#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ACOT7	11332	broad.mit.edu	37	1	6387461	6387461	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:6387461C>A	ENST00000377855.2	-	5	699	c.553G>T	c.(553-555)Gag>Tag	p.E185*	ACOT7_ENST00000545482.1_Nonsense_Mutation_p.E70*|ACOT7_ENST00000608083.1_Nonsense_Mutation_p.E143*|ACOT7_ENST00000377842.3_Nonsense_Mutation_p.E134*|ACOT7_ENST00000541130.1_Nonsense_Mutation_p.E155*|ACOT7_ENST00000377845.3_Nonsense_Mutation_p.E155*|ACOT7_ENST00000361521.4_Nonsense_Mutation_p.E175*	NM_181864.2	NP_863654.1	O00154	BACH_HUMAN	acyl-CoA thioesterase 7	185					coenzyme A biosynthetic process (GO:0015937)|fatty acid catabolic process (GO:0009062)|long-chain fatty-acyl-CoA catabolic process (GO:0036116)|medium-chain fatty acid biosynthetic process (GO:0051792)|medium-chain fatty-acyl-CoA catabolic process (GO:0036114)|palmitic acid biosynthetic process (GO:1900535)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)	carboxylic ester hydrolase activity (GO:0052689)|fatty-acyl-CoA binding (GO:0000062)|long-chain fatty acyl-CoA binding (GO:0036042)|palmitoyl-CoA hydrolase activity (GO:0016290)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	16	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		TCCTCCTGCTCCTGCCGGGAA	0.637																																					GBM(74;673 1226 4974 11850 13190)	GBM(74;673 1226 4974 11850 13190)	uc001ams.2		NA																	0					0						c.(553-555)GAG>TAG		acyl-CoA thioesterase 7 isoform hBACHb							71.0	58.0	62.0					1																	6387461		2203	4300	6503	SO:0001587	stop_gained	11332					mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity	g.chr1:6387461C>A	AB074417	CCDS65.1, CCDS66.1, CCDS67.1, CCDS30573.1	1p36	2008-08-14			ENSG00000097021	ENSG00000097021		"""Acyl CoA thioesterases"""	24157	protein-coding gene	gene with protein product	"""brain acyl CoA hydrolase"""	602587				10578051, 16103133, 16940157	Standard	XM_005263427		Approved	BACH, ACH1, ACT, CTE-II, LACH1, MGC1126, hBACH	uc001amt.3	O00154	OTTHUMG00000001295	ENST00000377855.2:c.553G>T	1.37:g.6387461C>A	ENSP00000367086:p.Glu185*		Somatic				ACOT7_uc010nzq.1_Nonsense_Mutation_p.E70*|ACOT7_uc001amt.2_Nonsense_Mutation_p.E175*|ACOT7_uc001amu.2_RNA|ACOT7_uc001amv.2_RNA|ACOT7_uc001amq.2_Nonsense_Mutation_p.E134*|ACOT7_uc001amr.2_Nonsense_Mutation_p.E155*	p.E185*	NM_181864	NP_863654	WXS	Illumina HiSeq	Unspecified	O00154	BACH_HUMAN		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)	5	710	-	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)	185					A8K0K7|A8K232|A8K6B8|A8K837|B3KQ12|O43703|Q53Y78|Q5JYL2|Q5JYL3|Q5JYL4|Q5JYL5|Q5JYL6|Q5TGR4|Q9UJM9|Q9Y539|Q9Y540	Nonsense_Mutation	SNP	ENST00000377855.2	37	c.553G>T	CCDS65.1	.	.	.	.	.	.	.	.	.	.	C	38	7.170165	0.98111	.	.	ENSG00000097021	ENST00000377855;ENST00000377845;ENST00000377842;ENST00000361521;ENST00000545482;ENST00000541130	.	.	.	5.42	5.42	0.78866	.	0.174584	0.49305	D	0.000157	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	17.8024	0.88591	0.0:1.0:0.0:0.0	.	.	.	.	X	185;155;134;175;70;155	.	ENSP00000354615:E175X	E	-	1	0	ACOT7	6310048	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.227000	0.72282	2.543000	0.85770	0.650000	0.86243	GAG		0.637	ACOT7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003773.1	NM_007274		4	35	1	0	1.23904e-05	0.000602	1.4199e-05	4	35				
MAD2L2	10459	broad.mit.edu	37	1	11737658	11737658	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:11737658G>A	ENST00000235310.3	-	6	1101	c.173C>T	c.(172-174)cCg>cTg	p.P58L	MAD2L2_ENST00000376667.3_Missense_Mutation_p.P58L|MAD2L2_ENST00000376672.1_Missense_Mutation_p.P58L|MAD2L2_ENST00000376692.4_Missense_Mutation_p.P58L|MAD2L2_ENST00000376669.5_Missense_Mutation_p.P58L			Q9UI95	MD2L2_HUMAN	MAD2 mitotic arrest deficient-like 2 (yeast)	58	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.|Mediates interaction with REV1 and REV3L and homodimerization.				actin filament organization (GO:0007015)|DNA damage response, signal transduction resulting in transcription (GO:0042772)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|zeta DNA polymerase complex (GO:0016035)	JUN kinase binding (GO:0008432)|RNA polymerase II activating transcription factor binding (GO:0001102)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATTCAGCTCCGGGTGGCAGGA	0.597								DNA polymerases (catalytic subunits)																															uc001asp.2		NA																	0					0						c.(172-174)CCG>CTG	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	MAD2 homolog							155.0	145.0	149.0					1																	11737658		2203	4300	6503	SO:0001583	missense	10459				cell division|DNA damage response, signal transduction resulting in transcription|double-strand break repair|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of mitotic anaphase-promoting complex activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription, DNA-dependent|regulation of cell growth|transcription, DNA-dependent	cytoplasm|nucleoplasm|spindle|zeta DNA polymerase complex	JUN kinase binding	g.chr1:11737658G>A	AF139365	CCDS134.1	1p36	2013-01-17	2001-11-28		ENSG00000116670	ENSG00000116670		"""DNA polymerases"""	6764	protein-coding gene	gene with protein product	"""mitotic arrest deficient homolog-like 2"", ""polymerase (DNA-directed), zeta 2, accessory subunit"""	604094	"""MAD2 (mitotic arrest deficient, yeast, homolog)-like 2"""			10366450	Standard	NM_006341		Approved	MAD2B, REV7, POLZ2	uc009vnc.3	Q9UI95	OTTHUMG00000002231	ENST00000235310.3:c.173C>T	1.37:g.11737658G>A	ENSP00000235310:p.Pro58Leu		Somatic				MAD2L2_uc009vnc.2_Missense_Mutation_p.P58L|MAD2L2_uc001asq.3_Missense_Mutation_p.P58L	p.P58L	NM_006341	NP_006332	WXS	Illumina HiSeq	Unspecified	Q9UI95	MD2L2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	4	361	-	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	58			Mediates interaction with REV1 and REV3L and homodimerization.|HORMA.		B3KNE3|Q5TGW7|Q9UNA7|Q9Y6I6	Missense_Mutation	SNP	ENST00000235310.3	37	c.173C>T	CCDS134.1	.	.	.	.	.	.	.	.	.	.	G	34	5.329639	0.95733	.	.	ENSG00000116670	ENST00000376692;ENST00000235310;ENST00000376672;ENST00000376669;ENST00000376667;ENST00000445656;ENST00000456915;ENST00000376655	.	.	.	5.81	5.81	0.92471	DNA-binding HORMA (4);	0.000000	0.85682	D	0.000000	D	0.85583	0.5730	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86662	0.1905	9	0.51188	T	0.08	-38.3092	18.6216	0.91323	0.0:0.0:1.0:0.0	.	58	Q9UI95	MD2L2_HUMAN	L	58;58;58;58;58;88;58;58	.	ENSP00000235310:P58L	P	-	2	0	MAD2L2	11660245	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.096000	0.94182	2.746000	0.94184	0.555000	0.69702	CCG		0.597	MAD2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006344.2	NM_006341		12	41	0	0	0	0.000978	0	12	41				
TNFRSF8	943	broad.mit.edu	37	1	12186294	12186294	+	Splice_Site	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:12186294G>A	ENST00000263932.2	+	12	1531		c.e12+1		TNFRSF8_ENST00000479933.2_Splice_Site|TNFRSF8_ENST00000417814.2_Splice_Site|TNFRSF8_ENST00000413146.2_Splice_Site	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8						cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	GAGCTTGTGGGTGAGTGTCCA	0.657																																							uc001atq.2		NA																	0				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5						c.e12+1		tumor necrosis factor receptor superfamily,							58.0	62.0	60.0					1																	12186294		2203	4300	6503	SO:0001630	splice_region_variant	943				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane		g.chr1:12186294G>A	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.1309+1G>A	1.37:g.12186294G>A			Somatic				TNFRSF8_uc010obc.1_Splice_Site_p.D326_splice|TNFRSF8_uc001atr.2_Splice_Site|TNFRSF8_uc001ats.2_Splice_Site	p.D437_splice	NM_001243	NP_001234	WXS	Illumina HiSeq	Unspecified	P28908	TNR8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	12	1531	+	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)						B1AN79|B9EGD9|D3YTD8|Q6P4D9	Splice_Site	SNP	ENST00000263932.2	37	c.1309_splice	CCDS144.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.322427	0.60634	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	.	.	.	3.67	3.67	0.42095	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.184	0.48644	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNFRSF8	12108881	1.000000	0.71417	0.781000	0.31783	0.615000	0.37417	3.673000	0.54591	2.353000	0.79882	0.563000	0.77884	.		0.657	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		Intron	13	80	0	0	0	0.004656	0	13	80				
TAS1R2	80834	broad.mit.edu	37	1	19166739	19166739	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:19166739G>A	ENST00000375371.3	-	6	1895	c.1874C>T	c.(1873-1875)cCc>cTc	p.P625L		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	625					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GGAGACCTTGGGCGGCCCCAC	0.622																																							uc001bba.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1873-1875)CCC>CTC		taste receptor, type 1, member 2 precursor	Aspartame(DB00168)						72.0	73.0	73.0					1																	19166739		2203	4300	6503	SO:0001583	missense	80834				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:19166739G>A		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1874C>T	1.37:g.19166739G>A	ENSP00000364520:p.Pro625Leu		Somatic					p.P625L	NM_152232	NP_689418	WXS	Illumina HiSeq	Unspecified	Q8TE23	TS1R2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	6	1875	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	625			Extracellular (Potential).		Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	c.1874C>T	CCDS187.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.327261	0.60743	.	.	ENSG00000179002	ENST00000375371	D	0.90788	-2.73	5.52	5.52	0.82312	GPCR, family 3, C-terminal (2);	0.000000	0.53938	D	0.000057	D	0.95516	0.8543	M	0.88775	2.98	0.80722	D	1	D	0.60160	0.987	P	0.61477	0.889	D	0.95785	0.8820	10	0.59425	D	0.04	.	16.9276	0.86180	0.0:0.0:1.0:0.0	.	625	Q8TE23	TS1R2_HUMAN	L	625	ENSP00000364520:P625L	ENSP00000364520:P625L	P	-	2	0	TAS1R2	19039326	1.000000	0.71417	0.899000	0.35326	0.090000	0.18270	7.832000	0.86757	2.600000	0.87896	0.561000	0.74099	CCC		0.622	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			16	85	0	0	0	0.003163	0	16	85				
HSPG2	3339	broad.mit.edu	37	1	22188551	22188551	+	Nonsense_Mutation	SNP	C	C	A	rs201665758		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:22188551C>A	ENST00000374695.3	-	38	4877	c.4798G>T	c.(4798-4800)Gga>Tga	p.G1600*		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1600	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GTGGCATCTCCGTAGTAGCCA	0.622																																							uc001bfj.2		NA																	0				ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9						c.(4798-4800)GGA>TGA		heparan sulfate proteoglycan 2 precursor	Becaplermin(DB00102)|Palifermin(DB00039)						75.0	74.0	75.0					1																	22188551		2203	4300	6503	SO:0001587	stop_gained	3339				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	g.chr1:22188551C>A	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.4798G>T	1.37:g.22188551C>A	ENSP00000363827:p.Gly1600*		Somatic				HSPG2_uc009vqd.2_Nonsense_Mutation_p.G1601*	p.G1600*	NM_005529	NP_005520	WXS	Illumina HiSeq	Unspecified	P98160	PGBM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	38	4838	-		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	1600			Laminin EGF-like 10.		Q16287|Q5SZI3|Q9H3V5	Nonsense_Mutation	SNP	ENST00000374695.3	37	c.4798G>T	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	46	12.895996	0.99704	.	.	ENSG00000142798	ENST00000374695	.	.	.	5.48	5.48	0.80851	.	0.000000	0.39083	N	0.001479	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.8781	0.86057	0.0:1.0:0.0:0.0	.	.	.	.	X	1600	.	ENSP00000363827:G1600X	G	-	1	0	HSPG2	22061138	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	7.166000	0.77553	2.848000	0.98002	0.655000	0.94253	GGA		0.622	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		45	71	1	0	1.06522e-23	0.003214	1.6288e-23	45	71				
CNR2	1269	broad.mit.edu	37	1	24202088	24202088	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:24202088G>T	ENST00000374472.4	-	2	181	c.20C>A	c.(19-21)aCa>aAa	p.T7K	CNR2_ENST00000536471.1_Missense_Mutation_p.T7K	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	7					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	GGCTATCTCTGTCACCCAGCA	0.483																																							uc001bif.2		NA																	0				skin(2)|central_nervous_system(1)	3						c.(19-21)ACA>AAA		cannabinoid receptor 2 (macrophage)	Nabilone(DB00486)						95.0	102.0	99.0					1																	24202088		2202	4298	6500	SO:0001583	missense	1269				behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity	g.chr1:24202088G>T	X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.20C>A	1.37:g.24202088G>T	ENSP00000363596:p.Thr7Lys		Somatic					p.T7K	NM_001841	NP_001832	WXS	Illumina HiSeq	Unspecified	P34972	CNR2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	2	147	-		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)	7			Extracellular (Potential).		C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Missense_Mutation	SNP	ENST00000374472.4	37	c.20C>A	CCDS245.1	.	.	.	.	.	.	.	.	.	.	G	9.949	1.219725	0.22373	.	.	ENSG00000188822	ENST00000374472;ENST00000536471	T;T	0.77489	-1.1;-1.1	5.18	-9.17	0.00691	.	0.842277	0.09998	N	0.728869	T	0.47801	0.1465	N	0.02539	-0.55	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.40664	-0.9551	10	0.30854	T	0.27	.	13.6714	0.62427	0.1709:0.1079:0.7211:0.0	.	7	P34972	CNR2_HUMAN	K	7	ENSP00000363596:T7K;ENSP00000442830:T7K	ENSP00000363596:T7K	T	-	2	0	CNR2	24074675	0.000000	0.05858	0.000000	0.03702	0.840000	0.47671	-1.188000	0.03064	-1.344000	0.02216	-0.367000	0.07326	ACA		0.483	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038949.1	NM_001841		52	107	1	0	8.99859e-20	0.00361	1.33331e-19	52	107				
RSRP1	57035	broad.mit.edu	37	1	25573269	25573269	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:25573269G>A	ENST00000243189.7	-	2	462	c.186C>T	c.(184-186)tcC>tcT	p.S62S	C1orf63_ENST00000417642.2_Silent_p.S55S|RP3-465N24.6_ENST00000607698.1_lincRNA|C1orf63_ENST00000431849.2_Silent_p.S62S	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN		62	Arg/Ser-rich.									breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AACGGGACCTGGACTTGCTCC	0.652																																							uc001bjw.2		NA																	0				pancreas(1)	1						c.(184-186)TCC>TCT		hypothetical protein LOC57035							49.0	56.0	53.0					1																	25573269		2202	4299	6501	SO:0001819	synonymous_variant	57035							g.chr1:25573269G>A																												ENST00000243189.7:c.186C>T	1.37:g.25573269G>A			Somatic					p.S62S	NM_020317	NP_064713	WXS	Illumina HiSeq	Unspecified	Q9BUV0	CA063_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	2	438	-		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)	62			Arg-rich.		A8K917|Q49AA4|Q5TH71|Q9GZP6	Silent	SNP	ENST00000243189.7	37	c.186C>T	CCDS260.1																																																																																				0.652	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101966.2			29	96	0	0	0	0.007291	0	29	96				
ZSCAN20	7579	broad.mit.edu	37	1	33956991	33956991	+	Missense_Mutation	SNP	A	A	G	rs529615717	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:33956991A>G	ENST00000361328.3	+	6	1286	c.1133A>G	c.(1132-1134)tAt>tGt	p.Y378C	ZSCAN20_ENST00000373413.2_Missense_Mutation_p.Y324C	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	378					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CAATGTCGCTATAGGGTCAAA	0.577													A|||	2	0.000399361	0.0	0.0	5008	,	,		18421	0.002		0.0	False		,,,				2504	0.0						uc001bxj.3		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1132-1134)TAT>TGT		zinc finger protein 31							94.0	99.0	98.0					1																	33956991		1965	4160	6125	SO:0001583	missense	7579				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:33956991A>G	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1133A>G	1.37:g.33956991A>G	ENSP00000355053:p.Tyr378Cys		Somatic				ZSCAN20_uc001bxk.2_Missense_Mutation_p.Y324C|ZSCAN20_uc009vui.2_Missense_Mutation_p.Y378C	p.Y378C	NM_145238	NP_660281	WXS	Illumina HiSeq	Unspecified	P17040	ZSC20_HUMAN			6	1300	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	378					A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	c.1133A>G	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	A	19.00	3.742519	0.69418	.	.	ENSG00000121903	ENST00000373411;ENST00000326544;ENST00000373413;ENST00000361328;ENST00000401072	T;T	0.41400	1.0;3.34	5.74	5.74	0.90152	SANT domain, DNA binding (1);	0.000000	0.56097	D	0.000031	T	0.53530	0.1802	L	0.35249	1.045	0.43317	D	0.995335	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.98;0.999	T	0.53613	-0.8414	10	0.51188	T	0.08	-31.2988	14.301	0.66352	1.0:0.0:0.0:0.0	.	378;324;378	P17040-3;P17040-4;P17040	.;.;ZSC20_HUMAN	C	324;378;324;312;312	ENSP00000362512:Y324C;ENSP00000355053:Y312C	ENSP00000324450:Y378C	Y	+	2	0	ZSCAN20	33729578	1.000000	0.71417	0.995000	0.50966	0.918000	0.54935	4.993000	0.63895	2.326000	0.78906	0.533000	0.62120	TAT		0.577	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238		17	131	0	0	0	0.008871	0	17	131				
GJA4	2701	broad.mit.edu	37	1	35260515	35260515	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:35260515G>A	ENST00000342280.4	+	2	789	c.701G>A	c.(700-702)cGc>cAc	p.R234H		NM_002060.2	NP_002051.2	P35212	CXA4_HUMAN	gap junction protein, alpha 4, 37kDa	234					blood vessel development (GO:0001568)|calcium ion transport (GO:0006816)|cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|endothelium development (GO:0003158)|response to pain (GO:0048265)|transport (GO:0006810)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(4)|stomach(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				CTGCTGTGTCGCTGCCTCAGC	0.602																																							uc001bya.2		NA																	0				central_nervous_system(1)	1						c.(700-702)CGC>CAC		connexin 37							75.0	74.0	75.0					1																	35260515		2203	4300	6503	SO:0001583	missense	2701				cell-cell junction assembly	integral to plasma membrane		g.chr1:35260515G>A	M96789	CCDS30669.1	1p35.1	2008-02-05	2007-01-16		ENSG00000187513	ENSG00000187513		"""Ion channels / Gap junction proteins (connexins)"""	4278	protein-coding gene	gene with protein product	"""connexin 37"""	121012	"""gap junction protein, alpha 4, 37kD (connexin 37)"", ""gap junction protein, alpha 4, 37kDa (connexin 37)"""			9843209, 7680674	Standard	XM_005270750		Approved	CX37	uc001bya.3	P35212	OTTHUMG00000004050	ENST00000342280.4:c.701G>A	1.37:g.35260515G>A	ENSP00000343676:p.Arg234His		Somatic				GJA4_uc009vul.2_Missense_Mutation_p.R310H|GJA4_uc009vum.1_Missense_Mutation_p.R234H	p.R234H	NM_002060	NP_002051	WXS	Illumina HiSeq	Unspecified	P35212	CXA4_HUMAN			2	789	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)	234			Cytoplasmic (Potential).		A8K698|D3DPR4|Q9P106|Q9UBL1|Q9UNA9|Q9UNB0|Q9UNB1|Q9Y5N7	Missense_Mutation	SNP	ENST00000342280.4	37	c.701G>A	CCDS30669.1	.	.	.	.	.	.	.	.	.	.	G	8.083	0.772728	0.16051	.	.	ENSG00000187513	ENST00000342280;ENST00000450137;ENST00000543143	D;D	0.97710	-4.45;-4.5	5.52	1.43	0.22495	.	0.574380	0.17126	N	0.186004	D	0.94870	0.8342	L	0.56769	1.78	0.33112	D	0.54061	B;B	0.15719	0.014;0.004	B;B	0.09377	0.004;0.001	D	0.91239	0.5020	10	0.72032	D	0.01	.	4.3041	0.10938	0.4598:0.0:0.3877:0.1525	.	234;234	Q5JW71;P35212	.;CXA4_HUMAN	H	234	ENSP00000343676:R234H;ENSP00000409186:R234H	ENSP00000343676:R234H	R	+	2	0	GJA4	35033102	0.050000	0.20438	0.065000	0.19835	0.038000	0.13279	1.721000	0.38032	0.002000	0.14630	-0.314000	0.08810	CGC		0.602	GJA4-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011556.1	NM_002060		12	58	0	0	0	0.001368	0	12	58				
