc>Tgc	p.G346C	ST8SIA5_ENST00000538168.1_Missense_Mutation_p.G382C|ST8SIA5_ENST00000536490.1_Missense_Mutation_p.G315C|ST8SIA5_ENST00000590497.1_5'UTR	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	346					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						GCGTGGAAGCCGGGACGCGGC	0.607																																							uc002lcj.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						c.(1036-1038)GGC>TGC		ST8 alpha-N-acetyl-neuraminide							112.0	117.0	115.0					18																	44260100		2203	4300	6503	SO:0001583	missense	29906				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane		g.chr18:44260100C>A	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.1036G>T	18.37:g.44260100C>A	ENSP00000321343:p.Gly346Cys		Somatic				ST8SIA5_uc002lci.1_Missense_Mutation_p.G193C|ST8SIA5_uc010xcy.1_Missense_Mutation_p.G382C|ST8SIA5_uc010xcz.1_Missense_Mutation_p.G315C	p.G346C	NM_013305	NP_037437	WXS	Illumina HiSeq	Unspecified	O15466	SIA8E_HUMAN			7	1604	-			346			Lumenal (Potential).		B7Z1K9|Q6IAW7	Missense_Mutation	SNP	ENST00000315087.7	37	c.1036G>T	CCDS11930.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050239	0.75846	.	.	ENSG00000101638	ENST00000315087;ENST00000538168;ENST00000536490	T;T;T	0.28666	1.6;1.6;1.6	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.64338	0.2589	M	0.89214	3.015	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.986;0.999	T	0.71507	-0.4572	10	0.72032	D	0.01	-10.2943	19.1205	0.93362	0.0:1.0:0.0:0.0	.	315;382;346	F5H8D1;B7Z1K9;O15466	.;.;SIA8E_HUMAN	C	346;382;315	ENSP00000321343:G346C;ENSP00000445492:G382C;ENSP00000443683:G315C	ENSP00000321343:G346C	G	-	1	0	ST8SIA5	42514098	1.000000	0.71417	0.978000	0.43139	0.838000	0.47535	6.084000	0.71335	2.584000	0.87258	0.561000	0.74099	GGC		0.607	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305		30	47	1	0	2.47511e-08	0.008361	3.34339e-08	30	47				
TCEB3B	51224	broad.mit.edu	37	18	44559770	44559770	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr18:44559770C>T	ENST00000332567.4	-	1	2218	c.1866G>A	c.(1864-1866)atG>atA	p.M622I	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	622	Activation domain. {ECO:0000250}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TATTCGTTGTCATTACTCTCA	0.502																																							uc002lcr.1		NA																	0				ovary(2)|large_intestine(1)|pancreas(1)	4						c.(1864-1866)ATG>ATA		elongin A2							105.0	105.0	105.0					18																	44559770		2203	4300	6503	SO:0001583	missense	51224				regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding	g.chr18:44559770C>T	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1866G>A	18.37:g.44559770C>T	ENSP00000331302:p.Met622Ile		Somatic				KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	p.M622I	NM_016427	NP_057511	WXS	Illumina HiSeq	Unspecified	Q8IYF1	ELOA2_HUMAN			1	2219	-			622			Activation domain (By similarity).		Q9P2V9	Missense_Mutation	SNP	ENST00000332567.4	37	c.1866G>A	CCDS11932.1	.	.	.	.	.	.	.	.	.	.	C	7.313	0.615427	0.14129	.	.	ENSG00000206181	ENST00000332567	T	0.26518	1.73	1.4	-0.652	0.11450	.	0.883378	0.09304	N	0.820463	T	0.07369	0.0186	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28713	-1.0035	10	0.39692	T	0.17	-8.3743	0.5438	0.00650	0.2458:0.329:0.2437:0.1815	.	622	Q8IYF1	ELOA2_HUMAN	I	622	ENSP00000331302:M622I	ENSP00000331302:M622I	M	-	3	0	TCEB3B	42813768	0.927000	0.31430	0.000000	0.03702	0.000000	0.00434	-0.214000	0.09292	-0.237000	0.09739	-0.192000	0.12808	ATG		0.502	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427		52	71	0	0	0	0.00361	0	52	71				
ZNF516	9658	broad.mit.edu	37	18	74091609	74091609	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr18:74091609C>G	ENST00000443185.2	-	4	2778	c.2461G>C	c.(2461-2463)Gcc>Ccc	p.A821P	ZNF516_ENST00000524431.2_5'UTR|RP11-504I13.3_ENST00000583287.1_RNA	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	821					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CCACCGAGGGCAGGCGGGGGG	0.612																																							uc010dqx.1		NA																	0				ovary(1)	1						c.(2461-2463)GCC>CCC		zinc finger protein 516							41.0	50.0	47.0					18																	74091609		1934	4123	6057	SO:0001583	missense	9658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:74091609C>G	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.2461G>C	18.37:g.74091609C>G	ENSP00000394757:p.Ala821Pro		Somatic				ZNF516_uc002lme.2_RNA|ZNF516_uc002lmd.2_RNA	p.A821P	NM_014643	NP_055458	WXS	Illumina HiSeq	Unspecified	Q92618	ZN516_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)	3	2696	-		Prostate(75;0.0869)|Esophageal squamous(42;0.129)	821						Missense_Mutation	SNP	ENST00000443185.2	37	c.2461G>C		.	.	.	.	.	.	.	.	.	.	C	13.06	2.124308	0.37533	.	.	ENSG00000101493	ENST00000443185	T	0.12465	2.68	4.31	4.31	0.51392	.	0.179933	0.36101	N	0.002782	T	0.27063	0.0663	.	.	.	0.21579	N	0.999637	D	0.57257	0.979	P	0.55222	0.771	T	0.03240	-1.1057	9	0.56958	D	0.05	-12.5748	15.5252	0.75898	0.0:1.0:0.0:0.0	.	821	Q92618	ZN516_HUMAN	P	821	ENSP00000394757:A821P	ENSP00000394757:A821P	A	-	1	0	ZNF516	72220597	0.919000	0.31177	0.131000	0.22000	0.066000	0.16364	2.206000	0.42779	2.387000	0.81309	0.561000	0.74099	GCC		0.612	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643		26	49	0	0	0	0.003954	0	26	49				
CATSPERD	257062	broad.mit.edu	37	19	5745958	5745958	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:5745958G>T	ENST00000381624.3	+	9	753	c.692G>T	c.(691-693)cGg>cTg	p.R231L	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	231					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											CCCCTCAACCGGAGTTTCGGG	0.527																																							uc002mda.2		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(691-693)CGG>CTG		transmembrane protein 146 precursor							167.0	160.0	162.0					19																	5745958		1882	4119	6001	SO:0001583	missense	257062					integral to membrane		g.chr19:5745958G>T	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.692G>T	19.37:g.5745958G>T	ENSP00000371037:p.Arg231Leu		Somatic				TMEM146_uc010duj.1_5'UTR	p.R231L	NM_152784	NP_689997	WXS	Illumina HiSeq	Unspecified	Q86XM0	TM146_HUMAN			9	753	+			231			Extracellular (Potential).		Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	37	c.692G>T	CCDS12149.2	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997047	0.54147	.	.	ENSG00000174898	ENST00000394548;ENST00000381624	T	0.16743	2.32	2.91	-3.97	0.04094	.	1.583910	0.04684	U	0.412863	T	0.13072	0.0317	L	0.43152	1.355	0.09310	N	0.999998	P	0.44627	0.839	B	0.43052	0.406	T	0.22695	-1.0209	10	0.19590	T	0.45	-1.5222	2.6155	0.04902	0.3728:0.0:0.2705:0.3567	.	231	Q86XM0	TM146_HUMAN	L	157;231	ENSP00000371037:R231L	ENSP00000371037:R231L	R	+	2	0	TMEM146	5696958	0.099000	0.21834	0.000000	0.03702	0.323000	0.28346	-0.000000	0.12993	-0.746000	0.04766	0.491000	0.48974	CGG		0.527	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784		86	143	1	0	1.68737e-39	0.00361	3.11442e-39	86	143				
DUS3L	56931	broad.mit.edu	37	19	5789498	5789498	+	Missense_Mutation	SNP	C	C	A	rs34998818	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:5789498C>A	ENST00000309061.7	-	3	716	c.620G>T	c.(619-621)cGc>cTc	p.R207L	DUS3L_ENST00000590681.1_5'UTR|DUS3L_ENST00000320699.8_Intron	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	207							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						CAGGCCGTTGCGGATGGACGG	0.721													C|||	23	0.00459265	0.0174	0.0	5008	,	,		13620	0.0		0.0	False		,,,				2504	0.0						uc002mdc.2		NA																	0					0						c.(619-621)CGC>CTC		dihydrouridine synthase 3-like isoform 1		C	,LEU/ARG	72,4224		0,72,2076	9.0	13.0	12.0		,620	4.5	0.4	19	dbSNP_126	12	0,8446		0,0,4223	no	intron,missense	DUS3L	NM_001161619.1,NM_020175.2	,102	0,72,6299	AA,AC,CC		0.0,1.676,0.5651	,benign	,207/651	5789498	72,12670	2148	4223	6371	SO:0001583	missense	56931				tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding	g.chr19:5789498C>A		CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.620G>T	19.37:g.5789498C>A	ENSP00000311977:p.Arg207Leu		Somatic				DUS3L_uc002mdd.2_Intron|DUS3L_uc010duk.2_5'UTR|DUS3L_uc010xiw.1_RNA	p.R207L	NM_020175	NP_064560	WXS	Illumina HiSeq	Unspecified	Q96G46	DUS3L_HUMAN			3	717	-			207					Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	ENST00000309061.7	37	c.620G>T	CCDS32880.1	16	0.007326007326007326	16	0.032520325203252036	0	0.0	0	0.0	0	0.0	C	3.469	-0.108372	0.06924	0.01676	0.0	ENSG00000141994	ENST00000309061	T	0.16897	2.31	4.51	4.51	0.55191	.	0.241269	0.33792	N	0.004555	T	0.05456	0.0144	M	0.67953	2.075	0.33966	D	0.646178	B	0.06786	0.001	B	0.12837	0.008	T	0.12319	-1.0552	10	0.10636	T	0.68	-30.5805	8.558	0.33494	0.0:0.8924:0.0:0.1076	rs34998818	207	Q96G46	DUS3L_HUMAN	L	207	ENSP00000311977:R207L	ENSP00000311977:R207L	R	-	2	0	DUS3L	5740498	0.993000	0.37304	0.448000	0.26945	0.126000	0.20510	1.610000	0.36869	2.057000	0.61298	0.491000	0.48974	CGC		0.721	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451870.2	NM_020175		5	24	1	0	0.000602214	0.000602	0.000689716	5	24				
MUC16	94025	broad.mit.edu	37	19	9014562	9014562	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:9014562T>A	ENST00000397910.4	-	31	38616	c.38413A>T	c.(38413-38415)Acc>Tcc	p.T12805S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12807	SEA 5. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGTCCAGGGTGTAGGGACCC	0.557																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(38413-38415)ACC>TCC		mucin 16							198.0	155.0	169.0					19																	9014562		1946	4128	6074	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9014562T>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38413A>T	19.37:g.9014562T>A	ENSP00000381008:p.Thr12805Ser		Somatic				MUC16_uc010xki.1_5'Flank	p.T12805S	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			31	38617	-			12807	Missing (in Ref. 3; AAK74120).		SEA 5.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.38413A>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	11.28	1.591360	0.28357	.	.	ENSG00000181143	ENST00000397910	T	0.24538	1.85	3.03	1.99	0.26369	.	.	.	.	.	T	0.29914	0.0748	M	0.62016	1.91	.	.	.	B	0.30686	0.29	B	0.40602	0.334	T	0.41574	-0.9501	8	0.87932	D	0	.	4.9989	0.14255	0.0:0.1485:0.0:0.8515	.	12805	B5ME49	.	S	12805	ENSP00000381008:T12805S	ENSP00000381008:T12805S	T	-	1	0	MUC16	8875562	0.008000	0.16893	0.266000	0.24541	0.040000	0.13550	0.038000	0.13862	0.362000	0.24319	0.254000	0.18369	ACC		0.557	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		93	134	0	0	0	0.00361	0	93	134				
MUC16	94025	broad.mit.edu	37	19	9084596	9084596	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:9084596G>T	ENST00000397910.4	-	1	7422	c.7219C>A	c.(7219-7221)Ctc>Atc	p.L2407I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2407	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAAGAGAAGAGAGATGGGGAG	0.473																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(7219-7221)CTC>ATC		mucin 16							103.0	104.0	104.0					19																	9084596		1957	4155	6112	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9084596G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7219C>A	19.37:g.9084596G>T	ENSP00000381008:p.Leu2407Ile		Somatic					p.L2407I	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	7423	-			2407			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.7219C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.041	-0.420164	0.04734	.	.	ENSG00000181143	ENST00000397910	T	0.02890	4.12	0.225	0.225	0.15325	.	.	.	.	.	T	0.03434	0.0099	N	0.08118	0	.	.	.	P	0.49696	0.927	P	0.56563	0.801	T	0.45862	-0.9232	7	0.87932	D	0	.	.	.	.	.	2407	B5ME49	.	I	2407	ENSP00000381008:L2407I	ENSP00000381008:L2407I	L	-	1	0	MUC16	8945596	0.001000	0.12720	0.100000	0.21137	0.100000	0.18952	-0.054000	0.11826	0.300000	0.22699	0.305000	0.20034	CTC		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		18	20	1	0	1.33834e-09	0.007413	1.87984e-09	18	20				
ZNF317	57693	broad.mit.edu	37	19	9269521	9269521	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:9269521A>T	ENST00000247956.6	+	6	710	c.405A>T	c.(403-405)aaA>aaT	p.K135N	ZNF317_ENST00000360385.3_Missense_Mutation_p.K103N	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						CTCCATCTAAAACCAAGTGGT	0.413																																							uc002mku.2		NA																	0					0						c.(403-405)AAA>AAT		zinc finger protein 317							115.0	104.0	108.0					19																	9269521		2203	4300	6503	SO:0001583	missense	57693				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9269521A>T	AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.405A>T	19.37:g.9269521A>T	ENSP00000247956:p.Lys135Asn		Somatic				ZNF317_uc002mkv.2_5'UTR|ZNF317_uc002mkw.2_Missense_Mutation_p.K103N|ZNF317_uc002mkx.2_Missense_Mutation_p.K50N|ZNF317_uc002mky.2_Missense_Mutation_p.K18N	p.K135N	NM_020933	NP_065984	WXS	Illumina HiSeq	Unspecified	Q96PQ6	ZN317_HUMAN			6	680	+			135					Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Missense_Mutation	SNP	ENST00000247956.6	37	c.405A>T	CCDS12210.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.412706	0.42817	.	.	ENSG00000130803	ENST00000247956;ENST00000360385	T;T	0.05786	3.39;5.69	3.15	-0.248	0.13015	.	0.317652	0.22981	N	0.053312	T	0.11495	0.0280	L	0.47190	1.495	0.27428	N	0.954102	D;D	0.71674	0.989;0.998	D;D	0.73708	0.978;0.981	T	0.13737	-1.0498	10	0.41790	T	0.15	-15.6366	2.3074	0.04177	0.3791:0.0:0.2375:0.3834	.	103;135	Q96PQ6-2;Q96PQ6	.;ZN317_HUMAN	N	135;103	ENSP00000247956:K135N;ENSP00000353554:K103N	ENSP00000247956:K135N	K	+	3	2	ZNF317	9130521	0.964000	0.33143	0.037000	0.18230	0.981000	0.71138	0.189000	0.17037	-0.119000	0.11830	-0.669000	0.03829	AAA		0.413	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448995.1	NM_020933		4	26	0	0	0	0.000248	0	4	26				
QTRT1	81890	broad.mit.edu	37	19	10823446	10823446	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:10823446G>C	ENST00000250237.5	+	8	884	c.874G>C	c.(874-876)Gcc>Ccc	p.A292P		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	292					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CTTTGGCTCTGCCCTGGTGCC	0.622																																							uc002mpr.2		NA																	0				skin(1)	1						c.(874-876)GCC>CCC		queuine tRNA-ribosyltransferase 1							114.0	108.0	110.0					19																	10823446		2203	4300	6503	SO:0001583	missense	81890				queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity	g.chr19:10823446G>C	AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.874G>C	19.37:g.10823446G>C	ENSP00000250237:p.Ala292Pro		Somatic				DNM2_uc010dxk.2_5'Flank	p.A292P	NM_031209	NP_112486	WXS	Illumina HiSeq	Unspecified	Q9BXR0	TGT_HUMAN	Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)		8	899	+			292					B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	37	c.874G>C	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687841	0.68271	.	.	ENSG00000213339	ENST00000250237	.	.	.	3.87	3.87	0.44632	.	0.074633	0.52532	U	0.000062	D	0.88280	0.6394	H	0.99042	4.41	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.92084	0.5675	9	0.72032	D	0.01	-5.5173	12.8457	0.57829	0.0:0.0:1.0:0.0	.	292	Q9BXR0	TGT_HUMAN	P	292	.	ENSP00000250237:A292P	A	+	1	0	QTRT1	10684446	1.000000	0.71417	0.994000	0.49952	0.812000	0.45895	6.497000	0.73674	2.005000	0.58758	0.462000	0.41574	GCC		0.622	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209		28	115	0	0	0	0.003755	0	28	115				
OR7A5	26659	broad.mit.edu	37	19	14938756	14938756	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:14938756G>T	ENST00000322301.3	-	2	385	c.298C>A	c.(298-300)Cag>Aag	p.Q100K	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Missense_Mutation_p.Q100K			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	100					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						AAATACATCTGCATGAGGCAG	0.453																																							uc002mzw.2		NA																	0				central_nervous_system(2)	2						c.(298-300)CAG>AAG		olfactory receptor, family 7, subfamily A,							174.0	157.0	163.0					19																	14938756		2203	4300	6503	SO:0001583	missense	26659				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:14938756G>T	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.298C>A	19.37:g.14938756G>T	ENSP00000316955:p.Gln100Lys		Somatic				OR7A5_uc010xoa.1_Missense_Mutation_p.Q100K	p.Q100K	NM_017506	NP_059976	WXS	Illumina HiSeq	Unspecified	Q15622	OR7A5_HUMAN			1	521	-			100			Helical; Name=3; (Potential).		B2R682|Q6IFP1|Q96R96	Missense_Mutation	SNP	ENST00000322301.3	37	c.298C>A	CCDS12318.1	.	.	.	.	.	.	.	.	.	.	g	15.36	2.811006	0.50421	.	.	ENSG00000188269	ENST00000322301	T	0.00462	7.26	3.13	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.291007	0.17991	U	0.155214	T	0.01523	0.0049	H	0.99464	4.58	0.40901	D	0.98415	B	0.29936	0.262	B	0.33620	0.167	T	0.00855	-1.1539	10	0.87932	D	0	.	12.25	0.54593	0.0:0.0:1.0:0.0	.	100	Q15622	OR7A5_HUMAN	K	100	ENSP00000316955:Q100K	ENSP00000316955:Q100K	Q	-	1	0	OR7A5	14799756	1.000000	0.71417	0.048000	0.18961	0.080000	0.17528	6.172000	0.71932	1.807000	0.52817	0.134000	0.15878	CAG		0.453	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506		22	102	1	0	3.8784e-16	0.001882	6.23149e-16	22	102				
NWD1	284434	broad.mit.edu	37	19	16861059	16861059	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:16861059C>A	ENST00000552788.1	+	4	1606	c.1606C>A	c.(1606-1608)Ctg>Atg	p.L536M	NWD1_ENST00000523826.1_Missense_Mutation_p.L330M|NWD1_ENST00000339803.6_Missense_Mutation_p.L401M|NWD1_ENST00000379808.3_Missense_Mutation_p.L536M|NWD1_ENST00000524140.2_Missense_Mutation_p.L536M|NWD1_ENST00000549814.1_Missense_Mutation_p.L536M			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	536	NACHT.						ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCCAGGGCGGCTGAGGCTGGC	0.647																																							uc002neu.3		NA																	0				skin(3)|ovary(2)|pancreas(2)	7						c.(1606-1608)CTG>ATG		RecName: Full=NACHT and WD repeat domain-containing protein 1;							28.0	30.0	30.0					19																	16861059		2202	4296	6498	SO:0001583	missense	284434						ATP binding	g.chr19:16861059C>A	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1606C>A	19.37:g.16861059C>A	ENSP00000447224:p.Leu536Met		Somatic				NWD1_uc002net.3_Missense_Mutation_p.L401M|NWD1_uc002nev.3_Missense_Mutation_p.L330M	p.L536M			WXS	Illumina HiSeq	Unspecified	Q149M9	NWD1_HUMAN			6	2028	+			536			NACHT.		C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37	c.1606C>A		.	.	.	.	.	.	.	.	.	.	c	16.46	3.128874	0.56721	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.65916	-0.18;-0.11;-0.18;-0.17;-0.12;-0.13	5.04	3.99	0.46301	.	0.078947	0.51477	D	0.000092	T	0.75649	0.3878	M	0.72479	2.2	0.36721	D	0.881193	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.998;0.999;0.997	T	0.81052	-0.1107	10	0.62326	D	0.03	-16.4808	11.5884	0.50931	0.0:0.9089:0.0:0.0911	.	536;536;401	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	M	401;536;536;536;330;536;401	ENSP00000428579:L536M;ENSP00000447548:L536M;ENSP00000369136:L536M;ENSP00000428955:L330M;ENSP00000447224:L536M;ENSP00000340159:L401M	ENSP00000340159:L401M	L	+	1	2	NWD1	16722059	0.999000	0.42202	0.987000	0.45799	0.404000	0.30871	1.906000	0.39887	2.339000	0.79563	0.549000	0.68633	CTG		0.647	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525		11	45	1	0	6.40141e-05	0.000978	7.57764e-05	11	45				
NWD1	284434	broad.mit.edu	37	19	16874727	16874727	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:16874727G>T	ENST00000552788.1	+	7	2222	c.2222G>T	c.(2221-2223)cGc>cTc	p.R741L	NWD1_ENST00000523826.1_Missense_Mutation_p.R535L|NWD1_ENST00000339803.6_Missense_Mutation_p.R606L|NWD1_ENST00000379808.3_Missense_Mutation_p.R741L|NWD1_ENST00000524140.2_Missense_Mutation_p.R741L|NWD1_ENST00000549814.1_Missense_Mutation_p.R741L			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	741							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CACTCGGGCCGCCTGGAGGAG	0.617																																							uc002neu.3		NA																	0				skin(3)|ovary(2)|pancreas(2)	7						c.(2221-2223)CGC>CTC		RecName: Full=NACHT and WD repeat domain-containing protein 1;							51.0	49.0	50.0					19																	16874727		2203	4300	6503	SO:0001583	missense	284434						ATP binding	g.chr19:16874727G>T	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.2222G>T	19.37:g.16874727G>T	ENSP00000447224:p.Arg741Leu		Somatic				NWD1_uc002net.3_Missense_Mutation_p.R606L|NWD1_uc002nev.3_Missense_Mutation_p.R535L	p.R741L			WXS	Illumina HiSeq	Unspecified	Q149M9	NWD1_HUMAN			9	2644	+			741					C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37	c.2222G>T		.	.	.	.	.	.	.	.	.	.	G	13.00	2.106809	0.37145	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.61158	0.13;0.21;0.13;0.14;0.17;0.18	4.88	3.84	0.44239	.	0.396975	0.26265	N	0.025363	T	0.51924	0.1703	M	0.74258	2.255	0.31653	N	0.646538	B;B;B	0.12630	0.003;0.006;0.003	B;B;B	0.12837	0.003;0.008;0.005	T	0.51942	-0.8641	10	0.20046	T	0.44	-26.1432	8.1744	0.31272	0.1095:0.0:0.8905:0.0	.	741;741;606	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	L	606;741;741;741;535;741;606	ENSP00000428579:R741L;ENSP00000447548:R741L;ENSP00000369136:R741L;ENSP00000428955:R535L;ENSP00000447224:R741L;ENSP00000340159:R606L	ENSP00000340159:R606L	R	+	2	0	NWD1	16735727	0.527000	0.26306	0.882000	0.34594	0.838000	0.47535	3.256000	0.51492	2.257000	0.74773	0.472000	0.43445	CGC		0.617	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525		21	32	1	0	1.2644e-06	0.001523	1.59539e-06	21	32				
MYO9B	4650	broad.mit.edu	37	19	17311621	17311621	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:17311621G>T	ENST00000594824.1	+	26	4693	c.4546G>T	c.(4546-4548)Gag>Tag	p.E1516*	MYO9B_ENST00000397274.2_Nonsense_Mutation_p.E1516*|MYO9B_ENST00000595618.1_Nonsense_Mutation_p.E1516*			Q13459	MYO9B_HUMAN	myosin IXB	1516	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GTACCTGGACGAGTTCCTGCT	0.557																																							uc010eak.2		NA																	0				breast(1)	1						c.(4546-4548)GAG>TAG		myosin IXB isoform 1							123.0	128.0	126.0					19																	17311621		2069	4186	6255	SO:0001587	stop_gained	4650				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity	g.chr19:17311621G>T		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.4546G>T	19.37:g.17311621G>T	ENSP00000471367:p.Glu1516*		Somatic				MYO9B_uc002nfi.2_Nonsense_Mutation_p.E1516*|MYO9B_uc002nfj.1_Nonsense_Mutation_p.E1516*|MYO9B_uc002nfl.1_Nonsense_Mutation_p.E65*	p.E1516*	NM_004145	NP_004136	WXS	Illumina HiSeq	Unspecified	Q13459	MYO9B_HUMAN			26	4698	+			1516			Tail.		O75314|Q9NUJ2|Q9UHN0	Nonsense_Mutation	SNP	ENST00000594824.1	37	c.4546G>T		.	.	.	.	.	.	.	.	.	.	G	44	11.182163	0.99527	.	.	ENSG00000099331	ENST00000397274	.	.	.	4.74	4.74	0.60224	.	0.000000	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	14.8763	0.70496	0.0:0.0:1.0:0.0	.	.	.	.	X	1516	.	ENSP00000380444:E1516X	E	+	1	0	MYO9B	17172621	1.000000	0.71417	0.995000	0.50966	0.826000	0.46750	8.553000	0.90686	2.194000	0.70268	0.436000	0.28706	GAG		0.557	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1			13	83	1	0	1.5842e-08	0.001855	2.15735e-08	13	83				
ZNF99	7652	broad.mit.edu	37	19	22952090	22952090	+	Missense_Mutation	SNP	C	C	G	rs201519928	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:22952090C>G	ENST00000596209.1	-	2	130	c.40G>C	c.(40-42)Gct>Cct	p.A14P	ZNF99_ENST00000397104.3_Missense_Mutation_p.A35P	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	14	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TCCTCCAGAGCGAATTCTATG	0.408																																							uc010xrh.1		NA																	0				ovary(1)|skin(1)	2						c.(103-105)GCT>CCT		zinc finger protein 99							76.0	82.0	80.0					19																	22952090		2198	4300	6498	SO:0001583	missense	7652							g.chr19:22952090C>G	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.40G>C	19.37:g.22952090C>G	ENSP00000472969:p.Ala14Pro		Somatic					p.A35P	NM_001080409	NP_001073878	WXS	Illumina HiSeq	Unspecified					2	103	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.103G>C	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	a	0.015	-1.565675	0.00903	.	.	ENSG00000213973	ENST00000397104	T	0.01745	4.66	1.04	-2.08	0.07254	Krueppel-associated box (4);	.	.	.	.	T	0.00875	0.0029	N	0.03608	-0.345	0.09310	N	1	B	0.13145	0.007	B	0.16289	0.015	T	0.47674	-0.9099	9	0.72032	D	0.01	.	1.8418	0.03151	0.2931:0.2542:0.0:0.4528	.	35	A8MXY4	ZNF99_HUMAN	P	35	ENSP00000380293:A35P	ENSP00000380293:A35P	A	-	1	0	ZNF99	22743930	0.449000	0.25689	0.003000	0.11579	0.002000	0.02628	-0.456000	0.06754	-1.794000	0.01256	-1.953000	0.00484	GCT		0.408	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		28	56	0	0	0	0.00632	0	28	56				
URI1	8725	broad.mit.edu	37	19	30477230	30477230	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:30477230C>T	ENST00000542441.2	+	4	570	c.273C>T	c.(271-273)gtC>gtT	p.V91V	URI1_ENST00000360605.4_Silent_p.V73V|URI1_ENST00000312051.6_Silent_p.V51V|URI1_ENST00000392271.1_Silent_p.V15V			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	91					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										GAAAACTTGTCCATACTAATG	0.388																																						Melanoma(75;661 1306 1472 28422 37948)	uc002nsr.2		NA																	0				ovary(1)|kidney(1)	2						c.(271-273)GTC>GTT		RPB5-mediating protein isoform a							149.0	141.0	144.0					19																	30477230		2203	4300	6503	SO:0001819	synonymous_variant	8725				protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding	g.chr19:30477230C>T	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.273C>T	19.37:g.30477230C>T			Somatic				C19orf2_uc002nsq.2_Silent_p.V73V|C19orf2_uc002nss.2_Silent_p.V51V|C19orf2_uc002nst.2_Silent_p.V15V	p.V91V	NM_003796	NP_003787	WXS	Illumina HiSeq	Unspecified	O94763	RMP_HUMAN	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)	4	303	+	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	91					A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	ENST00000542441.2	37	c.273C>T	CCDS12420.1																																																																																				0.388	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447		17	86	0	0	0	0.007413	0	17	86				
GPI	2821	broad.mit.edu	37	19	34859521	34859521	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:34859521C>T	ENST00000356487.5	+	4	557	c.316C>T	c.(316-318)Cgg>Tgg	p.R106W	GPI_ENST00000415930.3_Missense_Mutation_p.R145W|GPI_ENST00000586425.1_Missense_Mutation_p.R106W	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	106					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					TCTGCGGAACCGGTCAAACAC	0.582																																							uc002nvg.1		NA																	0				ovary(1)|kidney(1)	2						c.(316-318)CGG>TGG		glucose phosphate isomerase							142.0	113.0	123.0					19																	34859521		2203	4300	6503	SO:0001583	missense	2821				angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity	g.chr19:34859521C>T	M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.316C>T	19.37:g.34859521C>T	ENSP00000348877:p.Arg106Trp		Somatic				GPI_uc002nvf.2_Missense_Mutation_p.R145W|GPI_uc010xrv.1_Missense_Mutation_p.R145W|GPI_uc010xrw.1_Missense_Mutation_p.R106W|GPI_uc010edl.1_Missense_Mutation_p.R106W|GPI_uc002nvh.1_3'UTR	p.R106W	NM_000175	NP_000166	WXS	Illumina HiSeq	Unspecified	P06744	G6PI_HUMAN			4	419	+	Esophageal squamous(110;0.162)		106					B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	ENST00000356487.5	37	c.316C>T	CCDS12437.1	.	.	.	.	.	.	.	.	.	.	C	33	5.214815	0.95104	.	.	ENSG00000105220	ENST00000415930;ENST00000356487	D;D	0.94330	-3.4;-3.4	5.76	5.76	0.90799	.	0.047867	0.85682	D	0.000000	D	0.97084	0.9047	M	0.82923	2.615	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.995;0.992;0.995;0.996	D	0.97208	0.9869	10	0.87932	D	0	-24.8035	19.9698	0.97280	0.0:1.0:0.0:0.0	.	106;145;89;106	B4DE36;B4DG39;B4DVJ0;P06744	.;.;.;G6PI_HUMAN	W	145;106	ENSP00000405573:R145W;ENSP00000348877:R106W	ENSP00000348877:R106W	R	+	1	2	GPI	39551361	1.000000	0.71417	0.997000	0.53966	0.726000	0.41606	3.973000	0.56845	2.721000	0.93114	0.555000	0.69702	CGG		0.582	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3			5	55	0	0	0	0.001168	0	5	55				
ZFP82	284406	broad.mit.edu	37	19	36884554	36884554	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:36884554C>A	ENST00000392161.3	-	5	930	c.688G>T	c.(688-690)Gaa>Taa	p.E230*	ZFP82_ENST00000392171.1_Nonsense_Mutation_p.E230*	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TCCCCACATTCCTTACATTCA	0.418																																							uc002ody.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(688-690)GAA>TAA		zinc finger protein 82 homolog							140.0	137.0	138.0					19																	36884554		2203	4300	6503	SO:0001587	stop_gained	284406				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:36884554C>A	AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.688G>T	19.37:g.36884554C>A	ENSP00000431265:p.Glu230*		Somatic					p.E230*	NM_133466	NP_597723	WXS	Illumina HiSeq	Unspecified	Q8N141	ZFP82_HUMAN			5	923	-			230			C2H2-type 3.		Q8NC63|Q8TF53	Nonsense_Mutation	SNP	ENST00000392161.3	37	c.688G>T	CCDS12493.1	.	.	.	.	.	.	.	.	.	.	C	34	5.376435	0.95945	.	.	ENSG00000181007	ENST00000392161;ENST00000392171	.	.	.	4.47	4.47	0.54385	.	0.000000	0.42821	D	0.000646	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	14.6873	0.69059	0.0:1.0:0.0:0.0	.	.	.	.	X	230	.	ENSP00000431265:E230X	E	-	1	0	ZFP82	41576394	0.778000	0.28640	1.000000	0.80357	0.989000	0.77384	1.388000	0.34442	2.319000	0.78375	0.655000	0.94253	GAA		0.418	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109552.2	NM_133466		15	84	1	0	1.5739e-10	0.004007	2.2629e-10	15	84				
LTBP4	8425	broad.mit.edu	37	19	41105444	41105444	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:41105444T>A	ENST00000308370.7	+	3	323	c.323T>A	c.(322-324)cTc>cAc	p.L108H	LTBP4_ENST00000545697.1_5'UTR|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000396819.3_5'Flank|LTBP4_ENST00000204005.9_Missense_Mutation_p.L71H	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	108					extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CAGGTGTCCCTCAACTGGCAG	0.637																																							uc002ooh.1		NA																	0				central_nervous_system(1)	1						c.(322-324)CTC>CAC		latent transforming growth factor beta binding							78.0	90.0	86.0					19																	41105444		2036	4185	6221	SO:0001583	missense	8425				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity	g.chr19:41105444T>A	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.323T>A	19.37:g.41105444T>A	ENSP00000311905:p.Leu108His		Somatic				LTBP4_uc002oog.1_Missense_Mutation_p.L71H|LTBP4_uc002ooi.1_5'Flank	p.L108H	NM_001042544	NP_001036009	WXS	Illumina HiSeq	Unspecified	Q8N2S1	LTBP4_HUMAN	Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)		3	323	+			108					O00508|O75412|O75413	Missense_Mutation	SNP	ENST00000308370.7	37	c.323T>A		.	.	.	.	.	.	.	.	.	.	T	17.82	3.483964	0.63962	.	.	ENSG00000090006	ENST00000204005;ENST00000308370	D;D	0.83673	-1.7;-1.75	4.03	4.03	0.46877	.	0.242921	0.21203	N	0.078423	D	0.84051	0.5387	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.984	D	0.84599	0.0671	10	0.87932	D	0	.	9.2578	0.37595	0.0:0.0:0.0:1.0	.	108;71	Q8N2S1;E7ENG9	LTBP4_HUMAN;.	H	71;108	ENSP00000204005:L71H;ENSP00000311905:L108H	ENSP00000204005:L71H	L	+	2	0	LTBP4	45797284	0.996000	0.38824	0.963000	0.40424	0.900000	0.52787	2.117000	0.41939	1.695000	0.51148	0.454000	0.30748	CTC		0.637	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573		18	95	0	0	0	0.001523	0	18	95				
TMEM145	284339	broad.mit.edu	37	19	42822023	42822023	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:42822023T>A	ENST00000301204.3	+	12	1104	c.1063T>A	c.(1063-1065)Tat>Aat	p.Y355N	TMEM145_ENST00000598766.1_Missense_Mutation_p.Y379N	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	355					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				CTTTGCTGCCTATACCCTCTG	0.582																																							uc002otk.1		NA																	0					0						c.(1063-1065)TAT>AAT		transmembrane protein 145							139.0	115.0	123.0					19																	42822023		2203	4300	6503	SO:0001583	missense	284339					integral to membrane		g.chr19:42822023T>A	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.1063T>A	19.37:g.42822023T>A	ENSP00000301204:p.Tyr355Asn		Somatic					p.Y355N	NM_173633	NP_775904	WXS	Illumina HiSeq	Unspecified	Q8NBT3	TM145_HUMAN			12	1115	+		Prostate(69;0.00682)	355			Helical; (Potential).			Missense_Mutation	SNP	ENST00000301204.3	37	c.1063T>A	CCDS12603.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.417498	0.62622	.	.	ENSG00000167619	ENST00000301204	T	0.43688	0.94	4.55	4.55	0.56014	Rhodopsin-like GPCR transmembrane domain (1);	0.195723	0.33253	N	0.005112	T	0.60104	0.2243	M	0.70595	2.14	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.58769	-0.7578	10	0.30854	T	0.27	-19.0971	12.1572	0.54083	0.0:0.0:0.0:1.0	.	355	Q8NBT3	TM145_HUMAN	N	355	ENSP00000301204:Y355N	ENSP00000301204:Y355N	Y	+	1	0	TMEM145	47513863	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.453000	0.73488	1.832000	0.53329	0.482000	0.46254	TAT		0.582	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633		30	65	0	0	0	0.003271	0	30	65				
BCAM	4059	broad.mit.edu	37	19	45322968	45322968	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:45322968G>T	ENST00000270233.6	+	13	1770	c.1748G>T	c.(1747-1749)cGg>cTg	p.R583L	BCAM_ENST00000589651.1_Missense_Mutation_p.R583L	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	583					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CGCCAGCGGCGGGAGAAGGGG	0.637																																							uc002ozu.2		NA																	0				skin(1)	1						c.(1747-1749)CGG>CTG		basal cell adhesion molecule isoform 1							14.0	17.0	16.0					19																	45322968		2183	4244	6427	SO:0001583	missense	4059				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity	g.chr19:45322968G>T	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1748G>T	19.37:g.45322968G>T	ENSP00000270233:p.Arg583Leu		Somatic				BCAM_uc002ozt.1_Missense_Mutation_p.R583L	p.R583L	NM_005581	NP_005572	WXS	Illumina HiSeq	Unspecified	P50895	BCAM_HUMAN			13	1792	+	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)	583			Cytoplasmic (Potential).		A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	37	c.1748G>T	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	4.697	0.129623	0.08981	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.59772	0.24;0.34	4.08	1.68	0.24146	.	.	.	.	.	T	0.33904	0.0879	N	0.08118	0	0.09310	N	1	B	0.24092	0.097	B	0.15870	0.014	T	0.15521	-1.0434	9	0.30078	T	0.28	-5.8905	10.1318	0.42682	0.0:0.4182:0.5817:0.0	.	583	P50895	BCAM_HUMAN	L	583	ENSP00000270233:R583L;ENSP00000375817:R583L	ENSP00000270233:R583L	R	+	2	0	BCAM	50014808	0.003000	0.15002	0.037000	0.18230	0.042000	0.13812	1.344000	0.33941	0.242000	0.21303	0.531000	0.56144	CGG		0.637	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581		8	10	1	0	2.17888e-05	0.006214	2.63036e-05	8	10				
RELB	5971	broad.mit.edu	37	19	45540760	45540760	+	Silent	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:45540760C>G	ENST00000221452.8	+	12	1602	c.1452C>G	c.(1450-1452)ctC>ctG	p.L484L	CLASRP_ENST00000221455.3_5'Flank|CLASRP_ENST00000544944.2_5'Flank|RELB_ENST00000505236.1_Silent_p.L481L|RELB_ENST00000540120.1_Silent_p.L484L|CLASRP_ENST00000391953.4_5'Flank	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	484					antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		GGCCTGACCTCCTGGACGATG	0.682																																							uc002paj.1		NA																	0				ovary(1)	1						c.(1450-1452)CTC>CTG		reticuloendotheliosis viral oncogene homolog B							47.0	50.0	49.0					19																	45540760		2031	4176	6207	SO:0001819	synonymous_variant	5971					nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr19:45540760C>G	M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.1452C>G	19.37:g.45540760C>G			Somatic				SFRS16_uc002pak.2_5'Flank|SFRS16_uc002pal.2_5'Flank|SFRS16_uc010xxh.1_5'Flank|SFRS16_uc002pam.2_5'Flank|SFRS16_uc002pan.1_5'Flank	p.L484L	NM_006509	NP_006500	WXS	Illumina HiSeq	Unspecified	Q01201	RELB_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00986)	13	1578	+		Ovarian(192;0.0728)|all_neural(266;0.112)	484					Q6GTX7|Q9UEI7	Silent	SNP	ENST00000221452.8	37	c.1452C>G	CCDS46110.1																																																																																				0.682	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000367361.2			8	90	0	0	0	0.00308	0	8	90				
DMWD	1762	broad.mit.edu	37	19	46289893	46289893	+	Silent	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:46289893G>C	ENST00000270223.6	-	3	906	c.861C>G	c.(859-861)ctC>ctG	p.L287L	AC011530.4_ENST00000593999.1_5'Flank|DMWD_ENST00000601370.1_5'Flank|DMWD_ENST00000377735.3_Silent_p.L287L	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	287										central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		CGAACTCGTTGAGGGGCCCCT	0.667																																							uc002pdj.1		NA																	0					0						c.(859-861)CTC>CTG		dystrophia myotonica-containing WD repeat motif							29.0	34.0	32.0					19																	46289893		2202	4299	6501	SO:0001819	synonymous_variant	1762				meiosis			g.chr19:46289893G>C	L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.861C>G	19.37:g.46289893G>C			Somatic				DMWD_uc002pdk.1_Silent_p.L287L|DMWD_uc010eko.1_5'UTR	p.L287L	NM_004943	NP_004934	WXS	Illumina HiSeq	Unspecified	Q09019	DMWD_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)	3	907	-		Ovarian(192;0.0308)|all_neural(266;0.112)	287			WD 2.			Silent	SNP	ENST00000270223.6	37	c.861C>G	CCDS33054.1																																																																																				0.667	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402063.1	NM_004943		4	35	0	0	0	0.000248	0	4	35				
ZNF473	25888	broad.mit.edu	37	19	50545052	50545052	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:50545052G>A	ENST00000595661.1	+	5	697	c.202G>A	c.(202-204)Gga>Aga	p.G68R	ZNF473_ENST00000601364.1_Missense_Mutation_p.G68R|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000270617.3_Missense_Mutation_p.G68R|ZNF473_ENST00000391821.2_Missense_Mutation_p.G68R|ZNF473_ENST00000445728.3_Missense_Mutation_p.G56R|CTD-2126E3.3_ENST00000599410.1_RNA			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	68	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		TCTGGCAGGAGGAAGCCCAGA	0.592																																							uc002prn.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(202-204)GGA>AGA		zinc finger protein 473							81.0	81.0	81.0					19																	50545052		2203	4300	6503	SO:0001583	missense	25888				histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding	g.chr19:50545052G>A	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.202G>A	19.37:g.50545052G>A	ENSP00000472808:p.Gly68Arg		Somatic				ZNF473_uc002prm.2_Missense_Mutation_p.G68R|ZNF473_uc010ybo.1_Missense_Mutation_p.G56R	p.G68R	NM_001006656	NP_001006657	WXS	Illumina HiSeq	Unspecified	Q8WTR7	ZN473_HUMAN		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)	4	439	+		all_neural(266;0.0459)|Ovarian(192;0.0728)	68			KRAB.		A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	37	c.202G>A	CCDS33077.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.810731	0.32053	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.08896	3.04;3.04;3.13	4.96	3.9	0.45041	Krueppel-associated box (1);	0.577152	0.14518	N	0.314680	T	0.08980	0.0222	L	0.31926	0.97	0.09310	N	1	P	0.48162	0.906	P	0.47402	0.546	T	0.23154	-1.0196	10	0.20519	T	0.43	-4.307	8.6286	0.33906	0.1182:0.0:0.8818:0.0	.	68	Q8WTR7	ZN473_HUMAN	R	68;68;56	ENSP00000270617:G68R;ENSP00000375697:G68R;ENSP00000388961:G56R	ENSP00000270617:G68R	G	+	1	0	ZNF473	55236864	0.027000	0.19231	0.057000	0.19452	0.067000	0.16453	2.131000	0.42074	1.331000	0.45412	0.561000	0.74099	GGA		0.592	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390		17	108	0	0	0	0.006122	0	17	108				
ZNF613	79898	broad.mit.edu	37	19	52447603	52447603	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:52447603G>T	ENST00000293471.6	+	6	1146	c.467G>T	c.(466-468)gGg>gTg	p.G156V	ZNF613_ENST00000391794.4_Missense_Mutation_p.G120V	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		AATTCTGTGGGGGTTAATGGA	0.348																																							uc002pxz.1		NA																	0				ovary(1)	1						c.(466-468)GGG>GTG		zinc finger protein 613 isoform 1							79.0	85.0	83.0					19																	52447603		2203	4300	6503	SO:0001583	missense	79898				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52447603G>T	AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.467G>T	19.37:g.52447603G>T	ENSP00000293471:p.Gly156Val		Somatic				ZNF613_uc002pya.1_Missense_Mutation_p.G120V	p.G156V	NM_001031721	NP_001026891	WXS	Illumina HiSeq	Unspecified	Q6PF04	ZN613_HUMAN		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)	6	890	+		all_neural(266;0.117)	156					Q96SS9	Missense_Mutation	SNP	ENST00000293471.6	37	c.467G>T	CCDS33089.1	.	.	.	.	.	.	.	.	.	.	G	5.960	0.361158	0.11296	.	.	ENSG00000176024	ENST00000293471;ENST00000391794	T;T	0.05786	3.5;3.39	3.07	-2.45	0.06481	.	0.673577	0.12254	N	0.485405	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B	0.24823	0.112	B	0.19666	0.026	T	0.39210	-0.9625	10	0.51188	T	0.08	.	4.3825	0.11300	0.4906:0.1732:0.3362:0.0	.	156	Q6PF04	ZN613_HUMAN	V	156;120	ENSP00000293471:G156V;ENSP00000375671:G120V	ENSP00000293471:G156V	G	+	2	0	ZNF613	57139415	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.060000	0.14342	-0.739000	0.04809	-1.295000	0.01343	GGG		0.348	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	NM_024840		18	85	1	0	1.99824e-07	0.00499	2.59461e-07	18	85				
LILRB3	11025	broad.mit.edu	37	19	54721011	54721011	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:54721011C>T	ENST00000391750.1	-	14	1983	c.1847G>A	c.(1846-1848)gGg>gAg	p.G616E	LILRB3_ENST00000469273.1_5'UTR|LILRA6_ENST00000391735.3_3'UTR|LILRB3_ENST00000346401.6_Missense_Mutation_p.G628E|LILRA6_ENST00000419410.2_Missense_Mutation_p.G617E|LILRA6_ENST00000440558.2_Missense_Mutation_p.G616E|LILRA6_ENST00000270464.5_Missense_Mutation_p.G617E|LILRB3_ENST00000407860.2_Missense_Mutation_p.G633E|LILRB3_ENST00000424807.1_Missense_Mutation_p.G616E|LILRB3_ENST00000245620.9_Missense_Mutation_p.G617E			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	616					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGGAGGTTCCCCTTCCTGGGA	0.617																																							uc002qef.1		NA																	0				skin(2)|ovary(1)	3						c.(1846-1848)GGG>GAG		leukocyte immunoglobulin-like receptor,							115.0	112.0	113.0					19																	54721011		2202	4300	6502	SO:0001583	missense	11025				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity	g.chr19:54721011C>T	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1847G>A	19.37:g.54721011C>T	ENSP00000375630:p.Gly616Glu		Somatic				LILRB3_uc002qee.1_Missense_Mutation_p.G617E|LILRB3_uc002qeh.1_Missense_Mutation_p.G616E|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Missense_Mutation_p.G616E|LILRA6_uc002qek.1_Missense_Mutation_p.G617E|LILRB3_uc010erh.1_Missense_Mutation_p.G633E|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Missense_Mutation_p.G616E|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.G617E|LILRB3_uc002qep.1_Missense_Mutation_p.G617E|LILRB3_uc002qeq.1_Missense_Mutation_p.G616E|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.G617E	p.G616E	NM_006864	NP_006855	WXS	Illumina HiSeq	Unspecified	O75022	LIRB3_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	13	1958	-	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		616			Cytoplasmic (Potential).		C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	ENST00000391750.1	37	c.1847G>A	CCDS33105.1	.	.	.	.	.	.	.	.	.	.	C	5.597	0.294851	0.10622	.	.	ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000244482;ENSG00000244482;ENSG00000244482	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000407860;ENST00000440558;ENST00000270464;ENST00000419410	T;T;T;T;T;T;T;T	0.00524	6.83;6.83;6.84;6.85;6.87;6.82;6.83;6.86	2.81	-1.97	0.07503	.	.	.	.	.	T	0.00468	0.0015	L	0.45228	1.405	0.09310	N	1	P;D;B;B;B;B;B	0.53745	0.917;0.962;0.007;0.041;0.0;0.001;0.007	P;P;B;B;B;B;B	0.47402	0.521;0.546;0.007;0.025;0.003;0.004;0.03	T	0.48801	-0.9003	9	0.51188	T	0.08	.	2.6274	0.04933	0.2138:0.3961:0.0:0.3902	.	633;616;617;628;633;616;617	B5MCX0;F8WCY4;D3YTC4;F8W6G6;O75022-2;O75022;O75022-3	.;.;.;.;.;LIRB3_HUMAN;.	E	616;616;628;617;633;616;617;617	ENSP00000375630:G616E;ENSP00000412771:G616E;ENSP00000345184:G628E;ENSP00000245620:G617E;ENSP00000384274:G633E;ENSP00000390120:G616E;ENSP00000270464:G617E;ENSP00000411227:G617E	ENSP00000270464:G617E	G	-	2	0	LILRB3;LILRA6	59412823	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.134000	0.10436	-0.284000	0.09102	0.472000	0.43445	GGG		0.617	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864		11	63	0	0	0	0.008291	0	11	63				
LILRA4	23547	broad.mit.edu	37	19	54849379	54849379	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:54849379C>G	ENST00000291759.4	-	4	539	c.483G>C	c.(481-483)agG>agC	p.R161S	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	161	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TCCAGGAGAGCCTGTGGTCTC	0.587																																							uc002qfj.2		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(481-483)AGG>AGC		leukocyte immunoglobulin-like receptor subfamily							82.0	73.0	76.0					19																	54849379		2203	4300	6503	SO:0001583	missense	23547					integral to membrane	receptor activity	g.chr19:54849379C>G	AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.483G>C	19.37:g.54849379C>G	ENSP00000291759:p.Arg161Ser		Somatic				LILRA4_uc002qfi.2_Missense_Mutation_p.R95S	p.R161S	NM_012276	NP_036408	WXS	Illumina HiSeq	Unspecified	P59901	LIRA4_HUMAN		GBM - Glioblastoma multiforme(193;0.0565)	4	540	-	Ovarian(34;0.19)		161			Extracellular (Potential).|Ig-like C2-type 2.		Q32MC4	Missense_Mutation	SNP	ENST00000291759.4	37	c.483G>C	CCDS12890.1	.	.	.	.	.	.	.	.	.	.	.	6.031	0.374167	0.11409	.	.	ENSG00000239961	ENST00000291759	T	0.02682	4.2	2.39	-0.12	0.13539	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.734910	0.01619	N	0.022932	T	0.02230	0.0069	N	0.14661	0.345	0.09310	N	1	P	0.42010	0.768	B	0.38755	0.281	T	0.35025	-0.9805	10	0.33141	T	0.24	.	4.3999	0.11381	0.261:0.4835:0.2555:0.0	.	161	P59901	LIRA4_HUMAN	S	161	ENSP00000291759:R161S	ENSP00000291759:R161S	R	-	3	2	LILRA4	59541191	.	.	0.000000	0.03702	0.004000	0.04260	.	.	0.062000	0.16340	-0.311000	0.09066	AGG		0.587	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276		23	25	0	0	0	0.00278	0	23	25				
LILRA1	11024	broad.mit.edu	37	19	55107673	55107673	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:55107673C>T	ENST00000251372.3	+	7	1160	c.978C>T	c.(976-978)ccC>ccT	p.P326P	LILRA1_ENST00000453777.1_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000418536.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	326	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		GTGGCAGACCCTTCATCTCGG	0.612																																							uc002qgh.1		NA																	0				skin(2)|ovary(1)	3						c.(976-978)CCC>CCT		leukocyte immunoglobulin-like receptor,							55.0	55.0	55.0					19																	55107673		2203	4300	6503	SO:0001819	synonymous_variant	11024				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity	g.chr19:55107673C>T	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.978C>T	19.37:g.55107673C>T			Somatic				LILRA2_uc010yfg.1_Silent_p.P324P|LILRA1_uc010yfh.1_Silent_p.P326P	p.P326P	NM_006863	NP_006854	WXS	Illumina HiSeq	Unspecified	O75019	LIRA1_HUMAN		GBM - Glioblastoma multiforme(193;0.0348)	7	1160	+			326			Ig-like C2-type 4.|Extracellular (Potential).		O75018|Q3MJA6	Silent	SNP	ENST00000251372.3	37	c.978C>T	CCDS12901.1																																																																																				0.612	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863		9	41	0	0	0	0.004482	0	9	41				
ZNF264	9422	broad.mit.edu	37	19	57716786	57716786	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:57716786A>T	ENST00000263095.6	+	3	596	c.182A>T	c.(181-183)gAg>gTg	p.E61V	ZNF264_ENST00000536056.1_Missense_Mutation_p.E61V	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	61	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		CCCAAAGCTGAGCTGATCTGC	0.512																																							uc002qob.2		NA																	0				ovary(2)	2						c.(181-183)GAG>GTG		zinc finger protein 264							56.0	45.0	48.0					19																	57716786		2203	4300	6503	SO:0001583	missense	9422				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57716786A>T	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.182A>T	19.37:g.57716786A>T	ENSP00000263095:p.Glu61Val		Somatic					p.E61V	NM_003417	NP_003408	WXS	Illumina HiSeq	Unspecified	O43296	ZN264_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)	3	595	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	61			KRAB.		A8K8Y9|Q9P1V0	Missense_Mutation	SNP	ENST00000263095.6	37	c.182A>T	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	A	9.570	1.120881	0.20877	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.00892	5.57;5.57	2.62	1.56	0.23342	Krueppel-associated box (3);	.	.	.	.	T	0.02807	0.0084	L	0.58583	1.82	0.27390	N	0.955168	D	0.71674	0.998	D	0.80764	0.994	T	0.46133	-0.9213	9	0.66056	D	0.02	.	2.1223	0.03729	0.5973:0.0:0.1453:0.2574	.	61	O43296	ZN264_HUMAN	V	61	ENSP00000263095:E61V;ENSP00000440376:E61V	ENSP00000263095:E61V	E	+	2	0	ZNF264	62408598	0.016000	0.18221	0.501000	0.27601	0.009000	0.06853	0.980000	0.29513	0.401000	0.25424	-0.669000	0.03829	GAG		0.512	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1			7	21	0	0	0	0.001984	0	7	21				
AURKC	6795	broad.mit.edu	37	19	57744036	57744036	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr19:57744036G>C	ENST00000302804.7	+	4	609	c.423G>C	c.(421-423)caG>caC	p.Q141H	AURKC_ENST00000599062.1_Missense_Mutation_p.Q138H|AURKC_ENST00000598785.1_Missense_Mutation_p.Q107H|AURKC_ENST00000415300.2_Missense_Mutation_p.Q122H|AURKC_ENST00000448930.1_Missense_Mutation_p.Q107H	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	141	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		TAGATGAACAGCGCACAGCCA	0.552																																							uc002qoe.2		NA																	0				lung(4)|ovary(2)	6						c.(421-423)CAG>CAC		aurora kinase C isoform 1							69.0	67.0	67.0					19																	57744036		2203	4300	6503	SO:0001583	missense	6795				cell cycle|cytokinesis	condensed chromosome|cytoplasm|midbody|spindle midzone	ATP binding|protein serine/threonine kinase activity	g.chr19:57744036G>C		CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.423G>C	19.37:g.57744036G>C	ENSP00000302898:p.Gln141His		Somatic				AURKC_uc002qoc.2_Missense_Mutation_p.Q122H|AURKC_uc002qod.2_Missense_Mutation_p.Q107H|AURKC_uc010etv.2_Missense_Mutation_p.Q138H	p.Q141H	NM_001015878	NP_001015878	WXS	Illumina HiSeq	Unspecified	Q9UQB9	AURKC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)	4	612	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	141			Protein kinase.		O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	ENST00000302804.7	37	c.423G>C	CCDS33128.1	.	.	.	.	.	.	.	.	.	.	G	5.704	0.314450	0.10789	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.65732	-0.17;-0.17;-0.17	3.81	2.78	0.32641	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.061559	0.64402	D	0.000003	T	0.39226	0.1070	N	0.12443	0.215	0.44635	D	0.997613	B;B;B	0.26876	0.019;0.162;0.001	B;B;B	0.16289	0.012;0.015;0.007	T	0.31308	-0.9948	10	0.46703	T	0.11	-23.8118	9.6723	0.40019	0.1044:0.0:0.8956:0.0	.	138;141;122	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	H	122;107;141	ENSP00000407162:Q122H;ENSP00000406798:Q107H;ENSP00000302898:Q141H	ENSP00000302898:Q141H	Q	+	3	2	AURKC	62435848	1.000000	0.71417	0.864000	0.33941	0.008000	0.06430	2.741000	0.47426	1.198000	0.43158	0.561000	0.74099	CAG		0.552	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465089.1	NM_003160		6	40	0	0	0	0.001168	0	6	40				
CRIM1	51232	broad.mit.edu	37	2	36744655	36744655	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:36744655A>T	ENST00000280527.2	+	12	2543	c.2176A>T	c.(2176-2178)Acc>Tcc	p.T726S		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	726	VWFC 4. {ECO:0000255|PROSITE- ProRule:PRU00220}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				CCCCTCACGCACCCAGGATTC	0.597																																							uc002rpd.2		NA																	0				ovary(2)|skin(1)	3						c.(2176-2178)ACC>TCC		cysteine-rich motor neuron 1 precursor							73.0	67.0	69.0					2																	36744655		2203	4300	6503	SO:0001583	missense	51232				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity	g.chr2:36744655A>T	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.2176A>T	2.37:g.36744655A>T	ENSP00000280527:p.Thr726Ser		Somatic					p.T726S	NM_016441	NP_057525	WXS	Illumina HiSeq	Unspecified	Q9NZV1	CRIM1_HUMAN			12	2215	+		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)	726			VWFC 4.|Extracellular (Potential).		Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	c.2176A>T	CCDS1783.1	.	.	.	.	.	.	.	.	.	.	A	13.51	2.259764	0.39995	.	.	ENSG00000150938	ENST00000280527;ENST00000413985	T;T	0.71461	-0.57;-0.57	5.56	5.56	0.83823	von Willebrand factor, type C (4);	0.048705	0.85682	D	0.000000	T	0.49029	0.1533	N	0.05487	-0.04	0.53688	D	0.999972	B	0.24426	0.103	B	0.22152	0.038	T	0.49254	-0.8959	10	0.09084	T	0.74	-19.9157	14.9082	0.70735	1.0:0.0:0.0:0.0	.	726	Q9NZV1	CRIM1_HUMAN	S	726;88	ENSP00000280527:T726S;ENSP00000403120:T88S	ENSP00000280527:T726S	T	+	1	0	CRIM1	36598159	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	8.996000	0.93539	2.118000	0.64928	0.533000	0.62120	ACC		0.597	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441		22	69	0	0	0	0.00333	0	22	69				
FOXN2	3344	broad.mit.edu	37	2	48573727	48573727	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:48573727T>C	ENST00000340553.3	+	3	635	c.374T>C	c.(373-375)aTt>aCt	p.I125T		NM_002158.3	NP_002149.2	P32314	FOXN2_HUMAN	forkhead box N2	125					transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			TATATGGCCATTGAGCACTCT	0.418																																							uc002rwh.1		NA																	0					0						c.(373-375)ATT>ACT		T-cell leukemia virus enhancer factor							134.0	148.0	144.0					2																	48573727		2203	4300	6503	SO:0001583	missense	3344				embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr2:48573727T>C		CCDS1838.1	2p22-p16	2008-02-05	2006-10-02	2006-10-02	ENSG00000170802	ENSG00000170802		"""Forkhead boxes"""	5281	protein-coding gene	gene with protein product		143089	"""human T-cell leukemia virus enhancer factor"""	HTLF		1639393	Standard	NM_002158		Approved		uc002rwh.1	P32314	OTTHUMG00000129168	ENST00000340553.3:c.374T>C	2.37:g.48573727T>C	ENSP00000343633:p.Ile125Thr		Somatic					p.I125T	NM_002158	NP_002149	WXS	Illumina HiSeq	Unspecified	P32314	FOXN2_HUMAN	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)		3	689	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	125			Fork-head.		Q15769|Q6P4Q2	Missense_Mutation	SNP	ENST00000340553.3	37	c.374T>C	CCDS1838.1	.	.	.	.	.	.	.	.	.	.	T	19.98	3.927365	0.73327	.	.	ENSG00000170802	ENST00000413569;ENST00000304367;ENST00000340553	D;D	0.97232	-4.3;-4.3	5.28	5.28	0.74379	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98985	0.9654	H	0.96805	3.885	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99441	1.0938	10	0.87932	D	0	.	15.0203	0.71624	0.0:0.0:0.0:1.0	.	125	P32314	FOXN2_HUMAN	T	125;34;125	ENSP00000388486:I125T;ENSP00000343633:I125T	ENSP00000305685:I34T	I	+	2	0	FOXN2	48427231	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.868000	0.87116	2.212000	0.71576	0.482000	0.46254	ATT		0.418	FOXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251240.3	NM_002158		8	182	0	0	0	0.004482	0	8	182				
FSHR	2492	broad.mit.edu	37	2	49190511	49190511	+	Silent	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:49190511G>C	ENST00000406846.2	-	10	1568	c.1449C>G	c.(1447-1449)ctC>ctG	p.L483L	FSHR_ENST00000304421.4_Silent_p.L457L|FSHR_ENST00000541117.1_Silent_p.L219L|FSHR_ENST00000346173.3_Silent_p.L421L	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	483					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CAGCATGGCGGAGCTGCACCT	0.522									Gonadal Dysgenesis, 46 XX																														uc002rww.2		NA																	0				ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8						c.(1447-1449)CTC>CTG		follicle stimulating hormone receptor isoform 1	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)						52.0	45.0	47.0					2																	49190511		2203	4300	6503	SO:0001819	synonymous_variant	2492	Gonadal_Dysgenesis_46_XX	Familial Cancer Database		female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding	g.chr2:49190511G>C		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1449C>G	2.37:g.49190511G>C			Somatic				FSHR_uc002rwx.2_Silent_p.L421L|FSHR_uc010fbn.2_Silent_p.L457L	p.L483L	NM_000145	NP_000136	WXS	Illumina HiSeq	Unspecified	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		10	1523	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	483			Cytoplasmic (Potential).		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Silent	SNP	ENST00000406846.2	37	c.1449C>G	CCDS1843.1																																																																																				0.522	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			10	27	0	0	0	0.006214	0	10	27				
PAPOLG	64895	broad.mit.edu	37	2	60987422	60987422	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:60987422G>C	ENST00000238714.3	+	2	420	c.171G>C	c.(169-171)ttG>ttC	p.L57F		NM_022894.3	NP_075045.2	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	57					mRNA polyadenylation (GO:0006378)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	35	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			AGGAAGAATTGAACCACAGGT	0.323																																					GBM(183;1497 2932 21839 46797)	GBM(183;1497 2932 21839 46797)	uc002sai.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(169-171)TTG>TTC		poly(A) polymerase gamma							73.0	73.0	73.0					2																	60987422		2203	4300	6503	SO:0001583	missense	64895				mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding	g.chr2:60987422G>C	AC012498	CCDS1863.1	2p16.1	2008-02-08			ENSG00000115421	ENSG00000115421	2.7.7.19		14982	protein-coding gene	gene with protein product							Standard	NM_022894		Approved	FLJ12972	uc002sai.3	Q9BWT3	OTTHUMG00000129419	ENST00000238714.3:c.171G>C	2.37:g.60987422G>C	ENSP00000238714:p.Leu57Phe		Somatic				PAPOLG_uc002saj.2_5'UTR|PAPOLG_uc002sak.2_5'UTR	p.L57F	NM_022894	NP_075045	WXS	Illumina HiSeq	Unspecified	Q9BWT3	PAPOG_HUMAN	LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)		2	402	+	all_hematologic(2;0.0797)		57					B2RBH4|Q59G05|Q969N1|Q9H8L2|Q9HAD0	Missense_Mutation	SNP	ENST00000238714.3	37	c.171G>C	CCDS1863.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492625	0.64074	.	.	ENSG00000115421	ENST00000238714	.	.	.	5.74	-1.22	0.09494	Poly(A) polymerase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.59211	0.2177	M	0.84219	2.685	0.54753	D	0.999984	P	0.51147	0.942	P	0.47206	0.541	T	0.60944	-0.7162	9	0.72032	D	0.01	9.0E-4	7.0262	0.24942	0.443:0.0:0.4476:0.1095	.	57	Q9BWT3	PAPOG_HUMAN	F	57	.	ENSP00000238714:L57F	L	+	3	2	PAPOLG	60840926	0.311000	0.24536	0.946000	0.38457	0.985000	0.73830	-0.325000	0.07976	-0.144000	0.11314	0.563000	0.77884	TTG		0.323	PAPOLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251577.3	NM_022894		4	40	0	0	0	0.000602	0	4	40				
EXOC6B	23233	broad.mit.edu	37	2	72742214	72742214	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:72742214C>T	ENST00000272427.6	-	9	1087	c.957G>A	c.(955-957)agG>agA	p.R319R	EXOC6B_ENST00000410104.1_Silent_p.R319R	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	319					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						CCTGTTTTCGCCTCTGTTTTC	0.378																																							uc010fep.2		NA																	0				central_nervous_system(2)	2						c.(955-957)AGG>AGA		SEC15-like 2							85.0	86.0	86.0					2																	72742214		1875	4102	5977	SO:0001819	synonymous_variant	23233				protein transport|vesicle docking involved in exocytosis	exocyst		g.chr2:72742214C>T	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.957G>A	2.37:g.72742214C>T			Somatic				EXOC6B_uc002sij.2_Silent_p.R319R	p.R319R	NM_015189	NP_056004	WXS	Illumina HiSeq	Unspecified	Q9Y2D4	EXC6B_HUMAN			9	1095	-			319					B8ZZY3	Silent	SNP	ENST00000272427.6	37	c.957G>A	CCDS46333.1																																																																																				0.378	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570		4	18	0	0	0	0.000248	0	4	18				
C2orf78	388960	broad.mit.edu	37	2	74040627	74040627	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:74040627C>T	ENST00000409561.1	+	2	242	c.121C>T	c.(121-123)Cct>Tct	p.P41S		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	41	Ser-rich.									cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						TACGTCTTTACCTGGAACTGC	0.423																																							uc002sjr.1		NA																	0				ovary(2)	2						c.(121-123)CCT>TCT		hypothetical protein LOC388960							41.0	39.0	39.0					2																	74040627		1854	4092	5946	SO:0001583	missense	388960							g.chr2:74040627C>T	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.121C>T	2.37:g.74040627C>T	ENSP00000387124:p.Pro41Ser		Somatic					p.P41S	NM_001080474	NP_001073943	WXS	Illumina HiSeq	Unspecified	A6NCI8	CB078_HUMAN			2	242	+			41			Ser-rich.			Missense_Mutation	SNP	ENST00000409561.1	37	c.121C>T	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	C	6.122	0.390672	0.11581	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.27104	1.69	4.76	2.92	0.33932	.	1.723980	0.04357	U	0.356835	T	0.16557	0.0398	N	0.14661	0.345	0.09310	N	0.999998	P	0.37663	0.604	B	0.33960	0.173	T	0.23904	-1.0175	10	0.59425	D	0.04	-0.4882	6.9664	0.24625	0.0:0.7256:0.177:0.0974	.	41	A6NCI8	CB078_HUMAN	S	41	ENSP00000387124:P41S	ENSP00000340692:P41S	P	+	1	0	C2orf78	73894135	0.000000	0.05858	0.462000	0.27118	0.058000	0.15608	0.161000	0.16481	0.669000	0.31146	0.563000	0.77884	CCT		0.423	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		6	20	0	0	0	0.001168	0	6	20				
C2orf78	388960	broad.mit.edu	37	2	74041004	74041004	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:74041004T>A	ENST00000409561.1	+	2	619	c.498T>A	c.(496-498)taT>taA	p.Y166*		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	166										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						CCCAGTATTATAAAACTTCAG	0.443																																							uc002sjr.1		NA																	0				ovary(2)	2						c.(496-498)TAT>TAA		hypothetical protein LOC388960							72.0	66.0	68.0					2																	74041004		1913	4137	6050	SO:0001587	stop_gained	388960							g.chr2:74041004T>A	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.498T>A	2.37:g.74041004T>A	ENSP00000387124:p.Tyr166*		Somatic					p.Y166*	NM_001080474	NP_001073943	WXS	Illumina HiSeq	Unspecified	A6NCI8	CB078_HUMAN			2	619	+			166						Nonsense_Mutation	SNP	ENST00000409561.1	37	c.498T>A	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	T	10.23	1.294105	0.23564	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	.	.	.	5.07	-9.98	0.00438	.	1.198680	0.06856	U	0.798181	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-0.891	6.2366	0.20766	0.1081:0.5263:0.2187:0.1469	.	.	.	.	X	166	.	ENSP00000340692:Y166X	Y	+	3	2	C2orf78	73894512	0.001000	0.12720	0.000000	0.03702	0.088000	0.18126	-1.169000	0.03120	-1.972000	0.01001	0.533000	0.62120	TAT		0.443	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		13	22	0	0	0	0.001855	0	13	22				
DQX1	165545	broad.mit.edu	37	2	74751353	74751353	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:74751353C>A	ENST00000404568.3	-	4	732	c.513G>T	c.(511-513)gaG>gaT	p.E171D	DQX1_ENST00000495597.1_5'UTR|DQX1_ENST00000393951.2_Missense_Mutation_p.E171D	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	171	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						GCTCCTGAGCCTCATCTAGTA	0.597																																							uc010yrw.1		NA																	0				ovary(2)	2						c.(511-513)GAG>GAT		DEAQ box polypeptide 1 (RNA-dependent ATPase)							77.0	79.0	78.0					2																	74751353		2203	4300	6503	SO:0001583	missense	165545					nucleus	ATP binding|helicase activity|nucleic acid binding	g.chr2:74751353C>A	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.513G>T	2.37:g.74751353C>A	ENSP00000384621:p.Glu171Asp		Somatic				DQX1_uc002smc.2_5'Flank	p.E171D	NM_133637	NP_598376	WXS	Illumina HiSeq	Unspecified	Q8TE96	DQX1_HUMAN			4	678	-			171			Helicase ATP-binding.|DEAQ box.		Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	37	c.513G>T	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	C	17.65	3.443311	0.63067	.	.	ENSG00000144045	ENST00000393951;ENST00000404568;ENST00000451518	T;T;T	0.04603	3.59;3.59;3.59	4.59	4.59	0.56863	DEAD-like helicase (2);	0.000000	0.85682	D	0.000000	T	0.16214	0.0390	M	0.88842	2.985	0.53688	D	0.999973	D	0.55172	0.97	P	0.48627	0.584	T	0.03268	-1.1054	10	0.87932	D	0	-16.6004	14.9166	0.70801	0.0:1.0:0.0:0.0	.	171	Q8TE96	DQX1_HUMAN	D	171;171;53	ENSP00000377523:E171D;ENSP00000384621:E171D;ENSP00000392969:E53D	ENSP00000377523:E171D	E	-	3	2	DQX1	74604861	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	5.153000	0.64888	2.374000	0.81015	0.609000	0.83330	GAG		0.597	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637		19	129	1	0	1.15919e-05	0.008871	1.40954e-05	19	129				
M1AP	130951	broad.mit.edu	37	2	74802690	74802690	+	Missense_Mutation	SNP	C	C	T	rs140179344		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:74802690C>T	ENST00000290536.5	-	7	1065	c.949G>A	c.(949-951)Ggg>Agg	p.G317R	M1AP_ENST00000536235.1_Missense_Mutation_p.G317R|M1AP_ENST00000409585.1_Missense_Mutation_p.G317R|M1AP_ENST00000358434.2_Missense_Mutation_p.G35R|M1AP_ENST00000464686.1_5'UTR	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	317					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											TCGCAGAGCCCGCTAGATTTT	0.448																																							uc002smy.2		NA																	0				ovary(1)|pancreas(1)	2						c.(949-951)GGG>AGG		hypothetical protein LOC130951		C	ARG/GLY	0,4406		0,0,2203	102.0	102.0	102.0		949	5.0	0.7	2	dbSNP_134	102	1,8599	1.2+/-3.3	0,1,4299	no	missense	C2orf65	NM_138804.3	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	317/531	74802690	1,13005	2203	4300	6503	SO:0001583	missense	130951				chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane		g.chr2:74802690C>T		CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.949G>A	2.37:g.74802690C>T	ENSP00000290536:p.Gly317Arg		Somatic				C2orf65_uc010ysa.1_Missense_Mutation_p.G317R|C2orf65_uc002smz.2_Missense_Mutation_p.G317R|C2orf65_uc010ffp.2_Missense_Mutation_p.G35R|C2orf65_uc002smx.2_Missense_Mutation_p.G73R	p.G317R	NM_138804	NP_620159	WXS	Illumina HiSeq	Unspecified	Q8TC57	CB065_HUMAN			7	1066	-			317					B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Missense_Mutation	SNP	ENST00000290536.5	37	c.949G>A	CCDS33229.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188291	0.78789	0.0	1.16E-4	ENSG00000159374	ENST00000290536;ENST00000409585;ENST00000536235;ENST00000358434	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.66771	0.2823	M	0.69823	2.125	0.41982	D	0.990808	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.70472	-0.4862	10	0.87932	D	0	-18.2054	13.5676	0.61828	0.0:1.0:0.0:0.0	.	317;35;317;317;73	E9PGG8;Q8TC57-3;Q8TC57-2;Q8TC57;B3KX03	.;.;.;CB065_HUMAN;.	R	317;317;317;35	ENSP00000290536:G317R;ENSP00000386793:G317R;ENSP00000445662:G317R;ENSP00000351213:G35R	ENSP00000290536:G317R	G	-	1	0	C2orf65	74656198	0.997000	0.39634	0.736000	0.30914	0.924000	0.55760	4.562000	0.60816	2.550000	0.86006	0.655000	0.94253	GGG		0.448	M1AP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328569.1	NM_138804		14	103	0	0	0	0.003163	0	14	103				
IMMT	10989	broad.mit.edu	37	2	86371740	86371740	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:86371740C>T	ENST00000410111.3	-	15	2315	c.1928G>A	c.(1927-1929)cGa>cAa	p.R643Q	IMMT_ENST00000442664.2_Missense_Mutation_p.R642Q|IMMT_ENST00000449247.2_Missense_Mutation_p.R632Q|IMMT_ENST00000254636.5_Missense_Mutation_p.R544Q|IMMT_ENST00000409051.2_Missense_Mutation_p.R596Q	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	643					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)	p.R643Q(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGCTACCCTTCGGGCCAGTTT	0.512																																							uc002sqz.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1927-1929)CGA>CAA		inner membrane protein, mitochondrial isoform 1							127.0	123.0	125.0					2																	86371740		1871	4108	5979	SO:0001583	missense	10989					integral to mitochondrial inner membrane	protein binding	g.chr2:86371740C>T	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.1928G>A	2.37:g.86371740C>T	ENSP00000387262:p.Arg643Gln		Somatic				IMMT_uc002sqy.3_Missense_Mutation_p.R384Q|IMMT_uc002srb.3_Missense_Mutation_p.R632Q|IMMT_uc002sra.3_Missense_Mutation_p.R642Q|IMMT_uc010ytd.1_Missense_Mutation_p.R631Q|IMMT_uc010yte.1_Missense_Mutation_p.R596Q	p.R643Q	NM_006839	NP_006830	WXS	Illumina HiSeq	Unspecified	Q16891	IMMT_HUMAN			15	2316	-			643			Mitochondrial intermembrane (Potential).		B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	37	c.1928G>A	CCDS46355.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.461120	0.43736	.	.	ENSG00000132305	ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000398211;ENST00000409715	T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38	5.25	3.44	0.39384	.	0.261457	0.38164	N	0.001793	T	0.50786	0.1636	M	0.69823	2.125	0.49582	D	0.999801	B;B;B;B;B	0.27700	0.007;0.062;0.051;0.186;0.062	B;B;B;B;B	0.31614	0.034;0.133;0.082;0.082;0.133	T	0.51301	-0.8723	10	0.59425	D	0.04	0.0062	8.3344	0.32206	0.0:0.7041:0.0:0.2959	.	596;631;632;611;643	B9A067;B4DKR1;Q16891-2;Q16891-3;Q16891	.;.;.;.;IMMT_HUMAN	Q	544;632;643;642;596;632;611;257;544	ENSP00000254636:R544Q;ENSP00000396899:R632Q;ENSP00000387262:R643Q;ENSP00000407788:R642Q;ENSP00000387227:R596Q	ENSP00000254636:R544Q	R	-	2	0	IMMT	86225251	0.935000	0.31712	0.953000	0.39169	0.711000	0.40976	1.973000	0.40550	0.780000	0.33566	0.650000	0.86243	CGA		0.512	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839		9	165	0	0	0	0.006214	0	9	165				
ASTL	431705	broad.mit.edu	37	2	96789754	96789754	+	Silent	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:96789754A>G	ENST00000342380.2	-	9	1130	c.1131T>C	c.(1129-1131)ggT>ggC	p.G377G		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						CACCGGGGGCACCTGCTCCAG	0.627																																							uc010yui.1		NA																	0					0						c.(1129-1131)GGT>GGC		astacin-like metalloendopeptidase precursor							68.0	73.0	71.0					2																	96789754		2203	4300	6503	SO:0001819	synonymous_variant	431705				proteolysis		metalloendopeptidase activity|zinc ion binding	g.chr2:96789754A>G	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.1131T>C	2.37:g.96789754A>G			Somatic					p.G377G	NM_001002036	NP_001002036	WXS	Illumina HiSeq	Unspecified	Q6HA08	ASTL_HUMAN			9	1131	-			377						Silent	SNP	ENST00000342380.2	37	c.1131T>C	CCDS33249.1																																																																																				0.627	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1			17	86	0	0	0	0.00499	0	17	86				
AFF3	3899	broad.mit.edu	37	2	100210239	100210239	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:100210239C>T	ENST00000409236.2	-	13	1996	c.1884G>A	c.(1882-1884)agG>agA	p.R628R	AFF3_ENST00000409579.1_Silent_p.R653R|AFF3_ENST00000356421.2_Silent_p.R653R|AFF3_ENST00000317233.4_Silent_p.R628R			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	628					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TGCCACAGGGCCTGGTTTTGG	0.721																																							uc002tag.2		NA																	0				ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						c.(1882-1884)AGG>AGA		AF4/FMR2 family, member 3 isoform 1							31.0	37.0	35.0					2																	100210239		2203	4300	6503	SO:0001819	synonymous_variant	3899				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr2:100210239C>T	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1884G>A	2.37:g.100210239C>T			Somatic				AFF3_uc002taf.2_Silent_p.R653R|AFF3_uc010fiq.1_Silent_p.R628R|AFF3_uc010yvr.1_Silent_p.R781R|AFF3_uc002tah.1_Silent_p.R653R	p.R628R	NM_002285	NP_002276	WXS	Illumina HiSeq	Unspecified	P51826	AFF3_HUMAN			14	2120	-			628					B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	ENST00000409236.2	37	c.1884G>A	CCDS42723.1																																																																																				0.721	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285		22	48	0	0	0	0.00333	0	22	48				
RGPD4	285190	broad.mit.edu	37	2	108443477	108443477	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:108443477G>A	ENST00000408999.3	+	1	85	c.8G>A	c.(7-9)tGc>tAc	p.C3Y	AC096655.2_ENST00000457647.2_lincRNA|RGPD4_ENST00000354986.4_Missense_Mutation_p.C3Y	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	3					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						GCGATGAGTTGCAGCAAGGCC	0.652																																							uc010ywk.1		NA																	0				skin(2)	2						c.(7-9)TGC>TAC		RANBP2-like and GRIP domain containing 4							51.0	73.0	66.0					2																	108443477		692	1591	2283	SO:0001583	missense	285190				intracellular transport		binding	g.chr2:108443477G>A	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.8G>A	2.37:g.108443477G>A	ENSP00000386810:p.Cys3Tyr		Somatic				LOC729121_uc010ywj.1_5'Flank|LOC729121_uc002tdt.2_5'Flank	p.C3Y	NM_182588	NP_872394	WXS	Illumina HiSeq	Unspecified	Q7Z3J3	RGPD4_HUMAN			1	90	+			3					B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	c.8G>A	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	5.740	0.321009	0.10845	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.38077	1.16;1.17	1.8	1.8	0.24995	.	.	.	.	.	T	0.19208	0.0461	N	0.08118	0	0.22531	N	0.999011	B	0.02656	0.0	B	0.01281	0.0	T	0.21415	-1.0246	9	0.87932	D	0	-0.143	8.5331	0.33346	0.0:0.0:1.0:0.0	.	3	Q7Z3J3	RGPD4_HUMAN	Y	3	ENSP00000347081:C3Y;ENSP00000386810:C3Y	ENSP00000347081:C3Y	C	+	2	0	RGPD4	107809909	1.000000	0.71417	0.963000	0.40424	0.017000	0.09413	2.722000	0.47269	0.983000	0.38602	0.184000	0.17185	TGC		0.652	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581		6	12	0	0	0	0.001984	0	6	12				