GNL2	29889	broad.mit.edu	37	1	38047903	38047903	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:38047903G>A	ENST00000373062.3	-	8	928	c.830C>T	c.(829-831)cCa>cTa	p.P277L		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	277	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				AGCAAGTGTTGGATAATCCTG	0.433																																							uc001cbk.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(829-831)CCA>CTA		guanine nucleotide binding protein-like 2							96.0	82.0	87.0					1																	38047903		2203	4300	6503	SO:0001583	missense	29889				ribosome biogenesis	nucleolus	GTP binding|GTPase activity|protein binding	g.chr1:38047903G>A	L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.830C>T	1.37:g.38047903G>A	ENSP00000362153:p.Pro277Leu		Somatic				GNL2_uc010oif.1_Missense_Mutation_p.P118L	p.P277L	NM_013285	NP_037417	WXS	Illumina HiSeq	Unspecified	Q13823	NOG2_HUMAN			8	993	-		Myeloproliferative disorder(586;0.0393)	277					Q9BWN7	Missense_Mutation	SNP	ENST00000373062.3	37	c.830C>T	CCDS421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.350898|5.350898	0.95830|0.95830	.|.	.|.	ENSG00000134697|ENSG00000134697	ENST00000373062;ENST00000545489|ENST00000538069	T|.	0.13420|.	2.59|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.84306|.	0.5443|.	M|M	0.87900|0.87900	2.915|2.915	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|.	0.85761|.	0.1349|.	10|.	0.87932|.	D|.	0|.	-13.635|-13.635	19.6991|19.6991	0.96045|0.96045	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	277|.	Q13823|.	NOG2_HUMAN|.	L|X	277;118|61	ENSP00000362153:P277L|.	ENSP00000362153:P277L|.	P|Q	-|-	2|1	0|0	GNL2|GNL2	37820490|37820490	1.000000|1.000000	0.71417|0.71417	0.955000|0.955000	0.39395|0.39395	0.937000|0.937000	0.57800|0.57800	9.822000|9.822000	0.99363|0.99363	2.655000|2.655000	0.90218|0.90218	0.585000|0.585000	0.79938|0.79938	CCA|CAA		0.433	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285		5	50	0	0	0	0.001168	0	5	50				
DMBX1	127343	broad.mit.edu	37	1	46976208	46976208	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:46976208C>A	ENST00000360032.3	+	2	229	c.215C>A	c.(214-216)gCg>gAg	p.A72E	DMBX1_ENST00000371956.4_Missense_Mutation_p.A77E	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					AGCCGCACAGCGTTCACGGCT	0.587																																							uc001cpx.2		NA																	0				ovary(1)	1						c.(229-231)GCG>GAG		diencephalon/mesencephalon homeobox 1 isoform b							72.0	65.0	67.0					1																	46976208		2203	4300	6503	SO:0001583	missense	127343				brain development|developmental growth|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:46976208C>A	AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.215C>A	1.37:g.46976208C>A	ENSP00000353132:p.Ala72Glu		Somatic				DMBX1_uc001cpw.2_Missense_Mutation_p.A72E	p.A77E	NM_147192	NP_671725	WXS	Illumina HiSeq	Unspecified	Q8NFW5	DMBX1_HUMAN			2	245	+	Acute lymphoblastic leukemia(166;0.155)		77			Homeobox.|Interacts with OXT2 and is required for repressor activity (By similarity).			Missense_Mutation	SNP	ENST00000360032.3	37	c.230C>A	CCDS536.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380883	0.82792	.	.	ENSG00000197587	ENST00000371956;ENST00000360032	D;D	0.96265	-3.96;-3.96	4.81	4.81	0.61882	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.048680	0.85682	D	0.000000	D	0.97763	0.9266	M	0.72479	2.2	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.76071	0.987;0.978	D	0.98681	1.0692	10	0.87932	D	0	.	17.2476	0.87032	0.0:1.0:0.0:0.0	.	77;72	Q8NFW5;Q8NFW5-2	DMBX1_HUMAN;.	E	77;72	ENSP00000361024:A77E;ENSP00000353132:A72E	ENSP00000353132:A72E	A	+	2	0	DMBX1	46748795	1.000000	0.71417	0.223000	0.23860	0.637000	0.38172	7.786000	0.85741	2.403000	0.81681	0.491000	0.48974	GCG		0.587	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021895.1			10	41	1	0	0.000442599	0.006214	0.000483003	10	41				
ORC1	4998	broad.mit.edu	37	1	52841232	52841232	+	Missense_Mutation	SNP	T	T	C	rs539320346		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:52841232T>C	ENST00000371568.3	-	15	2391	c.2173A>G	c.(2173-2175)Atc>Gtc	p.I725V	ORC1_ENST00000371566.1_Missense_Mutation_p.I725V	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	725	Necessary and sufficient for ORC complex assembly.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CGCCTGCAGATGTCCAGGCAC	0.532													T|||	1	0.000199681	0.0008	0.0	5008	,	,		18339	0.0		0.0	False		,,,				2504	0.0						uc001ctt.2		NA																	0					0						c.(2173-2175)ATC>GTC		origin recognition complex, subunit 1							124.0	112.0	116.0					1																	52841232		2203	4300	6503	SO:0001583	missense	4998				cell cycle checkpoint|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nuclear origin of replication recognition complex|nucleolus|nucleoplasm|plasma membrane	ATP binding|DNA binding|nucleoside-triphosphatase activity|protein binding	g.chr1:52841232T>C		CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.2173A>G	1.37:g.52841232T>C	ENSP00000360623:p.Ile725Val		Somatic				ORC1L_uc010oni.1_Missense_Mutation_p.I720V|ORC1L_uc001ctu.2_Missense_Mutation_p.I725V|ORC1L_uc009vzd.2_Missense_Mutation_p.I479V	p.I725V	NM_004153	NP_004144	WXS	Illumina HiSeq	Unspecified	Q13415	ORC1_HUMAN			15	2392	-			725			Necessary and sufficient for ORC complex assembly.		D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	37	c.2173A>G	CCDS566.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.664143	0.88251	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.55930	0.49;0.49	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.66489	0.2794	L	0.55017	1.72	0.80722	D	1	D;D	0.65815	0.988;0.995	P;D	0.64410	0.883;0.925	T	0.67011	-0.5778	10	0.49607	T	0.09	-18.4499	15.6246	0.76845	0.0:0.0:0.0:1.0	.	720;725	B7Z8H0;Q13415	.;ORC1_HUMAN	V	725	ENSP00000360623:I725V;ENSP00000360621:I725V	ENSP00000360621:I725V	I	-	1	0	ORC1	52613820	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.490000	0.66881	2.272000	0.75746	0.460000	0.39030	ATC		0.532	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153		40	73	0	0	0	0.006999	0	40	73				
LRRC7	57554	broad.mit.edu	37	1	70504893	70504893	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:70504893C>G	ENST00000035383.5	+	19	3302	c.3272C>G	c.(3271-3273)cCa>cGa	p.P1091R	LRRC7_ENST00000310961.5_Missense_Mutation_p.P1096R|LRRC7_ENST00000415775.2_Missense_Mutation_p.P375R	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1091						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TTTTCTCAGCCATCTGTGAAT	0.532																																							uc001dep.2		NA																	0				ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(3271-3273)CCA>CGA		leucine rich repeat containing 7							71.0	75.0	73.0					1																	70504893		2203	4300	6503	SO:0001583	missense	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70504893C>G		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.3272C>G	1.37:g.70504893C>G	ENSP00000035383:p.Pro1091Arg		Somatic				LRRC7_uc009wbg.2_Missense_Mutation_p.P375R|LRRC7_uc001deq.2_Missense_Mutation_p.P332R	p.P1091R	NM_020794	NP_065845	WXS	Illumina HiSeq	Unspecified	Q96NW7	LRRC7_HUMAN			19	3302	+			1091					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	c.3272C>G	CCDS645.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.472012	0.01044	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.36157	1.27;1.35;2.43	5.76	5.76	0.90799	.	0.128282	0.56097	D	0.000037	T	0.37128	0.0992	L	0.50333	1.59	0.50813	D	0.999895	B;D;P	0.62365	0.157;0.991;0.651	B;P;B	0.62382	0.036;0.901;0.198	T	0.10042	-1.0647	10	0.06757	T	0.87	.	18.9453	0.92620	0.0:1.0:0.0:0.0	.	375;1091;1091	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	R	1096;1091;375;914	ENSP00000309245:P1096R;ENSP00000035383:P1091R;ENSP00000394867:P375R	ENSP00000035383:P1091R	P	+	2	0	LRRC7	70277481	1.000000	0.71417	0.964000	0.40570	0.016000	0.09150	5.711000	0.68400	2.721000	0.93114	0.655000	0.94253	CCA		0.532	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		34	66	0	0	0	0.002836	0	34	66				
IFI44L	10964	broad.mit.edu	37	1	79101021	79101021	+	Splice_Site	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:79101021G>T	ENST00000370751.5	+	5	902		c.e5-1		IFI44L_ENST00000342282.3_Splice_Site|IFI44L_ENST00000476521.1_Splice_Site	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like						defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						TTTTTTAACAGTATAGGATAT	0.358																																							uc010oro.1		NA																	0					0						c.e5-1		interferon-induced protein 44-like							66.0	71.0	70.0					1																	79101021		2203	4300	6503	SO:0001630	splice_region_variant	10964					cytoplasm		g.chr1:79101021G>T	AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.724-1G>T	1.37:g.79101021G>T			Somatic				IFI44L_uc010orp.1_Splice_Site|IFI44L_uc010orq.1_Splice_Site	p.Y242_splice	NM_006820	NP_006811	WXS	Illumina HiSeq	Unspecified	Q53G44	IF44L_HUMAN			5	903	+								Q86TE1|Q96B64|Q99984	Splice_Site	SNP	ENST00000370751.5	37	c.724_splice	CCDS687.2	.	.	.	.	.	.	.	.	.	.	G	16.06	3.017148	0.54576	.	.	ENSG00000137959	ENST00000370751	.	.	.	4.54	3.59	0.41128	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6148	0.51083	0.0:0.0:0.8206:0.1794	.	.	.	.	.	-1	.	.	.	+	.	.	IFI44L	78873609	1.000000	0.71417	0.913000	0.36048	0.900000	0.52787	3.847000	0.55895	1.170000	0.42753	0.508000	0.49915	.		0.358	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026834.3	NM_006820	Intron	11	61	1	0	1.58986e-06	0.008291	1.87085e-06	11	61				
GBP5	115362	broad.mit.edu	37	1	89726426	89726426	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:89726426C>A	ENST00000370459.3	-	11	1849	c.1722G>T	c.(1720-1722)caG>caT	p.Q574H	GBP5_ENST00000343435.5_Missense_Mutation_p.Q574H|GBP5_ENST00000471171.1_5'UTR|RP4-620F22.2_ENST00000437128.1_RNA			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	574	Required for tetramerization. {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		TAACAGTCCTCTGGGCGTGCT	0.403																																							uc001dnc.2		NA																	0				ovary(1)	1						c.(1720-1722)CAG>CAT		guanylate-binding protein 5							201.0	184.0	190.0					1																	89726426		2203	4300	6503	SO:0001583	missense	115362					plasma membrane	GTP binding|GTPase activity	g.chr1:89726426C>A	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.1722G>T	1.37:g.89726426C>A	ENSP00000359488:p.Gln574His		Somatic				GBP5_uc001dnd.2_Missense_Mutation_p.Q574H	p.Q574H	NM_052942	NP_443174	WXS	Illumina HiSeq	Unspecified	Q96PP8	GBP5_HUMAN		all cancers(265;0.00784)|Epithelial(280;0.0286)	12	2259	-			574					B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	37	c.1722G>T	CCDS722.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.501779	0.26949	.	.	ENSG00000154451	ENST00000343435;ENST00000370459	T;T	0.55234	0.53;0.53	4.34	-1.27	0.09347	Guanylate-binding protein, C-terminal (1);	0.656003	0.15012	N	0.285520	T	0.22781	0.0550	L	0.55103	1.725	0.09310	N	1	P	0.41366	0.747	B	0.41860	0.368	T	0.17198	-1.0377	10	0.56958	D	0.05	0.5054	0.7732	0.01028	0.1673:0.3774:0.1632:0.2921	.	574	Q96PP8	GBP5_HUMAN	H	574	ENSP00000340396:Q574H;ENSP00000359488:Q574H	ENSP00000340396:Q574H	Q	-	3	2	GBP5	89499014	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.038000	0.13862	-0.012000	0.14223	-0.149000	0.13747	CAG		0.403	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942		26	103	1	0	1.88708e-17	0.008361	2.72694e-17	26	103				
DPYD	1806	broad.mit.edu	37	1	98015199	98015199	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:98015199C>A	ENST00000370192.3	-	12	1541	c.1441G>T	c.(1441-1443)Gat>Tat	p.D481Y		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	481					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	CCAACGACATCACCACCTGCA	0.428																																							uc001drv.2		NA																	0				ovary(3)|skin(3)|breast(2)	8						c.(1441-1443)GAT>TAT		dihydropyrimidine dehydrogenase isoform 1	Capecitabine(DB01101)|Enfuvirtide(DB00109)						169.0	140.0	150.0					1																	98015199		2203	4300	6503	SO:0001583	missense	1806				'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity	g.chr1:98015199C>A	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1441G>T	1.37:g.98015199C>A	ENSP00000359211:p.Asp481Tyr		Somatic					p.D481Y	NM_000110	NP_000101	WXS	Illumina HiSeq	Unspecified	Q12882	DPYD_HUMAN		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	12	1578	-		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)	481			FAD (Potential).		A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	c.1441G>T	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.283976	0.59867	.	.	ENSG00000188641	ENST00000370192	D	0.85861	-2.04	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.96516	0.8863	H	0.99475	4.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97439	1.0020	10	0.87932	D	0	-29.6226	20.8598	0.99761	0.0:1.0:0.0:0.0	.	481	Q12882	DPYD_HUMAN	Y	481	ENSP00000359211:D481Y	ENSP00000359211:D481Y	D	-	1	0	DPYD	97787787	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	7.432000	0.80349	2.937000	0.99478	0.650000	0.86243	GAT		0.428	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110		17	88	1	0	3.41278e-10	0.00499	4.4544e-10	17	88				
DPYD	1806	broad.mit.edu	37	1	98187196	98187196	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:98187196G>C	ENST00000370192.3	-	5	453	c.353C>G	c.(352-354)tCt>tGt	p.S118C	DPYD_ENST00000423006.2_Missense_Mutation_p.S81C|DPYD_ENST00000474241.1_5'UTR|DPYD_ENST00000306031.5_Missense_Mutation_p.S118C	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	118					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TGGGTTGTCAGAAAATATCAT	0.338																																							uc001drv.2		NA																	0				ovary(3)|skin(3)|breast(2)	8						c.(352-354)TCT>TGT		dihydropyrimidine dehydrogenase isoform 1	Capecitabine(DB01101)|Enfuvirtide(DB00109)						87.0	85.0	86.0					1																	98187196		2203	4299	6502	SO:0001583	missense	1806				'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity	g.chr1:98187196G>C	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.353C>G	1.37:g.98187196G>C	ENSP00000359211:p.Ser118Cys		Somatic				DPYD_uc010oub.1_RNA|DPYD_uc001drw.2_Missense_Mutation_p.S118C	p.S118C	NM_000110	NP_000101	WXS	Illumina HiSeq	Unspecified	Q12882	DPYD_HUMAN		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	5	490	-		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)	118					A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	c.353C>G	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711043	0.89112	.	.	ENSG00000188641	ENST00000370192;ENST00000423006;ENST00000306031	T;T;T	0.73152	-0.72;-0.72;-0.72	6.06	6.06	0.98353	Fumarate reductase, C-terminal (1);Alpha-helical ferredoxin (1);	0.000000	0.85682	D	0.000000	D	0.87378	0.6162	M	0.91090	3.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88529	0.3101	10	0.87932	D	0	-22.9383	20.6397	0.99537	0.0:0.0:1.0:0.0	.	118;118	E9PFN1;Q12882	.;DPYD_HUMAN	C	118;81;118	ENSP00000359211:S118C;ENSP00000398884:S81C;ENSP00000307107:S118C	ENSP00000307107:S118C	S	-	2	0	DPYD	97959784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.405000	0.97313	2.880000	0.98712	0.650000	0.86243	TCT		0.338	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110		14	99	0	0	0	0.003163	0	14	99				
OLFM3	118427	broad.mit.edu	37	1	102462361	102462361	+	Silent	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:102462361C>G	ENST00000370103.4	-	1	225	c.12G>C	c.(10-12)acG>acC	p.T4T	OLFM3_ENST00000462354.1_5'UTR	NM_058170.2	NP_477518.2	Q96PB7	NOE3_HUMAN	olfactomedin 3	18					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		GAAGGTTGGACGTCGCCTGCA	0.443																																							uc001dug.2		NA																	0				ovary(2)|skin(1)	3						c.(10-12)ACG>ACC		olfactomedin 3							156.0	158.0	157.0					1																	102462361		2203	4300	6503	SO:0001819	synonymous_variant	118427					extracellular region		g.chr1:102462361C>G	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000370103.4:c.12G>C	1.37:g.102462361C>G			Somatic				OLFM3_uc001duh.2_RNA|OLFM3_uc001dui.2_RNA|OLFM3_uc001duj.2_5'UTR	p.T4T	NM_058170	NP_477518	WXS	Illumina HiSeq	Unspecified	Q96PB7	NOE3_HUMAN		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)	1	430	-		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Silent	SNP	ENST00000370103.4	37	c.12G>C	CCDS30781.1																																																																																				0.443	OLFM3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030144.1			10	57	0	0	0	0.006214	0	10	57				
COL11A1	1301	broad.mit.edu	37	1	103471818	103471818	+	Splice_Site	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:103471818C>A	ENST00000370096.3	-	16	2049	c.1737G>T	c.(1735-1737)agG>agT	p.R579S	COL11A1_ENST00000358392.2_Splice_Site_p.R591S|COL11A1_ENST00000512756.1_Splice_Site_p.R463S|COL11A1_ENST00000353414.4_Splice_Site_p.R540S|COL11A1_ENST00000461720.1_5'UTR	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	579	Collagen-like 2.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TAAGCCATACCCTTTTTCCAG	0.353																																							uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(1735-1737)AGG>AGT		alpha 1 type XI collagen isoform A							54.0	61.0	58.0					1																	103471818		2203	4300	6503	SO:0001630	splice_region_variant	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103471818C>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1737+1G>T	1.37:g.103471818C>A			Somatic				COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.R591S|COL11A1_uc001dun.2_Missense_Mutation_p.R540S|COL11A1_uc009weh.2_Missense_Mutation_p.R463S	p.R579S	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	16	2055	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	579			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.1737G>T	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.105524	0.56291	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.21	5.5	5.5	0.81552	.	0.046716	0.85682	D	0.000000	D	0.95252	0.8460	M	0.71036	2.16	0.80722	D	1	D;D;D;D	0.61080	0.985;0.981;0.989;0.985	D;D;D;D	0.75020	0.977;0.962;0.985;0.977	D	0.94679	0.7863	9	.	.	.	.	13.6602	0.62363	0.0:0.926:0.0:0.074	.	463;540;591;579	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	S	579;591;540;463	ENSP00000359114:R579S;ENSP00000351163:R591S;ENSP00000302551:R540S;ENSP00000426533:R463S	.	R	-	3	2	COL11A1	103244406	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	2.413000	0.44618	2.587000	0.87381	0.563000	0.77884	AGG		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	Missense_Mutation	10	67	1	0	1.08611e-07	0.000978	1.31634e-07	10	67				
WDR47	22911	broad.mit.edu	37	1	109524457	109524457	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:109524457C>T	ENST00000369962.3	-	13	2518	c.2296G>A	c.(2296-2298)Ggc>Agc	p.G766S	WDR47_ENST00000357672.3_Missense_Mutation_p.G738S|WDR47_ENST00000361054.3_Missense_Mutation_p.G738S|WDR47_ENST00000400794.3_Missense_Mutation_p.G774S|WDR47_ENST00000369965.4_Missense_Mutation_p.G767S			O94967	WDR47_HUMAN	WD repeat domain 47	766					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		ATCATCCAGCCACTCCAGGTA	0.383																																							uc001dwj.2		NA																	0				ovary(1)	1						c.(2296-2298)GGC>AGC		WD repeat domain 47 isoform 3							102.0	103.0	102.0					1																	109524457		2203	4300	6503	SO:0001583	missense	22911							g.chr1:109524457C>T	AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.2296G>A	1.37:g.109524457C>T	ENSP00000358979:p.Gly766Ser		Somatic				WDR47_uc001dwl.2_Missense_Mutation_p.G774S|WDR47_uc001dwi.2_Missense_Mutation_p.G767S|WDR47_uc010ovf.1_Missense_Mutation_p.G691S	p.G766S	NM_001142551	NP_001136023	WXS	Illumina HiSeq	Unspecified	O94967	WDR47_HUMAN		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)	13	2672	-		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)	766			WD 4.		A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Missense_Mutation	SNP	ENST00000369962.3	37	c.2296G>A	CCDS44187.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.021459	0.93462	.	.	ENSG00000085433	ENST00000400794;ENST00000369962;ENST00000361054;ENST00000369965;ENST00000357672	D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83	5.4	5.4	0.78164	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87422	0.6173	L	0.45581	1.43	0.80722	D	1	B;P;D;B	0.62365	0.207;0.843;0.991;0.207	B;P;D;B	0.63283	0.413;0.56;0.913;0.348	D	0.86398	0.1740	10	0.42905	T	0.14	-0.0039	19.1641	0.93546	0.0:1.0:0.0:0.0	.	738;774;766;767	O94967-2;A8MX09;O94967;O94967-3	.;.;WDR47_HUMAN;.	S	774;766;738;767;738	ENSP00000383599:G774S;ENSP00000358979:G766S;ENSP00000354339:G738S;ENSP00000358982:G767S;ENSP00000350301:G738S	ENSP00000350301:G738S	G	-	1	0	WDR47	109325980	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.532000	0.85374	0.591000	0.81541	GGC		0.383	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032414.2	NM_014969		8	126	0	0	0	0.00308	0	8	126				
ADORA3	140	broad.mit.edu	37	1	112045664	112045664	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:112045664C>T	ENST00000241356.4	-	1	718	c.313G>A	c.(313-315)Gct>Act	p.A105T	ADORA3_ENST00000486342.1_5'UTR|ADORA3_ENST00000369716.4_Missense_Mutation_p.A105T|ADORA3_ENST00000369717.4_Intron	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor	105			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.A105T(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	CGGTCCACAGCGATGGCCAGC	0.552																																							uc001ebh.3		NA																	1	Substitution - Missense(1)	p.A105T(1)	large_intestine(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.(313-315)GCT>ACT		adenosine A3 receptor isoform 2	Adenosine(DB00640)|Aminophylline(DB01223)						65.0	53.0	57.0					1																	112045664		2203	4300	6503	SO:0001583	missense	140				activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled	g.chr1:112045664C>T	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.313G>A	1.37:g.112045664C>T	ENSP00000241356:p.Ala105Thr		Somatic				ADORA3_uc001ebg.3_Intron|ADORA3_uc001ebf.2_Missense_Mutation_p.A105T	p.A105T	NM_000677	NP_000668	WXS	Illumina HiSeq	Unspecified	P33765	AA3R_HUMAN		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	1	1080	-		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)	105		A -> T (in a colorectal cancer sample; somatic mutation).	Helical; Name=3; (By similarity).		A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000241356.4	37	c.313G>A	CCDS839.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.920791	0.92249	.	.	ENSG00000121933	ENST00000369716;ENST00000241356	T;T	0.76186	-1.0;-1.0	5.26	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000276	D	0.82930	0.5144	M	0.70108	2.13	0.53005	D	0.999968	D;D	0.76494	0.999;0.996	D;P	0.66497	0.944;0.879	D	0.84392	0.0555	10	0.72032	D	0.01	-14.8213	18.8155	0.92075	0.0:1.0:0.0:0.0	.	105;105	P33765;P33765-2	AA3R_HUMAN;.	T	105	ENSP00000358730:A105T;ENSP00000241356:A105T	ENSP00000241356:A105T	A	-	1	0	ADORA3	111847187	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.445000	0.80570	2.613000	0.88420	0.561000	0.74099	GCT		0.552	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033065.1	NM_000677, NM_020683		4	41	0	0	0	0.009096	0	4	41				
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:145367767G>A	ENST00000342960.5	+	83	10398	c.10363G>A	c.(10363-10365)Gaa>Aaa	p.E3455K	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	755						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.E3455K(5)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.423																																							uc001end.3		NA																	5	Substitution - Missense(5)		skin(2)|urinary_tract(1)|kidney(1)|central_nervous_system(1)		0						c.(10588-10590)GAA>AAA		hypothetical protein LOC100132406																																				SO:0001583	missense	100132406							g.chr1:145367767G>A	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10363G>A	1.37:g.145367767G>A	ENSP00000345684:p.Glu3455Lys		Somatic				NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	p.E3530K	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	85	10623	+	all_hematologic(923;0.032)		3455					Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	c.10588G>A	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	0.008	-1.929795	0.00488	.	.	ENSG00000163386	ENST00000369339;ENST00000342960	T	0.02552	4.25	.	.	.	.	.	.	.	.	T	0.00784	0.0026	L	0.51422	1.61	0.09310	N	1	.	.	.	.	.	.	T	0.46162	-0.9211	4	0.02654	T	1	.	.	.	.	.	.	.	.	K	575;3455	ENSP00000345684:E3455K	ENSP00000345684:E3455K	E	+	1	0	NBPF10	144079124	0.039000	0.19947	.	.	.	.	0.000000	0.12993	.	.	.	.	GAA		0.423	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		4	69	0	0	0	0.001984	0	4	69				
THEM4	117145	broad.mit.edu	37	1	151860831	151860831	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:151860831T>C	ENST00000368814.3	-	4	824	c.475A>G	c.(475-477)Atg>Gtg	p.M159V	THEM4_ENST00000477437.1_5'UTR	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	159					epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GCATCAATCATGGTTGCAATG	0.398																																							uc001ezj.1		NA																	0					0						c.(475-477)ATG>GTG		thioesterase superfamily member 4							101.0	87.0	92.0					1																	151860831		2203	4300	6503	SO:0001583	missense	117145				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|ruffle membrane		g.chr1:151860831T>C	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.475A>G	1.37:g.151860831T>C	ENSP00000357804:p.Met159Val		Somatic				THEM4_uc001ezk.1_RNA	p.M159V	NM_053055	NP_444283	WXS	Illumina HiSeq	Unspecified	Q5T1C6	THEM4_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.181)		4	654	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		159					B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	c.475A>G	CCDS1006.1	.	.	.	.	.	.	.	.	.	.	T	9.180	1.023291	0.19433	.	.	ENSG00000159445	ENST00000368814	T	0.21932	1.98	5.11	3.98	0.46160	Thioesterase superfamily (1);	0.092153	0.64402	D	0.000001	T	0.07369	0.0186	L	0.42686	1.345	0.80722	D	1	B	0.25850	0.136	B	0.23852	0.049	T	0.09930	-1.0652	10	0.27082	T	0.32	-9.0148	9.3404	0.38076	0.0:0.0:0.1957:0.8043	.	159	Q5T1C6	THEM4_HUMAN	V	159	ENSP00000357804:M159V	ENSP00000357804:M159V	M	-	1	0	THEM4	150127455	1.000000	0.71417	0.995000	0.50966	0.167000	0.22549	2.285000	0.43487	1.040000	0.40099	0.533000	0.62120	ATG		0.398	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055		49	64	0	0	0	0.00361	0	49	64				
RPTN	126638	broad.mit.edu	37	1	152127445	152127445	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:152127445G>T	ENST00000316073.3	-	3	2194	c.2130C>A	c.(2128-2130)ggC>ggA	p.G710G		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	710	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						AAGTTTGATGGCCCTGCTCTT	0.567																																							uc001ezs.1		NA																	0					0						c.(2128-2130)GGC>GGA		repetin							332.0	270.0	289.0					1																	152127445		1568	3582	5150	SO:0001819	synonymous_variant	126638					proteinaceous extracellular matrix	calcium ion binding	g.chr1:152127445G>T	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.2130C>A	1.37:g.152127445G>T			Somatic					p.G710G	NM_001122965	NP_001116437	WXS	Illumina HiSeq	Unspecified	Q6XPR3	RPTN_HUMAN			3	2195	-			710			Gln-rich.		B7ZBZ3	Silent	SNP	ENST00000316073.3	37	c.2130C>A	CCDS41397.1																																																																																				0.567	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312		190	188	1	0	4.72421e-73	0.00361	7.83891e-73	190	188				
HRNR	388697	broad.mit.edu	37	1	152192519	152192519	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:152192519C>A	ENST00000368801.2	-	3	1661	c.1586G>T	c.(1585-1587)gGa>gTa	p.G529V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	529					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCGGCTGTGTCCCAAAGATTG	0.567																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(1585-1587)GGA>GTA		hornerin							197.0	197.0	197.0					1																	152192519		2203	4300	6503	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152192519C>A	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1586G>T	1.37:g.152192519C>A	ENSP00000357791:p.Gly529Val		Somatic					p.G529V	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1662	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		529			5.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.1586G>T	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	3.290	-0.145067	0.06627	.	.	ENSG00000197915	ENST00000368801	T	0.02552	4.25	2.47	0.351	0.16042	.	.	.	.	.	T	0.00637	0.0021	N	0.14661	0.345	0.09310	N	1	P	0.44734	0.842	B	0.42653	0.394	T	0.45862	-0.9232	9	0.25751	T	0.34	.	4.3178	0.11002	0.2226:0.6388:0.0:0.1386	.	529	Q86YZ3	HORN_HUMAN	V	529	ENSP00000357791:G529V	ENSP00000357791:G529V	G	-	2	0	HRNR	150459143	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.159000	0.16442	-0.043000	0.13513	-0.147000	0.13772	GGA		0.567	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		16	439	1	0	1.3612e-06	0.003163	1.6126e-06	16	439				
CD1A	909	broad.mit.edu	37	1	158225078	158225078	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:158225078G>A	ENST00000289429.5	+	2	796	c.263G>A	c.(262-264)cGt>cAt	p.R88H		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	88					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	ACATTATTCCGTATACGCACC	0.488																																							uc001frt.2		NA																	0				pancreas(2)|skin(1)	3						c.(262-264)CGT>CAT		CD1A antigen precursor	Antithymocyte globulin(DB00098)						110.0	106.0	107.0					1																	158225078		2203	4300	6503	SO:0001583	missense	909				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex		g.chr1:158225078G>A	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.263G>A	1.37:g.158225078G>A	ENSP00000289429:p.Arg88His		Somatic					p.R88H	NM_001763	NP_001754	WXS	Illumina HiSeq	Unspecified	P06126	CD1A_HUMAN			2	796	+	all_hematologic(112;0.0378)		88			Extracellular (Potential).		D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Missense_Mutation	SNP	ENST00000289429.5	37	c.263G>A	CCDS1174.1	.	.	.	.	.	.	.	.	.	.	G	6.590	0.477274	0.12521	.	.	ENSG00000158477	ENST00000289429	T	0.00801	5.68	4.07	-5.68	0.02436	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.928450	0.02879	N	0.132647	T	0.00271	0.0008	N	0.12961	0.28	0.09310	N	1	B	0.18741	0.03	B	0.15870	0.014	T	0.41574	-0.9501	10	0.29301	T	0.29	0.0856	12.438	0.55610	0.7665:0.0:0.2335:0.0	.	88	P06126	CD1A_HUMAN	H	88	ENSP00000289429:R88H	ENSP00000289429:R88H	R	+	2	0	CD1A	156491702	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.125000	0.03257	-1.211000	0.02624	-1.389000	0.01157	CGT		0.488	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763		18	74	0	0	0	0.00499	0	18	74				
CD1C	911	broad.mit.edu	37	1	158262005	158262005	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:158262005G>T	ENST00000368170.3	+	3	739	c.460G>T	c.(460-462)Ggc>Tgc	p.G154C		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	154					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					GCCATCTCCAGGCTGTGGAAG	0.458																																							uc001fru.2		NA																	0				ovary(2)|skin(1)|pancreas(1)	4						c.(460-462)GGC>TGC		CD1C antigen precursor							194.0	197.0	196.0					1																	158262005		2203	4300	6503	SO:0001583	missense	911				antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding	g.chr1:158262005G>T	M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.460G>T	1.37:g.158262005G>T	ENSP00000357152:p.Gly154Cys		Somatic				CD1C_uc001frv.2_Translation_Start_Site	p.G154C	NM_001765	NP_001756	WXS	Illumina HiSeq	Unspecified	P29017	CD1C_HUMAN			3	752	+	all_hematologic(112;0.0378)		154			Extracellular (Potential).		Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	ENST00000368170.3	37	c.460G>T	CCDS1175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	10.23|10.23	1.293137|1.293137	0.23564|0.23564	.|.	.|.	ENSG00000158481|ENSG00000158481	ENST00000368169;ENST00000368170|ENST00000443761	T|.	0.07688|.	3.17|.	3.92|3.92	2.0|2.0	0.26442|0.26442	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);|.	0.689942|.	0.11876|.	N|.	0.520941|.	T|T	0.22166|0.22166	0.0534|0.0534	L|L	0.52905|0.52905	1.665|1.665	0.09310|0.09310	N|N	1|1	P|.	0.42483|.	0.781|.	B|.	0.32762|.	0.152|.	T|T	0.20140|0.20140	-1.0284|-1.0284	10|5	0.62326|.	D|.	0.03|.	.|.	6.394|6.394	0.21603|0.21603	0.2311:0.0:0.7689:0.0|0.2311:0.0:0.7689:0.0	.|.	154|.	P29017|.	CD1C_HUMAN|.	C|M	154|88	ENSP00000357152:G154C|.	ENSP00000357151:G154C|.	G|R	+|+	1|2	0|0	CD1C|CD1C	156528629|156528629	0.011000|0.011000	0.17503|0.17503	0.001000|0.001000	0.08648|0.08648	0.007000|0.007000	0.05969|0.05969	0.555000|0.555000	0.23422|0.23422	0.430000|0.430000	0.26230|0.26230	0.644000|0.644000	0.83932|0.83932	GGC|AGG		0.458	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046351.2	NM_001765		57	350	1	0	2.48909e-17	0.00361	3.58701e-17	57	350				
OR10X1	128367	broad.mit.edu	37	1	158549373	158549373	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:158549373C>T	ENST00000368150.1	-	1	316	c.317G>A	c.(316-318)aGa>aAa	p.R106K		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					TGAAATGCTTCTGTCCTTGGC	0.478																																							uc010pin.1		NA																	0				ovary(1)	1						c.(316-318)AGA>AAA		olfactory receptor, family 10, subfamily X,							100.0	99.0	99.0					1																	158549373		2203	4300	6503	SO:0001583	missense	128367				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158549373C>T	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.317G>A	1.37:g.158549373C>T	ENSP00000357132:p.Arg106Lys		Somatic					p.R106K	NM_001004477	NP_001004477	WXS	Illumina HiSeq	Unspecified	Q8NGY0	O10X1_HUMAN			1	317	-	all_hematologic(112;0.0378)		106			Extracellular (Potential).		Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	c.317G>A	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	C	2.603	-0.292543	0.05568	.	.	ENSG00000186400	ENST00000368150	T	0.36157	1.27	5.0	2.09	0.27110	GPCR, rhodopsin-like superfamily (1);	0.489426	0.19035	N	0.124437	T	0.04724	0.0128	N	0.12920	0.275	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.43376	-0.9395	10	0.05721	T	0.95	.	7.361	0.26745	0.0:0.5758:0.0:0.4242	.	106	Q8NGY0	O10X1_HUMAN	K	106	ENSP00000357132:R106K	ENSP00000357132:R106K	R	-	2	0	OR10X1	156815997	0.000000	0.05858	0.063000	0.19743	0.595000	0.36748	-0.582000	0.05814	0.273000	0.22049	0.557000	0.71058	AGA		0.478	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477		7	140	0	0	0	0.004482	0	7	140				
SPTA1	6708	broad.mit.edu	37	1	158627350	158627350	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:158627350G>T	ENST00000368147.4	-	19	2902	c.2722C>A	c.(2722-2724)Ctg>Atg	p.L908M		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	908					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L908M(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCTTCATGCAGGTCAGCCAGG	0.483																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(2722-2724)CTG>ATG		spectrin, alpha, erythrocytic 1							171.0	172.0	172.0					1																	158627350		2023	4201	6224	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158627350G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2722C>A	1.37:g.158627350G>T	ENSP00000357129:p.Leu908Met		Somatic					p.L908M	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			19	2921	-	all_hematologic(112;0.0378)		908			Spectrin 10.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.2722C>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.172368	0.57584	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.51574	0.7;0.7	4.68	1.78	0.24846	.	0.000000	0.26704	N	0.022923	T	0.45518	0.1346	M	0.73217	2.22	0.29509	N	0.854311	D	0.69078	0.997	D	0.75484	0.986	T	0.29212	-1.0019	10	0.40728	T	0.16	.	5.49	0.16771	0.2272:0.2273:0.5455:0.0	.	908	P02549	SPTA1_HUMAN	M	908	ENSP00000357130:L908M;ENSP00000357129:L908M	ENSP00000357129:L908M	L	-	1	2	SPTA1	156893974	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.924000	0.40065	0.293000	0.22520	-0.126000	0.14955	CTG		0.483	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		24	271	1	0	1.85244e-09	0.00333	2.35928e-09	24	271				
OR6K2	81448	broad.mit.edu	37	1	158670208	158670208	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:158670208G>C	ENST00000359610.2	-	1	278	c.235C>G	c.(235-237)Cca>Gca	p.P79A		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					AGCATCTTTGGGATTGTGGCT	0.463																																							uc001fsu.1		NA																	0				pancreas(1)	1						c.(235-237)CCA>GCA		olfactory receptor, family 6, subfamily K,							92.0	89.0	90.0					1																	158670208		2203	4300	6503	SO:0001583	missense	81448				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158670208G>C	BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.235C>G	1.37:g.158670208G>C	ENSP00000352626:p.Pro79Ala		Somatic					p.P79A	NM_001005279	NP_001005279	WXS	Illumina HiSeq	Unspecified	Q8NGY2	OR6K2_HUMAN			1	235	-	all_hematologic(112;0.0378)		79			Extracellular (Potential).		B9EH33|Q6IFR6	Missense_Mutation	SNP	ENST00000359610.2	37	c.235C>G	CCDS30902.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.287029	0.40494	.	.	ENSG00000196171	ENST00000359610	T	0.01838	4.61	4.95	4.95	0.65309	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41294	D	0.000910	T	0.16428	0.0395	H	0.96996	3.92	0.38117	D	0.937735	D	0.89917	1.0	D	0.91635	0.999	T	0.22417	-1.0217	10	0.87932	D	0	-4.8185	17.1191	0.86697	0.0:0.0:1.0:0.0	.	79	Q8NGY2	OR6K2_HUMAN	A	79	ENSP00000352626:P79A	ENSP00000352626:P79A	P	-	1	0	OR6K2	156936832	1.000000	0.71417	0.991000	0.47740	0.059000	0.15707	4.425000	0.59875	2.534000	0.85438	0.655000	0.94253	CCA		0.463	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279		24	98	0	0	0	0.00278	0	24	98				