EDAR	10913	broad.mit.edu	37	2	109524389	109524389	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:109524389G>A	ENST00000258443.2	-	10	1320	c.890C>T	c.(889-891)tCc>tTc	p.S297F	EDAR_ENST00000409271.1_Missense_Mutation_p.S329F|EDAR_ENST00000376651.1_Missense_Mutation_p.S329F	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	297					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						CAGCTCCGGGGAGCCCTGCTT	0.617																																							uc002teq.3		NA																	0				skin(1)	1						c.(889-891)TCC>TTC		ectodysplasin A receptor precursor							42.0	47.0	45.0					2																	109524389		2203	4300	6503	SO:0001583	missense	10913				apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity	g.chr2:109524389G>A	AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.890C>T	2.37:g.109524389G>A	ENSP00000258443:p.Ser297Phe		Somatic				EDAR_uc010fjn.2_Missense_Mutation_p.S329F|EDAR_uc010yws.1_Missense_Mutation_p.S329F	p.S297F	NM_022336	NP_071731	WXS	Illumina HiSeq	Unspecified	Q9UNE0	EDAR_HUMAN			10	1321	-			297			Cytoplasmic (Potential).		B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Missense_Mutation	SNP	ENST00000258443.2	37	c.890C>T	CCDS2081.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411871	0.83340	.	.	ENSG00000135960	ENST00000409271;ENST00000258443;ENST00000376651	D;D;D	0.91792	-2.91;-2.88;-2.91	5.64	5.64	0.86602	.	0.527250	0.22101	N	0.064615	D	0.91250	0.7242	L	0.55481	1.735	0.45930	D	0.998768	P;P	0.37955	0.612;0.612	B;B	0.41088	0.347;0.241	D	0.91753	0.5414	10	0.87932	D	0	-24.9034	15.2196	0.73299	0.0:0.1401:0.8599:0.0	.	329;297	E9PC98;Q9UNE0	.;EDAR_HUMAN	F	329;297;329	ENSP00000386371:S329F;ENSP00000258443:S297F;ENSP00000365839:S329F	ENSP00000258443:S297F	S	-	2	0	EDAR	108890821	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	5.829000	0.69316	2.648000	0.89879	0.561000	0.74099	TCC		0.617	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253595.1			7	66	0	0	0	0.001984	0	7	66				
LOC401010	401010	broad.mit.edu	37	2	132201470	132201470	+	IGR	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:132201470C>A								AC073869.19 (34848 upstream) : RP11-109E12.1 (17923 downstream)																							AGGACGGGGCCAAGGAAAGTG	0.572																																							uc002tst.2		NA																	0					0						c.(532-534)GGC>TGC		SubName: Full=cDNA FLJ12694 fis, clone NT2RP1000358, highly similar to Homo sapiens mRNA; cDNA DKFZp564C186 (from clone DKFZp564C186);																																				SO:0001628	intergenic_variant	401010							g.chr2:132201470C>A																													2.37:g.132201470C>A			Somatic					p.G178C	NR_002826		WXS	Illumina HiSeq	Unspecified					1	998	-									Missense_Mutation	SNP		37	c.532G>T																																																																																				0	0.572									13	33	1	0	1.5842e-08	0.001855	2.15735e-08	13	33				
NCKAP5	344148	broad.mit.edu	37	2	133543152	133543152	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:133543152C>A	ENST00000409261.1	-	14	1605	c.1232G>T	c.(1231-1233)cGa>cTa	p.R411L	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.R411L	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	411										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TAACACTTTTCGCTTCTGTAG	0.413																																							uc002ttp.2		NA																	0					0						c.(1231-1233)CGA>CTA		Nck-associated protein 5 isoform 1							106.0	99.0	101.0					2																	133543152		1856	4097	5953	SO:0001583	missense	344148						protein binding	g.chr2:133543152C>A	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1232G>T	2.37:g.133543152C>A	ENSP00000387128:p.Arg411Leu		Somatic				NCKAP5_uc002ttq.2_Intron	p.R411L	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			14	1606	-			411					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.1232G>T	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	c	18.38	3.612000	0.66558	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.13901	2.55;2.55	5.23	4.35	0.52113	.	0.287028	0.18606	U	0.136307	T	0.13200	0.0320	L	0.29908	0.895	0.80722	D	1	D	0.53312	0.959	P	0.48166	0.569	T	0.02852	-1.1102	10	0.72032	D	0.01	.	6.5587	0.22474	0.0:0.7609:0.0:0.2391	.	411	O14513	NCKP5_HUMAN	L	411	ENSP00000387128:R411L;ENSP00000380603:R411L	ENSP00000380603:R411L	R	-	2	0	NCKAP5	133259622	0.989000	0.36119	1.000000	0.80357	0.998000	0.95712	1.464000	0.35288	1.441000	0.47550	0.645000	0.84053	CGA		0.413	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		9	103	1	0	1.33987e-11	0.008291	1.96867e-11	9	103				
LRP1B	53353	broad.mit.edu	37	2	141114000	141114000	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:141114000T>A	ENST00000389484.3	-	75	12412	c.11441A>T	c.(11440-11442)gAt>gTt	p.D3814V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3814	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATATGCATCATCTCCACATGG	0.338										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(11440-11442)GAT>GTT		low density lipoprotein-related protein 1B							103.0	106.0	105.0					2																	141114000		2201	4299	6500	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141114000T>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11441A>T	2.37:g.141114000T>A	ENSP00000374135:p.Asp3814Val	TSP Lung(27;0.18)	Somatic					p.D3814V	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	75	12413	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3814			Extracellular (Potential).|EGF-like 8.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.11441A>T	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.7|23.7	4.444143|4.444143	0.83993|0.83993	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977	D|.	0.90385|.	-2.66|.	5.83|5.83	5.83|5.83	0.93111|0.93111	Growth factor, receptor (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);|.	0.200794|.	0.41712|.	D|.	0.000825|.	T|T	0.57989|0.57989	0.2091|0.2091	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	P|.	0.41366|.	0.747|.	B|.	0.42827|.	0.399|.	T|T	0.54234|0.54234	-0.8324|-0.8324	10|5	0.30078|.	T|.	0.28|.	.|.	16.1968|16.1968	0.82036|0.82036	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	3814|.	Q9NZR2|.	LRP1B_HUMAN|.	V|L	3814;3752|46	ENSP00000374135:D3814V|.	ENSP00000374135:D3814V|.	D|M	-|-	2|1	0|0	LRP1B|LRP1B	140830470|140830470	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.865000|0.865000	0.49528|0.49528	7.665000|7.665000	0.83852|0.83852	2.225000|2.225000	0.72522|0.72522	0.533000|0.533000	0.62120|0.62120	GAT|ATG		0.338	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		24	55	0	0	0	0.00278	0	24	55				
LRP1B	53353	broad.mit.edu	37	2	141641553	141641553	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:141641553C>A	ENST00000389484.3	-	25	4973	c.4002G>T	c.(4000-4002)ctG>ctT	p.L1334L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1334					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGGAGTAGCCAGGCCATGCT	0.473										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(4000-4002)CTG>CTT		low density lipoprotein-related protein 1B							130.0	123.0	125.0					2																	141641553		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141641553C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4002G>T	2.37:g.141641553C>A		TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Silent_p.L516L	p.L1334L	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	25	4974	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1334			Extracellular (Potential).|LDL-receptor class B 9.		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.4002G>T	CCDS2182.1																																																																																				0.473	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		33	105	1	0	2.20474e-14	0.003755	3.45942e-14	33	105				
LRP1B	53353	broad.mit.edu	37	2	141660631	141660631	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:141660631G>T	ENST00000389484.3	-	23	4595	c.3624C>A	c.(3622-3624)gaC>gaA	p.D1208E		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1208	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATGTTTTATTGTCTTTGTTGA	0.428										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(3622-3624)GAC>GAA		low density lipoprotein-related protein 1B							164.0	144.0	151.0					2																	141660631		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141660631G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3624C>A	2.37:g.141660631G>T	ENSP00000374135:p.Asp1208Glu	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Missense_Mutation_p.D390E	p.D1208E	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	23	4596	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1208			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.3624C>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205081	0.79127	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.99042	-5.36;-5.36	5.43	2.18	0.27775	Epidermal growth factor-like (1);	0.136196	0.50627	D	0.000115	D	0.98820	0.9602	M	0.88105	2.93	0.38084	D	0.93677	P;P	0.51351	0.944;0.745	P;B	0.52514	0.701;0.251	D	0.99274	1.0894	10	0.59425	D	0.04	.	10.4375	0.44443	0.2643:0.0:0.7357:0.0	.	391;1208	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	E	1208;1146;353	ENSP00000374135:D1208E;ENSP00000413239:D353E	ENSP00000374135:D1208E	D	-	3	2	LRP1B	141377101	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.774000	0.62339	0.783000	0.33636	0.650000	0.86243	GAC		0.428	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		14	49	1	0	1.52009e-12	0.003163	2.28355e-12	14	49				
ARHGAP15	55843	broad.mit.edu	37	2	143913188	143913188	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:143913188C>A	ENST00000295095.6	+	2	296	c.129C>A	c.(127-129)tcC>tcA	p.S43S	ARHGAP15_ENST00000409869.1_Silent_p.S43S	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	43					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		AAAGTAAATCCATGATCCTCA	0.443																																							uc002tvm.3		NA																	0				ovary(1)|skin(1)	2						c.(127-129)TCC>TCA		ARHGAP15							107.0	94.0	99.0					2																	143913188		2203	4300	6503	SO:0001819	synonymous_variant	55843				regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity	g.chr2:143913188C>A	AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.129C>A	2.37:g.143913188C>A			Somatic				ARHGAP15_uc010zbl.1_Silent_p.S43S	p.S43S	NM_018460	NP_060930	WXS	Illumina HiSeq	Unspecified	Q53QZ3	RHG15_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.151)	2	280	+			43					Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Silent	SNP	ENST00000295095.6	37	c.129C>A	CCDS2184.1																																																																																				0.443	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460		18	32	1	0	1.64113e-05	0.001523	1.98477e-05	18	32				
SCN3A	6328	broad.mit.edu	37	2	166019212	166019212	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:166019212C>T	ENST00000360093.3	-	8	1312	c.821G>A	c.(820-822)aGg>aAg	p.R274K	SCN3A_ENST00000409101.3_Missense_Mutation_p.R274K|SCN3A_ENST00000283254.7_Missense_Mutation_p.R274K	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	274					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACATTTATTCCTCAGATTGCC	0.443																																							uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(820-822)AGG>AAG		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						111.0	107.0	109.0					2																	166019212		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166019212C>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.821G>A	2.37:g.166019212C>T	ENSP00000353206:p.Arg274Lys		Somatic				SCN3A_uc002ucy.2_Missense_Mutation_p.R274K|SCN3A_uc002ucz.2_Missense_Mutation_p.R274K|SCN3A_uc002uda.1_Missense_Mutation_p.R143K|SCN3A_uc002udb.1_Missense_Mutation_p.R143K	p.R274K	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			8	1313	-			274					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.821G>A		.	.	.	.	.	.	.	.	.	.	C	15.71	2.913356	0.52439	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98	5.82	5.82	0.92795	Ion transport (1);	0.000000	0.64402	D	0.000006	D	0.98096	0.9372	L	0.35487	1.065	0.80722	D	1	D;B;B;B;D	0.61697	0.979;0.001;0.001;0.001;0.99	D;B;B;B;D	0.74023	0.982;0.035;0.005;0.008;0.979	D	0.97722	1.0197	10	0.30078	T	0.28	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	274;274;274;274;274	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	K	274	ENSP00000353206:R274K;ENSP00000283254:R274K;ENSP00000386726:R274K;ENSP00000403348:R274K	ENSP00000283254:R274K	R	-	2	0	SCN3A	165727458	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.070000	0.71220	2.752000	0.94435	0.655000	0.94253	AGG		0.443	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		27	72	0	0	0	0.005443	0	27	72				
TTC21B	79809	broad.mit.edu	37	2	166797562	166797562	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:166797562C>A	ENST00000243344.7	-	6	822	c.685G>T	c.(685-687)Gac>Tac	p.D229Y	AC010127.5_ENST00000443032.1_RNA|AC010127.5_ENST00000440322.1_RNA	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	229					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						ACTGTCTGGTCCCAATCCTGC	0.388																																							uc002udk.2		NA																	0				ovary(2)|pancreas(2)|breast(1)	5						c.(685-687)GAC>TAC		tetratricopeptide repeat domain 21B							108.0	107.0	108.0					2																	166797562		2203	4300	6503	SO:0001583	missense	79809					cilium axoneme|cytoplasm|cytoskeleton	binding	g.chr2:166797562C>A	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.685G>T	2.37:g.166797562C>A	ENSP00000243344:p.Asp229Tyr		Somatic				TTC21B_uc002udl.2_Missense_Mutation_p.D229Y|uc002udm.1_Intron	p.D229Y	NM_024753	NP_079029	WXS	Illumina HiSeq	Unspecified	Q7Z4L5	TT21B_HUMAN			6	818	-			229					A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	ENST00000243344.7	37	c.685G>T	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720604	0.89205	.	.	ENSG00000123607	ENST00000243344	T	0.63913	-0.07	5.2	5.2	0.72013	Tetratricopeptide-like helical (1);	0.103117	0.64402	D	0.000003	T	0.80003	0.4544	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.68621	0.957;0.959	T	0.82489	-0.0432	10	0.87932	D	0	-17.1665	19.0941	0.93242	0.0:1.0:0.0:0.0	.	229;229	Q7Z4L5-2;Q7Z4L5	.;TT21B_HUMAN	Y	229	ENSP00000243344:D229Y	ENSP00000243344:D229Y	D	-	1	0	TTC21B	166505808	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.776000	0.85560	2.578000	0.87016	0.650000	0.86243	GAC		0.388	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753		16	50	1	0	9.16793e-09	0.00499	1.25614e-08	16	50				
XIRP2	129446	broad.mit.edu	37	2	168103850	168103850	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:168103850C>T	ENST00000409195.1	+	9	6037	c.5948C>T	c.(5947-5949)cCa>cTa	p.P1983L	XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.P1761L|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.P1983L|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1808					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAGCCAGGTCCATTTGAGCCA	0.473																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(5947-5949)CCA>CTA		xin actin-binding repeat containing 2 isoform 1							44.0	43.0	43.0					2																	168103850		1907	4120	6027	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168103850C>T	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5948C>T	2.37:g.168103850C>T	ENSP00000386840:p.Pro1983Leu		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.P1808L|XIRP2_uc010fpq.2_Missense_Mutation_p.P1761L|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.P1983L	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	5966	+			1808					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.5948C>T	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591035	0.28357	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02579	4.24;4.24;4.24	5.73	4.85	0.62838	.	0.120917	0.56097	D	0.000033	T	0.07052	0.0179	M	0.63428	1.95	0.49213	D	0.999764	D;B;B	0.59767	0.986;0.125;0.125	P;B;B	0.51582	0.674;0.046;0.046	T	0.28459	-1.0043	10	0.39692	T	0.17	-7.071	9.8264	0.40914	0.0:0.8419:0.0:0.1581	.	1808;1808;1761	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	L	1983;1983;1761	ENSP00000386840:P1983L;ENSP00000295237:P1983L;ENSP00000387255:P1761L	ENSP00000295237:P1983L	P	+	2	0	XIRP2	167812096	0.178000	0.23122	0.996000	0.52242	0.011000	0.07611	1.870000	0.39529	1.436000	0.47453	0.650000	0.86243	CCA		0.473	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		26	37	0	0	0	0.003954	0	26	37				
LRP2	4036	broad.mit.edu	37	2	169996113	169996113	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:169996113T>C	ENST00000263816.3	-	73	13492	c.13207A>G	c.(13207-13209)Agc>Ggc	p.S4403G		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4403	EGF-like 17. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTGTAGCCGCTAGGACACCTG	0.398																																							uc002ues.2		NA																	0				ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(13207-13209)AGC>GGC		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						94.0	98.0	96.0					2																	169996113		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:169996113T>C		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13207A>G	2.37:g.169996113T>C	ENSP00000263816:p.Ser4403Gly		Somatic					p.S4403G	NM_004525	NP_004516	WXS	Illumina HiSeq	Unspecified	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	73	13420	-			4403			EGF-like 17.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.13207A>G	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	2.212	-0.380449	0.05000	.	.	ENSG00000081479	ENST00000263816	T	0.42900	0.96	5.44	3.06	0.35304	Growth factor, receptor (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.680704	0.15846	N	0.241747	T	0.31702	0.0805	L	0.50333	1.59	0.18873	N	0.999986	B	0.13145	0.007	B	0.18561	0.022	T	0.20605	-1.0270	10	0.33141	T	0.24	.	3.2239	0.06725	0.2213:0.1944:0.0:0.5843	.	4403	P98164	LRP2_HUMAN	G	4403	ENSP00000263816:S4403G	ENSP00000263816:S4403G	S	-	1	0	LRP2	169704359	0.000000	0.05858	0.025000	0.17156	0.043000	0.13939	0.740000	0.26188	0.876000	0.35872	0.460000	0.39030	AGC		0.398	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		25	102	0	0	0	0.00333	0	25	102				
TTN	7273	broad.mit.edu	37	2	179396333	179396333	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:179396333G>T	ENST00000591111.1	-	308	100310	c.100086C>A	c.(100084-100086)gaC>gaA	p.D33362E	TTN_ENST00000589042.1_Missense_Mutation_p.D35003E|TTN_ENST00000460472.2_Missense_Mutation_p.D25938E|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D32435E|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D26063E|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D26130E|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000588716.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33362	Ig-like 146.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGTATGACAGTCCAGAATTT	0.488																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(97303-97305)GAC>GAA		titin isoform N2-A							117.0	116.0	116.0					2																	179396333		1998	4183	6181	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179396333G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100086C>A	2.37:g.179396333G>T	ENSP00000465570:p.Asp33362Glu		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D26130E|TTN_uc010zfi.1_Missense_Mutation_p.D26063E|TTN_uc010zfj.1_Missense_Mutation_p.D25938E|TTN_uc002umq.2_5'Flank	p.D32435E	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	97529	-			33362					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.97305C>A		.	.	.	.	.	.	.	.	.	.	G	17.14	3.312790	0.60414	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.56	4.68	0.58851	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.42381	0.1200	N	0.05574	-0.02	0.38040	D	0.935427	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.54543	-0.8278	9	0.87932	D	0	.	10.3886	0.44156	0.1487:0.0:0.8513:0.0	.	25938;26063;26130;33362	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	32435;25938;26130;26063;25935	ENSP00000343764:D32435E;ENSP00000434586:D25938E;ENSP00000340554:D26130E;ENSP00000352154:D26063E	ENSP00000340554:D26130E	D	-	3	2	TTN	179104579	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.345000	0.52182	1.352000	0.45808	0.650000	0.86243	GAC		0.488	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		27	45	1	0	1.39806e-14	0.008361	2.20399e-14	27	45				
TTN	7273	broad.mit.edu	37	2	179435842	179435842	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:179435842G>A	ENST00000591111.1	-	276	70318	c.70094C>T	c.(70093-70095)cCa>cTa	p.P23365L	TTN_ENST00000589042.1_Missense_Mutation_p.P25006L|TTN_ENST00000460472.2_Missense_Mutation_p.P15941L|TTN_ENST00000342992.6_Missense_Mutation_p.P22438L|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P16066L|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P16133L|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23365					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGATCACATGGGTCACGAGC	0.468																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(67312-67314)CCA>CTA		titin isoform N2-A							119.0	123.0	122.0					2																	179435842		1992	4168	6160	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179435842G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70094C>T	2.37:g.179435842G>A	ENSP00000465570:p.Pro23365Leu		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P16133L|TTN_uc010zfi.1_Missense_Mutation_p.P16066L|TTN_uc010zfj.1_Missense_Mutation_p.P15941L	p.P22438L	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	67537	-			23365					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.67313C>T		.	.	.	.	.	.	.	.	.	.	G	14.97	2.692955	0.48202	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	5.28	5.28	0.74379	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72645	0.3486	M	0.89904	3.07	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.997	T	0.78814	-0.2056	9	0.87932	D	0	.	19.2734	0.94019	0.0:0.0:1.0:0.0	.	15941;16066;16133;23365	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	22438;15941;16133;16066;15939	ENSP00000343764:P22438L;ENSP00000434586:P15941L;ENSP00000340554:P16133L;ENSP00000352154:P16066L	ENSP00000340554:P16133L	P	-	2	0	TTN	179144088	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.751000	0.98889	2.630000	0.89119	0.650000	0.86243	CCA		0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		8	165	0	0	0	0.00308	0	8	165				
TTN	7273	broad.mit.edu	37	2	179576905	179576905	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:179576905C>A	ENST00000591111.1	-	94	26925	c.26701G>T	c.(26701-26703)Gtt>Ttt	p.V8901F	TTN_ENST00000589042.1_Missense_Mutation_p.V9218F|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V7974F|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13047	Ig-like 72.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAATCTCCAACAGACACCTTA	0.458																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(23920-23922)GTT>TTT		titin isoform N2-A							62.0	61.0	61.0					2																	179576905		1907	4123	6030	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179576905C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26701G>T	2.37:g.179576905C>A	ENSP00000465570:p.Val8901Phe		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.V4635F	p.V7974F	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		93	24144	-			8901					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.23920G>T		.	.	.	.	.	.	.	.	.	.	C	13.46	2.242458	0.39598	.	.	ENSG00000155657	ENST00000342992	T	0.46451	0.87	5.76	5.76	0.90799	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.59293	0.2183	M	0.82630	2.6	0.80722	D	1	P	0.49696	0.927	P	0.52109	0.69	T	0.65257	-0.6212	9	0.87932	D	0	.	14.1618	0.65452	0.0:0.9286:0.0:0.0714	.	8901	Q8WZ42	TITIN_HUMAN	F	7974	ENSP00000343764:V7974F	ENSP00000343764:V7974F	V	-	1	0	TTN	179285150	0.723000	0.28027	0.969000	0.41365	0.976000	0.68499	2.670000	0.46833	2.710000	0.92621	0.655000	0.94253	GTT		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		24	78	1	0	5.35047e-06	0.00333	6.58973e-06	24	78				
ITGA4	3676	broad.mit.edu	37	2	182358123	182358123	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:182358123G>A	ENST00000397033.2	+	11	1655	c.1225G>A	c.(1225-1227)Ggg>Agg	p.G409R		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	409					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	CCGTGCAGATGGGATCTCGTC	0.373																																							uc002unu.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(1225-1227)GGG>AGG		integrin alpha 4 precursor	Natalizumab(DB00108)						109.0	103.0	105.0					2																	182358123		1881	4104	5985	SO:0001583	missense	3676				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity	g.chr2:182358123G>A		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1225G>A	2.37:g.182358123G>A	ENSP00000380227:p.Gly409Arg		Somatic					p.G409R	NM_000885	NP_000876	WXS	Illumina HiSeq	Unspecified	P13612	ITA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0593)		11	1988	+			409			FG-GAP 6.|Extracellular (Potential).		D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	c.1225G>A	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423593	0.83559	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	T;T	0.64260	-0.09;-0.09	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.82235	0.4993	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83722	0.0193	10	0.87932	D	0	.	20.1195	0.97955	0.0:0.0:1.0:0.0	.	409	P13612	ITA4_HUMAN	R	409	ENSP00000380227:G409R;ENSP00000233573:G409R	ENSP00000233573:G409R	G	+	1	0	ITGA4	182066368	1.000000	0.71417	0.971000	0.41717	0.636000	0.38137	8.502000	0.90505	2.759000	0.94783	0.650000	0.86243	GGG		0.373	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1			18	34	0	0	0	0.007413	0	18	34				
CERKL	375298	broad.mit.edu	37	2	182413579	182413579	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:182413579C>G	ENST00000339098.5	-	8	978	c.979G>C	c.(979-981)Gta>Cta	p.V327L	CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000374969.2_Missense_Mutation_p.V188L|CERKL_ENST00000374970.2_Missense_Mutation_p.V232L|CERKL_ENST00000410087.3_Missense_Mutation_p.V301L|CERKL_ENST00000409440.3_Missense_Mutation_p.V283L			Q49MI3	CERKL_HUMAN	ceramide kinase-like	327	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			ACCAGCTGTACATGCCCTTGA	0.433																																							uc002unx.2		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(979-981)GTA>CTA		ceramide kinase-like isoform b							54.0	57.0	56.0					2																	182413579		2203	4300	6503	SO:0001583	missense	375298				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity	g.chr2:182413579C>G	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.979G>C	2.37:g.182413579C>G	ENSP00000341159:p.Val327Leu		Somatic				CERKL_uc002uny.2_Missense_Mutation_p.V301L|CERKL_uc010zfm.1_Missense_Mutation_p.V283L|CERKL_uc002unz.2_Missense_Mutation_p.V49L|CERKL_uc002uoa.2_Missense_Mutation_p.V232L|CERKL_uc002uob.2_Missense_Mutation_p.V49L|CERKL_uc002uoc.2_Missense_Mutation_p.V188L|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_Missense_Mutation_p.V96L|CERKL_uc002uoe.2_Missense_Mutation_p.V301L|CERKL_uc002unw.2_5'Flank	p.V327L	NM_001030311	NP_001025482	WXS	Illumina HiSeq	Unspecified	Q49MI3	CERKL_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.088)		8	1080	-			327			DAGKc.		B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	ENST00000339098.5	37	c.979G>C	CCDS42789.1	.	.	.	.	.	.	.	.	.	.	C	7.063	0.566838	0.13560	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53	5.62	-7.08	0.01558	Diacylglycerol kinase, catalytic domain (2);	0.557300	0.20201	N	0.097100	T	0.06280	0.0162	L	0.29908	0.895	0.09310	N	0.999999	B;B;B;B;B	0.09022	0.001;0.002;0.001;0.0;0.001	B;B;B;B;B	0.11329	0.005;0.004;0.006;0.002;0.003	T	0.39761	-0.9598	10	0.11182	T	0.66	.	8.7892	0.34841	0.0:0.3206:0.4147:0.2647	.	283;188;232;301;327	B4DEY1;Q49MI3-4;Q49MI3-3;Q49MI3-2;Q49MI3	.;.;.;.;CERKL_HUMAN	L	301;283;188;327;232	ENSP00000386725:V301L;ENSP00000387080:V283L;ENSP00000364108:V188L;ENSP00000341159:V327L;ENSP00000364109:V232L	ENSP00000341159:V327L	V	-	1	0	CERKL	182121824	0.155000	0.22806	0.033000	0.17914	0.069000	0.16628	-0.018000	0.12568	-1.359000	0.02174	-0.302000	0.09304	GTA		0.433	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1			13	41	0	0	0	0.00245	0	13	41				
ZNF804A	91752	broad.mit.edu	37	2	185801049	185801049	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:185801049C>A	ENST00000302277.6	+	4	1520	c.926C>A	c.(925-927)cCt>cAt	p.P309H		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	309							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TTATTATTACCTTCATTTTGC	0.343																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(925-927)CCT>CAT		zinc finger protein 804A							32.0	31.0	31.0					2																	185801049		2202	4294	6496	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185801049C>A	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.926C>A	2.37:g.185801049C>A	ENSP00000303252:p.Pro309His		Somatic					p.P309H	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	1520	+			309					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.926C>A	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.688944	0.48097	.	.	ENSG00000170396	ENST00000302277	T	0.47869	0.83	5.57	3.39	0.38822	.	0.575492	0.16814	N	0.198428	T	0.42314	0.1197	M	0.62723	1.935	0.09310	N	1	B	0.25048	0.117	B	0.20184	0.028	T	0.43893	-0.9363	10	0.87932	D	0	-3.0119	7.3298	0.26575	0.1494:0.7002:0.0:0.1504	.	309	Q7Z570	Z804A_HUMAN	H	309	ENSP00000303252:P309H	ENSP00000303252:P309H	P	+	2	0	ZNF804A	185509294	0.414000	0.25408	0.854000	0.33618	0.835000	0.47333	1.460000	0.35244	1.300000	0.44818	0.591000	0.81541	CCT		0.343	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		9	27	1	0	0.000274275	0.004482	0.000316835	9	27				
INPP1	3628	broad.mit.edu	37	2	191233942	191233942	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:191233942G>T	ENST00000322522.4	+	5	1036	c.580G>T	c.(580-582)Ggg>Tgg	p.G194W	INPP1_ENST00000541441.1_Missense_Mutation_p.G194W|INPP1_ENST00000392329.2_Missense_Mutation_p.G194W	NM_002194.3	NP_002185.1	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	194					dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-1,3,4-trisphosphate 1-phosphatase activity (GO:0052829)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|metal ion binding (GO:0046872)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)			CATACAGACAGGGGTTCCCCT	0.408																																					Melanoma(130;184 1743 2185 19805 38428)	Melanoma(130;184 1743 2185 19805 38428)	uc002ury.3		NA																	0				ovary(1)|lung(1)	2						c.(580-582)GGG>TGG		inositol polyphosphate-1-phosphatase	Lithium(DB01356)						129.0	127.0	128.0					2																	191233942		2203	4300	6503	SO:0001583	missense	3628				signal transduction		inositol-1,4-bisphosphate 1-phosphatase activity|metal ion binding	g.chr2:191233942G>T		CCDS2305.1	2q32	2008-02-07			ENSG00000151689	ENSG00000151689	3.1.3.57		6071	protein-coding gene	gene with protein product		147263				8390685	Standard	NM_002194		Approved		uc010fsb.3	P49441	OTTHUMG00000132672	ENST00000322522.4:c.580G>T	2.37:g.191233942G>T	ENSP00000325423:p.Gly194Trp		Somatic				INPP1_uc010fsb.2_Missense_Mutation_p.G194W|INPP1_uc002urx.3_Missense_Mutation_p.G194W	p.G194W	NM_001128928	NP_001122400	WXS	Illumina HiSeq	Unspecified	P49441	INPP_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)		6	1280	+			194						Missense_Mutation	SNP	ENST00000322522.4	37	c.580G>T	CCDS2305.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528013	0.85706	.	.	ENSG00000151689	ENST00000392329;ENST00000322522;ENST00000541441;ENST00000431594;ENST00000423767	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72835	0.3510	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78695	-0.2104	10	0.87932	D	0	-24.2617	17.5378	0.87837	0.0:0.0:1.0:0.0	.	194	P49441	INPP_HUMAN	W	194	ENSP00000376142:G194W;ENSP00000325423:G194W;ENSP00000440650:G194W;ENSP00000409786:G194W;ENSP00000395424:G194W	ENSP00000325423:G194W	G	+	1	0	INPP1	190942187	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	8.077000	0.89505	2.747000	0.94245	0.644000	0.83932	GGG		0.408	INPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255932.2			38	84	1	0	3.43241e-23	0.002222	5.98885e-23	38	84				
DNAH7	56171	broad.mit.edu	37	2	196729424	196729424	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:196729424C>A	ENST00000312428.6	-	41	7055	c.6955G>T	c.(6955-6957)Gcc>Tcc	p.A2319S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2319	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TGCTCTATGGCAAATCGAAAC	0.448																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(6955-6957)GCC>TCC		dynein, axonemal, heavy chain 7							149.0	146.0	147.0					2																	196729424		1939	4155	6094	SO:0001583	missense	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196729424C>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6955G>T	2.37:g.196729424C>A	ENSP00000311273:p.Ala2319Ser		Somatic					p.A2319S	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			41	7056	-			2319			AAA 4 (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.6955G>T	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.670173	0.47677	.	.	ENSG00000118997	ENST00000312428	T	0.55413	0.52	4.87	4.87	0.63330	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.85682	D	0.000000	D	0.83667	0.5304	H	0.98487	4.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90373	0.4382	10	0.87932	D	0	.	17.7802	0.88522	0.0:1.0:0.0:0.0	.	2319	Q8WXX0	DYH7_HUMAN	S	2319	ENSP00000311273:A2319S	ENSP00000311273:A2319S	A	-	1	0	DNAH7	196437669	1.000000	0.71417	1.000000	0.80357	0.035000	0.12851	5.706000	0.68362	2.535000	0.85469	0.460000	0.39030	GCC		0.448	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		26	88	1	0	1.64293e-13	0.00333	2.53633e-13	26	88				
DNAH7	56171	broad.mit.edu	37	2	196801370	196801370	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:196801370G>A	ENST00000312428.6	-	20	3325	c.3225C>T	c.(3223-3225)tcC>tcT	p.S1075S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1075	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GTTCATCATTGGACAAAAAAA	0.313																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(3223-3225)TCC>TCT		dynein, axonemal, heavy chain 7							72.0	71.0	72.0					2																	196801370		1800	4060	5860	SO:0001819	synonymous_variant	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196801370G>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.3225C>T	2.37:g.196801370G>A			Somatic					p.S1075S	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			20	3326	-			1075			Stem (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	c.3225C>T	CCDS42794.1																																																																																				0.313	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		18	52	0	0	0	0.008871	0	18	52				
ALS2	57679	broad.mit.edu	37	2	202611466	202611466	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:202611466G>A	ENST00000264276.6	-	9	2193	c.1821C>T	c.(1819-1821)agC>agT	p.S607S	ALS2_ENST00000457679.2_5'Flank	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	607					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						CATTTTCACTGCTTATCTGCA	0.443																																							uc002uyo.2		NA																	0				skin(5)|lung(1)|breast(1)	7						c.(1819-1821)AGC>AGT		alsin isoform 1							108.0	105.0	106.0					2																	202611466		1906	4126	6032	SO:0001819	synonymous_variant	57679				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity	g.chr2:202611466G>A	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.1821C>T	2.37:g.202611466G>A			Somatic				ALS2_uc002uyp.3_Silent_p.S607S|ALS2_uc002uyq.2_Silent_p.S607S|ALS2_uc010ftl.2_5'Flank	p.S607S	NM_020919	NP_065970	WXS	Illumina HiSeq	Unspecified	Q96Q42	ALS2_HUMAN			9	2177	-			607			RCC1 5.		Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	37	c.1821C>T	CCDS42800.1																																																																																				0.443	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919		22	119	0	0	0	0.002299	0	22	119				
STK11IP	114790	broad.mit.edu	37	2	220477903	220477903	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:220477903G>T	ENST00000456909.1	+	20	2583	c.2493G>T	c.(2491-2493)gtG>gtT	p.V831V	STK11IP_ENST00000295641.10_Silent_p.V842V			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	842					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTGTGGTTGTGTCTGACCGCA	0.592																																							uc002vml.2		NA																	0				ovary(1)	1						c.(2524-2526)GTG>GTT		LKB1 interacting protein							82.0	87.0	85.0					2																	220477903		2038	4187	6225	SO:0001819	synonymous_variant	114790				protein localization	cytoplasm	protein kinase binding	g.chr2:220477903G>T	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.2493G>T	2.37:g.220477903G>T			Somatic					p.V842V	NM_052902	NP_443134	WXS	Illumina HiSeq	Unspecified	Q8N1F8	S11IP_HUMAN		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	20	2569	+		Renal(207;0.0183)	842					Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Silent	SNP	ENST00000456909.1	37	c.2526G>T																																																																																					0.592	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902		7	38	1	0	3.09899e-07	0.004482	3.97762e-07	7	38				
AGAP1	116987	broad.mit.edu	37	2	236403353	236403353	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:236403353C>A	ENST00000304032.8	+	1	603	c.23C>A	c.(22-24)gCc>gAc	p.A8D	AGAP1_ENST00000409457.1_Missense_Mutation_p.A8D|AGAP1_ENST00000336665.5_Missense_Mutation_p.A8D	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	8					protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CAGCAGCTGGCCAACTCGGCT	0.756																																							uc002vvs.2		NA																	0				ovary(2)|skin(1)	3						c.(22-24)GCC>GAC		centaurin, gamma 2 isoform 1							24.0	28.0	27.0					2																	236403353		2198	4294	6492	SO:0001583	missense	116987				protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding	g.chr2:236403353C>A	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.23C>A	2.37:g.236403353C>A	ENSP00000307634:p.Ala8Asp		Somatic				AGAP1_uc002vvt.2_Missense_Mutation_p.A8D	p.A8D	NM_001037131	NP_001032208	WXS	Illumina HiSeq	Unspecified	Q9UPQ3	AGAP1_HUMAN			1	618	+			8					B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	ENST00000304032.8	37	c.23C>A	CCDS33408.1	.	.	.	.	.	.	.	.	.	.	c	19.81	3.896545	0.72639	.	.	ENSG00000157985	ENST00000409457;ENST00000304032;ENST00000336665	D;T;T	0.86366	-2.11;-0.56;-0.56	3.77	3.77	0.43336	.	1.166280	0.07080	U	0.836884	T	0.76779	0.4035	N	0.08118	0	0.80722	D	1	B;B	0.27498	0.001;0.18	B;B	0.19391	0.001;0.025	T	0.62886	-0.6759	10	0.41790	T	0.15	.	13.0775	0.59095	0.0:1.0:0.0:0.0	.	8;8	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	D	8	ENSP00000387174:A8D;ENSP00000307634:A8D;ENSP00000338378:A8D	ENSP00000307634:A8D	A	+	2	0	AGAP1	236068092	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.473000	0.73572	1.634000	0.50500	0.472000	0.43445	GCC		0.756	AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914		17	41	1	0	5.01169e-05	0.00499	5.96418e-05	17	41				
RBM44	375316	broad.mit.edu	37	2	238725983	238725983	+	Missense_Mutation	SNP	G	G	A	rs372536189		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:238725983G>A	ENST00000409864.1	+	3	678	c.424G>A	c.(424-426)Gag>Aag	p.E142K	RBM44_ENST00000316997.4_Missense_Mutation_p.E142K|RBM44_ENST00000444524.2_Intron			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	141						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GCAGAAAAAAGAGGAGGTTTT	0.308																																							uc002vxi.3		NA																	0				ovary(4)	4						c.(424-426)GAG>AAG		RNA binding motif protein 44		G	LYS/GLU	1,3587		0,1,1793	24.0	24.0	24.0		424	2.6	0.0	2		24	0,8114		0,0,4057	no	missense	RBM44	NM_001080504.2	56	0,1,5850	AA,AG,GG		0.0,0.0279,0.0085	benign	142/1053	238725983	1,11701	1794	4057	5851	SO:0001583	missense	375316						nucleotide binding|RNA binding	g.chr2:238725983G>A	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.424G>A	2.37:g.238725983G>A	ENSP00000386727:p.Glu142Lys		Somatic					p.E142K	NM_001080504	NP_001073973	WXS	Illumina HiSeq	Unspecified	Q6ZP01	RBM44_HUMAN		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)	3	556	+		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)	141					A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	c.424G>A	CCDS46554.1	.	.	.	.	.	.	.	.	.	.	G	9.914	1.210331	0.22289	2.79E-4	0.0	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.32988	1.43;1.43	5.33	2.58	0.30949	.	0.253440	0.27000	N	0.021434	T	0.24392	0.0591	L	0.50333	1.59	0.09310	N	1	B	0.14805	0.011	B	0.18263	0.021	T	0.21586	-1.0241	10	0.24483	T	0.36	-2.8312	7.6712	0.28460	0.266:0.0:0.734:0.0	.	141	Q6ZP01	RBM44_HUMAN	K	142	ENSP00000321179:E142K;ENSP00000386727:E142K	ENSP00000321179:E142K	E	+	1	0	RBM44	238390722	0.001000	0.12720	0.003000	0.11579	0.049000	0.14656	0.821000	0.27338	0.262000	0.21774	-0.261000	0.10672	GAG		0.308	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504		8	9	0	0	0	0.00308	0	8	9				
RBM44	375316	broad.mit.edu	37	2	238726838	238726838	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:238726838G>T	ENST00000409864.1	+	3	1533	c.1279G>T	c.(1279-1281)Gat>Tat	p.D427Y	RBM44_ENST00000316997.4_Missense_Mutation_p.D427Y|RBM44_ENST00000444524.2_Intron			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	426						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GGCAATAGAAGATAATACGTC	0.383																																							uc002vxi.3		NA																	0				ovary(4)	4						c.(1279-1281)GAT>TAT		RNA binding motif protein 44							51.0	48.0	49.0					2																	238726838		1915	4120	6035	SO:0001583	missense	375316						nucleotide binding|RNA binding	g.chr2:238726838G>T	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.1279G>T	2.37:g.238726838G>T	ENSP00000386727:p.Asp427Tyr		Somatic					p.D427Y	NM_001080504	NP_001073973	WXS	Illumina HiSeq	Unspecified	Q6ZP01	RBM44_HUMAN		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)	3	1411	+		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)	426					A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	c.1279G>T	CCDS46554.1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.345457	0.24426	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.24723	1.84;1.84	5.86	4.99	0.66335	.	0.833643	0.10752	N	0.638160	T	0.25938	0.0632	L	0.51422	1.61	0.09310	N	1	P	0.46277	0.875	B	0.38327	0.271	T	0.15150	-1.0447	10	0.72032	D	0.01	-0.9487	11.9863	0.53149	0.0802:0.0:0.9198:0.0	.	426	Q6ZP01	RBM44_HUMAN	Y	427	ENSP00000321179:D427Y;ENSP00000386727:D427Y	ENSP00000321179:D427Y	D	+	1	0	RBM44	238391577	0.180000	0.23148	0.004000	0.12327	0.009000	0.06853	3.740000	0.55082	1.494000	0.48533	0.591000	0.81541	GAT		0.383	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504		23	31	1	0	6.44725e-10	0.002299	9.17125e-10	23	31				
RBM44	375316	broad.mit.edu	37	2	238742712	238742712	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:238742712C>A	ENST00000409864.1	+	14	3216	c.2962C>A	c.(2962-2964)Cca>Aca	p.P988T	RBM44_ENST00000316997.4_Missense_Mutation_p.P988T			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	987						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		ATTCATACCTCCAAATACATT	0.338																																							uc002vxi.3		NA																	0				ovary(4)	4						c.(2962-2964)CCA>ACA		RNA binding motif protein 44							53.0	48.0	49.0					2																	238742712		1817	4069	5886	SO:0001583	missense	375316						nucleotide binding|RNA binding	g.chr2:238742712C>A	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.2962C>A	2.37:g.238742712C>A	ENSP00000386727:p.Pro988Thr		Somatic					p.P988T	NM_001080504	NP_001073973	WXS	Illumina HiSeq	Unspecified	Q6ZP01	RBM44_HUMAN		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)	14	3094	+		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)	987					A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	c.2962C>A	CCDS46554.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313543	0.60414	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.37411	1.2;1.2	5.31	4.41	0.53225	.	.	.	.	.	T	0.58935	0.2157	M	0.73598	2.24	0.29339	N	0.866179	D	0.89917	1.0	D	0.79108	0.992	T	0.57900	-0.7731	9	0.72032	D	0.01	-11.5767	11.8373	0.52333	0.0:0.8233:0.1767:0.0	.	987	Q6ZP01	RBM44_HUMAN	T	988	ENSP00000321179:P988T;ENSP00000386727:P988T	ENSP00000321179:P988T	P	+	1	0	RBM44	238407451	0.994000	0.37717	0.977000	0.42913	0.791000	0.44710	1.503000	0.35715	1.190000	0.43042	0.585000	0.79938	CCA		0.338	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504		8	11	1	0	3.09899e-07	0.004482	3.97762e-07	8	11				
ESPNL	339768	broad.mit.edu	37	2	239016463	239016463	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:239016463G>T	ENST00000343063.3	+	4	967	c.704G>T	c.(703-705)cGg>cTg	p.R235L	ESPNL_ENST00000409169.1_Missense_Mutation_p.R235L	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	235										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CTCACGGCACGGGACAATGAG	0.652																																							uc002vxq.3		NA																	0				pancreas(1)	1						c.(703-705)CGG>CTG		espin-like							23.0	21.0	22.0					2																	239016463		2198	4300	6498	SO:0001583	missense	339768							g.chr2:239016463G>T	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.704G>T	2.37:g.239016463G>T	ENSP00000339115:p.Arg235Leu		Somatic				ESPNL_uc010fyw.2_5'UTR	p.R235L	NM_194312	NP_919288	WXS	Illumina HiSeq	Unspecified	Q6ZVH7	ESPNL_HUMAN		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)	4	814	+		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)	235					Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	c.704G>T	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.625849	0.46840	.	.	ENSG00000144488	ENST00000343063;ENST00000409169	T;T	0.64260	-0.09;-0.09	5.71	2.93	0.34026	Ankyrin repeat-containing domain (3);	0.381276	0.21426	U	0.074731	T	0.65616	0.2708	L	0.45051	1.395	0.80722	D	1	D	0.63046	0.992	D	0.64506	0.926	T	0.61917	-0.6964	10	0.42905	T	0.14	-34.6017	6.592	0.22651	0.3463:0.0:0.6537:0.0	.	235	Q6ZVH7	ESPNL_HUMAN	L	235	ENSP00000339115:R235L;ENSP00000386577:R235L	ENSP00000339115:R235L	R	+	2	0	ESPNL	238681202	0.974000	0.33945	0.553000	0.28255	0.051000	0.14879	1.521000	0.35910	0.752000	0.32923	0.655000	0.94253	CGG		0.652	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312		4	7	1	0	1.23904e-05	0.000602	1.50391e-05	4	7				
ESPNL	339768	broad.mit.edu	37	2	239016588	239016588	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:239016588G>C	ENST00000343063.3	+	4	1092	c.829G>C	c.(829-831)Gac>Cac	p.D277H	ESPNL_ENST00000409169.1_Missense_Mutation_p.D277H	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	277										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CCCCCTCCACGACGCAGCAGA	0.637																																							uc002vxq.3		NA																	0				pancreas(1)	1						c.(829-831)GAC>CAC		espin-like							37.0	34.0	35.0					2																	239016588		2201	4300	6501	SO:0001583	missense	339768							g.chr2:239016588G>C	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.829G>C	2.37:g.239016588G>C	ENSP00000339115:p.Asp277His		Somatic				ESPNL_uc010fyw.2_Missense_Mutation_p.D17H	p.D277H	NM_194312	NP_919288	WXS	Illumina HiSeq	Unspecified	Q6ZVH7	ESPNL_HUMAN		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)	4	939	+		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)	277			ANK 9.		Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	c.829G>C	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469654	0.84533	.	.	ENSG00000144488	ENST00000343063;ENST00000409169	T;T	0.63580	-0.05;0.68	5.51	5.51	0.81932	Ankyrin repeat-containing domain (4);	0.000000	0.64402	U	0.000018	T	0.58821	0.2149	N	0.04636	-0.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.59484	-0.7446	10	0.16420	T	0.52	-37.2561	16.3304	0.83010	0.0:0.0:1.0:0.0	.	277;277	Q6ZVH7-2;Q6ZVH7	.;ESPNL_HUMAN	H	277	ENSP00000339115:D277H;ENSP00000386577:D277H	ENSP00000339115:D277H	D	+	1	0	ESPNL	238681327	1.000000	0.71417	0.320000	0.25306	0.871000	0.50021	8.835000	0.92100	2.580000	0.87095	0.655000	0.94253	GAC		0.637	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312		11	27	0	0	0	0.001368	0	11	27				
PER2	8864	broad.mit.edu	37	2	239161729	239161729	+	Missense_Mutation	SNP	G	G	T	rs555709631	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:239161729G>T	ENST00000254657.3	-	19	3214	c.2935C>A	c.(2935-2937)Ccg>Acg	p.P979T	AC096574.4_ENST00000456601.1_RNA|PER2_ENST00000254658.3_3'UTR	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	979	Interaction with PPARG. {ECO:0000250|UniProtKB:O54943}.|Pro-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TGAAAGAGCGGTGGGGAGGCC	0.682																																							uc002vyc.2		NA																	0				upper_aerodigestive_tract(1)|breast(1)	2						c.(2935-2937)CCG>ACG		period 2							37.0	40.0	39.0					2																	239161729		2203	4299	6502	SO:0001583	missense	8864				circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity	g.chr2:239161729G>T	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2935C>A	2.37:g.239161729G>T	ENSP00000254657:p.Pro979Thr		Somatic				PER2_uc010znv.1_Missense_Mutation_p.P979T	p.P979T	NM_022817	NP_073728	WXS	Illumina HiSeq	Unspecified	O15055	PER2_HUMAN		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)	19	3172	-		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)	979			Pro-rich.		A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	c.2935C>A	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012523	0.35511	.	.	ENSG00000132326	ENST00000254657	T	0.14640	2.49	4.64	3.75	0.43078	.	0.672836	0.13982	N	0.349404	T	0.17066	0.0410	M	0.76328	2.33	0.80722	D	1	P;P	0.43287	0.802;0.802	B;B	0.34489	0.184;0.184	T	0.07177	-1.0786	10	0.56958	D	0.05	-10.4877	12.8181	0.57677	0.0:0.1659:0.8341:0.0	.	979;979	B4DH14;O15055	.;PER2_HUMAN	T	979	ENSP00000254657:P979T	ENSP00000254657:P979T	P	-	1	0	PER2	238826468	1.000000	0.71417	0.007000	0.13788	0.020000	0.10135	4.911000	0.63328	1.061000	0.40601	0.655000	0.94253	CCG		0.682	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817		23	43	1	0	1.96895e-08	0.00278	2.66504e-08	23	43				
SIRPB1	10326	broad.mit.edu	37	20	1559157	1559157	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr20:1559157G>T	ENST00000381605.4	-	2	324	c.260C>A	c.(259-261)cCa>cAa	p.P87Q	SIRPB1_ENST00000262929.5_Missense_Mutation_p.P86Q|RP4-576H24.4_ENST00000564763.1_Missense_Mutation_p.P87Q|SIRPB1_ENST00000381603.3_Missense_Mutation_p.P87Q	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	87	Ig-like V-type.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						TGTTACCCGTGGGAAGTGGCC	0.507																																							uc010gai.2		NA																	0				ovary(1)	1						c.(259-261)CCA>CAA		signal-regulatory protein beta 1 isoform 1							210.0	184.0	192.0					20																	1559157		2199	4245	6444	SO:0001583	missense	10326				cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding	g.chr20:1559157G>T	Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.260C>A	20.37:g.1559157G>T	ENSP00000371018:p.Pro87Gln		Somatic				SIRPB1_uc002wfk.3_Missense_Mutation_p.P87Q	p.P87Q	NM_006065	NP_006056	WXS	Illumina HiSeq	Unspecified	O00241	SIRB1_HUMAN			2	359	-			87			Extracellular (Potential).|Ig-like V-type.		A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	ENST00000381605.4	37	c.260C>A	CCDS13019.1	.	.	.	.	.	.	.	.	.	.	.	13.01	2.110700	0.37242	.	.	ENSG00000101307	ENST00000381605;ENST00000381603;ENST00000262929	T;T;T	0.65549	-0.16;-0.16;-0.16	2.36	2.36	0.29203	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.304199	0.28700	N	0.014439	T	0.79221	0.4409	M	0.90369	3.11	0.09310	N	1	D;D	0.89917	1.0;0.996	D;D	0.83275	0.996;0.989	T	0.67473	-0.5662	10	0.87932	D	0	.	8.1953	0.31392	0.0:0.0:1.0:0.0	.	87;87	O00241;O00241-2	SIRB1_HUMAN;.	Q	87;87;86	ENSP00000371018:P87Q;ENSP00000371016:P87Q;ENSP00000262929:P86Q	ENSP00000262929:P86Q	P	-	2	0	SIRPB1	1507157	0.516000	0.26218	0.003000	0.11579	0.002000	0.02628	2.834000	0.48167	1.328000	0.45358	0.462000	0.41574	CCA		0.507	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065		74	74	1	0	7.07328e-35	0.00361	1.29131e-34	74	74				
TGM6	343641	broad.mit.edu	37	20	2381054	2381054	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr20:2381054G>T	ENST00000202625.2	+	7	1014	c.953G>T	c.(952-954)gGg>gTg	p.G318V	TGM6_ENST00000381423.1_Missense_Mutation_p.G318V|TGM6_ENST00000477505.1_3'UTR	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	318					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	GACTCCTTCGGGCGGACCCTG	0.617																																							uc002wfy.1		NA																	0				ovary(3)|skin(1)	4						c.(952-954)GGG>GTG		transglutaminase 6	L-Glutamine(DB00130)						109.0	96.0	100.0					20																	2381054		2203	4300	6503	SO:0001583	missense	343641				cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr20:2381054G>T	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.953G>T	20.37:g.2381054G>T	ENSP00000202625:p.Gly318Val		Somatic				TGM6_uc010gal.1_Missense_Mutation_p.G318V	p.G318V	NM_198994	NP_945345	WXS	Illumina HiSeq	Unspecified	O95932	TGM3L_HUMAN			7	1014	+			318					Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	c.953G>T	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.674016	0.67928	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.96522	-4.04;-4.04	4.4	4.4	0.53042	Transglutaminase-like (2);	0.000000	0.85682	D	0.000000	D	0.98416	0.9473	H	0.95504	3.68	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98481	1.0605	10	0.72032	D	0.01	-37.6928	9.9859	0.41841	0.0:0.0:0.798:0.202	.	318;318	O95932-2;O95932	.;TGM3L_HUMAN	V	318	ENSP00000202625:G318V;ENSP00000370831:G318V	ENSP00000202625:G318V	G	+	2	0	TGM6	2329054	0.984000	0.35163	1.000000	0.80357	0.995000	0.86356	2.834000	0.48167	2.464000	0.83262	0.561000	0.74099	GGG		0.617	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994		27	33	1	0	5.77227e-19	0.008361	9.66855e-19	27	33				
NOP56	10528	broad.mit.edu	37	20	2637485	2637485	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr20:2637485G>C	ENST00000329276.5	+	10	1741	c.1225G>C	c.(1225-1227)Gag>Cag	p.E409Q	IDH3B_ENST00000488299.1_5'Flank|SNORD86_ENST00000391196.1_RNA|SNORD57_ENST00000448188.1_RNA|SNORD56_ENST00000413522.1_RNA|NOP56_ENST00000492135.1_3'UTR|SNORD110_ENST00000408189.1_RNA|SNORA51_ENST00000606420.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	409	Nop. {ECO:0000255|PROSITE- ProRule:PRU00690}.				cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						GTCCTTCTATGAGACTGGAGA	0.512																																							uc002wgh.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1225-1227)GAG>CAG		nucleolar protein 5A							157.0	131.0	140.0					20																	2637485		2203	4300	6503	SO:0001583	missense	10528				rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding	g.chr20:2637485G>C	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.1225G>C	20.37:g.2637485G>C	ENSP00000370589:p.Glu409Gln		Somatic				NOP56_uc010zpy.1_RNA|NOP56_uc002wgi.2_Missense_Mutation_p.E243Q|NOP56_uc002wgm.1_Missense_Mutation_p.E156Q|SNORD57_uc002wgo.1_5'Flank	p.E409Q	NM_006392	NP_006383	WXS	Illumina HiSeq	Unspecified	O00567	NOP56_HUMAN			10	1278	+			409			Nop.		Q2M3T6|Q9NQ05	Missense_Mutation	SNP	ENST00000329276.5	37	c.1225G>C	CCDS13030.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.324660|4.324660	0.81580|0.81580	.|.	.|.	ENSG00000101361|ENSG00000101361	ENST00000329276;ENST00000381169|ENST00000415272	T|.	0.77098|.	-1.07|.	5.75|5.75	5.75|5.75	0.90469|0.90469	Pre-mRNA processing ribonucleoprotein, snoRNA-binding domain (1);|.	0.093065|.	0.64402|.	D|.	0.000001|.	D|D	0.83852|0.83852	0.5344|0.5344	M|M	0.88377|0.88377	2.95|2.95	0.80722|0.80722	D|D	1|1	P;P|.	0.46859|.	0.624;0.885|.	B;P|.	0.51297|.	0.316;0.665|.	D|D	0.85819|0.85819	0.1384|0.1384	10|5	0.62326|.	D|.	0.03|.	-15.7497|-15.7497	17.4537|17.4537	0.87600|0.87600	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	156;409|.	E9PDI8;O00567|.	.;NOP56_HUMAN|.	Q|I	409;156|149	ENSP00000370589:E409Q|.	ENSP00000370589:E409Q|.	E|M	+|+	1|3	0|0	NOP56|NOP56	2585485|2585485	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.477000|9.477000	0.97925|0.97925	2.716000|2.716000	0.92895|0.92895	0.655000|0.655000	0.94253|0.94253	GAG|ATG		0.512	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392		15	64	0	0	0	0.00245	0	15	64				
FRG1B	284802	broad.mit.edu	37	20	29625934	29625934	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr20:29625934C>T	ENST00000278882.3	+	5	558	c.178C>T	c.(178-180)Cat>Tat	p.H60Y	FRG1B_ENST00000358464.4_Missense_Mutation_p.H60Y|FRG1B_ENST00000439954.2_Missense_Mutation_p.H65Y			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	60										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ACTTGTTGGGCATTCAGATGC	0.338																																							uc010ztl.1		NA																	0					0						c.(88-90)CAT>TAT		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29625934C>T			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.178C>T	20.37:g.29625934C>T	ENSP00000278882:p.His60Tyr		Somatic				FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron	p.H30Y			WXS	Illumina HiSeq	Unspecified					2	120	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.88C>T		.	.	.	.	.	.	.	.	.	.	c	3.585	-0.084798	0.07097	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.42131	0.98	1.68	1.68	0.24146	.	0.109676	0.64402	D	0.000005	T	0.32615	0.0835	.	.	.	0.23210	N	0.998115	B	0.26363	0.147	B	0.35859	0.212	T	0.27905	-1.0060	9	0.34782	T	0.22	.	9.3557	0.38164	0.0:1.0:0.0:0.0	.	65	F5H5R5	.	Y	60;65;60	ENSP00000408863:H65Y	ENSP00000278882:H60Y	H	+	1	0	FRG1B	28239595	1.000000	0.71417	0.997000	0.53966	0.021000	0.10359	6.442000	0.73443	1.250000	0.43966	0.184000	0.17185	CAT		0.338	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		5	56	0	0	0	0.001168	0	5	56				
SEMG2	6407	broad.mit.edu	37	20	43851084	43851084	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr20:43851084A>G	ENST00000372769.3	+	2	901	c.811A>G	c.(811-813)Aaa>Gaa	p.K271E		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	271	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				ACACCAGACAAAAAATCTCAG	0.418																																							uc010ggz.2		NA																	0				skin(1)	1						c.(811-813)AAA>GAA		semenogelin II precursor							91.0	90.0	91.0					20																	43851084		2203	4300	6503	SO:0001583	missense	6407				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity	g.chr20:43851084A>G		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.811A>G	20.37:g.43851084A>G	ENSP00000361855:p.Lys271Glu		Somatic				SEMG2_uc002xnk.2_Missense_Mutation_p.K271E|SEMG2_uc002xnl.2_Missense_Mutation_p.K271E	p.K271E	NM_003008	NP_002999	WXS	Illumina HiSeq	Unspecified	Q02383	SEMG2_HUMAN			2	868	+		Myeloproliferative disorder(115;0.0122)	271			Repeat-rich region.|4 X 60 AA tandem repeats, type I.		Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	c.811A>G	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	A	7.602	0.673046	0.14776	.	.	ENSG00000124157	ENST00000372769	T	0.09538	2.97	1.5	-3.0	0.05480	.	.	.	.	.	T	0.16685	0.0401	L	0.47716	1.5	0.09310	N	1	D;D;D	0.64830	0.994;0.983;0.966	D;P;P	0.79108	0.992;0.872;0.785	T	0.08953	-1.0697	9	0.39692	T	0.17	.	0.6466	0.00819	0.4161:0.232:0.1864:0.1655	.	271;271;271	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	E	271	ENSP00000361855:K271E	ENSP00000361855:K271E	K	+	1	0	SEMG2	43284498	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.512000	0.00446	-1.618000	0.01568	-1.642000	0.00770	AAA		0.418	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008		29	25	0	0	0	0.00632	0	29	25				
GRIK1	2897	broad.mit.edu	37	21	30934017	30934017	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:30934017G>T	ENST00000399907.1	-	15	2695	c.2284C>A	c.(2284-2286)Cag>Aag	p.Q762K	GRIK1_ENST00000399913.1_Missense_Mutation_p.Q762K|GRIK1_ENST00000327783.4_Missense_Mutation_p.Q762K|GRIK1_ENST00000399909.1_Missense_Mutation_p.Q747K|GRIK1_ENST00000399914.1_Missense_Mutation_p.Q747K|GRIK1_ENST00000389125.3_Missense_Mutation_p.Q747K|GRIK1_ENST00000389124.2_Missense_Mutation_p.Q762K|GRIK1_ENST00000535441.1_Missense_Mutation_p.Q764K|GRIK1_ENST00000309434.7_Missense_Mutation_p.Q764K	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	762					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CAGTTTCTCTGCGTCACATAC	0.532																																							uc002yno.1		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(2284-2286)CAG>AAG		glutamate receptor, ionotropic, kainate 1	L-Glutamic Acid(DB00142)|Topiramate(DB00273)						164.0	132.0	143.0					21																	30934017		2203	4300	6503	SO:0001583	missense	2897				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity	g.chr21:30934017G>T		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2284C>A	21.37:g.30934017G>T	ENSP00000382791:p.Gln762Lys		Somatic				GRIK1_uc002ynn.2_Missense_Mutation_p.Q747K|GRIK1_uc011acs.1_Missense_Mutation_p.Q762K|GRIK1_uc011act.1_Missense_Mutation_p.Q623K	p.Q762K	NM_000830	NP_000821	WXS	Illumina HiSeq	Unspecified	P39086	GRIK1_HUMAN			15	2748	-			762			Extracellular (Potential).		Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	c.2284C>A	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870868	0.72065	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.09911	2.93;2.93;2.93;2.93;2.93;2.93;2.93;2.93;2.93	4.83	4.83	0.62350	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.17662	0.0424	M	0.70108	2.13	0.80722	D	1	B;B;B;B	0.16603	0.018;0.006;0.006;0.005	B;B;B;B	0.15484	0.013;0.009;0.013;0.005	T	0.03364	-1.1044	10	0.87932	D	0	.	18.0824	0.89445	0.0:0.0:1.0:0.0	.	747;762;762;747	E7EPY9;E9PD61;P39086;P39086-2	.;.;GRIK1_HUMAN;.	K	762;747;762;747;764;623;762;762;747;764	ENSP00000327687:Q762K;ENSP00000373777:Q747K;ENSP00000382797:Q762K;ENSP00000382798:Q747K;ENSP00000446326:Q764K;ENSP00000373776:Q762K;ENSP00000382791:Q762K;ENSP00000382793:Q747K;ENSP00000311646:Q764K	ENSP00000311646:Q764K	Q	-	1	0	GRIK1	29855888	1.000000	0.71417	0.982000	0.44146	0.995000	0.86356	9.554000	0.98121	2.665000	0.90641	0.563000	0.77884	CAG		0.532	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1			15	76	1	0	4.7546e-09	0.004007	6.6091e-09	15	76				
KRTAP27-1	643812	broad.mit.edu	37	21	31709587	31709587	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:31709587C>A	ENST00000382835.2	-	1	425	c.400G>T	c.(400-402)Gca>Tca	p.A134S		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	134						intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						TTGAGGCTTGCAGGTTGGCAG	0.483																																							uc002ynx.1		NA																	0				ovary(2)	2						c.(400-402)GCA>TCA		keratin associated protein 27-1							150.0	157.0	155.0					21																	31709587		2203	4300	6503	SO:0001583	missense	643812					intermediate filament		g.chr21:31709587C>A	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.400G>T	21.37:g.31709587C>A	ENSP00000372286:p.Ala134Ser		Somatic					p.A134S	NM_001077711	NP_001071179	WXS	Illumina HiSeq	Unspecified	Q3LI81	KR271_HUMAN			1	426	-			134						Missense_Mutation	SNP	ENST00000382835.2	37	c.400G>T	CCDS33532.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.692178	0.30052	.	.	ENSG00000206107	ENST00000382835	T	0.03272	3.99	4.18	3.3	0.37823	.	1.594920	0.04144	N	0.320021	T	0.04543	0.0124	N	0.22421	0.69	0.19775	N	0.999955	B	0.34181	0.44	B	0.37833	0.259	T	0.42378	-0.9455	10	0.33141	T	0.24	0.0069	8.2577	0.31766	0.0:0.892:0.0:0.108	.	134	Q3LI81	KR271_HUMAN	S	134	ENSP00000372286:A134S	ENSP00000372286:A134S	A	-	1	0	KRTAP27-1	30631458	0.027000	0.19231	0.458000	0.27068	0.001000	0.01503	-0.078000	0.11375	1.351000	0.45789	-0.216000	0.12614	GCA		0.483	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711		41	175	1	0	3.4345e-17	0.002852	5.66777e-17	41	175				
KRTAP15-1	254950	broad.mit.edu	37	21	31812784	31812784	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:31812784C>A	ENST00000334067.3	+	1	188	c.139C>A	c.(139-141)Ctc>Atc	p.L47I		NM_181623.1	NP_853654.1	Q3LI76	KR151_HUMAN	keratin associated protein 15-1	47						intermediate filament (GO:0005882)		p.L47I(1)		kidney(1)|large_intestine(3)|lung(6)|skin(1)	11						GGGCTCCTCTCTCTACAATGG	0.483																																							uc002yod.2		NA																	1	Substitution - Missense(1)		kidney(1)		0						c.(139-141)CTC>ATC		keratin associated protein 15-1							87.0	86.0	87.0					21																	31812784		2203	4300	6503	SO:0001583	missense	254950					intermediate filament		g.chr21:31812784C>A	AP001708	CCDS13593.1	21q22.1	2008-05-21			ENSG00000186970	ENSG00000186970		"""Keratin associated proteins"""	18927	protein-coding gene	gene with protein product						12359730	Standard	NM_181623		Approved	KAP15.1	uc002yod.3	Q3LI76	OTTHUMG00000057784	ENST00000334067.3:c.139C>A	21.37:g.31812784C>A	ENSP00000334866:p.Leu47Ile		Somatic					p.L47I	NM_181623	NP_853654	WXS	Illumina HiSeq	Unspecified	Q3LI76	KR151_HUMAN			1	139	+			47					Q2M3F4	Missense_Mutation	SNP	ENST00000334067.3	37	c.139C>A	CCDS13593.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071667	0.55646	.	.	ENSG00000186970	ENST00000334067	T	0.04015	3.73	4.79	-2.76	0.05896	.	1.818090	0.02934	N	0.139540	T	0.07413	0.0187	M	0.74467	2.265	0.09310	N	1	B	0.29955	0.263	B	0.30105	0.111	T	0.38908	-0.9639	10	0.66056	D	0.02	-1.0964	1.7247	0.02919	0.1696:0.2136:0.4014:0.2154	.	47	Q3LI76	KR151_HUMAN	I	47	ENSP00000334866:L47I	ENSP00000334866:L47I	L	+	1	0	KRTAP15-1	30734655	0.000000	0.05858	0.000000	0.03702	0.197000	0.23852	-1.398000	0.02509	-0.489000	0.06716	0.655000	0.94253	CTC		0.483	KRTAP15-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128236.1			41	83	1	0	2.95478e-19	0.00874	4.96166e-19	41	83				
KRTAP19-1	337882	broad.mit.edu	37	21	31852534	31852534	+	Silent	SNP	G	G	T	rs371788350		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:31852534G>T	ENST00000390689.2	-	1	129	c.103C>A	c.(103-105)Cgg>Agg	p.R35R		NM_181607.1	NP_853638.1	Q8IUB9	KR191_HUMAN	keratin associated protein 19-1	35	26 X 2 AA repeats of G-[YCGS].					intermediate filament (GO:0005882)				cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CCAGAACCCCGTCTGCAGAAG	0.587																																							uc011acx.1		NA																	0					0						c.(103-105)CGG>AGG		keratin associated protein 19-1							158.0	168.0	164.0					21																	31852534		2203	4300	6503	SO:0001819	synonymous_variant	337882					intermediate filament		g.chr21:31852534G>T	AJ457067	CCDS13594.1	21q22.1	2010-03-10			ENSG00000184351	ENSG00000184351		"""Keratin associated proteins"""	18936	protein-coding gene	gene with protein product						12359730	Standard	NM_181607		Approved	KAP19.1	uc011acx.2	Q8IUB9	OTTHUMG00000057768	ENST00000390689.2:c.103C>A	21.37:g.31852534G>T			Somatic					p.R35R	NM_181607	NP_853638	WXS	Illumina HiSeq	Unspecified	Q8IUB9	KR191_HUMAN			1	103	-			35			26 X 2 AA repeats of G-[YCGS].		A4QN27|Q3LI75	Silent	SNP	ENST00000390689.2	37	c.103C>A	CCDS13594.1																																																																																				0.587	KRTAP19-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128220.2			78	240	1	0	4.00405e-42	0.00361	7.41081e-42	78	240				
TIAM1	7074	broad.mit.edu	37	21	32638519	32638519	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:32638519C>G	ENST00000286827.3	-	5	1241	c.770G>C	c.(769-771)tGt>tCt	p.C257S	TIAM1_ENST00000469412.1_Intron|TIAM1_ENST00000541036.1_Missense_Mutation_p.C257S	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	257					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CAAATTCCGACAGTAGCCTGC	0.493																																							uc002yow.1		NA																	0				lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(769-771)TGT>TCT		T-cell lymphoma invasion and metastasis 1							96.0	93.0	94.0					21																	32638519		2203	4300	6503	SO:0001583	missense	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32638519C>G		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.770G>C	21.37:g.32638519C>G	ENSP00000286827:p.Cys257Ser		Somatic				TIAM1_uc011adk.1_Missense_Mutation_p.C257S|TIAM1_uc011adl.1_Missense_Mutation_p.C257S|TIAM1_uc002yox.1_Intron	p.C257S	NM_003253	NP_003244	WXS	Illumina HiSeq	Unspecified	Q13009	TIAM1_HUMAN			5	1242	-			257					B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	c.770G>C	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.243708	0.22796	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.39229	1.11;1.09	5.4	5.4	0.78164	.	0.197254	0.53938	D	0.000044	T	0.36054	0.0953	L	0.47716	1.5	0.43457	D	0.995654	P;P;P	0.38370	0.628;0.495;0.495	B;B;B	0.31869	0.137;0.065;0.065	T	0.12116	-1.0560	10	0.18710	T	0.47	.	19.3745	0.94503	0.0:1.0:0.0:0.0	.	257;257;257	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	S	257;98;257	ENSP00000286827:C257S;ENSP00000441570:C257S	ENSP00000286827:C257S	C	-	2	0	TIAM1	31560390	1.000000	0.71417	0.385000	0.26158	0.987000	0.75469	3.938000	0.56583	2.803000	0.96430	0.585000	0.79938	TGT		0.493	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		39	77	0	0	0	0.00874	0	39	77				
IL10RB	3588	broad.mit.edu	37	21	34660564	34660564	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:34660564G>C	ENST00000290200.2	+	6	910	c.802G>C	c.(802-804)Gag>Cag	p.E268Q		NM_000628.4	NP_000619.3	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta	268					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	14						GCACCTGAAAGAGGTAGGTAG	0.493																																					Melanoma(67;315 1275 21667 21943 44564)	Melanoma(67;315 1275 21667 21943 44564)	uc002yrk.1		NA																	0					0						c.(802-804)GAG>CAG		interleukin 10 receptor, beta precursor							94.0	78.0	83.0					21																	34660564		2203	4300	6503	SO:0001583	missense	3588				immune response|inflammatory response	interleukin-28 receptor complex	protein binding|receptor activity	g.chr21:34660564G>C	U08988	CCDS13623.1	21q22.11	2014-09-17			ENSG00000243646	ENSG00000243646		"""Interleukins and interleukin receptors"", ""CD molecules"""	5965	protein-coding gene	gene with protein product		123889		CRFB4, D21S58, D21S66		8314576, 9312047	Standard	NM_000628		Approved	CRF2-4, CDW210B, IL-10R2		Q08334	OTTHUMG00000065128	ENST00000290200.2:c.802G>C	21.37:g.34660564G>C	ENSP00000290200:p.Glu268Gln		Somatic				IL10RB_uc002yrl.1_Missense_Mutation_p.E270Q	p.E268Q	NM_000628	NP_000619	WXS	Illumina HiSeq	Unspecified	Q08334	I10R2_HUMAN			6	901	+			268			Cytoplasmic (Potential).		Q9BUU4	Missense_Mutation	SNP	ENST00000290200.2	37	c.802G>C	CCDS13623.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068948	0.76301	.	.	ENSG00000243646	ENST00000290200;ENST00000539894	T	0.59772	0.24	5.71	5.71	0.89125	.	0.361635	0.28927	N	0.013684	T	0.69504	0.3118	M	0.78637	2.42	0.38349	D	0.944286	D;D	0.54772	0.968;0.968	P;P	0.53313	0.723;0.723	T	0.72381	-0.4311	10	0.37606	T	0.19	-23.737	15.3645	0.74510	0.0:0.0:1.0:0.0	.	270;268	Q6ZVU9;Q08334	.;I10R2_HUMAN	Q	268	ENSP00000290200:E268Q	ENSP00000290200:E268Q	E	+	1	0	IL10RB	33582434	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	5.178000	0.65037	2.691000	0.91804	0.655000	0.94253	GAG		0.493	IL10RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139831.3			15	57	0	0	0	0.004007	0	15	57				
B3GALT5	10317	broad.mit.edu	37	21	41032852	41032852	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:41032852G>T	ENST00000380620.4	+	5	958	c.366G>T	c.(364-366)aaG>aaT	p.K122N	B3GALT5_ENST00000398714.2_Missense_Mutation_p.K122N|B3GALT5_ENST00000380618.1_Missense_Mutation_p.K122N|AF064860.5_ENST00000416555.1_RNA|B3GALT5_ENST00000343118.4_Missense_Mutation_p.K122N			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5	122					protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				TTATCCAGAAGGATTTCCTAG	0.522																																							uc002yyb.1		NA																	0				skin(1)	1						c.(364-366)AAG>AAT		UDP-Gal:betaGlcNAc beta							93.0	95.0	94.0					21																	41032852		2203	4300	6503	SO:0001583	missense	10317				protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity	g.chr21:41032852G>T	AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.366G>T	21.37:g.41032852G>T	ENSP00000369994:p.Lys122Asn		Somatic				B3GALT5_uc002yye.2_Missense_Mutation_p.K122N|B3GALT5_uc002yyi.1_Missense_Mutation_p.K122N|B3GALT5_uc002yyj.1_Missense_Mutation_p.K122N|B3GALT5_uc002yyk.1_Missense_Mutation_p.K122N|B3GALT5_uc002yyl.1_Missense_Mutation_p.K122N|B3GALT5_uc002yym.1_Missense_Mutation_p.K122N	p.K122N	NM_033173	NP_149363	WXS	Illumina HiSeq	Unspecified	Q9Y2C3	B3GT5_HUMAN			5	958	+		Prostate(19;2.55e-06)	122			Lumenal (Potential).		A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Missense_Mutation	SNP	ENST00000380620.4	37	c.366G>T	CCDS13667.1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047150	0.55110	.	.	ENSG00000183778	ENST00000380620;ENST00000380618;ENST00000343118;ENST00000398714	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.72	3.6	0.41247	.	0.078972	0.52532	D	0.000074	T	0.59459	0.2195	M	0.72479	2.2	0.41841	D	0.990125	D	0.89917	1.0	D	0.79784	0.993	T	0.60490	-0.7253	10	0.42905	T	0.14	.	10.7787	0.46365	0.2243:0.0:0.7757:0.0	.	122	Q9Y2C3	B3GT5_HUMAN	N	122	ENSP00000369994:K122N;ENSP00000369992:K122N;ENSP00000343318:K122N;ENSP00000381699:K122N	ENSP00000343318:K122N	K	+	3	2	B3GALT5	39954722	1.000000	0.71417	1.000000	0.80357	0.266000	0.26442	5.568000	0.67385	1.430000	0.47334	0.655000	0.94253	AAG		0.522	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195008.2	NM_033170		18	61	1	0	6.49762e-13	0.006122	9.8271e-13	18	61				