OR6K6	128371	broad.mit.edu	37	1	158724731	158724731	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:158724731C>G	ENST00000368144.2	+	1	222	c.126C>G	c.(124-126)ttC>ttG	p.F42L		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					AGTTCCTCTTCTCTATGTTCC	0.428																																							uc001fsw.1		NA																	0				skin(1)	1						c.(124-126)TTC>TTG		olfactory receptor, family 6, subfamily K,							203.0	189.0	193.0					1																	158724731		2203	4300	6503	SO:0001583	missense	128371				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158724731C>G	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.126C>G	1.37:g.158724731C>G	ENSP00000357126:p.Phe42Leu		Somatic					p.F42L	NM_001005184	NP_001005184	WXS	Illumina HiSeq	Unspecified	Q8NGW6	OR6K6_HUMAN			1	126	+	all_hematologic(112;0.0378)		42			Extracellular (Potential).		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	c.126C>G	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	C	6.649	0.488308	0.12641	.	.	ENSG00000180433	ENST00000368144	T	0.00606	6.26	5.11	2.27	0.28462	.	0.000000	0.46442	D	0.000297	T	0.00241	0.0007	N	0.05306	-0.075	0.32621	N	0.523335	D	0.89917	1.0	D	0.87578	0.998	T	0.50931	-0.8769	10	0.02654	T	1	-20.2963	8.5576	0.33492	0.0:0.7469:0.0:0.2531	.	42	Q8NGW6	OR6K6_HUMAN	L	42	ENSP00000357126:F42L	ENSP00000357126:F42L	F	+	3	2	OR6K6	156991355	0.000000	0.05858	0.838000	0.33150	0.089000	0.18198	-0.943000	0.03917	0.339000	0.23719	-0.136000	0.14681	TTC		0.428	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184		22	249	0	0	0	0.002299	0	22	249				
OR10J3	441911	broad.mit.edu	37	1	159283771	159283771	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:159283771G>T	ENST00000332217.5	-	1	678	c.679C>A	c.(679-681)Ctt>Att	p.L227I		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					GCAATCTTAAGAATGGTGGAG	0.488																																							uc010piu.1		NA																	0				ovary(2)	2						c.(679-681)CTT>ATT		olfactory receptor, family 10, subfamily J,							159.0	141.0	147.0					1																	159283771		2203	4300	6503	SO:0001583	missense	441911				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:159283771G>T		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.679C>A	1.37:g.159283771G>T	ENSP00000331789:p.Leu227Ile		Somatic					p.L227I	NM_001004467	NP_001004467	WXS	Illumina HiSeq	Unspecified	Q5JRS4	O10J3_HUMAN			1	679	-	all_hematologic(112;0.0429)		227			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000332217.5	37	c.679C>A	CCDS30909.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739891	0.49045	.	.	ENSG00000196266	ENST00000332217	T	0.00302	8.2	5.34	3.44	0.39384	GPCR, rhodopsin-like superfamily (1);	0.306010	0.17889	U	0.158565	T	0.00210	0.0006	M	0.64630	1.985	0.09310	N	1	D	0.67145	0.996	D	0.71414	0.973	T	0.40059	-0.9583	10	0.59425	D	0.04	.	8.7023	0.34334	0.0801:0.0:0.7695:0.1504	.	227	Q5JRS4	O10J3_HUMAN	I	227	ENSP00000331789:L227I	ENSP00000331789:L227I	L	-	1	0	OR10J3	157550395	0.851000	0.29673	0.952000	0.39060	0.903000	0.53119	1.111000	0.31159	0.783000	0.33636	0.655000	0.94253	CTT		0.488	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			92	97	1	0	1.40862e-40	0.00361	2.31542e-40	92	97				
FCRLA	84824	broad.mit.edu	37	1	161681008	161681009	+	Missense_Mutation	DNP	CC	CC	AT	rs142998045		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:161681008_161681009CC>AT	ENST00000236938.6	+	3	536_537	c.294_295CC>AT	c.(292-297)atCCtc>atATtc	p.L99F	FCRLA_ENST00000540926.1_Missense_Mutation_p.L88F|FCRLA_ENST00000367959.2_Missense_Mutation_p.L105F|FCRLA_ENST00000470841.1_3'UTR|FCRLA_ENST00000367950.1_Intron|FCRLA_ENST00000294796.4_Intron|FCRLA_ENST00000540521.1_Intron|FCRLA_ENST00000546024.1_Intron|FCRLA_ENST00000367953.3_Missense_Mutation_p.L88F|FCRLA_ENST00000350710.3_Intron|FCRLA_ENST00000349527.4_Missense_Mutation_p.L82F|FCRLA_ENST00000309691.6_Intron|FCRLA_ENST00000367949.2_Intron|FCRLA_ENST00000367957.2_Intron	NM_032738.3	NP_116127.3	Q7L513	FCRLA_HUMAN	Fc receptor-like A	82	Ig-like C2-type 1.				cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			ACTGGCTGATCCTCCAAGGTCC	0.589																																							uc001gbe.2		NA																	0					0						c.(310-315)ATCCTC>ATATTC		Fc receptor-like and mucin-like 1																																				SO:0001583	missense	84824				cell differentiation	cytoplasm|extracellular region		g.chr1:161681008_161681009CC>AT	AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	Exception_encountered	1.37:g.161681008_161681009delinsAT	ENSP00000236938:p.Leu99Phe		Somatic				FCRLA_uc001gbd.2_Missense_Mutation_p.L99F|FCRLA_uc001gbf.2_Intron|FCRLA_uc001gbg.2_Intron|FCRLA_uc009wuo.2_Intron|FCRLA_uc009wup.2_Intron|FCRLA_uc009wuq.2_Intron	p.L105F	NM_032738	NP_116127	WXS	Illumina HiSeq	Unspecified	Q7L513	FCRLA_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00301)		4	554_555	+	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		82			Ig-like C2-type 1.		A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	Missense_Mutation	DNP	ENST00000236938.6	37	c.312_313CC>AT	CCDS30926.1																																																																																				0.589	FCRLA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083574.1	NM_032738		28	28	0	0	0	0.004672	0	28	28				
DDR2	4921	broad.mit.edu	37	1	162740157	162740157	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:162740157G>C	ENST00000367922.3	+	13	1797	c.1359G>C	c.(1357-1359)atG>atC	p.M453I	DDR2_ENST00000367921.3_Missense_Mutation_p.M453I	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	453					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	ATTCTAGCATGTTCAACAATA	0.517																																					NSCLC(161;314 2006 8283 19651 23192)	NSCLC(161;314 2006 8283 19651 23192)	uc001gcf.2		NA																	0				lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6						c.(1357-1359)ATG>ATC		discoidin domain receptor family, member 2							242.0	212.0	222.0					1																	162740157		2203	4300	6503	SO:0001583	missense	4921				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:162740157G>C	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.1359G>C	1.37:g.162740157G>C	ENSP00000356899:p.Met453Ile		Somatic				DDR2_uc001gcg.2_Missense_Mutation_p.M453I	p.M453I	NM_001014796	NP_001014796	WXS	Illumina HiSeq	Unspecified	Q16832	DDR2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.113)		13	1824	+	all_hematologic(112;0.115)		453			Cytoplasmic (Potential).		Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	c.1359G>C	CCDS1241.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.52|14.52	2.560998|2.560998	0.45590|0.45590	.|.	.|.	ENSG00000162733|ENSG00000162733	ENST00000367922;ENST00000367921;ENST00000458105|ENST00000433757	T;T;T|.	0.70869|.	-0.52;-0.52;-0.52|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.189413|.	0.64402|.	D|.	0.000013|.	T|T	0.46521|0.46521	0.1397|0.1397	L|L	0.28274|0.28274	0.84|0.84	.|.	.|.	.|.	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.37842|0.37842	-0.9688|-0.9688	9|4	0.11794|.	T|.	0.64|.	.|.	18.6038|18.6038	0.91259|0.91259	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	453|.	Q16832|.	DDR2_HUMAN|.	I|L	453;453;63|46	ENSP00000356899:M453I;ENSP00000356898:M453I;ENSP00000417030:M63I|.	ENSP00000356898:M453I|.	M|V	+|+	3|1	0|0	DDR2|DDR2	161006781|161006781	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	5.690000|5.690000	0.68241|0.68241	2.733000|2.733000	0.93635|0.93635	0.655000|0.655000	0.94253|0.94253	ATG|GTT		0.517	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182		37	242	0	0	0	0.004878	0	37	242				
PBX1	5087	broad.mit.edu	37	1	164761873	164761873	+	Silent	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:164761873T>C	ENST00000420696.2	+	3	596	c.408T>C	c.(406-408)tcT>tcC	p.S136S	PBX1_ENST00000559240.1_Silent_p.S136S|PBX1_ENST00000401534.1_Silent_p.S136S|PBX1_ENST00000367897.1_Silent_p.S136S|PBX1_ENST00000540246.1_Silent_p.S31S|PBX1_ENST00000560641.1_Silent_p.S31S|PBX1_ENST00000540236.1_Silent_p.S136S	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	136					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						cggcggcTTCTGGAGGGGCAG	0.607			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																		uc001gct.2		NA		Dom	yes		1	1q23	5087	T	pre-B-cell leukemia transcription factor 1			"""L, M"""	TCF3|EWSR1		pre B-ALL|myoepithelioma	EWSR1/PBX1(3)	0				soft_tissue(3)|lung(1)|skin(1)	5						c.(406-408)TCT>TCC		pre-B-cell leukemia homeobox 1							20.0	26.0	24.0					1																	164761873		2197	4295	6492	SO:0001819	synonymous_variant	5087				negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr1:164761873T>C	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.408T>C	1.37:g.164761873T>C			Somatic				PBX1_uc010pku.1_Silent_p.S136S|PBX1_uc010pkv.1_Silent_p.S53S|PBX1_uc001gcs.2_Silent_p.S136S|PBX1_uc010pkw.1_Silent_p.S26S	p.S136S	NM_002585	NP_002576	WXS	Illumina HiSeq	Unspecified	P40424	PBX1_HUMAN			3	666	+			136					B4DSC1|F5H4U9|Q5T488	Silent	SNP	ENST00000420696.2	37	c.408T>C	CCDS1246.1																																																																																				0.607	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585		11	61	0	0	0	0.001368	0	11	61				
CD247	919	broad.mit.edu	37	1	167403267	167403267	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:167403267A>G	ENST00000362089.5	-	6	455	c.383T>C	c.(382-384)aTg>aCg	p.M128T	CD247_ENST00000392122.3_Missense_Mutation_p.M127T|CD247_ENST00000483825.1_5'UTR			P20963	CD3Z_HUMAN	CD247 molecule	128	ITAM 2. {ECO:0000255|PROSITE- ProRule:PRU00379}.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	alpha-beta T cell receptor complex (GO:0042105)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)	6			LUSC - Lung squamous cell carcinoma(543;0.236)		Muromonab(DB00075)	CTCGCCTTTCATCCCAATCTC	0.507																																					Ovarian(192;1815 2869 36877 43334)	Ovarian(192;1815 2869 36877 43334)	uc001gei.3		NA																	0					0						c.(382-384)ATG>ACG		T-cell receptor zeta chain isoform 1 precursor							264.0	239.0	248.0					1																	167403267		2203	4300	6503	SO:0001583	missense	919				interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity	g.chr1:167403267A>G	BC025703	CCDS1260.1, CCDS1261.1	1q24.2	2014-09-17	2006-03-28	2006-03-09	ENSG00000198821	ENSG00000198821		"""CD molecules"""	1677	protein-coding gene	gene with protein product		186780	"""CD3z antigen, zeta polypeptide (TiT3 complex)"", ""CD247 antigen"""	CD3Z		2974162	Standard	NM_198053		Approved	CD3H, CD3Q	uc001gei.4	P20963	OTTHUMG00000034593	ENST00000362089.5:c.383T>C	1.37:g.167403267A>G	ENSP00000354782:p.Met128Thr		Somatic				CD247_uc001gej.3_Missense_Mutation_p.M127T	p.M128T	NM_198053	NP_932170	WXS	Illumina HiSeq	Unspecified	P20963	CD3Z_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.236)		6	528	-			128			Cytoplasmic (Potential).|ITAM 2.		B1AK49|Q5VX13|Q8TAX4	Missense_Mutation	SNP	ENST00000362089.5	37	c.383T>C	CCDS1261.1	.	.	.	.	.	.	.	.	.	.	A	0.045	-1.269204	0.01421	.	.	ENSG00000198821	ENST00000392122;ENST00000362089	T;T	0.36520	1.25;1.25	5.13	2.75	0.32379	.	.	.	.	.	T	0.04003	0.0112	N	0.02916	-0.46	0.23776	N	0.996875	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.41858	-0.9485	8	0.17369	T	0.5	.	4.3349	0.11081	0.6318:0.0:0.2308:0.1374	.	127;128	P20963-3;P20963	.;CD3Z_HUMAN	T	127;128	ENSP00000375969:M127T;ENSP00000354782:M128T	ENSP00000354782:M128T	M	-	2	0	CD247	165669891	0.046000	0.20272	0.261000	0.24466	0.139000	0.21198	0.348000	0.20031	0.388000	0.25054	0.533000	0.62120	ATG		0.507	CD247-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083707.1	NM_198053		10	260	0	0	0	0.000978	0	10	260				
PRRC2C	23215	broad.mit.edu	37	1	171505341	171505341	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:171505341G>T	ENST00000338920.4	+	14	2448	c.2211G>T	c.(2209-2211)tgG>tgT	p.W737C	PRRC2C_ENST00000426496.2_Missense_Mutation_p.W737C|PRRC2C_ENST00000367742.3_Missense_Mutation_p.W739C|PRRC2C_ENST00000392078.3_Missense_Mutation_p.W739C	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	737	Pro-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										ATCCAAGGTGGCTCATGATGC	0.473																																							uc010pmg.1		NA																	0					0						c.(2209-2211)TGG>TGT		HBxAg transactivated protein 2							149.0	115.0	127.0					1																	171505341		2203	4300	6503	SO:0001583	missense	23215						protein C-terminus binding	g.chr1:171505341G>T	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.2211G>T	1.37:g.171505341G>T	ENSP00000343629:p.Trp737Cys		Somatic					p.W737C	NM_015172	NP_055987	WXS	Illumina HiSeq	Unspecified	Q9Y520	PRC2C_HUMAN			14	2477	+			737			Pro-rich.		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	c.2211G>T	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426761	0.43020	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.81	5.81	0.92471	.	0.000000	0.43110	D	0.000616	T	0.39009	0.1062	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.19712	-1.0297	10	0.87932	D	0	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	737	Q9Y520-4	.	C	739;738;737;739;737;494;496	ENSP00000375928:W739C;ENSP00000410219:W737C;ENSP00000356716:W739C;ENSP00000343629:W737C	ENSP00000343629:W737C	W	+	3	0	PRRC2C	169771965	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.090000	0.94144	2.736000	0.93811	0.655000	0.94253	TGG		0.473	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172		22	24	1	0	1.22574e-08	0.002299	1.53144e-08	22	24				
TNR	7143	broad.mit.edu	37	1	175292530	175292530	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:175292530A>T	ENST00000367674.2	-	23	4748	c.4040T>A	c.(4039-4041)cTc>cAc	p.L1347H	TNR_ENST00000263525.2_Missense_Mutation_p.L1347H|RP3-518E13.2_ENST00000569593.1_RNA			Q92752	TENR_HUMAN	tenascin R	1347					associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CCCTGCCATGAGACGGTGGTT	0.468																																							uc001gkp.1		NA																	0				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(4039-4041)CTC>CAC		tenascin R precursor							159.0	142.0	148.0					1																	175292530		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175292530A>T	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.4040T>A	1.37:g.175292530A>T	ENSP00000356646:p.Leu1347His		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.L1347H	p.L1347H	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			21	4121	-	Renal(580;0.146)		1347					C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.4040T>A	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	A	7.701	0.693131	0.15039	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.27402	1.67;1.67	5.37	2.92	0.33932	.	0.411677	0.25613	N	0.029464	T	0.12987	0.0315	N	0.11927	0.2	0.23632	N	0.997241	B	0.24368	0.102	B	0.22386	0.039	T	0.15292	-1.0442	10	0.21540	T	0.41	.	2.9047	0.05716	0.3633:0.0:0.3637:0.2731	.	1347	Q92752	TENR_HUMAN	H	1347;1347;1257	ENSP00000356646:L1347H;ENSP00000263525:L1347H	ENSP00000263525:L1347H	L	-	2	0	TNR	173559153	0.998000	0.40836	0.076000	0.20297	0.008000	0.06430	1.375000	0.34295	0.818000	0.34468	0.459000	0.35465	CTC		0.468	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		11	110	0	0	0	0.001368	0	11	110				
PAPPA2	60676	broad.mit.edu	37	1	176659540	176659540	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:176659540C>T	ENST00000367662.3	+	5	3569	c.2405C>T	c.(2404-2406)cCg>cTg	p.P802L	PAPPA2_ENST00000367661.3_Missense_Mutation_p.P802L	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	802					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCAGGGGCTCCGTTCACCAAC	0.567																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(2404-2406)CCG>CTG		pappalysin 2 isoform 1							78.0	78.0	78.0					1																	176659540		1925	4134	6059	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176659540C>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2405C>T	1.37:g.176659540C>T	ENSP00000356634:p.Pro802Leu		Somatic				PAPPA2_uc001gky.1_Missense_Mutation_p.P802L|PAPPA2_uc009www.2_RNA	p.P802L	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			5	3569	+			802					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.2405C>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	32	5.146507	0.94603	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.79845	-1.31;1.02	5.51	5.51	0.81932	Peptidase M43, pregnancy-associated plasma-A (1);Metallopeptidase, catalytic domain (1);	0.108030	0.64402	D	0.000005	D	0.91392	0.7284	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92501	0.6008	10	0.87932	D	0	-10.9854	19.0279	0.92941	0.0:1.0:0.0:0.0	.	802;802	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	L	802	ENSP00000356634:P802L;ENSP00000356633:P802L	ENSP00000356633:P802L	P	+	2	0	PAPPA2	174926163	1.000000	0.71417	0.994000	0.49952	0.861000	0.49209	7.677000	0.84024	2.584000	0.87258	0.563000	0.77884	CCG		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			11	139	0	0	0	0.001368	0	11	139				
PAPPA2	60676	broad.mit.edu	37	1	176738905	176738905	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:176738905C>T	ENST00000367662.3	+	16	5650	c.4486C>T	c.(4486-4488)Cca>Tca	p.P1496S		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1496	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TTGTGTCCCACCAGCCAAGCT	0.512																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(4486-4488)CCA>TCA		pappalysin 2 isoform 1							109.0	109.0	109.0					1																	176738905		1996	4179	6175	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176738905C>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4486C>T	1.37:g.176738905C>T	ENSP00000356634:p.Pro1496Ser		Somatic				PAPPA2_uc009www.2_RNA	p.P1496S	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			16	5650	+			1496			Sushi 2.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.4486C>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	34	5.376209	0.95945	.	.	ENSG00000116183	ENST00000367662	T	0.47869	0.83	6.17	6.17	0.99709	Complement control module (2);Sushi/SCR/CCP (2);	0.000000	0.85682	D	0.000000	T	0.71710	0.3372	M	0.82323	2.585	0.80722	D	1	D	0.58268	0.982	P	0.62089	0.898	T	0.72530	-0.4265	10	0.62326	D	0.03	-9.5682	20.4745	0.99168	0.0:1.0:0.0:0.0	.	1496	Q9BXP8	PAPP2_HUMAN	S	1496	ENSP00000356634:P1496S	ENSP00000356634:P1496S	P	+	1	0	PAPPA2	175005528	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.965000	0.76067	2.941000	0.99782	0.655000	0.94253	CCA		0.512	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			43	187	0	0	0	0.00874	0	43	187				
PAPPA2	60676	broad.mit.edu	37	1	176759022	176759022	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:176759022C>A	ENST00000367662.3	+	18	5957	c.4793C>A	c.(4792-4794)cCc>cAc	p.P1598H		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1598	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGTGAGCCACCCCCTCCTGTG	0.478																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(4792-4794)CCC>CAC		pappalysin 2 isoform 1							126.0	128.0	127.0					1																	176759022		2011	4164	6175	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176759022C>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4793C>A	1.37:g.176759022C>A	ENSP00000356634:p.Pro1598His		Somatic				PAPPA2_uc009www.2_RNA	p.P1598H	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			18	5957	+			1598			Sushi 4.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.4793C>A	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.416793	0.62511	.	.	ENSG00000116183	ENST00000367662	D	0.90504	-2.68	5.51	4.6	0.57074	Complement control module (1);Sushi/SCR/CCP (2);	0.139163	0.48767	D	0.000178	D	0.94830	0.8330	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.94905	0.8060	10	0.72032	D	0.01	-7.2079	11.444	0.50112	0.0:0.9153:0.0:0.0847	.	1598	Q9BXP8	PAPP2_HUMAN	H	1598	ENSP00000356634:P1598H	ENSP00000356634:P1598H	P	+	2	0	PAPPA2	175025645	0.995000	0.38212	0.789000	0.31954	0.765000	0.43378	3.666000	0.54540	1.320000	0.45209	0.557000	0.71058	CCC		0.478	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			33	128	1	0	1.21669e-08	0.003271	1.52376e-08	33	128				
BRINP2	57795	broad.mit.edu	37	1	177250481	177250481	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:177250481C>T	ENST00000361539.4	+	8	2481	c.2169C>T	c.(2167-2169)ctC>ctT	p.L723L	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	723					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											TCATTGAGCTCAGGGACCGGG	0.537																																							uc001glf.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(2167-2169)CTC>CTT		family with sequence similarity 5, member B							100.0	95.0	97.0					1																	177250481		2203	4300	6503	SO:0001819	synonymous_variant	57795					extracellular region		g.chr1:177250481C>T		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.2169C>T	1.37:g.177250481C>T			Somatic				FAM5B_uc001glg.2_Silent_p.L618L	p.L723L	NM_021165	NP_066988	WXS	Illumina HiSeq	Unspecified	Q9C0B6	FAM5B_HUMAN			8	2481	+			723					O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	ENST00000361539.4	37	c.2169C>T	CCDS1320.1																																																																																				0.537	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165		25	162	0	0	0	0.00278	0	25	162				
RGS8	85397	broad.mit.edu	37	1	182640815	182640815	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:182640815C>A	ENST00000483095.2	-	0	131				RGS8_ENST00000367556.1_De_novo_Start_OutOfFrame|RGS8_ENST00000258302.4_Missense_Mutation_p.Q19H|RGS8_ENST00000491420.2_5'UTR|RGS8_ENST00000367557.4_De_novo_Start_OutOfFrame			P57771	RGS8_HUMAN	regulator of G-protein signaling 8						positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						TCCTCATGGCCTGAGGGTCTT	0.463																																					Ovarian(189;1262 3804 41973)	Ovarian(189;1262 3804 41973)	uc010pnw.1		NA																	0				ovary(1)	1						c.(-128--124)CAGGC>CATGC		regulator of G-protein signalling 8 isoform 2							157.0	158.0	158.0					1																	182640815		2203	4300	6503			85397				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:182640815C>A	AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.-127G>T	1.37:g.182640815C>A			Somatic				RGS8_uc001gpn.1_Translation_Start_Site|RGS8_uc001gpm.1_Missense_Mutation_p.Q19H		NM_001102450	NP_001095920	WXS	Illumina HiSeq	Unspecified	P57771	RGS8_HUMAN			2	132	-								B4DGL9|Q3SYD2	Translation_Start_Site	SNP	ENST00000483095.2	37	c.-126G>T	CCDS41443.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508239	0.44660	.	.	ENSG00000135824	ENST00000258302	T	0.46063	0.88	5.28	4.37	0.52481	.	2.341800	0.03305	U	0.189600	T	0.67258	0.2874	.	.	.	0.80722	D	1	D	0.54397	0.966	D	0.72338	0.977	T	0.34054	-0.9844	9	0.66056	D	0.02	.	10.8879	0.46978	0.0:0.9115:0.0:0.0885	.	19	P57771-2	.	H	19	ENSP00000258302:Q19H	ENSP00000258302:Q19H	Q	-	3	2	RGS8	180907438	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.754000	0.38369	1.222000	0.43521	0.563000	0.77884	CAG		0.463	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358979.1	NM_033345		44	66	1	0	2.40228e-13	0.003214	3.36063e-13	44	66				
F13B	2165	broad.mit.edu	37	1	197026189	197026189	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:197026189C>T	ENST00000367412.1	-	7	1168	c.1125G>A	c.(1123-1125)gaG>gaA	p.E375E		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	375	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TACAAGTTATCTCATTCGATC	0.368																																							uc001gtt.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(1123-1125)GAG>GAA		coagulation factor XIII B subunit precursor							132.0	113.0	119.0					1																	197026189		2203	4300	6503	SO:0001819	synonymous_variant	2165				blood coagulation	extracellular region		g.chr1:197026189C>T	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1125G>A	1.37:g.197026189C>T			Somatic					p.E375E	NM_001994	NP_001985	WXS	Illumina HiSeq	Unspecified	P05160	F13B_HUMAN			7	1169	-			375			Sushi 6.		A8K3E5|Q5VYL5	Silent	SNP	ENST00000367412.1	37	c.1125G>A	CCDS1388.1																																																																																				0.368	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		26	48	0	0	0	0.00632	0	26	48				
ASPM	259266	broad.mit.edu	37	1	197070480	197070480	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:197070480T>C	ENST00000367409.4	-	18	8157	c.7901A>G	c.(7900-7902)cAt>cGt	p.H2634R	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2634	IQ 28. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GGCTTTACAATGCTTCTGAAT	0.378																																							uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(7900-7902)CAT>CGT		asp (abnormal spindle)-like, microcephaly							66.0	62.0	63.0					1																	197070480		2203	4296	6499	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197070480T>C	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.7901A>G	1.37:g.197070480T>C	ENSP00000356379:p.His2634Arg		Somatic				ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Missense_Mutation_p.H482R	p.H2634R	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			18	8158	-			2634			IQ 28.		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.7901A>G	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	T	13.10	2.136844	0.37728	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.25749	1.78	5.09	5.09	0.68999	.	0.793755	0.11836	N	0.524706	T	0.37598	0.1009	L	0.58810	1.83	0.80722	D	1	B;P	0.47034	0.008;0.889	B;P	0.57960	0.032;0.83	T	0.08932	-1.0698	10	0.17369	T	0.5	.	6.6379	0.22893	0.0:0.0789:0.1555:0.7656	.	620;2634	E7EQ84;Q8IZT6	.;ASPM_HUMAN	R	2634;620	ENSP00000356379:H2634R	ENSP00000356376:H620R	H	-	2	0	ASPM	195337103	0.101000	0.21875	0.964000	0.40570	0.431000	0.31685	0.432000	0.21461	2.041000	0.60428	0.455000	0.32223	CAT		0.378	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		13	32	0	0	0	0.001368	0	13	32				
NAV1	89796	broad.mit.edu	37	1	201777944	201777944	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:201777944C>A	ENST00000367296.4	+	20	4572	c.4152C>A	c.(4150-4152)cgC>cgA	p.R1384R	MIR1231_ENST00000408101.1_RNA|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000295624.6_Silent_p.R1381R|NAV1_ENST00000367302.1_Silent_p.R1337R|NAV1_ENST00000367295.1_Silent_p.R990R|NAV1_ENST00000367300.3_Silent_p.R1324R|NAV1_ENST00000367297.4_Silent_p.R1376R	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1384					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CTTCCCCACGCCGCTCCCTAG	0.567																																							uc001gwu.2		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(4141-4143)CGC>CGA		neuron navigator 1							82.0	77.0	79.0					1																	201777944		2203	4300	6503	SO:0001819	synonymous_variant	89796				cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding	g.chr1:201777944C>A	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.4152C>A	1.37:g.201777944C>A			Somatic				NAV1_uc001gwx.2_Silent_p.R990R	p.R1381R	NM_020443	NP_065176	WXS	Illumina HiSeq	Unspecified	Q8NEY1	NAV1_HUMAN			19	4490	+			1384					A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Silent	SNP	ENST00000367296.4	37	c.4143C>A	CCDS1414.2																																																																																				0.567	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443		23	119	1	0	2.39556e-15	0.00278	3.38728e-15	23	119				
OPTC	26254	broad.mit.edu	37	1	203468946	203468946	+	Silent	SNP	C	C	A	rs368988940		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:203468946C>A	ENST00000367222.2	+	5	815	c.699C>A	c.(697-699)ctC>ctA	p.L233L		NM_014359.3	NP_055174.1	Q9UBM4	OPT_HUMAN	opticin	233					negative regulation of angiogenesis (GO:0016525)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			breast(1)|cervix(1)|kidney(5)|large_intestine(3)|lung(8)|pancreas(1)|stomach(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.109)			TAAATCGGCTCCAGAGCTCGG	0.582																																							uc001gzu.1		NA																	0					0						c.(697-699)CTC>CTA		opticin precursor							111.0	111.0	111.0					1																	203468946		2203	4300	6503	SO:0001819	synonymous_variant	26254					proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr1:203468946C>A	AF161702	CCDS1439.1	1q31	2008-02-05			ENSG00000188770	ENSG00000188770			8158	protein-coding gene	gene with protein product	"""oculoglycan"""	605127				10636917	Standard	NM_014359		Approved		uc001gzu.1	Q9UBM4	OTTHUMG00000036100	ENST00000367222.2:c.699C>A	1.37:g.203468946C>A			Somatic					p.L233L	NM_014359	NP_055174	WXS	Illumina HiSeq	Unspecified	Q9UBM4	OPT_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		5	815	+			233					Q5T2G4	Silent	SNP	ENST00000367222.2	37	c.699C>A	CCDS1439.1																																																																																				0.582	OPTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087964.1	NM_014359		27	75	1	0	9.04412e-07	0.004656	1.07629e-06	27	75				
NFASC	23114	broad.mit.edu	37	1	204924038	204924038	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:204924038C>A	ENST00000401399.1	+	6	693	c.494C>A	c.(493-495)cCg>cAg	p.P165Q	NFASC_ENST00000403080.1_Missense_Mutation_p.P165Q|NFASC_ENST00000404907.1_Missense_Mutation_p.P159Q|NFASC_ENST00000513543.1_Missense_Mutation_p.P159Q|NFASC_ENST00000339876.6_Missense_Mutation_p.P165Q|NFASC_ENST00000404076.1_Missense_Mutation_p.P159Q|NFASC_ENST00000367172.4_Missense_Mutation_p.P165Q|NFASC_ENST00000367171.4_Missense_Mutation_p.P165Q|NFASC_ENST00000367169.4_Missense_Mutation_p.P165Q|NFASC_ENST00000539706.1_Missense_Mutation_p.P159Q|NFASC_ENST00000338586.6_Missense_Mutation_p.P165Q|NFASC_ENST00000367170.4_Missense_Mutation_p.P165Q|NFASC_ENST00000338515.6_Missense_Mutation_p.P165Q|NFASC_ENST00000360049.4_Missense_Mutation_p.P159Q			O94856	NFASC_HUMAN	neurofascin	165	Ig-like C2-type 2.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TGCAACCCCCCGCCTGGACTT	0.567																																							uc001hbj.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(493-495)CCG>CAG		neurofascin isoform 1 precursor							141.0	144.0	143.0					1																	204924038		2203	4300	6503	SO:0001583	missense	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204924038C>A	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.494C>A	1.37:g.204924038C>A	ENSP00000385637:p.Pro165Gln		Somatic				NFASC_uc001hbh.2_Missense_Mutation_p.P165Q|NFASC_uc010pqz.1_Missense_Mutation_p.P159Q|NFASC_uc010pra.1_Missense_Mutation_p.P159Q|NFASC_uc001hbi.2_Missense_Mutation_p.P159Q|NFASC_uc009xbg.1_Missense_Mutation_p.P232Q|NFASC_uc010prb.1_Missense_Mutation_p.P159Q|NFASC_uc010prc.1_5'UTR|NFASC_uc001hbk.1_5'Flank	p.P165Q	NM_001005388	NP_001005388	WXS	Illumina HiSeq	Unspecified	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		7	822	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		165			Extracellular (Potential).|Ig-like C2-type 2.		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	c.494C>A	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.187352|5.187352	0.94923|0.94923	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000446412;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393|ENST00000367173	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.12984|.	2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63|.	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	0.000000|.	0.53938|.	D|.	0.000056|.	D|D	0.87462|0.87462	0.6183|0.6183	H|H	0.94808|0.94808	3.585|3.585	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D|D	0.90712|0.90712	0.4628|0.4628	10|5	0.87932|.	D|.	0|.	.|.	18.9167|18.9167	0.92508|0.92508	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	159;159;261;165;159;165|.	O94856-11;O94856-8;B4DRH7;O94856-9;O94856-3;O94856-2|.	.;.;.;.;.;.|.	Q|S	165;165;165;165;165;165;159;159;159;165;165;165;159;165;159;159;135|135	ENSP00000356140:P165Q;ENSP00000356139:P165Q;ENSP00000356138:P165Q;ENSP00000342128:P165Q;ENSP00000344786:P165Q;ENSP00000343509:P165Q;ENSP00000438614:P159Q;ENSP00000353154:P159Q;ENSP00000356137:P165Q;ENSP00000412161:P165Q;ENSP00000384875:P165Q;ENSP00000385676:P159Q;ENSP00000385637:P165Q;ENSP00000384061:P159Q;ENSP00000425908:P159Q;ENSP00000415031:P135Q|.	ENSP00000295776:P159Q|.	P|R	+|+	2|1	0|0	NFASC|NFASC	203190661|203190661	1.000000|1.000000	0.71417|0.71417	0.666000|0.666000	0.29783|0.29783	0.992000|0.992000	0.81027|0.81027	7.797000|7.797000	0.85911|0.85911	2.573000|2.573000	0.86826|0.86826	0.655000|0.655000	0.94253|0.94253	CCG|CGC		0.567	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		74	220	1	0	1.76421e-39	0.00361	2.87299e-39	74	220				
USH2A	7399	broad.mit.edu	37	1	215847560	215847560	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:215847560A>C	ENST00000307340.3	-	63	14079	c.13693T>G	c.(13693-13695)Tat>Gat	p.Y4565D	USH2A_ENST00000366943.2_Missense_Mutation_p.Y4565D	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4565	Fibronectin type-III 31. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAGAGGGTATAATTGATGATA	0.403										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(13693-13695)TAT>GAT		usherin isoform B							142.0	140.0	141.0					1																	215847560		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215847560A>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13693T>G	1.37:g.215847560A>C	ENSP00000305941:p.Tyr4565Asp	HNSCC(13;0.011)	Somatic					p.Y4565D	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	63	14080	-			4565			Fibronectin type-III 31.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.13693T>G	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	17.15	3.315219	0.60524	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.78707	-1.2;-1.2	4.52	4.52	0.55395	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.37715	U	0.001961	D	0.90521	0.7030	M	0.93241	3.395	0.49915	D	0.99983	D	0.89917	1.0	D	0.97110	1.0	D	0.92970	0.6397	10	0.87932	D	0	.	14.1593	0.65436	1.0:0.0:0.0:0.0	.	4565	O75445	USH2A_HUMAN	D	4565	ENSP00000305941:Y4565D;ENSP00000355910:Y4565D	ENSP00000305941:Y4565D	Y	-	1	0	USH2A	213914183	1.000000	0.71417	0.792000	0.32020	0.945000	0.59286	6.224000	0.72265	1.799000	0.52666	0.460000	0.39030	TAT		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		8	178	0	0	0	0.004482	0	8	178				
MIA3	375056	broad.mit.edu	37	1	222838929	222838929	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:222838929G>C	ENST00000344922.5	+	28	5717	c.5692G>C	c.(5692-5694)Gac>Cac	p.D1898H	AIDA_ENST00000474863.1_5'Flank|MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Missense_Mutation_p.D1898H|MIA3_ENST00000340535.7_Missense_Mutation_p.D776H	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1898					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		CACTAGCCAGGACTGTTCACA	0.478																																							uc001hnl.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(5692-5694)GAC>CAC		melanoma inhibitory activity family, member 3							120.0	119.0	119.0					1																	222838929		1862	4112	5974	SO:0001583	missense	375056				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr1:222838929G>C		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.5692G>C	1.37:g.222838929G>C	ENSP00000340900:p.Asp1898His		Somatic				MIA3_uc001hnm.2_Missense_Mutation_p.D776H	p.D1898H	NM_198551	NP_940953	WXS	Illumina HiSeq	Unspecified	Q5JRA6	MIA3_HUMAN		GBM - Glioblastoma multiforme(131;0.0199)	28	5701	+			1898			Cytoplasmic (Potential).		A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	c.5692G>C	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721134	0.48728	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000340535;ENST00000284471	T;T;T	0.13778	3.07;3.07;2.56	5.98	4.12	0.48240	.	.	.	.	.	T	0.32436	0.0829	M	0.64997	1.995	0.34942	D	0.750414	D;D	0.89917	0.999;1.0	D;D	0.71184	0.948;0.972	T	0.45948	-0.9226	9	0.87932	D	0	.	12.2082	0.54365	0.1385:0.0:0.8615:0.0	.	776;1898	Q5JRA6-4;Q5JRA6	.;MIA3_HUMAN	H	1898;1898;1839;776;776	ENSP00000340900:D1898H;ENSP00000340587:D1898H;ENSP00000345866:D776H	ENSP00000284471:D776H	D	+	1	0	MIA3	220905552	1.000000	0.71417	0.054000	0.19295	0.666000	0.39218	4.474000	0.60203	0.867000	0.35654	-0.136000	0.14681	GAC		0.478	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551		13	172	0	0	0	0.001855	0	13	172				
CNIH3	149111	broad.mit.edu	37	1	224804820	224804820	+	5'UTR	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:224804820G>T	ENST00000272133.3	+	0	826				RP11-100E13.1_ENST00000437416.1_RNA	NM_152495.1	NP_689708.1	Q8TBE1	CNIH3_HUMAN	cornichon family AMPA receptor auxiliary protein 3						intracellular signal transduction (GO:0035556)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|postsynaptic membrane (GO:0045211)	channel regulator activity (GO:0016247)			large_intestine(5)|lung(4)	9	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		CCTCTAGGGAGGCATCGGGCT	0.647																																							uc001hos.1		NA																	0					0						c.(-58--54)GAGGC>GATGC		cornichon homolog 3							100.0	88.0	91.0					1																	224804820		692	1591	2283	SO:0001623	5_prime_UTR_variant	149111				intracellular signal transduction|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic shaft|postsynaptic membrane		g.chr1:224804820G>T	AF070524	CCDS1544.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143786	ENSG00000143786			26802	protein-coding gene	gene with protein product			"""cornichon homolog 3 (Drosophila)"""			8619474, 9110174	Standard	NM_152495		Approved	FLJ38993, CNIH-3	uc001hos.1	Q8TBE1	OTTHUMG00000037634	ENST00000272133.3:c.-57G>T	1.37:g.224804820G>T			Somatic						NM_152495	NP_689708	WXS	Illumina HiSeq	Unspecified	Q8TBE1	CNIH3_HUMAN		GBM - Glioblastoma multiforme(131;0.073)	1	642	+	Breast(184;0.218)								Translation_Start_Site	SNP	ENST00000272133.3	37	c.-56G>T	CCDS1544.1																																																																																				0.647	CNIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091752.2	NM_152495		85	188	1	0	1.11057e-38	0.00361	1.80297e-38	85	188				