COL18A1	80781	broad.mit.edu	37	21	46896376	46896376	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:46896376A>T	ENST00000359759.4	+	5	2176	c.2155A>T	c.(2155-2157)Acg>Tcg	p.T719S	COL18A1_ENST00000400337.2_Missense_Mutation_p.T304S|COL18A1_ENST00000355480.5_Missense_Mutation_p.T484S			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	719	Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GGAGCAGACCACGGTGGCTTC	0.572																																							uc011afs.1		NA																	0				central_nervous_system(1)	1						c.(2155-2157)ACG>TCG		alpha 1 type XVIII collagen isoform 3 precursor							96.0	99.0	98.0					21																	46896376		2127	4250	6377	SO:0001583	missense	80781				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding	g.chr21:46896376A>T		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2155A>T	21.37:g.46896376A>T	ENSP00000352798:p.Thr719Ser		Somatic				COL18A1_uc002zhg.2_Missense_Mutation_p.T304S|COL18A1_uc002zhi.2_Missense_Mutation_p.T484S	p.T719S	NM_130444	NP_569711	WXS	Illumina HiSeq	Unspecified	P39060	COIA1_HUMAN		Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)	5	2176	+			719			Nonhelical region 1 (NC1).		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37	c.2155A>T		.	.	.	.	.	.	.	.	.	.	A	8.609	0.888583	0.17540	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	D;D;D	0.90261	-2.61;-2.64;-2.52	3.89	-0.134	0.13481	.	503.918000	0.00357	N	0.000023	D	0.82412	0.5031	N	0.16708	0.43	0.09310	N	1	B;B;B	0.28291	0.131;0.206;0.206	B;B;B	0.28139	0.039;0.086;0.086	T	0.70303	-0.4909	10	0.21540	T	0.41	.	6.5228	0.22285	0.6552:0.0:0.3448:0.0	.	719;484;304	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	S	304;304;484;719;719	ENSP00000383191:T304S;ENSP00000347665:T484S;ENSP00000352798:T719S	ENSP00000347665:T484S	T	+	1	0	COL18A1	45720804	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.651000	0.24873	-0.115000	0.11915	0.326000	0.21444	ACG		0.572	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1			8	10	0	0	0	0.00308	0	8	10				
COL18A1	80781	broad.mit.edu	37	21	46901927	46901927	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:46901927G>A	ENST00000359759.4	+	13	2928	c.2907G>A	c.(2905-2907)caG>caA	p.Q969Q	COL18A1_ENST00000400337.2_Silent_p.Q554Q|COL18A1_ENST00000355480.5_Silent_p.Q734Q			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	969	Triple-helical region 3 (COL3).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GGACTGGGCAGAAAGGCAGCC	0.647																																							uc011afs.1		NA																	0				central_nervous_system(1)	1						c.(2905-2907)CAG>CAA		alpha 1 type XVIII collagen isoform 3 precursor							36.0	42.0	40.0					21																	46901927		1883	4108	5991	SO:0001819	synonymous_variant	80781				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding	g.chr21:46901927G>A		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2907G>A	21.37:g.46901927G>A			Somatic				COL18A1_uc002zhg.2_Silent_p.Q554Q|COL18A1_uc002zhi.2_Silent_p.Q734Q	p.Q969Q	NM_130444	NP_569711	WXS	Illumina HiSeq	Unspecified	P39060	COIA1_HUMAN		Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)	13	2928	+			969			Triple-helical region 3 (COL3).		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	ENST00000359759.4	37	c.2907G>A																																																																																					0.647	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1			7	33	0	0	0	0.004482	0	7	33				
COL18A1	80781	broad.mit.edu	37	21	46930146	46930146	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:46930146C>A	ENST00000359759.4	+	39	4930	c.4909C>A	c.(4909-4911)Cgc>Agc	p.R1637S	COL18A1_ENST00000400337.2_Missense_Mutation_p.R1222S|COL18A1_ENST00000355480.5_Missense_Mutation_p.R1402S|SLC19A1_ENST00000567670.1_Intron|SLC19A1_ENST00000468508.1_5'Flank			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1637	Nonhelical region 11 (NC11).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCGTGCCGACCGCGCAGCCGT	0.711																																							uc011afs.1		NA																	0				central_nervous_system(1)	1						c.(4900-4902)CGC>AGC		alpha 1 type XVIII collagen isoform 3 precursor							9.0	11.0	10.0					21																	46930146		2041	4158	6199	SO:0001583	missense	80781				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding	g.chr21:46930146C>A		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4909C>A	21.37:g.46930146C>A	ENSP00000352798:p.Arg1637Ser		Somatic				COL18A1_uc002zhg.2_Missense_Mutation_p.R1219S|COL18A1_uc002zhi.2_Missense_Mutation_p.R1399S|SLC19A1_uc010gpy.1_Intron|COL18A1_uc002zhj.2_Missense_Mutation_p.R200S|COL18A1_uc002zhk.2_Missense_Mutation_p.R44S	p.R1634S	NM_130444	NP_569711	WXS	Illumina HiSeq	Unspecified	P39060	COIA1_HUMAN		Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)	40	4921	+			1637			Nonhelical region 11 (NC11).		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37	c.4900C>A		.	.	.	.	.	.	.	.	.	.	C	16.07	3.017424	0.54576	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	4.7	4.7	0.59300	Collagenase NC10/endostatin (1);C-type lectin fold (1);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.75583	0.3869	M	0.84585	2.705	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.80819	-0.1212	10	0.87932	D	0	.	16.5635	0.84573	0.0:1.0:0.0:0.0	.	1637;1219;1402;1222	P39060;D3DSM4;P39060-1;P39060-2	COIA1_HUMAN;.;.;.	S	1222;1222;1402;1637;1637;570	ENSP00000383191:R1222S;ENSP00000347665:R1402S;ENSP00000352798:R1637S;ENSP00000339118:R570S	ENSP00000339118:R570S	R	+	1	0	COL18A1	45754574	0.998000	0.40836	0.988000	0.46212	0.138000	0.21146	0.606000	0.24194	2.317000	0.78254	0.655000	0.94253	CGC		0.711	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1			5	6	1	0	5.9392e-07	0.001168	7.56514e-07	5	6				
COL6A1	1291	broad.mit.edu	37	21	47422543	47422543	+	Missense_Mutation	SNP	G	G	T	rs370546340		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:47422543G>T	ENST00000361866.3	+	33	2467	c.2353G>T	c.(2353-2355)Ggc>Tgc	p.G785C	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	785	C-terminal globular domain.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		GGGCCGGCCCGGCCTCTCGCT	0.597																																							uc002zhu.1		NA																	0				ovary(1)	1						c.(2353-2355)GGC>TGC		collagen, type VI, alpha 1 precursor	Palifermin(DB00039)						89.0	84.0	86.0					21																	47422543		2203	4300	6503	SO:0001583	missense	1291				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding	g.chr21:47422543G>T	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2353G>T	21.37:g.47422543G>T	ENSP00000355180:p.Gly785Cys		Somatic				COL6A1_uc010gqd.1_Missense_Mutation_p.G116C|COL6A1_uc002zhv.1_Missense_Mutation_p.G116C|COL6A1_uc002zhw.1_5'UTR	p.G785C	NM_001848	NP_001839	WXS	Illumina HiSeq	Unspecified	P12109	CO6A1_HUMAN		Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	33	2455	+	all_hematologic(128;0.24)		785			VWFA 2.|C-terminal globular domain.		O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	37	c.2353G>T	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.054843	0.36277	.	.	ENSG00000142156	ENST00000361866	D	0.90620	-2.7	4.94	3.03	0.35002	von Willebrand factor, type A (2);	0.063435	0.64402	D	0.000006	D	0.87653	0.6231	M	0.64997	1.995	0.80722	D	1	P	0.43633	0.813	B	0.43331	0.416	D	0.83940	0.0311	10	0.66056	D	0.02	-23.2541	4.284	0.10846	0.2022:0.0:0.6195:0.1783	.	785	P12109	CO6A1_HUMAN	C	785	ENSP00000355180:G785C	ENSP00000355180:G785C	G	+	1	0	COL6A1	46246971	1.000000	0.71417	0.105000	0.21289	0.029000	0.11900	4.487000	0.60293	0.449000	0.26747	0.455000	0.32223	GGC		0.597	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848		28	76	1	0	6.53348e-20	0.003755	1.11102e-19	28	76				
COL6A2	1292	broad.mit.edu	37	21	47545884	47545884	+	Silent	SNP	C	C	A	rs544785178		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr21:47545884C>A	ENST00000300527.4	+	26	2259	c.2155C>A	c.(2155-2157)Cgg>Agg	p.R719R	COL6A2_ENST00000409416.1_Silent_p.R719R|COL6A2_ENST00000357838.4_Silent_p.R719R|COL6A2_ENST00000397763.1_Silent_p.R719R|COL6A2_ENST00000310645.5_Silent_p.R719R	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	719	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CAAGGAGAGCCGGCGCCAGAA	0.637																																							uc002zia.1		NA																	0				central_nervous_system(7)|ovary(1)	8						c.(2155-2157)CGG>AGG		alpha 2 type VI collagen isoform 2C2 precursor							66.0	66.0	66.0					21																	47545884		2203	4300	6503	SO:0001819	synonymous_variant	1292				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	g.chr21:47545884C>A	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2155C>A	21.37:g.47545884C>A			Somatic				COL6A2_uc002zhy.1_Silent_p.R719R|COL6A2_uc002zhz.1_Silent_p.R719R|COL6A2_uc002zib.1_Silent_p.R125R|COL6A2_uc002zic.1_5'Flank	p.R719R	NM_001849	NP_001840	WXS	Illumina HiSeq	Unspecified	P12110	CO6A2_HUMAN		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	26	2237	+	Breast(49;0.245)		719			VWFA 2.|Nonhelical region.		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	ENST00000300527.4	37	c.2155C>A	CCDS13728.1																																																																																				0.637	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			14	52	1	0	4.36969e-10	0.001855	6.24242e-10	14	52				
CECR1	51816	broad.mit.edu	37	22	17684454	17684454	+	Splice_Site	SNP	G	G	C	rs148936893		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:17684454G>C	ENST00000399839.1	-	4	1022	c.752C>G	c.(751-753)cCg>cGg	p.P251R	CECR1_ENST00000262607.3_Splice_Site_p.P251R|CECR1_ENST00000399837.2_Splice_Site_p.P251R|CECR1_ENST00000449907.2_Splice_Site_p.P209R	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	251			P -> L (in PAN). {ECO:0000269|PubMed:24552285}.		adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				TGGGCTCACCGGCAGCAGCCT	0.532																																							uc002zmk.1		NA																	0				ovary(1)	1						c.(751-753)CCG>CGG		cat eye syndrome critical region protein 1							69.0	59.0	62.0					22																	17684454		2203	4300	6503	SO:0001630	splice_region_variant	51816				adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding	g.chr22:17684454G>C	AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.753+1C>G	22.37:g.17684454G>C			Somatic				CECR1_uc010gqu.1_Missense_Mutation_p.P251R|CECR1_uc011agi.1_Missense_Mutation_p.P209R|CECR1_uc011agj.1_Missense_Mutation_p.P209R	p.P251R	NM_017424	NP_059120	WXS	Illumina HiSeq	Unspecified	Q9NZK5	CECR1_HUMAN			3	964	-		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)	251					A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Missense_Mutation	SNP	ENST00000399839.1	37	c.752C>G	CCDS13742.1	.	.	.	.	.	.	.	.	.	.	G	10.47	1.360346	0.24598	.	.	ENSG00000093072	ENST00000399839;ENST00000262607;ENST00000449907;ENST00000399837	D;D;D;D	0.95069	-3.6;-3.6;-3.6;-3.6	3.74	1.58	0.23477	Adenosine/AMP deaminase (1);	0.333509	0.31450	N	0.007635	D	0.89431	0.6713	L	0.56199	1.76	0.26682	N	0.971513	P	0.41313	0.745	B	0.36335	0.222	T	0.81163	-0.1058	10	0.35671	T	0.21	.	6.0479	0.19770	0.1012:0.0:0.7135:0.1853	.	251	Q9NZK5	CECR1_HUMAN	R	251;251;209;251	ENSP00000382733:P251R;ENSP00000262607:P251R;ENSP00000406443:P209R;ENSP00000382731:P251R	ENSP00000262607:P251R	P	-	2	0	CECR1	16064454	1.000000	0.71417	0.124000	0.21820	0.041000	0.13682	1.753000	0.38359	0.100000	0.17581	0.655000	0.94253	CCG		0.532	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1		Missense_Mutation	8	28	0	0	0	0.00308	0	8	28				
MICAL3	57553	broad.mit.edu	37	22	18301796	18301796	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:18301796C>A	ENST00000441493.2	-	26	3983	c.3631G>T	c.(3631-3633)Gat>Tat	p.D1211Y		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1211	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GAGGGGGCATCAGCTTTGGGC	0.622																																							uc002zng.3		NA																	0					0						c.(3631-3633)GAT>TAT		microtubule associated monoxygenase, calponin							19.0	22.0	21.0					22																	18301796		1954	4128	6082	SO:0001583	missense	57553					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr22:18301796C>A	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3631G>T	22.37:g.18301796C>A	ENSP00000416015:p.Asp1211Tyr		Somatic				MICAL3_uc011agl.1_Missense_Mutation_p.D1127Y	p.D1211Y	NM_015241	NP_056056	WXS	Illumina HiSeq	Unspecified	Q7RTP6	MICA3_HUMAN		Lung(27;0.0427)	26	3984	-		all_epithelial(15;0.198)	1211			Pro-rich.		B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	c.3631G>T	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	C	5.188	0.220172	0.09863	.	.	ENSG00000093100	ENST00000441493	T	0.63580	-0.05	4.73	1.45	0.22620	.	.	.	.	.	T	0.44222	0.1283	L	0.29908	0.895	0.09310	N	0.999999	B	0.29805	0.257	B	0.23716	0.048	T	0.33548	-0.9864	9	0.62326	D	0.03	.	4.9086	0.13811	0.0:0.5405:0.1454:0.3141	.	1211	Q7RTP6	MICA3_HUMAN	Y	1211	ENSP00000416015:D1211Y	ENSP00000416015:D1211Y	D	-	1	0	XXbac-B461K10.4	16681796	0.287000	0.24315	0.000000	0.03702	0.017000	0.09413	1.260000	0.32968	0.096000	0.17463	-0.253000	0.11424	GAT		0.622	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			7	24	1	0	1.06961e-07	0.00308	1.40518e-07	7	24				
MICAL3	57553	broad.mit.edu	37	22	18384718	18384718	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:18384718G>A	ENST00000441493.2	-	5	969	c.617C>T	c.(616-618)cCc>cTc	p.P206L	MICAL3_ENST00000585038.1_Missense_Mutation_p.P206L|MICAL3_ENST00000429452.1_Missense_Mutation_p.P206L|MICAL3_ENST00000207726.7_Missense_Mutation_p.P206L|MICAL3_ENST00000400561.2_Missense_Mutation_p.P206L|MICAL3_ENST00000383094.3_Missense_Mutation_p.P206L|MICAL3_ENST00000444520.1_Missense_Mutation_p.P206L|MICAL3_ENST00000414725.2_Missense_Mutation_p.P206L	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	206	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		ATGAGTCTTGGGGTGCACCAG	0.532																																							uc002zng.3		NA																	0					0						c.(616-618)CCC>CTC		microtubule associated monoxygenase, calponin							66.0	58.0	60.0					22																	18384718		1568	3582	5150	SO:0001583	missense	57553					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr22:18384718G>A	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.617C>T	22.37:g.18384718G>A	ENSP00000416015:p.Pro206Leu		Somatic				MICAL3_uc011agl.1_Missense_Mutation_p.P206L|MICAL3_uc002znh.2_Missense_Mutation_p.P206L|MICAL3_uc002znj.1_5'UTR|MICAL3_uc002znk.1_Missense_Mutation_p.P206L|MICAL3_uc002znl.1_5'UTR|MICAL3_uc010grf.2_Missense_Mutation_p.P206L|MICAL3_uc011agm.1_Missense_Mutation_p.P206L	p.P206L	NM_015241	NP_056056	WXS	Illumina HiSeq	Unspecified	Q7RTP6	MICA3_HUMAN		Lung(27;0.0427)	5	970	-		all_epithelial(15;0.198)	206					B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	c.617C>T	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	G	35	5.454197	0.96223	.	.	ENSG00000093100;ENSG00000093100;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156	ENST00000441493;ENST00000429452;ENST00000400561;ENST00000444520;ENST00000414725;ENST00000383094;ENST00000207726	T;T;T;T;T;T;T	0.07567	3.18;3.18;3.18;3.18;3.18;3.18;3.18	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.42040	0.1185	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.959;0.998;0.999;0.996;0.998	T	0.51340	-0.8718	10	0.87932	D	0	.	20.1577	0.98120	0.0:0.0:1.0:0.0	.	206;206;206;206;206	B4DJ91;B2RXJ5;Q7RTP6-2;Q7RTP6-4;Q7RTP6	.;.;.;.;MICA3_HUMAN	L	206	ENSP00000416015:P206L;ENSP00000414846:P206L;ENSP00000383406:P206L;ENSP00000410315:P206L;ENSP00000391827:P206L;ENSP00000372574:P206L;ENSP00000207726:P206L	ENSP00000207726:P206L	P	-	2	0	XXbac-B461K10.4;MICAL3	16764718	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.840000	0.99478	2.767000	0.95098	0.655000	0.94253	CCC		0.532	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			5	30	0	0	0	0.001168	0	5	30				
DGCR2	9993	broad.mit.edu	37	22	19044598	19044598	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:19044598G>A	ENST00000263196.7	-	6	950	c.703C>T	c.(703-705)Cag>Tag	p.Q235*	DGCR2_ENST00000473832.1_5'UTR|DGCR2_ENST00000537045.1_Nonsense_Mutation_p.Q194*|DGCR2_ENST00000545799.1_3'UTR	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	235	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					CACTGAAGCTGGGCACAGAAC	0.567																																							uc002zoq.1		NA																	0				large_intestine(1)	1						c.(703-705)CAG>TAG		integral membrane protein DGCR2 precursor							98.0	73.0	81.0					22																	19044598		2203	4300	6503	SO:0001587	stop_gained	9993				cell adhesion|organ morphogenesis	integral to membrane	receptor activity|sugar binding	g.chr22:19044598G>A	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.703C>T	22.37:g.19044598G>A	ENSP00000263196:p.Gln235*		Somatic				DGCR2_uc002zor.1_Nonsense_Mutation_p.Q11*|DGCR2_uc011agr.1_Nonsense_Mutation_p.Q191*	p.Q235*	NM_005137	NP_005128	WXS	Illumina HiSeq	Unspecified	P98153	IDD_HUMAN			6	951	-	Colorectal(54;0.0993)		235			Extracellular (Potential).|C-type lectin.		A6NIB5|A8K6K5|B5TY34|B7Z935	Nonsense_Mutation	SNP	ENST00000263196.7	37	c.703C>T	CCDS33598.1	.	.	.	.	.	.	.	.	.	.	G	40	8.246480	0.98724	.	.	ENSG00000070413	ENST00000537045;ENST00000263196;ENST00000447928	.	.	.	5.56	4.52	0.55395	.	0.049944	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	15.2913	0.73868	0.0:0.0:0.8587:0.1413	.	.	.	.	X	194;235;235	.	ENSP00000263196:Q235X	Q	-	1	0	DGCR2	17424598	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.574000	0.98184	1.302000	0.44855	0.655000	0.94253	CAG		0.567	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316504.1	NM_005137		5	11	0	0	0	0.000602	0	5	11				
ZNF280A	129025	broad.mit.edu	37	22	22868938	22868938	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:22868938G>T	ENST00000302097.3	-	2	1269	c.1017C>A	c.(1015-1017)tgC>tgA	p.C339*		NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		ACTGCCGGTGGCAGTGCTGGC	0.458																																							uc002zwe.2		NA																	0				ovary(1)	1						c.(1015-1017)TGC>TGA		zinc finger protein 280A							138.0	125.0	130.0					22																	22868938		2203	4300	6503	SO:0001587	stop_gained	129025				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr22:22868938G>T	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.1017C>A	22.37:g.22868938G>T	ENSP00000302855:p.Cys339*		Somatic				LOC96610_uc011aim.1_Intron	p.C339*	NM_080740	NP_542778	WXS	Illumina HiSeq	Unspecified	P59817	Z280A_HUMAN		READ - Rectum adenocarcinoma(21;0.145)	2	1270	-	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)	339			C2H2-type 1.			Nonsense_Mutation	SNP	ENST00000302097.3	37	c.1017C>A	CCDS13800.1	.	.	.	.	.	.	.	.	.	.	G	38	6.923983	0.97940	.	.	ENSG00000169548	ENST00000302097	.	.	.	3.9	1.81	0.25067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.336	8.2329	0.31608	0.203:0.0:0.797:0.0	.	.	.	.	X	339	.	ENSP00000302855:C339X	C	-	3	2	ZNF280A	21198938	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	1.281000	0.33214	0.607000	0.29982	0.655000	0.94253	TGC		0.458	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075433.3	NM_080740		32	92	1	0	3.93418e-24	0.004289	6.93658e-24	32	92				
TFIP11	24144	broad.mit.edu	37	22	26895444	26895444	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:26895444C>T	ENST00000407690.1	-	9	1238	c.955G>A	c.(955-957)Gag>Aag	p.E319K	TFIP11_ENST00000407148.1_Missense_Mutation_p.E319K|TFIP11_ENST00000496523.1_5'Flank|TFIP11_ENST00000407431.1_Missense_Mutation_p.E319K|TFIP11_ENST00000405938.1_Missense_Mutation_p.E319K	NM_012143.2	NP_036275.1	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	319					biomineral tissue development (GO:0031214)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|spliceosomal complex disassembly (GO:0000390)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	DNA binding (GO:0003677)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25						TGCTCCAGCTCGGGCAGCGCG	0.612																																							uc003acr.2		NA																	0					0						c.(955-957)GAG>AAG		tuftelin interacting protein 11							85.0	78.0	81.0					22																	26895444		2203	4300	6503	SO:0001583	missense	24144				biomineral tissue development	catalytic step 2 spliceosome|cytoplasm|nuclear speck	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr22:26895444C>T	AL050258	CCDS13838.1	22q12.1	2013-01-28			ENSG00000100109	ENSG00000100109		"""G patch domain containing"""	17165	protein-coding gene	gene with protein product		612747				10806191, 11230166	Standard	NM_012143		Approved	TIP39, DKFZP434B194, Spp382	uc003acs.2	Q9UBB9	OTTHUMG00000150883	ENST00000407690.1:c.955G>A	22.37:g.26895444C>T	ENSP00000384421:p.Glu319Lys		Somatic				TFIP11_uc003acs.2_Missense_Mutation_p.E319K|TFIP11_uc003act.2_Missense_Mutation_p.E319K	p.E319K	NM_012143	NP_036275	WXS	Illumina HiSeq	Unspecified	Q9UBB9	TFP11_HUMAN			8	1329	-			319					O95908|Q20WL0|Q5H8V8|Q9UGV7|Q9Y2Q8	Missense_Mutation	SNP	ENST00000407690.1	37	c.955G>A	CCDS13838.1	.	.	.	.	.	.	.	.	.	.	C	33	5.283067	0.95489	.	.	ENSG00000100109	ENST00000407690;ENST00000407431;ENST00000407148;ENST00000405938	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.77075	0.4077	M	0.79258	2.445	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.79699	-0.1694	10	0.72032	D	0.01	-50.687	18.2804	0.90096	0.0:1.0:0.0:0.0	.	319	Q9UBB9	TFP11_HUMAN	K	319	ENSP00000384421:E319K;ENSP00000383892:E319K;ENSP00000385861:E319K;ENSP00000384297:E319K	ENSP00000384297:E319K	E	-	1	0	TFIP11	25225444	1.000000	0.71417	0.963000	0.40424	0.621000	0.37620	7.526000	0.81920	2.541000	0.85698	0.655000	0.94253	GAG		0.612	TFIP11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320750.1	NM_001008697		16	90	0	0	0	0.004007	0	16	90				
SLC5A1	6523	broad.mit.edu	37	22	32482216	32482216	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:32482216C>T	ENST00000266088.4	+	10	1281	c.1031C>T	c.(1030-1032)gCc>gTc	p.A344V	SLC5A1_ENST00000543737.1_Missense_Mutation_p.A217V	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	344					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	GAAAAAATTGCCTGTGTCGTC	0.448																																							uc003amc.2		NA																	0				skin(1)	1						c.(1030-1032)GCC>GTC		solute carrier family 5 (sodium/glucose							175.0	156.0	162.0					22																	32482216		2203	4300	6503	SO:0001583	missense	6523				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding	g.chr22:32482216C>T		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.1031C>T	22.37:g.32482216C>T	ENSP00000266088:p.Ala344Val		Somatic				SLC5A1_uc011alz.1_Missense_Mutation_p.A217V	p.A344V	NM_000343	NP_000334	WXS	Illumina HiSeq	Unspecified	P13866	SC5A1_HUMAN			10	1263	+			344			Extracellular (Potential).		B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	ENST00000266088.4	37	c.1031C>T	CCDS13902.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088823	0.76756	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	D;D	0.88586	-2.4;-2.4	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.95560	0.8557	M	0.92219	3.285	0.80722	D	1	P	0.52170	0.951	P	0.62014	0.897	D	0.96304	0.9223	10	0.87932	D	0	.	18.3634	0.90383	0.0:1.0:0.0:0.0	.	344	P13866	SC5A1_HUMAN	V	344;217	ENSP00000266088:A344V;ENSP00000444898:A217V	ENSP00000266088:A344V	A	+	2	0	SLC5A1	30812216	1.000000	0.71417	1.000000	0.80357	0.520000	0.34377	3.876000	0.56115	2.656000	0.90262	0.585000	0.79938	GCC		0.448	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075656.3	NM_000343		28	105	0	0	0	0.004289	0	28	105				
MYH9	4627	broad.mit.edu	37	22	36689452	36689452	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:36689452A>T	ENST00000216181.5	-	30	4248	c.4018T>A	c.(4018-4020)Tcc>Acc	p.S1340T		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1340					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TCCCGGAAGGAATTCTTCTCG	0.637			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														uc003apg.2		NA		Dom	yes		22	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome	L	ALK		ALCL		0				breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						c.(4018-4020)TCC>ACC		myosin, heavy polypeptide 9, non-muscle							90.0	84.0	86.0					22																	36689452		2203	4300	6503	SO:0001583	missense	4627	Hereditary_Macrothrombocytopenia_MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	g.chr22:36689452A>T		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4018T>A	22.37:g.36689452A>T	ENSP00000216181:p.Ser1340Thr		Somatic					p.S1340T	NM_002473	NP_002464	WXS	Illumina HiSeq	Unspecified	P35579	MYH9_HUMAN			30	4249	-			1340			Potential.		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	c.4018T>A	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	A	12.18	1.861915	0.32884	.	.	ENSG00000100345	ENST00000216181	T	0.78595	-1.19	5.0	3.9	0.45041	Myosin tail (1);	0.564945	0.18535	N	0.138363	T	0.68476	0.3005	L	0.50333	1.59	0.80722	D	1	B	0.02656	0.0	B	0.10450	0.005	T	0.66337	-0.5949	10	0.44086	T	0.13	.	5.8475	0.18673	0.5544:0.2379:0.0:0.2076	.	1340	P35579	MYH9_HUMAN	T	1340	ENSP00000216181:S1340T	ENSP00000216181:S1340T	S	-	1	0	MYH9	35019398	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	0.893000	0.28336	2.006000	0.58801	0.402000	0.26972	TCC		0.637	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		28	65	0	0	0	0.008361	0	28	65				
CSF2RB	1439	broad.mit.edu	37	22	37325452	37325452	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:37325452C>G	ENST00000403662.3	+	5	622	c.400C>G	c.(400-402)Cct>Gct	p.P134A	CSF2RB_ENST00000262825.5_Missense_Mutation_p.P134A|CSF2RB_ENST00000536485.1_Missense_Mutation_p.P75A|CSF2RB_ENST00000406230.1_Missense_Mutation_p.P134A			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	134	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	AGTCCAGCCTCCTGAGCCCAG	0.652																																							uc003aqa.3		NA																	0				skin(2)|pancreas(1)	3						c.(400-402)CCT>GCT		colony stimulating factor 2 receptor, beta	Sargramostim(DB00020)						101.0	100.0	101.0					22																	37325452		2203	4300	6503	SO:0001583	missense	1439				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity	g.chr22:37325452C>G	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.400C>G	22.37:g.37325452C>G	ENSP00000384053:p.Pro134Ala		Somatic				CSF2RB_uc003aqc.3_Missense_Mutation_p.P134A	p.P134A	NM_000395	NP_000386	WXS	Illumina HiSeq	Unspecified	P32927	IL3RB_HUMAN			5	617	+			134			Fibronectin type-III 1.|Extracellular (Potential).		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	c.400C>G	CCDS13936.1	.	.	.	.	.	.	.	.	.	.	C	12.37	1.917811	0.33815	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000421539;ENST00000536485	T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32	5.22	4.21	0.49690	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.161766	0.30118	N	0.010364	T	0.74658	0.3745	M	0.74881	2.28	0.20638	N	0.999875	D;D	0.89917	0.997;1.0	P;D	0.63957	0.777;0.92	T	0.63932	-0.6525	10	0.16420	T	0.52	-23.8095	8.3889	0.32516	0.0:0.8205:0.0:0.1795	.	134;134	P32927-2;P32927	.;IL3RB_HUMAN	A	134;134;134;134;54;75	ENSP00000384053:P134A;ENSP00000262825:P134A;ENSP00000385271:P134A;ENSP00000393585:P54A;ENSP00000440003:P75A	ENSP00000262825:P134A	P	+	1	0	CSF2RB	35655398	0.208000	0.23494	0.245000	0.24217	0.085000	0.17905	1.932000	0.40143	1.322000	0.45245	0.655000	0.94253	CCT		0.652	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395		23	131	0	0	0	0.003954	0	23	131				
SH3BP1	23616	broad.mit.edu	37	22	38040682	38040682	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:38040682G>T	ENST00000357436.4	+	8	970	c.657G>T	c.(655-657)aaG>aaT	p.K219N	SH3BP1_ENST00000495174.1_3'UTR|SH3BP1_ENST00000599616.1_Missense_Mutation_p.K155N|Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000336738.5_Missense_Mutation_p.K219N|SH3BP1_ENST00000442465.2_Missense_Mutation_p.K219N	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	219	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					TTGTTACCAAGGAGGACTCCT	0.587																																							uc003ati.2		NA																	0				central_nervous_system(1)	1						c.(655-657)AAG>AAT		SH3-domain binding protein 1							230.0	217.0	221.0					22																	38040682		2203	4300	6503	SO:0001583	missense	23616				signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding	g.chr22:38040682G>T		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.657G>T	22.37:g.38040682G>T	ENSP00000350018:p.Lys219Asn		Somatic				SH3BP1_uc003atg.1_RNA|SH3BP1_uc011anl.1_Missense_Mutation_p.K219N|SH3BP1_uc003ath.1_Missense_Mutation_p.K219N|SH3BP1_uc003atj.1_Missense_Mutation_p.K155N|SH3BP1_uc003atk.1_Missense_Mutation_p.K133N|uc003atl.1_Intron	p.K219N	NM_018957	NP_061830	WXS	Illumina HiSeq	Unspecified	Q9Y3L3	3BP1_HUMAN			8	768	+	Melanoma(58;0.0574)		219			BAR.		Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	ENST00000357436.4	37	c.657G>T	CCDS13952.2	.	.	.	.	.	.	.	.	.	.	G	10.39	1.337437	0.24253	.	.	ENSG00000100092	ENST00000357436;ENST00000336738;ENST00000442465;ENST00000397014	T;T;T	0.63580	-0.05;-0.05;-0.05	5.01	1.77	0.24775	BAR (2);	0.213100	0.32093	N	0.006597	T	0.72366	0.3451	M	0.62723	1.935	0.53005	D	0.999962	D;P;D;P;P	0.89917	0.974;0.955;1.0;0.955;0.955	P;P;D;P;P	0.91635	0.805;0.677;0.999;0.677;0.677	T	0.72279	-0.4340	10	0.72032	D	0.01	.	9.2851	0.37753	0.314:0.0:0.686:0.0	.	219;133;155;219;133	F5GZA8;E7EUD3;Q6ZT62;Q9Y3L3;Q6ZTJ5	.;.;.;3BP1_HUMAN;.	N	219;219;219;133	ENSP00000350018:K219N;ENSP00000337213:K219N;ENSP00000395126:K219N	ENSP00000337213:K219N	K	+	3	2	SH3BP1	36370628	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	1.489000	0.35562	0.647000	0.30713	-0.229000	0.12294	AAG		0.587	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957		38	176	1	0	1.30091e-30	0.006999	2.3557e-30	38	176				
CACNA1I	8911	broad.mit.edu	37	22	40066944	40066944	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:40066944C>T	ENST00000402142.3	+	26	4524	c.4524C>T	c.(4522-4524)caC>caT	p.H1508H	CACNA1I_ENST00000400164.3_Silent_p.H1473H|CACNA1I_ENST00000336649.4_Silent_p.H1514H|CACNA1I_ENST00000407673.1_Silent_p.H1473H|CACNA1I_ENST00000404898.1_Silent_p.H1473H|CACNA1I_ENST00000401624.1_Silent_p.H1508H	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1508					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CCCTGGAGCACTACAATCAGC	0.602																																							uc003ayc.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(4522-4524)CAC>CAT		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)						97.0	100.0	99.0					22																	40066944		2154	4250	6404	SO:0001819	synonymous_variant	8911				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding	g.chr22:40066944C>T	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4524C>T	22.37:g.40066944C>T			Somatic				CACNA1I_uc003ayd.2_Silent_p.H1473H|CACNA1I_uc003aye.2_Silent_p.H1423H|CACNA1I_uc003ayf.2_Silent_p.H1388H	p.H1508H	NM_021096	NP_066919	WXS	Illumina HiSeq	Unspecified	Q9P0X4	CAC1I_HUMAN			26	4524	+	Melanoma(58;0.0749)		1508			Extracellular (Potential).|IV.		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	c.4524C>T	CCDS46710.1																																																																																				0.602	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406		15	69	0	0	0	0.004007	0	15	69				
FBLN1	2192	broad.mit.edu	37	22	45929726	45929726	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr22:45929726G>T	ENST00000327858.6	+	7	827	c.732G>T	c.(730-732)cgG>cgT	p.R244R	FBLN1_ENST00000348697.2_Silent_p.R244R|FBLN1_ENST00000402984.3_Silent_p.R282R|FBLN1_ENST00000340923.5_Silent_p.R244R|FBLN1_ENST00000262722.7_Silent_p.R244R|FBLN1_ENST00000442170.2_Silent_p.R244R	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	244	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GCTGCCAGCGGGACAGCAGCT	0.572																																							uc003bgj.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(730-732)CGG>CGT		fibulin 1 isoform D							121.0	124.0	123.0					22																	45929726		2203	4300	6503	SO:0001819	synonymous_variant	2192				interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding	g.chr22:45929726G>T		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.732G>T	22.37:g.45929726G>T			Somatic				FBLN1_uc003bgg.1_Silent_p.R244R|FBLN1_uc003bgh.2_Silent_p.R244R|FBLN1_uc010gzz.2_Silent_p.R282R|FBLN1_uc003bgi.1_Silent_p.R244R	p.R244R	NM_006486	NP_006477	WXS	Illumina HiSeq	Unspecified	P23142	FBLN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)	7	879	+		Ovarian(80;0.00965)|all_neural(38;0.0416)	244			EGF-like 2; calcium-binding (Potential).		B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Silent	SNP	ENST00000327858.6	37	c.732G>T	CCDS14067.1																																																																																				0.572	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486		40	136	1	0	1.06522e-23	0.003214	1.87322e-23	40	136				
CNTN4	152330	broad.mit.edu	37	3	2787225	2787225	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:2787225G>T	ENST00000397461.1	+	5	586	c.202G>T	c.(202-204)Gat>Tat	p.D68Y	CNTN4_ENST00000418658.1_Missense_Mutation_p.D68Y|CNTN4_ENST00000427331.1_Missense_Mutation_p.D68Y	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	68	Ig-like C2-type 1.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		AAATGGAACAGATGTTGACAC	0.348																																							uc003bpc.2		NA																	0				large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7						c.(202-204)GAT>TAT		contactin 4 isoform a precursor							163.0	150.0	154.0					3																	2787225		1842	4096	5938	SO:0001583	missense	152330				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding	g.chr3:2787225G>T	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.202G>T	3.37:g.2787225G>T	ENSP00000380602:p.Asp68Tyr		Somatic				CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Missense_Mutation_p.D68Y	p.D68Y	NM_175607	NP_783200	WXS	Illumina HiSeq	Unspecified	Q8IWV2	CNTN4_HUMAN		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)	5	423	+		Ovarian(110;0.156)	68			Ig-like C2-type 1.		B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	37	c.202G>T	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.561788	0.45590	.	.	ENSG00000144619	ENST00000422330;ENST00000418658;ENST00000397461;ENST00000434053;ENST00000427331	T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36	5.6	5.6	0.85130	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.261604	0.36134	N	0.002771	T	0.58680	0.2139	L	0.45137	1.4	0.80722	D	1	P;P	0.42123	0.617;0.771	B;B	0.43052	0.406;0.293	T	0.61618	-0.7026	10	0.52906	T	0.07	.	6.505	0.22190	0.1148:0.1814:0.7039:0.0	.	68;68	B3KTK4;Q8IWV2	.;CNTN4_HUMAN	Y	68;68;68;86;68	ENSP00000408594:D68Y;ENSP00000396010:D68Y;ENSP00000380602:D68Y;ENSP00000404085:D86Y;ENSP00000413642:D68Y	ENSP00000380602:D68Y	D	+	1	0	CNTN4	2762225	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.127000	0.50484	2.627000	0.88993	0.655000	0.94253	GAT		0.348	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2			13	66	1	0	0.000219431	0.00245	0.000256131	13	66				
SLC6A11	6538	broad.mit.edu	37	3	10980044	10980044	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:10980044G>C	ENST00000254488.2	+	14	1921	c.1855G>C	c.(1855-1857)Gac>Cac	p.D619H		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	619					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	ACTCAAGAGTGACGGGACCAT	0.552																																							uc003bvz.2		NA																	0				skin(3)|ovary(1)	4						c.(1855-1857)GAC>CAC		solute carrier family 6 (neurotransmitter							131.0	118.0	123.0					3																	10980044		2203	4300	6503	SO:0001583	missense	6538				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr3:10980044G>C	S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1855G>C	3.37:g.10980044G>C	ENSP00000254488:p.Asp619His		Somatic					p.D619H	NM_014229	NP_055044	WXS	Illumina HiSeq	Unspecified	P48066	S6A11_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.229)	14	1889	+			619			Cytoplasmic (Potential).		B2R6U6|Q8IYC9	Missense_Mutation	SNP	ENST00000254488.2	37	c.1855G>C	CCDS2602.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.770022	0.49680	.	.	ENSG00000132164	ENST00000254488	T	0.76448	-1.02	4.68	4.68	0.58851	.	0.146450	0.43919	D	0.000519	T	0.67515	0.2901	N	0.24115	0.695	0.80722	D	1	B	0.19583	0.037	B	0.14023	0.01	T	0.64162	-0.6472	10	0.42905	T	0.14	.	17.6233	0.88088	0.0:0.0:1.0:0.0	.	619	P48066	S6A11_HUMAN	H	619	ENSP00000254488:D619H	ENSP00000254488:D619H	D	+	1	0	SLC6A11	10955044	1.000000	0.71417	0.994000	0.49952	0.537000	0.34900	9.161000	0.94739	2.167000	0.68274	0.563000	0.77884	GAC		0.552	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229		4	89	0	0	0	0.000602	0	4	89				
XPC	7508	broad.mit.edu	37	3	14220052	14220052	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:14220052G>A	ENST00000285021.7	-	1	231	c.17C>T	c.(16-18)gCg>gTg	p.A6V	LSM3_ENST00000306024.3_5'UTR|XPC_ENST00000449060.2_Missense_Mutation_p.A6V	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	6					DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CCCGCCGGCCGCGCGTTTCCG	0.701			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc011ave.1		NA	yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	Mis|N|F|S	"""xeroderma pigmentosum, complementation group C"""			E		skin basal cell|skin squamous cell|melanoma			0				ovary(2)|breast(1)	3						c.(16-18)GCG>GTG	NER	xeroderma pigmentosum, complementation group C																																				SO:0001583	missense	7508	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal	cytoplasm|nucleoplasm|XPC complex	bubble DNA binding|damaged DNA binding|loop DNA binding|protein binding|single-stranded DNA binding	g.chr3:14220052G>A		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.17C>T	3.37:g.14220052G>A	ENSP00000285021:p.Ala6Val		Somatic				XPC_uc011avf.1_5'UTR|XPC_uc011avg.1_Missense_Mutation_p.A6V|LSM3_uc003byn.2_5'Flank	p.A6V	NM_004628	NP_004619	WXS	Illumina HiSeq	Unspecified	Q01831	XPC_HUMAN			1	121	-			6					B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Missense_Mutation	SNP	ENST00000285021.7	37	c.17C>T	CCDS46763.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818354	0.90790	.	.	ENSG00000154767	ENST00000285021;ENST00000449060;ENST00000511155	T;T;T	0.74315	-0.83;-0.83;-0.83	5.19	2.32	0.28847	.	0.908557	0.09425	N	0.803835	T	0.58764	0.2145	L	0.27053	0.805	0.20638	N	0.99988	B;B	0.16166	0.016;0.016	B;B	0.09377	0.004;0.004	T	0.45249	-0.9274	10	0.34782	T	0.22	-2.7699	5.818	0.18512	0.169:0.3045:0.5265:0.0	.	6;6	E9PH69;Q01831	.;XPC_HUMAN	V	6	ENSP00000285021:A6V;ENSP00000404002:A6V;ENSP00000423867:A6V	ENSP00000285021:A6V	A	-	2	0	XPC	14195056	0.000000	0.05858	0.000000	0.03702	0.649000	0.38597	0.504000	0.22626	0.535000	0.28714	0.591000	0.81541	GCG		0.701	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340517.3	NM_004628		9	46	0	0	0	0.008291	0	9	46				
TGFBR2	7048	broad.mit.edu	37	3	30713590	30713590	+	Silent	SNP	C	C	T	rs146030104	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:30713590C>T	ENST00000295754.5	+	4	1297	c.915C>T	c.(913-915)ctC>ctT	p.L305L	TGFBR2_ENST00000359013.4_Silent_p.L330L	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	305	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						AGAACATACTCCAGTTCCTGA	0.517													C|||	2	0.000399361	0.0015	0.0	5008	,	,		23262	0.0		0.0	False		,,,				2504	0.0						uc003ceo.2		NA																	0				pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26						c.(913-915)CTC>CTT		transforming growth factor, beta receptor II		C	,	3,4403	6.2+/-15.9	0,3,2200	105.0	97.0	100.0		990,915	-2.6	1.0	3	dbSNP_134	100	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TGFBR2	NM_001024847.2,NM_003242.5	,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,	330/593,305/568	30713590	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	7048				activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding	g.chr3:30713590C>T		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.915C>T	3.37:g.30713590C>T			Somatic				TGFBR2_uc003cen.2_Silent_p.L330L	p.L305L	NM_003242	NP_003233	WXS	Illumina HiSeq	Unspecified	P37173	TGFR2_HUMAN			4	1297	+			305			Protein kinase.|Cytoplasmic (Potential).		B4DTV5|Q15580|Q6DKT6|Q99474	Silent	SNP	ENST00000295754.5	37	c.915C>T	CCDS2648.1																																																																																				0.517	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2			18	64	0	0	0	0.007413	0	18	64				
ITGA9	3680	broad.mit.edu	37	3	37536029	37536030	+	Nonsense_Mutation	DNP	CC	CC	TT			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:37536029_37536030CC>TT	ENST00000264741.5	+	5	838_839	c.582_583CC>TT	c.(580-585)tgCCag>tgTTag	p.Q195*	ITGA9_ENST00000422441.1_Nonsense_Mutation_p.Q195*	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	195					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		ACGGCTCCTGCCAGGCTGGGAT	0.52																																							uc003chd.2		NA																	0				breast(3)|pancreas(1)|lung(1)|skin(1)	6						c.(580-585)TGCCAG>TGTTAG		integrin, alpha 9 precursor																																				SO:0001587	stop_gained	3680				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr3:37536029_37536030CC>TT	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	Exception_encountered	3.37:g.37536029_37536030delinsTT	ENSP00000264741:p.Gln195*		Somatic				ITGA9_uc003chc.2_Nonsense_Mutation_p.Q195*	p.Q195*	NM_002207	NP_002198	WXS	Illumina HiSeq	Unspecified	Q13797	ITA9_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)	5	635_636	+			195			Extracellular (Potential).|FG-GAP 3.		Q14638	Nonsense_Mutation	DNP	ENST00000264741.5	37	c.582_583CC>TT	CCDS2669.1																																																																																				0.520	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207		12	27	0	0	0	0.004672	0	12	27				
SLC22A14	9389	broad.mit.edu	37	3	38347960	38347960	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:38347960G>T	ENST00000273173.4	+	1	534	c.443G>T	c.(442-444)gGc>gTc	p.G148V	RNU6-235P_ENST00000362644.1_RNA|SLC22A14_ENST00000448498.1_Missense_Mutation_p.G148V	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	148					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		ATCCAGTTTGGCCTCAATGAC	0.478																																							uc010hhc.1		NA																	0					0						c.(442-444)GGC>GTC		organic cation transporter like 4							141.0	125.0	131.0					3																	38347960		2203	4300	6503	SO:0001583	missense	9389					integral to plasma membrane	organic cation transmembrane transporter activity	g.chr3:38347960G>T	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.443G>T	3.37:g.38347960G>T	ENSP00000273173:p.Gly148Val		Somatic				SLC22A14_uc003cia.2_Missense_Mutation_p.G148V|SLC22A14_uc003cib.2_Missense_Mutation_p.G148V|SLC22A14_uc011ayo.1_RNA	p.G148V	NM_004803	NP_004794	WXS	Illumina HiSeq	Unspecified	Q9Y267	S22AE_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)	2	485	+			148			Extracellular (Potential).		A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	ENST00000273173.4	37	c.443G>T	CCDS2677.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308026	0.60305	.	.	ENSG00000144671	ENST00000466887;ENST00000448498;ENST00000423219;ENST00000273173	T;T;T	0.66995	-0.24;-0.06;-0.06	5.62	4.74	0.60224	Major facilitator superfamily domain (1);	0.098054	0.64402	D	0.000001	T	0.81351	0.4804	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80910	-0.1171	10	0.30078	T	0.28	.	13.3364	0.60520	0.0769:0.0:0.9231:0.0	.	148	Q9Y267	S22AE_HUMAN	V	16;148;148;148	ENSP00000442528:G16V;ENSP00000396283:G148V;ENSP00000273173:G148V	ENSP00000273173:G148V	G	+	2	0	SLC22A14	38322964	1.000000	0.71417	0.993000	0.49108	0.314000	0.28054	5.832000	0.69337	1.512000	0.48834	0.655000	0.94253	GGC		0.478	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253742.3	NM_004803		37	106	1	0	5.71845e-15	0.005524	9.03623e-15	37	106				
SCN5A	6331	broad.mit.edu	37	3	38598729	38598729	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:38598729G>A	ENST00000333535.4	-	24	4441	c.4292C>T	c.(4291-4293)tCc>tTc	p.S1431F	SCN5A_ENST00000449557.2_Missense_Mutation_p.S1377F|SCN5A_ENST00000425664.1_Intron|SCN5A_ENST00000450102.2_Missense_Mutation_p.S1377F|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000443581.1_Missense_Mutation_p.S1430F|SCN5A_ENST00000414099.2_Intron|SCN5A_ENST00000451551.2_Missense_Mutation_p.S1377F|SCN5A_ENST00000455624.2_Missense_Mutation_p.S1430F|SCN5A_ENST00000423572.2_Missense_Mutation_p.S1430F|SCN5A_ENST00000413689.1_Missense_Mutation_p.S1431F			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1431					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TACCCCCCTGGAGTCCACAGC	0.502																																							uc003cio.2		NA																	0				ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9						c.(4291-4293)TCC>TTC		voltage-gated sodium channel type V alpha	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)						62.0	68.0	66.0					3																	38598729		2201	4300	6501	SO:0001583	missense	6331				blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity	g.chr3:38598729G>A	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4292C>T	3.37:g.38598729G>A	ENSP00000328968:p.Ser1431Phe		Somatic				SCN5A_uc003cin.2_Missense_Mutation_p.S1430F|SCN5A_uc003cil.3_Missense_Mutation_p.S1431F|SCN5A_uc010hhi.2_Intron|SCN5A_uc010hhk.2_Missense_Mutation_p.S1430F|SCN5A_uc011ayr.1_Missense_Mutation_p.S1377F|SCN5A_uc010hhj.1_Intron	p.S1431F	NM_198056	NP_932173	WXS	Illumina HiSeq	Unspecified	Q14524	SCN5A_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	24	4486	-	Medulloblastoma(35;0.163)		1431					A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	c.4292C>T	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433299	0.83776	.	.	ENSG00000183873	ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D	0.97553	-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43	4.1	4.1	0.47936	Ion transport (1);	0.126562	0.56097	D	0.000031	D	0.99230	0.9732	H	0.99525	4.61	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.997	D;D;D;D;D	0.91635	0.996;0.998;0.999;0.997;0.948	D	0.98374	1.0555	10	0.87932	D	0	.	16.8913	0.86088	0.0:0.0:1.0:0.0	.	1377;1430;1431;1430;1431	E9PEF3;E9PHB6;Q14524;Q14524-2;E9PEK2	.;.;SCN5A_HUMAN;.;.	F	1430;1431;1377;1430;1431;1430;1377;1377	ENSP00000398266:S1430F;ENSP00000410257:S1431F;ENSP00000388797:S1377F;ENSP00000397915:S1430F;ENSP00000328968:S1431F;ENSP00000399524:S1430F;ENSP00000403355:S1377F;ENSP00000413996:S1377F	ENSP00000328968:S1431F	S	-	2	0	SCN5A	38573733	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.597000	0.98273	2.262000	0.75019	0.591000	0.81541	TCC		0.502	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056		5	55	0	0	0	0.004482	0	5	55				
SCN5A	6331	broad.mit.edu	37	3	38645303	38645303	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:38645303C>G	ENST00000333535.4	-	12	1939	c.1790G>C	c.(1789-1791)tGc>tCc	p.C597S	SCN5A_ENST00000449557.2_Missense_Mutation_p.C597S|SCN5A_ENST00000425664.1_Missense_Mutation_p.C597S|SCN5A_ENST00000450102.2_Missense_Mutation_p.C597S|SCN5A_ENST00000443581.1_Missense_Mutation_p.C597S|SCN5A_ENST00000414099.2_Missense_Mutation_p.C597S|SCN5A_ENST00000451551.2_Missense_Mutation_p.C597S|SCN5A_ENST00000455624.2_Missense_Mutation_p.C597S|SCN5A_ENST00000423572.2_Missense_Mutation_p.C597S|SCN5A_ENST00000413689.1_Missense_Mutation_p.C597S			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	597					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CACCCCATTGCAGTCCACAGT	0.667																																							uc003cio.2		NA																	0				ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9						c.(1789-1791)TGC>TCC		voltage-gated sodium channel type V alpha	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)						77.0	81.0	79.0					3																	38645303		1997	4183	6180	SO:0001583	missense	6331				blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity	g.chr3:38645303C>G	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1790G>C	3.37:g.38645303C>G	ENSP00000328968:p.Cys597Ser		Somatic				SCN5A_uc003cin.2_Missense_Mutation_p.C597S|SCN5A_uc003cil.3_Missense_Mutation_p.C597S|SCN5A_uc010hhi.2_Missense_Mutation_p.C597S|SCN5A_uc010hhk.2_Missense_Mutation_p.C597S|SCN5A_uc011ayr.1_Missense_Mutation_p.C597S|SCN5A_uc010hhj.1_Missense_Mutation_p.C208S	p.C597S	NM_198056	NP_932173	WXS	Illumina HiSeq	Unspecified	Q14524	SCN5A_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	12	1984	-	Medulloblastoma(35;0.163)		597					A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	c.1790G>C	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045268	0.75846	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	4.18	4.18	0.49190	Domain of unknown function DUF3451 (1);	0.311519	0.34133	N	0.004227	D	0.95294	0.8473	M	0.85859	2.78	0.58432	D	0.999996	D;D;D;D;D;D;P	0.89917	0.999;0.997;1.0;0.999;0.993;0.993;0.885	D;D;D;D;P;P;P	0.85130	0.997;0.994;0.996;0.997;0.824;0.718;0.465	D	0.94450	0.7666	10	0.29301	T	0.29	.	16.6938	0.85329	0.0:1.0:0.0:0.0	.	597;597;597;597;597;597;597	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	S	597	ENSP00000398962:C597S;ENSP00000398266:C597S;ENSP00000410257:C597S;ENSP00000388797:C597S;ENSP00000397915:C597S;ENSP00000416634:C597S;ENSP00000328968:C597S;ENSP00000399524:C597S;ENSP00000403355:C597S;ENSP00000413996:C597S	ENSP00000328968:C597S	C	-	2	0	SCN5A	38620307	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.894000	0.69806	2.164000	0.68074	0.561000	0.74099	TGC		0.667	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056		31	127	0	0	0	0.002096	0	31	127				
MYL3	4634	broad.mit.edu	37	3	46899892	46899892	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:46899892C>T	ENST00000395869.1	-	5	592	c.541G>A	c.(541-543)Ggc>Agc	p.G181S	MYL3_ENST00000292327.4_Missense_Mutation_p.G181S			P08590	MYL3_HUMAN	myosin, light chain 3, alkali; ventricular, skeletal, slow	181	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|skeletal muscle tissue development (GO:0007519)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|cytosol (GO:0005829)|I band (GO:0031674)|muscle myosin complex (GO:0005859)|sarcomere (GO:0030017)	actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|myosin II heavy chain binding (GO:0032038)|structural constituent of muscle (GO:0008307)			breast(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(193;0.00116)|KIRC - Kidney renal clear cell carcinoma(197;0.00557)|Kidney(197;0.0063)		TTGATGCAGCCATTGGAGTCC	0.607																																					Melanoma(166;130 1949 2249 18977 46142)	Melanoma(166;130 1949 2249 18977 46142)	uc003cql.1		NA																	0					0						c.(541-543)GGC>AGC		slow skeletal ventricular myosin alkali light							156.0	131.0	139.0					3																	46899892		2203	4300	6503	SO:0001583	missense	4634				cardiac muscle contraction|muscle filament sliding|positive regulation of ATPase activity|regulation of striated muscle contraction|regulation of the force of heart contraction|ventricular cardiac muscle tissue morphogenesis	A band|cytosol|I band|muscle myosin complex	actin monomer binding|calcium ion binding|myosin II heavy chain binding|structural constituent of muscle	g.chr3:46899892C>T		CCDS2746.1	3p	2014-09-17	2006-09-29		ENSG00000160808	ENSG00000160808		"""Myosins / Light chain"", ""EF-hand domain containing"""	7584	protein-coding gene	gene with protein product		160790	"""myosin, light polypeptide 3, alkali; ventricular, skeletal, slow"""			1479618, 2784124	Standard	NM_000258		Approved	CMH8, VLC1, MLC1V, MLC1SB	uc003cql.1	P08590	OTTHUMG00000133516	ENST00000395869.1:c.541G>A	3.37:g.46899892C>T	ENSP00000379210:p.Gly181Ser		Somatic					p.G181S	NM_000258	NP_000249	WXS	Illumina HiSeq	Unspecified	P08590	MYL3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00116)|KIRC - Kidney renal clear cell carcinoma(197;0.00557)|Kidney(197;0.0063)	5	634	-			181			EF-hand 3.		B2R534|Q9NRS8	Missense_Mutation	SNP	ENST00000395869.1	37	c.541G>A	CCDS2746.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327589	0.81690	.	.	ENSG00000160808	ENST00000395869;ENST00000292327	D;D	0.85556	-2.0;-2.0	3.77	3.77	0.43336	EF-hand-like domain (1);	0.000000	0.64402	D	0.000002	D	0.95059	0.8400	H	0.98577	4.27	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.96374	0.9276	10	0.72032	D	0.01	.	13.4778	0.61318	0.0:1.0:0.0:0.0	.	181	P08590	MYL3_HUMAN	S	181	ENSP00000379210:G181S;ENSP00000292327:G181S	ENSP00000292327:G181S	G	-	1	0	MYL3	46874896	1.000000	0.71417	0.979000	0.43373	0.757000	0.42996	7.468000	0.80943	2.127000	0.65507	0.561000	0.74099	GGC		0.607	MYL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259165.2	NM_000258		12	46	0	0	0	0.000978	0	12	46				
DNAH1	25981	broad.mit.edu	37	3	52403852	52403852	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:52403852G>T	ENST00000420323.2	+	38	6216	c.5955G>T	c.(5953-5955)atG>atT	p.M1985I		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1985	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CAATGACCATGATGTTCGAGG	0.622																																							uc011bef.1		NA																	0				large_intestine(3)	3						c.(5953-5955)ATG>ATT		dynein, axonemal, heavy chain 1							69.0	74.0	72.0					3																	52403852		2057	4209	6266	SO:0001583	missense	25981				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr3:52403852G>T	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5955G>T	3.37:g.52403852G>T	ENSP00000401514:p.Met1985Ile		Somatic					p.M1985I	NM_015512	NP_056327	WXS	Illumina HiSeq	Unspecified	Q9P2D7	DYH1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	38	6216	+			1985			AAA 2 (By similarity).		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	c.5955G>T	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.389339	0.82902	.	.	ENSG00000114841	ENST00000420323	D	0.86956	-2.19	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000009	D	0.91543	0.7329	M	0.62723	1.935	0.80722	D	1	D	0.60575	0.988	P	0.61722	0.893	D	0.91285	0.5054	10	0.46703	T	0.11	.	18.2391	0.89960	0.0:0.0:1.0:0.0	.	1985	C9JXH6	.	I	1985	ENSP00000401514:M1985I	ENSP00000401514:M1985I	M	+	3	0	DNAH1	52378892	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.073000	0.76784	2.559000	0.86315	0.561000	0.74099	ATG		0.622	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512		16	33	1	0	0.00400662	0.004007	0.00450409	16	33				
LRTM1	57408	broad.mit.edu	37	3	54958689	54958689	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:54958689G>T	ENST00000273286.5	-	2	723	c.561C>A	c.(559-561)caC>caA	p.H187Q	CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000288197.5_Intron|LRTM1_ENST00000493075.1_Missense_Mutation_p.H111Q|CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000490478.1_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	187	LRRCT.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		GACCGAGCAAGTGGCAATTGC	0.468																																							uc003dhl.2		NA																	0					0						c.(559-561)CAC>CAA		leucine-rich repeats and transmembrane domains 1							94.0	99.0	97.0					3																	54958689		2203	4300	6503	SO:0001583	missense	57408					integral to membrane		g.chr3:54958689G>T	AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.561C>A	3.37:g.54958689G>T	ENSP00000273286:p.His187Gln		Somatic				CACNA2D3_uc003dhf.2_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	p.H187Q	NM_020678	NP_065729	WXS	Illumina HiSeq	Unspecified	Q9HBL6	LRTM1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)	2	695	-			187			Extracellular (Potential).|LRRCT.		Q8IUU2	Missense_Mutation	SNP	ENST00000273286.5	37	c.561C>A	CCDS2876.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.418441	0.25552	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;D	0.89810	4.34;-2.57	5.96	4.19	0.49359	Cysteine-rich flanking region, C-terminal (1);	0.099989	0.64402	D	0.000001	T	0.78253	0.4254	N	0.20986	0.625	0.35773	D	0.821063	B	0.26195	0.144	B	0.21708	0.036	T	0.73439	-0.3982	10	0.31617	T	0.26	.	5.783	0.18318	0.2264:0.0:0.635:0.1386	.	187	Q9HBL6	LRTM1_HUMAN	Q	187;111	ENSP00000273286:H187Q;ENSP00000419772:H111Q	ENSP00000273286:H187Q	H	-	3	2	LRTM1	54933729	0.951000	0.32395	0.997000	0.53966	0.954000	0.61252	0.745000	0.26259	0.866000	0.35629	0.655000	0.94253	CAC		0.468	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351399.1	NM_020678		26	60	1	0	1.77063e-15	0.005443	2.82458e-15	26	60				
PTPRG	5793	broad.mit.edu	37	3	61547990	61547990	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:61547990G>T	ENST00000474889.1	+	1	406	c.29G>T	c.(28-30)tGg>tTg	p.W10L	PTPRG_ENST00000495879.1_3'UTR|PTPRG_ENST00000295874.10_Missense_Mutation_p.W10L	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	10					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CCGTGTTGGTGGATTTTGTTC	0.572																																							uc003dlb.2		NA																	0				ovary(5)|lung(2)	7						c.(28-30)TGG>TTG		protein tyrosine phosphatase, receptor type, G							196.0	166.0	176.0					3																	61547990		2203	4300	6503	SO:0001583	missense	5793				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr3:61547990G>T	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.29G>T	3.37:g.61547990G>T	ENSP00000418112:p.Trp10Leu		Somatic				PTPRG_uc003dlc.2_Missense_Mutation_p.W10L|PTPRG_uc003dla.3_RNA	p.W10L	NM_002841	NP_002832	WXS	Illumina HiSeq	Unspecified	P23470	PTPRG_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)	1	748	+			10					B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	c.29G>T	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340880	0.81911	.	.	ENSG00000144724	ENST00000536499;ENST00000474889;ENST00000295874	T;T	0.49139	0.8;0.79	3.99	3.99	0.46301	.	0.000000	0.49916	D	0.000129	T	0.48095	0.1481	N	0.08118	0	0.49051	D	0.999749	D;D	0.57899	0.981;0.967	D;P	0.67900	0.954;0.901	T	0.60826	-0.7186	10	0.66056	D	0.02	.	16.2207	0.82257	0.0:0.0:1.0:0.0	.	10;10	P23470-2;P23470	.;PTPRG_HUMAN	L	10	ENSP00000418112:W10L;ENSP00000295874:W10L	ENSP00000295874:W10L	W	+	2	0	PTPRG	61523030	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.950000	0.70265	2.208000	0.71279	0.484000	0.47621	TGG		0.572	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841		33	68	1	0	6.90743e-12	0.003755	1.02616e-11	33	68				
ROBO1	6091	broad.mit.edu	37	3	78766455	78766455	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:78766455C>A	ENST00000464233.1	-	7	1000	c.887G>T	c.(886-888)aGg>aTg	p.R296M	ROBO1_ENST00000467549.1_Missense_Mutation_p.R257M|ROBO1_ENST00000495273.1_Missense_Mutation_p.R257M|ROBO1_ENST00000436010.2_Missense_Mutation_p.R257M	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	296	Ig-like C2-type 3.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ATCATCTTTCCTCCATCGTAC	0.443																																							uc003dqe.2		NA																	0				large_intestine(2)	2						c.(886-888)AGG>ATG		roundabout 1 isoform a							260.0	254.0	256.0					3																	78766455		1979	4150	6129	SO:0001583	missense	6091				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding	g.chr3:78766455C>A	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.887G>T	3.37:g.78766455C>A	ENSP00000420321:p.Arg296Met		Somatic				ROBO1_uc003dqb.2_Missense_Mutation_p.R257M|ROBO1_uc003dqc.2_Missense_Mutation_p.R257M|ROBO1_uc003dqd.2_Missense_Mutation_p.R257M|ROBO1_uc003dqf.1_5'Flank	p.R296M	NM_002941	NP_002932	WXS	Illumina HiSeq	Unspecified	Q9Y6N7	ROBO1_HUMAN		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)	7	1095	-		Lung SC(41;0.0257)|Lung NSC(201;0.0439)	296			Extracellular (Potential).|Ig-like C2-type 3.		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	c.887G>T	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867272	0.91511	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;D;D	0.81821	-0.64;1.08;-1.54;-1.54	5.54	5.54	0.83059	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83243	0.5212	N	0.17723	0.515	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;1.0;0.996;0.996	T	0.81867	-0.0735	9	.	.	.	.	19.4858	0.95028	0.0:1.0:0.0:0.0	.	296;257;257;257	Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	ROBO1_HUMAN;.;.;.	M	257;257;296;257;257;296	ENSP00000406043:R257M;ENSP00000420321:R296M;ENSP00000420637:R257M;ENSP00000417992:R257M	.	R	-	2	0	ROBO1	78849145	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.484000	0.60271	2.607000	0.88179	0.462000	0.41574	AGG		0.443	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941		58	134	1	0	1.34159e-35	0.00361	2.46265e-35	58	134				
CHMP2B	25978	broad.mit.edu	37	3	87302634	87302634	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:87302634G>A	ENST00000263780.4	+	5	743	c.505G>A	c.(505-507)Gaa>Aaa	p.E169K	CHMP2B_ENST00000471660.1_Missense_Mutation_p.E128K|CHMP2B_ENST00000494980.1_Missense_Mutation_p.E139K	NM_014043.3	NP_054762.2	Q9UQN3	CHM2B_HUMAN	charged multivesicular body protein 2B	169					cell death (GO:0008219)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	12	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		AGTTCTTGATGAAATTGGAAT	0.358																																							uc003dqp.3		NA																	0				skin(2)|ovary(1)	3						c.(505-507)GAA>AAA		chromatin modifying protein 2B							97.0	94.0	95.0					3																	87302634		2203	4300	6503	SO:0001583	missense	25978				cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane|mitochondrion|nucleus	protein domain specific binding	g.chr3:87302634G>A	BC001553	CCDS2918.1, CCDS58840.1	3p12.1	2011-09-21	2011-09-21		ENSG00000083937	ENSG00000083937		"""Charged multivesicular body proteins"""	24537	protein-coding gene	gene with protein product	"""VPS2 homolog B (S. cerevisiae)"""	609512	"""chromatin modifying protein 2B"""			11559748	Standard	NM_014043		Approved	DKFZP564O123, CHMP2.5, VPS2B	uc003dqp.4	Q9UQN3	OTTHUMG00000158982	ENST00000263780.4:c.505G>A	3.37:g.87302634G>A	ENSP00000263780:p.Glu169Lys		Somatic				CHMP2B_uc011bgn.1_Missense_Mutation_p.E128K	p.E169K	NM_014043	NP_054762	WXS	Illumina HiSeq	Unspecified	Q9UQN3	CHM2B_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)	5	765	+	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)	169					B4DJG8|Q53HC7|Q9Y4U6	Missense_Mutation	SNP	ENST00000263780.4	37	c.505G>A	CCDS2918.1	.	.	.	.	.	.	.	.	.	.	G	36	5.737400	0.96865	.	.	ENSG00000083937	ENST00000471660;ENST00000263780;ENST00000494980	T;T;T	0.79653	-1.29;-1.29;-1.29	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.93132	0.7813	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.83275	0.996;0.994	D	0.94289	0.7527	10	0.87932	D	0	-49.9526	20.0499	0.97621	0.0:0.0:1.0:0.0	.	128;169	B4DJG8;Q9UQN3	.;CHM2B_HUMAN	K	128;169;139	ENSP00000419998:E128K;ENSP00000263780:E169K;ENSP00000418920:E139K	ENSP00000263780:E169K	E	+	1	0	CHMP2B	87385324	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.471000	0.97696	2.734000	0.93682	0.650000	0.86243	GAA		0.358	CHMP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352779.2	NM_014043		9	24	0	0	0	0.006214	0	9	24				
EPHA6	285220	broad.mit.edu	37	3	96706376	96706376	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:96706376C>T	ENST00000389672.5	+	3	691	c.653C>T	c.(652-654)aCa>aTa	p.T218I	EPHA6_ENST00000470610.2_Missense_Mutation_p.T218I|EPHA6_ENST00000542517.1_Missense_Mutation_p.T124I	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	124						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						TGCAAAGAAACATTTAATCTG	0.393																																							uc010how.1		NA																	0				stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(652-654)ACA>ATA		EPH receptor A6 isoform a							114.0	116.0	115.0					3																	96706376		1862	4090	5952	SO:0001583	missense	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:96706376C>T	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.653C>T	3.37:g.96706376C>T	ENSP00000374323:p.Thr218Ile		Somatic				EPHA6_uc003drp.1_Missense_Mutation_p.T218I	p.T218I	NM_001080448	NP_001073917	WXS	Illumina HiSeq	Unspecified	Q9UF33	EPHA6_HUMAN			3	696	+			123			Ephrin-binding.|Extracellular (Potential).		D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	c.653C>T	CCDS46876.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270142	0.80469	.	.	ENSG00000080224	ENST00000470610;ENST00000389672;ENST00000542517	T;T;T	0.16743	2.32;2.32;2.32	5.74	5.74	0.90152	.	0.000000	0.64402	U	0.000002	T	0.57140	0.2033	H	0.94886	3.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.69064	-0.5244	10	0.87932	D	0	.	19.9351	0.97137	0.0:1.0:0.0:0.0	.	218;218	B3KS12;E7EU71	.;.	I	218;218;124	ENSP00000420598:T218I;ENSP00000374323:T218I;ENSP00000439758:T124I	ENSP00000374323:T218I	T	+	2	0	EPHA6	98189066	1.000000	0.71417	0.996000	0.52242	0.868000	0.49771	7.818000	0.86416	2.703000	0.92315	0.655000	0.94253	ACA		0.393	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448		45	106	0	0	0	0.00874	0	45	106				
LNP1	348801	broad.mit.edu	37	3	100170692	100170692	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:100170692G>A	ENST00000383693.3	+	3	1566	c.286G>A	c.(286-288)Gag>Aag	p.E96K	LNP1_ENST00000489752.1_Missense_Mutation_p.E109K	NM_001085451.1	NP_001078920.1	A1A4G5	LNP1_HUMAN	leukemia NUP98 fusion partner 1	96										cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6						GTCATTCAAGGAGCCACTGGA	0.448																																							uc003dtx.3		NA																	0					0						c.(286-288)GAG>AAG		leukemia NUP98 fusion partner 1							106.0	98.0	101.0					3																	100170692		1848	4089	5937	SO:0001583	missense	348801							g.chr3:100170692G>A		CCDS43120.1	3q12.2	2014-05-12			ENSG00000206535	ENSG00000206535			28014	protein-coding gene	gene with protein product						16467868	Standard	NM_001085451		Approved	NP3	uc003dtx.4	A1A4G5	OTTHUMG00000159082	ENST00000383693.3:c.286G>A	3.37:g.100170692G>A	ENSP00000373191:p.Glu96Lys		Somatic				LNP1_uc003dty.3_RNA|LNP1_uc011bhb.1_RNA	p.E96K	NM_001085451	NP_001078920	WXS	Illumina HiSeq	Unspecified	A1A4G5	LNP1_HUMAN			3	1566	+			96					B7ZLT3	Missense_Mutation	SNP	ENST00000383693.3	37	c.286G>A	CCDS43120.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.519192	0.64634	.	.	ENSG00000206535	ENST00000383693;ENST00000489752	.	.	.	5.32	4.44	0.53790	.	0.297478	0.31010	N	0.008432	T	0.43277	0.1240	L	0.32530	0.975	0.09310	N	1	P	0.50156	0.932	P	0.53450	0.726	T	0.23833	-1.0177	9	0.41790	T	0.15	-12.2161	11.1308	0.48345	0.0875:0.0:0.9125:0.0	.	96	A1A4G5	LNP1_HUMAN	K	96;109	.	ENSP00000373191:E96K	E	+	1	0	LNP1	101653382	0.998000	0.40836	0.243000	0.24186	0.820000	0.46376	3.249000	0.51437	1.251000	0.43983	0.461000	0.40582	GAG		0.448	LNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353232.1			14	60	0	0	0	0.004007	0	14	60				
NFKBIZ	64332	broad.mit.edu	37	3	101571804	101571804	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:101571804A>G	ENST00000326172.5	+	4	650	c.535A>G	c.(535-537)Agg>Ggg	p.R179G	NFKBIZ_ENST00000394054.2_Missense_Mutation_p.R79G|NFKBIZ_ENST00000326151.5_Missense_Mutation_p.R179G	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	179					inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						TGCTTGCAAAAGGCCAGCTCT	0.423																																							uc003dvp.2		NA																	0				ovary(2)	2						c.(535-537)AGG>GGG		nuclear factor of kappa light polypeptide gene							151.0	144.0	146.0					3																	101571804		2203	4300	6503	SO:0001583	missense	64332				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr3:101571804A>G	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.535A>G	3.37:g.101571804A>G	ENSP00000325663:p.Arg179Gly		Somatic				NFKBIZ_uc003dvo.2_Missense_Mutation_p.R79G|NFKBIZ_uc010hpo.2_Missense_Mutation_p.R79G|NFKBIZ_uc003dvq.2_Missense_Mutation_p.R179G	p.R179G	NM_031419	NP_113607	WXS	Illumina HiSeq	Unspecified	Q9BYH8	IKBZ_HUMAN			4	650	+			179			Nuclear localization signal (By similarity).		B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	ENST00000326172.5	37	c.535A>G	CCDS2946.1	.	.	.	.	.	.	.	.	.	.	A	13.35	2.211020	0.39102	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326151;ENST00000326172;ENST00000491281	T;T;T;T	0.63580	0.15;0.1;-0.05;0.16	5.84	5.84	0.93424	.	0.272158	0.37761	N	0.001941	T	0.65739	0.2720	L	0.29908	0.895	0.39324	D	0.965297	P;D	0.62365	0.873;0.991	P;P	0.60236	0.461;0.871	T	0.70193	-0.4939	10	0.62326	D	0.03	-13.0852	12.902	0.58130	0.8557:0.1443:0.0:0.0	.	179;179	Q9BYH8-3;Q9BYH8	.;IKBZ_HUMAN	G	79;79;179;179;79	ENSP00000419800:R79G;ENSP00000377618:R79G;ENSP00000325593:R179G;ENSP00000325663:R179G	ENSP00000325593:R179G	R	+	1	2	NFKBIZ	103054494	1.000000	0.71417	1.000000	0.80357	0.188000	0.23474	2.624000	0.46444	2.220000	0.72140	0.533000	0.62120	AGG		0.423	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	NM_031419		15	69	0	0	0	0.00245	0	15	69				
TMPRSS7	344805	broad.mit.edu	37	3	111785291	111785291	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:111785291C>A	ENST00000452346.2	+	13	1611	c.1608C>A	c.(1606-1608)ctC>ctA	p.L536L	TMPRSS7_ENST00000419127.1_Silent_p.L410L			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	536	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						ATGGCCCTCTCATCTGTGATG	0.507																																							uc010hqb.2		NA																	0				ovary(1)|kidney(1)	2						c.(1228-1230)CTC>CTA		transmembrane protease, serine 7							100.0	100.0	100.0					3																	111785291		1967	4167	6134	SO:0001819	synonymous_variant	344805				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity	g.chr3:111785291C>A	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1608C>A	3.37:g.111785291C>A			Somatic				TMPRSS7_uc011bhr.1_Silent_p.L265L	p.L410L	NM_001042575	NP_001036040	WXS	Illumina HiSeq	Unspecified	Q7RTY8	TMPS7_HUMAN			11	1400	+			536			Extracellular (Potential).|LDL-receptor class A 2.		C9J8P7|E9PAS3|Q17RH4	Silent	SNP	ENST00000452346.2	37	c.1230C>A																																																																																					0.507	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599		25	95	1	0	5.45727e-16	0.008361	8.7473e-16	25	95				
GPR156	165829	broad.mit.edu	37	3	119886566	119886566	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:119886566C>A	ENST00000464295.1	-	10	2203	c.1758G>T	c.(1756-1758)atG>atT	p.M586I	GPR156_ENST00000315843.3_Missense_Mutation_p.M586I|GPR156_ENST00000461057.1_Missense_Mutation_p.M582I			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	586						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		TGGAGAGGGGCATCTTTTGGG	0.607																																							uc011bjf.1		NA																	0				ovary(1)|skin(1)	2						c.(1756-1758)ATG>ATT		G protein-coupled receptor 156							32.0	36.0	34.0					3																	119886566		2202	4297	6499	SO:0001583	missense	165829					integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr3:119886566C>A	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.1758G>T	3.37:g.119886566C>A	ENSP00000417261:p.Met586Ile		Somatic				GPR156_uc011bjg.1_Missense_Mutation_p.M582I	p.M586I	NM_153002	NP_694547	WXS	Illumina HiSeq	Unspecified	Q8NFN8	GP156_HUMAN		GBM - Glioblastoma multiforme(114;0.19)	9	1758	-			586			Cytoplasmic (Potential).		B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	ENST00000464295.1	37	c.1758G>T	CCDS2997.1	.	.	.	.	.	.	.	.	.	.	C	4.664	0.123422	0.08931	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.22743	1.94;1.94;1.95	5.08	-0.0739	0.13733	.	1.118960	0.06619	N	0.756973	T	0.09335	0.0230	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35325	-0.9793	9	.	.	.	0.1728	0.7035	0.00911	0.2692:0.3544:0.1314:0.2451	.	582;586	E9PFZ4;Q8NFN8	.;GP156_HUMAN	I	586;586;582	ENSP00000417261:M586I;ENSP00000324553:M586I;ENSP00000418758:M582I	.	M	-	3	0	GPR156	121369256	0.012000	0.17670	0.216000	0.23742	0.957000	0.61999	-0.363000	0.07593	-0.204000	0.10235	0.563000	0.77884	ATG		0.607	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002		10	49	1	0	4.68919e-08	0.008291	6.27097e-08	10	49				
STXBP5L	9515	broad.mit.edu	37	3	121126327	121126327	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:121126327A>G	ENST00000273666.6	+	24	3168	c.2897A>G	c.(2896-2898)cAg>cGg	p.Q966R	STXBP5L_ENST00000492541.1_Missense_Mutation_p.Q966R|STXBP5L_ENST00000497029.1_Missense_Mutation_p.Q940R|STXBP5L_ENST00000471454.1_Missense_Mutation_p.Q942R|STXBP5L_ENST00000472879.1_Missense_Mutation_p.Q942R	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	966					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CTGCCTTCTCAGACTTGCCTT	0.418																																							uc003eec.3		NA																	0				ovary(7)|skin(2)	9						c.(2896-2898)CAG>CGG		syntaxin binding protein 5-like							149.0	140.0	143.0					3																	121126327		1942	4141	6083	SO:0001583	missense	9515				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane		g.chr3:121126327A>G	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2897A>G	3.37:g.121126327A>G	ENSP00000273666:p.Gln966Arg		Somatic				STXBP5L_uc011bji.1_Missense_Mutation_p.Q942R	p.Q966R	NM_014980	NP_055795	WXS	Illumina HiSeq	Unspecified	Q9Y2K9	STB5L_HUMAN		GBM - Glioblastoma multiforme(114;0.0694)	24	3037	+			966			WD 12.		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	37	c.2897A>G	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.498780	0.85069	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85;1.85	5.33	5.33	0.75918	Lethal giant larvae (Lgl)-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.55955	0.1953	M	0.88105	2.93	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.78314	0.991;0.991	T	0.59263	-0.7487	10	0.25106	T	0.35	-8.1614	15.5893	0.76512	1.0:0.0:0.0:0.0	.	942;966	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	R	966;942;942;940;966;909	ENSP00000273666:Q966R;ENSP00000420019:Q942R;ENSP00000419627:Q942R;ENSP00000420287:Q940R;ENSP00000420666:Q966R;ENSP00000420167:Q909R	ENSP00000273666:Q966R	Q	+	2	0	STXBP5L	122609017	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.907000	0.92634	2.149000	0.67028	0.528000	0.53228	CAG		0.418	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3			3	79	0	0	0	0.000248	0	3	79				