RYR2	6262	broad.mit.edu	37	1	237819198	237819198	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:237819198G>T	ENST00000366574.2	+	53	8360	c.8043G>T	c.(8041-8043)atG>atT	p.M2681I	RYR2_ENST00000542537.1_Missense_Mutation_p.M2665I|RYR2_ENST00000360064.6_Missense_Mutation_p.M2679I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2681	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGACTACATGGAGTCAAATT	0.423																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(8041-8043)ATG>ATT		cardiac muscle ryanodine receptor							62.0	61.0	61.0					1																	237819198		1857	4098	5955	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237819198G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8043G>T	1.37:g.237819198G>T	ENSP00000355533:p.Met2681Ile		Somatic					p.M2681I	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		53	8163	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2681			Modulator (Potential).|Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.8043G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.154233	0.57259	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96300	-3.97;-3.93;-3.96	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.91955	0.7452	N	0.19112	0.55	0.80722	D	1	B	0.31837	0.342	B	0.25884	0.064	D	0.89327	0.3644	10	0.19147	T	0.46	-23.2848	20.3789	0.98926	0.0:0.0:1.0:0.0	.	2681	Q92736	RYR2_HUMAN	I	2681;2679;2665	ENSP00000355533:M2681I;ENSP00000353174:M2679I;ENSP00000443798:M2665I	ENSP00000353174:M2679I	M	+	3	0	RYR2	235885821	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.718000	0.74713	2.826000	0.97356	0.563000	0.77884	ATG		0.423	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		16	20	1	0	1.3612e-06	0.003163	1.6126e-06	16	20				
ZP4	57829	broad.mit.edu	37	1	238048824	238048824	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:238048824G>C	ENST00000366570.4	-	8	1185	c.1027C>G	c.(1027-1029)Cgg>Ggg	p.R343G	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	343	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			ATGGGATCCCGAAGCAACTTC	0.498																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	0				ovary(2)|skin(1)	3						c.(1027-1029)CGG>GGG		zona pellucida glycoprotein 4 preproprotein							67.0	65.0	66.0					1																	238048824		2203	4300	6503	SO:0001583	missense	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238048824G>C	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1027C>G	1.37:g.238048824G>C	ENSP00000355529:p.Arg343Gly		Somatic				LOC100130331_uc010pyc.1_Intron	p.R343G	NM_021186	NP_067009	WXS	Illumina HiSeq	Unspecified	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		8	1027	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	343			ZP.|Extracellular (Potential).		B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	c.1027C>G	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990658	0.35131	.	.	ENSG00000116996	ENST00000366570	T	0.77489	-1.1	4.95	4.01	0.46588	Zona pellucida sperm-binding protein (3);	0.250121	0.36167	N	0.002758	D	0.84915	0.5578	M	0.76838	2.35	0.45580	D	0.998526	D	0.71674	0.998	D	0.74023	0.982	D	0.84270	0.0488	10	0.87932	D	0	-4.2321	5.7459	0.18120	0.1045:0.0:0.708:0.1876	.	343	Q12836	ZP4_HUMAN	G	343	ENSP00000355529:R343G	ENSP00000355529:R343G	R	-	1	2	ZP4	236115447	0.020000	0.18652	0.651000	0.29564	0.122000	0.20287	0.646000	0.24797	1.015000	0.39444	0.655000	0.94253	CGG		0.498	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			5	75	0	0	0	0.000602	0	5	75				
OR2G2	81470	broad.mit.edu	37	1	247752559	247752559	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:247752559G>C	ENST00000320065.1	+	1	898	c.898G>C	c.(898-900)Gtg>Ctg	p.V300L	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	300						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GATCAAGGAGGTGAAAGGGGC	0.368																																							uc010pyy.1		NA																	0					0						c.(898-900)GTG>CTG		olfactory receptor, family 2, subfamily G,							85.0	90.0	88.0					1																	247752559		2203	4300	6503	SO:0001583	missense	81470				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247752559G>C	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.898G>C	1.37:g.247752559G>C	ENSP00000326349:p.Val300Leu		Somatic					p.V300L	NM_001001915	NP_001001915	WXS	Illumina HiSeq	Unspecified	Q8NGZ5	OR2G2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	898	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		300			Cytoplasmic (Potential).		Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	37	c.898G>C	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582399	0.28180	.	.	ENSG00000177489	ENST00000320065	T	0.37584	1.19	4.05	2.04	0.26737	.	0.237022	0.20738	U	0.086589	T	0.23727	0.0574	L	0.39020	1.185	0.09310	N	1	B	0.29162	0.235	B	0.25405	0.06	T	0.19386	-1.0307	10	0.87932	D	0	.	4.6895	0.12774	0.1066:0.0:0.4771:0.4163	.	300	Q8NGZ5	OR2G2_HUMAN	L	300	ENSP00000326349:V300L	ENSP00000326349:V300L	V	+	1	0	OR2G2	245819182	0.005000	0.15991	0.002000	0.10522	0.037000	0.13140	0.015000	0.13355	0.300000	0.22699	0.585000	0.79938	GTG		0.368	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1			47	125	0	0	0	0.00361	0	47	125				
OR6F1	343169	broad.mit.edu	37	1	247875588	247875588	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:247875588G>C	ENST00000302084.2	-	1	517	c.470C>G	c.(469-471)gCa>gGa	p.A157G	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TGTGGGCACTGCAATGGCCAC	0.597																																							uc001idj.1		NA																	0					0						c.(469-471)GCA>GGA		olfactory receptor, family 6, subfamily F,							70.0	80.0	77.0					1																	247875588		2203	4300	6503	SO:0001583	missense	343169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247875588G>C	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.470C>G	1.37:g.247875588G>C	ENSP00000305640:p.Ala157Gly		Somatic					p.A157G	NM_001005286	NP_001005286	WXS	Illumina HiSeq	Unspecified	Q8NGZ6	OR6F1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	470	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		157			Helical; Name=4; (Potential).		B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	37	c.470C>G	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	G	5.662	0.306748	0.10733	.	.	ENSG00000169214	ENST00000302084	T	0.00130	8.69	3.99	1.07	0.20283	GPCR, rhodopsin-like superfamily (1);	0.726886	0.11813	N	0.527000	T	0.00178	0.0005	L	0.53249	1.67	0.09310	N	1	B	0.23735	0.09	B	0.28385	0.089	T	0.21724	-1.0237	10	0.87932	D	0	-1.026	7.1531	0.25622	0.3192:0.0:0.6808:0.0	.	157	Q8NGZ6	OR6F1_HUMAN	G	157	ENSP00000305640:A157G	ENSP00000305640:A157G	A	-	2	0	OR6F1	245942211	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.544000	0.06077	0.452000	0.26830	-0.218000	0.12543	GCA		0.597	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286		22	87	0	0	0	0.002299	0	22	87				
OR2L13	284521	broad.mit.edu	37	1	248262885	248262885	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:248262885C>T	ENST00000358120.2	+	2	353	c.208C>T	c.(208-210)Ctg>Ttg	p.L70L	OR2L13_ENST00000366478.2_Silent_p.L70L			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CCTTATGGACCTGATGTACAT	0.547																																							uc001ids.2		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(208-210)CTG>TTG		olfactory receptor, family 2, subfamily L,							233.0	211.0	219.0					1																	248262885		2203	4300	6503	SO:0001819	synonymous_variant	284521				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding	g.chr1:248262885C>T	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.208C>T	1.37:g.248262885C>T			Somatic					p.L70L	NM_175911	NP_787107	WXS	Illumina HiSeq	Unspecified	Q8N349	OR2LD_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0132)		3	545	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		70			Helical; Name=2; (Potential).		Q5VUR5	Silent	SNP	ENST00000358120.2	37	c.208C>T	CCDS1637.1																																																																																				0.547	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911		36	188	0	0	0	0.004289	0	36	188				
OR2T34	127068	broad.mit.edu	37	1	248737448	248737448	+	Missense_Mutation	SNP	G	G	T	rs201522585	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr1:248737448G>T	ENST00000328782.2	-	1	632	c.611C>A	c.(610-612)aCg>aAg	p.T204K		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T204K(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCACAGGTACGTGAGCATCTT	0.517																																							uc001iep.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(610-612)ACG>AAG		olfactory receptor, family 2, subfamily T,							197.0	211.0	206.0					1																	248737448		2101	4300	6401	SO:0001583	missense	127068				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248737448G>T	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.611C>A	1.37:g.248737448G>T	ENSP00000330904:p.Thr204Lys		Somatic					p.T204K	NM_001001821	NP_001001821	WXS	Illumina HiSeq	Unspecified	Q8NGX1	O2T34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	611	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		204			Helical; Name=5; (Potential).		B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	c.611C>A	CCDS31120.1	.	.	.	.	.	.	.	.	.	.	.	8.598	0.886207	0.17540	.	.	ENSG00000183310	ENST00000328782	T	0.00091	8.74	2.37	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	L	0.39245	1.2	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.38373	-0.9664	9	0.87932	D	0	.	5.2071	0.15297	0.5593:0.0:0.4407:0.0	.	204	Q8NGX1	O2T34_HUMAN	K	204	ENSP00000330904:T204K	ENSP00000330904:T204K	T	-	2	0	OR2T34	246804071	0.001000	0.12720	0.888000	0.34837	0.067000	0.16453	1.443000	0.35057	0.081000	0.16988	-1.849000	0.00571	ACG		0.517	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821		85	497	1	0	3.7744e-50	0.00361	6.22361e-50	85	497				
TUBB8	347688	broad.mit.edu	37	10	93213	93213	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:93213G>A	ENST00000309812.4	-	4	1181	c.1119C>T	c.(1117-1119)gcC>gcT	p.A373A	TUBB8_ENST00000447903.2_Silent_p.A301A|TUBB8_ENST00000413237.3_5'Flank	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	373					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GTTCCTGGATGGCCGTATTAT	0.537																																					Pancreas(192;2041 3010 9013 18103)	Pancreas(192;2041 3010 9013 18103)	uc001ifi.2		NA																	0				ovary(1)	1						c.(1117-1119)GCC>GCT		tubulin, beta 8 isoform 1							80.0	86.0	84.0					10																	93213		2203	4298	6501	SO:0001819	synonymous_variant	347688				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr10:93213G>A	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.1119C>T	10.37:g.93213G>A			Somatic				TUBB8_uc009xhe.2_Silent_p.A336A|TUBB8_uc010pzs.1_Silent_p.A301A	p.A373A	NM_177987	NP_817124	WXS	Illumina HiSeq	Unspecified	Q3ZCM7	TBB8_HUMAN		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)	4	1119	-		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)	373					Q5SQX9|Q8WZ78	Silent	SNP	ENST00000309812.4	37	c.1119C>T	CCDS7051.1																																																																																				0.537	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987		22	124	0	0	0	0.005443	0	22	124				
CALML5	51806	broad.mit.edu	37	10	5541168	5541168	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:5541168G>A	ENST00000380332.3	-	1	365	c.234C>T	c.(232-234)gcC>gcT	p.A78A		NM_017422.4	NP_059118.2	Q9NZT1	CALL5_HUMAN	calmodulin-like 5	78	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				epidermis development (GO:0008544)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			biliary_tract(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|stomach(1)	8						CCTCCAGGCCGGCCCTGGCCT	0.682																																					GBM(149;1055 3356 43077)	GBM(149;1055 3356 43077)	uc001iic.2		NA																	0					0						c.(232-234)GCC>GCT		calmodulin-like 5							38.0	41.0	40.0					10																	5541168		2203	4300	6503	SO:0001819	synonymous_variant	51806				epidermis development|signal transduction		calcium ion binding|protein binding	g.chr10:5541168G>A	AF172852	CCDS7068.1	10p15.1	2013-01-10			ENSG00000178372	ENSG00000178372		"""EF-hand domain containing"""	18180	protein-coding gene	gene with protein product	"""calmodulin-like skin protein"""	605183				10777582	Standard	NM_017422		Approved	CLSP	uc001iic.2	Q9NZT1	OTTHUMG00000017598	ENST00000380332.3:c.234C>T	10.37:g.5541168G>A			Somatic					p.A78A	NM_017422	NP_059118	WXS	Illumina HiSeq	Unspecified	Q9NZT1	CALL5_HUMAN			1	366	-			78			EF-hand 3.		Q5SQI3|Q8IXU8	Silent	SNP	ENST00000380332.3	37	c.234C>T	CCDS7068.1																																																																																				0.682	CALML5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046556.1	NM_017422		6	44	0	0	0	0.004007	0	6	44				
GATA3	2625	broad.mit.edu	37	10	8115719	8115719	+	Silent	SNP	T	T	A	rs201916439		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:8115719T>A	ENST00000346208.3	+	6	1520	c.1065T>A	c.(1063-1065)acT>acA	p.T355T	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Silent_p.T356T			P23771	GATA3_HUMAN	GATA binding protein 3	355					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.M357fs*14(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GACCCCTGACTATGAAGAAGG	0.398			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																uc001ika.2		NA		Rec	yes		10	10p15	2625	F|N|S	GATA binding protein 3	yes	HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)	E			breast		1	Deletion - Frameshift(1)	p.M357fs*14(1)	breast(1)	breast(17)|ovary(3)|central_nervous_system(2)	22						c.(1063-1065)ACT>ACA		GATA binding protein 3 isoform 2							43.0	47.0	45.0					10																	8115719		2203	4300	6503	SO:0001819	synonymous_variant	2625				aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr10:8115719T>A	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1065T>A	10.37:g.8115719T>A			Somatic				GATA3_uc001ijz.2_Silent_p.T356T	p.T355T	NM_002051	NP_002042	WXS	Illumina HiSeq	Unspecified	P23771	GATA3_HUMAN			6	1622	+			355					Q5VWG7|Q5VWG8|Q96J16	Silent	SNP	ENST00000346208.3	37	c.1065T>A	CCDS7083.1																																																																																				0.398	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295		10	49	0	0	0	0.006214	0	10	49				
DCLRE1C	64421	broad.mit.edu	37	10	14950843	14950843	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:14950843C>T	ENST00000378278.2	-	14	1680	c.1643G>A	c.(1642-1644)aGt>aAt	p.S548N	DCLRE1C_ENST00000492201.1_5'UTR|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.S428N|DCLRE1C_ENST00000378289.4_Intron|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.S433N|DCLRE1C_ENST00000378242.1_Missense_Mutation_p.S201N|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.S428N|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.S428N|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.S433N|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.S433N|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.S428N|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.S428N			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	548					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						CCAGCCTTGACTTCCTTGTTC	0.443								Non-homologous end-joining																															uc001inn.2		NA																	0				ovary(1)	1						c.(1642-1644)AGT>AAT	Involved_in_tolerance_or_repair_of_DNA_crosslinks|NHEJ	artemis protein isoform a							103.0	98.0	100.0					10																	14950843		2203	4300	6503	SO:0001583	missense	64421				DNA recombination	nucleus	5'-3' exonuclease activity|single-stranded DNA specific endodeoxyribonuclease activity	g.chr10:14950843C>T	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1643G>A	10.37:g.14950843C>T	ENSP00000367527:p.Ser548Asn		Somatic				DCLRE1C_uc010qbx.1_Intron|DCLRE1C_uc001ink.2_Missense_Mutation_p.S201N|DCLRE1C_uc001inl.2_Missense_Mutation_p.S428N|DCLRE1C_uc009xji.2_Missense_Mutation_p.S433N|DCLRE1C_uc001inm.2_Missense_Mutation_p.S428N|DCLRE1C_uc001ino.2_Missense_Mutation_p.S433N|DCLRE1C_uc009xjh.2_RNA|DCLRE1C_uc001inp.2_Missense_Mutation_p.S428N|DCLRE1C_uc001inq.2_Missense_Mutation_p.S428N|DCLRE1C_uc001inr.2_Missense_Mutation_p.S433N	p.S548N	NM_001033855	NP_001029027	WXS	Illumina HiSeq	Unspecified	Q96SD1	DCR1C_HUMAN			14	1728	-			548	S->A: Reduced IR induced phosphorylation; when associated with A-516; A-534; A-538; A-553; A-561 and A-562.				D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	ENST00000378278.2	37	c.1643G>A	CCDS31149.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711815	0.89112	.	.	ENSG00000152457	ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000378242	T;T;T;T;T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7	5.93	5.93	0.95920	.	0.289515	0.42964	D	0.000629	T	0.44540	0.1298	L	0.32530	0.975	0.46222	D	0.998937	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.30090	-0.9990	10	0.87932	D	0	.	20.3312	0.98718	0.0:1.0:0.0:0.0	.	433;548	Q96SD1-3;Q96SD1	.;DCR1C_HUMAN	N	428;433;433;433;428;428;428;548;428;201	ENSP00000400529:S428N;ENSP00000367492:S433N;ENSP00000350349:S433N;ENSP00000367496:S433N;ENSP00000380030:S428N;ENSP00000367503:S428N;ENSP00000367502:S428N;ENSP00000367527:S548N;ENSP00000367506:S428N;ENSP00000367488:S201N	ENSP00000350349:S433N	S	-	2	0	DCLRE1C	14990849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.677000	0.68142	2.797000	0.96272	0.655000	0.94253	AGT		0.443	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046934.1	NM_022487		24	100	0	0	0	0.00278	0	24	100				
FAM171A1	221061	broad.mit.edu	37	10	15290663	15290663	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:15290663C>A	ENST00000378116.4	-	5	735	c.729G>T	c.(727-729)gcG>gcT	p.A243A	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	243						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						ACCGCCACGCCGCGACATAGG	0.557																																							uc001iob.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(727-729)GCG>GCT		hypothetical protein LOC221061 precursor							80.0	73.0	75.0					10																	15290663		2203	4300	6503	SO:0001819	synonymous_variant	221061					integral to membrane		g.chr10:15290663C>A	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.729G>T	10.37:g.15290663C>A			Somatic					p.A243A	NM_001010924	NP_001010924	WXS	Illumina HiSeq	Unspecified	Q5VUB5	F1711_HUMAN			5	736	-			243			Extracellular (Potential).		D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	37	c.729G>T	CCDS31154.1																																																																																				0.557	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		20	73	1	0	2.4624e-09	0.008871	3.11351e-09	20	73				
CUBN	8029	broad.mit.edu	37	10	16942660	16942660	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:16942660C>G	ENST00000377833.4	-	53	8439	c.8374G>C	c.(8374-8376)Ggt>Cgt	p.G2792R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2792	CUB 20. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TAAAATCCACCACCTTGCAAT	0.368																																							uc001ioo.2		NA																	0				ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(8374-8376)GGT>CGT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						174.0	150.0	158.0					10																	16942660		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16942660C>G	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8374G>C	10.37:g.16942660C>G	ENSP00000367064:p.Gly2792Arg		Somatic				CUBN_uc009xjq.1_RNA|CUBN_uc009xjr.1_Missense_Mutation_p.G148R	p.G2792R	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			53	8426	-			2792			CUB 20.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.8374G>C	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861130	0.32884	.	.	ENSG00000107611	ENST00000377833	T	0.15952	2.38	5.58	2.68	0.31781	CUB (5);	0.151492	0.30791	N	0.008864	T	0.05777	0.0151	N	0.03238	-0.38	0.80722	D	1	B	0.30482	0.281	B	0.31869	0.137	T	0.30937	-0.9961	10	0.06891	T	0.86	.	6.547	0.22412	0.0:0.6561:0.134:0.2098	.	2792	O60494	CUBN_HUMAN	R	2792	ENSP00000367064:G2792R	ENSP00000367064:G2792R	G	-	1	0	CUBN	16982666	0.997000	0.39634	0.473000	0.27253	0.908000	0.53690	1.439000	0.35013	0.378000	0.24764	0.650000	0.86243	GGT		0.368	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		35	71	0	0	0	0.006999	0	35	71				
RET	5979	broad.mit.edu	37	10	43606878	43606878	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:43606878C>G	ENST00000355710.3	+	7	1719	c.1487C>G	c.(1486-1488)gCc>gGc	p.A496G	RET_ENST00000340058.5_Missense_Mutation_p.A496G	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	496					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TCTAGGCAGGCCCAGGCCCAG	0.647		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	uc001jal.2		1	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	T|Mis|N|F	ret proto-oncogene	yes	Hirschsprung disease	"""E, O"""	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma		0				thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451						c.(1486-1488)GCC>GGC		ret proto-oncogene isoform a	Sunitinib(DB01268)						35.0	35.0	35.0					10																	43606878		2203	4300	6503	SO:0001583	missense	5979	Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity	g.chr10:43606878C>G	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.1487C>G	10.37:g.43606878C>G	ENSP00000347942:p.Ala496Gly		Somatic				RET_uc001jak.1_Missense_Mutation_p.A496G|RET_uc010qez.1_Missense_Mutation_p.A242G	p.A496G	NM_020975	NP_066124	WXS	Illumina HiSeq	Unspecified	P07949	RET_HUMAN			7	1677	+		Ovarian(717;0.0423)	496			Extracellular (Potential).		A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	37	c.1487C>G	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923225	0.52653	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	T;T	0.79940	-1.21;-1.32	5.74	4.82	0.62117	.	0.543319	0.22969	N	0.053441	T	0.75874	0.3909	L	0.47716	1.5	0.28044	N	0.933633	P;P;P	0.37663	0.469;0.469;0.604	B;B;B	0.40066	0.05;0.11;0.318	T	0.72811	-0.4180	10	0.87932	D	0	.	9.4218	0.38557	0.1445:0.7842:0.0:0.0713	.	242;496;496	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	G	496	ENSP00000347942:A496G;ENSP00000344798:A496G	ENSP00000344798:A496G	A	+	2	0	RET	42926884	1.000000	0.71417	0.990000	0.47175	0.382000	0.30200	4.820000	0.62671	1.382000	0.46385	0.655000	0.94253	GCC		0.647	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975		5	30	0	0	0	0.000602	0	5	30				
CDHR1	92211	broad.mit.edu	37	10	85968063	85968063	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:85968063C>A	ENST00000372117.3	+	11	1200	c.1097C>A	c.(1096-1098)tCc>tAc	p.S366Y	CDHR1_ENST00000332904.3_Missense_Mutation_p.S366Y|CDHR1_ENST00000440770.2_Missense_Mutation_p.S125Y	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	366	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						TTTGAGCTGTCCATGAATGAG	0.597																																							uc001kcv.2		NA																	0				ovary(1)	1						c.(1096-1098)TCC>TAC		protocadherin 21 precursor							80.0	77.0	78.0					10																	85968063		2203	4300	6503	SO:0001583	missense	92211				homophilic cell adhesion		calcium ion binding|receptor activity	g.chr10:85968063C>A	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1097C>A	10.37:g.85968063C>A	ENSP00000361189:p.Ser366Tyr		Somatic				CDHR1_uc001kcw.2_Missense_Mutation_p.S366Y|CDHR1_uc009xst.2_Missense_Mutation_p.S125Y	p.S366Y	NM_033100	NP_149091	WXS	Illumina HiSeq	Unspecified	Q96JP9	CDHR1_HUMAN			11	1097	+			366			Cadherin 4.|Extracellular (Potential).		Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	c.1097C>A	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.037540	0.75617	.	.	ENSG00000148600	ENST00000332904;ENST00000372117;ENST00000440770	T;T;T	0.60920	0.15;0.15;0.32	5.71	5.71	0.89125	Cadherin (2);Cadherin-like (1);	0.097197	0.64402	D	0.000001	T	0.66489	0.2794	L	0.50993	1.605	0.44142	D	0.99693	D;D;D	0.58970	0.979;0.98;0.984	P;P;P	0.56700	0.642;0.804;0.73	T	0.59963	-0.7355	10	0.25106	T	0.35	-17.4632	18.6186	0.91313	0.0:1.0:0.0:0.0	.	125;366;366	E7EN47;Q96JP9-2;Q96JP9	.;.;CDHR1_HUMAN	Y	366;366;125	ENSP00000331063:S366Y;ENSP00000361189:S366Y;ENSP00000415980:S125Y	ENSP00000331063:S366Y	S	+	2	0	CDHR1	85958043	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	5.781000	0.68964	2.701000	0.92244	0.591000	0.81541	TCC		0.597	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100		9	55	1	0	0.00448238	0.004482	0.00475349	9	55				
PAPSS2	9060	broad.mit.edu	37	10	89503231	89503231	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:89503231C>T	ENST00000361175.4	+	10	1678	c.1309C>T	c.(1309-1311)Ccg>Tcg	p.P437S	PAPSS2_ENST00000456849.1_Missense_Mutation_p.P442S|PAPSS2_ENST00000427144.2_Missense_Mutation_p.P441S	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	437					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		CTACAAGCACCCGGTCCTCCT	0.607																																							uc001kex.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1309-1311)CCG>TCG		3'-phosphoadenosine 5'-phosphosulfate synthase 2							97.0	93.0	94.0					10																	89503231		2203	4300	6503	SO:0001583	missense	9060				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|protein binding|sulfate adenylyltransferase (ATP) activity	g.chr10:89503231C>T	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.1309C>T	10.37:g.89503231C>T	ENSP00000354436:p.Pro437Ser		Somatic				PAPSS2_uc001kew.2_Missense_Mutation_p.P442S	p.P437S	NM_004670	NP_004661	WXS	Illumina HiSeq	Unspecified	O95340	PAPS2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)	10	1572	+		Melanoma(5;0.019)|Colorectal(252;0.123)	437			Adenylyl-sulfate kinase.		Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Missense_Mutation	SNP	ENST00000361175.4	37	c.1309C>T	CCDS7385.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536927	0.85812	.	.	ENSG00000198682	ENST00000361175;ENST00000456849;ENST00000427144;ENST00000371981	T;T;T	0.28255	1.62;1.62;1.62	5.33	5.33	0.75918	Sulphate adenylyltransferase (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.048250	0.85682	D	0.000000	T	0.71091	0.3299	H	0.96691	3.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.991;1.0	T	0.81409	-0.0946	10	0.87932	D	0	-14.9615	19.2123	0.93760	0.0:1.0:0.0:0.0	.	437;442	O95340;O95340-2	PAPS2_HUMAN;.	S	437;442;441;441	ENSP00000354436:P437S;ENSP00000406157:P442S;ENSP00000397123:P441S	ENSP00000354436:P437S	P	+	1	0	PAPSS2	89493211	1.000000	0.71417	0.998000	0.56505	0.668000	0.39293	7.315000	0.78998	2.771000	0.95319	0.561000	0.74099	CCG		0.607	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1			14	96	0	0	0	0.00245	0	14	96				
CC2D2B	387707	broad.mit.edu	37	10	97773580	97773580	+	Silent	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:97773580T>C	ENST00000344386.3	+	5	518	c.354T>C	c.(352-354)ttT>ttC	p.F118F	CC2D2B_ENST00000410012.2_Silent_p.F118F|ENTPD1-AS1_ENST00000454638.1_RNA|RP11-690P14.4_ENST00000475252.2_Intron|ENTPD1-AS1_ENST00000452728.1_RNA|CC2D2B_ENST00000371198.2_Intron|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA	NM_001001732.3	NP_001001732.2	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B	118										large_intestine(1)|lung(7)|ovary(1)|urinary_tract(1)	10		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		TGATTCCTTTTGTGCCTAATA	0.308																																							uc001kll.2		NA																	0				ovary(1)	1						c.(352-354)TTT>TTC		coiled-coil and C2 domain containing 2B isoform							127.0	124.0	125.0					10																	97773580		1866	4104	5970	SO:0001819	synonymous_variant	387707							g.chr10:97773580T>C	BC075861	CCDS41555.1, CCDS53560.1	10q23.33	2008-11-06	2007-10-19	2007-10-19	ENSG00000188649	ENSG00000188649			31666	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 130"""	C10orf130			Standard	NM_001001732		Approved	bA248J23.4	uc010qop.2	Q6DHV5	OTTHUMG00000018820	ENST00000344386.3:c.354T>C	10.37:g.97773580T>C			Somatic				uc001klg.1_Intron|uc001klj.1_Intron|CC2D2B_uc001klk.2_Intron|CC2D2B_uc010qop.1_Silent_p.F118F	p.F118F	NM_001001732	NP_001001732	WXS	Illumina HiSeq	Unspecified	Q6DHV5	C2D2B_HUMAN		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)	5	553	+		Colorectal(252;0.158)	118					A2A3E9|B4DYD4|E9PCC3|Q5VUS0	Silent	SNP	ENST00000344386.3	37	c.354T>C	CCDS41555.1																																																																																				0.308	CC2D2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049573.3	NM_001001732		11	22	0	0	0	0.003163	0	11	22				
TLL2	7093	broad.mit.edu	37	10	98180730	98180730	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:98180730G>T	ENST00000357947.3	-	7	1131	c.906C>A	c.(904-906)gcC>gcA	p.A302A	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	302	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		AGGTGTTCCGGGCGTAGTGCA	0.507																																							uc001kml.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(904-906)GCC>GCA		tolloid-like 2 precursor							284.0	251.0	262.0					10																	98180730		2203	4300	6503	SO:0001819	synonymous_variant	7093				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr10:98180730G>T	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.906C>A	10.37:g.98180730G>T			Somatic				TLL2_uc009xvf.1_Silent_p.A250A	p.A302A	NM_012465	NP_036597	WXS	Illumina HiSeq	Unspecified	Q9Y6L7	TLL2_HUMAN		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)	7	1132	-		Colorectal(252;0.0846)	302			Metalloprotease (By similarity).		A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Silent	SNP	ENST00000357947.3	37	c.906C>A	CCDS7449.1																																																																																				0.507	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			39	187	1	0	2.2871e-25	0.007835	3.54871e-25	39	187				
PDCD11	22984	broad.mit.edu	37	10	105166456	105166456	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:105166456C>T	ENST00000369797.3	+	7	873	c.779C>T	c.(778-780)tCa>tTa	p.S260L		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	260					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GTTGGTCACTCAGAGGTTTCT	0.478																																							uc001kwy.1		NA																	0				ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7						c.(778-780)TCA>TTA		programmed cell death 11							136.0	125.0	128.0					10																	105166456		2203	4300	6503	SO:0001583	missense	22984				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding	g.chr10:105166456C>T	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.779C>T	10.37:g.105166456C>T	ENSP00000358812:p.Ser260Leu		Somatic					p.S260L	NM_014976	NP_055791	WXS	Illumina HiSeq	Unspecified	Q14690	RRP5_HUMAN		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	7	866	+		Colorectal(252;0.0747)|Breast(234;0.128)	260					Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	c.779C>T	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	C	5.786	0.329374	0.10956	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.15952	2.38	4.82	2.97	0.34412	Nucleic acid-binding, OB-fold-like (1);	0.962941	0.08660	N	0.912635	T	0.17874	0.0429	L	0.56769	1.78	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.28427	-1.0044	10	0.37606	T	0.19	0.0036	6.3394	0.21314	0.1465:0.6987:0.0:0.1548	.	260	Q14690	RRP5_HUMAN	L	260	ENSP00000358812:S260L	ENSP00000358812:S260L	S	+	2	0	PDCD11	105156446	0.012000	0.17670	0.003000	0.11579	0.137000	0.21094	2.255000	0.43222	0.571000	0.29365	-0.448000	0.05591	TCA		0.478	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			15	81	0	0	0	0.003163	0	15	81				
C10orf90	118611	broad.mit.edu	37	10	128192773	128192773	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:128192773G>A	ENST00000284694.7	-	3	1116	c.996C>T	c.(994-996)ggC>ggT	p.G332G	C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000454341.1_Silent_p.G332G|C10orf90_ENST00000392694.1_Silent_p.G285G|C10orf90_ENST00000544758.1_Silent_p.G429G|C10orf90_ENST00000356858.3_Silent_p.G285G	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	332					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TCCAGCGCTGGCCTACGAGGT	0.547											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001ljq.2		NA																	0				ovary(1)|skin(1)	2						c.(994-996)GGC>GGT		hypothetical protein LOC118611							68.0	67.0	67.0					10																	128192773		2203	4300	6503	SO:0001819	synonymous_variant	118611							g.chr10:128192773G>A	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.996C>T	10.37:g.128192773G>A			Somatic	OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1563	C10orf90_uc001ljp.2_Silent_p.G285G|C10orf90_uc010qum.1_Silent_p.G429G|C10orf90_uc009yao.2_Silent_p.G429G|C10orf90_uc001ljs.1_Silent_p.G285G	p.G332G	NM_001004298	NP_001004298	WXS	Illumina HiSeq	Unspecified	Q96M02	CJ090_HUMAN		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)	3	1117	-		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)	332					B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Silent	SNP	ENST00000284694.7	37	c.996C>T	CCDS31310.1																																																																																				0.547	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298		12	79	0	0	0	0.001368	0	12	79				
NLRP6	171389	broad.mit.edu	37	11	284376	284376	+	Missense_Mutation	SNP	C	C	A	rs534390821		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:284376C>A	ENST00000312165.5	+	6	2348	c.2348C>A	c.(2347-2349)cCg>cAg	p.P783Q	NLRP6_ENST00000534750.1_Missense_Mutation_p.P782Q|RP11-326C3.2_ENST00000533924.1_RNA	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	783					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTAGCCTGGCCGCAGTGCAGG	0.711																																							uc010qvs.1		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(2347-2349)CCG>CAG		NLR family, pyrin domain containing 6							33.0	36.0	35.0					11																	284376		2203	4300	6503	SO:0001583	missense	171389					cytoplasm	ATP binding	g.chr11:284376C>A	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.2348C>A	11.37:g.284376C>A	ENSP00000309767:p.Pro783Gln		Somatic				NLRP6_uc010qvt.1_Missense_Mutation_p.P782Q	p.P783Q	NM_138329	NP_612202	WXS	Illumina HiSeq	Unspecified	P59044	NALP6_HUMAN		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)	6	2348	+		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	783					A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	37	c.2348C>A	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183684	0.38609	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.54279	0.58;0.58	3.06	3.06	0.35304	.	1.042900	0.07708	N	0.941501	T	0.68421	0.2999	M	0.67625	2.065	0.29790	N	0.83329	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.56637	-0.7946	10	0.48119	T	0.1	.	7.6122	0.28137	0.2537:0.7462:0.0:0.0	.	782;783	E9PJZ8;P59044	.;NALP6_HUMAN	Q	782;783	ENSP00000433617:P782Q;ENSP00000309767:P783Q	ENSP00000309767:P783Q	P	+	2	0	NLRP6	274376	0.048000	0.20356	0.988000	0.46212	0.390000	0.30446	3.549000	0.53681	1.732000	0.51606	0.456000	0.33151	CCG		0.711	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329		3	29	1	0	0.00024832	0.009096	0.000272685	3	29				
NLRP14	338323	broad.mit.edu	37	11	7059831	7059831	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:7059831C>T	ENST00000299481.4	+	2	360	c.14C>T	c.(13-15)tCa>tTa	p.S5L		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	5	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GCAGATTCATCATCATCTTCT	0.368																																							uc001mfb.1		NA																	0				ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(13-15)TCA>TTA		NLR family, pyrin domain containing 14							84.0	91.0	89.0					11																	7059831		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7059831C>T	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.14C>T	11.37:g.7059831C>T	ENSP00000299481:p.Ser5Leu		Somatic					p.S5L	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	2	337	+			5			DAPIN.		Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.14C>T	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	C	2.363	-0.346161	0.05208	.	.	ENSG00000158077	ENST00000299481	T	0.71934	-0.61	4.22	1.17	0.20885	Pyrin (1);	0.508636	0.14842	N	0.295195	T	0.56396	0.1982	L	0.40543	1.245	0.09310	N	0.99999	B	0.10296	0.003	B	0.06405	0.002	T	0.46105	-0.9215	10	0.42905	T	0.14	.	6.0044	0.19539	0.0:0.6431:0.0:0.3569	.	5	Q86W24	NAL14_HUMAN	L	5	ENSP00000299481:S5L	ENSP00000299481:S5L	S	+	2	0	NLRP14	7016407	0.000000	0.05858	0.106000	0.21319	0.049000	0.14656	0.016000	0.13377	0.268000	0.21939	-0.345000	0.07892	TCA		0.368	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		12	100	0	0	0	0.000978	0	12	100				
NLRP10	338322	broad.mit.edu	37	11	7982770	7982770	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:7982770G>A	ENST00000328600.2	-	2	550	c.389C>T	c.(388-390)cCc>cTc	p.P130L		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	130					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCTGAGCTGGGCTTGGCCAC	0.562																																							uc001mfv.1		NA																	0				lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9						c.(388-390)CCC>CTC		NLR family, pyrin domain containing 10							64.0	64.0	64.0					11																	7982770		2201	4296	6497	SO:0001583	missense	338322						ATP binding	g.chr11:7982770G>A	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.389C>T	11.37:g.7982770G>A	ENSP00000327763:p.Pro130Leu		Somatic					p.P130L	NM_176821	NP_789791	WXS	Illumina HiSeq	Unspecified	Q86W26	NAL10_HUMAN		Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	406	-			130					Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	37	c.389C>T	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849149	0.32699	.	.	ENSG00000182261	ENST00000328600	T	0.79749	-1.3	4.85	1.97	0.26223	.	1.025880	0.07799	N	0.956206	T	0.64046	0.2563	N	0.19112	0.55	0.09310	N	1	P	0.36789	0.57	B	0.32533	0.147	T	0.53049	-0.8493	10	0.30854	T	0.27	.	5.9784	0.19393	0.314:0.0:0.686:0.0	.	130	Q86W26	NAL10_HUMAN	L	130	ENSP00000327763:P130L	ENSP00000327763:P130L	P	-	2	0	NLRP10	7939346	0.042000	0.20092	0.001000	0.08648	0.021000	0.10359	1.513000	0.35823	0.732000	0.32470	0.655000	0.94253	CCC		0.562	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		12	60	0	0	0	0.001855	0	12	60				