SEMA5B	54437	broad.mit.edu	37	3	122631876	122631876	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:122631876T>G	ENST00000357599.3	-	18	2925	c.2539A>C	c.(2539-2541)Acc>Ccc	p.T847P	SEMA5B_ENST00000195173.4_Missense_Mutation_p.T846P|SEMA5B_ENST00000451055.2_Missense_Mutation_p.T901P	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	847					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TGCGGGGAGGTGCTCCCGCTG	0.771																																							uc003efz.1		NA																	0				ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7						c.(2539-2541)ACC>CCC		semaphorin 5B isoform 1							6.0	7.0	7.0					3																	122631876		2120	4082	6202	SO:0001583	missense	54437				cell differentiation|nervous system development	integral to membrane	receptor activity	g.chr3:122631876T>G	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2539A>C	3.37:g.122631876T>G	ENSP00000350215:p.Thr847Pro		Somatic				SEMA5B_uc011bju.1_Missense_Mutation_p.T789P|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Missense_Mutation_p.T847P|SEMA5B_uc003efy.1_5'Flank	p.T847P	NM_001031702	NP_001026872	WXS	Illumina HiSeq	Unspecified	Q9P283	SEM5B_HUMAN		GBM - Glioblastoma multiforme(114;0.0367)	18	2843	-			847			Extracellular (Potential).		A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	c.2539A>C	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	T	11.51	1.660577	0.29515	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.35973	1.28;1.28;1.35;1.38	5.01	-3.24	0.05094	.	0.994614	0.08157	N	0.989126	T	0.18593	0.0446	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.001	T	0.25882	-1.0119	10	0.36615	T	0.2	.	11.0448	0.47852	0.0:0.4601:0.0:0.5399	.	789;847	D3YTI7;Q9P283	.;SEM5B_HUMAN	P	847;846;789;901;847	ENSP00000350215:T847P;ENSP00000195173:T846P;ENSP00000389588:T901P;ENSP00000377208:T847P	ENSP00000195173:T846P	T	-	1	0	SEMA5B	124114566	0.042000	0.20092	0.009000	0.14445	0.896000	0.52359	-0.219000	0.09228	-0.774000	0.04590	-0.408000	0.06270	ACC		0.771	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702		6	13	0	0	0	0.001168	0	6	13				
EPHB1	2047	broad.mit.edu	37	3	134670615	134670615	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:134670615G>T	ENST00000398015.3	+	3	896	c.526G>T	c.(526-528)Gct>Tct	p.A176S	EPHB1_ENST00000488154.1_Intron	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	176	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.A176T(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TTTTTACCTCGCTTTTCAGGA	0.463																																							uc003eqt.2		NA																	2	Substitution - Missense(2)	p.A176T(2)	ovary(2)	lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						c.(526-528)GCT>TCT		ephrin receptor EphB1 precursor							257.0	246.0	250.0					3																	134670615		1915	4137	6052	SO:0001583	missense	2047					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding	g.chr3:134670615G>T	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.526G>T	3.37:g.134670615G>T	ENSP00000381097:p.Ala176Ser		Somatic				EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_Intron	p.A176S	NM_004441	NP_004432	WXS	Illumina HiSeq	Unspecified	P54762	EPHB1_HUMAN			3	746	+			176			Extracellular (Potential).		A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	c.526G>T	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791777	0.90453	.	.	ENSG00000154928	ENST00000398015	T	0.21734	1.99	5.49	5.49	0.81192	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.51718	-0.8670	9	.	.	.	.	19.3897	0.94576	0.0:0.0:1.0:0.0	.	176	P54762	EPHB1_HUMAN	S	176	ENSP00000381097:A176S	.	A	+	1	0	EPHB1	136153305	1.000000	0.71417	0.984000	0.44739	0.994000	0.84299	9.869000	0.99810	2.578000	0.87016	0.655000	0.94253	GCT		0.463	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441		40	227	1	0	2.37825e-27	0.002522	4.27192e-27	40	227				
SLC25A36	55186	broad.mit.edu	37	3	140692765	140692765	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:140692765G>T	ENST00000324194.6	+	6	828	c.660G>T	c.(658-660)gtG>gtT	p.V220V	SLC25A36_ENST00000446041.2_Silent_p.V220V|SLC25A36_ENST00000453248.2_Silent_p.V194V|RP11-231L11.3_ENST00000513802.1_RNA			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36	220					response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						AAGAGTCTGTGAAAGAAGCAT	0.348																																							uc003etr.2		NA																	0					0						c.(658-660)GTG>GTT		solute carrier family 25, member 36 isoform a							68.0	69.0	69.0					3																	140692765		2203	4300	6503	SO:0001819	synonymous_variant	55186				response to estradiol stimulus|transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr3:140692765G>T	AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.660G>T	3.37:g.140692765G>T			Somatic				SLC25A36_uc003ets.2_Silent_p.V220V|SLC25A36_uc003etq.2_Silent_p.V63V|SLC25A36_uc011bmz.1_Silent_p.V194V	p.V220V	NM_001104647	NP_001098117	WXS	Illumina HiSeq	Unspecified	Q96CQ1	S2536_HUMAN			6	895	+			220					A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	Silent	SNP	ENST00000324194.6	37	c.660G>T	CCDS46927.1																																																																																				0.348	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359929.1	NM_018155		14	18	1	0	4.3838e-07	0.001855	5.61596e-07	14	18				
PAQR9	344838	broad.mit.edu	37	3	142681404	142681404	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:142681404G>A	ENST00000340634.3	-	1	774	c.775C>T	c.(775-777)Ctc>Ttc	p.L259F	RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	259						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						CAGCTCTCGAGCATAATGGGG	0.617																																							uc003evg.2		NA																	0					0						c.(775-777)CTC>TTC		progestin and adipoQ receptor family member IX							80.0	80.0	80.0					3																	142681404		2203	4300	6503	SO:0001583	missense	344838					integral to membrane	receptor activity	g.chr3:142681404G>A	AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.775C>T	3.37:g.142681404G>A	ENSP00000341564:p.Leu259Phe		Somatic				PAQR9_uc003evf.1_5'Flank	p.L259F	NM_198504	NP_940906	WXS	Illumina HiSeq	Unspecified	Q6ZVX9	PAQR9_HUMAN			1	775	-			259			Helical; (Potential).		Q147T6	Missense_Mutation	SNP	ENST00000340634.3	37	c.775C>T	CCDS3128.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397754	0.42512	.	.	ENSG00000188582	ENST00000340634	T	0.33438	1.41	5.52	5.52	0.82312	.	0.307932	0.27946	N	0.017212	T	0.22126	0.0533	L	0.27053	0.805	0.34544	D	0.710556	B	0.15473	0.013	B	0.25759	0.063	T	0.21655	-1.0239	10	0.30854	T	0.27	-30.2594	9.6077	0.39643	0.0725:0.0:0.7867:0.1408	.	259	Q6ZVX9	PAQR9_HUMAN	F	259	ENSP00000341564:L259F	ENSP00000341564:L259F	L	-	1	0	PAQR9	144164094	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	3.498000	0.53302	2.595000	0.87683	0.655000	0.94253	CTC		0.617	PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354538.1	NM_198504		26	66	0	0	0	0.007291	0	26	66				
HLTF	6596	broad.mit.edu	37	3	148789207	148789207	+	Silent	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:148789207T>A	ENST00000310053.5	-	7	919	c.726A>T	c.(724-726)ccA>ccT	p.P242P	HLTF_ENST00000465259.1_Silent_p.P242P|HLTF_ENST00000494055.1_Silent_p.P242P|HLTF_ENST00000392912.2_Silent_p.P242P	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	242					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GTTTTTGATGTGGAAGCAGTG	0.358																																							uc003ewq.1		NA																	0				ovary(1)	1						c.(724-726)CCA>CCT		helicase-like transcription factor							108.0	101.0	103.0					3																	148789207		2203	4300	6503	SO:0001819	synonymous_variant	6596				chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr3:148789207T>A	L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.726A>T	3.37:g.148789207T>A			Somatic				HLTF_uc003ewr.1_Silent_p.P242P|HLTF_uc003ews.1_Silent_p.P242P|HLTF_uc010hve.1_Silent_p.P242P	p.P242P	NM_139048	NP_620636	WXS	Illumina HiSeq	Unspecified	Q14527	HLTF_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		7	944	-			242					D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Silent	SNP	ENST00000310053.5	37	c.726A>T	CCDS33875.1																																																																																				0.358	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356064.1			12	21	0	0	0	0.004007	0	12	21				
MED12L	116931	broad.mit.edu	37	3	151101949	151101949	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:151101949C>A	ENST00000474524.1	+	33	4802	c.4764C>A	c.(4762-4764)tcC>tcA	p.S1588S	P2RY12_ENST00000302632.3_Intron|MED12L_ENST00000273432.4_Silent_p.S1448S	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1588						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAAATGCATCCCCTGGGGGAT	0.358																																							uc003eyp.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(4762-4764)TCC>TCA		mediator of RNA polymerase II transcription,							124.0	121.0	122.0					3																	151101949		2203	4300	6503	SO:0001819	synonymous_variant	116931				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		g.chr3:151101949C>A	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4764C>A	3.37:g.151101949C>A			Somatic				MED12L_uc011bnz.1_Silent_p.S1448S|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_Silent_p.S751S	p.S1588S	NM_053002	NP_443728	WXS	Illumina HiSeq	Unspecified	Q86YW9	MD12L_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		33	4802	+			1588					Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	37	c.4764C>A	CCDS33876.1																																																																																				0.358	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		22	33	1	0	5.49717e-05	0.00333	6.53032e-05	22	33				
KPNA4	3840	broad.mit.edu	37	3	160239566	160239566	+	Splice_Site	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:160239566C>T	ENST00000334256.4	-	11	1209		c.e11+1			NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)						cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			AACAAACTTACCTGAACTTTA	0.348																																							uc003fdn.2		NA																	0					0						c.e11+1		karyopherin alpha 4							91.0	96.0	94.0					3																	160239566		2203	4300	6503	SO:0001630	splice_region_variant	3840				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding	g.chr3:160239566C>T	AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.903+1G>A	3.37:g.160239566C>T			Somatic					p.Q301_splice	NM_002268	NP_002259	WXS	Illumina HiSeq	Unspecified	O00629	IMA4_HUMAN	Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)		11	1209	-								A8K4S6|D3DNM2|O00190	Splice_Site	SNP	ENST00000334256.4	37	c.903_splice	CCDS3191.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.746654	0.69418	.	.	ENSG00000186432	ENST00000334256;ENST00000483437	.	.	.	5.2	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0922	0.72204	0.1426:0.8574:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KPNA4	161722260	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.503000	0.81632	1.359000	0.45940	0.655000	0.94253	.		0.348	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352960.1	NM_002268	Intron	7	78	0	0	0	0.004482	0	7	78				
BCHE	590	broad.mit.edu	37	3	165547481	165547481	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:165547481G>T	ENST00000264381.3	-	2	1507	c.1341C>A	c.(1339-1341)taC>taA	p.Y447*	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	447					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	GTTCAAAATAGTAGAAAAAGG	0.428																																							uc003fem.3		NA																	0				ovary(3)|pancreas(1)	4						c.(1339-1341)TAC>TAA		butyrylcholinesterase precursor	Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)						100.0	104.0	103.0					3																	165547481		2203	4300	6503	SO:0001587	stop_gained	590				choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding	g.chr3:165547481G>T	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1341C>A	3.37:g.165547481G>T	ENSP00000264381:p.Tyr447*		Somatic				BCHE_uc003fen.3_Intron	p.Y447*	NM_000055	NP_000046	WXS	Illumina HiSeq	Unspecified	P06276	CHLE_HUMAN			2	1501	-			447					A8K7P8	Nonsense_Mutation	SNP	ENST00000264381.3	37	c.1341C>A	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	G	37	6.259308	0.97421	.	.	ENSG00000114200	ENST00000264381	.	.	.	5.52	0.604	0.17547	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.5062	0.44834	0.4068:0.0:0.5932:0.0	.	.	.	.	X	447	.	ENSP00000264381:Y447X	Y	-	3	2	BCHE	167030175	0.986000	0.35501	0.997000	0.53966	0.988000	0.76386	0.456000	0.21859	0.048000	0.15891	0.591000	0.81541	TAC		0.428	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1			18	56	1	0	1.33834e-09	0.007413	1.87984e-09	18	56				
KLHL6	89857	broad.mit.edu	37	3	183217574	183217574	+	Missense_Mutation	SNP	C	C	A	rs577428463		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:183217574C>A	ENST00000341319.3	-	4	986	c.951G>T	c.(949-951)caG>caT	p.Q317H		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	317					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			ACACCTCAGACTGGAACTCAT	0.572																																							uc003flr.2		NA																	0				haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3						c.(949-951)CAG>CAT		kelch-like 6							78.0	63.0	69.0					3																	183217574		2203	4300	6503	SO:0001583	missense	89857							g.chr3:183217574C>A	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.951G>T	3.37:g.183217574C>A	ENSP00000341342:p.Gln317His		Somatic				KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_Intron	p.Q317H	NM_130446	NP_569713	WXS	Illumina HiSeq	Unspecified	Q8WZ60	KLHL6_HUMAN	all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)		4	1009	-	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		317					B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	c.951G>T	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	C	13.69	2.311480	0.40895	.	.	ENSG00000172578	ENST00000341319	T	0.74209	-0.82	5.13	2.94	0.34122	.	0.110612	0.64402	D	0.000007	T	0.69468	0.3114	L	0.57536	1.79	0.47547	D	0.999456	P	0.50943	0.94	P	0.47044	0.535	T	0.65067	-0.6258	10	0.16896	T	0.51	.	8.6325	0.33928	0.0:0.7183:0.0:0.2817	.	317	Q8WZ60	KLHL6_HUMAN	H	317	ENSP00000341342:Q317H	ENSP00000341342:Q317H	Q	-	3	2	KLHL6	184700268	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.509000	0.35780	1.311000	0.45024	0.561000	0.74099	CAG		0.572	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446		10	19	1	0	1.58986e-06	0.008291	1.99104e-06	10	19				
FETUB	26998	broad.mit.edu	37	3	186358347	186358347	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:186358347C>T	ENST00000265029.3	+	1	199	c.98C>T	c.(97-99)tCc>tTc	p.S33F	FETUB_ENST00000382136.3_Missense_Mutation_p.S33F|FETUB_ENST00000539949.1_Intron|FETUB_ENST00000382134.3_Missense_Mutation_p.S33F|RP11-134F2.2_ENST00000428501.1_RNA|RP11-134F2.2_ENST00000455926.1_RNA|FETUB_ENST00000450521.1_Missense_Mutation_p.S33F|FETUB_ENST00000488561.1_3'UTR	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	33	Cystatin fetuin-B-type 1. {ECO:0000255|PROSITE-ProRule:PRU00862}.		S -> P (in dbSNP:rs34522046).		binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		GCTCTGCTCTCCCGGGGCTGC	0.577																																							uc010hyq.2		NA																	0				ovary(1)|lung(1)	2						c.(97-99)TCC>TTC		fetuin B precursor							159.0	166.0	164.0					3																	186358347		2203	4300	6503	SO:0001583	missense	26998					extracellular space	cysteine-type endopeptidase inhibitor activity	g.chr3:186358347C>T	AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.98C>T	3.37:g.186358347C>T	ENSP00000265029:p.Ser33Phe		Somatic				FETUB_uc011brz.1_Intron|FETUB_uc003fqn.2_Missense_Mutation_p.S33F|FETUB_uc003fqo.2_5'UTR|FETUB_uc010hyr.2_Missense_Mutation_p.S33F|FETUB_uc010hys.2_5'UTR|FETUB_uc003fqp.3_Missense_Mutation_p.S33F	p.S33F	NM_014375	NP_055190	WXS	Illumina HiSeq	Unspecified	Q9UGM5	FETUB_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)	2	359	+	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		33			Cystatin fetuin-B-type 1.		B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Missense_Mutation	SNP	ENST00000265029.3	37	c.98C>T	CCDS3279.1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.796145	0.50208	.	.	ENSG00000090512	ENST00000450521;ENST00000265029;ENST00000382134;ENST00000382136	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.26	3.48	0.39840	Proteinase inhibitor I25, cystatin (1);	1.463350	0.03806	N	0.265151	T	0.60418	0.2267	M	0.73598	2.24	0.18873	N	0.999985	P;P;P	0.51653	0.868;0.718;0.947	B;B;P	0.55222	0.38;0.233;0.771	T	0.28618	-1.0038	10	0.72032	D	0.01	-0.0224	8.4509	0.32871	0.0:0.818:0.0:0.182	.	33;33;33	E9PG06;E9PG08;Q9UGM5	.;.;FETUB_HUMAN	F	33	ENSP00000404288:S33F;ENSP00000265029:S33F;ENSP00000371569:S33F;ENSP00000371571:S33F	ENSP00000265029:S33F	S	+	2	0	FETUB	187841041	0.003000	0.15002	0.016000	0.15963	0.033000	0.12548	1.099000	0.31013	0.875000	0.35847	0.655000	0.94253	TCC		0.577	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1	NM_014375		95	181	0	0	0	0.00361	0	95	181				
ATP13A4	84239	broad.mit.edu	37	3	193176992	193176992	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr3:193176992C>A	ENST00000342695.4	-	14	1874	c.1552G>T	c.(1552-1554)Ggc>Tgc	p.G518C	ATP13A4_ENST00000295548.3_Missense_Mutation_p.G518C|ATP13A4_ENST00000392443.3_Missense_Mutation_p.G499C	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	518						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		AAAGCCTGGCCTGAGGCAAAG	0.532																																							uc003ftd.2		NA																	0				ovary(2)	2						c.(1552-1554)GGC>TGC		ATPase type 13A4							61.0	59.0	60.0					3																	193176992		2203	4300	6503	SO:0001583	missense	84239				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193176992C>A	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.1552G>T	3.37:g.193176992C>A	ENSP00000339182:p.Gly518Cys		Somatic				ATP13A4_uc003fte.1_Missense_Mutation_p.G518C|ATP13A4_uc011bsr.1_Translation_Start_Site|ATP13A4_uc010hzi.2_RNA|ATP13A4_uc003ftf.3_Missense_Mutation_p.G224C	p.G518C	NM_032279	NP_115655	WXS	Illumina HiSeq	Unspecified	Q4VNC1	AT134_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)	14	1660	-	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		518			Extracellular (Potential).		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	ENST00000342695.4	37	c.1552G>T	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	C	17.64	3.440183	0.63067	.	.	ENSG00000127249	ENST00000392443;ENST00000342695;ENST00000295548	T;T;D	0.88975	-0.71;-0.71;-2.45	5.41	5.41	0.78517	ATPase, cation-transporting, domain N (1);	0.084418	0.50627	D	0.000115	D	0.94251	0.8154	M	0.74258	2.255	0.30844	N	0.735341	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.997;0.998	D	0.92555	0.6053	10	0.54805	T	0.06	-9.9878	18.1796	0.89773	0.0:1.0:0.0:0.0	.	518;518;518	Q4VNC1-3;Q4VNC1-2;Q4VNC1	.;.;AT134_HUMAN	C	499;518;518	ENSP00000376238:G499C;ENSP00000339182:G518C;ENSP00000295548:G518C	ENSP00000295548:G518C	G	-	1	0	ATP13A4	194659686	0.880000	0.30214	0.537000	0.28052	0.706000	0.40770	3.773000	0.55333	2.552000	0.86080	0.650000	0.86243	GGC		0.532	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279		11	66	1	0	7.03913e-09	0.001368	9.72415e-09	11	66				
SCFD2	152579	broad.mit.edu	37	4	53773703	53773703	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:53773703C>T	ENST00000401642.3	-	7	1896	c.1763G>A	c.(1762-1764)aGg>aAg	p.R588K	SCFD2_ENST00000388940.4_Intron	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	588					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GGAATCTGGCCTCTCGGGATG	0.403																																							uc003gzu.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1762-1764)AGG>AAG		sec1 family domain containing 2							138.0	132.0	134.0					4																	53773703		2203	4300	6503	SO:0001583	missense	152579				protein transport|vesicle docking involved in exocytosis			g.chr4:53773703C>T	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.1763G>A	4.37:g.53773703C>T	ENSP00000384182:p.Arg588Lys		Somatic				SCFD2_uc010igm.2_Intron	p.R588K	NM_152540	NP_689753	WXS	Illumina HiSeq	Unspecified	Q8WU76	SCFD2_HUMAN	GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)		7	1897	-			588					Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	ENST00000401642.3	37	c.1763G>A	CCDS33984.1	.	.	.	.	.	.	.	.	.	.	C	1.650	-0.514202	0.04200	.	.	ENSG00000184178	ENST00000401642	T	0.76060	-0.99	5.71	-2.49	0.06403	.	0.391981	0.26654	N	0.023192	T	0.46308	0.1386	N	0.11560	0.145	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.46261	-0.9204	10	0.02654	T	1	.	12.2129	0.54389	0.0:0.3488:0.0:0.6512	.	588	Q8WU76	SCFD2_HUMAN	K	588	ENSP00000384182:R588K	ENSP00000384182:R588K	R	-	2	0	SCFD2	53468460	0.938000	0.31826	0.919000	0.36401	0.414000	0.31173	0.240000	0.18042	-0.993000	0.03467	-0.367000	0.07326	AGG		0.403	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540		37	51	0	0	0	0.004289	0	37	51				
KDR	3791	broad.mit.edu	37	4	55972944	55972944	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:55972944A>T	ENST00000263923.4	-	11	1741	c.1446T>A	c.(1444-1446)tgT>tgA	p.C482*		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	482	Ig-like C2-type 5.		C -> R (in HCI susceptibility; expression of FLT1 in hemangioma endothelial cells is markedly reduced and KDR activity is increased compared to controls; low FLT1 expression in hemangioma cells is caused by reduced activity of a pathway involving ITGB1, ANTXR1, KDR and NFATC2IP; the mutation predicts to result in loss-of-function and disruption of the normal association of these molecules; dbSNP:rs34231037). {ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:18931684}.		angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCCATTCTTCACAAGGGTATG	0.338			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																													uc003has.2		NA		Dom	yes		4	4q11-q12	3791	Mis	vascular endothelial growth factor receptor 2			E			NSCLC|angiosarcoma		0				lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33						c.(1444-1446)TGT>TGA		kinase insert domain receptor precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						80.0	84.0	82.0					4																	55972944		2203	4300	6503	SO:0001587	stop_gained	3791	Familial_Infantile_Hemangioma			angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	g.chr4:55972944A>T	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1446T>A	4.37:g.55972944A>T	ENSP00000263923:p.Cys482*	TSP Lung(20;0.16)	Somatic				KDR_uc003hat.1_Nonsense_Mutation_p.C482*|KDR_uc011bzx.1_Nonsense_Mutation_p.C482*	p.C482*	NM_002253	NP_002244	WXS	Illumina HiSeq	Unspecified	P35968	VGFR2_HUMAN	Epithelial(7;0.189)		11	1748	-	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		482			Ig-like C2-type 5.|Extracellular (Potential).		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Nonsense_Mutation	SNP	ENST00000263923.4	37	c.1446T>A	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	A	36	5.696782	0.96802	.	.	ENSG00000128052	ENST00000263923	.	.	.	5.67	3.31	0.37934	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.2582	0.26189	0.7008:0.0:0.2992:0.0	.	.	.	.	X	482	.	ENSP00000263923:C482X	C	-	3	2	KDR	55667701	0.993000	0.37304	0.995000	0.50966	0.100000	0.18952	0.288000	0.18939	0.960000	0.38005	0.533000	0.62120	TGT		0.338	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			5	42	0	0	0	0.001168	0	5	42				
CLOCK	9575	broad.mit.edu	37	4	56342213	56342213	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:56342213C>A	ENST00000309964.4	-	6	515	c.265G>T	c.(265-267)Gca>Tca	p.A89S	CLOCK_ENST00000381322.1_Missense_Mutation_p.A89S|CLOCK_ENST00000513440.1_Missense_Mutation_p.A89S|CLOCK_ENST00000506923.1_5'Flank	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	89					cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			TCTGACTGTGCAGTGATTTCT	0.378																																							uc003haz.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(265-267)GCA>TCA		clock							126.0	114.0	118.0					4																	56342213		2203	4299	6502	SO:0001583	missense	9575				circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr4:56342213C>A	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.265G>T	4.37:g.56342213C>A	ENSP00000308741:p.Ala89Ser		Somatic				CLOCK_uc003hba.1_Missense_Mutation_p.A89S	p.A89S	NM_004898	NP_004889	WXS	Illumina HiSeq	Unspecified	O15516	CLOCK_HUMAN	LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)		8	1191	-	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		89					A0AV01|A2I2N9|O14516|Q9UIT8	Missense_Mutation	SNP	ENST00000309964.4	37	c.265G>T	CCDS3500.1	.	.	.	.	.	.	.	.	.	.	C	35	5.435551	0.96150	.	.	ENSG00000134852	ENST00000309964;ENST00000381322;ENST00000513440	T;T;T	0.05258	3.47;3.47;3.47	5.95	5.95	0.96441	Helix-loop-helix DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.14570	0.0352	L	0.40543	1.245	0.80722	D	1	P	0.41546	0.754	P	0.49597	0.616	T	0.00108	-1.2050	10	0.72032	D	0.01	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	89	O15516	CLOCK_HUMAN	S	89	ENSP00000308741:A89S;ENSP00000370723:A89S;ENSP00000426983:A89S	ENSP00000308741:A89S	A	-	1	0	CLOCK	56036970	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.294000	0.78760	2.824000	0.97209	0.655000	0.94253	GCA		0.378	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898		11	33	1	0	2.27111e-07	0.001368	2.94322e-07	11	33				
AMBN	258	broad.mit.edu	37	4	71467241	71467241	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:71467241C>T	ENST00000322937.6	+	6	504	c.401C>T	c.(400-402)aCc>aTc	p.T134I	AMBN_ENST00000449493.2_Missense_Mutation_p.T119I	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	134					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)	p.T134I(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			GCTGCAACCACCAACCAGGCC	0.547											OREG0016218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003hfl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(400-402)ACC>ATC		ameloblastin precursor							146.0	139.0	141.0					4																	71467241		2203	4300	6503	SO:0001583	missense	258				bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel	g.chr4:71467241C>T	AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.401C>T	4.37:g.71467241C>T	ENSP00000313809:p.Thr134Ile		Somatic	OREG0016218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1130		p.T134I	NM_016519	NP_057603	WXS	Illumina HiSeq	Unspecified	Q9NP70	AMBN_HUMAN	Lung(101;0.235)		6	476	+			134					Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	ENST00000322937.6	37	c.401C>T	CCDS3543.1	.	.	.	.	.	.	.	.	.	.	C	9.254	1.041369	0.19669	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.32988	1.43;1.43	5.62	1.8	0.24995	.	0.870147	0.09913	N	0.739594	T	0.17238	0.0414	N	0.08118	0	0.09310	N	1	B	0.24768	0.111	B	0.22152	0.038	T	0.25984	-1.0116	10	0.52906	T	0.07	-0.0126	10.3398	0.43870	0.14:0.4288:0.4312:0.0	.	134	Q9NP70	AMBN_HUMAN	I	134;134;119	ENSP00000313809:T134I;ENSP00000391234:T119I	ENSP00000313809:T134I	T	+	2	0	AMBN	71501830	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.374000	0.07484	0.088000	0.17205	0.563000	0.77884	ACC		0.547	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519		43	103	0	0	0	0.00874	0	43	103				
SHROOM3	57619	broad.mit.edu	37	4	77663049	77663049	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:77663049G>T	ENST00000296043.6	+	5	4676	c.3723G>T	c.(3721-3723)agG>agT	p.R1241S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1241					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TGAGGTCCAGGTCATCTCCCG	0.652																																							uc011cbx.1		NA																	0				skin(2)|ovary(1)	3						c.(3721-3723)AGG>AGT		shroom family member 3 protein							21.0	19.0	20.0					4																	77663049		2184	4264	6448	SO:0001583	missense	57619				apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding	g.chr4:77663049G>T	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.3723G>T	4.37:g.77663049G>T	ENSP00000296043:p.Arg1241Ser		Somatic				SHROOM3_uc011cbz.1_Missense_Mutation_p.R1065S|SHROOM3_uc003hkf.1_Missense_Mutation_p.R1116S|SHROOM3_uc003hkg.2_Missense_Mutation_p.R1019S	p.R1241S	NM_020859	NP_065910	WXS	Illumina HiSeq	Unspecified	Q8TF72	SHRM3_HUMAN	Lung(101;0.0903)		5	4676	+			1241					Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	c.3723G>T	CCDS3579.2	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915428	0.52546	.	.	ENSG00000138771	ENST00000296043	T	0.40756	1.02	5.48	1.76	0.24704	.	0.076243	0.53938	D	0.000056	T	0.58264	0.2110	M	0.75264	2.295	0.37241	D	0.906126	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.989;0.989;0.984	T	0.61710	-0.7007	10	0.87932	D	0	-26.8619	7.4848	0.27425	0.2575:0.1091:0.6334:0.0	.	1065;1241;1019	B4E244;Q8TF72;B3KY47	.;SHRM3_HUMAN;.	S	1241	ENSP00000296043:R1241S	ENSP00000296043:R1241S	R	+	3	2	SHROOM3	77882073	0.999000	0.42202	0.402000	0.26371	0.171000	0.22731	0.415000	0.21181	0.272000	0.22027	0.655000	0.94253	AGG		0.652	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859		6	21	1	0	1.06961e-07	0.00308	1.40518e-07	6	21				
FRAS1	80144	broad.mit.edu	37	4	79455609	79455609	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:79455609G>A	ENST00000264895.6	+	71	11372	c.10932G>A	c.(10930-10932)ctG>ctA	p.L3644L		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3640					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TTAGATTCCTGATACCCATTG	0.468																																							uc003hlb.2		NA																	0				large_intestine(5)	5						c.(10930-10932)CTG>CTA		Fraser syndrome 1							170.0	154.0	159.0					4																	79455609		1943	4134	6077	SO:0001819	synonymous_variant	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79455609G>A	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.10932G>A	4.37:g.79455609G>A			Somatic					p.L3644L	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			71	11372	+			3639			Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000264895.6	37	c.10932G>A	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	G	6.750	0.507267	0.12883	.	.	ENSG00000138759	ENST00000512123	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	T	0.70491	0.3230	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68914	-0.5283	4	.	.	.	.	14.1709	0.65510	0.0:0.0:0.8502:0.1498	.	.	.	.	N	1873	.	.	D	+	1	0	FRAS1	79674633	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	4.541000	0.60670	2.547000	0.85894	0.491000	0.48974	GAT		0.468	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				9	132	0	0	0	0.000978	0	9	132				
MEPE	56955	broad.mit.edu	37	4	88766489	88766489	+	Missense_Mutation	SNP	C	C	A	rs550948283|rs375278887		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:88766489C>A	ENST00000424957.3	+	4	542	c.469C>A	c.(469-471)Cca>Aca	p.P157T	MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000540395.1_Missense_Mutation_p.P44T|MEPE_ENST00000361056.3_Missense_Mutation_p.P157T|MEPE_ENST00000395102.4_Missense_Mutation_p.P188T|MEPE_ENST00000560249.1_Missense_Mutation_p.P44T|MEPE_ENST00000497649.2_Missense_Mutation_p.P133T	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	157					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		TATAATGGGGCCAGTGACTGC	0.408																																							uc003hqy.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(469-471)CCA>ACA		matrix, extracellular phosphoglycoprotein with							61.0	61.0	61.0					4																	88766489		2203	4300	6503	SO:0001583	missense	56955				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr4:88766489C>A	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.469C>A	4.37:g.88766489C>A	ENSP00000416984:p.Pro157Thr		Somatic				MEPE_uc010ikn.2_Missense_Mutation_p.P44T	p.P157T	NM_020203	NP_064588	WXS	Illumina HiSeq	Unspecified	Q9NQ76	MEPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000432)	4	508	+		Hepatocellular(203;0.114)	157					A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	37	c.469C>A	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.686907	0.48097	.	.	ENSG00000152595	ENST00000535138;ENST00000424957;ENST00000395102;ENST00000497649;ENST00000540395;ENST00000361056	T;T;T;T;T	0.45276	4.35;0.91;0.9;0.93;4.35	4.84	3.91	0.45181	.	0.434279	0.19962	N	0.102189	T	0.61022	0.2314	M	0.81497	2.545	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51585	-0.8687	10	0.52906	T	0.07	-6.0501	7.2083	0.25919	0.0:0.8791:0.0:0.1209	.	157	Q9NQ76	MEPE_HUMAN	T	157;157;188;133;44;157	ENSP00000416984:P157T;ENSP00000378534:P188T;ENSP00000422747:P133T;ENSP00000443491:P44T;ENSP00000354341:P157T	ENSP00000354341:P157T	P	+	1	0	MEPE	88985513	0.000000	0.05858	0.070000	0.20053	0.074000	0.17049	0.394000	0.20834	2.523000	0.85059	0.655000	0.94253	CCA		0.408	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1			20	29	1	0	2.27731e-05	0.001882	2.74424e-05	20	29				
RAP1GDS1	5910	broad.mit.edu	37	4	99358197	99358197	+	Silent	SNP	G	G	A	rs372036662		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:99358197G>A	ENST00000408927.3	+	14	1787	c.1674G>A	c.(1672-1674)ctG>ctA	p.L558L	RAP1GDS1_ENST00000264572.7_Silent_p.L467L|RAP1GDS1_ENST00000339360.5_Silent_p.L559L|RAP1GDS1_ENST00000408900.3_Silent_p.L509L|RAP1GDS1_ENST00000380158.4_Silent_p.L510L|RAP1GDS1_ENST00000453712.2_Silent_p.L558L	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	558					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		CCATGGTCCTGATATGTGCTC	0.323			T	NUP98	T-ALL																																		uc003htx.3		NA		Dom	yes		4	4q21-q25	5910	T	"""RAP1, GTP-GDP dissociation stimulator 1"""			L	NUP98		T-ALL		0				ovary(1)|lung(1)|breast(1)	3						c.(1672-1674)CTG>CTA		RAP1, GTP-GDP dissociation stimulator 1 isoform		G	,,,,,	0,3664		0,0,1832	111.0	105.0	107.0		1677,1674,1530,1527,1401,1674	3.2	1.0	4		107	1,8179		0,1,4089	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RAP1GDS1	NM_001100426.1,NM_001100427.1,NM_001100428.1,NM_001100429.1,NM_001100430.1,NM_021159.4	,,,,,	0,1,5921	AA,AG,GG		0.0122,0.0,0.0084	,,,,,	559/609,558/608,510/560,509/559,467/517,558/608	99358197	1,11843	1832	4090	5922	SO:0001819	synonymous_variant	5910						binding|GTPase activator activity	g.chr4:99358197G>A		CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.1674G>A	4.37:g.99358197G>A			Somatic				RAP1GDS1_uc003htw.3_Silent_p.L559L|RAP1GDS1_uc003htv.3_Silent_p.L558L|RAP1GDS1_uc003htz.3_Silent_p.L509L|RAP1GDS1_uc003hty.3_Silent_p.L510L|RAP1GDS1_uc003hua.3_Silent_p.L467L	p.L558L	NM_001100427	NP_001093897	WXS	Illumina HiSeq	Unspecified	P52306	GDS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)	14	1864	+			558					E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Silent	SNP	ENST00000408927.3	37	c.1674G>A	CCDS43253.1																																																																																				0.323	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363273.2	NM_001100426		5	25	0	0	0	0.000602	0	5	25				
ADH6	130	broad.mit.edu	37	4	100131439	100131439	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:100131439G>T	ENST00000237653.7	-	5	751	c.367C>A	c.(367-369)Ctg>Atg	p.L123M	ADH6_ENST00000504257.1_5'UTR|RP11-696N14.1_ENST00000506160.1_RNA|RP11-696N14.1_ENST00000500358.2_RNA|ADH6_ENST00000394897.1_Missense_Mutation_p.L123M|ADH6_ENST00000407820.2_Intron|ADH6_ENST00000394899.2_Missense_Mutation_p.L123M|RP11-696N14.1_ENST00000506454.1_RNA	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)	123					ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	TCAGACATCAGTTGGGTTTTT	0.333																																							uc003hup.3		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(367-369)CTG>ATG		class V alcohol dehydrogenase isoform 2	Abacavir(DB01048)|NADH(DB00157)						73.0	72.0	72.0					4																	100131439		2203	4300	6503	SO:0001583	missense	130				ethanol oxidation|response to ethanol|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|electron carrier activity|zinc ion binding	g.chr4:100131439G>T	AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.367C>A	4.37:g.100131439G>T	ENSP00000237653:p.Leu123Met		Somatic				uc003hum.1_Intron|ADH6_uc003huo.2_Missense_Mutation_p.L123M|ADH6_uc011cef.1_Intron|ADH6_uc010ile.2_Missense_Mutation_p.L123M	p.L123M	NM_000672	NP_000663	WXS	Illumina HiSeq	Unspecified	P28332	ADH6_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	5	461	-			123					B3KS45|Q58F53	Missense_Mutation	SNP	ENST00000237653.7	37	c.367C>A	CCDS3647.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626176	0.28978	.	.	ENSG00000172955	ENST00000394897;ENST00000394899;ENST00000237653	T;T;T	0.03689	3.84;3.84;3.84	3.93	-0.963	0.10330	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.356613	0.27151	N	0.020691	T	0.07818	0.0196	L	0.41710	1.295	0.09310	N	0.999999	P;D;D	0.76494	0.645;0.999;0.996	B;D;D	0.74348	0.411;0.983;0.958	T	0.14839	-1.0458	10	0.45353	T	0.12	-1.8472	6.8039	0.23766	0.3482:0.1244:0.5274:0.0	.	123;123;123	E9PBI1;P28332;P28332-2	.;ADH6_HUMAN;.	M	123	ENSP00000378358:L123M;ENSP00000378359:L123M;ENSP00000237653:L123M	ENSP00000237653:L123M	L	-	1	2	ADH6	100350462	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.128000	0.03247	-0.140000	0.11394	0.460000	0.39030	CTG		0.333	ADH6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253665.1	NM_000672		17	40	1	0	4.75885e-15	0.00499	7.53766e-15	17	40				
LEF1	51176	broad.mit.edu	37	4	109084820	109084820	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:109084820G>T	ENST00000265165.1	-	3	972	c.318C>A	c.(316-318)ccC>ccA	p.P106P	LEF1_ENST00000438313.2_Silent_p.P106P|LEF1_ENST00000510624.1_Silent_p.P38P|LEF1_ENST00000379951.2_Silent_p.P106P|LEF1_ENST00000512172.1_Silent_p.P38P	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	106	Pro-rich.				alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		TCGAGTAGGAGGGTCCCTTGT	0.423																																							uc003hyt.1		NA																	0				large_intestine(1)	1						c.(316-318)CCC>CCA		lymphoid enhancer-binding factor 1 isoform 1							138.0	125.0	129.0					4																	109084820		2203	4300	6503	SO:0001819	synonymous_variant	51176				canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding	g.chr4:109084820G>T		CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.318C>A	4.37:g.109084820G>T			Somatic				LEF1_uc011cfj.1_5'UTR|LEF1_uc011cfk.1_Silent_p.P38P|LEF1_uc003hyu.1_Silent_p.P106P|LEF1_uc003hyv.1_Silent_p.P106P|LEF1_uc010imb.1_RNA	p.P106P	NM_016269	NP_057353	WXS	Illumina HiSeq	Unspecified	Q9UJU2	LEF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000224)	3	973	-			106			Pro-rich.		B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Silent	SNP	ENST00000265165.1	37	c.318C>A	CCDS3679.1																																																																																				0.423	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2			10	38	1	0	2.74318e-10	0.006214	3.9272e-10	10	38				
ENPEP	2028	broad.mit.edu	37	4	111474593	111474593	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:111474593G>T	ENST00000265162.5	+	18	2966	c.2624G>T	c.(2623-2625)tGg>tTg	p.W875L		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	875					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		CAACTCAACTGGGACTATCTA	0.398																																							uc003iab.3		NA																	0				skin(3)|ovary(1)|breast(1)	5						c.(2623-2625)TGG>TTG		glutamyl aminopeptidase	L-Glutamic Acid(DB00142)						204.0	199.0	201.0					4																	111474593		2203	4300	6503	SO:0001583	missense	2028				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding	g.chr4:111474593G>T	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.2624G>T	4.37:g.111474593G>T	ENSP00000265162:p.Trp875Leu		Somatic					p.W875L	NM_001977	NP_001968	WXS	Illumina HiSeq	Unspecified	Q07075	AMPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	18	2966	+		Hepatocellular(203;0.217)	875			Extracellular (Potential).		Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	c.2624G>T	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904671	0.92035	.	.	ENSG00000138792	ENST00000265162	T	0.06068	3.35	5.4	5.4	0.78164	.	0.051844	0.85682	N	0.000000	T	0.37489	0.1005	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51450	-0.8704	10	0.72032	D	0.01	.	19.1712	0.93578	0.0:0.0:1.0:0.0	.	875	Q07075	AMPE_HUMAN	L	875	ENSP00000265162:W875L	ENSP00000265162:W875L	W	+	2	0	ENPEP	111694042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.383000	0.97214	2.524000	0.85096	0.650000	0.86243	TGG		0.398	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2			38	68	1	0	3.43241e-23	0.002222	5.98885e-23	38	68				
ANK2	287	broad.mit.edu	37	4	114274602	114274602	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:114274602G>T	ENST00000357077.4	+	38	4881	c.4828G>T	c.(4828-4830)Gaa>Taa	p.E1610*	ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Nonsense_Mutation_p.E1577*	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1610					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGCACCTTTAGAAATCACTGA	0.403																																							uc003ibe.3		NA																	0				central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(4828-4830)GAA>TAA		ankyrin 2 isoform 1							92.0	98.0	96.0					4																	114274602		2203	4300	6503	SO:0001587	stop_gained	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114274602G>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4828G>T	4.37:g.114274602G>T	ENSP00000349588:p.Glu1610*		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Nonsense_Mutation_p.E1625*	p.E1610*	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	4928	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	1577					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Nonsense_Mutation	SNP	ENST00000357077.4	37	c.4828G>T	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	42	9.486622	0.99184	.	.	ENSG00000145362	ENST00000503423;ENST00000504454;ENST00000357077;ENST00000264366	.	.	.	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	19.1882	0.93653	0.0:0.0:1.0:0.0	.	.	.	.	X	1523;1625;1610;1577	.	ENSP00000264366:E1577X	E	+	1	0	ANK2	114494051	1.000000	0.71417	0.456000	0.27044	0.832000	0.47134	7.694000	0.84235	2.510000	0.84645	0.655000	0.94253	GAA		0.403	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		26	26	1	0	4.72057e-08	0.003954	6.28784e-08	26	26				
ANK2	287	broad.mit.edu	37	4	114279870	114279870	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:114279870A>T	ENST00000357077.4	+	38	10149	c.10096A>T	c.(10096-10098)Acc>Tcc	p.T3366S	ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.T3333S	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3366					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGATCTAGACACCTCTGTCCA	0.463																																							uc003ibe.3		NA																	0				central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(10096-10098)ACC>TCC		ankyrin 2 isoform 1							107.0	108.0	108.0					4																	114279870		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114279870A>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10096A>T	4.37:g.114279870A>T	ENSP00000349588:p.Thr3366Ser		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.T668S|ANK2_uc011cgb.1_Missense_Mutation_p.T3381S	p.T3366S	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	10196	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	3333					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.10096A>T	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	A	0.276	-0.989507	0.02162	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	T;T;D	0.95690	-0.15;-0.15;-3.78	5.36	-10.7	0.00240	.	1.567130	0.03907	N	0.281210	T	0.79896	0.4525	N	0.02802	-0.49	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.75252	-0.3383	10	0.07030	T	0.85	.	1.802	0.03073	0.4247:0.2868:0.1514:0.1371	.	3333;3366	Q01484;Q01484-4	ANK2_HUMAN;.	S	3366;3333;376	ENSP00000349588:T3366S;ENSP00000264366:T3333S;ENSP00000422498:T376S	ENSP00000264366:T3333S	T	+	1	0	ANK2	114499319	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.118000	0.15605	-1.411000	0.02032	-0.646000	0.03943	ACC		0.463	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		35	62	0	0	0	0.003271	0	35	62				
ANK2	287	broad.mit.edu	37	4	114286264	114286264	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:114286264C>A	ENST00000357077.4	+	41	11011	c.10958C>A	c.(10957-10959)aCa>aAa	p.T3653K	ANK2_ENST00000506722.1_Missense_Mutation_p.T1559K|ANK2_ENST00000509550.1_Missense_Mutation_p.T744K|ANK2_ENST00000510275.2_Missense_Mutation_p.T220K|ANK2_ENST00000394537.3_Missense_Mutation_p.T1568K|ANK2_ENST00000264366.6_Missense_Mutation_p.T3620K	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3653	Death 2. {ECO:0000255|PROSITE- ProRule:PRU00064}.		T -> K (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T3653K(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GAGACCAACACAGAACCTCTC	0.413																																							uc003ibe.3		NA																	1	Substitution - Missense(1)	p.T3653K(1)	large_intestine(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(10957-10959)ACA>AAA		ankyrin 2 isoform 1							160.0	138.0	146.0					4																	114286264		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114286264C>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10958C>A	4.37:g.114286264C>A	ENSP00000349588:p.Thr3653Lys		Somatic				ANK2_uc003ibd.3_Missense_Mutation_p.T1559K|ANK2_uc003ibf.3_Missense_Mutation_p.T1568K|ANK2_uc011cgc.1_Missense_Mutation_p.T744K|ANK2_uc003ibg.3_Missense_Mutation_p.T552K|ANK2_uc003ibh.3_Missense_Mutation_p.T242K|ANK2_uc011cgd.1_Missense_Mutation_p.T955K	p.T3653K	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	41	11058	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	3620		T -> K (in a colorectal cancer sample; somatic mutation).	Death.		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.10958C>A	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.541|3.541	-0.093715|-0.093715	0.07053|0.07053	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000514960|ENST00000506722;ENST00000431447;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275;ENST00000505342	.|D;D;D;D;D;D;D	.|0.93426	.|-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	5.3|5.3	3.47|3.47	0.39725|0.39725	.|.	.|1.068070	.|0.07362	.|N	.|0.884274	D|D	0.87406|0.87406	0.6169|0.6169	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999999|0.999999	.|P;P;D;P;P;P	.|0.53312	.|0.891;0.606;0.959;0.534;0.73;0.589	.|P;B;P;B;B;B	.|0.50049	.|0.492;0.429;0.629;0.149;0.299;0.288	T|T	0.73839|0.73839	-0.3856|-0.3856	5|10	.|0.06757	.|T	.|0.87	.|.	9.4933|9.4933	0.38974|0.38974	0.0:0.6588:0.0:0.3412|0.0:0.6588:0.0:0.3412	.|.	.|744;603;569;1568;3653;1559	.|E9PCH6;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.|.;.;.;.;.;.	Q|K	569|1559;603;1568;3653;3620;1559;744;220;663	.|ENSP00000421067:T1559K;ENSP00000378044:T1568K;ENSP00000349588:T3653K;ENSP00000264366:T3620K;ENSP00000426944:T744K;ENSP00000421023:T220K;ENSP00000422498:T663K	.|ENSP00000264366:T3620K	H|T	+|+	3|2	2|0	ANK2|ANK2	114505713|114505713	0.118000|0.118000	0.22208|0.22208	0.365000|0.365000	0.25901|0.25901	0.151000|0.151000	0.21798|0.21798	0.369000|0.369000	0.20416|0.20416	0.202000|0.202000	0.20498|0.20498	-1.267000|-1.267000	0.01435|0.01435	CAC|ACA		0.413	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		12	59	1	0	7.03913e-09	0.001368	9.72415e-09	12	59				
ANXA5	308	broad.mit.edu	37	4	122589682	122589682	+	Splice_Site	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:122589682C>T	ENST00000296511.5	-	13	1189	c.904G>A	c.(904-906)Gga>Aga	p.G302R	ANXA5_ENST00000501272.2_Splice_Site_p.G242R|ANXA5_ENST00000515017.1_Splice_Site_p.G202R	NM_001154.3	NP_001145.1	P08758	ANXA5_HUMAN	annexin A5	302					blood coagulation (GO:0007596)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of coagulation (GO:0050819)|response to organic substance (GO:0010033)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipase inhibitor activity (GO:0004859)|phospholipid binding (GO:0005543)			NS(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)	15						GATGTATCTCCCTGAAACCAA	0.423																																					Pancreas(191;1279 2147 16046 17806 52646)|GBM(88;628 1285 16585 32846 50188)	Pancreas(191;1279 2147 16046 17806 52646)|GBM(88;628 1285 16585 32846 50188)	uc003idu.3		NA																	0				ovary(1)	1						c.(904-906)GGA>AGA		annexin 5							146.0	128.0	134.0					4																	122589682		2203	4300	6503	SO:0001630	splice_region_variant	308				anti-apoptosis|blood coagulation|negative regulation of coagulation|signal transduction	cytoplasm	calcium ion binding|calcium-dependent phospholipid binding|phospholipase inhibitor activity	g.chr4:122589682C>T	U05770	CCDS3720.1	4q27	2008-02-05			ENSG00000164111	ENSG00000164111		"""Annexins"""	543	protein-coding gene	gene with protein product		131230		ENX2, ANX5		2960376	Standard	NM_001154		Approved		uc003idv.4	P08758	OTTHUMG00000133034	ENST00000296511.5:c.904-1G>A	4.37:g.122589682C>T			Somatic				ANXA5_uc003idv.3_Missense_Mutation_p.G302R|ANXA5_uc003idw.3_RNA|ANXA5_uc010inm.2_Missense_Mutation_p.G258R|ANXA5_uc010inn.2_Missense_Mutation_p.G242R|ANXA5_uc010ino.2_Missense_Mutation_p.G202R	p.G302R	NM_001154	NP_001145	WXS	Illumina HiSeq	Unspecified	P08758	ANXA5_HUMAN			12	974	-			302			Annexin 4.		D3DNW7|Q6FHB3|Q6FI16|Q8WV69|Q9UDH9	Missense_Mutation	SNP	ENST00000296511.5	37	c.904G>A	CCDS3720.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784285	0.49997	.	.	ENSG00000164111	ENST00000296511;ENST00000512232;ENST00000501272;ENST00000515017	T;T;T	0.12361	2.69;2.69;2.69	5.77	-1.79	0.07932	Annexin repeat, conserved site (1);	0.720473	0.14902	N	0.291768	T	0.39410	0.1077	M	0.90369	3.11	0.24084	N	0.995933	P;B;B;B	0.43701	0.815;0.423;0.042;0.423	P;B;B;P	0.59825	0.864;0.434;0.048;0.539	T	0.37430	-0.9706	10	0.87932	D	0	.	13.7887	0.63126	0.0:0.3101:0.0:0.6899	.	202;242;258;302	D6RBE9;D6RBL5;E7ENQ5;P08758	.;.;.;ANXA5_HUMAN	R	302;258;242;202	ENSP00000296511:G302R;ENSP00000424106:G242R;ENSP00000424199:G202R	ENSP00000296511:G302R	G	-	1	0	ANXA5	122809132	0.008000	0.16893	0.109000	0.21407	0.485000	0.33311	-0.132000	0.10467	-0.785000	0.04522	-0.355000	0.07637	GGA		0.423	ANXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256636.2	NM_001154	Missense_Mutation	5	56	0	0	0	0.00308	0	5	56				
INTU	27152	broad.mit.edu	37	4	128577843	128577843	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:128577843G>T	ENST00000335251.6	+	3	838	c.735G>T	c.(733-735)gaG>gaT	p.E245D	INTU_ENST00000296461.5_Missense_Mutation_p.E245D	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	245	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						AAAACATCGAGAGAGTTCTGT	0.313																																							uc003ifk.1		NA																	0				ovary(1)	1						c.(733-735)GAG>GAT		PDZ domain containing 6							167.0	160.0	162.0					4																	128577843		2203	4300	6503	SO:0001583	missense	27152							g.chr4:128577843G>T	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.735G>T	4.37:g.128577843G>T	ENSP00000334003:p.Glu245Asp		Somatic				INTU_uc011cgq.1_RNA	p.E245D	NM_015693	NP_056508	WXS	Illumina HiSeq	Unspecified	Q9ULD6	PDZD6_HUMAN			3	805	+			245			PDZ.		A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	37	c.735G>T	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235274	0.22626	.	.	ENSG00000164066	ENST00000335251;ENST00000296461	T;T	0.42900	0.96;0.96	4.42	0.385	0.16249	PDZ/DHR/GLGF (3);	0.054412	0.64402	D	0.000001	T	0.20414	0.0491	N	0.17082	0.46	0.54753	D	0.999987	B	0.30439	0.279	B	0.28305	0.088	T	0.03335	-1.1047	10	0.30854	T	0.27	-18.3612	5.2683	0.15611	0.409:0.1462:0.4448:0.0	.	245	Q9ULD6	PDZD6_HUMAN	D	245	ENSP00000334003:E245D;ENSP00000296461:E245D	ENSP00000296461:E245D	E	+	3	2	INTU	128797293	0.977000	0.34250	1.000000	0.80357	0.810000	0.45777	0.088000	0.14979	0.207000	0.20607	0.591000	0.81541	GAG		0.313	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707		14	31	1	0	1.99824e-07	0.00499	2.59461e-07	14	31				
INTU	27152	broad.mit.edu	37	4	128626894	128626894	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:128626894G>T	ENST00000335251.6	+	11	1818	c.1715G>T	c.(1714-1716)cGa>cTa	p.R572L	INTU_ENST00000512995.1_3'UTR	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	572					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						CATCACCTCCGACCTTTGGCA	0.448																																							uc003ifk.1		NA																	0				ovary(1)	1						c.(1714-1716)CGA>CTA		PDZ domain containing 6							151.0	141.0	144.0					4																	128626894		2203	4300	6503	SO:0001583	missense	27152							g.chr4:128626894G>T	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1715G>T	4.37:g.128626894G>T	ENSP00000334003:p.Arg572Leu		Somatic				INTU_uc011cgq.1_RNA	p.R572L	NM_015693	NP_056508	WXS	Illumina HiSeq	Unspecified	Q9ULD6	PDZD6_HUMAN			11	1785	+			572					A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	37	c.1715G>T	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	G	4.801	0.149015	0.09185	.	.	ENSG00000164066	ENST00000335251;ENST00000506283	T;T	0.30182	1.54;1.54	4.83	2.4	0.29515	.	0.621931	0.16704	N	0.202983	T	0.24547	0.0595	L	0.32530	0.975	0.24621	N	0.993672	B	0.15141	0.012	B	0.19148	0.024	T	0.20739	-1.0266	10	0.56958	D	0.05	-0.8617	12.1385	0.53984	0.9235:0.0:0.0765:0.0	.	572	Q9ULD6	PDZD6_HUMAN	L	572;86	ENSP00000334003:R572L;ENSP00000426171:R86L	ENSP00000334003:R572L	R	+	2	0	INTU	128846344	0.608000	0.26966	0.091000	0.20842	0.015000	0.08874	2.798000	0.47884	0.347000	0.23924	-1.232000	0.01568	CGA		0.448	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707		46	79	1	0	7.05377e-20	0.00361	1.19646e-19	46	79				
PRMT9	90826	broad.mit.edu	37	4	148575513	148575513	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:148575513T>A	ENST00000322396.6	-	9	1777	c.1535A>T	c.(1534-1536)gAt>gTt	p.D512V	PRMT10_ENST00000541232.1_Missense_Mutation_p.D399V|TMEM184C_ENST00000508208.1_Intron	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		512						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						CTCTACAGCATCTGGTTTACT	0.383																																							uc003ilc.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1534-1536)GAT>GTT		protein arginine methyltransferase 10							161.0	153.0	156.0					4																	148575513		2203	4300	6503	SO:0001583	missense	90826					cytoplasm	binding|protein methyltransferase activity	g.chr4:148575513T>A																												ENST00000322396.6:c.1535A>T	4.37:g.148575513T>A	ENSP00000314396:p.Asp512Val		Somatic				PRMT10_uc003ilb.2_Missense_Mutation_p.D156V|PRMT10_uc003ild.2_Missense_Mutation_p.D399V	p.D512V	NM_138364	NP_612373	WXS	Illumina HiSeq	Unspecified	Q6P2P2	ANM10_HUMAN			9	1677	-			512					A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Missense_Mutation	SNP	ENST00000322396.6	37	c.1535A>T	CCDS3771.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.830850	0.50845	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	T;T	0.53423	0.62;0.62	6.04	4.87	0.63330	.	0.378177	0.32273	N	0.006331	T	0.46268	0.1384	M	0.65975	2.015	0.58432	D	0.999999	B	0.29341	0.242	B	0.26202	0.067	T	0.44802	-0.9304	10	0.59425	D	0.04	.	11.892	0.52635	0.0:0.0673:0.0:0.9327	.	512	Q6P2P2	ANM10_HUMAN	V	512;399	ENSP00000314396:D512V;ENSP00000439508:D399V	ENSP00000314396:D512V	D	-	2	0	PRMT10	148794963	0.899000	0.30636	0.876000	0.34364	0.913000	0.54294	1.406000	0.34646	1.120000	0.41904	0.459000	0.35465	GAT		0.383	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1			26	46	0	0	0	0.004656	0	26	46				
KIAA0922	23240	broad.mit.edu	37	4	154525336	154525336	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:154525336G>A	ENST00000409663.3	+	25	3221	c.3169G>A	c.(3169-3171)Gaa>Aaa	p.E1057K	KIAA0922_ENST00000440693.1_Missense_Mutation_p.E974K|KIAA0922_ENST00000409959.3_Missense_Mutation_p.E1058K	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1057						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				GAATAAAGAAGAAAACACACT	0.378																																							uc003inm.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(3169-3171)GAA>AAA		hypothetical protein LOC23240 isoform 2							71.0	73.0	72.0					4																	154525336		2203	4300	6503	SO:0001583	missense	23240					integral to membrane		g.chr4:154525336G>A	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.3169G>A	4.37:g.154525336G>A	ENSP00000386574:p.Glu1057Lys		Somatic				KIAA0922_uc010ipp.2_Missense_Mutation_p.E1058K|KIAA0922_uc010ipq.2_Missense_Mutation_p.E826K	p.E1057K	NM_015196	NP_056011	WXS	Illumina HiSeq	Unspecified	A2VDJ0	T131L_HUMAN			25	3221	+	all_hematologic(180;0.093)	Renal(120;0.118)	1057			Cytoplasmic (Potential).		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	c.3169G>A	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.074775	0.76415	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.30182	1.87;1.54;1.87;1.56	5.97	5.97	0.96955	.	0.147710	0.64402	D	0.000011	T	0.51534	0.1680	L	0.58101	1.795	0.53005	D	0.999969	D;P;P	0.71674	0.998;0.929;0.883	P;P;B	0.60789	0.879;0.539;0.338	T	0.35076	-0.9803	10	0.45353	T	0.12	-8.7868	20.428	0.99075	0.0:0.0:1.0:0.0	.	974;1058;1057	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	K	1057;974;1058;835	ENSP00000386574:E1057K;ENSP00000409663:E974K;ENSP00000386787:E1058K;ENSP00000240487:E835K	ENSP00000240487:E835K	E	+	1	0	KIAA0922	154744786	1.000000	0.71417	0.255000	0.24374	0.997000	0.91878	6.649000	0.74364	2.837000	0.97791	0.655000	0.94253	GAA		0.378	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196		11	57	0	0	0	0.008291	0	11	57				
PDGFC	56034	broad.mit.edu	37	4	157732074	157732074	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:157732074C>T	ENST00000502773.1	-	3	900	c.410G>A	c.(409-411)gGa>gAa	p.G137E	PDGFC_ENST00000542208.1_Intron|PDGFC_ENST00000541126.1_5'UTR|PDGFC_ENST00000422544.2_Missense_Mutation_p.G137E	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	137	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		AATTTGATTTCCTTTAGAAAT	0.398																																							uc003iph.1		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(409-411)GGA>GAA		platelet-derived growth factor C precursor							87.0	88.0	88.0					4																	157732074		2203	4300	6503	SO:0001583	missense	56034				central nervous system development|platelet-derived growth factor receptor signaling pathway|positive regulation of cell division|positive regulation of DNA replication|positive regulation of fibroblast proliferation|vascular endothelial growth factor receptor signaling pathway	endoplasmic reticulum lumen|extracellular space|Golgi membrane|nucleus	cell surface binding|growth factor activity|platelet-derived growth factor receptor binding|protein homodimerization activity	g.chr4:157732074C>T	AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.410G>A	4.37:g.157732074C>T	ENSP00000422464:p.Gly137Glu		Somatic				PDGFC_uc003ipi.1_5'UTR|PDGFC_uc011cis.1_5'UTR|PDGFC_uc011cir.1_Intron	p.G137E	NM_016205	NP_057289	WXS	Illumina HiSeq	Unspecified	Q9NRA1	PDGFC_HUMAN		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)	3	901	-	all_hematologic(180;0.24)	Renal(120;0.0458)	137			CUB.		B4DU34|B9EGR8|Q4W5M9|Q9UL22	Missense_Mutation	SNP	ENST00000502773.1	37	c.410G>A	CCDS3795.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779432	0.90195	.	.	ENSG00000145431	ENST00000502773;ENST00000422544;ENST00000543489	T;T	0.38887	1.11;1.11	5.08	5.08	0.68730	CUB (5);	0.000000	0.85682	D	0.000000	T	0.66655	0.2811	M	0.75884	2.315	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70385	-0.4886	10	0.72032	D	0.01	-25.7334	18.8259	0.92119	0.0:1.0:0.0:0.0	.	137	Q9NRA1	PDGFC_HUMAN	E	137	ENSP00000422464:G137E;ENSP00000410048:G137E	ENSP00000410048:G137E	G	-	2	0	PDGFC	157951524	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.445000	0.80570	2.523000	0.85059	0.563000	0.77884	GGA		0.398	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366123.1			20	28	0	0	0	0.007413	0	20	28				
MARCH1	55016	broad.mit.edu	37	4	164534471	164534471	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:164534471G>A	ENST00000503008.1	-	5	1213	c.237C>T	c.(235-237)atC>atT	p.I79I	MARCH1_ENST00000274056.7_Silent_p.I79I|MARCH1_ENST00000339875.5_Silent_p.I62I|MARCH1_ENST00000514618.1_Silent_p.I79I	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase	79					antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CTTACCTGCAGATGTCCTGAG	0.428																																							uc003iqs.1		NA																	0				lung(2)	2						c.(235-237)ATC>ATT		membrane-associated RING-CH protein I							106.0	103.0	104.0					4																	164534471		2203	4300	6503	SO:0001819	synonymous_variant	55016				antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr4:164534471G>A	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.237C>T	4.37:g.164534471G>A			Somatic				MARCH1_uc003iqr.1_Silent_p.I62I	p.I79I	NM_017923	NP_060393	WXS	Illumina HiSeq	Unspecified	Q8TCQ1	MARH1_HUMAN			5	1214	-	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)	79			RING-CH-type.		D3DP29|Q9NWR0	Silent	SNP	ENST00000503008.1	37	c.237C>T	CCDS54814.1																																																																																				0.428	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923		7	66	0	0	0	0.004482	0	7	66				
DDX60	55601	broad.mit.edu	37	4	169196580	169196580	+	Silent	SNP	C	C	G	rs555343743		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:169196580C>G	ENST00000393743.3	-	16	2511	c.2220G>C	c.(2218-2220)ctG>ctC	p.L740L		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	740					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CCATGTATTGCAGTTGGAACC	0.403																																							uc003irp.2		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2218-2220)CTG>CTC		DEAD (Asp-Glu-Ala-Asp) box polypeptide 60							102.0	99.0	100.0					4																	169196580		2203	4300	6503	SO:0001819	synonymous_variant	55601						ATP binding|ATP-dependent helicase activity|RNA binding	g.chr4:169196580C>G	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.2220G>C	4.37:g.169196580C>G			Somatic					p.L740L	NM_017631	NP_060101	WXS	Illumina HiSeq	Unspecified	Q8IY21	DDX60_HUMAN		GBM - Glioblastoma multiforme(119;0.0485)	16	2512	-		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)	740					Q6PK35|Q9NVE3	Silent	SNP	ENST00000393743.3	37	c.2220G>C	CCDS34097.1																																																																																				0.403	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631		13	33	0	0	0	0.001855	0	13	33				
IRX1	79192	broad.mit.edu	37	5	3599534	3599534	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:3599534G>A	ENST00000302006.3	+	2	524	c.472G>A	c.(472-474)Ggc>Agc	p.G158S	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	158					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CCCCACCAAGGGCGAGAAGAT	0.637																																							uc003jde.2		NA																	0				ovary(1)|pancreas(1)	2						c.(472-474)GGC>AGC		iroquois homeobox protein 1							160.0	124.0	136.0					5																	3599534		2203	4298	6501	SO:0001583	missense	79192					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:3599534G>A	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.472G>A	5.37:g.3599534G>A	ENSP00000305244:p.Gly158Ser		Somatic					p.G158S	NM_024337	NP_077313	WXS	Illumina HiSeq	Unspecified	P78414	IRX1_HUMAN			2	524	+			158			Homeobox; TALE-type.		Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	c.472G>A	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	G	33	5.235912	0.95240	.	.	ENSG00000170549	ENST00000302006	D	0.91068	-2.78	4.81	4.81	0.61882	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.89403	0.6705	N	0.04162	-0.26	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92033	0.5635	10	0.49607	T	0.09	.	17.5082	0.87753	0.0:0.0:1.0:0.0	.	158	P78414	IRX1_HUMAN	S	158	ENSP00000305244:G158S	ENSP00000305244:G158S	G	+	1	0	IRX1	3652534	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.528000	0.98046	2.173000	0.68751	0.655000	0.94253	GGC		0.637	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337		15	94	0	0	0	0.00499	0	15	94				
SEMA5A	9037	broad.mit.edu	37	5	9122921	9122921	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:9122921A>T	ENST00000382496.5	-	14	2293	c.1628T>A	c.(1627-1629)tTt>tAt	p.F543Y		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	543	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CCACACACCAAAGTGCCCATC	0.547																																							uc003jek.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1627-1629)TTT>TAT		semaphorin 5A precursor							62.0	62.0	62.0					5																	9122921		2203	4300	6503	SO:0001583	missense	9037				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane		g.chr5:9122921A>T	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1628T>A	5.37:g.9122921A>T	ENSP00000371936:p.Phe543Tyr		Somatic					p.F543Y	NM_003966	NP_003957	WXS	Illumina HiSeq	Unspecified	Q13591	SEM5A_HUMAN			14	2340	-			543			Extracellular (Potential).|TSP type-1 1.		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	c.1628T>A	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	A	8.975	0.973991	0.18736	.	.	ENSG00000112902	ENST00000382496	T	0.17854	2.25	4.95	2.29	0.28610	.	0.165132	0.56097	N	0.000037	T	0.09247	0.0228	N	0.13327	0.33	0.25793	N	0.984595	B	0.11235	0.004	B	0.12156	0.007	T	0.25606	-1.0127	10	0.33940	T	0.23	.	8.9486	0.35773	0.7081:0.0:0.0:0.2919	.	543	Q13591	SEM5A_HUMAN	Y	543	ENSP00000371936:F543Y	ENSP00000371936:F543Y	F	-	2	0	SEMA5A	9175921	1.000000	0.71417	0.238000	0.24106	0.083000	0.17756	4.833000	0.62766	0.801000	0.34066	0.528000	0.53228	TTT		0.547	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			19	95	0	0	0	0.007413	0	19	95				
CTNND2	1501	broad.mit.edu	37	5	11022887	11022887	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:11022887C>A	ENST00000304623.8	-	17	3182	c.2993G>T	c.(2992-2994)gGa>gTa	p.G998V	CTNND2_ENST00000503622.1_Missense_Mutation_p.G661V|CTNND2_ENST00000458100.2_Missense_Mutation_p.G565V|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.G940V|CTNND2_ENST00000511377.1_Missense_Mutation_p.G907V	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	998					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TTACTTATCTCCTTTGCTTTT	0.483																																							uc003jfa.1		NA																	0				large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(2992-2994)GGA>GTA		catenin (cadherin-associated protein), delta 2							136.0	118.0	124.0					5																	11022887		2203	4300	6503	SO:0001583	missense	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11022887C>A	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2993G>T	5.37:g.11022887C>A	ENSP00000307134:p.Gly998Val		Somatic				CTNND2_uc010itt.2_Missense_Mutation_p.G907V|CTNND2_uc011cmy.1_Missense_Mutation_p.G661V|CTNND2_uc011cmz.1_Missense_Mutation_p.G565V|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.G590V	p.G998V	NM_001332	NP_001323	WXS	Illumina HiSeq	Unspecified	Q9UQB3	CTND2_HUMAN			17	3138	-			998			ARM 9.		B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	c.2993G>T	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745858	0.89663	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	T;T;T;T;T	0.81163	-1.31;-1.46;-1.24;-1.31;-1.34	5.64	5.64	0.86602	Armadillo-like helical (1);Armadillo-type fold (1);	0.059848	0.64402	D	0.000002	D	0.89090	0.6616	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.997	D	0.89456	0.3733	10	0.87932	D	0	-11.6309	19.7154	0.96115	0.0:1.0:0.0:0.0	.	661;590;998	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	V	998;940;907;93;565;661	ENSP00000307134:G998V;ENSP00000352661:G940V;ENSP00000426510:G907V;ENSP00000391155:G565V;ENSP00000426887:G661V	ENSP00000307134:G998V	G	-	2	0	CTNND2	11075887	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.424000	0.80242	2.664000	0.90586	0.655000	0.94253	GGA		0.483	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		30	47	1	0	2.80507e-11	0.002445	4.09455e-11	30	47				
DNAH5	1767	broad.mit.edu	37	5	13885257	13885257	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:13885257T>A	ENST00000265104.4	-	19	2928	c.2824A>T	c.(2824-2826)Acg>Tcg	p.T942S	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	942	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTTTTCCTCGTGACTGTCGTC	0.418									Kartagener syndrome																														uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(2824-2826)ACG>TCG		dynein, axonemal, heavy chain 5							102.0	100.0	101.0					5																	13885257		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13885257T>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2824A>T	5.37:g.13885257T>A	ENSP00000265104:p.Thr942Ser		Somatic					p.T942S	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			19	2866	-	Lung NSC(4;0.00476)		942			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.2824A>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	8.223	0.803010	0.16397	.	.	ENSG00000039139	ENST00000265104	T	0.22336	1.96	5.73	-10.3	0.00346	.	1.706560	0.02551	N	0.095721	T	0.05502	0.0145	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25950	-1.0117	10	0.09338	T	0.73	.	1.122	0.01727	0.1909:0.2525:0.3117:0.2448	.	942	Q8TE73	DYH5_HUMAN	S	942	ENSP00000265104:T942S	ENSP00000265104:T942S	T	-	1	0	DNAH5	13938257	.	.	0.000000	0.03702	0.038000	0.13279	.	.	-2.292000	0.00665	-0.301000	0.09380	ACG		0.418	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		23	53	0	0	0	0.00278	0	23	53				
PRDM9	56979	broad.mit.edu	37	5	23522775	23522775	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:23522775C>A	ENST00000296682.3	+	8	845	c.663C>A	c.(661-663)ccC>ccA	p.P221P		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	221					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CCCATGGGCCCCCTACATTTG	0.532										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(661-663)CCC>CCA		PR domain containing 9							51.0	50.0	50.0					5																	23522775		2203	4300	6503	SO:0001819	synonymous_variant	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23522775C>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.663C>A	5.37:g.23522775C>A		HNSCC(3;0.000094)	Somatic					p.P221P	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			8	845	+			221					B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	c.663C>A	CCDS43307.1																																																																																				0.532	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		16	46	1	0	2.23348e-06	0.004007	2.78666e-06	16	46				
DROSHA	29102	broad.mit.edu	37	5	31495408	31495408	+	Silent	SNP	C	C	A	rs200983619		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:31495408C>A	ENST00000511367.2	-	11	1984	c.1740G>T	c.(1738-1740)ccG>ccT	p.P580P	DROSHA_ENST00000344624.3_Silent_p.P580P|DROSHA_ENST00000442743.1_Silent_p.P543P|DROSHA_ENST00000513349.1_Silent_p.P543P	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	580	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						AGTTCGTAGGCGGGGAGACTG	0.383																																							uc003jhg.2		NA																	0					0						c.(1738-1740)CCG>CCT		ribonuclease III, nuclear isoform 1							62.0	65.0	64.0					5																	31495408		1805	4079	5884	SO:0001819	synonymous_variant	29102				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity	g.chr5:31495408C>A	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.1740G>T	5.37:g.31495408C>A			Somatic				RNASEN_uc003jhh.2_Silent_p.P543P|RNASEN_uc003jhi.2_Silent_p.P543P|RNASEN_uc010iui.1_Silent_p.P503P	p.P580P	NM_013235	NP_037367	WXS	Illumina HiSeq	Unspecified	Q9NRR4	RNC_HUMAN			11	2099	-			580			Necessary for interaction with DGCR8 and pri-miRNA processing activity.		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Silent	SNP	ENST00000511367.2	37	c.1740G>T	CCDS47195.1	.	.	.	.	.	.	.	.	.	.	C	8.315	0.823057	0.16678	.	.	ENSG00000113360	ENST00000512076	.	.	.	5.43	-3.49	0.04724	.	.	.	.	.	T	0.39358	0.1075	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34229	-0.9837	4	.	.	.	-12.9013	2.5835	0.04824	0.2349:0.4362:0.1333:0.1956	.	.	.	.	S	342	.	.	A	-	1	0	DROSHA	31531165	0.138000	0.22547	0.989000	0.46669	0.894000	0.52154	-0.788000	0.04614	-0.490000	0.06707	-0.976000	0.02587	GCC		0.383	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235		10	18	1	0	3.86212e-05	0.008291	4.60431e-05	10	18				
C7	730	broad.mit.edu	37	5	40945382	40945382	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:40945382C>T	ENST00000313164.9	+	7	1009	c.650C>T	c.(649-651)tCa>tTa	p.S217L		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	217	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				GAACACACATCATCTAGTCGG	0.303																																							uc003jmh.2		NA																	0					0						c.(649-651)TCA>TTA		complement component 7 precursor							147.0	134.0	138.0					5																	40945382		1860	4108	5968	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40945382C>T	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.650C>T	5.37:g.40945382C>T	ENSP00000322061:p.Ser217Leu		Somatic				C7_uc011cpn.1_Intron	p.S217L	NM_000587	NP_000578	WXS	Illumina HiSeq	Unspecified	P10643	CO7_HUMAN			7	764	+		Ovarian(839;0.0112)	217			MACPF.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.650C>T	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.565601	0.27915	.	.	ENSG00000112936	ENST00000313164;ENST00000515157	T	0.65549	-0.16	5.67	3.88	0.44766	Membrane attack complex component/perforin (MACPF) domain (1);	0.791459	0.11695	N	0.538461	T	0.59865	0.2225	M	0.75447	2.3	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.50056	-0.8872	10	0.27082	T	0.32	-7.726	8.8831	0.35387	0.0:0.7704:0.1499:0.0797	.	217	P10643	CO7_HUMAN	L	217	ENSP00000322061:S217L	ENSP00000322061:S217L	S	+	2	0	C7	40981139	0.990000	0.36364	0.006000	0.13384	0.011000	0.07611	3.577000	0.53885	0.848000	0.35191	-0.291000	0.09656	TCA		0.303	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			5	29	0	0	0	0.000602	0	5	29				
MROH2B	133558	broad.mit.edu	37	5	41048553	41048553	+	Silent	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:41048553A>G	ENST00000399564.4	-	16	2007	c.1557T>C	c.(1555-1557)ccT>ccC	p.P519P	MROH2B_ENST00000506092.2_Silent_p.P74P	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	519																	CTAAACTGGCAGGCATAGATA	0.423																																							uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(1555-1557)CCT>CCC		HEAT repeat family member 7B2							70.0	64.0	66.0					5																	41048553		1851	4095	5946	SO:0001819	synonymous_variant	133558						binding	g.chr5:41048553A>G		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1557T>C	5.37:g.41048553A>G			Somatic				HEATR7B2_uc003jmi.3_Silent_p.P74P	p.P519P	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			16	2047	-			519					Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	c.1557T>C	CCDS47202.1																																																																																				0.423	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		12	27	0	0	0	0.000978	0	12	27				
HCN1	348980	broad.mit.edu	37	5	45262862	45262862	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:45262862C>A	ENST00000303230.4	-	8	1891	c.1834G>T	c.(1834-1836)Ggt>Tgt	p.G612C		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	612					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TTGAAAACACCAGTGTTCAGA	0.413																																							uc003jok.2		NA																	0				ovary(1)	1						c.(1834-1836)GGT>TGT		hyperpolarization activated cyclic							90.0	79.0	83.0					5																	45262862		2203	4300	6503	SO:0001583	missense	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45262862C>A	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1834G>T	5.37:g.45262862C>A	ENSP00000307342:p.Gly612Cys		Somatic					p.G612C	NM_021072	NP_066550	WXS	Illumina HiSeq	Unspecified	O60741	HCN1_HUMAN			8	1859	-			612			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000303230.4	37	c.1834G>T	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.300848	0.81136	.	.	ENSG00000164588	ENST00000303230	D	0.92495	-3.05	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000003	D	0.95915	0.8670	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	D	0.95403	0.8491	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	612	O60741	HCN1_HUMAN	C	612	ENSP00000307342:G612C	ENSP00000307342:G612C	G	-	1	0	HCN1	45298619	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GGT		0.413	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		11	49	1	0	2.80697e-09	0.000978	3.92625e-09	11	49				
TTC37	9652	broad.mit.edu	37	5	94863776	94863776	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:94863776C>T	ENST00000358746.2	-	13	1373	c.1075G>A	c.(1075-1077)Gct>Act	p.A359T		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	359						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TTAATCAAAGCCTCTGCTTTC	0.378																																							uc003klb.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1075-1077)GCT>ACT		tetratricopeptide repeat domain 37							87.0	87.0	87.0					5																	94863776		2203	4300	6503	SO:0001583	missense	9652						binding	g.chr5:94863776C>T	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.1075G>A	5.37:g.94863776C>T	ENSP00000351596:p.Ala359Thr		Somatic				TTC37_uc010jbf.1_Missense_Mutation_p.A311T	p.A359T	NM_014639	NP_055454	WXS	Illumina HiSeq	Unspecified	Q6PGP7	TTC37_HUMAN			13	1345	-			359					O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	37	c.1075G>A	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660740	0.88154	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.78003	-1.14;-1.05	5.22	5.22	0.72569	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.82098	0.4963	L	0.36672	1.1	0.51482	D	0.999924	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.989	T	0.81210	-0.1036	10	0.39692	T	0.17	.	14.0645	0.64819	0.0:0.9252:0.0:0.0748	.	311;359	D6RCE2;Q6PGP7	.;TTC37_HUMAN	T	359;311	ENSP00000351596:A359T;ENSP00000423742:A311T	ENSP00000351596:A359T	A	-	1	0	TTC37	94889532	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.604000	0.54081	2.427000	0.82271	0.484000	0.47621	GCT		0.378	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639		14	27	0	0	0	0.003163	0	14	27				
LVRN	206338	broad.mit.edu	37	5	115298444	115298444	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:115298444C>T	ENST00000357872.4	+	1	254	c.130C>T	c.(130-132)Cca>Tca	p.P44S	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		44						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										CGAGCGCGTCCCACCGTCGGA	0.697																																							uc003kro.2		NA																	0					0						c.(130-132)CCA>TCA		laeverin							17.0	20.0	19.0					5																	115298444		2169	4257	6426	SO:0001583	missense	206338				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding	g.chr5:115298444C>T																												ENST00000357872.4:c.130C>T	5.37:g.115298444C>T	ENSP00000350541:p.Pro44Ser		Somatic				AQPEP_uc003krp.2_RNA|uc003krn.1_5'UTR	p.P44S	NM_173800	NP_776161	WXS	Illumina HiSeq	Unspecified	Q6Q4G3	AMPQ_HUMAN			1	294	+			44			Lumenal (Potential).		A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	c.130C>T	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	C	1.752	-0.488933	0.04352	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.01215	5.16	3.78	0.803	0.18691	.	1.153630	0.06561	N	0.746731	T	0.00815	0.0027	N	0.14661	0.345	0.09310	N	0.999991	B	0.12013	0.005	B	0.09377	0.004	T	0.45991	-0.9223	10	0.06757	T	0.87	.	5.9924	0.19474	0.0:0.4574:0.4292:0.1134	.	44	Q6Q4G3	AMPQ_HUMAN	S	44	ENSP00000350541:P44S	ENSP00000350541:P44S	P	+	1	0	AC010282.1	115326343	0.010000	0.17322	0.008000	0.14137	0.422000	0.31414	0.232000	0.17891	0.025000	0.15241	-0.136000	0.14681	CCA		0.697	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1			10	11	0	0	0	0.006214	0	10	11				
FTMT	94033	broad.mit.edu	37	5	121188072	121188072	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:121188072C>A	ENST00000321339.1	+	1	423	c.414C>A	c.(412-414)ggC>ggA	p.G138G		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	138	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		AGCGAGGAGGCCGGATCCGCC	0.582																																							uc003kss.2		NA																	0				ovary(1)	1						c.(412-414)GGC>GGA		ferritin mitochondrial precursor							64.0	67.0	66.0					5																	121188072		2203	4300	6503	SO:0001819	synonymous_variant	94033				cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity	g.chr5:121188072C>A	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.414C>A	5.37:g.121188072C>A			Somatic					p.G138G	NM_177478	NP_803431	WXS	Illumina HiSeq	Unspecified	Q8N4E7	FTMT_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)	1	423	+		all_cancers(142;0.0124)|Prostate(80;0.0322)	138			Ferritin-like diiron.			Silent	SNP	ENST00000321339.1	37	c.414C>A	CCDS4128.1																																																																																				0.582	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478		26	29	1	0	7.41945e-09	0.005443	1.01865e-08	26	29				
RAPGEF6	51735	broad.mit.edu	37	5	130831345	130831345	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:130831345C>T	ENST00000509018.1	-	13	1633	c.1428G>A	c.(1426-1428)cgG>cgA	p.R476R	CTC-432M15.3_ENST00000514667.1_Silent_p.R526R|RAPGEF6_ENST00000512052.1_Silent_p.R191R|RAPGEF6_ENST00000296859.6_Silent_p.R476R|RAPGEF6_ENST00000510071.1_Silent_p.R476R|RAPGEF6_ENST00000307984.5_Silent_p.R476R|RAPGEF6_ENST00000507093.1_Silent_p.R476R|RAPGEF6_ENST00000308008.6_Silent_p.R476R	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	476	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		ATAATACAATCCGTGTCACCT	0.358																																					Melanoma(168;435 1955 13113 13877 23213)	Melanoma(168;435 1955 13113 13877 23213)	uc003kvn.1		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(1426-1428)CGG>CGA		PDZ domain-containing guanine nucleotide							48.0	47.0	48.0					5																	130831345		2202	4300	6502	SO:0001819	synonymous_variant	51735				Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding	g.chr5:130831345C>T	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.1428G>A	5.37:g.130831345C>T			Somatic				RAPGEF6_uc003kvp.1_Silent_p.R526R|RAPGEF6_uc003kvo.1_Silent_p.R476R|RAPGEF6_uc010jdi.1_Silent_p.R476R|RAPGEF6_uc010jdj.1_Silent_p.R476R|RAPGEF6_uc003kvq.2_Silent_p.R193R|RAPGEF6_uc003kvr.2_Silent_p.R476R|RAPGEF6_uc011cxe.1_RNA|RAPGEF6_uc010jdk.2_Silent_p.R476R	p.R476R	NM_016340	NP_057424	WXS	Illumina HiSeq	Unspecified	Q8TEU7	RPGF6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)	13	1634	-			476			N-terminal Ras-GEF.		A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Silent	SNP	ENST00000509018.1	37	c.1428G>A	CCDS34225.1																																																																																				0.358	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340		5	27	0	0	0	0.001168	0	5	27				
TXNDC15	79770	broad.mit.edu	37	5	134223588	134223588	+	Missense_Mutation	SNP	G	G	T	rs564525612		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:134223588G>T	ENST00000358387.4	+	2	932	c.307G>T	c.(307-309)Gac>Tac	p.D103Y	TXNDC15_ENST00000546290.1_Missense_Mutation_p.D80Y	NM_024715.3	NP_078991.3	Q96J42	TXD15_HUMAN	thioredoxin domain containing 15	103					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGAAGCTGAGGACAAAGTGAG	0.607																																							uc003lac.1		NA																	0				ovary(1)|breast(1)	2						c.(307-309)GAC>TAC		disulfide isomerase precursor							111.0	98.0	102.0					5																	134223588		2203	4300	6503	SO:0001583	missense	79770				cell redox homeostasis	integral to membrane		g.chr5:134223588G>T	AK026278	CCDS4180.1	5q31.1	2008-02-05	2007-08-16	2007-08-16	ENSG00000113621	ENSG00000113621			20652	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 14"""	C5orf14			Standard	NM_024715		Approved	2310047H23Rik, FLJ22625	uc003lac.1	Q96J42	OTTHUMG00000129115	ENST00000358387.4:c.307G>T	5.37:g.134223588G>T	ENSP00000351157:p.Asp103Tyr		Somatic				TXNDC15_uc010jdy.1_Intron|TXNDC15_uc011cxv.1_RNA	p.D103Y	NM_024715	NP_078991	WXS	Illumina HiSeq	Unspecified	Q96J42	TXD15_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		2	965	+			103			Extracellular (Potential).		D3DQA9|Q96MT2|Q9H639	Missense_Mutation	SNP	ENST00000358387.4	37	c.307G>T	CCDS4180.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.78|19.78	3.890871|3.890871	0.72524|0.72524	.|.	.|.	ENSG00000113621|ENSG00000113621	ENST00000441965;ENST00000358387;ENST00000506916;ENST00000508810;ENST00000546290|ENST00000508779	T;T|.	0.59083|.	0.29;0.32|.	5.61|5.61	4.74|4.74	0.60224|0.60224	.|.	0.186472|.	0.56097|.	D|.	0.000035|.	T|T	0.55065|0.55065	0.1897|0.1897	L|L	0.34521|0.34521	1.04|1.04	0.38842|0.38842	D|D	0.956075|0.956075	D|.	0.89917|.	1.0|.	D|.	0.76575|.	0.988|.	T|T	0.54840|0.54840	-0.8233|-0.8233	10|5	0.87932|.	D|.	0|.	-7.6147|-7.6147	14.0173|14.0173	0.64531|0.64531	0.0733:0.0:0.9267:0.0|0.0733:0.0:0.9267:0.0	.|.	103|.	Q96J42|.	TXD15_HUMAN|.	Y|S	87;103;101;86;80|86	ENSP00000351157:D103Y;ENSP00000443942:D80Y|.	ENSP00000351157:D103Y|.	D|R	+|+	1|3	0|2	TXNDC15|TXNDC15	134251487|134251487	1.000000|1.000000	0.71417|0.71417	0.904000|0.904000	0.35570|0.35570	0.791000|0.791000	0.44710|0.44710	5.081000|5.081000	0.64444|0.64444	1.377000|1.377000	0.46286|0.46286	0.585000|0.585000	0.79938|0.79938	GAC|AGG		0.607	TXNDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251160.1	NM_024715		8	40	1	0	0.000442599	0.006214	0.000508648	8	40				
PCDHA6	56142	broad.mit.edu	37	5	140208796	140208796	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:140208796G>T	ENST00000529310.1	+	1	1234	c.1120G>T	c.(1120-1122)Gtg>Ttg	p.V374L	PCDHA6_ENST00000527624.1_Missense_Mutation_p.V374L|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	374	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTAATTAGCGTGAACGACCT	0.488																																							uc003lho.2		NA																	0				haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(1120-1122)GTG>TTG		protocadherin alpha 6 isoform 1 precursor							144.0	137.0	139.0					5																	140208796		2203	4300	6503	SO:0001583	missense	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140208796G>T	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1120G>T	5.37:g.140208796G>T	ENSP00000433378:p.Val374Leu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.V374L|PCDHA6_uc011dab.1_Missense_Mutation_p.V374L	p.V374L	NM_018909	NP_061732	WXS	Illumina HiSeq	Unspecified	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1147	+			374			Cadherin 4.|Extracellular (Potential).		O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	c.1120G>T	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063588	0.55432	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.54279	0.58;0.58	3.7	3.7	0.42460	Cadherin (4);Cadherin-like (1);	0.000000	0.33199	U	0.005169	T	0.75583	0.3869	M	0.91717	3.235	0.39041	D	0.960128	P;P;D	0.67145	0.862;0.773;0.996	P;P;P	0.62649	0.588;0.711;0.905	D	0.84046	0.0367	10	0.59425	D	0.04	.	15.9817	0.80114	0.0:0.0:1.0:0.0	.	374;374;374	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	L	374	ENSP00000433378:V374L;ENSP00000434113:V374L	ENSP00000434113:V374L	V	+	1	0	PCDHA6	140188980	1.000000	0.71417	0.810000	0.32431	0.479000	0.33129	3.456000	0.53000	2.055000	0.61198	0.313000	0.20887	GTG		0.488	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		55	68	1	0	7.07328e-35	0.00361	1.29131e-34	55	68				
PCDHA10	56139	broad.mit.edu	37	5	140236734	140236734	+	Silent	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:140236734C>G	ENST00000307360.5	+	1	1101	c.1101C>G	c.(1099-1101)gtC>gtG	p.V367V	PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Silent_p.V367V|PCDHA4_ENST00000512229.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	367	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGCACCGTCATTGCCCTAA	0.507																																							uc003lhx.2		NA																	0				ovary(2)|skin(2)|breast(1)	5						c.(1099-1101)GTC>GTG		protocadherin alpha 10 isoform 1 precursor							160.0	141.0	147.0					5																	140236734		2196	4274	6470	SO:0001819	synonymous_variant	56139				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140236734C>G	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1101C>G	5.37:g.140236734C>G			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Silent_p.V367V|PCDHA10_uc011dad.1_Silent_p.V367V	p.V367V	NM_018901	NP_061724	WXS	Illumina HiSeq	Unspecified	Q9Y5I2	PCDAA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1101	+			367			Cadherin 4.|Extracellular (Potential).		A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	37	c.1101C>G	CCDS54921.1																																																																																				0.507	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901		34	61	0	0	0	0.003271	0	34	61				
PCDHA10	56139	broad.mit.edu	37	5	140237414	140237414	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:140237414G>T	ENST00000307360.5	+	1	1781	c.1781G>T	c.(1780-1782)cGc>cTc	p.R594L	PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	594	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTAAGGTGCGCGCAGTGGAC	0.672																																							uc003lhx.2		NA																	0				ovary(2)|skin(2)|breast(1)	5						c.(1780-1782)CGC>CTC		protocadherin alpha 10 isoform 1 precursor							97.0	94.0	95.0					5																	140237414		1322	2290	3612	SO:0001583	missense	56139				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140237414G>T	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1781G>T	5.37:g.140237414G>T	ENSP00000304234:p.Arg594Leu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc011dad.1_Missense_Mutation_p.R594L	p.R594L	NM_018901	NP_061724	WXS	Illumina HiSeq	Unspecified	Q9Y5I2	PCDAA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1781	+			594			Extracellular (Potential).|Cadherin 6.		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	c.1781G>T	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	G	7.282	0.609338	0.14066	.	.	ENSG00000250120	ENST00000307360	T	0.52754	0.65	3.68	2.81	0.32909	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.43077	0.1231	L	0.58354	1.805	0.09310	N	1	B;B	0.29341	0.242;0.234	B;B	0.37422	0.122;0.249	T	0.40098	-0.9581	9	0.32370	T	0.25	.	3.0713	0.06231	0.3014:0.0:0.4879:0.2106	.	594;594	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	L	594	ENSP00000304234:R594L	ENSP00000304234:R594L	R	+	2	0	PCDHA10	140217598	0.000000	0.05858	1.000000	0.80357	0.353000	0.29299	0.201000	0.17276	0.882000	0.36016	0.491000	0.48974	CGC		0.672	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901		5	30	1	0	8.12818e-05	0.001984	9.57097e-05	5	30				
MYOZ3	91977	broad.mit.edu	37	5	150051463	150051463	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:150051463G>A	ENST00000297130.4	+	5	616	c.417G>A	c.(415-417)ctG>ctA	p.L139L	CTC-345K18.2_ENST00000511626.2_RNA|MYOZ3_ENST00000517768.1_Silent_p.L139L|MYOZ3_ENST00000520112.1_5'Flank	NM_001122853.2|NM_133371.4	NP_001116325.1|NP_588612.2			myozenin 3											large_intestine(2)|lung(1)|skin(2)	5		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCAGCGCCCTGGCGCCAGGTG	0.736																																							uc003lss.2		NA																	0				skin(1)	1						c.(415-417)CTG>CTA		myozenin 3							4.0	6.0	5.0					5																	150051463		1907	3760	5667	SO:0001819	synonymous_variant	91977					sarcomere	protein binding	g.chr5:150051463G>A	AF480443	CCDS4309.1	5q33.2	2008-07-18			ENSG00000164591	ENSG00000164591			18565	protein-coding gene	gene with protein product	"""calsarcin 3"", ""FATZ related protein 3"""	610735				11842093	Standard	NM_001122853		Approved	CS-3, CS3, FRP3	uc003lsr.3	Q8TDC0	OTTHUMG00000130077	ENST00000297130.4:c.417G>A	5.37:g.150051463G>A			Somatic				MYOZ3_uc003lsr.2_Silent_p.L139L	p.L139L	NM_001122853	NP_001116325	WXS	Illumina HiSeq	Unspecified	Q8TDC0	MYOZ3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		5	1004	+		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	139						Silent	SNP	ENST00000297130.4	37	c.417G>A	CCDS4309.1																																																																																				0.736	MYOZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252369.1	NM_001122853		4	4	0	0	0	0.000248	0	4	4				
KIF4B	285643	broad.mit.edu	37	5	154394287	154394287	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:154394287G>C	ENST00000435029.4	+	1	1028	c.868G>C	c.(868-870)Gat>Cat	p.D290H		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	290	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCCCTACAGAGATTCCAAGTT	0.443																																							uc010jih.1		NA																	0				ovary(1)	1						c.(868-870)GAT>CAT		kinesin family member 4B							163.0	166.0	165.0					5																	154394287		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154394287G>C	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.868G>C	5.37:g.154394287G>C	ENSP00000387875:p.Asp290His		Somatic					p.D290H	NM_001099293	NP_001092763	WXS	Illumina HiSeq	Unspecified	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	1028	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	290			Kinesin-motor.			Missense_Mutation	SNP	ENST00000435029.4	37	c.868G>C	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	g	15.19	2.760301	0.49468	.	.	ENSG00000226650	ENST00000435029	T	0.81247	-1.47	1.48	1.48	0.22813	Kinesin, motor domain (4);	.	.	.	.	D	0.92074	0.7488	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91757	0.5417	9	0.87932	D	0	.	8.8832	0.35387	0.0:0.0:1.0:0.0	.	290	Q2VIQ3	KIF4B_HUMAN	H	290	ENSP00000387875:D290H	ENSP00000387875:D290H	D	+	1	0	KIF4B	154374480	1.000000	0.71417	0.963000	0.40424	0.872000	0.50106	2.944000	0.49034	1.138000	0.42230	0.563000	0.77884	GAT		0.443	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			65	92	0	0	0	0.00361	0	65	92				
DOCK2	1794	broad.mit.edu	37	5	169145670	169145670	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:169145670G>T	ENST00000256935.8	+	22	2222	c.2142G>T	c.(2140-2142)atG>atT	p.M714I	DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.M206I	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	714					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGAAATTGATGACAGTGCTGA	0.368																																							uc003maf.2		NA																	0				ovary(5)|pancreas(2)	7						c.(2140-2142)ATG>ATT		dedicator of cytokinesis 2							108.0	96.0	100.0					5																	169145670		2203	4300	6503	SO:0001583	missense	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169145670G>T	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2142G>T	5.37:g.169145670G>T	ENSP00000256935:p.Met714Ile		Somatic				DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.M206I	p.M714I	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		22	2222	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	714					Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	c.2142G>T	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	4.611	0.113571	0.08831	.	.	ENSG00000134516	ENST00000256935;ENST00000520908	T;T	0.64991	-0.13;-0.13	5.58	5.58	0.84498	.	0.035391	0.85682	D	0.000000	T	0.49779	0.1577	N	0.02916	-0.46	0.80722	D	1	B;D	0.54207	0.076;0.965	B;P	0.55508	0.038;0.777	T	0.50268	-0.8848	10	0.02654	T	1	.	19.6412	0.95758	0.0:0.0:1.0:0.0	.	206;714	E7ERW7;Q92608	.;DOCK2_HUMAN	I	714;206	ENSP00000256935:M714I;ENSP00000429283:M206I	ENSP00000256935:M714I	M	+	3	0	DOCK2	169078248	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.582000	0.67477	2.661000	0.90470	0.644000	0.83932	ATG		0.368	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		17	17	1	0	1.99824e-07	0.00499	2.59461e-07	17	17				
FOXI1	2299	broad.mit.edu	37	5	169535566	169535566	+	Missense_Mutation	SNP	G	G	T	rs150705492	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:169535566G>T	ENST00000306268.6	+	2	1149	c.1088G>T	c.(1087-1089)aGt>aTt	p.S363I	FOXI1_ENST00000449804.2_Missense_Mutation_p.S268I			Q12951	FOXI1_HUMAN	forkhead box I1	363					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCTACAACAGTGTCAACACC	0.572									Pendred syndrome																														uc003mai.3		NA																	0				breast(3)|central_nervous_system(1)	4						c.(1087-1089)AGT>ATT		forkhead box I1 isoform a		G	ILE/SER,ILE/SER	1,4403		0,1,2201	122.0	98.0	106.0		1088,803	3.7	0.4	5	dbSNP_134	106	9,8591		0,9,4291	yes	missense,missense	FOXI1	NM_012188.4,NM_144769.2	142,142	0,10,6492	TT,TG,GG		0.1047,0.0227,0.0769	possibly-damaging,possibly-damaging	363/379,268/284	169535566	10,12994	2202	4300	6502	SO:0001583	missense	2299	Pendred_syndrome	Familial Cancer Database	Goiter-Deafness syndrome	epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding	g.chr5:169535566G>T	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.1088G>T	5.37:g.169535566G>T	ENSP00000304286:p.Ser363Ile		Somatic				FOXI1_uc003maj.3_Missense_Mutation_p.S268I	p.S363I	NM_012188	NP_036320	WXS	Illumina HiSeq	Unspecified	Q12951	FOXI1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		2	1133	+	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	363					Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	37	c.1088G>T	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.874995	0.33162	2.27E-4	0.001047	ENSG00000168269	ENST00000306268;ENST00000449804	D;D	0.95554	-3.35;-3.74	5.52	3.73	0.42828	.	0.229124	0.43919	D	0.000507	D	0.93893	0.8046	M	0.76574	2.34	0.24009	N	0.996182	P;P	0.45902	0.85;0.868	B;B	0.43575	0.424;0.312	D	0.88486	0.3072	10	0.59425	D	0.04	.	6.2766	0.20983	0.0704:0.133:0.6585:0.138	.	268;363	Q12951-2;Q12951	.;FOXI1_HUMAN	I	363;268	ENSP00000304286:S363I;ENSP00000415483:S268I	ENSP00000304286:S363I	S	+	2	0	FOXI1	169468144	1.000000	0.71417	0.408000	0.26446	0.000000	0.00434	3.791000	0.55469	0.692000	0.31613	-0.890000	0.02929	AGT		0.572	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188		31	36	1	0	2.46105e-21	0.002096	4.19569e-21	31	36				
SH3PXD2B	285590	broad.mit.edu	37	5	171849423	171849423	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:171849423G>A	ENST00000311601.5	-	2	323	c.153C>T	c.(151-153)ctC>ctT	p.L51L	SH3PXD2B_ENST00000519643.1_Silent_p.L51L	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	51	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCCTTACCTGGAGGTCAAAAA	0.488																																							uc003mbr.2		NA																	0				ovary(3)|skin(1)	4						c.(151-153)CTC>CTT		SH3 and PX domains 2B							38.0	36.0	37.0					5																	171849423		2203	4299	6502	SO:0001819	synonymous_variant	285590				adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding	g.chr5:171849423G>A	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.153C>T	5.37:g.171849423G>A			Somatic				SH3PXD2B_uc003mbs.1_Silent_p.L51L	p.L51L	NM_001017995	NP_001017995	WXS	Illumina HiSeq	Unspecified	A1X283	SPD2B_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		2	324	-	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	51			PX.		B6F0V2|Q9P2Q1	Silent	SNP	ENST00000311601.5	37	c.153C>T	CCDS34291.1																																																																																				0.488	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963		7	18	0	0	0	0.001984	0	7	18				
CLK4	57396	broad.mit.edu	37	5	178050304	178050304	+	Silent	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:178050304T>C	ENST00000316308.4	-	2	282	c.114A>G	c.(112-114)caA>caG	p.Q38Q	CLK4_ENST00000520957.1_Silent_p.Q38Q	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	38					protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		GCCTGTTCTCTTGTGTGCTAC	0.388																																							uc003mjf.1		NA																	0				ovary(1)	1						c.(112-114)CAA>CAG		CDC-like kinase 4							276.0	249.0	258.0					5																	178050304		2203	4300	6503	SO:0001819	synonymous_variant	57396					nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr5:178050304T>C	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.114A>G	5.37:g.178050304T>C			Somatic				CLK4_uc003mjg.1_5'UTR|CLK4_uc010jku.1_5'UTR|CLK4_uc003mjh.1_5'UTR|CLK4_uc010jkv.1_RNA|CLK4_uc011dgg.1_Silent_p.Q38Q|CLK4_uc011dgh.1_5'UTR|CLK4_uc011dgi.1_Silent_p.Q38Q|CLK4_uc011dgj.1_Silent_p.Q38Q|CLK4_uc003mji.2_Silent_p.Q38Q|CLK4_uc010jkw.1_Silent_p.Q38Q	p.Q38Q	NM_020666	NP_065717	WXS	Illumina HiSeq	Unspecified	Q9HAZ1	CLK4_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)	2	222	-	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	38						Silent	SNP	ENST00000316308.4	37	c.114A>G	CCDS4437.1																																																																																				0.388	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2			12	71	0	0	0	0.00245	0	12	71				
ADAMTS2	9509	broad.mit.edu	37	5	178557085	178557085	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:178557085C>T	ENST00000251582.7	-	16	2406	c.2305G>A	c.(2305-2307)Gag>Aag	p.E769K		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	769	Spacer.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TTGCCTGTCTCCAGGTTCTTG	0.567																																							uc003mjw.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(2305-2307)GAG>AAG		ADAM metallopeptidase with thrombospondin type 1							91.0	79.0	83.0					5																	178557085		2203	4300	6503	SO:0001583	missense	9509				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:178557085C>T	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2305G>A	5.37:g.178557085C>T	ENSP00000251582:p.Glu769Lys		Somatic					p.E769K	NM_014244	NP_055059	WXS	Illumina HiSeq	Unspecified	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)	16	2305	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	769			Spacer.			Missense_Mutation	SNP	ENST00000251582.7	37	c.2305G>A	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.786594	0.90367	.	.	ENSG00000087116	ENST00000251582	T	0.50548	0.74	5.09	5.09	0.68999	ADAM-TS Spacer 1 (1);	0.000000	0.56097	D	0.000038	T	0.59891	0.2227	L	0.60455	1.87	0.80722	D	1	D	0.54964	0.969	P	0.55749	0.783	T	0.58601	-0.7608	10	0.40728	T	0.16	.	17.8402	0.88713	0.0:1.0:0.0:0.0	.	769	O95450	ATS2_HUMAN	K	769	ENSP00000251582:E769K	ENSP00000251582:E769K	E	-	1	0	ADAMTS2	178489691	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.669000	0.83911	2.523000	0.85059	0.462000	0.41574	GAG		0.567	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244		12	29	0	0	0	0.001855	0	12	29				
BMP6	654	broad.mit.edu	37	6	7862567	7862567	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:7862567T>G	ENST00000283147.6	+	4	1199	c.1040T>G	c.(1039-1041)gTg>gGg	p.V347G		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	347					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					GCAGGCCTGGTGGGCAGAGAC	0.557																																							uc003mxu.3		NA																	0				large_intestine(2)|ovary(1)	3						c.(1039-1041)GTG>GGG		bone morphogenetic protein 6 preproprotein							85.0	93.0	90.0					6																	7862567		2203	4300	6503	SO:0001583	missense	654				BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity	g.chr6:7862567T>G	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.1040T>G	6.37:g.7862567T>G	ENSP00000283147:p.Val347Gly		Somatic					p.V347G	NM_001718	NP_001709	WXS	Illumina HiSeq	Unspecified	P22004	BMP6_HUMAN			4	1218	+	Ovarian(93;0.0721)		347					Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	c.1040T>G	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.542670	0.85917	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.63417	-0.04	5.8	5.8	0.92144	Transforming growth factor-beta, N-terminal (1);	0.126361	0.51477	D	0.000082	T	0.70185	0.3195	M	0.75615	2.305	0.80722	D	1	D	0.57571	0.98	P	0.58130	0.833	T	0.74691	-0.3580	10	0.62326	D	0.03	.	16.1549	0.81657	0.0:0.0:0.0:1.0	.	347	P22004	BMP6_HUMAN	G	269;347;310	ENSP00000283147:V347G	ENSP00000283147:V347G	V	+	2	0	BMP6	7807566	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	6.116000	0.71571	2.209000	0.71365	0.533000	0.62120	GTG		0.557	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718		20	83	0	0	0	0.00333	0	20	83				
GPX5	2880	broad.mit.edu	37	6	28497230	28497230	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:28497230G>T	ENST00000412168.2	+	2	179	c.90G>T	c.(88-90)atG>atT	p.M30I	GPX5_ENST00000442674.2_3'UTR|GPX5_ENST00000469384.1_Missense_Mutation_p.M30I|GPX6_ENST00000483058.1_5'Flank	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	30					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	TCTTCCAGATGGATTGCCACA	0.368																																							uc003nll.2		NA																	0				skin(1)	1						c.(88-90)ATG>ATT		glutathione peroxidase 5 isoform 1 precursor	Glutathione(DB00143)						118.0	105.0	110.0					6																	28497230		2203	4300	6503	SO:0001583	missense	2880				lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity	g.chr6:28497230G>T	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.90G>T	6.37:g.28497230G>T	ENSP00000392398:p.Met30Ile		Somatic				GPX5_uc003nlm.2_Missense_Mutation_p.M30I|GPX5_uc003nln.2_RNA	p.M30I	NM_001509	NP_001500	WXS	Illumina HiSeq	Unspecified	O75715	GPX5_HUMAN			2	92	+			30					A1A4Y0	Missense_Mutation	SNP	ENST00000412168.2	37	c.90G>T	CCDS4652.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185052	0.38609	.	.	ENSG00000224586	ENST00000412168;ENST00000469384	T;T	0.09445	4.28;2.98	3.65	2.79	0.32731	.	0.394431	0.28572	N	0.014877	T	0.04227	0.0117	L	0.52573	1.65	0.33002	D	0.526397	P;B	0.48764	0.915;0.06	B;B	0.41764	0.366;0.039	T	0.39921	-0.9590	10	0.25751	T	0.34	0.8549	9.4398	0.38661	0.1086:0.0:0.8914:0.0	.	30;30	A1A4Y0;O75715	.;GPX5_HUMAN	I	30	ENSP00000392398:M30I;ENSP00000419935:M30I	ENSP00000392398:M30I	M	+	3	0	GPX5	28605209	1.000000	0.71417	0.995000	0.50966	0.727000	0.41649	3.175000	0.50855	1.091000	0.41335	0.655000	0.94253	ATG		0.368	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043672.2			29	40	1	0	3.86903e-22	0.002836	6.61288e-22	29	40				
GRM4	2914	broad.mit.edu	37	6	34008522	34008522	+	Missense_Mutation	SNP	C	C	T	rs374647710		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:34008522C>T	ENST00000538487.2	-	7	1615	c.1172G>A	c.(1171-1173)cGt>cAt	p.R391H	GRM4_ENST00000374181.4_Missense_Mutation_p.R391H|GRM4_ENST00000455714.2_Missense_Mutation_p.R251H|GRM4_ENST00000374177.3_Missense_Mutation_p.R275H|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000535756.1_Missense_Mutation_p.R258H|GRM4_ENST00000544773.2_Missense_Mutation_p.R222H|GRM4_ENST00000609222.1_Missense_Mutation_p.R258H	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	391					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						AATTCGCTCACGGTCTGCAAT	0.597																																							uc003oir.3		NA																	0				lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6						c.(1171-1173)CGT>CAT		glutamate receptor, metabotropic 4 precursor	L-Glutamic Acid(DB00142)	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	160.0	124.0	136.0		1172	4.3	0.9	6		136	0,8600		0,0,4300	no	missense	GRM4	NM_000841.1	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	391/913	34008522	1,13005	2203	4300	6503	SO:0001583	missense	2914				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:34008522C>T	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1172G>A	6.37:g.34008522C>T	ENSP00000440556:p.Arg391His		Somatic				GRM4_uc011dsn.1_Missense_Mutation_p.R344H|GRM4_uc010jvh.2_Missense_Mutation_p.R391H|GRM4_uc010jvi.2_Missense_Mutation_p.R83H|GRM4_uc003oio.2_Missense_Mutation_p.R83H|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.R251H|GRM4_uc003oiq.2_Missense_Mutation_p.R258H|GRM4_uc011dsm.1_Missense_Mutation_p.R222H	p.R391H	NM_000841	NP_000832	WXS	Illumina HiSeq	Unspecified	Q14833	GRM4_HUMAN			6	1342	-			391			Extracellular (Potential).		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	c.1172G>A	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.369050	0.24771	2.27E-4	0.0	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.85955	-2.05;-1.62;-2.05;-2.05;-2.05;-2.05;-2.05	4.29	4.29	0.51040	Extracellular ligand-binding receptor (1);	0.144833	0.47852	D	0.000220	T	0.60805	0.2297	N	0.08118	0	0.35546	D	0.803456	B;B;B;B;B	0.26081	0.007;0.017;0.025;0.141;0.014	B;B;B;B;B	0.16289	0.009;0.015;0.007;0.013;0.013	T	0.64041	-0.6500	10	0.49607	T	0.09	.	16.9212	0.86165	0.0:1.0:0.0:0.0	.	344;222;251;391;258	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	H	391;275;83;258;222;391;251	ENSP00000363296:R391H;ENSP00000363292:R275H;ENSP00000445533:R83H;ENSP00000437925:R258H;ENSP00000437730:R222H;ENSP00000440556:R391H;ENSP00000398456:R251H	ENSP00000363292:R275H	R	-	2	0	GRM4	34116500	1.000000	0.71417	0.946000	0.38457	0.938000	0.57974	5.220000	0.65267	2.205000	0.71048	0.305000	0.20034	CGT		0.597	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2			26	36	0	0	0	0.008361	0	26	36				
MAPK14	1432	broad.mit.edu	37	6	36075254	36075254	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:36075254G>T	ENST00000229794.4	+	11	1252	c.864G>T	c.(862-864)atG>atT	p.M288I	MAPK14_ENST00000468133.1_Missense_Mutation_p.M211I|MAPK14_ENST00000310795.4_Missense_Mutation_p.C262F|MAPK14_ENST00000229795.3_Missense_Mutation_p.M288I	NM_139012.2|NM_139014.2	NP_620581.1|NP_620583.1	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14	288	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cartilage condensation (GO:0001502)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to ionizing radiation (GO:0071479)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chemotaxis (GO:0006935)|chondrocyte differentiation (GO:0002062)|DNA damage checkpoint (GO:0000077)|fatty acid oxidation (GO:0019395)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoclast differentiation (GO:0030316)|p38MAPK cascade (GO:0038066)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to muramyl dipeptide (GO:0032495)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|signal transduction in response to DNA damage (GO:0042770)|skeletal muscle tissue development (GO:0007519)|stress-activated MAPK cascade (GO:0051403)|stress-induced premature senescence (GO:0090400)|striated muscle cell differentiation (GO:0051146)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|MAP kinase kinase activity (GO:0004708)|NFAT protein binding (GO:0051525)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|stomach(1)	16						TGGAGAAGATGCTTGTATTGG	0.433																																					Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)	Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)	uc003olp.2		NA																	0				ovary(2)|stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	6						c.(862-864)ATG>ATT		mitogen-activated protein kinase 14 isoform 1							167.0	161.0	163.0					6																	36075254		2203	4300	6503	SO:0001583	missense	1432				activation of MAPK activity|cellular component movement|cellular response to ionizing radiation|chemotaxis|innate immune response|mRNA metabolic process|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of muscle cell differentiation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|signal transduction in response to DNA damage|stress-activated MAPK cascade|stress-induced premature senescence|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|MAP kinase kinase activity|protein binding	g.chr6:36075254G>T	L35263	CCDS4815.1, CCDS4816.1, CCDS4817.1	6p21.3-p21.2	2011-06-09			ENSG00000112062	ENSG00000112062		"""Mitogen-activated protein kinase cascade / Kinases"""	6876	protein-coding gene	gene with protein product	"""p38 MAP kinase"""	600289		CSPB1, CSBP1, CSBP2		7997261	Standard	NM_139012		Approved	PRKM14, p38, Mxi2, PRKM15	uc003olq.3	Q16539	OTTHUMG00000159806	ENST00000229794.4:c.864G>T	6.37:g.36075254G>T	ENSP00000229794:p.Met288Ile		Somatic				MAPK14_uc003olq.2_Missense_Mutation_p.M288I|MAPK14_uc003olr.2_Missense_Mutation_p.C262F|MAPK14_uc011dti.1_Missense_Mutation_p.M211I	p.M288I	NM_001315	NP_001306	WXS	Illumina HiSeq	Unspecified	Q16539	MK14_HUMAN			11	1345	+			288			Protein kinase.		A6ZJ92|A8K6P4|B0LPH0|B5TY32|O60776|Q13083|Q14084|Q8TDX0	Missense_Mutation	SNP	ENST00000229794.4	37	c.864G>T	CCDS4816.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.527338|5.527338	0.96431|0.96431	.|.	.|.	ENSG00000112062|ENSG00000112062	ENST00000310795|ENST00000229795;ENST00000229794;ENST00000468133	T|T;T;T	0.68331|0.15017	-0.32|2.46;2.46;2.46	5.96|5.96	5.96|5.96	0.96718|0.96718	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.40694|0.40694	0.1127|0.1127	.|.	.|.	.|.	0.46927|0.46927	D|D	0.999256|0.999256	D|D;P	0.69078|0.71674	0.997|0.998;0.929	D|D;P	0.80764|0.87578	0.994|0.998;0.849	T|T	0.24799|0.24799	-1.0150|-1.0150	8|9	0.72032|0.87932	D|D	0.01|0	-15.8746|-15.8746	20.4192|20.4192	0.99033|0.99033	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	262|288;288	Q16539-4|Q16539;Q16539-2	.|MK14_HUMAN;.	F|I	262|288;288;211	ENSP00000308669:C262F|ENSP00000229795:M288I;ENSP00000229794:M288I;ENSP00000419837:M211I	ENSP00000308669:C262F|ENSP00000229794:M288I	C|M	+|+	2|3	0|0	MAPK14|MAPK14	36183232|36183232	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.869000|9.869000	0.99810|0.99810	2.831000|2.831000	0.97527|0.97527	0.650000|0.650000	0.86243|0.86243	TGC|ATG		0.433	MAPK14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357450.1	NM_001315		59	96	1	0	1.37693e-34	0.00361	2.50692e-34	59	96				
DNAH8	1769	broad.mit.edu	37	6	38783335	38783335	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:38783335G>T	ENST00000359357.3	+	24	3028	c.2774G>T	c.(2773-2775)gGg>gTg	p.G925V	DNAH8_ENST00000449981.2_Missense_Mutation_p.G1142V|DNAH8_ENST00000441566.1_Missense_Mutation_p.G925V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	925					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GCTCACTGGGGGCAACAGCAA	0.488																																							uc003ooe.1		NA																	0				skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(2773-2775)GGG>GTG		dynein, axonemal, heavy polypeptide 8							114.0	94.0	101.0					6																	38783335		2203	4300	6503	SO:0001583	missense	1769							g.chr6:38783335G>T	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.2774G>T	6.37:g.38783335G>T	ENSP00000352312:p.Gly925Val		Somatic					p.G925V	NM_001371	NP_001362	WXS	Illumina HiSeq	Unspecified					24	3374	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37	c.2774G>T		.	.	.	.	.	.	.	.	.	.	G	16.87	3.243102	0.58995	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.59083	0.29;0.29;0.29	5.74	5.74	0.90152	.	0.419888	0.26692	N	0.022996	T	0.52901	0.1763	M	0.75777	2.31	0.80722	D	1	P	0.36789	0.57	B	0.40741	0.339	T	0.52968	-0.8504	10	0.29301	T	0.29	.	17.7057	0.88309	0.0:0.0:1.0:0.0	.	925	Q96JB1	DYH8_HUMAN	V	1130;1130;925;925	ENSP00000333363:G1130V;ENSP00000352312:G925V;ENSP00000402294:G925V	ENSP00000333363:G1130V	G	+	2	0	DNAH8	38891313	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	5.341000	0.65964	2.720000	0.93068	0.650000	0.86243	GGG		0.488	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		16	24	1	0	4.7546e-09	0.004007	6.6091e-09	16	24				
MRPL2	51069	broad.mit.edu	37	6	43025848	43025848	+	Missense_Mutation	SNP	T	T	A	rs141171843	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:43025848T>A	ENST00000388752.3	-	2	644	c.220A>T	c.(220-222)Att>Ttt	p.I74F	KLC4_ENST00000394056.2_5'Flank|MRPL2_ENST00000468957.1_Missense_Mutation_p.I74F|MRPL2_ENST00000487429.1_3'UTR|KLC4_ENST00000347162.5_5'Flank|MRPL2_ENST00000489623.1_Missense_Mutation_p.I74F|KLC4_ENST00000458460.2_5'Flank|KLC4_ENST00000394058.1_5'Flank|MRPL2_ENST00000230413.5_Missense_Mutation_p.I74F|KLC4_ENST00000259708.3_5'Flank|KLC4_ENST00000479388.1_5'Flank|KLC4_ENST00000453940.2_5'Flank	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2	74					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		ACTGGTGTAATGGTGTACTTG	0.512																																							uc003ots.1		NA																	0					0						c.(220-222)ATT>TTT		mitochondrial ribosomal protein L2 precursor							196.0	179.0	185.0					6																	43025848		2203	4300	6503	SO:0001583	missense	51069				translation	mitochondrion|ribosome	structural constituent of ribosome	g.chr6:43025848T>A	AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.220A>T	6.37:g.43025848T>A	ENSP00000373404:p.Ile74Phe		Somatic				KLC4_uc003otr.1_Intron|MRPL2_uc011dvc.1_Missense_Mutation_p.I74F|MRPL2_uc010jyi.2_3'UTR|MRPL2_uc003ott.3_Missense_Mutation_p.I74F|KLC4_uc011dvd.1_5'Flank|KLC4_uc003otu.2_5'Flank|KLC4_uc003otv.1_5'Flank|KLC4_uc003otw.1_5'Flank|KLC4_uc003otx.1_5'Flank|KLC4_uc003oty.1_5'Flank|KLC4_uc003otz.1_5'Flank	p.I74F	NM_015950	NP_057034	WXS	Illumina HiSeq	Unspecified	Q5T653	RM02_HUMAN	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)	2	343	-		Ovarian(999;0.0014)	74					B2RC56|Q8WUL1|Q96Q56|Q9Y311	Missense_Mutation	SNP	ENST00000388752.3	37	c.220A>T	CCDS34454.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.929511	0.73327	.	.	ENSG00000112651	ENST00000388752;ENST00000230413;ENST00000489623;ENST00000468957	T	0.45668	0.89	5.19	-5.28	0.02755	Nucleic acid-binding, OB-fold (1);	0.401707	0.27739	N	0.018045	T	0.33789	0.0875	L	0.55481	1.735	0.31223	N	0.697259	P;D;P	0.57571	0.883;0.98;0.498	P;P;B	0.55965	0.523;0.788;0.189	T	0.51450	-0.8704	10	0.72032	D	0.01	0.0933	16.0139	0.80422	0.0:0.6643:0.0:0.3357	.	74;74;74	B4DVE2;C9JZW2;Q5T653	.;.;RM02_HUMAN	F	74	ENSP00000373404:I74F	ENSP00000230413:I74F	I	-	1	0	MRPL2	43133826	0.251000	0.23961	0.002000	0.10522	0.800000	0.45204	0.072000	0.14617	-1.396000	0.02071	0.379000	0.24179	ATT		0.512	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040577.2			50	103	0	0	0	0.00361	0	50	103				
TMEM63B	55362	broad.mit.edu	37	6	44119703	44119703	+	Silent	SNP	C	C	G	rs564040846		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:44119703C>G	ENST00000259746.9	+	19	1977	c.1794C>G	c.(1792-1794)ctC>ctG	p.L598L	TMEM63B_ENST00000323267.6_Silent_p.L598L			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	598					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			TGATCCGGCTCTGCCTGGCGC	0.667											OREG0017465	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003owr.2		NA																	0				pancreas(2)|central_nervous_system(1)	3						c.(1792-1794)CTC>CTG		transmembrane protein 63B							43.0	31.0	35.0					6																	44119703		2203	4300	6503	SO:0001819	synonymous_variant	55362					integral to membrane	nucleotide binding|protein binding	g.chr6:44119703C>G	BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.1794C>G	6.37:g.44119703C>G			Somatic	OREG0017465	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	921	TMEM63B_uc003ows.2_Silent_p.L501L|TMEM63B_uc010jyz.2_RNA	p.L598L	NM_018426	NP_060896	WXS	Illumina HiSeq	Unspecified	Q5T3F8	TM63B_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)		19	1858	+	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		598					B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Silent	SNP	ENST00000259746.9	37	c.1794C>G	CCDS34461.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379301	0.24944	.	.	ENSG00000137216	ENST00000371893	.	.	.	5.03	4.14	0.48551	.	.	.	.	.	T	0.45955	0.1368	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46162	-0.9211	4	.	.	.	.	8.5335	0.33349	0.0:0.6262:0.2934:0.0804	.	.	.	.	C	527	.	.	S	+	2	0	TMEM63B	44227681	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.352000	0.34033	1.305000	0.44909	0.557000	0.71058	TCT		0.667	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410		5	28	0	0	0	0.000602	0	5	28				
CDC5L	988	broad.mit.edu	37	6	44397514	44397514	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:44397514C>G	ENST00000371477.3	+	14	2257	c.1958C>G	c.(1957-1959)tCa>tGa	p.S653*		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	653	Interaction with DAPK3. {ECO:0000250|UniProtKB:O08837}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGAGAGCTCTCAAGTGAAGCT	0.428																																							uc003oxl.2		NA																	0				lung(3)|ovary(1)|kidney(1)|skin(1)	6						c.(1957-1959)TCA>TGA		CDC5-like							127.0	125.0	126.0					6																	44397514		2203	4300	6503	SO:0001587	stop_gained	988				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|cytoplasm|nuclear speck|nucleolus	DNA binding|RNA binding	g.chr6:44397514C>G	D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.1958C>G	6.37:g.44397514C>G	ENSP00000360532:p.Ser653*		Somatic					p.S653*	NM_001253	NP_001244	WXS	Illumina HiSeq	Unspecified	Q99459	CDC5L_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		14	2217	+	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		653			Interaction with DAPK3 (By similarity).		Q76N46|Q99974	Nonsense_Mutation	SNP	ENST00000371477.3	37	c.1958C>G	CCDS4912.1	.	.	.	.	.	.	.	.	.	.	C	42	9.340007	0.99142	.	.	ENSG00000096401	ENST00000371477	.	.	.	5.81	5.81	0.92471	.	0.108387	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-10.4937	20.0896	0.97814	0.0:1.0:0.0:0.0	.	.	.	.	X	653	.	ENSP00000360532:S653X	S	+	2	0	CDC5L	44505492	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.153000	0.71819	2.741000	0.93983	0.650000	0.86243	TCA		0.428	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040743.1			15	63	0	0	0	0.00499	0	15	63				
TFAP2B	7021	broad.mit.edu	37	6	50786607	50786607	+	Start_Codon_SNP	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:50786607G>T	ENST00000393655.3	+	1	172	c.3G>T	c.(1-3)atG>atT	p.M1I	TFAP2B_ENST00000263046.4_Start_Codon_SNP_p.M1I	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	1					aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					TCACATGAATGCACTCACCTC	0.502																																					Pancreas(116;1373 2332 5475 10752)	Pancreas(116;1373 2332 5475 10752)	uc003pag.2		NA																	0					0						c.(1-3)ATG>ATT		transcription factor AP-2 beta							105.0	88.0	94.0					6																	50786607		2203	4300	6503	SO:0001582	initiator_codon_variant	7021				nervous system development|positive regulation of transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr6:50786607G>T	X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.3G>T	6.37:g.50786607G>T	ENSP00000377265:p.Met1Ile		Somatic					p.M1I	NM_003221	NP_003212	WXS	Illumina HiSeq	Unspecified	Q92481	AP2B_HUMAN			1	169	+	Lung NSC(77;0.156)		1					Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Missense_Mutation	SNP	ENST00000393655.3	37	c.3G>T	CCDS4934.2	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729681	0.48833	.	.	ENSG00000008196	ENST00000393655;ENST00000263046	D;D	0.97089	-4.24;-4.23	4.47	4.47	0.54385	.	0.000000	0.53938	U	0.000045	D	0.92499	0.7618	.	.	.	0.35636	D	0.810607	B	0.02656	0.0	B	0.01281	0.0	D	0.91995	0.5606	9	0.87932	D	0	.	12.9982	0.58660	0.0:0.1626:0.8374:0.0	.	1	Q92481	AP2B_HUMAN	I	1	ENSP00000377265:M1I;ENSP00000263046:M1I	ENSP00000263046:M1I	M	+	3	0	TFAP2B	50894566	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.011000	0.76359	2.032000	0.59987	0.556000	0.70494	ATG		0.502	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040886.3	NM_003221	Missense_Mutation	4	34	1	0	5.9392e-07	0.001168	7.56514e-07	4	34				
GSTA1	2938	broad.mit.edu	37	6	52657738	52657738	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:52657738G>T	ENST00000334575.5	-	6	617	c.462C>A	c.(460-462)agC>agA	p.S154R	GSTA1_ENST00000493331.1_5'UTR	NM_145740.3	NP_665683.1	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	154	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|metabolic process (GO:0008152)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	12	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Glutathione(DB00143)	TGTCAGCCCGGCTCAGCTTGT	0.517																																							uc003paz.2		NA																	0				ovary(1)	1						c.(460-462)AGC>AGA		glutathione S-transferase alpha 1	Amsacrine(DB00276)|Busulfan(DB01008)|Glutathione(DB00143)						178.0	158.0	165.0					6																	52657738		2203	4300	6503	SO:0001583	missense	2938				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity	g.chr6:52657738G>T		CCDS4945.1	6p12.2	2012-06-21	2008-11-26		ENSG00000243955	ENSG00000243955	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4626	protein-coding gene	gene with protein product		138359	"""glutathione S-transferase A1"""			9503014	Standard	NM_145740		Approved		uc003paz.3	P08263	OTTHUMG00000014861	ENST00000334575.5:c.462C>A	6.37:g.52657738G>T	ENSP00000335620:p.Ser154Arg		Somatic					p.S154R	NM_145740	NP_665683	WXS	Illumina HiSeq	Unspecified	P08263	GSTA1_HUMAN			6	574	-	Lung NSC(77;0.118)		154			GST C-terminal.		Q14750|Q5GHF8|Q5SZC1	Missense_Mutation	SNP	ENST00000334575.5	37	c.462C>A	CCDS4945.1	.	.	.	.	.	.	.	.	.	.	.	12.13	1.845405	0.32606	.	.	ENSG00000243955	ENST00000334575	T	0.18502	2.21	2.43	2.43	0.29744	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.33323	0.0859	M	0.90650	3.135	0.37334	D	0.91008	D	0.89917	1.0	D	0.97110	1.0	T	0.31110	-0.9955	10	0.72032	D	0.01	.	8.1284	0.31012	0.1328:0.0:0.8672:0.0	.	154	P08263	GSTA1_HUMAN	R	154	ENSP00000335620:S154R	ENSP00000335620:S154R	S	-	3	2	GSTA1	52765697	0.995000	0.38212	0.968000	0.41197	0.338000	0.28826	2.858000	0.48356	1.043000	0.40175	0.195000	0.17529	AGC		0.517	GSTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040922.1			27	128	1	0	1.75199e-13	0.007291	2.68611e-13	27	128				
GSTA5	221357	broad.mit.edu	37	6	52701069	52701069	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:52701069G>T	ENST00000370989.2	-	3	266	c.237C>A	c.(235-237)taC>taA	p.Y79*	GSTA5_ENST00000284562.2_Nonsense_Mutation_p.Y79*|GSTA5_ENST00000475052.1_Intron			Q7RTV2	GSTA5_HUMAN	glutathione S-transferase alpha 5	79	GST N-terminal.				glutathione metabolic process (GO:0006749)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Lung NSC(77;0.0912)				Glutathione(DB00143)	CATAAAGGTTGTATTTGCTGG	0.433																																							uc003pba.1		NA																	0				ovary(1)	1						c.(235-237)TAC>TAA		glutathione S-transferase alpha 5	Glutathione(DB00143)						192.0	197.0	195.0					6																	52701069		2203	4300	6503	SO:0001587	stop_gained	221357				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity	g.chr6:52701069G>T	BK000212	CCDS4946.1	6p12.2	2012-06-21	2008-11-26		ENSG00000182793	ENSG00000182793	2.5.1.18	"""Glutathione S-transferases / Soluble"""	19662	protein-coding gene	gene with protein product		607605	"""glutathione S-transferase A5"""			12042665	Standard	NM_153699		Approved		uc003pba.1	Q7RTV2	OTTHUMG00000014857	ENST00000370989.2:c.237C>A	6.37:g.52701069G>T	ENSP00000360028:p.Tyr79*		Somatic					p.Y79*	NM_153699	NP_714543	WXS	Illumina HiSeq	Unspecified	Q7RTV2	GSTA5_HUMAN			4	307	-	Lung NSC(77;0.0912)		79			GST N-terminal.		Q5SZC2	Nonsense_Mutation	SNP	ENST00000370989.2	37	c.237C>A	CCDS4946.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481339	0.63849	.	.	ENSG00000182793	ENST00000370989;ENST00000284562	.	.	.	2.63	1.73	0.24493	.	0.067757	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.7047	0.34347	0.1213:0.0:0.8787:0.0	.	.	.	.	X	79	.	ENSP00000284562:Y79X	Y	-	3	2	GSTA5	52809028	1.000000	0.71417	0.999000	0.59377	0.360000	0.29518	1.483000	0.35497	0.416000	0.25844	0.205000	0.17691	TAC		0.433	GSTA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040917.1	NM_153699		47	116	1	0	2.77807e-22	0.003214	4.78485e-22	47	116				
DST	667	broad.mit.edu	37	6	56341021	56341021	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:56341021T>C	ENST00000361203.3	-	87	20837	c.20830A>G	c.(20830-20832)Aca>Gca	p.T6944A	DST_ENST00000244364.6_Missense_Mutation_p.T4641A|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.T4967A|DST_ENST00000370769.4_Missense_Mutation_p.T7055A|DST_ENST00000370788.2_Missense_Mutation_p.T4858A|DST_ENST00000446842.2_Missense_Mutation_p.T6729A|DST_ENST00000370754.5_Missense_Mutation_p.T7233A			Q03001	DYST_HUMAN	dystonin	6944					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCAGTAAGTGTAGTTTCAGCC	0.433																																							uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(15433-15435)ACA>GCA		dystonin isoform 2							74.0	72.0	73.0					6																	56341021		1930	4120	6050	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56341021T>C	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.20830A>G	6.37:g.56341021T>C	ENSP00000354508:p.Thr6944Ala		Somatic				DST_uc003pcz.3_Missense_Mutation_p.T4967A|DST_uc011dxj.1_Missense_Mutation_p.T4996A|DST_uc011dxk.1_Missense_Mutation_p.T5007A|DST_uc003pcy.3_Missense_Mutation_p.T4641A	p.T5145A	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		86	15461	-	Lung NSC(77;0.103)		7053					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.15433A>G		.	.	.	.	.	.	.	.	.	.	T	20.9	4.058989	0.76074	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.51574	0.7;1.37;1.37;0.7;1.37;1.37;1.37	5.87	5.87	0.94306	.	0.000000	0.56097	D	0.000029	T	0.58177	0.2104	M	0.66378	2.025	0.30726	N	0.74776	D;D;D;P;B	0.71674	0.998;0.998;0.998;0.919;0.367	D;D;D;B;B	0.75484	0.986;0.93;0.952;0.3;0.219	T	0.54589	-0.8271	9	0.27785	T	0.31	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	4967;7055;7233;7053;4641	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	A	4641;7233;7055;4967;6729;4858;6944	ENSP00000244364:T4641A;ENSP00000359790:T7233A;ENSP00000359805:T7055A;ENSP00000400883:T4967A;ENSP00000393645:T6729A;ENSP00000359824:T4858A;ENSP00000354508:T6944A	ENSP00000244364:T4641A	T	-	1	0	DST	56448980	1.000000	0.71417	0.514000	0.27761	0.928000	0.56348	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	ACA		0.433	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		7	18	0	0	0	0.00308	0	7	18				
EYS	346007	broad.mit.edu	37	6	66112371	66112371	+	Splice_Site	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:66112371C>G	ENST00000370621.3	-	7	1710	c.1184G>C	c.(1183-1185)aGc>aCc	p.S395T	EYS_ENST00000370616.2_Splice_Site_p.S395T|EYS_ENST00000503581.1_Splice_Site_p.S395T|EYS_ENST00000342421.5_Splice_Site_p.S395T|EYS_ENST00000393380.2_Splice_Site_p.S395T|EYS_ENST00000370618.3_Splice_Site_p.S395T			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	395	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTAATTATACCTGCAAGGATA	0.274																																							uc011dxu.1		NA																	0				lung(4)|ovary(1)|skin(1)	6						c.(1183-1185)AGC>ACC		eyes shut homolog isoform 1							40.0	41.0	41.0					6																	66112371		2201	4282	6483	SO:0001630	splice_region_variant	346007				response to stimulus|visual perception	extracellular region	calcium ion binding	g.chr6:66112371C>G		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1184+1G>C	6.37:g.66112371C>G			Somatic				EYS_uc003peq.2_Missense_Mutation_p.S395T|EYS_uc003per.1_Missense_Mutation_p.S395T	p.S395T	NM_001142800	NP_001136272	WXS	Illumina HiSeq	Unspecified	Q5T1H1	EYS_HUMAN			7	1722	-			395			EGF-like 5.		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37	c.1184G>C		.	.	.	.	.	.	.	.	.	.	C	3.868	-0.028454	0.07589	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	4.68	3.79	0.43588	.	.	.	.	.	T	0.66287	0.2774	N	0.12961	0.28	0.21697	N	0.999582	P;D;P	0.54207	0.728;0.965;0.941	B;P;P	0.53450	0.366;0.726;0.537	T	0.60811	-0.7189	8	.	.	.	.	11.542	0.50672	0.1911:0.8089:0.0:0.0	.	395;395;395	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	T	395	ENSP00000424243:S395T;ENSP00000359655:S395T;ENSP00000359650:S395T;ENSP00000377042:S395T;ENSP00000341818:S395T;ENSP00000359652:S395T	.	S	-	2	0	EYS	66169092	1.000000	0.71417	0.350000	0.25708	0.089000	0.18198	1.516000	0.35856	0.915000	0.36847	0.591000	0.81541	AGC		0.274	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	Missense_Mutation	3	18	0	0	0	0.004672	0	3	18				
IMPG1	3617	broad.mit.edu	37	6	76715160	76715160	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:76715160A>G	ENST00000369950.3	-	10	1168	c.979T>C	c.(979-981)Tcc>Ccc	p.S327P	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				ATTTTGTTGGAATCAAAAGAC	0.448																																					Pancreas(37;839 1141 2599 26037)	Pancreas(37;839 1141 2599 26037)	uc003pik.1		NA																	0				ovary(2)|skin(1)	3						c.(979-981)TCC>CCC		interphotoreceptor matrix proteoglycan 1							153.0	139.0	143.0					6																	76715160		2203	4300	6503	SO:0001583	missense	3617				visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity	g.chr6:76715160A>G	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.979T>C	6.37:g.76715160A>G	ENSP00000358966:p.Ser327Pro		Somatic					p.S327P	NM_001563	NP_001554	WXS	Illumina HiSeq	Unspecified	Q17R60	IMPG1_HUMAN			10	1109	-		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)	327			SEA 1.			Missense_Mutation	SNP	ENST00000369950.3	37	c.979T>C	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904352	0.52333	.	.	ENSG00000112706	ENST00000369950	T	0.40225	1.04	5.82	4.65	0.58169	SEA (2);	0.000000	0.64402	D	0.000006	T	0.37652	0.1011	M	0.75777	2.31	0.80722	D	1	B	0.30664	0.289	B	0.40477	0.33	T	0.47341	-0.9125	10	0.62326	D	0.03	.	10.5925	0.45318	0.9246:0.0:0.0754:0.0	.	327	Q17R60	IMPG1_HUMAN	P	327	ENSP00000358966:S327P	ENSP00000358966:S327P	S	-	1	0	IMPG1	76771880	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	3.774000	0.55341	2.232000	0.73038	0.477000	0.44152	TCC		0.448	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563		4	68	0	0	0	0.000248	0	4	68				
SNAP91	9892	broad.mit.edu	37	6	84375238	84375238	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:84375238C>T	ENST00000439399.2	-	3	509	c.193G>A	c.(193-195)Gag>Aag	p.E65K	SNAP91_ENST00000521485.1_Missense_Mutation_p.E65K|SNAP91_ENST00000520302.1_Missense_Mutation_p.E65K|SNAP91_ENST00000520213.1_Missense_Mutation_p.E65K|SNAP91_ENST00000369694.2_Missense_Mutation_p.E65K|SNAP91_ENST00000521743.1_Missense_Mutation_p.E65K|SNAP91_ENST00000428679.2_Missense_Mutation_p.E65K|SNAP91_ENST00000437520.1_Missense_Mutation_p.E65K|SNAP91_ENST00000195649.6_Missense_Mutation_p.E65K	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	65	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GTTGCCCGCTCAAAGAGAGTG	0.383																																							uc011dze.1		NA																	0				ovary(1)	1						c.(193-195)GAG>AAG		synaptosomal-associated protein, 91kDa homolog							170.0	164.0	166.0					6																	84375238		1881	4098	5979	SO:0001583	missense	9892				clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding	g.chr6:84375238C>T	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.193G>A	6.37:g.84375238C>T	ENSP00000400459:p.Glu65Lys		Somatic				SNAP91_uc003pkb.2_Missense_Mutation_p.E30K|SNAP91_uc003pkc.2_Missense_Mutation_p.E65K|SNAP91_uc003pkd.2_Missense_Mutation_p.E65K|SNAP91_uc003pka.2_Missense_Mutation_p.E65K|SNAP91_uc011dzf.1_Intron	p.E65K	NM_014841	NP_055656	WXS	Illumina HiSeq	Unspecified	O60641	AP180_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0967)	3	510	-		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)	65			ENTH.		A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	37	c.193G>A	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	C	36	5.748460	0.96882	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931;ENST00000519779;ENST00000518309;ENST00000369690;ENST00000523484;ENST00000519825	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61	5.6	5.6	0.85130	ENTH/VHS (2);ANTH (1);Epsin-like, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.56108	0.1963	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.67145	0.995;0.989;0.996;0.996	D;D;D;D	0.76071	0.984;0.981;0.987;0.987	T	0.60712	-0.7209	10	0.87932	D	0	-13.2075	19.9756	0.97304	0.0:1.0:0.0:0.0	.	65;65;65;65	O60641-3;E5RI02;O60641;E1P549	.;.;AP180_HUMAN;.	K	65	ENSP00000429776:E65K;ENSP00000358708:E65K;ENSP00000400459:E65K;ENSP00000195649:E65K;ENSP00000412492:E65K;ENSP00000413277:E65K;ENSP00000428511:E65K;ENSP00000428215:E65K;ENSP00000428026:E65K;ENSP00000430071:E65K;ENSP00000429429:E65K;ENSP00000430441:E65K;ENSP00000358704:E65K;ENSP00000427959:E65K;ENSP00000431055:E65K	ENSP00000195649:E65K	E	-	1	0	SNAP91	84431957	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.793000	0.96121	0.563000	0.77884	GAG		0.383	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1			26	140	0	0	0	0.00333	0	26	140				
GJA10	84694	broad.mit.edu	37	6	90605647	90605647	+	Missense_Mutation	SNP	C	C	G	rs150458704		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:90605647C>G	ENST00000369352.1	+	1	1460	c.1460C>G	c.(1459-1461)cCg>cGg	p.P487R	Y_RNA_ENST00000517082.1_RNA	NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	0					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		GCAGCCCTACCGATCATGGAA	0.473																																							uc011eaa.1		NA																	0					0						c.(1459-1461)CCG>CGG		gap junction protein, alpha 10							136.0	129.0	131.0					6																	90605647		2203	4300	6503	SO:0001583	missense	84694				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity	g.chr6:90605647C>G	AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.1460C>G	6.37:g.90605647C>G	ENSP00000358358:p.Pro487Arg		Somatic					p.P487R	NM_032602	NP_115991	WXS	Illumina HiSeq	Unspecified	Q969M2	CXA10_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0915)	1	1460	+		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)	487			Cytoplasmic (Potential).		B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	ENST00000369352.1	37	c.1460C>G	CCDS5025.1	.	.	.	.	.	.	.	.	.	.	C	8.739	0.918495	0.17982	.	.	ENSG00000135355	ENST00000369352	D	0.97731	-4.51	4.55	3.4	0.38934	.	1.653120	0.04513	U	0.383251	D	0.89234	0.6657	N	0.22421	0.69	0.09310	N	1	B	0.31680	0.335	B	0.30943	0.122	D	0.86420	0.1754	10	0.29301	T	0.29	.	6.1531	0.20322	0.0:0.1186:0.0:0.8814	.	487	Q969M2	CXA10_HUMAN	R	487	ENSP00000358358:P487R	ENSP00000358358:P487R	P	+	2	0	GJA10	90662368	0.054000	0.20591	0.039000	0.18376	0.050000	0.14768	0.200000	0.17257	0.784000	0.33661	-0.471000	0.05019	CCG		0.473	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041505.1	NM_032602		35	96	0	0	0	0.005524	0	35	96				
RFX6	222546	broad.mit.edu	37	6	117232175	117232175	+	Silent	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:117232175T>A	ENST00000332958.2	+	7	766	c.750T>A	c.(748-750)ctT>ctA	p.L250L	RFX6_ENST00000471966.1_3'UTR	NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	250					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CTCAACACCTTGTATACCAAG	0.373																																							uc003pxm.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(748-750)CTT>CTA		regulatory factor X, 6							100.0	99.0	100.0					6																	117232175		2203	4300	6503	SO:0001819	synonymous_variant	222546				glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding	g.chr6:117232175T>A	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.750T>A	6.37:g.117232175T>A			Somatic					p.L250L	NM_173560	NP_775831	WXS	Illumina HiSeq	Unspecified	Q8HWS3	RFX6_HUMAN			7	813	+			250					Q5T6B3	Silent	SNP	ENST00000332958.2	37	c.750T>A	CCDS5113.1																																																																																				0.373	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560		32	50	0	0	0	0.004878	0	32	50				
EYA4	2070	broad.mit.edu	37	6	133827275	133827275	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:133827275G>T	ENST00000367895.5	+	14	1687	c.1223G>T	c.(1222-1224)cGc>cTc	p.R408L	EYA4_ENST00000355167.3_Missense_Mutation_p.R408L|EYA4_ENST00000525849.1_Missense_Mutation_p.R385L|EYA4_ENST00000430974.2_Missense_Mutation_p.R360L|EYA4_ENST00000431403.2_Missense_Mutation_p.R408L|EYA4_ENST00000531901.1_Missense_Mutation_p.R414L|RP3-323P13.2_ENST00000607033.1_RNA|RP3-323P13.2_ENST00000451017.1_RNA|EYA4_ENST00000452339.2_Missense_Mutation_p.R354L|EYA4_ENST00000355286.6_Missense_Mutation_p.R385L	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	408					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CTTGGACTCCGCATGGAAGAA	0.328																																					Melanoma(57;398 1237 3528 4702 7415)	Melanoma(57;398 1237 3528 4702 7415)	uc003qec.3		NA																	0				large_intestine(2)	2						c.(1222-1224)CGC>CTC		eyes absent 4 isoform a							79.0	81.0	80.0					6																	133827275		2203	4300	6503	SO:0001583	missense	2070				anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr6:133827275G>T	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1223G>T	6.37:g.133827275G>T	ENSP00000356870:p.Arg408Leu		Somatic				EYA4_uc011ecq.1_Missense_Mutation_p.R354L|EYA4_uc011ecr.1_Missense_Mutation_p.R360L|EYA4_uc003qed.3_Missense_Mutation_p.R408L|EYA4_uc003qee.3_Missense_Mutation_p.R385L|EYA4_uc011ecs.1_Missense_Mutation_p.R414L|uc003qef.1_RNA|uc003qeg.1_RNA	p.R408L	NM_004100	NP_004091	WXS	Illumina HiSeq	Unspecified	O95677	EYA4_HUMAN		GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)	14	1681	+	Colorectal(23;0.221)		408					B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	c.1223G>T	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584447	0.65992	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.63	4.74	0.60224	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.112992	0.64402	D	0.000010	D	0.84261	0.5433	M	0.82517	2.595	0.80722	D	1	B;B;D;P;B;B	0.55385	0.005;0.028;0.971;0.928;0.011;0.011	B;B;P;P;B;B	0.47744	0.033;0.053;0.556;0.556;0.033;0.033	D	0.86988	0.2108	10	0.72032	D	0.01	-4.9479	15.4675	0.75412	0.0699:0.0:0.9301:0.0	.	414;360;354;385;408;408	F2Z2Y1;E7ESD5;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;.;EYA4_HUMAN	L	354;360;408;408;385;414;385;408	ENSP00000395916:R354L;ENSP00000388670:R360L;ENSP00000356870:R408L;ENSP00000347294:R408L;ENSP00000347434:R385L;ENSP00000432770:R414L;ENSP00000433219:R385L;ENSP00000404558:R408L	ENSP00000347294:R408L	R	+	2	0	EYA4	133868968	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	7.195000	0.77798	2.816000	0.96949	0.650000	0.86243	CGC		0.328	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100		6	52	1	0	8.12818e-05	0.001984	9.57097e-05	6	52				
LATS1	9113	broad.mit.edu	37	6	150004837	150004837	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:150004837T>C	ENST00000543571.1	-	4	1935	c.1388A>G	c.(1387-1389)aAt>aGt	p.N463S	LATS1_ENST00000253339.5_Missense_Mutation_p.N463S|LATS1_ENST00000392273.3_Missense_Mutation_p.N463S|LATS1_ENST00000542747.1_5'UTR	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		ATTAAAAGAATTTGACCTCAC	0.453																																							uc003qmu.1		NA																	0				lung(5)|central_nervous_system(1)	6						c.(1387-1389)AAT>AGT		LATS homolog 1							163.0	168.0	166.0					6																	150004837		2203	4300	6503	SO:0001583	missense	9113				cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity	g.chr6:150004837T>C	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.1388A>G	6.37:g.150004837T>C	ENSP00000437550:p.Asn463Ser		Somatic				LATS1_uc010kif.1_Missense_Mutation_p.N358S|LATS1_uc003qmv.1_Missense_Mutation_p.N463S|LATS1_uc003qmw.2_Missense_Mutation_p.N463S|LATS1_uc010kig.1_Missense_Mutation_p.N358S	p.N463S	NM_004690	NP_004681	WXS	Illumina HiSeq	Unspecified	O95835	LATS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)	4	1936	-		Ovarian(120;0.0164)	463						Missense_Mutation	SNP	ENST00000543571.1	37	c.1388A>G	CCDS34551.1	.	.	.	.	.	.	.	.	.	.	T	16.77	3.213910	0.58452	.	.	ENSG00000131023	ENST00000543571;ENST00000253339;ENST00000392273	T;T;T	0.55930	0.49;0.49;2.82	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000006	T	0.33147	0.0853	L	0.47716	1.5	0.43808	D	0.996361	B;P;B	0.46784	0.115;0.884;0.403	B;B;B	0.39503	0.083;0.301;0.145	T	0.17501	-1.0367	9	.	.	.	.	15.3947	0.74781	0.0:0.0:0.0:1.0	.	315;463;463	Q59FN4;O95835-2;O95835	.;.;LATS1_HUMAN	S	463	ENSP00000437550:N463S;ENSP00000253339:N463S;ENSP00000444678:N463S	.	N	-	2	0	LATS1	150046530	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.816000	0.62642	2.057000	0.61298	0.533000	0.62120	AAT		0.453	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690		78	114	0	0	0	0.00361	0	78	114				
SLC22A2	6582	broad.mit.edu	37	6	160668324	160668324	+	Silent	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:160668324T>A	ENST00000366953.3	-	5	1107	c.849A>T	c.(847-849)atA>atT	p.I283I	SLC22A2_ENST00000491092.1_5'UTR|SLC22A2_ENST00000366952.1_Silent_p.I262I	NM_003058.3	NP_003049.2	O15244	S22A2_HUMAN	solute carrier family 22 (organic cation transporter), member 2	283					body fluid secretion (GO:0007589)|drug transmembrane transport (GO:0006855)|histamine transport (GO:0051608)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|organic cation transport (GO:0015695)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|steroid binding (GO:0005496)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(16)|prostate(2)|skin(1)	27		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Chlorphenamine(DB01114)|Choline(DB00122)|Cimetidine(DB00501)|Cisplatin(DB00515)|Cladribine(DB00242)|Cocaine(DB00907)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Desipramine(DB01151)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Famotidine(DB00927)|Flurazepam(DB00690)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Memantine(DB01043)|Metformin(DB00331)|Metoprolol(DB00264)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Oxprenolol(DB01580)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Propranolol(DB00571)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Reserpine(DB00206)|Thiamine(DB00152)|Tubocurarine(DB01199)|Vinblastine(DB00570)|Zidovudine(DB00495)	GAGACTCAGGTATGCACCTAG	0.448																																							uc003qtf.2		NA																	0				breast(1)|skin(1)	2						c.(847-849)ATA>ATT		solute carrier family 22 member 2							105.0	96.0	99.0					6																	160668324		2203	4300	6503	SO:0001819	synonymous_variant	6582				body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity	g.chr6:160668324T>A	X98333	CCDS5276.1	6q25.3	2013-05-22			ENSG00000112499	ENSG00000112499		"""Solute carriers"""	10966	protein-coding gene	gene with protein product		602608				9605850	Standard	NM_003058		Approved	OCT2	uc003qtf.3	O15244	OTTHUMG00000015950	ENST00000366953.3:c.849A>T	6.37:g.160668324T>A			Somatic				SLC22A2_uc003qte.1_Silent_p.I283I	p.I283I	NM_003058	NP_003049	WXS	Illumina HiSeq	Unspecified	O15244	S22A2_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	5	1019	-		Breast(66;0.000776)|Ovarian(120;0.0303)	283			Helical; (Potential).		Q5T7Q6|Q6PIQ8|Q8NG62|Q9NQB9	Silent	SNP	ENST00000366953.3	37	c.849A>T	CCDS5276.1																																																																																				0.448	SLC22A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042943.1	NM_003058		6	61	0	0	0	0.001168	0	6	61				
C6orf118	168090	broad.mit.edu	37	6	165715399	165715399	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:165715399G>T	ENST00000230301.8	-	2	432	c.412C>A	c.(412-414)Ctt>Att	p.L138I	C6orf118_ENST00000543069.1_Missense_Mutation_p.L34I	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	138										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		GTGTGGGAAAGAGAGGCCTGG	0.617																																							uc003qum.3		NA																	0					0						c.(412-414)CTT>ATT		hypothetical protein LOC168090							66.0	75.0	72.0					6																	165715399		2203	4299	6502	SO:0001583	missense	168090							g.chr6:165715399G>T		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.412C>A	6.37:g.165715399G>T	ENSP00000230301:p.Leu138Ile		Somatic				C6orf118_uc011egi.1_RNA	p.L138I	NM_144980	NP_659417	WXS	Illumina HiSeq	Unspecified	Q5T5N4	CF118_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)	2	448	-		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)	138					Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	37	c.412C>A	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	G	3.830	-0.036006	0.07497	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.15834	2.65;2.39	4.9	-9.8	0.00490	.	5.081990	0.00166	N	0.000003	T	0.02688	0.0081	L	0.34521	1.04	0.09310	N	1	B	0.21147	0.052	B	0.12837	0.008	T	0.22103	-1.0226	10	0.22706	T	0.39	.	5.2993	0.15770	0.2576:0.1277:0.5234:0.0912	.	138	Q5T5N4	CF118_HUMAN	I	138;34	ENSP00000230301:L138I;ENSP00000439288:L34I	ENSP00000230301:L138I	L	-	1	0	C6orf118	165635389	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.651000	0.00857	-1.654000	0.01499	-0.211000	0.12701	CTT		0.617	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980		6	135	1	0	1.06961e-07	0.00308	1.40518e-07	6	135				
GPR31	2853	broad.mit.edu	37	6	167570401	167570401	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:167570401C>G	ENST00000366834.1	-	1	1416	c.919G>C	c.(919-921)Gca>Cca	p.A307P		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	307					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		GGGGGCTCTGCTGCCTGCCCT	0.557																																							uc011egq.1		NA																	0					0						c.(919-921)GCA>CCA		G protein-coupled receptor 31							53.0	58.0	56.0					6																	167570401		2203	4300	6503	SO:0001583	missense	2853					integral to plasma membrane	G-protein coupled receptor activity	g.chr6:167570401C>G	U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.919G>C	6.37:g.167570401C>G	ENSP00000355799:p.Ala307Pro		Somatic					p.A307P	NM_005299	NP_005290	WXS	Illumina HiSeq	Unspecified	O00270	GPR31_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)	1	919	-		Breast(66;1.53e-05)|Ovarian(120;0.0606)	307			Cytoplasmic (Potential).		B0M0K2|Q4VBL3|Q9NQ20	Missense_Mutation	SNP	ENST00000366834.1	37	c.919G>C	CCDS5299.1	.	.	.	.	.	.	.	.	.	.	C	8.559	0.877288	0.17395	.	.	ENSG00000120436	ENST00000366834	T	0.61510	0.1	3.54	-7.07	0.01563	.	1.587520	0.04522	U	0.384863	T	0.13329	0.0323	N	0.14661	0.345	0.09310	N	1	P	0.37731	0.607	B	0.36719	0.231	T	0.15263	-1.0443	10	0.51188	T	0.08	0.0256	2.1368	0.03764	0.1093:0.2801:0.1883:0.4223	.	307	O00270	GPR31_HUMAN	P	307	ENSP00000355799:A307P	ENSP00000355799:A307P	A	-	1	0	GPR31	167490391	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.663000	0.05299	-1.952000	0.01027	-0.657000	0.03884	GCA		0.557	GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043111.1	NM_005299		4	48	0	0	0	0.000248	0	4	48				
TNRC18	84629	broad.mit.edu	37	7	5410791	5410791	+	Missense_Mutation	SNP	C	C	A	rs371595450	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:5410791C>A	ENST00000430969.1	-	11	3782	c.3434G>T	c.(3433-3435)cGg>cTg	p.R1145L	TNRC18_ENST00000399537.4_Missense_Mutation_p.R1145L	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1145	Pro-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CGGGCCCTCCCGCAGCGGCTC	0.687																																							uc003soi.3		NA																	0					0						c.(3433-3435)CGG>CTG		trinucleotide repeat containing 18							14.0	17.0	16.0					7																	5410791		1991	4148	6139	SO:0001583	missense	84629						DNA binding	g.chr7:5410791C>A	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.3434G>T	7.37:g.5410791C>A	ENSP00000395538:p.Arg1145Leu		Somatic					p.R1145L	NM_001080495	NP_001073964	WXS	Illumina HiSeq	Unspecified	O15417	TNC18_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)	11	3783	-		Ovarian(82;0.142)	1145			Pro-rich.		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	c.3434G>T	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.237104	0.22711	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000327499	T;T	0.11821	2.74;2.74	4.87	1.39	0.22231	.	0.435684	0.17103	N	0.186926	T	0.12603	0.0306	M	0.67953	2.075	0.18873	N	0.999988	P	0.40332	0.713	B	0.35312	0.2	T	0.13202	-1.0518	10	0.38643	T	0.18	.	6.7157	0.23302	0.0:0.3552:0.5044:0.1404	.	1145	O15417	TNC18_HUMAN	L	1145;1145;200;200	ENSP00000382452:R1145L;ENSP00000395538:R1145L	ENSP00000330383:R200L	R	-	2	0	TNRC18	5377317	0.013000	0.17824	0.057000	0.19452	0.973000	0.67179	0.120000	0.15647	0.418000	0.25898	0.462000	0.41574	CGG		0.687	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				15	15	1	0	6.31663e-08	0.003163	8.36391e-08	15	15				
POLD2	5425	broad.mit.edu	37	7	44156578	44156578	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:44156578G>A	ENST00000406581.2	-	7	1267	c.618C>T	c.(616-618)ggC>ggT	p.G206G	POLD2_ENST00000452185.1_Silent_p.G206G|POLD2_ENST00000223361.3_Silent_p.G206G	NM_001256879.1	NP_001243808.1	P49005	DPOD2_HUMAN	polymerase (DNA directed), delta 2, accessory subunit	206					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	12						CGCCTCCACCGCCACCCAGGC	0.692																																							uc010kxz.2		NA																	0				ovary(2)	2						c.(616-618)GGC>GGT		DNA-directed DNA polymerase delta 2							19.0	22.0	21.0					7																	44156578		2202	4298	6500	SO:0001819	synonymous_variant	5425				base-excision repair|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity|protein binding	g.chr7:44156578G>A		CCDS5477.1, CCDS75586.1	7p13	2012-05-18	2012-05-18		ENSG00000106628	ENSG00000106628		"""DNA polymerases"""	9176	protein-coding gene	gene with protein product	"""Pol delta B subunit (p50)"", ""DNA polymerase delta subunit p50"""	600815	"""polymerase (DNA directed), delta 2, regulatory subunit (50kD)"", ""polymerase (DNA directed), delta 2, regulatory subunit 50kDa"""			8530069	Standard	NM_001127218		Approved		uc003tkf.5	P49005	OTTHUMG00000022909	ENST00000406581.2:c.618C>T	7.37:g.44156578G>A			Somatic				POLD2_uc003tke.3_Silent_p.G206G|POLD2_uc010kya.2_Silent_p.G206G|POLD2_uc003tkf.3_Silent_p.G206G	p.G206G	NM_006230	NP_006221	WXS	Illumina HiSeq	Unspecified	P49005	DPOD2_HUMAN			7	1268	-			206					A4D2J4|B2R5S4	Silent	SNP	ENST00000406581.2	37	c.618C>T	CCDS5477.1																																																																																				0.692	POLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250994.2	NM_001127218		20	20	0	0	0	0.001523	0	20	20				
IGFBP3	3486	broad.mit.edu	37	7	45956212	45956212	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:45956212C>T	ENST00000275521.6	-	3	818	c.685G>A	c.(685-687)Gtg>Atg	p.V229M	IGFBP3_ENST00000381083.4_Missense_Mutation_p.V235M|IGFBP3_ENST00000465642.1_5'Flank|IGFBP3_ENST00000381086.5_Missense_Mutation_p.V132M	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	229	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)			large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	GGACTCAGCACATTGAGGAAC	0.478																																							uc003tns.2		NA																	0				large_intestine(2)|lung(1)	3						c.(685-687)GTG>ATG		insulin-like growth factor binding protein 3	Mecasermin(DB01277)						199.0	169.0	179.0					7																	45956212		2203	4300	6503	SO:0001583	missense	3486				negative regulation of protein phosphorylation|negative regulation of signal transduction|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of apoptosis|positive regulation of myoblast differentiation|protein phosphorylation|regulation of cell growth	nucleus	insulin-like growth factor I binding|metal ion binding|protein tyrosine phosphatase activator activity	g.chr7:45956212C>T		CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.685G>A	7.37:g.45956212C>T	ENSP00000275521:p.Val229Met		Somatic				IGFBP3_uc003tnq.2_RNA|IGFBP3_uc003tnr.2_Missense_Mutation_p.V235M|IGFBP3_uc003tnt.2_Missense_Mutation_p.V132M	p.V229M	NM_000598	NP_000589	WXS	Illumina HiSeq	Unspecified	P17936	IBP3_HUMAN			3	817	-			229			Thyroglobulin type-1.		A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Missense_Mutation	SNP	ENST00000275521.6	37	c.685G>A	CCDS5505.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	14.63|14.63|14.63	2.591520|2.591520|2.591520	0.46214|0.46214|0.46214	.|.|.	.|.|.	ENSG00000146674|ENSG00000146674|ENSG00000146674	ENST00000417621|ENST00000428530|ENST00000545032;ENST00000275521;ENST00000381086;ENST00000438491;ENST00000442142;ENST00000381083;ENST00000433047;ENST00000448817	.|.|T;T;T;T	.|.|0.63913	.|.|-0.07;-0.07;-0.07;-0.07	4.83|4.83|4.83	2.88|2.88|2.88	0.33553|0.33553|0.33553	.|.|Thyroglobulin type-1 (4);	.|.|0.492239	.|.|0.20445	.|.|N	.|.|0.092206	T|T|T	0.52709|0.52709|0.52709	0.1751|0.1751|0.1751	L|L|L	0.27053|0.27053|0.27053	0.805|0.805|0.805	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|.|B;B;P	.|.|0.40834	.|.|0.334;0.399;0.73	.|.|B;B;P	.|.|0.46339	.|.|0.351;0.34;0.513	T|T|T	0.39761|0.39761|0.39761	-0.9598|-0.9598|-0.9598	5|5|10	.|.|0.28530	.|.|T	.|.|0.3	-20.4559|-20.4559|-20.4559	10.3434|10.3434|10.3434	0.43893|0.43893|0.43893	0.0:0.8705:0.0:0.1295|0.0:0.8705:0.0:0.1295|0.0:0.8705:0.0:0.1295	.|.|.	.|.|132;229;214	.|.|B3KWK7;P17936;B4DN53	.|.|.;IBP3_HUMAN;.	Y|I|M	90|80|206;229;132;215;127;235;201;119	.|.|ENSP00000275521:V229M;ENSP00000370476:V132M;ENSP00000370473:V235M;ENSP00000389668:V119M	.|.|ENSP00000275521:V229M	C|M|V	-|-|-	2|3|1	0|0|0	IGFBP3|IGFBP3|IGFBP3	45922737|45922737|45922737	0.927000|0.927000|0.927000	0.31430|0.31430|0.31430	0.086000|0.086000|0.086000	0.20670|0.20670|0.20670	0.944000|0.944000|0.944000	0.59088|0.59088|0.59088	1.203000|1.203000|1.203000	0.32284|0.32284|0.32284	0.356000|0.356000|0.356000	0.24157|0.24157|0.24157	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TGT|ATG|GTG		0.478	IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251356.3	NM_001013398		57	66	0	0	0	0.00361	0	57	66				
CDC14C	168448	broad.mit.edu	37	7	48964302	48964302	+	IGR	SNP	C	C	A	rs401292	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:48964302C>A								AC004899.1 (73081 upstream) : AC010971.1 (305430 downstream)																							CCCGCGCCGCCGGGACCCCCA	0.612																																							uc010kyv.1		NA																	0					0						c.(34-36)CGG>AGG		SubName: Full=Putative uncharacterized protein MGC26484;																																				SO:0001628	intergenic_variant	168448							g.chr7:48964302C>A																													7.37:g.48964302C>A			Somatic					p.R12R	NR_003595		WXS	Illumina HiSeq	Unspecified					1	146	+									Silent	SNP		37	c.34C>A																																																																																				0	0.612									31	28	1	0	1.61788e-16	0.002445	2.62465e-16	31	28				
GBAS	2631	broad.mit.edu	37	7	56062641	56062641	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:56062641C>G	ENST00000322090.3	+	8	701	c.672C>G	c.(670-672)ttC>ttG	p.F224L	GBAS_ENST00000446778.1_Missense_Mutation_p.F185L	NM_001483.2	NP_001474.1	O75323	NIPS2_HUMAN	glioblastoma amplified sequence	224					ATP biosynthetic process (GO:0006754)|negative regulation of ATP citrate synthase activity (GO:2000984)|oxidative phosphorylation (GO:0006119)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GAGGATTCTTCTCTCAGATTG	0.438																																							uc003tre.1		NA																	0				central_nervous_system(1)	1						c.(670-672)TTC>TTG		nipsnap homolog 2							288.0	253.0	264.0					7																	56062641		2203	4300	6503	SO:0001583	missense	2631					integral to plasma membrane|membrane fraction|mitochondrion	protein binding	g.chr7:56062641C>G	AF029786	CCDS5521.1, CCDS56488.1	7p12	2014-03-11			ENSG00000146729	ENSG00000146729			4179	protein-coding gene	gene with protein product		603004				9615231, 9661659, 20888800	Standard	NM_001483		Approved	NIPSNAP2	uc003tre.2	O75323	OTTHUMG00000022932	ENST00000322090.3:c.672C>G	7.37:g.56062641C>G	ENSP00000313050:p.Phe224Leu		Somatic				GBAS_uc003trf.1_Missense_Mutation_p.F185L	p.F224L	NM_001483	NP_001474	WXS	Illumina HiSeq	Unspecified	O75323	NIPS2_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		8	680	+	Breast(14;0.214)		224					C9IYJ3|O43801|Q53X96	Missense_Mutation	SNP	ENST00000322090.3	37	c.672C>G	CCDS5521.1	.	.	.	.	.	.	.	.	.	.	C	36	5.606392	0.96626	.	.	ENSG00000146729	ENST00000322090;ENST00000446778	T;T	0.54279	0.58;0.58	5.7	5.7	0.88788	Dimeric alpha-beta barrel (1);	0.000000	0.85682	D	0.000000	T	0.77018	0.4069	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.991;0.997	T	0.79881	-0.1616	10	0.72032	D	0.01	-19.7471	18.8203	0.92094	0.0:1.0:0.0:0.0	.	185;224	C9IYJ3;O75323	.;NIPS2_HUMAN	L	224;185	ENSP00000313050:F224L;ENSP00000406855:F185L	ENSP00000313050:F224L	F	+	3	2	GBAS	56030135	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.630000	0.74272	2.685000	0.91497	0.655000	0.94253	TTC		0.438	GBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251524.1	NM_001483		4	99	0	0	0	0.000602	0	4	99				
SBDS	51119	broad.mit.edu	37	7	66456250	66456250	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:66456250C>G	ENST00000246868.2	-	4	681	c.498G>C	c.(496-498)aaG>aaC	p.K166N		NM_016038.2	NP_057122.2	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome	166					bone marrow development (GO:0048539)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|inner cell mass cell proliferation (GO:0001833)|leukocyte chemotaxis (GO:0030595)|mature ribosome assembly (GO:0042256)|mitotic spindle stabilization (GO:0043148)|ribosomal large subunit biogenesis (GO:0042273)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			cervix(1)|endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7						CACGTTCTATCTTCATTTTCT	0.373			Gene Conversion			"""AML, MDS"""			Shwachman-Diamond syndrome																														uc003tvm.1		NA	yes	Rec		Schwachman-Diamond syndrome	7	7q11	51119	Gene Conversion	Shwachman-Bodian-Diamond syndrome protein			L		AML|MDS			0				ovary(1)	1						c.(496-498)AAG>AAC		Shwachman-Bodian-Diamond syndrome protein							93.0	82.0	86.0					7																	66456250		2203	4300	6503	SO:0001583	missense	51119	Shwachman-Diamond_syndrome	Familial Cancer Database	Shwachman syndrome, Shwachman-Bodian syndrome, Congenital Lipomatosis of the Pancreas	bone marrow development|bone mineralization|leukocyte chemotaxis|mature ribosome assembly|mitotic spindle stabilization|positive regulation of translation|ribosomal large subunit biogenesis|rRNA processing	cytoplasm|nucleolus|nucleoplasm|spindle pole	microtubule binding|ribosome binding|rRNA binding	g.chr7:66456250C>G	AF151855	CCDS5537.1	7q11.22	2014-09-17			ENSG00000126524	ENSG00000126524			19440	protein-coding gene	gene with protein product		607444				12496757	Standard	NM_016038		Approved	CGI-97, FLJ10917, SDS, SWDS	uc003tvm.1	Q9Y3A5	OTTHUMG00000023165	ENST00000246868.2:c.498G>C	7.37:g.66456250C>G	ENSP00000246868:p.Lys166Asn		Somatic					p.K166N	NM_016038	NP_057122	WXS	Illumina HiSeq	Unspecified	Q9Y3A5	SBDS_HUMAN			4	682	-			166					A8K0P4|Q96FX0|Q9NV53	Missense_Mutation	SNP	ENST00000246868.2	37	c.498G>C	CCDS5537.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.006616	0.54361	.	.	ENSG00000126524	ENST00000246868	D	0.96011	-3.88	5.04	4.17	0.49024	Ribosome maturation protein SBDS, C-terminal (1);	0.292902	0.42548	D	0.000682	D	0.89979	0.6872	N	0.16368	0.405	0.42671	D	0.993518	B	0.02656	0.0	B	0.14023	0.01	D	0.86672	0.1911	10	0.72032	D	0.01	-11.4681	11.3554	0.49613	0.0:0.912:0.0:0.088	.	166	Q9Y3A5	SBDS_HUMAN	N	166	ENSP00000246868:K166N	ENSP00000246868:K166N	K	-	3	2	SBDS	66093685	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.656000	0.37355	1.368000	0.46115	0.555000	0.69702	AAG		0.373	SBDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251746.2	NM_016038		4	30	0	0	0	0.000602	0	4	30				
FKBP6	8468	broad.mit.edu	37	7	72744232	72744232	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:72744232C>A	ENST00000252037.4	+	4	414	c.345C>A	c.(343-345)aaC>aaA	p.N115K	FKBP6_ENST00000431982.2_Missense_Mutation_p.N110K|FKBP6_ENST00000413573.2_Missense_Mutation_p.N85K|TRIM50_ENST00000333149.2_5'Flank|TRIM50_ENST00000493498.1_5'Flank	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa	115	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				TCAAACCGAACTACGCCTATG	0.537																																							uc003tya.2		NA																	0					0						c.(343-345)AAC>AAA		FK506 binding protein 6 isoform a							148.0	129.0	135.0					7																	72744232		2203	4300	6503	SO:0001583	missense	8468				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr7:72744232C>A	AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.345C>A	7.37:g.72744232C>A	ENSP00000252037:p.Asn115Lys		Somatic				FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Missense_Mutation_p.N110K|FKBP6_uc010lbe.1_RNA|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank	p.N115K	NM_003602	NP_003593	WXS	Illumina HiSeq	Unspecified	O75344	FKBP6_HUMAN			4	477	+		Lung NSC(55;0.0908)|all_lung(88;0.198)	115			PPIase FKBP-type.		B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Missense_Mutation	SNP	ENST00000252037.4	37	c.345C>A	CCDS43595.1	.	.	.	.	.	.	.	.	.	.	C	0.228	-1.023645	0.02061	.	.	ENSG00000077800	ENST00000431982;ENST00000442793;ENST00000413573;ENST00000252037	T;T;D;T	0.85339	1.0;1.0;-1.97;1.0	4.52	3.62	0.41486	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	1.073500	0.07052	N	0.832178	T	0.64011	0.2560	N	0.03903	-0.33	0.22940	N	0.998531	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.56312	-0.8000	10	0.02654	T	1	-0.8582	5.5192	0.16923	0.3559:0.5496:0.0:0.0945	.	110;115	O75344-2;O75344	.;FKBP6_HUMAN	K	110;110;85;115	ENSP00000416277:N110K;ENSP00000402360:N110K;ENSP00000394952:N85K;ENSP00000252037:N115K	ENSP00000252037:N115K	N	+	3	2	FKBP6	72382168	0.024000	0.19004	0.822000	0.32727	0.651000	0.38670	0.235000	0.17948	0.882000	0.36016	0.485000	0.47835	AAC		0.537	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318723.1	NM_003602		52	34	1	0	1.81118e-26	0.00361	3.22737e-26	52	34				
TECPR1	25851	broad.mit.edu	37	7	97870247	97870247	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:97870247G>A	ENST00000447648.2	-	8	1148	c.849C>T	c.(847-849)atC>atT	p.I283I	TECPR1_ENST00000379795.3_Silent_p.I283I|TECPR1_ENST00000542604.1_Silent_p.I213I			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	283					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GAGGCTCCACGATGGACCAGG	0.612																																							uc003upg.2		NA																	0				pancreas(1)	1						c.(847-849)ATC>ATT		tectonin beta-propeller repeat containing 1							25.0	31.0	29.0					7																	97870247		2191	4295	6486	SO:0001819	synonymous_variant	25851					integral to membrane	protein binding	g.chr7:97870247G>A		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.849C>T	7.37:g.97870247G>A			Somatic				TECPR1_uc003uph.1_Silent_p.I213I	p.I283I	NM_015395	NP_056210	WXS	Illumina HiSeq	Unspecified	Q7Z6L1	TCPR1_HUMAN			8	1054	-			283			TECPR 2.		A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Silent	SNP	ENST00000447648.2	37	c.849C>T	CCDS47648.1																																																																																				0.612	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	NM_015395		9	4	0	0	0	0.006214	0	9	4				
MUC17	140453	broad.mit.edu	37	7	100696667	100696667	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:100696667G>C	ENST00000306151.4	+	11	13377	c.13313G>C	c.(13312-13314)aGt>aCt	p.S4438T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4438					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGAGGACAGTGGACCAGCT	0.463																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(13312-13314)AGT>ACT		mucin 17 precursor							101.0	98.0	99.0					7																	100696667		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100696667G>C	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.13313G>C	7.37:g.100696667G>C	ENSP00000302716:p.Ser4438Thr		Somatic				MUC17_uc010lho.1_RNA	p.S4438T	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			11	13366	+	Lung NSC(181;0.136)|all_lung(186;0.182)		4438			Cytoplasmic (Potential).		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.13313G>C	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	7.444	0.641260	0.14451	.	.	ENSG00000169876	ENST00000306151	T	0.01854	4.6	5.14	3.31	0.37934	.	.	.	.	.	T	0.01627	0.0052	N	0.14661	0.345	0.09310	N	1	B	0.23377	0.084	B	0.13407	0.009	T	0.47736	-0.9094	9	0.32370	T	0.25	.	6.859	0.24056	0.2061:0.0:0.7939:0.0	.	4438	Q685J3	MUC17_HUMAN	T	4438	ENSP00000302716:S4438T	ENSP00000302716:S4438T	S	+	2	0	MUC17	100483387	0.014000	0.17966	0.003000	0.11579	0.001000	0.01503	1.597000	0.36729	1.173000	0.42796	0.555000	0.69702	AGT		0.463	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		24	13	0	0	0	0.003954	0	24	13				
FBXL13	222235	broad.mit.edu	37	7	102517935	102517935	+	Silent	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:102517935A>G	ENST00000313221.4	-	16	2040	c.1614T>C	c.(1612-1614)tcT>tcC	p.S538S	FBXL13_ENST00000436908.1_Silent_p.S538S|FBXL13_ENST00000379308.3_Silent_p.S538S|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000379306.3_Intron|FBXL13_ENST00000393772.2_Silent_p.S538S|FBXL13_ENST00000379305.3_Silent_p.S538S|FBXL13_ENST00000455112.2_Silent_p.S538S	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	538										NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						TGTCTGTTCCAGAGAGATCTA	0.284																																							uc003vaq.2		NA																	0					0						c.(1612-1614)TCT>TCC		F-box and leucine-rich repeat protein 13 isoform							59.0	60.0	60.0					7																	102517935		2202	4295	6497	SO:0001819	synonymous_variant	222235							g.chr7:102517935A>G	BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.1614T>C	7.37:g.102517935A>G			Somatic				FBXL13_uc010liq.1_Intron|FBXL13_uc010lir.1_Silent_p.S538S|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Silent_p.S538S	p.S538S	NM_145032	NP_659469	WXS	Illumina HiSeq	Unspecified	Q8NEE6	FXL13_HUMAN			16	2041	-			538			LRR 12.		C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Silent	SNP	ENST00000313221.4	37	c.1614T>C	CCDS5726.1																																																																																				0.284	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348001.1	NM_145032		23	26	0	0	0	0.00333	0	23	26				
SLC26A3	1811	broad.mit.edu	37	7	107423683	107423683	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:107423683G>T	ENST00000340010.5	-	9	1270	c.1086C>A	c.(1084-1086)tcC>tcA	p.S362S	SLC26A3_ENST00000422236.2_Silent_p.S327S	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	362					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						CGTATTTGAGGGAATAGACGC	0.423																																							uc003ver.2		NA																	0				ovary(3)|skin(1)	4						c.(1084-1086)TCC>TCA		solute carrier family 26, member 3							100.0	95.0	97.0					7																	107423683		2203	4300	6503	SO:0001819	synonymous_variant	1811				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity	g.chr7:107423683G>T	L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1086C>A	7.37:g.107423683G>T			Somatic				SLC26A3_uc003ves.2_Silent_p.S327S	p.S362S	NM_000111	NP_000102	WXS	Illumina HiSeq	Unspecified	P40879	S26A3_HUMAN			9	1297	-			362			Helical; (Potential).			Silent	SNP	ENST00000340010.5	37	c.1086C>A	CCDS5748.1																																																																																				0.423	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111		29	35	1	0	1.32181e-22	0.007291	2.2884e-22	29	35				
IMMP2L	83943	broad.mit.edu	37	7	111127317	111127317	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:111127317G>T	ENST00000405709.2	-	3	658	c.216C>A	c.(214-216)caC>caA	p.H72Q	IMMP2L_ENST00000437687.1_Missense_Mutation_p.H72Q|IMMP2L_ENST00000415362.1_Missense_Mutation_p.H72Q|IMMP2L_ENST00000452895.1_Missense_Mutation_p.H72Q|IMMP2L_ENST00000331762.3_Missense_Mutation_p.H72Q|IMMP2L_ENST00000447215.1_Missense_Mutation_p.H72Q	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)	72					ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		TGTCACCACGGTGTACTTCAA	0.368																																							uc003vfq.1		NA																	0					0						c.(214-216)CAC>CAA		IMP2 inner mitochondrial membrane protease-like							114.0	110.0	112.0					7																	111127317		2203	4300	6503	SO:0001583	missense	83943				protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity	g.chr7:111127317G>T	AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.216C>A	7.37:g.111127317G>T	ENSP00000384966:p.His72Gln		Somatic				IMMP2L_uc010ljr.1_Missense_Mutation_p.H72Q|IMMP2L_uc003vfr.2_Missense_Mutation_p.H72Q	p.H72Q	NM_032549	NP_115938	WXS	Illumina HiSeq	Unspecified	Q96T52	IMP2L_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)	3	659	-			72					Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	Missense_Mutation	SNP	ENST00000405709.2	37	c.216C>A	CCDS5753.1	.	.	.	.	.	.	.	.	.	.	G	3.733	-0.055251	0.07362	.	.	ENSG00000184903	ENST00000405709;ENST00000331762;ENST00000452895;ENST00000415362;ENST00000447215;ENST00000437687;ENST00000452753	.	.	.	5.48	-8.3	0.01005	Peptidase S24/S26A/S26B/S26C (1);Peptidase S24/S26A/S26B/S26C, beta-ribbon domain (1);Peptidase S24/S26A/S26B (1);	0.193583	0.45361	N	0.000374	T	0.04588	0.0125	N	0.00815	-1.16	0.18873	N	0.999982	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36915	-0.9728	9	0.02654	T	1	-13.0743	5.2755	0.15647	0.1557:0.4838:0.0952:0.2653	.	72;72	Q96T52-2;Q96T52	.;IMP2L_HUMAN	Q	72	.	ENSP00000329553:H72Q	H	-	3	2	IMMP2L	110914553	0.008000	0.16893	0.945000	0.38365	0.986000	0.74619	-1.838000	0.01687	-0.787000	0.04510	-1.053000	0.02334	CAC		0.368	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338109.4	NM_032549		38	46	1	0	2.47872e-24	0.002522	4.38191e-24	38	46				
TMEM140	55281	broad.mit.edu	37	7	134849484	134849484	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:134849484C>A	ENST00000275767.3	+	2	514	c.291C>A	c.(289-291)gcC>gcA	p.A97A	C7orf49_ENST00000459937.1_Intron	NM_018295.3	NP_060765.4	Q9NV12	TM140_HUMAN	transmembrane protein 140	97						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(2)	5						CCCTCTTTGCCCCCCAGCCTC	0.677																																							uc003vsi.2		NA																	0				large_intestine(1)	1						c.(289-291)GCC>GCA		transmembrane protein 140							58.0	54.0	55.0					7																	134849484		2203	4300	6503	SO:0001819	synonymous_variant	55281					integral to membrane		g.chr7:134849484C>A	AK001862	CCDS5837.1	7q33	2006-03-17			ENSG00000146859	ENSG00000146859			21870	protein-coding gene	gene with protein product							Standard	NM_018295		Approved	FLJ11000	uc003vsi.3	Q9NV12	OTTHUMG00000155413	ENST00000275767.3:c.291C>A	7.37:g.134849484C>A			Somatic				C7orf49_uc003vsh.2_Intron	p.A97A	NM_018295	NP_060765	WXS	Illumina HiSeq	Unspecified	Q9NV12	TM140_HUMAN			2	572	+			97			Helical; (Potential).		A4D1P9|Q8WUC3	Silent	SNP	ENST00000275767.3	37	c.291C>A	CCDS5837.1																																																																																				0.677	TMEM140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340017.2	NM_018295		16	54	1	0	1.52009e-12	0.003163	2.28355e-12	16	54				
ZNF746	155061	broad.mit.edu	37	7	149191310	149191310	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:149191310C>T	ENST00000340622.3	-	2	589	c.309G>A	c.(307-309)aaG>aaA	p.K103K	ZNF746_ENST00000461958.2_Silent_p.K103K|ZNF746_ENST00000458143.2_Silent_p.K103K			Q6NUN9	ZN746_HUMAN	zinc finger protein 746	103	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GGGACTCCCCCTTGCTGCCCG	0.652																																							uc003wfw.2		NA																	0				ovary(2)|breast(1)	3						c.(307-309)AAG>AAA		zinc finger protein 746 isoform 2							64.0	79.0	74.0					7																	149191310		2203	4300	6503	SO:0001819	synonymous_variant	155061				negative regulation of transcription, DNA-dependent|neuron death|regulation of cell death|transcription, DNA-dependent	cytoplasm|nucleus	transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding	g.chr7:149191310C>T	AK055975	CCDS5897.1, CCDS55180.1	7q36.1	2013-01-08			ENSG00000181220	ENSG00000181220		"""Zinc fingers, C2H2-type"", ""-"""	21948	protein-coding gene	gene with protein product		613914					Standard	NM_152557		Approved	FLJ31413	uc010lpi.2	Q6NUN9	OTTHUMG00000158972	ENST00000340622.3:c.309G>A	7.37:g.149191310C>T			Somatic				ZNF746_uc010lpi.2_Silent_p.K103K	p.K103K	NM_152557	NP_689770	WXS	Illumina HiSeq	Unspecified	Q6NUN9	ZN746_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00358)		2	580	-	Melanoma(164;0.165)		103			KRAB.		A8K6Z9|Q6ZRF9	Silent	SNP	ENST00000340622.3	37	c.309G>A	CCDS5897.1																																																																																				0.652	ZNF746-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352730.1	NM_152557		94	87	0	0	0	0.00361	0	94	87				
SSPO	23145	broad.mit.edu	37	7	149515769	149515769	+	RNA	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:149515769C>T	ENST00000378016.2	+	0	11670							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCTCCTGGTCCCCCTGCTCCA	0.682																																							uc010lpk.2		NA																	0					0						c.(11668-11670)TCC>TCT		SCO-spondin precursor							20.0	24.0	22.0					7																	149515769		1978	4139	6117			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149515769C>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149515769C>T			Somatic					p.S3890S	NM_198455	NP_940857	WXS	Illumina HiSeq	Unspecified	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		84	11670	+	Melanoma(164;0.165)|Ovarian(565;0.177)		3890			TSP type-1 16.		Q76B61	Silent	SNP	ENST00000378016.2	37	c.11670C>T																																																																																					0.682	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				14	39	0	0	0	0.003163	0	14	39				
GBX1	2636	broad.mit.edu	37	7	150846032	150846032	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:150846032C>G	ENST00000297537.4	-	2	735	c.736G>C	c.(736-738)Gag>Cag	p.E246Q	GBX1_ENST00000475831.1_5'Flank	NM_001098834.1	NP_001092304.1	Q14549	GBX1_HUMAN	gastrulation brain homeobox 1	246					adult walking behavior (GO:0007628)|neuron fate commitment (GO:0048663)|proprioception (GO:0019230)|regulation of transcription, DNA-templated (GO:0006355)|sensory neuron axon guidance (GO:0097374)|spinal cord motor neuron differentiation (GO:0021522)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(5)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGTGCCCCCTCCTCAGCTCCA	0.617																																							uc011kvg.1		NA																	0					0						c.(736-738)GAG>CAG		gastrulation brain homeo box 1							91.0	103.0	99.0					7																	150846032		1906	4095	6001	SO:0001583	missense	2636					nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:150846032C>G	L11239	CCDS43682.1	7q36.1	2012-03-09	2005-12-22		ENSG00000164900	ENSG00000164900		"""Homeoboxes / ANTP class : HOXL subclass"""	4185	protein-coding gene	gene with protein product		603354	"""gastrulation brain homeo box 1"""			7903253	Standard	NM_001098834		Approved		uc011kvg.2	Q14549	OTTHUMG00000158751	ENST00000297537.4:c.736G>C	7.37:g.150846032C>G	ENSP00000297537:p.Glu246Gln		Somatic					p.E246Q	NM_001098834	NP_001092304	WXS	Illumina HiSeq	Unspecified	Q14549	GBX1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	2	968	-			246						Missense_Mutation	SNP	ENST00000297537.4	37	c.736G>C	CCDS43682.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.576676	0.45902	.	.	ENSG00000164900	ENST00000297537	D	0.91577	-2.87	5.12	4.24	0.50183	Homeodomain-like (1);	0.282681	0.32578	N	0.005908	T	0.81489	0.4833	N	0.19112	0.55	0.80722	D	1	B	0.32245	0.361	B	0.31686	0.134	T	0.76892	-0.2791	10	0.32370	T	0.25	-30.7416	8.8193	0.35016	0.0:0.8275:0.0:0.1725	.	246	Q14549	GBX1_HUMAN	Q	246	ENSP00000297537:E246Q	ENSP00000297537:E246Q	E	-	1	0	GBX1	150476965	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.413000	0.59795	1.175000	0.42826	-0.229000	0.12294	GAG		0.617	GBX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352029.1			31	158	0	0	0	0.002096	0	31	158				
KMT2C	58508	broad.mit.edu	37	7	151878057	151878057	+	Silent	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:151878057A>G	ENST00000262189.6	-	36	7106	c.6888T>C	c.(6886-6888)cgT>cgC	p.R2296R	KMT2C_ENST00000355193.2_Silent_p.R2296R	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2296					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CATAGGGATCACGGGCAGCAG	0.522																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(6886-6888)CGT>CGC		myeloid/lymphoid or mixed-lineage leukemia 3							104.0	100.0	101.0					7																	151878057		2203	4300	6503	SO:0001819	synonymous_variant	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151878057A>G	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.6888T>C	7.37:g.151878057A>G			Somatic				MLL3_uc003wkz.2_Silent_p.R1357R|MLL3_uc003wky.2_5'Flank	p.R2296R	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	36	7107	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	2296					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	c.6888T>C	CCDS5931.1																																																																																				0.522	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			3	78	0	0	0	0.004672	0	3	78				
KIAA1456	57604	broad.mit.edu	37	8	12879006	12879006	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:12879006A>G	ENST00000524591.2	+	5	1307	c.818A>G	c.(817-819)aAc>aGc	p.N273S	KIAA1456_ENST00000447063.2_Intron	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	273							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						CCCTTGAAAAACACAGAAGTT	0.418																																							uc010lsq.2		NA																	0					0						c.(817-819)AAC>AGC		hypothetical protein LOC57604 isoform 1							81.0	78.0	79.0					8																	12879006		1869	4099	5968	SO:0001583	missense	57604						methyltransferase activity	g.chr8:12879006A>G	BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.818A>G	8.37:g.12879006A>G	ENSP00000432695:p.Asn273Ser		Somatic				C8orf79_uc011kxw.1_Intron|C8orf79_uc003wwj.3_Missense_Mutation_p.N186S|C8orf79_uc010lsr.2_Missense_Mutation_p.N147S	p.N273S	NM_020844	NP_065895	WXS	Illumina HiSeq	Unspecified	Q9P272	K1456_HUMAN			5	1310	+			273					Q96AW6	Missense_Mutation	SNP	ENST00000524591.2	37	c.818A>G	CCDS47808.1	.	.	.	.	.	.	.	.	.	.	A	10.97	1.501838	0.26949	.	.	ENSG00000250305	ENST00000524591;ENST00000529978	T	0.09538	2.97	5.71	-4.55	0.03441	.	1.065370	0.07120	N	0.843701	T	0.04861	0.0131	N	0.16307	0.4	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.43605	-0.9381	10	0.21540	T	0.41	-4.8126	2.3791	0.04349	0.399:0.2218:0.2832:0.0959	.	273	Q9P272	K1456_HUMAN	S	273;186	ENSP00000432695:N273S	ENSP00000432695:N273S	N	+	2	0	AC135352.2	12923377	0.000000	0.05858	0.000000	0.03702	0.787000	0.44495	0.094000	0.15107	-0.700000	0.05070	0.533000	0.62120	AAC		0.418	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383262.2	NM_001099677		19	52	0	0	0	0.008871	0	19	52				
SGCZ	137868	broad.mit.edu	37	8	13959971	13959971	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:13959971G>A	ENST00000382080.1	-	7	1373	c.658C>T	c.(658-660)Ccc>Tcc	p.P220S	SGCZ_ENST00000421524.2_Missense_Mutation_p.P173S	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	207					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		ACCCCACGGGGAGCTTCCATG	0.448																																							uc003wwq.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(658-660)CCC>TCC		sarcoglycan zeta							43.0	43.0	43.0					8																	13959971		2203	4300	6503	SO:0001583	missense	137868				cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma		g.chr8:13959971G>A	AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.658C>T	8.37:g.13959971G>A	ENSP00000371512:p.Pro220Ser		Somatic				SGCZ_uc010lss.2_Missense_Mutation_p.P173S	p.P220S	NM_139167	NP_631906	WXS	Illumina HiSeq	Unspecified	Q96LD1	SGCZ_HUMAN		all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)	7	1318	-			207			Extracellular (Potential).		Q6REU0	Missense_Mutation	SNP	ENST00000382080.1	37	c.658C>T	CCDS5992.2	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892800	0.91889	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	D;D	0.94457	-3.43;-3.43	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.96790	0.8952	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.95183	0.8301	10	0.27082	T	0.32	.	18.5657	0.91115	0.0:0.0:1.0:0.0	.	173;220	Q08AT0;Q96LD1-2	.;.	S	220;173	ENSP00000371512:P220S;ENSP00000405224:P173S	ENSP00000371512:P220S	P	-	1	0	SGCZ	14004342	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	9.118000	0.94355	2.809000	0.96659	0.655000	0.94253	CCC		0.448	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167		5	34	0	0	0	0.000602	0	5	34				
WRN	7486	broad.mit.edu	37	8	30973963	30973963	+	Silent	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:30973963A>T	ENST00000298139.5	+	20	2616	c.2367A>T	c.(2365-2367)ctA>ctT	p.L789L		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	789	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		AACTGAATCTATCCTGTGGAA	0.388			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	Ovarian(18;161 598 2706 14834 27543)	uc003xio.3		NA	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Mis|N|F|S	Werner syndrome (RECQL2)			"""L, E, M, O"""		osteosarcoma|meningioma|others			0				ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7						c.(2365-2367)CTA>CTT	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner syndrome protein							129.0	119.0	122.0					8																	30973963		2203	4300	6503	SO:0001819	synonymous_variant	7486	Werner_syndrome	Familial Cancer Database	WS, Adult Progeria	base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding	g.chr8:30973963A>T		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.2367A>T	8.37:g.30973963A>T			Somatic				WRN_uc010lvk.2_Silent_p.L256L	p.L789L	NM_000553	NP_000544	WXS	Illumina HiSeq	Unspecified	Q14191	WRN_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)	20	3155	+		Breast(100;0.195)	789			Helicase C-terminal.		A1KYY9	Silent	SNP	ENST00000298139.5	37	c.2367A>T	CCDS6082.1																																																																																				0.388	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1			13	42	0	0	0	0.003163	0	13	42				
PXDNL	137902	broad.mit.edu	37	8	52387588	52387588	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:52387588G>T	ENST00000356297.4	-	7	738	c.638C>A	c.(637-639)cCc>cAc	p.P213H	PXDNL_ENST00000543296.1_Missense_Mutation_p.P213H	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	213	LRRCT.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GAGTCTCCTGGGATATTCGCA	0.498																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(637-639)CCC>CAC		peroxidasin homolog-like precursor							56.0	56.0	56.0					8																	52387588		1911	4129	6040	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52387588G>T		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.638C>A	8.37:g.52387588G>T	ENSP00000348645:p.Pro213His		Somatic					p.P213H	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			7	739	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	213			LRRCT.		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.638C>A	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.535944	0.64972	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.57273	0.41;0.41	4.63	3.76	0.43208	Cysteine-rich flanking region, C-terminal (1);	.	.	.	.	T	0.77935	0.4205	H	0.95114	3.625	0.33655	D	0.608947	D	0.89917	1.0	D	0.71414	0.973	D	0.85892	0.1429	9	0.87932	D	0	.	10.353	0.43948	0.0979:0.0:0.9021:0.0	.	213	A1KZ92	PXDNL_HUMAN	H	213	ENSP00000348645:P213H;ENSP00000444865:P213H	ENSP00000348645:P213H	P	-	2	0	PXDNL	52550141	1.000000	0.71417	0.002000	0.10522	0.019000	0.09904	5.376000	0.66178	0.935000	0.37341	0.650000	0.86243	CCC		0.498	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		6	13	1	0	0.00116845	0.001168	0.00132463	6	13				
NPBWR1	2831	broad.mit.edu	37	8	53853136	53853136	+	Silent	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:53853136T>C	ENST00000331251.3	+	1	2146	c.669T>C	c.(667-669)taT>taC	p.Y223Y		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	223					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				GTGTCCTCTATACCACCCTGC	0.662																																							uc011ldu.1		NA																	0				ovary(2)|breast(1)	3						c.(667-669)TAT>TAC		G protein-coupled receptor 7							24.0	15.0	18.0					8																	53853136		2188	4274	6462	SO:0001819	synonymous_variant	2831				synaptic transmission	plasma membrane	opioid receptor activity|protein binding	g.chr8:53853136T>C	BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.669T>C	8.37:g.53853136T>C			Somatic					p.Y223Y	NM_005285	NP_005276	WXS	Illumina HiSeq	Unspecified	P48145	NPBW1_HUMAN			1	669	+		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)	223			Helical; Name=5; (Potential).		Q6NTC7	Silent	SNP	ENST00000331251.3	37	c.669T>C	CCDS6151.1																																																																																				0.662	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378047.1	NM_005285		7	13	0	0	0	0.001984	0	7	13				
ZFHX4	79776	broad.mit.edu	37	8	77762527	77762527	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:77762527C>G	ENST00000521891.2	+	9	4341	c.3893C>G	c.(3892-3894)gCa>gGa	p.A1298G	ZFHX4_ENST00000455469.2_Missense_Mutation_p.A1253G|ZFHX4_ENST00000518282.1_Missense_Mutation_p.A1272G|ZFHX4_ENST00000050961.6_Missense_Mutation_p.A1253G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTACTGCCAGCAGCTGCCTCT	0.478										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(3757-3759)GCA>GGA		zinc finger homeodomain 4							49.0	52.0	51.0					8																	77762527		1945	4145	6090	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77762527C>G		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3893C>G	8.37:g.77762527C>G	ENSP00000430497:p.Ala1298Gly	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.A1298G|ZFHX4_uc003yaw.1_Missense_Mutation_p.A1253G	p.A1253G	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		9	4145	+			1253					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.3758C>G	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349405	0.61183	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.51574	0.7;0.75;0.72;0.71	5.07	5.07	0.68467	.	0.178548	0.26662	U	0.023159	T	0.47135	0.1429	L	0.53249	1.67	0.36973	D	0.893916	B;B;B	0.18741	0.018;0.03;0.03	B;B;B	0.18561	0.01;0.022;0.022	T	0.49370	-0.8947	10	0.38643	T	0.18	.	18.6348	0.91372	0.0:1.0:0.0:0.0	.	1253;1253;1298	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	G	1298;1298;1253;1253;1272	ENSP00000430497:A1298G;ENSP00000399605:A1253G;ENSP00000050961:A1253G;ENSP00000430848:A1272G	ENSP00000050961:A1253G	A	+	2	0	ZFHX4	77925082	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	3.190000	0.50973	2.640000	0.89533	0.561000	0.74099	GCA		0.478	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		3	17	0	0	0	0.004672	0	3	17				
ZFHX4	79776	broad.mit.edu	37	8	77776202	77776202	+	Missense_Mutation	SNP	G	G	A	rs374431158		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:77776202G>A	ENST00000521891.2	+	11	10700	c.10252G>A	c.(10252-10254)Gca>Aca	p.A3418T	ZFHX4_ENST00000455469.2_Missense_Mutation_p.A3373T|ZFHX4_ENST00000518282.1_Missense_Mutation_p.A3392T|ZFHX4_ENST00000050961.6_Missense_Mutation_p.A3369T	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3369					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGAAGACGCCGCAGTAAATCA	0.423										HNSCC(33;0.089)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		20160	0.0		0.0	False		,,,				2504	0.0						uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(10117-10119)GCA>ACA		zinc finger homeodomain 4		G	THR/ALA	1,3795		0,1,1897	57.0	53.0	54.0		10252	3.1	1.0	8		54	0,8262		0,0,4131	no	missense	ZFHX4	NM_024721.4	58	0,1,6028	AA,AG,GG		0.0,0.0263,0.0083	benign	3418/3617	77776202	1,12057	1898	4131	6029	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77776202G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10252G>A	8.37:g.77776202G>A	ENSP00000430497:p.Ala3418Thr	HNSCC(33;0.089)	Somatic					p.A3373T	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		11	10504	+			3369			C2H2-type 19; degenerate.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.10117G>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	10.57	1.387402	0.25031	2.63E-4	0.0	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.61859	0.07;0.15;0.12;0.1	4.91	3.1	0.35709	.	0.154096	0.29707	N	0.011401	T	0.54013	0.1832	M	0.72118	2.19	0.37519	D	0.917442	B	0.11235	0.004	B	0.09377	0.004	T	0.55095	-0.8194	10	0.41790	T	0.15	.	10.4895	0.44741	0.1591:0.0:0.8409:0.0	.	3373	Q86UP3-4	.	T	3418;3402;3373;3369;3392	ENSP00000430497:A3418T;ENSP00000399605:A3373T;ENSP00000050961:A3369T;ENSP00000430848:A3392T	ENSP00000050961:A3369T	A	+	1	0	ZFHX4	77938757	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.456000	0.66665	0.662000	0.31006	0.655000	0.94253	GCA		0.423	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		7	23	0	0	0	0.001984	0	7	23				
SLC10A5	347051	broad.mit.edu	37	8	82607015	82607015	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:82607015C>G	ENST00000518568.1	-	1	1394	c.193G>C	c.(193-195)Gaa>Caa	p.E65Q		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	65						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						TTAGGATCTTCTATTTTCACA	0.368																																							uc011lfs.1		NA																	0					0						c.(193-195)GAA>CAA		solute carrier family 10 (sodium/bile acid							125.0	122.0	123.0					8																	82607015		2203	4300	6503	SO:0001583	missense	347051					integral to membrane	bile acid:sodium symporter activity	g.chr8:82607015C>G		CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.193G>C	8.37:g.82607015C>G	ENSP00000428612:p.Glu65Gln		Somatic					p.E65Q	NM_001010893	NP_001010893	WXS	Illumina HiSeq	Unspecified	Q5PT55	NTCP5_HUMAN			1	193	-			65			Extracellular (Potential).		B2RN26	Missense_Mutation	SNP	ENST00000518568.1	37	c.193G>C	CCDS34915.1	.	.	.	.	.	.	.	.	.	.	C	0.495	-0.873728	0.02570	.	.	ENSG00000253598	ENST00000518568	T	0.08282	3.11	6.17	1.8	0.24995	.	0.455819	0.18533	N	0.138439	T	0.05090	0.0136	L	0.27053	0.805	0.09310	N	0.999999	B	0.17852	0.024	B	0.16722	0.016	T	0.44574	-0.9319	10	0.14252	T	0.57	-4.0941	6.7081	0.23262	0.0:0.5551:0.2786:0.1663	.	65	Q5PT55	NTCP5_HUMAN	Q	65	ENSP00000428612:E65Q	ENSP00000428612:E65Q	E	-	1	0	SLC10A5	82769570	0.815000	0.29118	0.150000	0.22450	0.115000	0.19883	1.316000	0.33620	0.452000	0.26830	0.655000	0.94253	GAA		0.368	SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379736.1	XM_294493		28	53	0	0	0	0.005443	0	28	53				
SPAG1	6674	broad.mit.edu	37	8	101243392	101243392	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:101243392A>G	ENST00000388798.2	+	15	2055	c.1864A>G	c.(1864-1866)Aca>Gca	p.T622A	SPAG1_ENST00000523302.1_3'UTR|SPAG1_ENST00000251809.3_Missense_Mutation_p.T622A	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	622					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		AGATGAAAAAACATTTAAAGC	0.303																																							uc003yjh.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1864-1866)ACA>GCA		sperm associated antigen 1							71.0	72.0	72.0					8																	101243392		2203	4296	6499	SO:0001583	missense	6674				single fertilization	cytoplasm	GTP binding|hydrolase activity	g.chr8:101243392A>G	AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.1864A>G	8.37:g.101243392A>G	ENSP00000373450:p.Thr622Ala		Somatic				SPAG1_uc003yji.1_Missense_Mutation_p.T622A	p.T622A	NM_172218	NP_757367	WXS	Illumina HiSeq	Unspecified	Q07617	SPAG1_HUMAN	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)	15	1950	+	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	622					A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Missense_Mutation	SNP	ENST00000388798.2	37	c.1864A>G	CCDS34930.1	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.072096	0.00379	.	.	ENSG00000104450	ENST00000251809;ENST00000388798	T;T	0.73258	-0.73;-0.73	5.41	1.48	0.22813	Tetratricopeptide-like helical (1);	0.623134	0.17743	N	0.163509	T	0.44726	0.1307	N	0.14661	0.345	0.09310	N	1	B	0.16166	0.016	B	0.15870	0.014	T	0.28490	-1.0042	10	0.05833	T	0.94	-2.958	7.8627	0.29520	0.6722:0.2589:0.0689:0.0	.	622	Q07617	SPAG1_HUMAN	A	622	ENSP00000251809:T622A;ENSP00000373450:T622A	ENSP00000251809:T622A	T	+	1	0	SPAG1	101312568	0.001000	0.12720	0.000000	0.03702	0.062000	0.15995	0.166000	0.16583	0.072000	0.16694	0.533000	0.62120	ACA		0.303	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2	NM_172218		19	47	0	0	0	0.008871	0	19	47				
SNX31	169166	broad.mit.edu	37	8	101661539	101661539	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:101661539C>T	ENST00000311812.2	-	2	254	c.104G>A	c.(103-105)aGg>aAg	p.R35K		NM_152628.3	NP_689841.3	Q8N9S9	SNX31_HUMAN	sorting nexin 31	35	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	protein complex (GO:0043234)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|skin(3)|urinary_tract(1)	26	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			GTAGCGCACCCTGCAGAAGAG	0.607																																							uc003yjr.2		NA																	0					0						c.(103-105)AGG>AAG		sorting nexin 31							71.0	68.0	69.0					8																	101661539		2203	4300	6503	SO:0001583	missense	169166				cell communication|protein transport		phosphatidylinositol binding	g.chr8:101661539C>T		CCDS6288.1	8q22.3	2011-05-03			ENSG00000174226	ENSG00000174226		"""Sorting nexins"""	28605	protein-coding gene	gene with protein product						16782399	Standard	NM_152628		Approved	MGC39715	uc003yjr.3	Q8N9S9	OTTHUMG00000164725	ENST00000311812.2:c.104G>A	8.37:g.101661539C>T	ENSP00000312368:p.Arg35Lys		Somatic					p.R35K	NM_152628	NP_689841	WXS	Illumina HiSeq	Unspecified	Q8N9S9	SNX31_HUMAN	Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)		2	255	-	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		35			PX.		C9J6L9|Q8N0U9	Missense_Mutation	SNP	ENST00000311812.2	37	c.104G>A	CCDS6288.1	.	.	.	.	.	.	.	.	.	.	C	7.778	0.708889	0.15239	.	.	ENSG00000174226	ENST00000311812;ENST00000520743	T;T	0.36699	1.24;1.54	4.54	-4.71	0.03279	Phox homologous domain (5);	0.426956	0.21047	N	0.081065	T	0.14614	0.0353	N	0.05414	-0.055	0.58432	D	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.20472	-1.0274	10	0.13853	T	0.58	-3.0004	13.1216	0.59329	0.0:0.1801:0.0:0.8199	.	35	Q8N9S9	SNX31_HUMAN	K	35;61	ENSP00000312368:R35K;ENSP00000428262:R61K	ENSP00000312368:R35K	R	-	2	0	SNX31	101730715	0.965000	0.33210	0.881000	0.34555	0.930000	0.56654	-0.040000	0.12104	-0.862000	0.04089	-0.379000	0.06801	AGG		0.607	SNX31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379910.1	NM_152628		9	30	0	0	0	0.004482	0	9	30				
DCSTAMP	81501	broad.mit.edu	37	8	105361787	105361787	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:105361787T>A	ENST00000297581.2	+	2	1056	c.1007T>A	c.(1006-1008)gTt>gAt	p.V336D	DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000517991.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	336					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											GGGTTTGAGGTTCACTTGAAA	0.488																																							uc003ylx.1		NA																	0				pancreas(2)|large_intestine(1)|ovary(1)	4						c.(1006-1008)GTT>GAT		dendritic cell-specific transmembrane protein							122.0	123.0	123.0					8																	105361787		2203	4300	6503	SO:0001583	missense	81501				osteoclast differentiation	cell surface|integral to membrane|plasma membrane		g.chr8:105361787T>A	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.1007T>A	8.37:g.105361787T>A	ENSP00000297581:p.Val336Asp		Somatic					p.V336D	NM_030788	NP_110415	WXS	Illumina HiSeq	Unspecified	Q9H295	TM7S4_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		2	1056	+			336					B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	c.1007T>A	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876312	0.72180	.	.	ENSG00000164935	ENST00000297581	T	0.37235	1.21	5.5	5.5	0.81552	Dendritic cell-specific transmembrane protein-like (1);	0.060333	0.64402	D	0.000004	T	0.60856	0.2301	M	0.79805	2.47	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.62779	-0.6782	10	0.40728	T	0.16	-9.8388	14.1787	0.65559	0.0:0.0:0.0:1.0	.	336	Q9H295	TM7S4_HUMAN	D	336	ENSP00000297581:V336D	ENSP00000297581:V336D	V	+	2	0	TM7SF4	105430963	1.000000	0.71417	0.956000	0.39512	0.834000	0.47266	4.381000	0.59587	2.094000	0.63399	0.454000	0.30748	GTT		0.488	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788		36	149	0	0	0	0.005524	0	36	149				
DPYS	1807	broad.mit.edu	37	8	105405054	105405054	+	Silent	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:105405054T>A	ENST00000351513.2	-	8	1533	c.1401A>T	c.(1399-1401)ccA>ccT	p.P467P	DPYS_ENST00000521601.1_Intron	NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	467					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATTCAGCAAATGGTTTTCGAG	0.488																																							uc003yly.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1399-1401)CCA>CCT		dihydropyrimidinase							166.0	166.0	166.0					8																	105405054		2203	4300	6503	SO:0001819	synonymous_variant	1807				protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding	g.chr8:105405054T>A	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.1401A>T	8.37:g.105405054T>A			Somatic				DPYS_uc010mcf.1_Silent_p.P37P	p.P467P	NM_001385	NP_001376	WXS	Illumina HiSeq	Unspecified	Q14117	DPYS_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		8	1530	-			467						Silent	SNP	ENST00000351513.2	37	c.1401A>T	CCDS6302.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.259378	0.23051	.	.	ENSG00000147647	ENST00000533874	.	.	.	6.02	-12.0	0.00017	.	.	.	.	.	T	0.38295	0.1035	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50171	-0.8859	4	.	.	.	-16.0019	3.9742	0.09467	0.1409:0.3836:0.2224:0.253	.	.	.	.	F	11	.	.	I	-	1	0	DPYS	105474230	0.016000	0.18221	0.012000	0.15200	0.998000	0.95712	-1.260000	0.02858	-3.426000	0.00165	0.528000	0.53228	ATT		0.488	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385		34	177	0	0	0	0.003271	0	34	177				
CSMD3	114788	broad.mit.edu	37	8	113418829	113418829	+	Silent	SNP	A	A	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:113418829A>G	ENST00000297405.5	-	35	5977	c.5733T>C	c.(5731-5733)caT>caC	p.H1911H	CSMD3_ENST00000352409.3_Silent_p.H1841H|CSMD3_ENST00000455883.2_Silent_p.H1807H|CSMD3_ENST00000343508.3_Silent_p.H1871H	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1911	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTATGGATCCATGGAGAATAT	0.398										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(5731-5733)CAT>CAC		CUB and Sushi multiple domains 3 isoform 1							116.0	114.0	115.0					8																	113418829		2203	4300	6503	SO:0001819	synonymous_variant	114788					integral to membrane|plasma membrane		g.chr8:113418829A>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5733T>C	8.37:g.113418829A>G		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Silent_p.H1113H|CSMD3_uc003ynt.2_Silent_p.H1871H|CSMD3_uc011lhx.1_Silent_p.H1807H	p.H1911H	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			35	5892	-			1911			Sushi 10.|Extracellular (Potential).		Q96PZ3	Silent	SNP	ENST00000297405.5	37	c.5733T>C	CCDS6315.1																																																																																				0.398	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		5	45	0	0	0	0.001168	0	5	45				
DEPTOR	64798	broad.mit.edu	37	8	121021282	121021283	+	Missense_Mutation	DNP	GG	GG	TT	rs544954637		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:121021282_121021283GG>TT	ENST00000286234.5	+	8	1141_1142	c.1011_1012GG>TT	c.(1009-1014)gcGGtt>gcTTtt	p.V338F	DEPTOR_ENST00000518057.1_3'UTR|DEPTOR_ENST00000523492.1_Missense_Mutation_p.V237F	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	338	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)				endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						TTGGTGACGCGGTTGGCTGGGG	0.545																																							uc003yow.3		NA																	0					0						c.(1009-1014)GCGGTT>GCTTTT		DEP domain containing 6																																				SO:0001583	missense	64798				intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding	g.chr8:121021282_121021283GG>TT		CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	Exception_encountered	8.37:g.121021282_121021283delinsTT	ENSP00000286234:p.Val338Phe		Somatic				DEPDC6_uc011lid.1_Missense_Mutation_p.V237F	p.V338F	NM_022783	NP_073620	WXS	Illumina HiSeq	Unspecified	Q8TB45	DPTOR_HUMAN	STAD - Stomach adenocarcinoma(47;0.00185)		8	1198_1199	+	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		338			PDZ.		B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Missense_Mutation	DNP	ENST00000286234.5	37	c.1011_1012GG>TT	CCDS6331.1																																																																																				0.545	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381601.1	NM_022783		7	45	0	0	0	0.004672	0	7	45				
ZHX2	22882	broad.mit.edu	37	8	123965171	123965171	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:123965171A>C	ENST00000314393.4	+	3	2256	c.1421A>C	c.(1420-1422)gAg>gCg	p.E474A		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	474	Required for interaction with NFYA.				mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CGGCTCATCGAGGTGACTGGC	0.562																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)	Esophageal Squamous(94;1056 1388 11767 13799 49639)	uc003ypk.1		NA																	0				ovary(1)|skin(1)	2						c.(1420-1422)GAG>GCG		zinc fingers and homeoboxes 2							88.0	87.0	87.0					8																	123965171		2203	4300	6503	SO:0001583	missense	22882					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:123965171A>C	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.1421A>C	8.37:g.123965171A>C	ENSP00000314709:p.Glu474Ala		Somatic					p.E474A	NM_014943	NP_055758	WXS	Illumina HiSeq	Unspecified	Q9Y6X8	ZHX2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		3	1988	+	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		474			Required for interaction with NFYA.|Homeobox 2.			Missense_Mutation	SNP	ENST00000314393.4	37	c.1421A>C	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	A	13.04	2.119006	0.37436	.	.	ENSG00000178764	ENST00000314393	D	0.96041	-3.89	5.94	4.8	0.61643	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.102570	0.64402	D	0.000003	D	0.91680	0.7370	L	0.31065	0.9	0.58432	D	0.999999	P	0.36683	0.565	B	0.38803	0.282	D	0.91695	0.5369	10	0.59425	D	0.04	-24.8951	11.4794	0.50316	0.9304:0.0:0.0696:0.0	.	474	Q9Y6X8	ZHX2_HUMAN	A	474	ENSP00000314709:E474A	ENSP00000314709:E474A	E	+	2	0	ZHX2	124034352	1.000000	0.71417	1.000000	0.80357	0.470000	0.32858	5.851000	0.69481	2.279000	0.76181	0.459000	0.35465	GAG		0.562	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943		4	44	0	0	0	0.000248	0	4	44				
FOXD4	2298	broad.mit.edu	37	9	118065	118065	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:118065C>A	ENST00000382500.2	-	1	352	c.55G>T	c.(55-57)Gac>Tac	p.D19Y		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	19					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CCATCGGAGTCCCGGAGGCTG	0.627																																							uc003zfz.2		NA																	0				skin(1)	1						c.(55-57)GAC>TAC		forkhead box D4							61.0	72.0	68.0					9																	118065		2115	4170	6285	SO:0001583	missense	2298				axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr9:118065C>A	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.55G>T	9.37:g.118065C>A	ENSP00000371940:p.Asp19Tyr		Somatic					p.D19Y	NM_207305	NP_997188	WXS	Illumina HiSeq	Unspecified	Q12950	FOXD4_HUMAN	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)	1	353	-	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	19					B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	ENST00000382500.2	37	c.55G>T	CCDS34975.1	.	.	.	.	.	.	.	.	.	.	.	12.67	2.008125	0.35415	.	.	ENSG00000170122	ENST00000382500	D	0.95342	-3.68	2.31	0.889	0.19212	.	0.234289	0.20840	U	0.084729	D	0.87708	0.6245	N	0.19112	0.55	0.20074	N	0.999934	P	0.50943	0.94	P	0.44732	0.459	T	0.81167	-0.1056	10	0.52906	T	0.07	.	5.2823	0.15682	0.0:0.7101:0.0:0.2899	.	19	Q12950	FOXD4_HUMAN	Y	19	ENSP00000371940:D19Y	ENSP00000371940:D19Y	D	-	1	0	FOXD4	108065	.	.	0.013000	0.15412	0.061000	0.15899	.	.	0.063000	0.16370	0.291000	0.19559	GAC		0.627	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055433.1	NM_207305		37	61	1	0	8.48111e-28	0.00361	1.52751e-27	37	61				
FAM154A	158297	broad.mit.edu	37	9	18950780	18950780	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:18950780G>A	ENST00000380534.4	-	2	473	c.194C>T	c.(193-195)cCa>cTa	p.P65L	FAM154A_ENST00000380530.1_Missense_Mutation_p.P65L|FAM154A_ENST00000542071.1_5'UTR|FAM154A_ENST00000583128.1_5'UTR	NM_153707.2	NP_714918.2	Q8IYX7	F154A_HUMAN	family with sequence similarity 154, member A	65										breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|skin(1)	26				GBM - Glioblastoma multiforme(50;6.53e-16)		GCCTTCCATTGGTATAGGCCC	0.448																																							uc003zni.1		NA																	0				pancreas(1)	1						c.(193-195)CCA>CTA		hypothetical protein LOC158297							201.0	183.0	189.0					9																	18950780		2203	4300	6503	SO:0001583	missense	158297							g.chr9:18950780G>A	BC033489	CCDS6487.1, CCDS75819.1, CCDS75820.1	9p22.1	2012-03-23	2008-02-21	2008-02-21	ENSG00000155875	ENSG00000155875			28566	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 138"""	C9orf138		12477932	Standard	NM_153707		Approved	MGC35182	uc003zni.2	Q8IYX7	OTTHUMG00000019609	ENST00000380534.4:c.194C>T	9.37:g.18950780G>A	ENSP00000369907:p.Pro65Leu		Somatic				FAM154A_uc010mip.1_5'UTR	p.P65L	NM_153707	NP_714918	WXS	Illumina HiSeq	Unspecified	Q8IYX7	F154A_HUMAN		GBM - Glioblastoma multiforme(50;6.53e-16)	2	472	-			65					Q5VY58	Missense_Mutation	SNP	ENST00000380534.4	37	c.194C>T	CCDS6487.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505924	0.44558	.	.	ENSG00000155875	ENST00000380534;ENST00000380530	T;T	0.32515	1.45;1.45	5.26	5.26	0.73747	.	0.000000	0.52532	D	0.000062	T	0.43033	0.1229	M	0.72118	2.19	0.51012	D	0.999903	P	0.43885	0.82	P	0.49047	0.599	T	0.35871	-0.9771	10	0.52906	T	0.07	-4.7382	12.1416	0.54000	0.0:0.1728:0.8272:0.0	.	65	Q8IYX7	F154A_HUMAN	L	65	ENSP00000369907:P65L;ENSP00000369902:P65L	ENSP00000369902:P65L	P	-	2	0	FAM154A	18940780	0.841000	0.29509	0.150000	0.22450	0.220000	0.24768	3.880000	0.56145	2.452000	0.82932	0.561000	0.74099	CCA		0.448	FAM154A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051811.1	NM_153707		17	107	0	0	0	0.008871	0	17	107				
TAF1L	138474	broad.mit.edu	37	9	32635171	32635171	+	Nonsense_Mutation	SNP	G	G	T	rs139816850	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:32635171G>T	ENST00000242310.4	-	1	496	c.407C>A	c.(406-408)tCg>tAg	p.S136*	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	136					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		ATCATAATCCGAGTGGTAAAG	0.478																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(406-408)TCG>TAG		TBP-associated factor RNA polymerase 1-like							284.0	248.0	260.0					9																	32635171		2203	4300	6503	SO:0001587	stop_gained	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32635171G>T	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.407C>A	9.37:g.32635171G>T	ENSP00000418379:p.Ser136*		Somatic				uc003zrh.1_Intron	p.S136*	NM_153809	NP_722516	WXS	Illumina HiSeq	Unspecified	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	497	-			136					Q0VG57	Nonsense_Mutation	SNP	ENST00000242310.4	37	c.407C>A	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287923	0.59976	.	.	ENSG00000122728	ENST00000242310	.	.	.	0.479	0.479	0.16796	.	0.838984	0.10745	N	0.639001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6915	0.23174	2.0E-4:0.0:0.9998:0.0	.	.	.	.	X	136	.	ENSP00000418379:S136X	S	-	2	0	TAF1L	32625171	0.919000	0.31177	0.777000	0.31699	0.050000	0.14768	0.362000	0.20284	0.507000	0.28148	0.195000	0.17529	TCG		0.478	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			40	106	1	0	7.63091e-17	0.007835	1.25005e-16	40	106				
Unknown	0	broad.mit.edu	37	9	66499759	66499759	+	IGR	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:66499759G>C								RP11-262H14.1 (30449 upstream) : RP11-262H14.7 (17446 downstream)																							GGGGTGGTGGGCAACCTGGTG	0.592																																							uc004aee.1		NA																	0					0						c.(568-570)GGC>GCC		Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).																																				SO:0001628	intergenic_variant	442421							g.chr9:66499759G>C																													9.37:g.66499759G>C			Somatic				LOC442421_uc004aed.1_RNA	p.G190A			WXS	Illumina HiSeq	Unspecified					1	569	+									Missense_Mutation	SNP		37	c.569G>C																																																																																				0	0.592									7	91	0	0	0	0.00308	0	7	91				
SPATA31D1	389763	broad.mit.edu	37	9	84608884	84608884	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:84608884G>A	ENST00000344803.2	+	4	3546	c.3499G>A	c.(3499-3501)Gga>Aga	p.G1167R		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1167					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CAGCAAGTCAGGAAGCTGCTC	0.413																																							uc004amn.2		NA																	0					0						c.(3499-3501)GGA>AGA		hypothetical protein LOC389763							50.0	49.0	49.0					9																	84608884		1894	4130	6024	SO:0001583	missense	389763					integral to membrane		g.chr9:84608884G>A		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3499G>A	9.37:g.84608884G>A	ENSP00000341988:p.Gly1167Arg		Somatic					p.G1167R	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	3546	+			1167						Missense_Mutation	SNP	ENST00000344803.2	37	c.3499G>A	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	8.435	0.849474	0.17034	.	.	ENSG00000214929	ENST00000344803	T	0.13538	2.58	2.75	1.84	0.25277	.	.	.	.	.	T	0.07728	0.0194	N	0.20986	0.625	0.09310	N	1	B	0.33044	0.395	B	0.33121	0.158	T	0.37361	-0.9709	9	0.15499	T	0.54	2.446	5.5587	0.17131	0.1594:0.0:0.8406:0.0	.	1167	Q6ZQQ2	F75D1_HUMAN	R	1167	ENSP00000341988:G1167R	ENSP00000341988:G1167R	G	+	1	0	FAM75D1	83798704	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.048000	0.11944	0.733000	0.32492	0.603000	0.83216	GGA		0.413	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		7	28	0	0	0	0.001984	0	7	28				
TMEM38B	55151	broad.mit.edu	37	9	108483876	108483876	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:108483876G>T	ENST00000374692.3	+	3	445	c.328G>T	c.(328-330)Gtt>Ttt	p.V110F	TMEM38B_ENST00000374688.1_Missense_Mutation_p.V56F	NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	110						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						ATATCTACCTGTTCAACTACT	0.363																																							uc004bcu.1		NA																	0				ovary(1)|skin(1)	2						c.(328-330)GTT>TTT		transmembrane protein 38B							87.0	81.0	83.0					9																	108483876		2203	4300	6503	SO:0001583	missense	55151					integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity	g.chr9:108483876G>T	BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.328G>T	9.37:g.108483876G>T	ENSP00000363824:p.Val110Phe		Somatic				TMEM38B_uc010mtn.1_Intron	p.V110F	NM_018112	NP_060582	WXS	Illumina HiSeq	Unspecified	Q9NVV0	TM38B_HUMAN			3	445	+			110			Cytoplasmic (Potential).		Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Missense_Mutation	SNP	ENST00000374692.3	37	c.328G>T	CCDS6768.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.034551	0.35893	.	.	ENSG00000095209	ENST00000374692;ENST00000374688	T;T	0.55052	0.54;0.57	5.74	0.328	0.15918	.	0.265638	0.38548	N	0.001642	T	0.46964	0.1420	L	0.47716	1.5	0.41557	D	0.988607	P	0.51147	0.942	P	0.49999	0.628	T	0.37776	-0.9691	10	0.44086	T	0.13	-8.1714	5.6043	0.17371	0.4122:0.1999:0.3879:0.0	.	110	Q9NVV0	TM38B_HUMAN	F	110;56	ENSP00000363824:V110F;ENSP00000363820:V56F	ENSP00000363820:V56F	V	+	1	0	TMEM38B	107523697	1.000000	0.71417	1.000000	0.80357	0.168000	0.22595	0.993000	0.29680	0.344000	0.23847	-0.136000	0.14681	GTT		0.363	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053517.1	NM_018112		10	29	1	0	0.00010058	0.001368	0.000118226	10	29				
SVEP1	79987	broad.mit.edu	37	9	113173854	113173854	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:113173854T>C	ENST00000401783.2	-	37	6473	c.6137A>G	c.(6136-6138)tAc>tGc	p.Y2046C	SVEP1_ENST00000297826.5_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.Y2023C	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2046	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ATCAGAGCAGTAGTAGAATGC	0.552																																							uc010mtz.2		NA																	0				ovary(7)	7						c.(6136-6138)TAC>TGC		polydom							48.0	49.0	48.0					9																	113173854		1958	4147	6105	SO:0001583	missense	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113173854T>C	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6137A>G	9.37:g.113173854T>C	ENSP00000384917:p.Tyr2046Cys		Somatic				SVEP1_uc010mty.2_5'UTR	p.Y2046C	NM_153366	NP_699197	WXS	Illumina HiSeq	Unspecified	Q4LDE5	SVEP1_HUMAN			37	6474	-			2046			Sushi 11.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	c.6137A>G	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	15.47	2.843536	0.51057	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	T;T	0.64803	-0.12;-0.12	5.98	5.98	0.97165	Complement control module (2);Sushi/SCR/CCP (3);	0.173189	0.52532	D	0.000068	T	0.72431	0.3459	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.71384	-0.4609	10	0.38643	T	0.18	.	12.1583	0.54089	0.1351:0.0:0.0:0.8649	.	2046	Q4LDE5	SVEP1_HUMAN	C	2046;2023	ENSP00000384917:Y2046C;ENSP00000363593:Y2023C	ENSP00000363593:Y2023C	Y	-	2	0	SVEP1	112213675	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.018000	0.49625	2.296000	0.77279	0.482000	0.46254	TAC		0.552	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				11	23	0	0	0	0.000978	0	11	23				
CDK5RAP2	55755	broad.mit.edu	37	9	123253683	123253683	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:123253683T>A	ENST00000349780.4	-	13	1563	c.1384A>T	c.(1384-1386)Aag>Tag	p.K462*	CDK5RAP2_ENST00000359309.3_Nonsense_Mutation_p.K462*|CDK5RAP2_ENST00000360822.3_Nonsense_Mutation_p.K462*|CDK5RAP2_ENST00000360190.4_Nonsense_Mutation_p.K462*	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	462					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						AGAAGACTCTTGTAACGATTT	0.343																																							uc004bkf.2		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(1384-1386)AAG>TAG		CDK5 regulatory subunit associated protein 2							197.0	171.0	180.0					9																	123253683		2202	4300	6502	SO:0001587	stop_gained	55755				brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding	g.chr9:123253683T>A	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.1384A>T	9.37:g.123253683T>A	ENSP00000343818:p.Lys462*		Somatic				CDK5RAP2_uc004bkg.2_Nonsense_Mutation_p.K462*|CDK5RAP2_uc011lxw.1_5'UTR|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_5'UTR|CDK5RAP2_uc011lya.1_5'UTR|CDK5RAP2_uc004bkh.1_Nonsense_Mutation_p.K462*|CDK5RAP2_uc004bki.2_Nonsense_Mutation_p.K261*	p.K462*	NM_018249	NP_060719	WXS	Illumina HiSeq	Unspecified	Q96SN8	CK5P2_HUMAN			13	1565	-			462					Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Nonsense_Mutation	SNP	ENST00000349780.4	37	c.1384A>T	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.872999	0.91664	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000345313	.	.	.	5.76	0.61	0.17580	.	0.279604	0.30890	N	0.008679	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.033	0.14419	0.0:0.2129:0.2695:0.5176	.	.	.	.	X	462;462;462;462;464	.	ENSP00000341695:K464X	K	-	1	0	CDK5RAP2	122293504	1.000000	0.71417	0.021000	0.16686	0.192000	0.23643	0.837000	0.27558	-0.125000	0.11703	0.528000	0.53228	AAG		0.343	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249		12	38	0	0	0	0.000978	0	12	38				
RC3H2	54542	broad.mit.edu	37	9	125620205	125620205	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:125620205C>A	ENST00000373670.1	-	12	3051	c.2451G>T	c.(2449-2451)gcG>gcT	p.A817A	RC3H2_ENST00000357244.2_Silent_p.A817A|RC3H2_ENST00000423239.2_Silent_p.A817A			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	817					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						TTCTTACATCCGCACGAAAGT	0.418																																							uc010mwc.1		NA																	0				ovary(2)|lung(2)	4						c.(2449-2451)GCG>GCT		ring finger and CCCH-type zinc finger domains 2							126.0	127.0	126.0					9																	125620205		1984	4152	6136	SO:0001819	synonymous_variant	54542					cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding	g.chr9:125620205C>A	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.2451G>T	9.37:g.125620205C>A			Somatic				RC3H2_uc004bnc.2_RNA|RC3H2_uc004bnd.1_Silent_p.A817A|RC3H2_uc004bne.3_Silent_p.A817A	p.A817A	NM_001100588	NP_001094058	WXS	Illumina HiSeq	Unspecified	Q9HBD1	RC3H2_HUMAN			13	2692	-			817					Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Silent	SNP	ENST00000373670.1	37	c.2451G>T	CCDS43874.1																																																																																				0.418	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835		18	34	1	0	8.34094e-07	0.008871	1.05442e-06	18	34				
NUP188	23511	broad.mit.edu	37	9	131750354	131750354	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:131750354C>T	ENST00000372577.2	+	24	2443	c.2422C>T	c.(2422-2424)Cag>Tag	p.Q808*		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	808					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GGGGCAGGGCCAGCTGCTGAT	0.502																																							uc004bws.1		NA																	0				ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						c.(2422-2424)CAG>TAG		nucleoporin 188kDa							162.0	151.0	155.0					9																	131750354		2203	4300	6503	SO:0001587	stop_gained	23511				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr9:131750354C>T	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.2422C>T	9.37:g.131750354C>T	ENSP00000361658:p.Gln808*		Somatic				NUP188_uc004bwu.2_Nonsense_Mutation_p.Q151*	p.Q808*	NM_015354	NP_056169	WXS	Illumina HiSeq	Unspecified	Q5SRE5	NU188_HUMAN			24	2444	+			808					Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Nonsense_Mutation	SNP	ENST00000372577.2	37	c.2422C>T	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	C	40	8.507573	0.98841	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-3.9268	17.7375	0.88397	0.0:1.0:0.0:0.0	.	.	.	.	X	697;808	.	ENSP00000349125:Q697X	Q	+	1	0	NUP188	130790175	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.943000	0.75934	2.941000	0.99782	0.655000	0.94253	CAG		0.502	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			37	138	0	0	0	0.005524	0	37	138				
TOR1B	27348	broad.mit.edu	37	9	132566477	132566477	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:132566477G>T	ENST00000259339.2	+	2	385	c.325G>T	c.(325-327)Ggc>Tgc	p.G109C	TOR1B_ENST00000486372.1_3'UTR	NM_014506.1	NP_055321.1	O14657	TOR1B_HUMAN	torsin family 1, member B (torsin B)	109					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum organization (GO:0007029)|nuclear membrane organization (GO:0071763)|protein homooligomerization (GO:0051260)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)	12		Ovarian(14;0.0586)				TTCCTTACACGGCTGGGCTGG	0.468																																							uc004byk.1		NA																	0					0						c.(325-327)GGC>TGC		torsin family 1, member B (torsin B) precursor							97.0	93.0	94.0					9																	132566477		2203	4300	6503	SO:0001583	missense	27348				chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen	ATP binding|nucleoside-triphosphatase activity|unfolded protein binding	g.chr9:132566477G>T	AF007872	CCDS6929.1	9q34	2008-07-21			ENSG00000136816	ENSG00000136816			11995	protein-coding gene	gene with protein product		608050				9288096, 10644435	Standard	NM_014506		Approved	DQ1, MGC4386	uc004byk.1	O14657	OTTHUMG00000020795	ENST00000259339.2:c.325G>T	9.37:g.132566477G>T	ENSP00000259339:p.Gly109Cys		Somatic					p.G109C	NM_014506	NP_055321	WXS	Illumina HiSeq	Unspecified	O14657	TOR1B_HUMAN			2	385	+		Ovarian(14;0.0586)	109			ATP (Potential).			Missense_Mutation	SNP	ENST00000259339.2	37	c.325G>T	CCDS6929.1	.	.	.	.	.	.	.	.	.	.	G	31	5.095724	0.94197	.	.	ENSG00000136816	ENST00000259339	D	0.92911	-3.13	5.1	5.1	0.69264	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97259	0.9104	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98438	1.0585	10	0.87932	D	0	-21.26	17.5305	0.87813	0.0:0.0:1.0:0.0	.	109	O14657	TOR1B_HUMAN	C	109	ENSP00000259339:G109C	ENSP00000259339:G109C	G	+	1	0	TOR1B	131606298	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.367000	0.79558	2.390000	0.81377	0.561000	0.74099	GGC		0.468	TOR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054615.1	NM_014506		20	77	1	0	1.56452e-12	0.007413	2.34504e-12	20	77				
TTF1	7270	broad.mit.edu	37	9	135267523	135267523	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:135267523C>A	ENST00000334270.2	-	6	1966	c.1927G>T	c.(1927-1929)Ggt>Tgt	p.G643C		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	643	Myb-like 1. {ECO:0000255|PROSITE- ProRule:PRU00133}.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		ACCATCTCACCAATCGTCTTC	0.488																																							uc004cbl.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(1927-1929)GGT>TGT		transcription termination factor, RNA polymerase							88.0	78.0	81.0					9																	135267523		2203	4300	6503	SO:0001583	missense	7270				negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding	g.chr9:135267523C>A	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1927G>T	9.37:g.135267523C>A	ENSP00000333920:p.Gly643Cys		Somatic				TTF1_uc011mcp.1_RNA|TTF1_uc004cbm.2_Missense_Mutation_p.G128C	p.G643C	NM_007344	NP_031370	WXS	Illumina HiSeq	Unspecified	Q15361	TTF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)	6	1979	-		Myeloproliferative disorder(178;0.204)	643			Myb-like 1.		A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	ENST00000334270.2	37	c.1927G>T	CCDS6948.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244429	0.79912	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.43294	0.95	5.77	5.77	0.91146	SANT domain, DNA binding (1);Homeodomain-like (1);MYB-like (1);	0.186331	0.37669	N	0.001999	T	0.65322	0.2680	M	0.73962	2.25	0.40978	D	0.984755	D	0.89917	1.0	D	0.83275	0.996	T	0.68792	-0.5315	10	0.87932	D	0	.	15.4916	0.75611	0.0:1.0:0.0:0.0	.	643	Q15361	TTF1_HUMAN	C	643	ENSP00000333920:G643C	ENSP00000245588:G643C	G	-	1	0	TTF1	134257344	0.477000	0.25909	0.995000	0.50966	0.973000	0.67179	1.948000	0.40303	2.723000	0.93209	0.655000	0.94253	GGT		0.488	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344		15	23	1	0	1.49906e-05	0.00245	1.81622e-05	15	23				
KCNT1	57582	broad.mit.edu	37	9	138656985	138656985	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:138656985A>T	ENST00000263604.3	+	12	1087	c.1087A>T	c.(1087-1089)Aag>Tag	p.K363*	KCNT1_ENST00000491806.2_Nonsense_Mutation_p.K349*|KCNT1_ENST00000487664.1_Nonsense_Mutation_p.K337*|KCNT1_ENST00000486577.2_Nonsense_Mutation_p.K343*|KCNT1_ENST00000371757.2_Nonsense_Mutation_p.K382*|KCNT1_ENST00000298480.5_Nonsense_Mutation_p.K382*|KCNT1_ENST00000490355.2_Nonsense_Mutation_p.K363*|KCNT1_ENST00000488444.2_Nonsense_Mutation_p.K363*			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	363					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CAGCTCCCTCAAGATCGACCT	0.642																																							uc011mdq.1		NA																	0				large_intestine(2)|ovary(1)|pancreas(1)	4						c.(1144-1146)AAG>TAG		potassium channel, subfamily T, member 1							221.0	196.0	205.0					9																	138656985		2203	4300	6503	SO:0001587	stop_gained	57582					membrane	binding|calcium-activated potassium channel activity	g.chr9:138656985A>T	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1087A>T	9.37:g.138656985A>T	ENSP00000263604:p.Lys363*		Somatic				KCNT1_uc011mdr.1_Nonsense_Mutation_p.K209*|KCNT1_uc010nbf.2_Nonsense_Mutation_p.K337*|KCNT1_uc004cgo.1_Nonsense_Mutation_p.K131*	p.K382*	NM_020822	NP_065873	WXS	Illumina HiSeq	Unspecified	Q5JUK3	KCNT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)	12	1218	+		Myeloproliferative disorder(178;0.0821)	382					B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Nonsense_Mutation	SNP	ENST00000263604.3	37	c.1144A>T		.	.	.	.	.	.	.	.	.	.	A	39	7.489476	0.98316	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	.	.	.	4.35	4.35	0.52113	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	12.6755	12.853	0.57869	1.0:0.0:0.0:0.0	.	.	.	.	X	337;382;382;343;349;363;363;363	.	ENSP00000263604:K363X	K	+	1	0	KCNT1	137796806	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.990000	0.93510	1.817000	0.53016	0.379000	0.24179	AAG		0.642	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822		25	79	0	0	0	0.00278	0	25	79				
TRAF2	7186	broad.mit.edu	37	9	139814764	139814764	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:139814764G>C	ENST00000247668.2	+	8	809	c.757G>C	c.(757-759)Gag>Cag	p.E253Q	TRAF2_ENST00000482854.1_3'UTR|TRAF2_ENST00000536468.1_Missense_Mutation_p.E253Q|TRAF2_ENST00000359662.3_Missense_Mutation_p.E305Q	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	253				Missing (in Ref. 2; BAB70792). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		CTCGGTGCTGGAGGCAAAGCC	0.622																																							uc010nbu.2		NA																	0				ovary(1)|lung(1)|breast(1)|skin(1)	4						c.(757-759)GAG>CAG		TNF receptor-associated factor 2							59.0	57.0	58.0					9																	139814764		2203	4300	6503	SO:0001583	missense	7186				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:139814764G>C	U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.757G>C	9.37:g.139814764G>C	ENSP00000247668:p.Glu253Gln		Somatic				TRAF2_uc004cjv.2_Missense_Mutation_p.E253Q|TRAF2_uc011mek.1_Missense_Mutation_p.E242Q|TRAF2_uc010nbw.2_Missense_Mutation_p.E228Q	p.E253Q	NM_021138	NP_066961	WXS	Illumina HiSeq	Unspecified	Q12933	TRAF2_HUMAN	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)	9	930	+	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	253	Missing (in Ref. 2; BAB70792).				A8K107|B4DPJ7|Q7Z337|Q96NT2	Missense_Mutation	SNP	ENST00000247668.2	37	c.757G>C	CCDS7013.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990236	0.35131	.	.	ENSG00000127191	ENST00000536468;ENST00000432785;ENST00000247668;ENST00000359662	T;T;T	0.36878	1.47;1.47;1.23	4.37	4.37	0.52481	.	1.228230	0.05616	N	0.579050	T	0.35998	0.0951	L	0.35487	1.065	0.29609	N	0.847107	B;B;B	0.25486	0.127;0.127;0.002	B;B;B	0.33121	0.158;0.158;0.004	T	0.24728	-1.0152	10	0.13470	T	0.59	-20.5751	16.0627	0.80852	0.0:0.0:1.0:0.0	.	242;228;253	Q12933-3;Q12933-4;Q12933	.;.;TRAF2_HUMAN	Q	253;252;253;305	ENSP00000446414:E253Q;ENSP00000247668:E253Q;ENSP00000352685:E305Q	ENSP00000247668:E253Q	E	+	1	0	TRAF2	138934585	1.000000	0.71417	0.904000	0.35570	0.123000	0.20343	4.454000	0.60068	2.246000	0.74042	0.462000	0.41574	GAG		0.622	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055166.1	NM_021138		10	34	0	0	0	0.006214	0	10	34				
GRIN1	2902	broad.mit.edu	37	9	140036576	140036576	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:140036576C>G	ENST00000371561.3	+	2	1467	c.370C>G	c.(370-372)Cgc>Ggc	p.R124G	GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000350902.5_Missense_Mutation_p.R124G|GRIN1_ENST00000371560.3_Missense_Mutation_p.R124G|GRIN1_ENST00000315048.3_Missense_Mutation_p.R124G|GRIN1_ENST00000371546.4_Missense_Mutation_p.R124G|GRIN1_ENST00000371555.4_Missense_Mutation_p.R124G|GRIN1_ENST00000371559.4_Missense_Mutation_p.R124G|GRIN1_ENST00000371550.4_Missense_Mutation_p.R124G|GRIN1_ENST00000371553.3_Missense_Mutation_p.R124G	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	124					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGACCACCCGCATGTCCAT	0.652																																					NSCLC(113;717 1653 2089 20474 37618)	NSCLC(113;717 1653 2089 20474 37618)	uc004clk.2		NA																	0				skin(1)	1						c.(370-372)CGC>GGC		NMDA receptor 1 isoform NR1-3 precursor	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)						248.0	199.0	216.0					9																	140036576		2203	4300	6503	SO:0001583	missense	2902				ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding	g.chr9:140036576C>G		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.370C>G	9.37:g.140036576C>G	ENSP00000360616:p.Arg124Gly		Somatic				GRIN1_uc004cli.1_5'UTR|GRIN1_uc004clj.1_Missense_Mutation_p.R121G|GRIN1_uc004cll.2_Missense_Mutation_p.R124G|GRIN1_uc004clm.2_Missense_Mutation_p.R124G|GRIN1_uc004cln.2_Missense_Mutation_p.R121G|GRIN1_uc004clo.2_Missense_Mutation_p.R121G	p.R124G	NM_007327	NP_015566	WXS	Illumina HiSeq	Unspecified	Q05586	NMDZ1_HUMAN	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	2	700	+	all_cancers(76;0.0926)		124			Extracellular (Potential).		A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	ENST00000371561.3	37	c.370C>G	CCDS7031.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342027	0.61073	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	D;D;D;D;D;D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61	3.67	3.67	0.42095	Extracellular ligand-binding receptor (1);	0.121891	0.51477	D	0.000100	D	0.89199	0.6647	M	0.76574	2.34	0.80722	D	1	D;B;D;D;D;D	0.89917	1.0;0.426;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.97110	0.999;0.572;1.0;1.0;1.0;1.0	D	0.87239	0.2265	10	0.22109	T	0.4	.	14.1127	0.65132	0.0:1.0:0.0:0.0	.	124;124;124;124;124;124	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	G	124	ENSP00000360616:R124G;ENSP00000316696:R124G;ENSP00000316915:R124G;ENSP00000360605:R124G;ENSP00000360601:R124G;ENSP00000360610:R124G;ENSP00000360608:R124G;ENSP00000360614:R124G;ENSP00000360615:R124G	ENSP00000316696:R124G	R	+	1	0	GRIN1	139156397	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.058000	0.76676	1.887000	0.54652	0.462000	0.41574	CGC		0.652	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327		37	81	0	0	0	0.004878	0	37	81				
GRIN1	2902	broad.mit.edu	37	9	140036578	140036578	+	Silent	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:140036578C>G	ENST00000371561.3	+	2	1469	c.372C>G	c.(370-372)cgC>cgG	p.R124R	GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000350902.5_Silent_p.R124R|GRIN1_ENST00000371560.3_Silent_p.R124R|GRIN1_ENST00000315048.3_Silent_p.R124R|GRIN1_ENST00000371546.4_Silent_p.R124R|GRIN1_ENST00000371555.4_Silent_p.R124R|GRIN1_ENST00000371559.4_Silent_p.R124R|GRIN1_ENST00000371550.4_Silent_p.R124R|GRIN1_ENST00000371553.3_Silent_p.R124R	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	124					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGACCACCCGCATGTCCATCT	0.647																																					NSCLC(113;717 1653 2089 20474 37618)	NSCLC(113;717 1653 2089 20474 37618)	uc004clk.2		NA																	0				skin(1)	1						c.(370-372)CGC>CGG		NMDA receptor 1 isoform NR1-3 precursor	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)						237.0	190.0	206.0					9																	140036578		2203	4300	6503	SO:0001819	synonymous_variant	2902				ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding	g.chr9:140036578C>G		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.372C>G	9.37:g.140036578C>G			Somatic				GRIN1_uc004cli.1_5'UTR|GRIN1_uc004clj.1_Silent_p.R121R|GRIN1_uc004cll.2_Silent_p.R124R|GRIN1_uc004clm.2_Silent_p.R124R|GRIN1_uc004cln.2_Silent_p.R121R|GRIN1_uc004clo.2_Silent_p.R121R	p.R124R	NM_007327	NP_015566	WXS	Illumina HiSeq	Unspecified	Q05586	NMDZ1_HUMAN	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	2	702	+	all_cancers(76;0.0926)		124			Extracellular (Potential).		A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Silent	SNP	ENST00000371561.3	37	c.372C>G	CCDS7031.1																																																																																				0.647	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327		35	76	0	0	0	0.003755	0	35	76				
PNPLA7	375775	broad.mit.edu	37	9	140356475	140356475	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:140356475C>A	ENST00000277531.4	-	31	3775	c.3589G>T	c.(3589-3591)Ggg>Tgg	p.G1197W	NSMF_ENST00000437259.1_5'Flank|PNPLA7_ENST00000371457.1_Missense_Mutation_p.G803W|NSMF_ENST00000371473.3_5'Flank|PNPLA7_ENST00000492278.1_5'UTR|PNPLA7_ENST00000406427.1_Missense_Mutation_p.G1222W|NSMF_ENST00000371475.3_5'Flank|NSMF_ENST00000371474.3_5'Flank|NSMF_ENST00000371472.2_5'Flank|NSMF_ENST00000392812.4_5'Flank|NSMF_ENST00000265663.7_5'Flank	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	1197					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		ACCGTGCGCCCGTGCTGGTAG	0.672																																							uc004cnf.2		NA																	0				skin(1)	1						c.(3589-3591)GGG>TGG		patatin-like phospholipase domain containing 7							12.0	13.0	13.0					9																	140356475		2192	4293	6485	SO:0001583	missense	375775				lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity	g.chr9:140356475C>A	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.3589G>T	9.37:g.140356475C>A	ENSP00000277531:p.Gly1197Trp		Somatic				C9orf167_uc011mew.1_Intron|PNPLA7_uc004cnd.1_Missense_Mutation_p.G444W|PNPLA7_uc004cne.1_Missense_Mutation_p.G463W|PNPLA7_uc011mfa.1_Missense_Mutation_p.G605W|PNPLA7_uc010ncj.1_Missense_Mutation_p.G1222W|NELF_uc004cna.2_5'Flank|NELF_uc011mez.1_5'Flank|NELF_uc004cmz.2_5'Flank|NELF_uc004cnc.2_5'Flank|NELF_uc004cnb.2_5'Flank	p.G1197W	NM_152286	NP_689499	WXS	Illumina HiSeq	Unspecified	Q6ZV29	PLPL7_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)	31	3926	-	all_cancers(76;0.126)		1197					B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	c.3589G>T	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760306	0.89932	.	.	ENSG00000130653	ENST00000371457;ENST00000371446;ENST00000277531;ENST00000406427;ENST00000434090	T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14	4.33	4.33	0.51752	.	0.000000	0.85682	D	0.000000	D	0.90212	0.6940	M	0.91818	3.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	D	0.92779	0.6239	10	0.87932	D	0	-37.5817	16.1832	0.81925	0.0:1.0:0.0:0.0	.	605;1222;1197;444	E2QRF8;Q6ZV29-5;Q6ZV29;B3KXH5	.;.;PLPL7_HUMAN;.	W	803;605;1197;1222;1188	ENSP00000360512:G803W;ENSP00000360501:G605W;ENSP00000277531:G1197W;ENSP00000384610:G1222W;ENSP00000400582:G1188W	ENSP00000277531:G1197W	G	-	1	0	PNPLA7	139476296	1.000000	0.71417	0.976000	0.42696	0.957000	0.61999	7.439000	0.80444	2.126000	0.65437	0.462000	0.41574	GGG		0.672	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286		7	10	1	0	5.18039e-06	0.00308	6.4038e-06	7	10				
CACNA1B	774	broad.mit.edu	37	9	140878624	140878624	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr9:140878624C>A	ENST00000371372.1	+	13	1836	c.1691C>A	c.(1690-1692)gCg>gAg	p.A564E	CACNA1B_ENST00000371363.1_Missense_Mutation_p.A564E|CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A565E|CACNA1B_ENST00000277551.2_Missense_Mutation_p.A564E|CACNA1B_ENST00000371355.4_Missense_Mutation_p.A565E	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	564					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GTGGTCTGGGCGGCCATCAAG	0.602																																							uc004cog.2		NA																	0				breast(3)|large_intestine(2)|ovary(1)	6						c.(1690-1692)GCG>GAG		calcium channel, voltage-dependent, N type,	Amlodipine(DB00381)|Gabapentin(DB00996)						75.0	93.0	87.0					9																	140878624		2118	4216	6334	SO:0001583	missense	774				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity	g.chr9:140878624C>A	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1691C>A	9.37:g.140878624C>A	ENSP00000360423:p.Ala564Glu		Somatic				CACNA1B_uc011mfd.1_Missense_Mutation_p.A95E	p.A564E	NM_000718	NP_000709	WXS	Illumina HiSeq	Unspecified	Q00975	CAC1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	13	1836	+	all_cancers(76;0.166)		564			Extracellular (Potential).|II.		B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	c.1691C>A	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	c	20.5	3.993860	0.74703	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.98419	-4.92;-4.92;-4.92;-4.92;-4.92	4.68	4.68	0.58851	.	0.056748	0.64402	D	0.000001	D	0.97492	0.9179	N	0.25094	0.71	0.80722	D	1	D;D	0.58268	0.982;0.982	P;P	0.59424	0.857;0.823	D	0.99327	1.0908	10	0.87932	D	0	.	18.0155	0.89239	0.0:1.0:0.0:0.0	.	564;564	B1AQK4;B1AQK6	.;.	E	564;564;564;565;565	ENSP00000360423:A564E;ENSP00000277551:A564E;ENSP00000360414:A564E;ENSP00000360408:A565E;ENSP00000360406:A565E	ENSP00000277551:A564E	A	+	2	0	CACNA1B	139998445	0.997000	0.39634	0.989000	0.46669	0.972000	0.66771	3.719000	0.54926	2.302000	0.77476	0.550000	0.68814	GCG		0.602	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718		5	5	1	0	0.00116845	0.001168	0.00132463	5	5				
P2RY8	286530	broad.mit.edu	37	X	1584790	1584790	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:1584790A>T	ENST00000381297.4	-	2	872	c.662T>A	c.(661-663)tTg>tAg	p.L221*	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTCCGTGCGCAACAGCTTGAG	0.647			T	CRLF2	"""B-ALL, Downs associated ALL"""																																		uc004cpz.2		NA		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	T	"""purinergic receptor P2Y, G-protein coupled, 8"""			L	CRLF2		B-ALL|Downs associated ALL		0				lung(5)	5						c.(661-663)TTG>TAG		G-protein coupled purinergic receptor P2Y8							72.0	43.0	53.0					X																	1584790		2203	4293	6496	SO:0001587	stop_gained	286530					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:1584790A>T	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.662T>A	X.37:g.1584790A>T	ENSP00000370697:p.Leu221*		Somatic					p.L221*	NM_178129	NP_835230	WXS	Illumina HiSeq	Unspecified	Q86VZ1	P2RY8_HUMAN			2	910	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	221			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000381297.4	37	c.662T>A	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	a	12.22	1.871482	0.33069	.	.	ENSG00000182162	ENST00000381297	.	.	.	2.41	1.08	0.20341	.	0.262358	0.18834	U	0.129866	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	7.9722	0.30134	0.7939:0.206:0.0:0.0	.	.	.	.	X	221	.	ENSP00000370697:L221X	L	-	2	0	P2RY8	1544790	1.000000	0.71417	0.001000	0.08648	0.051000	0.14879	4.338000	0.59316	-0.147000	0.11254	0.230000	0.17803	TTG		0.647	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129		12	26	0	0	0	0.000978	0	12	26				
MXRA5	25878	broad.mit.edu	37	X	3229500	3229500	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:3229500C>A	ENST00000217939.6	-	7	6898	c.6744G>T	c.(6742-6744)aaG>aaT	p.K2248N		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2248	Ig-like C2-type 7.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CGTTCTCCTCCTTGTGTTCAA	0.542																																							uc004crg.3		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(6742-6744)AAG>AAT		adlican precursor							84.0	79.0	81.0					X																	3229500		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3229500C>A	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6744G>T	X.37:g.3229500C>A	ENSP00000217939:p.Lys2248Asn		Somatic					p.K2248N	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			7	6901	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	2248			Ig-like C2-type 7.		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.6744G>T	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	10.80	1.453856	0.26161	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.66280	-0.2	4.28	-2.9	0.05648	Immunoglobulin-like (1);	0.452872	0.16064	U	0.231329	T	0.73976	0.3656	M	0.79123	2.44	0.31561	N	0.657493	D	0.89917	1.0	D	0.85130	0.997	T	0.72953	-0.4135	10	0.34782	T	0.22	.	11.8484	0.52397	0.0:0.4513:0.0:0.5487	.	2248	Q9NR99	MXRA5_HUMAN	N	2248	ENSP00000217939:K2248N	ENSP00000217939:K2248N	K	-	3	2	MXRA5	3239500	0.887000	0.30362	0.000000	0.03702	0.121000	0.20230	-0.065000	0.11617	-0.758000	0.04690	-0.513000	0.04457	AAG		0.542	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		39	74	1	0	1.7489e-18	0.002852	2.92211e-18	39	74				
VCX3B	425054	broad.mit.edu	37	X	8434331	8434331	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:8434331G>T	ENST00000381032.1	+	3	955	c.648G>T	c.(646-648)caG>caT	p.Q216H	VCX3B_ENST00000444481.1_Missense_Mutation_p.Q186H|VCX3B_ENST00000453306.1_Intron|VCX3B_ENST00000381029.4_Missense_Mutation_p.Q184H|VCX3B_ENST00000440654.2_Missense_Mutation_p.Q166H	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	216	14 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						CACTGAGTCAGGAGAGCCAGG	0.562																																							uc010ndo.2		NA																	0					0						c.(556-558)CAG>CAT		variable charge, X-linked 3B							81.0	146.0	124.0					X																	8434331		2181	4243	6424	SO:0001583	missense	425054					nucleolus		g.chrX:8434331G>T		CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.648G>T	X.37:g.8434331G>T	ENSP00000370420:p.Gln216His		Somatic				VCX3B_uc004csd.1_Missense_Mutation_p.Q166H	p.Q186H	NM_001001888	NP_001001888	WXS	Illumina HiSeq	Unspecified	Q9H321	VCX3B_HUMAN			4	865	+			186			9.|11 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.		C9JS46|Q4KN12	Missense_Mutation	SNP	ENST00000381032.1	37	c.558G>T	CCDS48077.2	.	.	.	.	.	.	.	.	.	.	N	4.301	0.055209	0.08291	.	.	ENSG00000205642	ENST00000381032;ENST00000444481;ENST00000440654;ENST00000381029	T;T;T;T	0.20463	2.07;2.07;2.2;2.07	0.705	0.705	0.18127	.	.	.	.	.	T	0.12603	0.0306	N	0.14661	0.345	0.09310	N	1	D;D	0.53462	0.96;0.96	P;P	0.44394	0.448;0.448	T	0.17930	-1.0353	9	0.44086	T	0.13	.	7.3105	0.26471	1.0E-4:0.0:0.9999:0.0	.	186;166	Q9H321;E7ERZ8	VCX3B_HUMAN;.	H	216;186;166;184	ENSP00000370420:Q216H;ENSP00000414780:Q186H;ENSP00000410372:Q166H;ENSP00000370417:Q184H	ENSP00000370417:Q184H	Q	+	3	2	VCX3B	8394331	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.191000	0.17076	0.695000	0.31675	0.525000	0.51046	CAG		0.562	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055691.1			23	295	1	0	2.65835e-16	0.007291	4.29179e-16	23	295				
TLR7	51284	broad.mit.edu	37	X	12904321	12904321	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:12904321C>G	ENST00000380659.3	+	3	833	c.694C>G	c.(694-696)Ctc>Gtc	p.L232V		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	232					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.L232I(1)		NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	AGAACTATATCTCTACAACAA	0.358																																							uc004cvc.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|lung(2)|breast(1)	5						c.(694-696)CTC>GTC		toll-like receptor 7 precursor	Imiquimod(DB00724)						65.0	60.0	62.0					X																	12904321		2203	4300	6503	SO:0001583	missense	51284				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity	g.chrX:12904321C>G	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.694C>G	X.37:g.12904321C>G	ENSP00000370034:p.Leu232Val		Somatic					p.L232V	NM_016562	NP_057646	WXS	Illumina HiSeq	Unspecified	Q9NYK1	TLR7_HUMAN			3	833	+			232			Extracellular (Potential).|LRR 8.		D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	c.694C>G	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338909	0.41398	.	.	ENSG00000196664	ENST00000380659	T	0.08008	3.14	5.41	5.41	0.78517	.	0.080132	0.51477	D	0.000098	T	0.31827	0.0809	M	0.88570	2.965	0.47905	D	0.999543	D	0.69078	0.997	P	0.62491	0.903	T	0.20773	-1.0265	10	0.87932	D	0	.	13.944	0.64073	0.1616:0.8384:0.0:0.0	.	232	Q9NYK1	TLR7_HUMAN	V	232	ENSP00000370034:L232V	ENSP00000370034:L232V	L	+	1	0	TLR7	12814242	1.000000	0.71417	0.932000	0.37286	0.201000	0.24016	5.001000	0.63946	2.242000	0.73789	0.589000	0.80489	CTC		0.358	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562		12	50	0	0	0	0.001368	0	12	50				
SCML1	6322	broad.mit.edu	37	X	17768022	17768022	+	Silent	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:17768022T>C	ENST00000380041.3	+	6	640	c.312T>C	c.(310-312)taT>taC	p.Y104Y	SCML1_ENST00000380045.3_5'UTR|SCML1_ENST00000380043.3_Silent_p.Y77Y|SCML1_ENST00000398080.1_5'UTR	NM_001037540.1	NP_001032629.1	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 (Drosophila)	104					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)	10	Hepatocellular(33;0.183)					AGAAGCGATATGGATATAAAA	0.318																																							uc004cyb.2		NA																	0				breast(2)|ovary(1)	3						c.(310-312)TAT>TAC		sex comb on midleg-like 1 isoform a							69.0	75.0	73.0					X																	17768022		2203	4299	6502	SO:0001819	synonymous_variant	6322				anatomical structure morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:17768022T>C		CCDS14182.2, CCDS35210.1, CCDS35211.1	Xp22	2013-01-10	2001-11-28		ENSG00000047634	ENSG00000047634		"""Sterile alpha motif (SAM) domain containing"""	10580	protein-coding gene	gene with protein product		300227	"""sex comb on midleg (Drosophila)-like 1"""			9570953	Standard	XM_005274578		Approved		uc004cyc.3	Q9UN30	OTTHUMG00000021206	ENST00000380041.3:c.312T>C	X.37:g.17768022T>C			Somatic				SCML1_uc004cyc.2_Silent_p.Y77Y|SCML1_uc004cyd.2_5'UTR|SCML1_uc004cye.2_5'UTR	p.Y104Y	NM_001037540	NP_001032629	WXS	Illumina HiSeq	Unspecified	Q9UN30	SCML1_HUMAN			6	637	+	Hepatocellular(33;0.183)		104					B0FZN6|B2RA08|Q5H968|Q5H969	Silent	SNP	ENST00000380041.3	37	c.312T>C	CCDS35210.1																																																																																				0.318	SCML1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060495.5	NM_006746		53	81	0	0	0	0.00361	0	53	81				
SH3KBP1	30011	broad.mit.edu	37	X	19560137	19560137	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:19560137C>A	ENST00000397821.3	-	16	2088	c.1798G>T	c.(1798-1800)Gag>Tag	p.E600*	SH3KBP1_ENST00000541422.1_Nonsense_Mutation_p.E339*|SH3KBP1_ENST00000379698.4_Nonsense_Mutation_p.E563*|SH3KBP1_ENST00000379716.1_Nonsense_Mutation_p.E362*	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	600					apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						GCCGCAGGCTCCATCTTTGGT	0.617																																							uc004czm.2		NA																	0					0						c.(1798-1800)GAG>TAG		SH3-domain kinase binding protein 1 isoform a							81.0	79.0	80.0					X																	19560137		2203	4300	6503	SO:0001587	stop_gained	30011				apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding	g.chrX:19560137C>A	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.1798G>T	X.37:g.19560137C>A	ENSP00000380921:p.Glu600*		Somatic				SH3KBP1_uc011mje.1_Nonsense_Mutation_p.E339*|SH3KBP1_uc011mjf.1_Nonsense_Mutation_p.E362*|SH3KBP1_uc004czl.2_Nonsense_Mutation_p.E563*|SH3KBP1_uc010nfm.2_Nonsense_Mutation_p.E45*	p.E600*	NM_031892	NP_114098	WXS	Illumina HiSeq	Unspecified	Q96B97	SH3K1_HUMAN			16	2114	-			600					B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Nonsense_Mutation	SNP	ENST00000397821.3	37	c.1798G>T	CCDS14193.1	.	.	.	.	.	.	.	.	.	.	C	38	7.146587	0.98096	.	.	ENSG00000147010	ENST00000379702;ENST00000397821;ENST00000379716;ENST00000379698;ENST00000541422;ENST00000379726	.	.	.	5.5	5.5	0.81552	.	1.744810	0.02536	N	0.094142	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-11.9616	17.4268	0.87528	0.0:1.0:0.0:0.0	.	.	.	.	X	585;600;362;563;339;580	.	ENSP00000369020:E563X	E	-	1	0	SH3KBP1	19470058	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.472000	0.66768	2.329000	0.79093	0.525000	0.51046	GAG		0.617	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892		15	127	1	0	3.35478e-16	0.003163	5.40312e-16	15	127				
EIF2S3	1968	broad.mit.edu	37	X	24075597	24075597	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:24075597C>T	ENST00000253039.4	+	3	446	c.193C>T	c.(193-195)Cat>Tat	p.H65Y		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	65	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						TTCTGGAGTTCATACTGTCAG	0.348																																							uc004dbc.2		NA																	0				lung(1)	1						c.(193-195)CAT>TAT		eukaryotic translation initiation factor 2,							69.0	66.0	67.0					X																	24075597		2203	4300	6503	SO:0001583	missense	1968					cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity	g.chrX:24075597C>T	L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.193C>T	X.37:g.24075597C>T	ENSP00000253039:p.His65Tyr		Somatic					p.H65Y	NM_001415	NP_001406	WXS	Illumina HiSeq	Unspecified	P41091	IF2G_HUMAN			3	214	+			65					B5BTZ4	Missense_Mutation	SNP	ENST00000253039.4	37	c.193C>T	CCDS14210.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.08|15.08	2.727699|2.727699	0.48833|0.48833	.|.	.|.	ENSG00000130741|ENSG00000130741	ENST00000253039|ENST00000423068	T|.	0.61859|.	0.07|.	5.22|5.22	5.22|5.22	0.72569|0.72569	Protein synthesis factor, GTP-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73179|0.73179	0.3554|0.3554	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	B|.	0.16802|.	0.019|.	B|.	0.23275|.	0.045|.	T|T	0.72040|0.72040	-0.4410|-0.4410	10|5	0.06891|.	T|.	0.86|.	.|.	18.1221|18.1221	0.89574|0.89574	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	65|.	P41091|.	IF2G_HUMAN|.	Y|L	65|64	ENSP00000253039:H65Y|.	ENSP00000253039:H65Y|.	H|S	+|+	1|2	0|0	EIF2S3|EIF2S3	23985518|23985518	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.823000|0.823000	0.46562|0.46562	7.401000|7.401000	0.79962|0.79962	2.303000|2.303000	0.77524|0.77524	0.513000|0.513000	0.50165|0.50165	CAT|TCA		0.348	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056079.1	NM_001415		9	41	0	0	0	0.004482	0	9	41				
POLA1	5422	broad.mit.edu	37	X	24745975	24745975	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:24745975G>T	ENST00000379059.3	+	15	1605	c.1590G>T	c.(1588-1590)aaG>aaT	p.K530N	POLA1_ENST00000493342.1_3'UTR|POLA1_ENST00000379068.3_Missense_Mutation_p.K536N	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	530					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	ATGTAATTAAGGATGTCAGTC	0.408																																							uc004dbl.2		NA																	0				ovary(2)|skin(1)	3						c.(1588-1590)AAG>AAT		DNA-directed DNA polymerase alpha 1	Clofarabine(DB00631)|Fludarabine(DB01073)						143.0	113.0	123.0					X																	24745975		2203	4300	6503	SO:0001583	missense	5422				cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding	g.chrX:24745975G>T		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1590G>T	X.37:g.24745975G>T	ENSP00000368349:p.Lys530Asn		Somatic				POLA1_uc004dbm.2_Missense_Mutation_p.K536N|POLA1_uc004dbn.2_Missense_Mutation_p.K394N	p.K530N	NM_016937	NP_058633	WXS	Illumina HiSeq	Unspecified	P09884	DPOLA_HUMAN			15	1613	+			530					Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	c.1590G>T	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.656559	0.47467	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.08546	3.08;3.08	5.08	0.623	0.17654	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.096626	0.64402	D	0.000001	T	0.11750	0.0286	L	0.45470	1.425	0.58432	D	0.999999	B;P	0.51653	0.425;0.947	B;P	0.53401	0.105;0.725	T	0.12528	-1.0544	10	0.22706	T	0.39	-6.3936	9.1812	0.37143	0.701:0.0:0.299:0.0	.	536;530	A6NMQ1;P09884	.;DPOLA_HUMAN	N	536;530	ENSP00000368358:K536N;ENSP00000368349:K530N	ENSP00000368349:K530N	K	+	3	2	POLA1	24655896	1.000000	0.71417	0.970000	0.41538	0.987000	0.75469	1.805000	0.38883	-0.163000	0.10946	0.513000	0.50165	AAG		0.408	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937		11	32	1	0	1.61879e-10	0.001368	2.32246e-10	11	32				
DCAF8L2	347442	broad.mit.edu	37	X	27765838	27765838	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:27765838C>A	ENST00000451261.2	+	5	1225	c.826C>A	c.(826-828)Cag>Aag	p.Q276K		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	276										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						TAATGTCTTCCAGGCCAAGTT	0.498																																							uc011mjy.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(826-828)CAG>AAG		DDB1 and CUL4 associated factor 8-like 2							190.0	144.0	158.0					X																	27765838		692	1591	2283	SO:0001583	missense	347442							g.chrX:27765838C>A		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.826C>A	X.37:g.27765838C>A	ENSP00000462745:p.Gln276Lys		Somatic					p.Q276K	NM_001136533	NP_001130005	WXS	Illumina HiSeq	Unspecified					1	913	+								B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	c.826C>A	CCDS59162.1																																																																																				0.498	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354		10	14	1	0	1.76689e-08	0.006214	2.39639e-08	10	14				
DMD	1756	broad.mit.edu	37	X	32407680	32407680	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:32407680G>A	ENST00000357033.4	-	32	4662	c.4456C>T	c.(4456-4458)Cct>Tct	p.P1486S	DMD_ENST00000378677.2_Missense_Mutation_p.P1482S	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1486	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCCAATGCAGGCAAGTGCATC	0.413																																							uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.(4456-4458)CCT>TCT		dystrophin Dp427m isoform							205.0	157.0	173.0					X																	32407680		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32407680G>A	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4456C>T	X.37:g.32407680G>A	ENSP00000354923:p.Pro1486Ser		Somatic				DMD_uc004dcw.2_Missense_Mutation_p.P142S|DMD_uc004dcx.2_Missense_Mutation_p.P145S|DMD_uc004dcz.2_Missense_Mutation_p.P1363S|DMD_uc004dcy.1_Missense_Mutation_p.P1482S|DMD_uc004ddb.1_Missense_Mutation_p.P1478S|DMD_uc010ngo.1_Intron	p.P1486S	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			32	4700	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1486			Spectrin 10.|Interaction with SYNM (By similarity).		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.4456C>T	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.056121	0.55325	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.13538	2.58;2.58	5.58	5.58	0.84498	.	0.000000	0.34879	U	0.003611	T	0.26231	0.0640	L	0.51422	1.61	0.80722	D	1	D;P;D;D;D	0.63880	0.993;0.932;0.988;0.97;0.97	P;B;P;P;P	0.60789	0.879;0.445;0.76;0.681;0.681	T	0.03017	-1.1082	10	0.06365	T	0.9	.	18.5631	0.91108	0.0:0.0:1.0:0.0	.	1478;1486;1482;145;142	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	S	1478;145;142;1482;1486;1486;1363	ENSP00000367948:P1482S;ENSP00000354923:P1486S	ENSP00000354923:P1486S	P	-	1	0	DMD	32317601	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.893000	0.75649	2.327000	0.79052	0.594000	0.82650	CCT		0.413	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		23	54	0	0	0	0.00278	0	23	54				
CXorf22	170063	broad.mit.edu	37	X	35969947	35969947	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:35969947A>T	ENST00000297866.5	+	6	979	c.913A>T	c.(913-915)Att>Ttt	p.I305F		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	305										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AAGAACAGATATTGCTTTAAA	0.284																																							uc004ddj.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)	3						c.(913-915)ATT>TTT		hypothetical protein LOC170063							39.0	38.0	38.0					X																	35969947		2183	4244	6427	SO:0001583	missense	170063							g.chrX:35969947A>T	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.913A>T	X.37:g.35969947A>T	ENSP00000297866:p.Ile305Phe		Somatic				CXorf22_uc010ngv.2_RNA	p.I305F	NM_152632	NP_689845	WXS	Illumina HiSeq	Unspecified	Q6ZTR5	CX022_HUMAN			6	972	+			305					Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	c.913A>T	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	A	9.737	1.163819	0.21538	.	.	ENSG00000165164	ENST00000297866	T	0.14266	2.52	5.76	0.19	0.15125	.	0.445221	0.24488	N	0.038098	T	0.10208	0.0250	L	0.57536	1.79	0.35309	D	0.783683	B	0.10296	0.003	B	0.08055	0.003	T	0.37820	-0.9689	10	0.09843	T	0.71	-8.0848	5.4909	0.16774	0.2966:0.0:0.5775:0.1259	.	305	Q6ZTR5	CX022_HUMAN	F	305	ENSP00000297866:I305F	ENSP00000297866:I305F	I	+	1	0	CXorf22	35879868	1.000000	0.71417	0.984000	0.44739	0.532000	0.34746	0.575000	0.23729	-0.450000	0.07107	-0.462000	0.05337	ATT		0.284	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		12	52	0	0	0	0.001368	0	12	52				
MED14	9282	broad.mit.edu	37	X	40562805	40562805	+	Silent	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:40562805T>A	ENST00000324817.1	-	11	1420	c.1302A>T	c.(1300-1302)gcA>gcT	p.A434A		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	434	Interaction with STAT2.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAGCTGGGAGTGCAGTCTCTA	0.338																																							uc004dex.3		NA																	0				breast(2)|kidney(1)|skin(1)	4						c.(1300-1302)GCA>GCT		mediator complex subunit 14							49.0	43.0	45.0					X																	40562805		2203	4300	6503	SO:0001819	synonymous_variant	9282				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:40562805T>A	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.1302A>T	X.37:g.40562805T>A			Somatic					p.A434A	NM_004229	NP_004220	WXS	Illumina HiSeq	Unspecified	O60244	MED14_HUMAN			11	1442	-			434			Interaction with STAT2.		Q4KMR7|Q9UNB3	Silent	SNP	ENST00000324817.1	37	c.1302A>T	CCDS14254.1																																																																																				0.338	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229		12	20	0	0	0	0.001368	0	12	20				
SLC9A7	84679	broad.mit.edu	37	X	46508189	46508189	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:46508189G>T	ENST00000328306.4	-	11	1416	c.1391C>A	c.(1390-1392)tCc>tAc	p.S464Y		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	464					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						GAGGAAGAAGGAGAGCGGGTA	0.463																																					Pancreas(118;454 1696 1930 13865 39976)	Pancreas(118;454 1696 1930 13865 39976)	uc004dgu.1		NA																	0				ovary(2)	2						c.(1390-1392)TCC>TAC		solute carrier family 9, member 7							110.0	90.0	97.0					X																	46508189		2203	4300	6503	SO:0001583	missense	84679				regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity	g.chrX:46508189G>T	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.1391C>A	X.37:g.46508189G>T	ENSP00000330320:p.Ser464Tyr		Somatic					p.S464Y	NM_032591	NP_115980	WXS	Illumina HiSeq	Unspecified	Q96T83	SL9A7_HUMAN			11	1399	-			464					O75827|Q5JXP9	Missense_Mutation	SNP	ENST00000328306.4	37	c.1391C>A	CCDS14269.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544075	0.86022	.	.	ENSG00000065923	ENST00000328306	T	0.16743	2.32	5.64	5.64	0.86602	Cation/H+ exchanger (1);	0.049158	0.85682	D	0.000000	T	0.49779	0.1577	M	0.91300	3.195	0.80722	D	1	P	0.44478	0.836	P	0.57548	0.823	T	0.59553	-0.7433	10	0.87932	D	0	.	18.6796	0.91541	0.0:0.0:1.0:0.0	.	464	Q96T83	SL9A7_HUMAN	Y	464	ENSP00000330320:S464Y	ENSP00000330320:S464Y	S	-	2	0	SLC9A7	46393133	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.350000	0.97070	2.355000	0.79922	0.600000	0.82982	TCC		0.463	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591		28	46	1	0	9.80776e-20	0.00632	1.65521e-19	28	46				
SLC9A7	84679	broad.mit.edu	37	X	46618330	46618330	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:46618330C>A	ENST00000328306.4	-	1	160	c.135G>T	c.(133-135)ggG>ggT	p.G45G		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	45					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						CCGCCGCCGCCCCAGAGGAGG	0.736																																					Pancreas(118;454 1696 1930 13865 39976)	Pancreas(118;454 1696 1930 13865 39976)	uc004dgu.1		NA																	0				ovary(2)	2						c.(133-135)GGG>GGT		solute carrier family 9, member 7							9.0	8.0	9.0					X																	46618330		2179	4258	6437	SO:0001819	synonymous_variant	84679				regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity	g.chrX:46618330C>A	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.135G>T	X.37:g.46618330C>A			Somatic				SLC9A7_uc004dgv.1_Silent_p.G45G	p.G45G	NM_032591	NP_115980	WXS	Illumina HiSeq	Unspecified	Q96T83	SL9A7_HUMAN			1	143	-			45					O75827|Q5JXP9	Silent	SNP	ENST00000328306.4	37	c.135G>T	CCDS14269.1																																																																																				0.736	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591		10	13	1	0	9.31168e-06	0.001855	1.13433e-05	10	13				
RBM10	8241	broad.mit.edu	37	X	47045727	47045727	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:47045727G>T	ENST00000377604.3	+	23	3350	c.2608G>T	c.(2608-2610)Ggc>Tgc	p.G870C	RBM10_ENST00000345781.6_Missense_Mutation_p.G793C|RBM10_ENST00000329236.7_Missense_Mutation_p.G792C	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	870	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GCAGGCCATGGGCTGGAAAGA	0.637																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	0				ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.(2608-2610)GGC>TGC		RNA binding motif protein 10 isoform 1							52.0	51.0	51.0					X																	47045727		2197	4293	6490	SO:0001583	missense	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47045727G>T	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.2608G>T	X.37:g.47045727G>T	ENSP00000366829:p.Gly870Cys		Somatic				RBM10_uc004dhg.2_Missense_Mutation_p.G792C|RBM10_uc004dhh.2_Missense_Mutation_p.G869C|RBM10_uc010nhq.2_Missense_Mutation_p.G793C|RBM10_uc004dhi.2_Missense_Mutation_p.G935C	p.G870C	NM_005676	NP_005667	WXS	Illumina HiSeq	Unspecified	P98175	RBM10_HUMAN			23	2987	+			870			G-patch.		C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	37	c.2608G>T	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406440	0.83230	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	D;D;D	0.99270	-5.66;-5.66;-5.66	5.53	5.53	0.82687	D111/G-patch (3);	0.000000	0.64402	D	0.000018	D	0.99750	0.9900	H	0.99689	4.705	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.999;1.0;1.0;1.0	D	0.96865	0.9635	10	0.87932	D	0	-25.339	16.0209	0.80493	0.0:0.0:1.0:0.0	.	793;935;869;792;870	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	C	870;792;793	ENSP00000366829:G870C;ENSP00000328848:G792C;ENSP00000329659:G793C	ENSP00000328848:G792C	G	+	1	0	RBM10	46930671	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.705000	0.84606	2.471000	0.83476	0.600000	0.82982	GGC		0.637	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676		6	7	1	0	2.0095e-06	0.001984	2.51187e-06	6	7				
SYN1	6853	broad.mit.edu	37	X	47466576	47466576	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:47466576T>A	ENST00000295987.7	-	2	523	c.399A>T	c.(397-399)aaA>aaT	p.K133N	SYN1_ENST00000340666.4_Missense_Mutation_p.K133N	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	133	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						CATGGATCTTTTTCCCTTTGA	0.428																																							uc004die.2		NA																	0				ovary(1)	1						c.(397-399)AAA>AAT		synapsin I isoform Ia							199.0	167.0	178.0					X																	47466576		2203	4300	6503	SO:0001583	missense	6853					cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity	g.chrX:47466576T>A		CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.399A>T	X.37:g.47466576T>A	ENSP00000295987:p.Lys133Asn		Somatic				SYN1_uc004did.2_Missense_Mutation_p.K133N	p.K133N	NM_006950	NP_008881	WXS	Illumina HiSeq	Unspecified	P17600	SYN1_HUMAN			2	528	-			133			C; actin-binding and synaptic-vesicle binding.		B1AJQ1|O75825|Q5H9A9	Missense_Mutation	SNP	ENST00000295987.7	37	c.399A>T	CCDS14280.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.040903	0.75732	.	.	ENSG00000008056	ENST00000295987;ENST00000340666	T;T	0.42900	1.45;0.96	5.96	3.28	0.37604	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Synapsin, pre-ATP-grasp domain (1);	0.068892	0.64402	D	0.000018	T	0.54967	0.1891	M	0.62154	1.92	0.47905	D	0.999545	D;D	0.89917	1.0;0.998	D;D	0.80764	0.994;0.913	T	0.54523	-0.8281	10	0.87932	D	0	-7.3352	5.4712	0.16670	0.0:0.4983:0.0:0.5017	.	133;133	P17600;P17600-2	SYN1_HUMAN;.	N	133	ENSP00000295987:K133N;ENSP00000343206:K133N	ENSP00000295987:K133N	K	-	3	2	SYN1	47351520	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	0.283000	0.18846	0.714000	0.32081	0.481000	0.45027	AAA		0.428	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056445.1	NM_006950		16	28	0	0	0	0.00499	0	16	28				
CCDC120	90060	broad.mit.edu	37	X	48920062	48920062	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:48920062G>C	ENST00000376396.3	+	4	332	c.113G>C	c.(112-114)cGg>cCg	p.R38P	CCDC120_ENST00000536628.2_Missense_Mutation_p.R26P|CCDC120_ENST00000597275.1_Missense_Mutation_p.R38P|CCDC120_ENST00000422185.2_Missense_Mutation_p.R38P|CCDC120_ENST00000603986.1_Missense_Mutation_p.R73P|CCDC120_ENST00000496529.2_Missense_Mutation_p.R38P	NM_001271835.1|NM_001271836.1|NM_033626.2	NP_001258764.1|NP_001258765.1|NP_296375.1	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	38										breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14						CTGCTTGACCGGCAGCGGACC	0.652																																							uc010nik.2		NA																	0				pancreas(1)	1						c.(112-114)CGG>CCG		coiled-coil domain containing 120 isoform 3							19.0	20.0	19.0					X																	48920062		2201	4297	6498	SO:0001583	missense	90060						protein binding	g.chrX:48920062G>C	BC008769	CCDS14316.1, CCDS55413.1, CCDS55414.1, CCDS55414.2	Xp11.23	2008-02-05			ENSG00000147144	ENSG00000147144			28910	protein-coding gene	gene with protein product						12477932	Standard	NM_033626		Approved	JM11	uc011mmr.3	Q96HB5	OTTHUMG00000021509	ENST00000376396.3:c.113G>C	X.37:g.48920062G>C	ENSP00000365577:p.Arg38Pro		Somatic				CCDC120_uc011mmq.1_Missense_Mutation_p.R26P|CCDC120_uc004dmf.2_Missense_Mutation_p.R38P|CCDC120_uc010nil.2_Missense_Mutation_p.R38P|CCDC120_uc011mmr.1_Missense_Mutation_p.R38P|CCDC120_uc011mms.1_Missense_Mutation_p.R26P|CCDC120_uc004dmg.1_3'UTR	p.R38P	NM_033626	NP_296375	WXS	Illumina HiSeq	Unspecified	Q96HB5	CC120_HUMAN			4	620	+			38					B4DFC1|B4DTU2|F5GZU4	Missense_Mutation	SNP	ENST00000376396.3	37	c.113G>C	CCDS14316.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406640	0.62399	.	.	ENSG00000147144	ENST00000376396;ENST00000422185;ENST00000536628	.	.	.	5.64	4.77	0.60923	.	0.251904	0.28431	N	0.015369	T	0.57917	0.2086	L	0.60067	1.865	0.37672	D	0.923181	P;D;D;P	0.56287	0.927;0.975;0.975;0.927	P;P;P;P	0.56788	0.737;0.737;0.806;0.737	T	0.65857	-0.6066	9	0.72032	D	0.01	-7.7159	4.7621	0.13113	0.1711:0.1883:0.6406:0.0	.	26;73;26;38	B4DTU2;B4DFC1;B4DF24;Q96HB5	.;.;.;CC120_HUMAN	P	38;38;26	.	ENSP00000365577:R38P	R	+	2	0	CCDC120	48807006	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	2.584000	0.46102	2.374000	0.81015	0.529000	0.55759	CGG		0.652	CCDC120-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056528.1	NM_033626		21	34	0	0	0	0.001523	0	21	34				
WDR45	11152	broad.mit.edu	37	X	48933220	48933220	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:48933220G>C	ENST00000376372.3	-	8	890	c.709C>G	c.(709-711)Cct>Gct	p.P237A	WDR45_ENST00000553851.1_Missense_Mutation_p.P135A|PRAF2_ENST00000376386.3_5'Flank|WDR45_ENST00000473974.1_Missense_Mutation_p.P237A|WDR45_ENST00000396681.4_Missense_Mutation_p.P237A|PRAF2_ENST00000376390.4_5'Flank|WDR45_ENST00000376368.2_Missense_Mutation_p.P238A|PRAF2_ENST00000491199.1_5'Flank|WDR45_ENST00000322995.8_Missense_Mutation_p.P248A|WDR45_ENST00000356463.3_Missense_Mutation_p.P238A|AF196779.12_ENST00000376358.3_Missense_Mutation_p.P135A|WDR45_ENST00000465431.1_5'Flank|WDR45_ENST00000485908.1_Missense_Mutation_p.P202A	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	237					autophagy (GO:0006914)|cell death (GO:0008219)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						AGGGTGGCAGGGTCAGTGCCT	0.557																																							uc004dmk.1		NA																	0				ovary(1)	1						c.(709-711)CCT>GCT		WD repeat domain 45 isoform 2							76.0	62.0	67.0					X																	48933220		2203	4300	6503	SO:0001583	missense	11152				autophagy|response to starvation	organelle membrane	phosphatidylinositol-3,5-bisphosphate binding	g.chrX:48933220G>C	BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.709C>G	X.37:g.48933220G>C	ENSP00000365551:p.Pro237Ala		Somatic				PRAF2_uc004dmh.2_5'Flank|PRAF2_uc004dmi.2_5'Flank|PRAF2_uc011mmt.1_Missense_Mutation_p.P135A|WDR45_uc004dmj.1_Missense_Mutation_p.P198A|WDR45_uc004dml.1_Missense_Mutation_p.P238A|WDR45_uc004dmm.1_Missense_Mutation_p.P202A|WDR45_uc010nim.1_Missense_Mutation_p.P237A|WDR45_uc004dmn.1_Missense_Mutation_p.P128A|WDR45_uc004dmo.1_Missense_Mutation_p.P260A|WDR45_uc004dmp.1_Missense_Mutation_p.P238A	p.P237A	NM_001029896	NP_001025067	WXS	Illumina HiSeq	Unspecified	Q9Y484	WIPI4_HUMAN			8	881	-			237			WD 3.		A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Missense_Mutation	SNP	ENST00000376372.3	37	c.709C>G	CCDS35250.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.35|12.35	1.912903|1.912903	0.33815|0.33815	.|.	.|.	ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000250232|ENSG00000196998	ENST00000553851;ENST00000376372;ENST00000322995;ENST00000356463;ENST00000485908;ENST00000473974;ENST00000376368;ENST00000396681;ENST00000475977;ENST00000376358|ENST00000367375	T;T;T;T;T;T;T;T;T;T|.	0.73363|.	-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;0.54;-0.3;-0.74|.	3.54|3.54	2.67|2.67	0.31697|0.31697	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.61350|0.61350	0.2340|0.2340	L|L	0.61036|0.61036	1.89|1.89	0.48395|0.48395	D|D	0.999644|0.999644	D;P;P;D;P;P|.	0.65815|.	0.982;0.952;0.926;0.995;0.73;0.465|.	P;P;P;D;P;B|.	0.66602|.	0.869;0.729;0.793;0.945;0.624;0.159|.	T|T	0.57447|0.57447	-0.7810|-0.7810	10|6	0.30078|.	T|.	0.28|.	-11.2565|-11.2565	9.8293|9.8293	0.40932|0.40932	0.1128:0.0:0.8872:0.0|0.1128:0.0:0.8872:0.0	.|.	135;237;248;202;238;237|.	A6NM71;C9J471;Q9Y484-2;C9JYH8;Q9Y484-3;Q9Y484|.	.;.;.;.;.;WIPI4_HUMAN|.	A|R	135;237;248;238;202;237;238;237;65;135|163	ENSP00000451962:P135A;ENSP00000365551:P237A;ENSP00000365543:P248A;ENSP00000348848:P238A;ENSP00000419897:P202A;ENSP00000417211:P237A;ENSP00000365546:P238A;ENSP00000379913:P237A;ENSP00000417754:P65A;ENSP00000365536:P135A|.	ENSP00000365536:P135A|.	P|P	-|-	1|2	0|0	AF196779.12;WDR45|WDR45	48820164|48820164	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.948000|0.948000	0.59901|0.59901	7.264000|7.264000	0.78432|0.78432	0.634000|0.634000	0.30469|0.30469	0.409000|0.409000	0.27619|0.27619	CCT|CCC		0.557	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083418.2	NM_007075		17	40	0	0	0	0.008871	0	17	40				
CACNA1F	778	broad.mit.edu	37	X	49068426	49068426	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:49068426C>A	ENST00000376265.2	-	35	4126	c.4065G>T	c.(4063-4065)caG>caT	p.Q1355H	CACNA1F_ENST00000323022.5_Missense_Mutation_p.Q1344H|CACNA1F_ENST00000376251.1_Missense_Mutation_p.Q1290H	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1355					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GTGTGCCATCCTGAAGAGCCA	0.517																																							uc004dnb.2		NA																	0				breast(3)|ovary(1)|kidney(1)|skin(1)	6						c.(4063-4065)CAG>CAT		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						223.0	135.0	165.0					X																	49068426		2203	4300	6503	SO:0001583	missense	778				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chrX:49068426C>A	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4065G>T	X.37:g.49068426C>A	ENSP00000365441:p.Gln1355His		Somatic				CACNA1F_uc010nip.2_Missense_Mutation_p.Q1344H	p.Q1355H	NM_005183	NP_005174	WXS	Illumina HiSeq	Unspecified	O60840	CAC1F_HUMAN			35	4127	-			1355			Extracellular (Potential).|IV.		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	c.4065G>T	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.264054	0.39995	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.98550	-4.99;-4.99;-4.99	5.05	4.19	0.49359	Ion transport (1);	0.240515	0.42682	D	0.000665	D	0.97501	0.9182	L	0.37697	1.125	0.49915	D	0.999831	D;D	0.71674	0.995;0.998	P;D	0.75020	0.885;0.985	D	0.96285	0.9209	10	0.52906	T	0.07	.	6.6885	0.23158	0.0:0.7065:0.0:0.2935	.	1344;1355	F5CIQ9;O60840	.;CAC1F_HUMAN	H	1290;1344;1355	ENSP00000365427:Q1290H;ENSP00000321618:Q1344H;ENSP00000365441:Q1355H	ENSP00000321618:Q1344H	Q	-	3	2	CACNA1F	48955370	0.148000	0.22702	1.000000	0.80357	0.998000	0.95712	-0.058000	0.11750	0.898000	0.36418	0.600000	0.82982	CAG		0.517	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183		24	49	1	0	7.41945e-09	0.005443	1.01865e-08	24	49				
SHROOM4	57477	broad.mit.edu	37	X	50350926	50350926	+	Silent	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:50350926G>A	ENST00000289292.7	-	6	3499	c.3216C>T	c.(3214-3216)gcC>gcT	p.A1072A	SHROOM4_ENST00000460112.3_Silent_p.A956A|SHROOM4_ENST00000376020.2_Silent_p.A1072A			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1072					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GCTGCCCCCAGGCCCGGGTGC	0.617																																							uc004dpe.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(3214-3216)GCC>GCT		shroom family member 4							37.0	35.0	36.0					X																	50350926		2203	4300	6503	SO:0001819	synonymous_variant	57477				actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding	g.chrX:50350926G>A	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3216C>T	X.37:g.50350926G>A			Somatic				SHROOM4_uc004dpd.3_RNA	p.A1072A	NM_020717	NP_065768	WXS	Illumina HiSeq	Unspecified	Q9ULL8	SHRM4_HUMAN			6	3242	-	Ovarian(276;0.236)		1072					A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	c.3216C>T	CCDS35277.1																																																																																				0.617	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717		24	44	0	0	0	0.00333	0	24	44				
HUWE1	10075	broad.mit.edu	37	X	53577916	53577916	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:53577916G>C	ENST00000342160.3	-	64	9788	c.9331C>G	c.(9331-9333)Cgt>Ggt	p.R3111G	HUWE1_ENST00000262854.6_Missense_Mutation_p.R3111G|HUWE1_ENST00000474288.1_5'Flank			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3111					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CCAAACAGACGCTCATGCATG	0.582																																							uc004dsp.2		NA																	0				ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(9331-9333)CGT>GGT		HECT, UBA and WWE domain containing 1							63.0	46.0	51.0					X																	53577916		2203	4300	6503	SO:0001583	missense	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53577916G>C	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9331C>G	X.37:g.53577916G>C	ENSP00000340648:p.Arg3111Gly		Somatic				HUWE1_uc004dsn.2_Missense_Mutation_p.R1919G	p.R3111G	NM_031407	NP_113584	WXS	Illumina HiSeq	Unspecified	Q7Z6Z7	HUWE1_HUMAN			65	9733	-			3111					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	c.9331C>G	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.35|13.35	2.211667|2.211667	0.39102|0.39102	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.46451	.|0.87;0.87	5.88|5.88	4.95|4.95	0.65309|0.65309	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.58906|0.58906	0.2155|0.2155	L|L	0.53249|0.53249	1.67|1.67	0.53005|0.53005	D|D	0.999962|0.999962	.|D;D	.|0.63046	.|0.987;0.992	.|D;D	.|0.72982	.|0.953;0.979	T|T	0.61053|0.61053	-0.7140|-0.7140	5|10	.|0.72032	.|D	.|0.01	.|.	14.3491|14.3491	0.66688|0.66688	0.0:0.0:0.8199:0.1801|0.0:0.0:0.8199:0.1801	.|.	.|3111;3095	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	G|G	2144|3111	.|ENSP00000340648:R3111G;ENSP00000262854:R3111G	.|ENSP00000262854:R3111G	A|R	-|-	2|1	0|0	HUWE1|HUWE1	53594641|53594641	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.009000|3.009000	0.49552|0.49552	2.489000|2.489000	0.83994|0.83994	0.600000|0.600000	0.82982|0.82982	GCG|CGT		0.582	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		6	60	0	0	0	0.001168	0	6	60				
FGD1	2245	broad.mit.edu	37	X	54482964	54482964	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:54482964G>A	ENST00000375135.3	-	9	2406	c.1673C>T	c.(1672-1674)tCg>tTg	p.S558L		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	558	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GGCAGCATTCGAGTGCTCTGC	0.602																																							uc004dtg.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1672-1674)TCG>TTG		faciogenital dysplasia protein							59.0	45.0	50.0					X																	54482964		2203	4300	6503	SO:0001583	missense	2245				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chrX:54482964G>A	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1673C>T	X.37:g.54482964G>A	ENSP00000364277:p.Ser558Leu		Somatic				FGD1_uc011moi.1_Missense_Mutation_p.S316L	p.S558L	NM_004463	NP_004454	WXS	Illumina HiSeq	Unspecified	P98174	FGD1_HUMAN			9	2407	-			558			DH.		Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	c.1673C>T	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517879	0.85495	.	.	ENSG00000102302	ENST00000375135	T	0.61627	0.09	4.51	4.51	0.55191	Dbl homology (DH) domain (5);	0.000000	0.48286	D	0.000182	T	0.69878	0.3160	L	0.54908	1.71	0.50039	D	0.999842	D;D	0.62365	0.991;0.98	D;P	0.64877	0.93;0.782	T	0.73889	-0.3840	10	0.87932	D	0	-6.9993	15.352	0.74396	0.0:0.0:1.0:0.0	.	316;558	B4DS99;P98174	.;FGD1_HUMAN	L	558	ENSP00000364277:S558L	ENSP00000364277:S558L	S	-	2	0	FGD1	54499689	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.426000	0.97469	2.219000	0.72066	0.513000	0.50165	TCG		0.602	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463		4	46	0	0	0	0.001168	0	4	46				
AMER1	139285	broad.mit.edu	37	X	63410715	63410715	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:63410715C>A	ENST00000330258.3	-	2	2724	c.2452G>T	c.(2452-2454)Ggg>Tgg	p.G818W	AMER1_ENST00000403336.1_Intron|AMER1_ENST00000374869.3_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	818					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TTGCCTTCCCCATCCCGTTCC	0.507																																							uc004dvo.2		NA																	67	Whole gene deletion(67)	p.0?(40)	kidney(65)|ovary(1)|large_intestine(1)	kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						c.(2452-2454)GGG>TGG		family with sequence similarity 123B							44.0	42.0	43.0					X																	63410715		2200	4299	6499	SO:0001583	missense	139285				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		g.chrX:63410715C>A	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2452G>T	X.37:g.63410715C>A	ENSP00000329117:p.Gly818Trp		Somatic					p.G818W	NM_152424	NP_689637	WXS	Illumina HiSeq	Unspecified	Q5JTC6	F123B_HUMAN			2	2725	-			818					A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	c.2452G>T	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	15.06	2.722375	0.48728	.	.	ENSG00000184675	ENST00000330258	T	0.70749	-0.51	5.0	5.0	0.66597	.	.	.	.	.	T	0.66257	0.2771	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.64972	-0.6281	8	.	.	.	-6.5176	9.9247	0.41485	0.0:0.9044:0.0:0.0956	.	818	Q5JTC6	F123B_HUMAN	W	818	ENSP00000329117:G818W	.	G	-	1	0	FAM123B	63327440	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.118000	0.57884	2.484000	0.83849	0.529000	0.55759	GGG		0.507	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		12	38	1	0	9.05144e-12	0.001855	1.33873e-11	12	38				
VSIG4	11326	broad.mit.edu	37	X	65242194	65242194	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:65242194C>T	ENST00000374737.4	-	8	1219	c.1111G>A	c.(1111-1113)Gcc>Acc	p.A371T	VSIG4_ENST00000412866.2_Missense_Mutation_p.A277T|VSIG4_ENST00000455586.2_3'UTR	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	371					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A371T(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTGATCTGGGCGATGATCTGG	0.517																																							uc004dwh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1111-1113)GCC>ACC		V-set and immunoglobulin domain containing 4							103.0	78.0	86.0					X																	65242194		2203	4300	6503	SO:0001583	missense	11326				complement activation, alternative pathway	integral to membrane	protein binding	g.chrX:65242194C>T	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.1111G>A	X.37:g.65242194C>T	ENSP00000363869:p.Ala371Thr		Somatic				VSIG4_uc004dwi.2_Missense_Mutation_p.A277T|VSIG4_uc010nkq.1_3'UTR|VSIG4_uc004dwj.2_3'UTR|VSIG4_uc011moy.1_3'UTR|VSIG4_uc004dwk.2_3'UTR|VSIG4_uc004dwl.2_Intron	p.A371T	NM_007268	NP_009199	WXS	Illumina HiSeq	Unspecified	Q9Y279	VSIG4_HUMAN			8	1238	-			371			Cytoplasmic (Potential).		Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	37	c.1111G>A	CCDS14383.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.958894	0.00465	.	.	ENSG00000155659	ENST00000374737;ENST00000412866	T;T	0.23552	1.9;2.27	4.4	-8.79	0.00820	.	1.030490	0.07735	N	0.945929	T	0.05731	0.0150	N	0.00707	-1.245	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.40850	-0.9541	10	0.02654	T	1	-0.0507	13.8978	0.63783	0.0:0.6967:0.0:0.3033	.	277;371	Q9Y279-3;Q9Y279	.;VSIG4_HUMAN	T	371;277	ENSP00000363869:A371T;ENSP00000394143:A277T	ENSP00000363869:A371T	A	-	1	0	VSIG4	65158919	0.061000	0.20836	0.000000	0.03702	0.039000	0.13416	-1.908000	0.01587	-2.560000	0.00474	-0.305000	0.09177	GCC		0.517	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268		26	45	0	0	0	0.004656	0	26	45				
HEPH	9843	broad.mit.edu	37	X	65427105	65427105	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:65427105G>C	ENST00000343002.2	+	13	3024	c.2360G>C	c.(2359-2361)aGg>aCg	p.R787T	HEPH_ENST00000419594.1_Missense_Mutation_p.R598T|HEPH_ENST00000336279.5_Missense_Mutation_p.R520T|HEPH_ENST00000519389.1_Missense_Mutation_p.R841T|HEPH_ENST00000374727.3_Missense_Mutation_p.R790T|HEPH_ENST00000441993.2_Missense_Mutation_p.R790T			Q9BQS7	HEPH_HUMAN	hephaestin	787	Plastocyanin-like 5.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						GCTGTATTCAGGGAATACACT	0.463																																							uc011moz.1		NA																	0				lung(5)|ovary(4)	9						c.(2368-2370)AGG>ACG		hephaestin isoform a							125.0	103.0	111.0					X																	65427105		2203	4300	6503	SO:0001583	missense	9843				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity	g.chrX:65427105G>C	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.2360G>C	X.37:g.65427105G>C	ENSP00000343939:p.Arg787Thr		Somatic				HEPH_uc004dwn.2_Missense_Mutation_p.R790T|HEPH_uc004dwo.2_Missense_Mutation_p.R520T|HEPH_uc010nkr.2_Missense_Mutation_p.R598T|HEPH_uc011mpa.1_Missense_Mutation_p.R790T|HEPH_uc010nks.2_Missense_Mutation_p.R79T	p.R790T	NM_138737	NP_620074	WXS	Illumina HiSeq	Unspecified	Q9BQS7	HEPH_HUMAN			14	2429	+			787			Extracellular (Potential).|Plastocyanin-like 5.		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37	c.2369G>C		.	.	.	.	.	.	.	.	.	.	G	19.94	3.920056	0.73098	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.99167	-5.51;-5.51;-5.51;-5.51;-5.51;-5.51;-5.51	4.85	4.85	0.62838	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.98991	0.9656	M	0.63843	1.955	0.35690	D	0.814763	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.91635	0.964;0.989;0.978;0.999	D	0.99968	1.1915	10	0.45353	T	0.12	.	15.5895	0.76517	0.0:0.0:1.0:0.0	.	841;187;598;787	E9PHN8;B4DFV3;E7ES21;Q9BQS7	.;.;.;HEPH_HUMAN	T	841;790;520;790;598;787;744	ENSP00000430620:R841T;ENSP00000363859:R790T;ENSP00000337418:R520T;ENSP00000411687:R790T;ENSP00000413211:R598T;ENSP00000343939:R787T;ENSP00000398078:R744T	ENSP00000337418:R520T	R	+	2	0	HEPH	65343830	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.860000	0.92272	2.244000	0.73946	0.544000	0.68410	AGG		0.463	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737		22	51	0	0	0	0.002299	0	22	51				
STARD8	9754	broad.mit.edu	37	X	67937571	67937571	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:67937571C>G	ENST00000252336.6	+	5	947	c.575C>G	c.(574-576)gCc>gGc	p.A192G	STARD8_ENST00000374599.3_Missense_Mutation_p.A272G|STARD8_ENST00000374597.3_Missense_Mutation_p.A192G	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	192					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						GGCAGTGGTGCCAATACTCGG	0.622																																							uc004dxa.2		NA																	0				breast(3)|ovary(2)|pancreas(1)	6						c.(574-576)GCC>GGC		StAR-related lipid transfer (START) domain							44.0	39.0	41.0					X																	67937571		2203	4300	6503	SO:0001583	missense	9754				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity	g.chrX:67937571C>G	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.575C>G	X.37:g.67937571C>G	ENSP00000252336:p.Ala192Gly		Somatic				STARD8_uc004dxb.2_Missense_Mutation_p.A272G|STARD8_uc004dxc.3_Missense_Mutation_p.A192G	p.A192G	NM_014725	NP_055540	WXS	Illumina HiSeq	Unspecified	Q92502	STAR8_HUMAN			5	947	+			192					A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	ENST00000252336.6	37	c.575C>G	CCDS14390.1	.	.	.	.	.	.	.	.	.	.	c	0.028	-1.357420	0.01245	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.08102	3.13;3.14;3.13	3.9	0.833	0.18875	.	1.672750	0.03071	N	0.157222	T	0.03434	0.0099	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.37641	-0.9697	10	0.15499	T	0.54	.	1.2597	0.01999	0.2239:0.4066:0.2312:0.1384	.	272;192	Q92502-2;Q92502	.;STAR8_HUMAN	G	192;272;192	ENSP00000252336:A192G;ENSP00000363727:A272G;ENSP00000363725:A192G	ENSP00000252336:A192G	A	+	2	0	STARD8	67854296	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.351000	0.20096	0.211000	0.20683	0.597000	0.82753	GCC		0.622	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		27	58	0	0	0	0.00632	0	27	58				
FOXO4	4303	broad.mit.edu	37	X	70321242	70321243	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:70321242_70321243CC>AA	ENST00000374259.3	+	2	1494_1495	c.1162_1163CC>AA	c.(1162-1164)CCc>AAc	p.P388N	FOXO4_ENST00000341558.3_Missense_Mutation_p.P333N	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	388					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					CCAGGTAGATCCCATTCTGTCC	0.634																																							uc004dys.1		NA																	0				central_nervous_system(2)|prostate(1)	3						c.(1162-1164)CCC>AAC		forkhead box O4																																				SO:0001583	missense	4303				cell cycle arrest|cell differentiation|embryo development|G1 phase of mitotic cell cycle|insulin receptor signaling pathway|mitotic cell cycle G2/M transition DNA damage checkpoint|muscle organ development|negative regulation of angiogenesis|negative regulation of cell proliferation|negative regulation of smooth muscle cell differentiation|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chrX:70321242_70321243CC>AA		CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	Exception_encountered	X.37:g.70321242_70321243delinsAA	ENSP00000363377:p.Pro388Asn		Somatic				FOXO4_uc010nkz.2_Intron|FOXO4_uc004dyt.1_Missense_Mutation_p.P333N	p.P388N	NM_005938	NP_005929	WXS	Illumina HiSeq	Unspecified	P98177	FOXO4_HUMAN			2	1515_1516	+	Renal(35;0.156)		388					B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Missense_Mutation	DNP	ENST00000374259.3	37	c.1162_1163CC>AA	CCDS43969.1																																																																																				0.634	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057115.1	NM_005938		21	67	0	0	0	0.004672	0	21	67				
MED12	9968	broad.mit.edu	37	X	70345560	70345560	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:70345560T>G	ENST00000374080.3	+	17	2451	c.2419T>G	c.(2419-2421)Tta>Gta	p.L807V	MED12_ENST00000374102.1_Missense_Mutation_p.L807V|MED12_ENST00000333646.6_Missense_Mutation_p.L807V			Q93074	MED12_HUMAN	mediator complex subunit 12	807					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CCTGACATTCTTAGGTACCTC	0.527			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(2419-2421)TTA>GTA		mediator complex subunit 12							159.0	133.0	142.0					X																	70345560		2010	4171	6181	SO:0001583	missense	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70345560T>G	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.2419T>G	X.37:g.70345560T>G	ENSP00000363193:p.Leu807Val		Somatic				MED12_uc011mpq.1_Missense_Mutation_p.L807V|MED12_uc004dyz.2_Missense_Mutation_p.L807V|MED12_uc004dza.2_Missense_Mutation_p.L654V	p.L807V	NM_005120	NP_005111	WXS	Illumina HiSeq	Unspecified	Q93074	MED12_HUMAN			17	2618	+	Renal(35;0.156)		807					O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	c.2419T>G	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	1.291	-0.607653	0.03717	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	4.31	3.04	0.35103	.	0.653723	0.14127	N	0.339586	T	0.46014	0.1371	N	0.02011	-0.69	0.27965	N	0.936615	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.001	T	0.38950	-0.9637	10	0.10377	T	0.69	-5.6801	5.7577	0.18182	0.2413:0.0:0.0:0.7587	.	807;654;807;807	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	V	807;807;807;807;775	ENSP00000333125:L807V;ENSP00000363215:L807V;ENSP00000363193:L807V;ENSP00000414203:L775V	ENSP00000333125:L807V	L	+	1	2	MED12	70262285	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.093000	0.41710	1.717000	0.51406	0.376000	0.23039	TTA		0.527	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		14	68	0	0	0	0.004007	0	14	68				
CDX4	1046	broad.mit.edu	37	X	72667506	72667506	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:72667506G>T	ENST00000373514.2	+	1	417	c.417G>T	c.(415-417)acG>acT	p.T139T		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	139					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					TTGTCCCGACGGACGCAGGCG	0.657																																							uc011mqk.1		NA																	0					0						c.(415-417)ACG>ACT		caudal type homeobox 4							17.0	17.0	17.0					X																	72667506		2193	4276	6469	SO:0001819	synonymous_variant	1046					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:72667506G>T	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.417G>T	X.37:g.72667506G>T			Somatic					p.T139T	NM_005193	NP_005184	WXS	Illumina HiSeq	Unspecified	O14627	CDX4_HUMAN			1	417	+	Renal(35;0.156)		139					A1A513|Q5JS20	Silent	SNP	ENST00000373514.2	37	c.417G>T	CCDS14424.1																																																																																				0.657	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057229.2	NM_005193		15	29	1	0	1.3612e-06	0.003163	1.71108e-06	15	29				
LPAR4	2846	broad.mit.edu	37	X	78010848	78010848	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:78010848G>A	ENST00000435339.3	+	2	868	c.482G>A	c.(481-483)gGt>gAt	p.G161D		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	161					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						GTGTGTGCTGGTGTCTGGATC	0.458																																							uc010nme.2		NA																	0				ovary(3)	3						c.(481-483)GGT>GAT		lysophosphatidic acid receptor 4							168.0	113.0	132.0					X																	78010848		2203	4300	6503	SO:0001583	missense	2846					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78010848G>A	U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.482G>A	X.37:g.78010848G>A	ENSP00000408205:p.Gly161Asp		Somatic					p.G161D	NM_005296	NP_005287	WXS	Illumina HiSeq	Unspecified	Q99677	LPAR4_HUMAN			2	887	+			161			Helical; Name=4; (Potential).		B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	c.482G>A	CCDS14441.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095188	0.56075	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.39787	1.06;1.06	4.21	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.208092	0.41097	D	0.000957	T	0.61540	0.2355	M	0.81341	2.54	0.43756	D	0.996267	D	0.53619	0.961	P	0.58577	0.841	T	0.68625	-0.5359	10	0.66056	D	0.02	.	14.3969	0.67018	0.0:0.0:1.0:0.0	.	161	Q99677	LPAR4_HUMAN	D	161	ENSP00000408205:G161D;ENSP00000362398:G161D	ENSP00000362398:G161D	G	+	2	0	LPAR4	77897504	1.000000	0.71417	0.997000	0.53966	0.902000	0.53008	4.402000	0.59722	1.943000	0.56356	0.422000	0.28245	GGT		0.458	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296		40	93	0	0	0	0.005524	0	40	93				
KLHL4	56062	broad.mit.edu	37	X	86872999	86872999	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:86872999G>T	ENST00000373119.4	+	4	937	c.792G>T	c.(790-792)ctG>ctT	p.L264L	KLHL4_ENST00000373114.4_Silent_p.L264L	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	264						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						TTCTGCAGCTGACTCAGGTCA	0.418																																							uc004efb.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(790-792)CTG>CTT		kelch-like 4 isoform 1							95.0	78.0	84.0					X																	86872999		2203	4300	6503	SO:0001819	synonymous_variant	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86872999G>T	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.792G>T	X.37:g.86872999G>T			Somatic				KLHL4_uc004efa.2_Silent_p.L264L	p.L264L	NM_019117	NP_061990	WXS	Illumina HiSeq	Unspecified	Q9C0H6	KLHL4_HUMAN			4	974	+			264					B2RTW2|Q9Y3J5	Silent	SNP	ENST00000373119.4	37	c.792G>T	CCDS14457.1																																																																																				0.418	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			16	52	1	0	0.00074312	0.006122	0.000848195	16	52				
PCDH11X	27328	broad.mit.edu	37	X	91132041	91132041	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:91132041G>A	ENST00000373094.1	+	2	1647	c.802G>A	c.(802-804)Gtg>Atg	p.V268M	PCDH11X_ENST00000406881.1_Missense_Mutation_p.V268M|PCDH11X_ENST00000361724.1_Missense_Mutation_p.V268M|PCDH11X_ENST00000395337.2_Missense_Mutation_p.V268M|PCDH11X_ENST00000373097.1_Missense_Mutation_p.V268M|PCDH11X_ENST00000298274.8_Missense_Mutation_p.V268M|PCDH11X_ENST00000504220.2_Missense_Mutation_p.V268M|PCDH11X_ENST00000361655.2_Missense_Mutation_p.V268M|PCDH11X_ENST00000373088.1_Missense_Mutation_p.V268M	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	268	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AGGCACTTCAGTGACACAGCT	0.428																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(802-804)GTG>ATG		protocadherin 11 X-linked isoform c							35.0	32.0	33.0					X																	91132041		2202	4277	6479	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91132041G>A	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.802G>A	X.37:g.91132041G>A	ENSP00000362186:p.Val268Met		Somatic				PCDH11X_uc004efl.1_Missense_Mutation_p.V268M|PCDH11X_uc004efo.1_Missense_Mutation_p.V268M|PCDH11X_uc010nmv.1_Missense_Mutation_p.V268M|PCDH11X_uc004efm.1_Missense_Mutation_p.V268M|PCDH11X_uc004efn.1_Missense_Mutation_p.V268M|PCDH11X_uc004efh.1_Missense_Mutation_p.V268M|PCDH11X_uc004efj.1_Missense_Mutation_p.V268M	p.V268M	NM_032968	NP_116750	WXS	Illumina HiSeq	Unspecified	Q9BZA7	PC11X_HUMAN			2	1647	+			268			Extracellular (Potential).|Cadherin 3.		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.802G>A	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124447	0.77436	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	4.63	4.63	0.57726	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.82273	0.5001	M	0.79805	2.47	0.58432	D	0.999994	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.997;1.0;1.0;1.0;1.0;1.0;1.0	D	0.85560	0.1227	10	0.87932	D	0	.	15.613	0.76740	0.0:0.0:1.0:0.0	.	268;268;268;268;268;268;268;268	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	M	268	ENSP00000378746:V268M;ENSP00000362186:V268M;ENSP00000362189:V268M;ENSP00000355040:V268M;ENSP00000362180:V268M;ENSP00000423762:V268M;ENSP00000355105:V268M;ENSP00000384758:V268M;ENSP00000298274:V268M	ENSP00000298274:V268M	V	+	1	0	PCDH11X	91018697	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.507000	0.97996	1.870000	0.54199	0.544000	0.68410	GTG		0.428	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		28	55	0	0	0	0.00361	0	28	55				
CSTF2	1478	broad.mit.edu	37	X	100078902	100078902	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:100078902G>C	ENST00000372972.2	+	5	488	c.472G>C	c.(472-474)Gca>Cca	p.A158P	SNORA9_ENST00000365361.1_RNA|CSTF2_ENST00000415585.2_Missense_Mutation_p.A158P	NM_001325.2	NP_001316.1	P33240	CSTF2_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	158	Interactions with CSTF3 and SYMPK.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cleavage body (GO:0071920)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	13						TCCCCAGGAGGCACGGAACAT	0.458																																							uc004egh.2		NA																	0				skin(1)	1						c.(472-474)GCA>CCA		cleavage stimulation factor subunit 2							156.0	131.0	140.0					X																	100078902		2203	4300	6503	SO:0001583	missense	1478				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cleavage body|mRNA cleavage and polyadenylation specificity factor complex	nucleotide binding|protein binding|protein binding|RNA binding	g.chrX:100078902G>C	BC017712	CCDS14473.1	Xq22.1	2013-02-12	2002-08-29		ENSG00000101811	ENSG00000101811		"""RNA binding motif (RRM) containing"""	2484	protein-coding gene	gene with protein product		300907	"""cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD"""			1741396	Standard	XM_006724622		Approved		uc004egh.3	P33240	OTTHUMG00000022709	ENST00000372972.2:c.472G>C	X.37:g.100078902G>C	ENSP00000362063:p.Ala158Pro		Somatic				CSTF2_uc010nnd.2_Missense_Mutation_p.A158P|CSTF2_uc004egi.2_Missense_Mutation_p.A158P	p.A158P	NM_001325	NP_001316	WXS	Illumina HiSeq	Unspecified	P33240	CSTF2_HUMAN			5	530	+			158			Interactions with CSTF3 and SYMPK.		Q5H951|Q6LA74|Q8N502	Missense_Mutation	SNP	ENST00000372972.2	37	c.472G>C	CCDS14473.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631869	0.87660	.	.	ENSG00000101811	ENST00000415585;ENST00000372972;ENST00000458320;ENST00000413437	T;T;T	0.21932	1.98;1.98;1.98	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.60508	0.2274	H	0.94345	3.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.996;0.996;0.995	T	0.73675	-0.3908	10	0.87932	D	0	-9.7012	18.3647	0.90386	0.0:0.0:1.0:0.0	.	158;158;158	E7EWR4;P33240-2;P33240	.;.;CSTF2_HUMAN	P	158;158;158;149	ENSP00000387996:A158P;ENSP00000362063:A158P;ENSP00000415705:A149P	ENSP00000362063:A158P	A	+	1	0	CSTF2	99965558	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.158000	0.94723	2.277000	0.76020	0.600000	0.82982	GCA		0.458	CSTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058926.1	NM_001325		36	101	0	0	0	0.003755	0	36	101				
GPRASP1	9737	broad.mit.edu	37	X	101912052	101912052	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:101912052C>G	ENST00000361600.5	+	5	4012	c.3211C>G	c.(3211-3213)Ccg>Gcg	p.P1071A	GPRASP1_ENST00000537097.1_Missense_Mutation_p.P1071A|GPRASP1_ENST00000415986.1_Missense_Mutation_p.P1071A|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000444152.1_Missense_Mutation_p.P1071A	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1071	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CTTTAGATTTCCGAAAGAGGC	0.512																																							uc004ejj.3		NA																	0				ovary(1)|lung(1)	2						c.(3211-3213)CCG>GCG		G protein-coupled receptor associated sorting							115.0	119.0	117.0					X																	101912052		2203	4300	6503	SO:0001583	missense	9737					cytoplasm	protein binding	g.chrX:101912052C>G	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3211C>G	X.37:g.101912052C>G	ENSP00000355146:p.Pro1071Ala		Somatic				GPRASP1_uc004eji.3_Missense_Mutation_p.P1071A|GPRASP1_uc010nod.2_Missense_Mutation_p.P1071A	p.P1071A	NM_014710	NP_055525	WXS	Illumina HiSeq	Unspecified	Q5JY77	GASP1_HUMAN			5	4012	+			1071			OPRD1-binding.		O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	c.3211C>G	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	C	5.899	0.349966	0.11182	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.10099	2.91;2.91;2.91;2.91	2.84	-1.11	0.09840	.	.	.	.	.	T	0.12050	0.0293	M	0.61703	1.905	0.09310	N	1	D	0.56521	0.976	B	0.43950	0.437	T	0.15378	-1.0439	9	0.51188	T	0.08	-0.1407	6.2787	0.20995	0.0:0.3942:0.0:0.6058	.	1071	Q5JY77	GASP1_HUMAN	A	1071	ENSP00000393691:P1071A;ENSP00000409420:P1071A;ENSP00000355146:P1071A;ENSP00000445683:P1071A	ENSP00000355146:P1071A	P	+	1	0	GPRASP1	101798708	0.148000	0.22702	0.000000	0.03702	0.878000	0.50629	0.271000	0.18626	-0.452000	0.07087	0.284000	0.19432	CCG		0.512	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710		104	189	0	0	0	0.00361	0	104	189				
GPRASP2	114928	broad.mit.edu	37	X	101970102	101970102	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:101970102C>A	ENST00000535209.1	+	4	1136	c.305C>A	c.(304-306)gCc>gAc	p.A102D	GPRASP2_ENST00000332262.5_Missense_Mutation_p.A102D|GPRASP2_ENST00000543253.1_Missense_Mutation_p.A102D			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	102						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AAAACCGATGCCAGGGCAGTA	0.577																																							uc004ejk.2		NA																	0				ovary(1)	1						c.(304-306)GCC>GAC		G protein-coupled receptor associated sorting							78.0	79.0	79.0					X																	101970102		2203	4300	6503	SO:0001583	missense	114928					cytoplasm	protein binding	g.chrX:101970102C>A	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.305C>A	X.37:g.101970102C>A	ENSP00000437394:p.Ala102Asp		Somatic				GPRASP2_uc004ejl.2_Missense_Mutation_p.A102D|GPRASP2_uc004ejm.2_Missense_Mutation_p.A102D|GPRASP2_uc011mrp.1_5'Flank	p.A102D	NM_138437	NP_612446	WXS	Illumina HiSeq	Unspecified	Q96D09	GASP2_HUMAN			4	1639	+			102					D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	c.305C>A	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	C	8.309	0.821605	0.16678	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.08102	3.13;3.13;3.13	4.49	-0.707	0.11245	.	0.000000	0.43747	D	0.000537	T	0.06645	0.0170	L	0.29908	0.895	0.34169	D	0.669581	D	0.58268	0.982	P	0.49752	0.621	T	0.44081	-0.9351	10	0.11794	T	0.64	.	6.4407	0.21849	0.0:0.3917:0.4243:0.184	.	102	Q96D09	GASP2_HUMAN	D	102	ENSP00000437872:A102D;ENSP00000437394:A102D;ENSP00000339057:A102D	ENSP00000339057:A102D	A	+	2	0	GPRASP2	101856758	0.000000	0.05858	0.495000	0.27527	0.170000	0.22686	-0.325000	0.07976	-0.167000	0.10871	-1.005000	0.02491	GCC		0.577	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437		62	166	1	0	8.52622e-23	0.00361	1.48378e-22	62	166				
BHLHB9	80823	broad.mit.edu	37	X	102005196	102005197	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:102005196_102005197GG>TT	ENST00000372735.1	+	4	1858_1859	c.1273_1274GG>TT	c.(1273-1275)GGa>TTa	p.G425L	BHLHB9_ENST00000361229.4_Missense_Mutation_p.G425L|BHLHB9_ENST00000447531.1_Missense_Mutation_p.G425L|BHLHB9_ENST00000457056.1_Missense_Mutation_p.G425L|BHLHB9_ENST00000448867.1_Missense_Mutation_p.G425L			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	425					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ACAGCAATCTGGATTAAAGATA	0.386																																							uc010nog.2		NA																	0				ovary(2)	2						c.(1273-1275)GGA>TTA		basic helix-loop-helix domain containing, class																																				SO:0001583	missense	80823					cytoplasm|nucleus	binding	g.chrX:102005196_102005197GG>TT	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	Exception_encountered	X.37:g.102005196_102005197delinsTT	ENSP00000361820:p.Gly425Leu		Somatic				BHLHB9_uc011mrq.1_Missense_Mutation_p.G425L|BHLHB9_uc011mrr.1_Missense_Mutation_p.G425L|BHLHB9_uc011mrs.1_Missense_Mutation_p.G425L|BHLHB9_uc011mrt.1_Missense_Mutation_p.G425L|BHLHB9_uc004ejo.2_Missense_Mutation_p.G425L|BHLHB9_uc011mru.1_Missense_Mutation_p.G425L|BHLHB9_uc011mrv.1_Missense_Mutation_p.G425L	p.G425L	NM_001142526	NP_001135998	WXS	Illumina HiSeq	Unspecified	Q6PI77	BHLH9_HUMAN			4	1844_1845	+			425					Q9C0G2	Missense_Mutation	DNP	ENST00000372735.1	37	c.1273_1274GG>TT	CCDS14502.1																																																																																				0.386	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639		21	78	0	0	0	0.004672	0	21	78				
FAM199X	139231	broad.mit.edu	37	X	103431193	103431193	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:103431193G>T	ENST00000493442.1	+	4	786	c.620G>T	c.(619-621)cGg>cTg	p.R207L	FAM199X_ENST00000299906.5_3'UTR	NM_207318.3	NP_997201.1	Q6PEV8	F199X_HUMAN	family with sequence similarity 199, X-linked	207										breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						ATGGGTCTTCGGGAGCAACTT	0.353																																							uc004elw.2		NA																	0				ovary(1)	1						c.(619-621)CGG>CTG		hypothetical protein LOC139231							133.0	123.0	126.0					X																	103431193		2203	4300	6503	SO:0001583	missense	139231							g.chrX:103431193G>T	BC016683	CCDS35364.1	Xq22	2010-02-11	2010-02-11	2010-02-11	ENSG00000123575	ENSG00000123575			25195	protein-coding gene	gene with protein product			"""chromosome X open reading frame 39"""	CXorf39			Standard	NM_207318		Approved		uc004elw.3	Q6PEV8	OTTHUMG00000022126	ENST00000493442.1:c.620G>T	X.37:g.103431193G>T	ENSP00000417581:p.Arg207Leu		Somatic				FAM199X_uc004elx.2_Missense_Mutation_p.R24L	p.R207L	NM_207318	NP_997201	WXS	Illumina HiSeq	Unspecified	Q6PEV8	F199X_HUMAN			4	786	+			207					Q8WVP6|Q96AV3	Missense_Mutation	SNP	ENST00000493442.1	37	c.620G>T	CCDS35364.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707323	0.89018	.	.	ENSG00000123575	ENST00000493442	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.76198	0.3954	M	0.62723	1.935	0.80722	D	1	D;D	0.69078	0.997;0.992	D;D	0.75484	0.986;0.969	T	0.76509	-0.2933	8	.	.	.	-8.1108	16.3372	0.83068	0.0:0.0:1.0:0.0	.	207;207	Q6PEV8-2;Q6PEV8	.;F199X_HUMAN	L	207	.	.	R	+	2	0	FAM199X	103317849	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.743000	0.98849	2.141000	0.66446	0.600000	0.82982	CGG		0.353	FAM199X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057764.1	NM_207318		33	59	1	0	3.86903e-22	0.002836	6.61288e-22	33	59				
RGAG1	57529	broad.mit.edu	37	X	109695043	109695043	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:109695043G>T	ENST00000465301.2	+	3	1444	c.1198G>T	c.(1198-1200)Gca>Tca	p.A400S	RGAG1_ENST00000540313.1_Missense_Mutation_p.A400S	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	400										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GGTGATGTCTGCACCACCAGT	0.512																																							uc004eor.1		NA																	0				lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(1198-1200)GCA>TCA		retrotransposon gag domain containing 1							191.0	199.0	197.0					X																	109695043		2203	4300	6503	SO:0001583	missense	57529							g.chrX:109695043G>T	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1198G>T	X.37:g.109695043G>T	ENSP00000419786:p.Ala400Ser		Somatic				RGAG1_uc011msr.1_Missense_Mutation_p.A400S	p.A400S	NM_020769	NP_065820	WXS	Illumina HiSeq	Unspecified	Q8NET4	RGAG1_HUMAN			3	1444	+			400					Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	c.1198G>T	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	9.913	1.210184	0.22289	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.45668	0.89;0.89	4.06	-0.0523	0.13823	.	0.463599	0.16109	N	0.229219	T	0.29321	0.0730	L	0.53249	1.67	0.09310	N	1	B	0.33171	0.4	B	0.30855	0.121	T	0.12682	-1.0538	9	.	.	.	-2.1636	3.2539	0.06824	0.4019:0.0:0.3946:0.2035	.	400	Q8NET4	RGAG1_HUMAN	S	400	ENSP00000419786:A400S;ENSP00000441452:A400S	.	A	+	1	0	RGAG1	109581699	0.002000	0.14202	0.001000	0.08648	0.007000	0.05969	0.461000	0.21940	-0.086000	0.12550	-0.380000	0.06706	GCA		0.512	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		126	428	1	0	2.77834e-61	0.00361	5.21426e-61	126	428				
CAPN6	827	broad.mit.edu	37	X	110494310	110494310	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:110494310G>T	ENST00000324068.1	-	8	1160	c.993C>A	c.(991-993)tgC>tgA	p.C331*	CAPN6_ENST00000541758.1_Nonsense_Mutation_p.C76*	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	331	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						GAAAGTTGCGGCAAAAGTCCT	0.438																																							uc004epc.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						c.(991-993)TGC>TGA		calpain 6							263.0	241.0	249.0					X																	110494310		2203	4300	6503	SO:0001587	stop_gained	827				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding	g.chrX:110494310G>T	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.993C>A	X.37:g.110494310G>T	ENSP00000317214:p.Cys331*		Somatic				CAPN6_uc011msu.1_Nonsense_Mutation_p.C76*	p.C331*	NM_014289	NP_055104	WXS	Illumina HiSeq	Unspecified	Q9Y6Q1	CAN6_HUMAN			8	1161	-			331			Calpain catalytic.		D3DUY7|Q9UEQ1|Q9UJA8	Nonsense_Mutation	SNP	ENST00000324068.1	37	c.993C>A	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	G	37	6.567890	0.97671	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	.	.	.	5.95	4.1	0.47936	.	0.095166	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4949	0.33121	0.3413:0.0:0.6587:0.0	.	.	.	.	X	331;76	.	ENSP00000317214:C331X	C	-	3	2	CAPN6	110380966	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.018000	0.40991	1.192000	0.43071	0.600000	0.82982	TGC		0.438	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1			222	395	1	0	1.11227e-129	0.00361	2.09332e-129	222	395				
SLC6A14	11254	broad.mit.edu	37	X	115572134	115572134	+	Splice_Site	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:115572134G>T	ENST00000371900.4	+	3	303	c.215G>T	c.(214-216)gGc>gTc	p.G72V		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	72					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CCTTTTTTAGGCGCCTTCTTG	0.403																																							uc004eqi.2		NA																	0				ovary(2)|pancreas(1)	3						c.(214-216)GGC>GTC		solute carrier family 6 (amino acid	L-Proline(DB00172)						416.0	359.0	378.0					X																	115572134		2203	4300	6503	SO:0001630	splice_region_variant	11254				cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chrX:115572134G>T	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.215-1G>T	X.37:g.115572134G>T			Somatic				SLC6A14_uc011mtm.1_RNA	p.G72V	NM_007231	NP_009162	WXS	Illumina HiSeq	Unspecified	Q9UN76	S6A14_HUMAN			3	319	+			72			Helical; Name=2; (Potential).		Q5H942	Missense_Mutation	SNP	ENST00000371900.4	37	c.215G>T	CCDS14570.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.512569	0.64522	.	.	ENSG00000087916	ENST00000371900	D	0.87729	-2.29	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.95040	0.8394	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96236	0.9172	9	.	.	.	.	15.069	0.72021	0.0:0.0:1.0:0.0	.	72	Q9UN76	S6A14_HUMAN	V	72	ENSP00000360967:G72V	.	G	+	2	0	SLC6A14	115486162	1.000000	0.71417	0.999000	0.59377	0.476000	0.33039	9.110000	0.94302	2.146000	0.66826	0.544000	0.68410	GGC		0.403	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		Missense_Mutation	90	316	1	0	5.01286e-43	0.00361	9.32948e-43	90	316				
BCORL1	63035	broad.mit.edu	37	X	129148822	129148822	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:129148822G>T	ENST00000218147.7	+	4	2271	c.2074G>T	c.(2074-2076)Gag>Tag	p.E692*	BCORL1_ENST00000303743.5_Nonsense_Mutation_p.E692*|BCORL1_ENST00000359304.2_Nonsense_Mutation_p.E692*|BCORL1_ENST00000540052.1_Nonsense_Mutation_p.E692*			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	692					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E692K(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CATCTTTCCCGAGATCGTGAG	0.602																																							uc004evb.1		NA																	1	Substitution - Missense(1)	p.E692K(1)	ovary(1)	ovary(4)|breast(2)|lung(1)	7						c.(2074-2076)GAG>TAG		BCL6 co-repressor-like 1							70.0	58.0	62.0					X																	129148822		2203	4300	6503	SO:0001587	stop_gained	63035				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chrX:129148822G>T	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2074G>T	X.37:g.129148822G>T	ENSP00000218147:p.Glu692*		Somatic				BCORL1_uc010nrd.1_Nonsense_Mutation_p.E594*	p.E692*	NM_021946	NP_068765	WXS	Illumina HiSeq	Unspecified	Q5H9F3	BCORL_HUMAN			4	2188	+			692					B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Nonsense_Mutation	SNP	ENST00000218147.7	37	c.2074G>T	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.957789|3.957789	0.73902|0.73902	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	.|.	.|.	.|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.000000|.	0.37178|.	N|.	0.002211|.	.|T	.|0.74351	.|0.3705	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73953	.|-0.3820	.|3	0.26408|.	T|.	0.33|.	-9.2769|-9.2769	18.0781|18.0781	0.89433|0.89433	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	692;692;692;692;292|127	.|.	ENSP00000218147:E692X|.	E|R	+|+	1|2	0|0	BCORL1|BCORL1	128976503|128976503	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.333000|0.333000	0.28666|0.28666	4.592000|4.592000	0.61027|0.61027	2.205000|2.205000	0.71048|0.71048	0.436000|0.436000	0.28706|0.28706	GAG|CGA		0.602	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		34	68	1	0	4.11147e-13	0.003755	6.23232e-13	34	68				
ARHGEF6	9459	broad.mit.edu	37	X	135757176	135757176	+	Silent	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:135757176G>T	ENST00000250617.6	-	19	3230	c.2025C>A	c.(2023-2025)ggC>ggA	p.G675G	ARHGEF6_ENST00000370620.1_Silent_p.G521G|ARHGEF6_ENST00000535227.1_Silent_p.G548G|ARHGEF6_ENST00000370622.1_Silent_p.G521G	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	675					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					TTGAGCCATGGCCTTGTTGAA	0.423																																							uc004fab.2		NA																	0					0						c.(2023-2025)GGC>GGA		Rac/Cdc42 guanine nucleotide exchange factor 6							153.0	135.0	141.0					X																	135757176		2203	4300	6503	SO:0001819	synonymous_variant	9459				apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chrX:135757176G>T	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.2025C>A	X.37:g.135757176G>T			Somatic				ARHGEF6_uc011mwd.1_Silent_p.G548G|ARHGEF6_uc011mwe.1_Silent_p.G521G	p.G675G	NM_004840	NP_004831	WXS	Illumina HiSeq	Unspecified	Q15052	ARHG6_HUMAN			19	2487	-	Acute lymphoblastic leukemia(192;0.000127)		675					A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Silent	SNP	ENST00000250617.6	37	c.2025C>A	CCDS14660.1																																																																																				0.423	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840		20	69	1	0	2.98393e-07	0.00278	3.85953e-07	20	69				
ARHGEF6	9459	broad.mit.edu	37	X	135770121	135770121	+	Silent	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:135770121C>T	ENST00000250617.6	-	11	2420	c.1215G>A	c.(1213-1215)ctG>ctA	p.L405L	ARHGEF6_ENST00000370620.1_Silent_p.L251L|ARHGEF6_ENST00000535227.1_Silent_p.L278L|ARHGEF6_ENST00000370622.1_Silent_p.L251L	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	405	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					CGATTGCTTTCAGAATATCCT	0.378																																							uc004fab.2		NA																	0					0						c.(1213-1215)CTG>CTA		Rac/Cdc42 guanine nucleotide exchange factor 6							149.0	138.0	142.0					X																	135770121		2203	4300	6503	SO:0001819	synonymous_variant	9459				apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chrX:135770121C>T	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1215G>A	X.37:g.135770121C>T			Somatic				ARHGEF6_uc011mwd.1_Silent_p.L278L|ARHGEF6_uc011mwe.1_Silent_p.L251L	p.L405L	NM_004840	NP_004831	WXS	Illumina HiSeq	Unspecified	Q15052	ARHG6_HUMAN			11	1677	-	Acute lymphoblastic leukemia(192;0.000127)		405			DH.		A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Silent	SNP	ENST00000250617.6	37	c.1215G>A	CCDS14660.1																																																																																				0.378	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840		8	147	0	0	0	0.00308	0	8	147				
RBMX	27316	broad.mit.edu	37	X	135956515	135956515	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:135956515C>A	ENST00000320676.7	-	9	1116	c.962G>T	c.(961-963)gGt>gTt	p.G321V	RBMX_ENST00000570135.1_Missense_Mutation_p.G186V|RBMX_ENST00000431446.3_Intron|RBMX_ENST00000562646.1_3'UTR|RBMX_ENST00000496459.2_5'Flank|RBMX_ENST00000565438.1_Missense_Mutation_p.G193V	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	321					cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					TCGACTTCCACCATATCCGTC	0.532																																							uc004fae.1		NA																	0				ovary(1)	1						c.(961-963)GGT>GTT		RNA binding motif protein, X-linked isoform 1							130.0	120.0	123.0					X																	135956515		2203	4297	6500	SO:0001583	missense	27316					catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chrX:135956515C>A		CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.962G>T	X.37:g.135956515C>A	ENSP00000359645:p.Gly321Val		Somatic				RBMX_uc004fac.1_5'Flank|RBMX_uc011mwf.1_Intron|RBMX_uc004fad.1_3'UTR|RBMX_uc011mwg.1_Missense_Mutation_p.G282V|RBMX_uc004faf.1_Missense_Mutation_p.G182V|RBMX_uc010nsf.1_Missense_Mutation_p.G282V|RBMX_uc004fag.1_Missense_Mutation_p.G193V	p.G321V	NM_002139	NP_002130	WXS	Illumina HiSeq	Unspecified	P38159	HNRPG_HUMAN			9	1172	-	Acute lymphoblastic leukemia(192;0.000127)		321					B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Missense_Mutation	SNP	ENST00000320676.7	37	c.962G>T	CCDS14661.1	.	.	.	.	.	.	.	.	.	.	.	15.20	2.762490	0.49574	.	.	ENSG00000147274	ENST00000320676;ENST00000449161	T	0.80566	-1.39	5.4	5.4	0.78164	.	0.000000	0.85682	U	0.000000	D	0.89128	0.6627	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90126	0.4203	10	0.87932	D	0	.	18.4308	0.90624	0.0:1.0:0.0:0.0	.	321	P38159	HNRPG_HUMAN	V	321;308	ENSP00000359645:G321V	ENSP00000359645:G321V	G	-	2	0	RBMX	135784181	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.444000	0.52914	2.380000	0.81148	0.600000	0.82982	GGT		0.532	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139		15	298	1	0	4.11147e-13	0.003755	6.23232e-13	15	298				
CDR1	1038	broad.mit.edu	37	X	139866350	139866350	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:139866350G>T	ENST00000370532.2	-	1	373	c.182C>A	c.(181-183)aCg>aAg	p.T61K		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	61	23 X 6 AA approximate repeats.									breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CAGGAAATCCGTGTCTTCCAG	0.438																																							uc004fbg.1		NA																	0					0						c.(181-183)ACG>AAG		cerebellar degeneration-related protein 1,							105.0	100.0	101.0					X																	139866350		2203	4300	6503	SO:0001583	missense	1038							g.chrX:139866350G>T		CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.182C>A	X.37:g.139866350G>T	ENSP00000359563:p.Thr61Lys		Somatic				uc004fbf.1_RNA	p.T61K	NM_004065	NP_004056	WXS	Illumina HiSeq	Unspecified	P51861	CDR1_HUMAN			1	374	-	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)	61			10.|23 X 6 AA approximate repeats.		Q5JXH6	Missense_Mutation	SNP	ENST00000370532.2	37	c.182C>A	CCDS14670.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.911484	0.33721	.	.	ENSG00000184258	ENST00000370532	T	0.25912	1.77	4.7	-9.4	0.00616	.	.	.	.	.	T	0.09202	0.0227	N	0.14661	0.345	0.09310	N	1	B	0.19583	0.037	B	0.17098	0.017	T	0.22871	-1.0204	8	.	.	.	.	2.9704	0.05920	0.165:0.2147:0.4297:0.1906	.	61	P51861	CDR1_HUMAN	K	61	ENSP00000359563:T61K	.	T	-	2	0	CDR1	139694016	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.630000	0.02028	-1.566000	0.01673	-1.169000	0.01745	ACG		0.438	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1	NM_004065		83	186	1	0	6.11987e-43	0.00361	1.13582e-42	83	186				
MAGEC2	51438	broad.mit.edu	37	X	141291725	141291725	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:141291725G>T	ENST00000247452.3	-	3	396	c.49C>A	c.(49-51)Ccg>Acg	p.P17T		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	17					cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					ACTGAGGTCGGGGAGTCGTTG	0.512										HNSCC(46;0.14)																													uc004fbu.1		NA																	0				breast(2)	2						c.(49-51)CCG>ACG		melanoma antigen family C, 2							125.0	118.0	120.0					X																	141291725		2203	4300	6503	SO:0001583	missense	51438					cytoplasm|nucleus		g.chrX:141291725G>T	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.49C>A	X.37:g.141291725G>T	ENSP00000354660:p.Pro17Thr	HNSCC(46;0.14)	Somatic					p.P17T	NM_016249	NP_057333	WXS	Illumina HiSeq	Unspecified	Q9UBF1	MAGC2_HUMAN			3	397	-	Acute lymphoblastic leukemia(192;6.56e-05)		17					Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	c.49C>A	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	2.982	-0.210008	0.06140	.	.	ENSG00000046774	ENST00000247452	T	0.01998	4.51	0.896	0.896	0.19253	.	1.045060	0.07772	U	0.951923	T	0.01189	0.0039	N	0.08118	0	0.09310	N	1	P	0.38110	0.618	B	0.23018	0.043	T	0.48364	-0.9042	9	0.72032	D	0.01	.	.	.	.	.	17	Q9UBF1	MAGC2_HUMAN	T	17	ENSP00000354660:P17T	ENSP00000354660:P17T	P	-	1	0	MAGEC2	141119391	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.813000	0.27225	0.707000	0.31934	0.411000	0.27672	CCG		0.512	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249		68	175	1	0	9.53695e-23	0.00361	1.65538e-22	68	175				
IDS	3423	broad.mit.edu	37	X	148564645	148564645	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:148564645C>T	ENST00000340855.6	-	9	1494	c.1285G>A	c.(1285-1287)Gtt>Att	p.V429I	IDS_ENST00000537071.1_Missense_Mutation_p.V32I|IDS_ENST00000422081.2_Missense_Mutation_p.V218I|IDS_ENST00000541269.1_Missense_Mutation_p.V218I	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	429					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CACAGCTCAACGTGAAATGAA	0.527																																							uc011mxe.1		NA																	0					0						c.(1285-1287)GTT>ATT		iduronate-2-sulfatase isoform a precursor							106.0	87.0	94.0					X																	148564645		2203	4300	6503	SO:0001583	missense	3423					lysosome	iduronate-2-sulfatase activity|metal ion binding	g.chrX:148564645C>T	M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.1285G>A	X.37:g.148564645C>T	ENSP00000339801:p.Val429Ile		Somatic				IDS_uc011mxd.1_Missense_Mutation_p.V32I|IDS_uc011mxf.1_Missense_Mutation_p.V339I|IDS_uc011mxg.1_Missense_Mutation_p.V218I|IDS_uc010nsu.1_Missense_Mutation_p.V39I|IDS_uc004fcw.3_Missense_Mutation_p.V218I	p.V429I	NM_000202	NP_000193	WXS	Illumina HiSeq	Unspecified	P22304	IDS_HUMAN			9	1483	-	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)		429					D3DWT4|Q14604|Q9BRM3	Missense_Mutation	SNP	ENST00000340855.6	37	c.1285G>A	CCDS14685.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.973905	0.34848	.	.	ENSG00000010404	ENST00000340855;ENST00000537071;ENST00000541269	D;D;D	0.99893	-7.57;-5.49;-7.57	5.23	0.878	0.19150	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.684672	0.14571	N	0.311438	D	0.99152	0.9707	L	0.33339	1.005	0.35660	D	0.812499	B;B	0.23650	0.089;0.019	B;B	0.24269	0.052;0.04	D	0.99990	1.4145	10	0.37606	T	0.19	.	9.0881	0.36594	0.0:0.5179:0.0:0.4821	.	339;429	B4DGD7;P22304	.;IDS_HUMAN	I	429;32;218	ENSP00000339801:V429I;ENSP00000440324:V32I;ENSP00000441261:V218I	ENSP00000339801:V429I	V	-	1	0	IDS	148372550	0.146000	0.22672	0.004000	0.12327	0.910000	0.53928	0.655000	0.24933	0.110000	0.17919	0.422000	0.28245	GTT		0.527	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058677.3			52	90	0	0	0	0.00361	0	52	90				
GPR50	9248	broad.mit.edu	37	X	150349293	150349293	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:150349293C>A	ENST00000218316.3	+	2	1307	c.1238C>A	c.(1237-1239)gCt>gAt	p.A413D	GPR50-AS1_ENST00000454196.1_RNA|AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	413	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CACTCCAAGGCTGCCTCTGGT	0.582																																							uc010ntg.1		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(1237-1239)GCT>GAT		G protein-coupled receptor 50							130.0	145.0	140.0					X																	150349293		2083	4196	6279	SO:0001583	missense	9248				cell-cell signaling	integral to plasma membrane	melatonin receptor activity	g.chrX:150349293C>A	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1238C>A	X.37:g.150349293C>A	ENSP00000218316:p.Ala413Asp		Somatic				uc004fes.1_5'Flank	p.A413D	NM_004224	NP_004215	WXS	Illumina HiSeq	Unspecified	Q13585	MTR1L_HUMAN			2	1373	+	Acute lymphoblastic leukemia(192;6.56e-05)		413			Cytoplasmic (Potential).|Pro-rich.		Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	c.1238C>A	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	C	6.168	0.399237	0.11696	.	.	ENSG00000102195	ENST00000218316	T	0.72167	-0.63	3.09	2.21	0.28008	.	.	.	.	.	T	0.45716	0.1356	N	0.08118	0	0.09310	N	1	B	0.33694	0.421	B	0.24269	0.052	T	0.34650	-0.9820	9	0.72032	D	0.01	.	8.0317	0.30470	0.0:0.862:0.0:0.138	.	413	Q13585	MTR1L_HUMAN	D	413	ENSP00000218316:A413D	ENSP00000218316:A413D	A	+	2	0	GPR50	150099951	0.000000	0.05858	0.007000	0.13788	0.170000	0.22686	-0.047000	0.11963	0.483000	0.27608	0.468000	0.43344	GCT		0.582	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224		125	354	1	0	2.91419e-48	0.00361	5.43873e-48	125	354				
GPR50	9248	broad.mit.edu	37	X	150349627	150349627	+	Silent	SNP	C	C	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:150349627C>A	ENST00000218316.3	+	2	1641	c.1572C>A	c.(1570-1572)gcC>gcA	p.A524A	AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	524	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CCAAGCCTGCCACTACCAGCC	0.612																																							uc010ntg.1		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(1570-1572)GCC>GCA		G protein-coupled receptor 50							72.0	87.0	82.0					X																	150349627		2174	4248	6422	SO:0001819	synonymous_variant	9248				cell-cell signaling	integral to plasma membrane	melatonin receptor activity	g.chrX:150349627C>A	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1572C>A	X.37:g.150349627C>A			Somatic					p.A524A	NM_004224	NP_004215	WXS	Illumina HiSeq	Unspecified	Q13585	MTR1L_HUMAN			2	1707	+	Acute lymphoblastic leukemia(192;6.56e-05)		524			Cytoplasmic (Potential).|Pro-rich.		Q0VGG3|Q3ZAR0	Silent	SNP	ENST00000218316.3	37	c.1572C>A	CCDS44012.1																																																																																				0.612	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224		50	173	1	0	2.0833e-19	0.00361	3.50706e-19	50	173				
PNCK	139728	broad.mit.edu	37	X	152937657	152937657	+	Splice_Site	SNP	T	T	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:152937657T>C	ENST00000370150.1	-	4	379		c.e4-2		PNCK_ENST00000370145.4_Splice_Site|PNCK_ENST00000447676.2_Splice_Site|PNCK_ENST00000370142.1_Splice_Site|PNCK_ENST00000393831.2_Splice_Site|PNCK_ENST00000340888.3_Splice_Site|PNCK_ENST00000475172.1_Splice_Site			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase							cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGACTGATCCTGCAATGGCAA	0.617																																							uc011myu.1		NA																	0				breast(1)	1						c.e4-1		pregnancy upregulated non-ubiquitously expressed							88.0	63.0	72.0					X																	152937657		2203	4300	6503	SO:0001630	splice_region_variant	139728					cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chrX:152937657T>C	BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.201-2A>G	X.37:g.152937657T>C			Somatic				PNCK_uc011myt.1_Splice_Site_p.R84_splice|PNCK_uc004fia.2_Splice_Site_p.R79_splice|PNCK_uc004fhz.3_Splice_Site|PNCK_uc010nuh.2_Intron|PNCK_uc011myv.1_Splice_Site_p.R94_splice|PNCK_uc011myw.1_Splice_Site_p.R94_splice	p.R150_splice	NM_001039582	NP_001034671	WXS	Illumina HiSeq	Unspecified	Q6P2M8	KCC1B_HUMAN			4	636	-	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)							B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Splice_Site	SNP	ENST00000370150.1	37	c.450_splice		.	.	.	.	.	.	.	.	.	.	T	6.128	0.391841	0.11581	.	.	ENSG00000130822	ENST00000340888;ENST00000370150;ENST00000393831;ENST00000370142;ENST00000370145;ENST00000447676;ENST00000439087;ENST00000422811;ENST00000434652	.	.	.	4.78	3.61	0.41365	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3502	0.38133	0.1629:0.0:0.0:0.8371	.	.	.	.	.	-1	.	.	.	-	.	.	PNCK	152590851	1.000000	0.71417	0.798000	0.32154	0.003000	0.03518	6.191000	0.72063	0.527000	0.28560	-0.410000	0.06199	.		0.617	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000061044.2	NM_198452	Intron	4	41	0	0	0	0.000248	0	4	41				
L1CAM	3897	broad.mit.edu	37	X	153133826	153133826	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:153133826G>T	ENST00000370060.1	-	14	1823	c.1634C>A	c.(1633-1635)cCc>cAc	p.P545H	L1CAM_ENST00000361981.3_Missense_Mutation_p.P540H|L1CAM_ENST00000370055.1_Missense_Mutation_p.P540H|L1CAM_ENST00000370057.3_Missense_Mutation_p.P545H|L1CAM_ENST00000361699.4_Missense_Mutation_p.P545H|L1CAM_ENST00000543994.1_Missense_Mutation_p.P547H|L1CAM_ENST00000538883.1_Missense_Mutation_p.P547H	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	545	Ig-like C2-type 6.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGCAAGGAGGGGTCAAAGGA	0.602																																							uc004fjb.2		NA																	0				ovary(8)|central_nervous_system(1)	9						c.(1633-1635)CCC>CAC		L1 cell adhesion molecule isoform 1 precursor							141.0	144.0	143.0					X																	153133826		2203	4300	6503	SO:0001583	missense	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153133826G>T	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.1634C>A	X.37:g.153133826G>T	ENSP00000359077:p.Pro545His		Somatic				L1CAM_uc004fjc.2_Missense_Mutation_p.P545H|L1CAM_uc010nuo.2_Missense_Mutation_p.P540H|L1CAM_uc004fjd.1_Missense_Mutation_p.P359H	p.P545H	NM_000425	NP_000416	WXS	Illumina HiSeq	Unspecified	P32004	L1CAM_HUMAN			13	1742	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		545			Ig-like C2-type 6.|Extracellular (Potential).		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	c.1634C>A	CCDS14733.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.35|14.35	2.510531|2.510531	0.44660|0.44660	.|.	.|.	ENSG00000198910|ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699|ENST00000455590	T;T;T;T;T;T;T|T	0.74526|0.74002	-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85|-0.8	5.62|5.62	4.75|4.75	0.60458|0.60458	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.096985|0.096985	0.43919|0.43919	D|D	0.000509|0.000509	D|D	0.85128|0.85128	0.5626|0.5626	M|M	0.88842|0.88842	2.985|2.985	0.52501|0.52501	D|D	0.999951|0.999951	B;B;P|.	0.34587|.	0.404;0.202;0.458|.	B;B;B|.	0.40534|.	0.159;0.285;0.332|.	D|D	0.86194|0.86194	0.1614|0.1614	10|7	0.26408|.	T|.	0.33|.	.|.	11.2215|11.2215	0.48857|0.48857	0.091:0.0:0.909:0.0|0.091:0.0:0.909:0.0	.|.	540;545;545|.	G3XAF4;P32004-2;P32004|.	.;.;L1CAM_HUMAN|.	H|T	545;547;545;547;540;540;545|3	ENSP00000359077:P545H;ENSP00000438430:P547H;ENSP00000359074:P545H;ENSP00000439645:P547H;ENSP00000354712:P540H;ENSP00000359072:P540H;ENSP00000355380:P545H|ENSP00000397792:P3T	ENSP00000355380:P545H|.	P|P	-|-	2|1	0|0	L1CAM|L1CAM	152787020|152787020	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	3.881000|3.881000	0.56152|0.56152	1.142000|1.142000	0.42291|0.42291	0.529000|0.529000	0.55759|0.55759	CCC|CCT		0.602	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		58	228	1	0	1.95512e-22	0.00361	3.37611e-22	58	228				
ARHGAP4	393	broad.mit.edu	37	X	153186130	153186130	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:153186130C>T	ENST00000350060.5	-	5	672	c.631G>A	c.(631-633)Ggg>Agg	p.G211R	ARHGAP4_ENST00000537206.1_Missense_Mutation_p.G188R|ARHGAP4_ENST00000370028.3_Missense_Mutation_p.G211R|ARHGAP4_ENST00000370016.1_Missense_Mutation_p.G190R|ARHGAP4_ENST00000393721.1_Intron	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	211					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGGAGGGGCCCTGCCTCAGTG	0.692																																							uc004fjk.1		NA																	0				central_nervous_system(1)	1						c.(631-633)GGG>AGG		Rho GTPase activating protein 4 isoform 2							36.0	35.0	35.0					X																	153186130		2203	4300	6503	SO:0001583	missense	393				apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity	g.chrX:153186130C>T	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.631G>A	X.37:g.153186130C>T	ENSP00000203786:p.Gly211Arg		Somatic				ARHGAP4_uc011mzf.1_Missense_Mutation_p.G188R|ARHGAP4_uc004fjl.1_Missense_Mutation_p.G211R|ARHGAP4_uc010nup.1_RNA	p.G211R	NM_001666	NP_001657	WXS	Illumina HiSeq	Unspecified	P98171	RHG04_HUMAN			5	673	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		211					Q14144|Q86UY3	Missense_Mutation	SNP	ENST00000350060.5	37	c.631G>A	CCDS14736.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.732|4.732	0.136049|0.136049	0.09032|0.09032	.|.	.|.	ENSG00000089820|ENSG00000089820	ENST00000370028;ENST00000350060;ENST00000370016;ENST00000537206|ENST00000418750	T;T;T;T|.	0.10099|.	3.04;2.96;2.91;2.97|.	4.89|4.89	4.02|4.02	0.46733|0.46733	.|.	0.153893|.	0.30850|.	N|.	0.008758|.	T|T	0.34250|0.34250	0.0891|0.0891	N|N	0.16790|0.16790	0.44|0.44	0.34634|0.34634	D|D	0.719944|0.719944	P;B|.	0.37141|.	0.584;0.43|.	B;B|.	0.29267|.	0.1;0.1|.	T|T	0.40757|0.40757	-0.9546|-0.9546	10|5	0.06494|.	T|.	0.89|.	.|.	9.1869|9.1869	0.37176|0.37176	0.0:0.8924:0.0:0.1076|0.0:0.8924:0.0:0.1076	.|.	211;211|.	Q86UY3;P98171|.	.;RHG04_HUMAN|.	R|K	211;211;190;188|58	ENSP00000359045:G211R;ENSP00000203786:G211R;ENSP00000359033:G190R;ENSP00000444169:G188R|.	ENSP00000203786:G211R|.	G|R	-|-	1|2	0|0	ARHGAP4|ARHGAP4	152839324|152839324	0.400000|0.400000	0.25295|0.25295	0.805000|0.805000	0.32314|0.32314	0.348000|0.348000	0.29142|0.29142	1.164000|1.164000	0.31810|0.31810	2.355000|2.355000	0.79922|0.79922	0.529000|0.529000	0.55759|0.55759	GGG|AGG		0.692	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666		27	76	0	0	0	0.005443	0	27	76				
CTAG2	30848	broad.mit.edu	37	X	153880627	153880627	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:153880627G>A	ENST00000247306.4	-	2	611	c.548C>T	c.(547-549)cCa>cTa	p.P183L	CTAG2_ENST00000369585.3_Intron	NM_020994.3	NP_066274.2	O75638	CTAG2_HUMAN	cancer/testis antigen 2	183	Poly-Pro.					centrosome (GO:0005813)				central_nervous_system(1)|endometrium(1)|lung(6)|ovary(1)|pancreas(1)	10	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGGCGGGCCTGGTGTACCAGG	0.607																																							uc004fmi.1		NA																	0				pancreas(1)	1						c.(547-549)CCA>CTA		cancer/testis antigen 2 isoform LAGE-1b							70.0	73.0	72.0					X																	153880627		2203	4299	6502	SO:0001583	missense	30848					centrosome		g.chrX:153880627G>A	AJ012833	CCDS14759.1, CCDS35455.1	Xq28	2009-08-18			ENSG00000126890	ENSG00000126890			2492	protein-coding gene	gene with protein product	"""CTL-recognized antigen on melanoma"", ""LAGE-1a protein"", ""cancer/testis antigen family 6, member 2a"", ""cancer/testis antigen family 6, member 2b"""	300396				9626360, 10399963	Standard	NM_020994		Approved	LAGE-1, CAMEL, LAGE1, ESO2, MGC3803, MGC138724, CT6.2a, CT6.2b, LAGE-1a, LAGE-1b	uc004fmi.2	O75638	OTTHUMG00000024239	ENST00000247306.4:c.548C>T	X.37:g.153880627G>A	ENSP00000247306:p.Pro183Leu		Somatic				CTAG2_uc004fmh.1_Intron	p.P183L	NM_020994	NP_066274	WXS	Illumina HiSeq	Unspecified	O75638	CTAG2_HUMAN			2	601	-	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		183			Poly-Pro.		O75637|Q0VIL6|Q14CD6|Q2Z1N4|Q9BU80|Q9UJ89|Q9Y479	Missense_Mutation	SNP	ENST00000247306.4	37	c.548C>T	CCDS14759.1	.	.	.	.	.	.	.	.	.	.	G	3.963	-0.009930	0.07727	.	.	ENSG00000126890	ENST00000247306	T	0.31247	1.5	2.59	-2.35	0.06684	.	.	.	.	.	T	0.13457	0.0326	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.22521	-1.0214	9	0.87932	D	0	2.5556	4.8874	0.13710	0.2405:0.4829:0.2767:0.0	.	183	O75638	CTAG2_HUMAN	L	183	ENSP00000247306:P183L	ENSP00000247306:P183L	P	-	2	0	CTAG2	153533821	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.041000	0.13927	-0.528000	0.06366	-0.571000	0.04153	CCA		0.607	CTAG2-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061176.1	NM_020994		42	116	0	0	0	0.00874	0	42	116				
DKC1	1736	broad.mit.edu	37	X	153993755	153993755	+	Nonsense_Mutation	SNP	G	G	T	rs121912302		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:153993755G>T	ENST00000369550.5	+	3	331	c.121G>T	c.(121-123)Gaa>Taa	p.E41*		NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin	41			E -> K (in DKCX; dbSNP:rs121912302). {ECO:0000269|PubMed:10364516}.		cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TATCAAACCTGAATCCAAAGT	0.388									Congenital Dyskeratosis																														uc004fmm.2		NA																	0					0	GRCh37	CM990476	DKC1	M	rs121912302	c.(121-123)GAA>TAA		dyskerin isoform 1							165.0	156.0	159.0					X																	153993755		2203	4300	6503	SO:0001587	stop_gained	1736	Congenital_Dyskeratosis	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity	g.chrX:153993755G>T	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.121G>T	X.37:g.153993755G>T	ENSP00000358563:p.Glu41*		Somatic				DKC1_uc010nvf.2_Nonsense_Mutation_p.E41*	p.E41*	NM_001363	NP_001354	WXS	Illumina HiSeq	Unspecified	O60832	DKC1_HUMAN			3	331	+	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		41					F5BSB3|O43845|Q96G67|Q9Y505	Nonsense_Mutation	SNP	ENST00000369550.5	37	c.121G>T	CCDS14761.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.087371|5.087371	0.94100|0.94100	.|.	.|.	ENSG00000130826|ENSG00000130826	ENST00000369550;ENST00000413910|ENST00000437719	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.106373|.	0.64402|.	D|.	0.000005|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.72032|.	D|.	0.01|.	-24.6375|-24.6375	17.5162|17.5162	0.87775|0.87775	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	41|26	.|.	ENSP00000358563:E41X|.	E|X	+|+	1|2	0|2	DKC1|DKC1	153646949|153646949	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.804000|0.804000	0.45430|0.45430	7.070000|7.070000	0.76763|0.76763	2.457000|2.457000	0.83068|0.83068	0.600000|0.600000	0.82982|0.82982	GAA|TGA		0.388	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061180.5	NM_001363		62	189	1	0	6.25564e-26	0.00361	1.11175e-25	62	189				
F8	2157	broad.mit.edu	37	X	154197711	154197711	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:154197711G>T	ENST00000360256.4	-	7	1104	c.904C>A	c.(904-906)Cag>Aag	p.Q302K	F8_ENST00000483822.1_5'Flank	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	302	F5/8 type A 1.|Plastocyanin-like 2.		Missing (in HEMA). {ECO:0000269|PubMed:8644728}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	AAGGACGCCTGGCGATGGTTC	0.458																																							uc004fmt.2		NA																	0				ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(904-906)CAG>AAG		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						149.0	131.0	137.0					X																	154197711		2203	4300	6503	SO:0001583	missense	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154197711G>T	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.904C>A	X.37:g.154197711G>T	ENSP00000353393:p.Gln302Lys		Somatic					p.Q302K	NM_000132	NP_000123	WXS	Illumina HiSeq	Unspecified	P00451	FA8_HUMAN			7	1075	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		302		Missing (in HEMA).	Plastocyanin-like 2.|F5/8 type A 1.		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	c.904C>A	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	G	5.490	0.275401	0.10403	.	.	ENSG00000185010	ENST00000360256	D	0.99735	-6.58	5.65	4.74	0.60224	Cupredoxin (2);Multicopper oxidase, type 1 (1);	0.554792	0.19468	N	0.113533	D	0.98422	0.9475	N	0.19112	0.55	0.28193	N	0.927672	P	0.35684	0.515	B	0.41412	0.356	D	0.97945	1.0328	10	0.35671	T	0.21	-6.4374	12.0699	0.53609	0.0:0.169:0.831:0.0	.	302	P00451	FA8_HUMAN	K	302	ENSP00000353393:Q302K	ENSP00000353393:Q302K	Q	-	1	0	F8	153850905	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	3.623000	0.54224	2.370000	0.80446	0.544000	0.68410	CAG		0.458	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			51	129	1	0	1.21353e-23	0.00361	2.12845e-23	51	129				
WASH6P	653440	broad.mit.edu	37	X	155252868	155252868	+	RNA	SNP	T	T	A			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:155252868T>A	ENST00000461007.1	+	0	1876				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.P304P(5)									TAGCCGAGCCTCTCAAGGCAG	0.632																																							uc004fnw.1		NA																	5	Substitution - coding silent(5)		kidney(3)|endometrium(2)		NA						c.(910-912)CCT>CCA		WAS protein family homolog 1																																						0							g.chrX:155252868T>A	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252868T>A			Somatic				uc004fnx.3_Silent_p.P90P	p.P304P	NM_182905	NP_878908	WXS	Illumina HiSeq	Unspecified					6	1571	+								A6NGF1|Q8N305	Silent	SNP	ENST00000461007.1	37	c.912T>A																																																																																					0.632	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1	NG_008380		5	10	0	0	0	0.001168	0	5	10				
VCAM1	7412	broad.mit.edu	37	1	101196902	101196903	+	Frame_Shift_Ins	INS	-	-	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:101196902_101196903insT	ENST00000294728.2	+	6	1454_1455	c.1353_1354insT	c.(1354-1356)tttfs	p.F452fs	VCAM1_ENST00000370119.4_Frame_Shift_Ins_p.F390fs|VCAM1_ENST00000347652.2_Frame_Shift_Ins_p.F360fs|VCAM1_ENST00000370115.1_Intron	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	452	Ig-like C2-type 5.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AGAATATAGAGTTTTTGGAGGA	0.441																																							uc001dti.2		NA																	0				central_nervous_system(1)	1						c.(1351-1356)GAGTTTfs		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)																																			SO:0001589	frameshift_variant	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101196902_101196903insT	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.1358dupT	1.37:g.101196907_101196907dupT	ENSP00000294728:p.Phe452fs		Somatic				VCAM1_uc001dtj.2_Frame_Shift_Ins_p.E359fs|VCAM1_uc010ouj.1_Frame_Shift_Ins_p.E389fs	p.E451fs	NM_001078	NP_001069	WXS	Illumina HiSeq	Unspecified	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	6	1473_1474	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	451_452			Ig-like C2-type 5.|Extracellular (Potential).		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Frame_Shift_Ins	INS	ENST00000294728.2	37	c.1353_1354insT	CCDS773.1																																																																																				0.441	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		11	87	NA	NA	NA	NA	NA	11	87	---	---	---	---
AKNAD1	254268	broad.mit.edu	37	1	109377596	109377596	+	Frame_Shift_Del	DEL	G	G	-	rs558196750		TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr1:109377596delG	ENST00000370001.3	-	8	1887	c.1619delC	c.(1618-1620)ccgfs	p.P540fs	AKNAD1_ENST00000369995.3_Frame_Shift_Del_p.P540fs|AKNAD1_ENST00000369994.1_Intron|AKNAD1_ENST00000357393.4_Frame_Shift_Del_p.P247fs	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	540						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						GGCCTCCTGCGGCCCTCCTTG	0.662																																							uc001dwa.2		NA																	0				ovary(3)	3						c.(1618-1620)CCGfs		hypothetical protein LOC254268							34.0	36.0	35.0					1																	109377596		2203	4300	6503	SO:0001589	frameshift_variant	254268							g.chr1:109377596delG	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.1619delC	1.37:g.109377596delG	ENSP00000359018:p.Pro540fs		Somatic				AKNAD1_uc010ovb.1_Frame_Shift_Del_p.P247fs|AKNAD1_uc001dwb.2_Intron	p.P540fs	NM_152763	NP_689976	WXS	Illumina HiSeq	Unspecified	Q5T1N1	AKND1_HUMAN			8	1888	-			540					B9EK62|Q5T1N0|Q8N990|Q8NCN9	Frame_Shift_Del	DEL	ENST00000370001.3	37	c.1619delC	CCDS791.2																																																																																				0.662	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030923.2	NM_152763		13	46	NA	NA	NA	NA	NA	13	46	---	---	---	---
TRIM48	79097	broad.mit.edu	37	11	55032507	55032507	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:55032507delG	ENST00000417545.2	+	2	262	c.176delG	c.(175-177)tggfs	p.W59fs		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	43						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						TACCTCAACTGGCAAGACATC	0.463																																							uc010rid.1		NA																	0					0						c.(175-177)TGGfs		tripartite motif-containing 48							85.0	85.0	85.0					11																	55032507		2186	4260	6446	SO:0001589	frameshift_variant	79097					intracellular	zinc ion binding	g.chr11:55032507delG	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.176delG	11.37:g.55032507delG	ENSP00000402414:p.Trp59fs		Somatic					p.W59fs	NM_024114	NP_077019	WXS	Illumina HiSeq	Unspecified	Q8IWZ4	TRI48_HUMAN			2	262	+			43			RING-type.		Q9BUW4	Frame_Shift_Del	DEL	ENST00000417545.2	37	c.176delG	CCDS7947.2																																																																																				0.463	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1			53	122	NA	NA	NA	NA	NA	53	122	---	---	---	---
OR8K5	219453	broad.mit.edu	37	11	55927671	55927672	+	Frame_Shift_Ins	INS	-	-	C			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:55927671_55927672insC	ENST00000313447.1	-	1	121_122	c.122_123insG	c.(121-123)ggcfs	p.G41fs		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				TAGTTAGGTTGCCCACCACTGT	0.426																																							uc010rja.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(121-123)GGCfs		olfactory receptor, family 8, subfamily K,																																				SO:0001589	frameshift_variant	219453				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55927671_55927672insC	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.123dupG	11.37:g.55927674_55927674dupC	ENSP00000323853:p.Gly41fs		Somatic					p.G41fs	NM_001004058	NP_001004058	WXS	Illumina HiSeq	Unspecified	Q8NH50	OR8K5_HUMAN			1	122_123	-	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)	41			Helical; Name=1; (Potential).		Q6IFB5	Frame_Shift_Ins	INS	ENST00000313447.1	37	c.122_123insG	CCDS31521.1																																																																																				0.426	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058		16	83	NA	NA	NA	NA	NA	16	83	---	---	---	---
OR5T3	390154	broad.mit.edu	37	11	56019980	56019980	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr11:56019980delG	ENST00000303059.3	+	1	305	c.305delG	c.(304-306)tgcfs	p.C102fs		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					TTGGATGCTTGCTATTCTACA	0.373																																							uc010rjd.1		NA																	0					0						c.(304-306)TGCfs		olfactory receptor, family 5, subfamily T,							109.0	108.0	108.0					11																	56019980		2201	4296	6497	SO:0001589	frameshift_variant	390154				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56019980delG	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.305delG	11.37:g.56019980delG	ENSP00000305403:p.Cys102fs		Somatic					p.C102fs	NM_001004747	NP_001004747	WXS	Illumina HiSeq	Unspecified	Q8NGG3	OR5T3_HUMAN			1	305	+	Esophageal squamous(21;0.00448)		102			Helical; Name=2; (Potential).		Q6IFC7	Frame_Shift_Del	DEL	ENST00000303059.3	37	c.305delG	CCDS31524.1																																																																																				0.373	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	NM_001004747		33	65	NA	NA	NA	NA	NA	33	65	---	---	---	---
ITGA2B	3674	broad.mit.edu	37	17	42462399	42462399	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:42462399delC	ENST00000262407.5	-	7	747	c.716delG	c.(715-717)cgcfs	p.R239fs	ITGA2B_ENST00000353281.4_Frame_Shift_Del_p.R239fs|ITGA2B_ENST00000377068.3_Intron	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	239					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GATGCCTGGGCGGTAACTCGA	0.607																																							uc002igt.1		NA																	0				ovary(2)|lung(1)	3						c.(715-717)CGCfs		integrin alpha 2b preproprotein	Tirofiban(DB00775)						92.0	95.0	94.0					17																	42462399		2203	4300	6503	SO:0001589	frameshift_variant	3674				axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity	g.chr17:42462399delC		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.716delG	17.37:g.42462399delC	ENSP00000262407:p.Arg239fs		Somatic					p.R239fs	NM_000419	NP_000410	WXS	Illumina HiSeq	Unspecified	P08514	ITA2B_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.191)	7	748	-		Prostate(33;0.0181)	239			Extracellular (Potential).		B2RCY8|O95366|Q14443|Q17R67	Frame_Shift_Del	DEL	ENST00000262407.5	37	c.716delG	CCDS32665.1																																																																																				0.607	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1			37	109	NA	NA	NA	NA	NA	37	109	---	---	---	---
GPRC5C	55890	broad.mit.edu	37	17	72436961	72436961	+	Frame_Shift_Del	DEL	T	T	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr17:72436961delT	ENST00000392627.1	+	2	2307	c.1181delT	c.(1180-1182)gttfs	p.V394fs	GPRC5C_ENST00000392629.2_Frame_Shift_Del_p.V361fs|GPRC5C_ENST00000342648.5_Frame_Shift_Del_p.V34fs|GPRC5C_ENST00000481232.1_Intron	NM_022036.2	NP_071319.2	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	349					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						GATGAGCCGGTTGCAGGTGGG	0.552																																							uc002jks.2		NA																	0				ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						c.(1045-1047)GTTfs		G protein-coupled receptor family C, group 5,							76.0	73.0	74.0					17																	72436961		2203	4300	6503	SO:0001589	frameshift_variant	55890					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding	g.chr17:72436961delT	AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000392627.1:c.1181delT	17.37:g.72436961delT	ENSP00000376403:p.Val394fs		Somatic				GPRC5C_uc002jkp.2_Frame_Shift_Del_p.V394fs|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Frame_Shift_Del_p.V361fs|GPRC5C_uc002jkt.2_Frame_Shift_Del_p.V349fs|GPRC5C_uc002jku.2_5'Flank	p.V349fs	NM_018653	NP_061123	WXS	Illumina HiSeq	Unspecified	Q9NQ84	GPC5C_HUMAN			1	1085	+			349			Cytoplasmic (Potential).		B5BUN4|Q2NL85|Q9NZG5	Frame_Shift_Del	DEL	ENST00000392627.1	37	c.1046delT	CCDS11699.1																																																																																				0.552	GPRC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145094.2			11	48	NA	NA	NA	NA	NA	11	48	---	---	---	---
KCTD1	284252	broad.mit.edu	37	18	24039787	24039787	+	Frame_Shift_Del	DEL	T	T	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr18:24039787delT	ENST00000408011.3	-	4	971	c.412delA	c.(412-414)aggfs	p.R138fs	KCTD1_ENST00000317932.7_Frame_Shift_Del_p.R138fs|KCTD1_ENST00000579973.1_Frame_Shift_Del_p.R138fs|KCTD1_ENST00000417602.1_Frame_Shift_Del_p.R746fs|KCTD1_ENST00000580059.1_Frame_Shift_Del_p.R138fs	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1	138					negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			TCACAGGGCCTTGAAAATCGA	0.468																																							uc002kvw.2		NA																	0				ovary(1)	1						c.(412-414)AGGfs		potassium channel tetramerisation domain							107.0	96.0	100.0					18																	24039787		2203	4300	6503	SO:0001589	frameshift_variant	284252				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity	g.chr18:24039787delT	AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.412delA	18.37:g.24039787delT	ENSP00000384367:p.Arg138fs		Somatic				KCTD1_uc010xbj.1_Frame_Shift_Del_p.R746fs|KCTD1_uc010xbk.1_Frame_Shift_Del_p.R138fs|KCTD1_uc002kvy.2_Frame_Shift_Del_p.R56fs	p.R138fs	NM_001136205	NP_001129677	WXS	Illumina HiSeq	Unspecified	Q719H9	KCTD1_HUMAN	Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)		4	972	-	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		138					A8K1F5	Frame_Shift_Del	DEL	ENST00000408011.3	37	c.412delA	CCDS11888.1																																																																																				0.468	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000446265.1	XM_209091		31	39	NA	NA	NA	NA	NA	31	39	---	---	---	---
HOXD12	3238	broad.mit.edu	37	2	176964687	176964689	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	CCA	CCA	-	-	CCA	CCA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr2:176964687_176964689delCCA	ENST00000406506.2	+	1	230_232	c.158_160delCCA	c.(157-162)gccacg>gcg	p.T54del	HOXD12_ENST00000404162.2_In_Frame_Del_p.T54del			P35452	HXD12_HUMAN	homeobox D12	54					embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)	p.A53D(1)		central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		CCCTGGGCCGCCACGCCCGCCTC	0.734																																							uc010zev.1		NA																	1	Substitution - Missense(1)		ovary(1)		0						c.(157-162)GCCACG>GCG		homeobox D12																																				SO:0001651	inframe_deletion	3238					nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176964687_176964689delCCA		CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	ENST00000406506.2:c.158_160delCCA	2.37:g.176964687_176964689delCCA	ENSP00000385586:p.Thr54del		Somatic				HOXD12_uc010zew.1_In_Frame_Del_p.T54del	p.T54del	NM_021193	NP_067016	WXS	Illumina HiSeq	Unspecified	P35452	HXD12_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)	1	158_160	+			54					B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	In_Frame_Del	DEL	ENST00000406506.2	37	c.158_160delCCA	CCDS46456.1																																																																																				0.734	HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359253.2	NM_021193		14	39	NA	NA	NA	NA	NA	14	39	---	---	---	---
NPY2R	4887	broad.mit.edu	37	4	156135819	156135819	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr4:156135819delG	ENST00000329476.3	+	2	1217	c.728delG	c.(727-729)tggfs	p.W243fs	NPY2R_ENST00000506608.1_Frame_Shift_Del_p.W243fs	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	243					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	ACTCGCATTTGGAGTAAATTG	0.443																																							uc003ioq.2		NA																	0				lung(2)|skin(1)	3						c.(727-729)TGGfs		neuropeptide Y receptor Y2							98.0	99.0	99.0					4																	156135819		2203	4300	6503	SO:0001589	frameshift_variant	4887				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity	g.chr4:156135819delG	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.728delG	4.37:g.156135819delG	ENSP00000332591:p.Trp243fs		Somatic				NPY2R_uc003ior.2_Frame_Shift_Del_p.W243fs	p.W243fs	NM_000910	NP_000901	WXS	Illumina HiSeq	Unspecified	P49146	NPY2R_HUMAN			2	1223	+	all_hematologic(180;0.24)	Renal(120;0.0854)	243			Cytoplasmic (Potential).		Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Frame_Shift_Del	DEL	ENST00000329476.3	37	c.728delG	CCDS3791.1																																																																																				0.443	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910		30	66	NA	NA	NA	NA	NA	30	66	---	---	---	---
ACOT12	134526	broad.mit.edu	37	5	80631600	80631600	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:80631600delC	ENST00000307624.3	-	12	1277	c.1249delG	c.(1249-1251)gacfs	p.D417fs	ACOT12_ENST00000508234.1_5'UTR	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	417	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		AAATGGGGGTCCCACAAAGGT	0.393																																							uc003khl.3		NA																	0				ovary(1)|kidney(1)	2						c.(1249-1251)GACfs		acyl-CoA thioesterase 12							82.0	92.0	89.0					5																	80631600		2203	4300	6503	SO:0001589	frameshift_variant	134526				acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity	g.chr5:80631600delC	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.1249delG	5.37:g.80631600delC	ENSP00000303246:p.Asp417fs		Somatic				RNU5E_uc011cto.1_Intron	p.D417fs	NM_130767	NP_570123	WXS	Illumina HiSeq	Unspecified	Q8WYK0	ACO12_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)	12	1304	-		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)	417			START.		B3KVK9|Q5FWE9	Frame_Shift_Del	DEL	ENST00000307624.3	37	c.1249delG	CCDS4055.1																																																																																				0.393	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254074.1	NM_130767		39	54	NA	NA	NA	NA	NA	39	54	---	---	---	---
CAMK4	814	broad.mit.edu	37	5	110818622	110818622	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr5:110818622delG	ENST00000282356.4	+	10	1366	c.968delG	c.(967-969)cggfs	p.R324fs	CAMK4_ENST00000512890.1_3'UTR|CAMK4_ENST00000512453.1_Frame_Shift_Del_p.R324fs	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	324	Calmodulin-binding. {ECO:0000255}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TTCAATGCCCGGCGTAAGCTT	0.368																																							uc011cvj.1		NA																	0				ovary(3)|lung(2)	5						c.(967-969)CGGfs		calcium/calmodulin-dependent protein kinase IV							69.0	67.0	68.0					5																	110818622		2202	4300	6502	SO:0001589	frameshift_variant	814				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr5:110818622delG	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.968delG	5.37:g.110818622delG	ENSP00000282356:p.Arg324fs		Somatic				CAMK4_uc003kpf.2_Frame_Shift_Del_p.R323fs|CAMK4_uc010jbv.2_Frame_Shift_Del_p.R126fs|CAMK4_uc003kpg.2_Frame_Shift_Del_p.R14fs	p.R323fs	NM_001744	NP_001735	WXS	Illumina HiSeq	Unspecified	Q16566	KCC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)	11	1067	+		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)	323			Calmodulin-binding (Potential).|PP2A-binding.		D3DSZ7	Frame_Shift_Del	DEL	ENST00000282356.4	37	c.968delG	CCDS4103.1																																																																																				0.368	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744		10	17	NA	NA	NA	NA	NA	10	17	---	---	---	---
PRRC2A	7916	broad.mit.edu	37	6	31594793	31594793	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:31594793delC	ENST00000376033.2	+	11	1342	c.1108delC	c.(1108-1110)cccfs	p.P371fs	PRRC2A_ENST00000376007.4_Frame_Shift_Del_p.P371fs	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	371	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TGAGGAACGGCCCCCTGAAGC	0.517																																							uc003nvb.3		NA																	0					0						c.(1108-1110)CCCfs		HLA-B associated transcript-2							69.0	72.0	71.0					6																	31594793		2203	4300	6503	SO:0001589	frameshift_variant	7916					cytoplasm|nucleus	protein binding	g.chr6:31594793delC	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1108delC	6.37:g.31594793delC	ENSP00000365201:p.Pro371fs		Somatic				BAT2_uc011dnv.1_RNA|BAT2_uc003nvc.3_Frame_Shift_Del_p.P370fs	p.P370fs	NM_080686	NP_542417	WXS	Illumina HiSeq	Unspecified	P48634	PRC2A_HUMAN			11	1357	+			370			4 X 57 AA type A repeats.|2 X type B repeats.|2-1.		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Frame_Shift_Del	DEL	ENST00000376033.2	37	c.1108delC	CCDS4708.1																																																																																				0.517	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686		20	101	NA	NA	NA	NA	NA	20	101	---	---	---	---
MCHR2	84539	broad.mit.edu	37	6	100395721	100395721	+	Frame_Shift_Del	DEL	C	C	-	rs138925190	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:100395721delC	ENST00000281806.2	-	3	623	c.309delG	c.(307-309)gggfs	p.G103fs	MCHR2_ENST00000369212.2_Frame_Shift_Del_p.G103fs	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		TGCAGAGAGGCCCCCCAAACA	0.488																																							uc003pqh.1		NA																	0				lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8						c.(307-309)GGGfs		melanin-concentrating hormone receptor 2							124.0	128.0	126.0					6																	100395721		2203	4300	6503	SO:0001589	frameshift_variant	84539					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:100395721delC	AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.309delG	6.37:g.100395721delC	ENSP00000281806:p.Gly103fs		Somatic				MCHR2_uc003pqi.1_Frame_Shift_Del_p.G103fs	p.G103fs	NM_001040179	NP_001035269	WXS	Illumina HiSeq	Unspecified	Q969V1	MCHR2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0429)	3	624	-		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)	103			Extracellular (Potential).		B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Frame_Shift_Del	DEL	ENST00000281806.2	37	c.309delG	CCDS5044.1																																																																																				0.488	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041620.2	NM_032503		43	95	NA	NA	NA	NA	NA	43	95	---	---	---	---
SOGA3	387104	broad.mit.edu	37	6	127837137	127837137	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr6:127837137delC	ENST00000525778.1	-	2	1368	c.623delG	c.(622-624)ggcfs	p.G208fs	SOGA3_ENST00000556132.1_Frame_Shift_Del_p.G208fs|SOGA3_ENST00000465909.2_Frame_Shift_Del_p.G208fs|SOGA3_ENST00000481848.2_Frame_Shift_Del_p.G208fs|SOGA3_ENST00000368268.2_Frame_Shift_Del_p.G208fs			Q5TF21	SOGA3_HUMAN	SOGA family member 3	208	Gly-rich.				regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CCCGCCGCTGCCGCCCCTCTG	0.751																																							uc003qbd.2		NA																	0				breast(3)|ovary(2)|skin(1)	6						c.(622-624)GGCfs		hypothetical protein LOC387104 precursor							7.0	8.0	8.0					6																	127837137		1329	3380	4709	SO:0001589	frameshift_variant	387104					integral to membrane		g.chr6:127837137delC	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.623delG	6.37:g.127837137delC	ENSP00000434570:p.Gly208fs		Somatic					p.G208fs	NM_001012279	NP_001012279	WXS	Illumina HiSeq	Unspecified	Q5TF21	CF174_HUMAN		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)	2	1488	-			208			Gly-rich.			Frame_Shift_Del	DEL	ENST00000525778.1	37	c.623delG	CCDS43505.1																																																																																				0.751	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279		9	15	NA	NA	NA	NA	NA	9	15	---	---	---	---
CLCN1	1180	broad.mit.edu	37	7	143039216	143039217	+	Frame_Shift_Ins	INS	-	-	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr7:143039216_143039217insT	ENST00000343257.2	+	15	1864_1865	c.1777_1778insT	c.(1777-1779)cttfs	p.L593fs		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	593					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					CTTGCCTGACCTTGGCTGGAAC	0.535																																							uc003wcr.1		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(1777-1779)CTTfs		chloride channel 1, skeletal muscle																																				SO:0001589	frameshift_variant	1180				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr7:143039216_143039217insT	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1779dupT	7.37:g.143039218_143039218dupT	ENSP00000339867:p.Leu593fs		Somatic				CLCN1_uc011ktc.1_Frame_Shift_Ins_p.L205fs	p.L593fs	NM_000083	NP_000074	WXS	Illumina HiSeq	Unspecified	P35523	CLCN1_HUMAN			15	1864_1865	+	Melanoma(164;0.205)		593			Cytoplasmic (By similarity).		A4D2H5|Q2M202	Frame_Shift_Ins	INS	ENST00000343257.2	37	c.1777_1778insT	CCDS5881.1																																																																																				0.535	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083		24	28	NA	NA	NA	NA	NA	24	28	---	---	---	---
DLGAP2	9228	broad.mit.edu	37	8	1497504	1497505	+	Frame_Shift_Ins	INS	-	-	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:1497504_1497505insT	ENST00000421627.2	+	2	779_780	c.645_646insT	c.(646-648)tggfs	p.W216fs		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	295					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GCATGAGCAGCTGGTGGAGCTC	0.693																																							uc003wpl.2		NA																	0					0						c.(643-648)AGCTGGfs		discs large-associated protein 2																																				SO:0001589	frameshift_variant	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1497504_1497505insT	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.646dupT	8.37:g.1497505_1497505dupT	ENSP00000400258:p.Trp216fs		Somatic				DLGAP2_uc003wpm.2_Frame_Shift_Ins_p.S215fs	p.S215fs	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	2	742_743	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	294_295					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Frame_Shift_Ins	INS	ENST00000421627.2	37	c.645_646insT	CCDS47760.1																																																																																				0.693	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		11	75	NA	NA	NA	NA	NA	11	75	---	---	---	---
POTEA	340441	broad.mit.edu	37	8	43197456	43197456	+	RNA	DEL	A	A	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chr8:43197456delA	ENST00000522175.2	+	0	1209							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TGAACAACTCAAAATGGATTT	0.363																																							uc003xpz.1		NA																	0				ovary(1)	1						c.(1345-1347)AAAfs		POTE ankyrin domain family, member A isoform 2							120.0	115.0	116.0					8																	43197456		1857	4088	5945			340441							g.chr8:43197456delA	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43197456delA			Somatic				POTEA_uc003xqa.1_Frame_Shift_Del_p.K403fs	p.K449fs	NM_001005365	NP_001005365	WXS	Illumina HiSeq	Unspecified	Q6S8J7	POTEA_HUMAN			11	1388	+			449					A6ND17|A6ND71|Q6S8J6	Frame_Shift_Del	DEL	ENST00000522175.2	37	c.1345delA																																																																																					0.363	POTEA-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000383492.1	NM_001002920		18	60	NA	NA	NA	NA	NA	18	60	---	---	---	---
MSN	4478	broad.mit.edu	37	X	64957044	64957044	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:64957044delG	ENST00000360270.5	+	10	1267	c.1095delG	c.(1093-1095)ctgfs	p.L365fs		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	365					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						GCTCAGAACTGGAAGAACAGA	0.532			T	ALK	ALCL																																		uc004dwf.2		NA		Dom	yes		X	Xq11.2-q12	4478	T	moesin			L	ALK		ALCL	MSN/ALK(6)	0				haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						c.(1093-1095)CTGfs		moesin							24.0	22.0	22.0					X																	64957044		2200	4300	6500	SO:0001589	frameshift_variant	4478				leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton	g.chrX:64957044delG	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1095delG	X.37:g.64957044delG	ENSP00000353408:p.Leu365fs		Somatic					p.L365fs	NM_002444	NP_002435	WXS	Illumina HiSeq	Unspecified	P26038	MOES_HUMAN			10	1293	+			365						Frame_Shift_Del	DEL	ENST00000360270.5	37	c.1095delG	CCDS14382.1																																																																																				0.532	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444		10	23	NA	NA	NA	NA	NA	10	23	---	---	---	---
ARMCX2	9823	broad.mit.edu	37	X	100911734	100911735	+	Frame_Shift_Ins	INS	-	-	T			TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:100911734_100911735insT	ENST00000328766.5	-	5	1293_1294	c.840_841insA	c.(838-843)aaaggtfs	p.G281fs	ARMCX2_ENST00000356824.4_Frame_Shift_Ins_p.G281fs|ARMCX2_ENST00000330154.2_Frame_Shift_Ins_p.G281fs|ARMCX2_ENST00000467416.1_5'Flank	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	281						integral component of membrane (GO:0016021)				NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						TTGCCTCCACCTTTGGGTACCG	0.584																																							uc004eid.2		NA																	0				ovary(6)	6						c.(838-843)AAAGGTfs		ALEX2 protein																																				SO:0001589	frameshift_variant	9823					integral to membrane	binding	g.chrX:100911734_100911735insT	AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.841dupA	X.37:g.100911737_100911737dupT	ENSP00000331662:p.Gly281fs		Somatic				ARMCX2_uc004eie.3_Frame_Shift_Ins_p.K280fs|ARMCX2_uc004eif.3_Frame_Shift_Ins_p.K280fs|ARMCX2_uc004eig.3_Frame_Shift_Ins_p.K280fs|ARMCX2_uc010nnt.2_Frame_Shift_Ins_p.K280fs	p.K280fs	NM_177949	NP_808818	WXS	Illumina HiSeq	Unspecified	Q7L311	ARMX2_HUMAN			3	1195_1196	-			280_281					O60267|Q5H9D9	Frame_Shift_Ins	INS	ENST00000328766.5	37	c.840_841insA	CCDS14490.1																																																																																				0.584	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782		42	304	NA	NA	NA	NA	NA	42	304	---	---	---	---
CD99L2	83692	broad.mit.edu	37	X	149937526	149937528	+	In_Frame_Del	DEL	GGC	GGC	-	rs7877654	byFrequency	TCGA-55-7281-01A-11D-2036-08	TCGA-55-7281-10A-01D-2036-08	GGC	GGC	-	-	GGC	GGC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d5443922-fea5-4ff0-bd6e-8ce04e1951d8	7ba2ada7-2353-4035-b73c-9b2a3880a72c	g.chrX:149937526_149937528delGGC	ENST00000370377.3	-	11	885_887	c.768_770delGCC	c.(766-771)ccgccc>ccc	p.256_257PP>P	CD99L2_ENST00000437787.2_In_Frame_Del_p.183_184PP>P|CD99L2_ENST00000466436.1_In_Frame_Del_p.207_208PP>P|CD99L2_ENST00000346693.4_5'UTR|CD99L2_ENST00000355149.3_In_Frame_Del_p.184_185PP>P	NM_001242614.1|NM_031462.3	NP_001229543.1|NP_113650.2	Q8TCZ2	C99L2_HUMAN	CD99 molecule-like 2	256	Poly-Pro.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GGCTGGTTCGGGCGGCGGCGGCG	0.611																																							uc004fel.2		NA																	0				large_intestine(2)|ovary(1)	3						c.(766-771)CCGCCC>CCC		CD99 antigen-like 2 isoform E3'-E4'-E3-E4																																				SO:0001651	inframe_deletion	83692				cell adhesion	cell junction|integral to membrane		g.chrX:149937526_149937528delGGC	BC030536	CCDS14697.1, CCDS14698.1, CCDS35427.1, CCDS55527.1, CCDS76044.1	Xq28	2007-12-04	2006-03-28	2003-02-14	ENSG00000102181	ENSG00000102181			18237	protein-coding gene	gene with protein product		300846	"""MIC2 like 1"", ""CD99 antigen-like 2"""	MIC2L1			Standard	NM_001184808		Approved	CD99B	uc004fek.3	Q8TCZ2	OTTHUMG00000024247	ENST00000370377.3:c.768_770delGCC	X.37:g.149937535_149937537delGGC	ENSP00000359403:p.Pro257del		Somatic				CD99L2_uc004fek.2_RNA|CD99L2_uc004fem.2_In_Frame_Del_p.207_208PP>P|CD99L2_uc004fen.2_In_Frame_Del_p.184_185PP>P|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_In_Frame_Del_p.183_184PP>P	p.256_257PP>P	NM_031462	NP_113650	WXS	Illumina HiSeq	Unspecified	Q8TCZ2	C99L2_HUMAN			11	886_888	-	Acute lymphoblastic leukemia(192;6.56e-05)		256_257			Cytoplasmic (Potential).|Poly-Pro.		A8K2D5|A8K5R0|B3KWG2|B4DDL7|E7EMK5|E9PD27|Q8TAW2|Q8TCZ0|Q8TCZ1|Q9BQG9	In_Frame_Del	DEL	ENST00000370377.3	37	c.768_770delGCC	CCDS35427.1																																																																																				0.611	CD99L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061199.1	NM_031462		9	321	NA	NA	NA	NA	NA	9	321	---	---	---	---