NAV2	89797	broad.mit.edu	37	11	20070445	20070445	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:20070445G>A	ENST00000396087.3	+	16	4242	c.4143G>A	c.(4141-4143)aaG>aaA	p.K1381K	NAV2_ENST00000311043.8_Silent_p.K444K|NAV2_ENST00000349880.4_Silent_p.K1358K|NAV2_ENST00000360655.4_Silent_p.K1294K|NAV2-AS2_ENST00000533767.1_RNA|NAV2_ENST00000533917.1_Silent_p.K444K|NAV2_ENST00000527559.2_Silent_p.K1310K|NAV2_ENST00000396085.1_Silent_p.K1358K|NAV2_ENST00000540292.1_Silent_p.K1312K	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1381	Ser-rich.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						TCTACAGCAAGAATGTGGACC	0.612																																							uc010rdm.1		NA																	0				skin(4)|ovary(1)|pancreas(1)	6						c.(4141-4143)AAG>AAA		neuron navigator 2 isoform 2							123.0	105.0	111.0					11																	20070445		2203	4300	6503	SO:0001819	synonymous_variant	89797					nucleus	ATP binding|helicase activity	g.chr11:20070445G>A	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.4143G>A	11.37:g.20070445G>A			Somatic				NAV2_uc001mpp.2_Silent_p.K1294K|NAV2_uc001mpr.3_Silent_p.K1358K|NAV2_uc001mpt.2_Silent_p.K444K|NAV2_uc009yhx.2_Silent_p.K444K|NAV2_uc009yhy.1_Silent_p.K357K|NAV2_uc009yhz.2_Silent_p.K40K	p.K1381K	NM_145117	NP_660093	WXS	Illumina HiSeq	Unspecified	Q8IVL1	NAV2_HUMAN			16	4504	+			1381			Ser-rich.		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	c.4143G>A	CCDS58126.1																																																																																				0.612	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117		32	101	0	0	0	0.002445	0	32	101				
BBOX1	8424	broad.mit.edu	37	11	27077157	27077157	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:27077157G>T	ENST00000529202.1	+	2	519	c.180G>T	c.(178-180)gtG>gtT	p.V60V	BBOX1_ENST00000263182.3_Silent_p.V60V|BBOX1_ENST00000525090.1_Silent_p.V60V|RP11-1L12.3_ENST00000526061.1_RNA|BBOX1_ENST00000527505.1_3'UTR|BBOX1_ENST00000528583.1_Silent_p.V60V			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	60					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	CTCTTGATGTGAACATTGGAA	0.408																																							uc001mre.1		NA																	0				ovary(1)	1						c.(178-180)GTG>GTT		gamma-butyrobetaine dioxygenase	Succinic acid(DB00139)|Vitamin C(DB00126)						86.0	83.0	84.0					11																	27077157		2202	4299	6501	SO:0001819	synonymous_variant	8424				carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr11:27077157G>T	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.180G>T	11.37:g.27077157G>T			Somatic				BBOX1_uc009yih.1_Silent_p.V60V|BBOX1_uc001mrg.1_Silent_p.V60V	p.V60V	NM_003986	NP_003977	WXS	Illumina HiSeq	Unspecified	O75936	BODG_HUMAN			3	548	+			60					B2R8L7|D3DQZ1|Q6IBJ2	Silent	SNP	ENST00000529202.1	37	c.180G>T	CCDS7862.1																																																																																				0.408	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1	NM_003986		14	39	1	0	1.05317e-09	0.00245	1.35776e-09	14	39				
MYBPC3	4607	broad.mit.edu	37	11	47360146	47360146	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:47360146C>T	ENST00000545968.1	-	23	2287	c.2233G>A	c.(2233-2235)Gat>Aat	p.D745N	MYBPC3_ENST00000256993.4_Missense_Mutation_p.D744N|MYBPC3_ENST00000399249.2_Missense_Mutation_p.D745N	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	745	Ig-like C2-type 5.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		ACGCCCTCATCTTCCTTCTCT	0.647																																							uc001nfa.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2233-2235)GAT>AAT		myosin binding protein C, cardiac							83.0	88.0	87.0					11																	47360146		2106	4209	6315	SO:0001583	missense	4607				cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding	g.chr11:47360146C>T	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.2233G>A	11.37:g.47360146C>T	ENSP00000442795:p.Asp745Asn		Somatic				MYBPC3_uc010rhl.1_RNA	p.D745N	NM_000256	NP_000247	WXS	Illumina HiSeq	Unspecified	Q14896	MYPC3_HUMAN		Lung(87;0.176)	22	2288	-			744			Ig-like C2-type 5.		A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	c.2233G>A	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	C	36	5.625201	0.96671	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.80994	-1.44;-1.44;-1.44	5.4	5.4	0.78164	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.92714	0.7684	M	0.93375	3.41	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.94285	0.7523	9	0.87932	D	0	.	19.209	0.93747	0.0:1.0:0.0:0.0	.	744	Q14896	MYPC3_HUMAN	N	745;745;744	ENSP00000442795:D745N;ENSP00000382193:D745N;ENSP00000256993:D744N	ENSP00000256993:D744N	D	-	1	0	MYBPC3	47316722	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.469000	0.80959	2.536000	0.85505	0.563000	0.77884	GAT		0.647	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3			24	30	0	0	0	0.003954	0	24	30				
PTPRJ	5795	broad.mit.edu	37	11	48177639	48177639	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:48177639A>G	ENST00000418331.2	+	21	3758	c.3406A>G	c.(3406-3408)Att>Gtt	p.I1136V		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	1136	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						ATATGCCATCATTATGTTGAC	0.323																																							uc001ngp.3		NA																	0				breast(3)|kidney(3)|ovary(1)|skin(1)	8						c.(3406-3408)ATT>GTT		protein tyrosine phosphatase, receptor type, J							112.0	109.0	110.0					11																	48177639		2201	4298	6499	SO:0001583	missense	5795				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity	g.chr11:48177639A>G	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.3406A>G	11.37:g.48177639A>G	ENSP00000400010:p.Ile1136Val		Somatic					p.I1136V	NM_002843	NP_002834	WXS	Illumina HiSeq	Unspecified	Q12913	PTPRJ_HUMAN			21	3761	+			1136			Tyrosine-protein phosphatase.|Cytoplasmic (Potential).		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	c.3406A>G	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	A	3.885	-0.025204	0.07589	.	.	ENSG00000149177	ENST00000418331	T	0.05855	3.38	5.5	2.54	0.30619	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	.	.	.	.	T	0.01320	0.0043	N	0.00313	-1.665	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.43491	-0.9388	9	0.02654	T	1	.	7.249	0.26138	0.3124:0.0:0.6876:0.0	.	1136	Q12913	PTPRJ_HUMAN	V	1136	ENSP00000400010:I1136V	ENSP00000400010:I1136V	I	+	1	0	PTPRJ	48134215	1.000000	0.71417	0.972000	0.41901	0.984000	0.73092	4.991000	0.63883	0.243000	0.21327	0.533000	0.62120	ATT		0.323	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1			17	147	0	0	0	0.004007	0	17	147				
TRIM48	79097	broad.mit.edu	37	11	55033135	55033135	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:55033135C>A	ENST00000417545.2	+	3	605	c.519C>A	c.(517-519)aaC>aaA	p.N173K		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	157						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.N173K(1)|p.N157K(1)		endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ATCAGAGAAACCTGAATGTGG	0.408																																							uc010rid.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(517-519)AAC>AAA		tripartite motif-containing 48							41.0	46.0	44.0					11																	55033135		2185	4250	6435	SO:0001583	missense	79097					intracellular	zinc ion binding	g.chr11:55033135C>A	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.519C>A	11.37:g.55033135C>A	ENSP00000402414:p.Asn173Lys		Somatic					p.N173K	NM_024114	NP_077019	WXS	Illumina HiSeq	Unspecified	Q8IWZ4	TRI48_HUMAN			3	605	+			157					Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	c.519C>A	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	c	4.689	0.128204	0.08981	.	.	ENSG00000150244	ENST00000417545	T	0.72051	-0.62	0.596	-1.19	0.09585	.	.	.	.	.	T	0.63954	0.2555	M	0.82193	2.58	0.09310	N	1	B	0.29085	0.232	B	0.26770	0.073	T	0.50432	-0.8829	8	0.25106	T	0.35	.	.	.	.	.	157	Q8IWZ4	TRI48_HUMAN	K	173	ENSP00000402414:N173K	ENSP00000402414:N173K	N	+	3	2	TRIM48	54789711	0.023000	0.18921	0.001000	0.08648	0.007000	0.05969	-0.232000	0.09055	-1.255000	0.02481	-1.046000	0.02355	AAC		0.408	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1			8	62	1	0	0.00829132	0.008291	0.00873995	8	62				
OR4A15	81328	broad.mit.edu	37	11	55136282	55136282	+	Missense_Mutation	SNP	C	C	A	rs376490865		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:55136282C>A	ENST00000314706.3	+	1	923	c.923C>A	c.(922-924)cCc>cAc	p.P308H		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						TTTATAACTCCCATGCTGAAC	0.383																																							uc010rif.1		NA																	0				ovary(1)|skin(1)	2						c.(922-924)CCC>CAC		olfactory receptor, family 4, subfamily A,							185.0	188.0	187.0					11																	55136282		2201	4296	6497	SO:0001583	missense	81328				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55136282C>A	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.923C>A	11.37:g.55136282C>A	ENSP00000325065:p.Pro308His		Somatic					p.P308H	NM_001005275	NP_001005275	WXS	Illumina HiSeq	Unspecified	Q8NGL6	O4A15_HUMAN			1	923	+			308			Helical; Name=7; (Potential).		Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	c.923C>A	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	-	12.38	1.919517	0.33908	.	.	ENSG00000181958	ENST00000314706	T	0.00349	7.99	3.65	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000134	T	0.01222	0.0040	H	0.98646	4.29	0.27520	N	0.951439	D	0.53151	0.958	P	0.57244	0.816	T	0.05053	-1.0909	10	0.87932	D	0	.	12.9163	0.58207	0.0:1.0:0.0:0.0	.	308	Q8NGL6	O4A15_HUMAN	H	308	ENSP00000325065:P308H	ENSP00000325065:P308H	P	+	2	0	OR4A15	54892858	0.998000	0.40836	0.658000	0.29665	0.128000	0.20619	4.683000	0.61679	1.871000	0.54225	0.492000	0.49549	CCC		0.383	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275		71	178	1	0	6.00099e-30	0.00361	9.47904e-30	71	178				
OR4C15	81309	broad.mit.edu	37	11	55322196	55322196	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:55322196C>T	ENST00000314644.2	+	1	414	c.414C>T	c.(412-414)tcC>tcT	p.S138S		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TTGTAGACTCCCTCTATGTGA	0.488										HNSCC(20;0.049)																													uc010rig.1		NA																	0				ovary(1)|skin(1)	2						c.(412-414)TCC>TCT		olfactory receptor, family 4, subfamily C,							174.0	150.0	158.0					11																	55322196		2201	4296	6497	SO:0001819	synonymous_variant	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322196C>T	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.414C>T	11.37:g.55322196C>T		HNSCC(20;0.049)	Somatic					p.S138S	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	414	+			84			Extracellular (Potential).		Q6IFE2	Silent	SNP	ENST00000314644.2	37	c.414C>T	CCDS31501.1																																																																																				0.488	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		30	162	0	0	0	0.008361	0	30	162				
OR4C15	81309	broad.mit.edu	37	11	55322292	55322292	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:55322292C>T	ENST00000314644.2	+	1	510	c.510C>T	c.(508-510)gcC>gcT	p.A170A		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TCCTCACAGCCATGGCCTATG	0.493										HNSCC(20;0.049)																													uc010rig.1		NA																	0				ovary(1)|skin(1)	2						c.(508-510)GCC>GCT		olfactory receptor, family 4, subfamily C,							130.0	116.0	121.0					11																	55322292		2201	4296	6497	SO:0001819	synonymous_variant	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322292C>T	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.510C>T	11.37:g.55322292C>T		HNSCC(20;0.049)	Somatic					p.A170A	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	510	+			116			Helical; Name=3; (Potential).		Q6IFE2	Silent	SNP	ENST00000314644.2	37	c.510C>T	CCDS31501.1																																																																																				0.493	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		10	116	0	0	0	0.006214	0	10	116				
OR4S2	219431	broad.mit.edu	37	11	55419211	55419211	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:55419211C>A	ENST00000312422.2	+	1	832	c.832C>A	c.(832-834)Ccc>Acc	p.P278T		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				CATTATCACTCCCATGTTAAA	0.408																																							uc001nhs.1		NA																	0				skin(2)|ovary(1)	3						c.(832-834)CCC>ACC		olfactory receptor, family 4, subfamily S,							157.0	144.0	149.0					11																	55419211		2181	4037	6218	SO:0001583	missense	219431				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55419211C>A	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.832C>A	11.37:g.55419211C>A	ENSP00000310337:p.Pro278Thr		Somatic					p.P278T	NM_001004059	NP_001004059	WXS	Illumina HiSeq	Unspecified	Q8NH73	OR4S2_HUMAN			1	832	+		all_epithelial(135;0.0748)	278			Helical; Name=7; (Potential).		Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	37	c.832C>A	CCDS31505.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445165	0.83993	.	.	ENSG00000174982	ENST00000312422	T	0.00344	8.02	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000063	T	0.01940	0.0061	H	0.98936	4.375	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.09552	-1.0669	10	0.87932	D	0	.	17.6379	0.88128	0.0:1.0:0.0:0.0	.	278	Q8NH73	OR4S2_HUMAN	T	278	ENSP00000310337:P278T	ENSP00000310337:P278T	P	+	1	0	OR4S2	55175787	0.998000	0.40836	0.992000	0.48379	0.994000	0.84299	4.865000	0.62998	2.508000	0.84585	0.542000	0.68232	CCC		0.408	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059		50	165	1	0	5.13769e-22	0.00361	7.83311e-22	50	165				
OR5L2	26338	broad.mit.edu	37	11	55595447	55595447	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:55595447C>T	ENST00000378397.1	+	1	753	c.753C>T	c.(751-753)tcC>tcT	p.S251S		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TCACTGTCTCCCATGGAACAA	0.498										HNSCC(27;0.073)																													uc001nhy.1		NA																	0				ovary(1)	1						c.(751-753)TCC>TCT		olfactory receptor, family 5, subfamily L,							138.0	124.0	129.0					11																	55595447		2200	4296	6496	SO:0001819	synonymous_variant	26338				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55595447C>T	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.753C>T	11.37:g.55595447C>T		HNSCC(27;0.073)	Somatic					p.S251S	NM_001004739	NP_001004739	WXS	Illumina HiSeq	Unspecified	Q8NGL0	OR5L2_HUMAN			1	753	+		all_epithelial(135;0.208)	251			Helical; Name=6; (Potential).		Q6IF66|Q96RB2	Silent	SNP	ENST00000378397.1	37	c.753C>T	CCDS31511.1																																																																																				0.498	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		26	87	0	0	0	0.007291	0	26	87				
SERPING1	710	broad.mit.edu	37	11	57379371	57379371	+	Missense_Mutation	SNP	C	C	T	rs373751057		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:57379371C>T	ENST00000278407.4	+	7	1438	c.1211C>T	c.(1210-1212)aCg>aTg	p.T404M	SERPING1_ENST00000378323.4_Missense_Mutation_p.T409M|SERPING1_ENST00000340687.6_Missense_Mutation_p.T367M|SERPING1_ENST00000403558.1_Missense_Mutation_p.T447M|SERPING1_ENST00000378324.2_Missense_Mutation_p.T352M	NM_000062.2	NP_000053.2	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G (C1 inhibitor), member 1	404					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(1)	27						ATCAAAGTGACGACCAGCCAG	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19598	0.0		0.0	False		,,,				2504	0.0						uc001nkp.1		NA																	0				central_nervous_system(1)	1						c.(1210-1212)ACG>ATG		serpin peptidase inhibitor, clade G, member 1							114.0	107.0	109.0					11																	57379371		2201	4296	6497	SO:0001583	missense	710	Hereditary_Angioedema			blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity	g.chr11:57379371C>T	X54486	CCDS7962.1	11q12.1	2014-09-17	2008-07-31		ENSG00000149131	ENSG00000149131		"""Serine (or cysteine) peptidase inhibitors"""	1228	protein-coding gene	gene with protein product	"""plasma protease C1 inhibitor"", ""angioedema, hereditary"""	606860	"""serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)"""	C1NH		2026152, 24172014	Standard	NM_000062		Approved	C1IN, C1-INH, HAE1, HAE2	uc001nkp.1	P05155	OTTHUMG00000150304	ENST00000278407.4:c.1211C>T	11.37:g.57379371C>T	ENSP00000278407:p.Thr404Met		Somatic				SERPING1_uc001nkq.1_Missense_Mutation_p.T367M|SERPING1_uc010rju.1_Missense_Mutation_p.T352M|SERPING1_uc010rjv.1_Missense_Mutation_p.T409M|SERPING1_uc001nkr.1_Missense_Mutation_p.T404M|SERPING1_uc009ymi.1_Missense_Mutation_p.T413M|SERPING1_uc009ymj.1_Intron|SERPING1_uc001nks.1_Missense_Mutation_p.T95M	p.T404M	NM_000062	NP_000053	WXS	Illumina HiSeq	Unspecified	P05155	IC1_HUMAN			7	1402	+			404					A6NMU0|A8KAI9|B2R6L5|B4E1F0|B4E1H2|Q16304|Q547W3|Q59EI5|Q7Z455|Q96FE0|Q9UC49|Q9UCF9	Missense_Mutation	SNP	ENST00000278407.4	37	c.1211C>T	CCDS7962.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436441	0.43224	.	.	ENSG00000149131	ENST00000278407;ENST00000340687;ENST00000378323;ENST00000378324;ENST00000403558	D;D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34;-2.34	4.58	-1.28	0.09318	Serpin domain (3);	0.693261	0.14122	N	0.339925	D	0.88683	0.6503	L	0.39898	1.24	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71870	0.975;0.975;0.975	T	0.81795	-0.0769	10	0.66056	D	0.02	.	12.5524	0.56233	0.3814:0.6186:0.0:0.0	.	409;404;404	B4E1F0;E9KL26;P05155	.;.;IC1_HUMAN	M	404;367;409;352;447	ENSP00000278407:T404M;ENSP00000341861:T367M;ENSP00000367574:T409M;ENSP00000367575:T352M;ENSP00000384420:T447M	ENSP00000278407:T404M	T	+	2	0	SERPING1	57135947	0.377000	0.25106	0.146000	0.22360	0.934000	0.57294	0.447000	0.21710	-0.069000	0.12931	-0.397000	0.06425	ACG		0.527	SERPING1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317465.1	NM_000062		17	79	0	0	0	0.006122	0	17	79				
GLYAT	10249	broad.mit.edu	37	11	58478160	58478160	+	Missense_Mutation	SNP	G	G	A	rs200442404	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:58478160G>A	ENST00000344743.3	-	5	532	c.391C>T	c.(391-393)Cgc>Tgc	p.R131C	GLYAT_ENST00000278400.3_Missense_Mutation_p.R131C|GLYAT_ENST00000529732.1_Missense_Mutation_p.R131C	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	131					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)	p.R131C(1)		NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	TAGAGAATGCGTTGTGTTTGT	0.428													G|||	11	0.00219649	0.0	0.0	5008	,	,		20019	0.0		0.0	False		,,,				2504	0.0112						uc001nnb.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(391-393)CGC>TGC		glycine-N-acyltransferase isoform a	Glycine(DB00145)						172.0	155.0	161.0					11																	58478160		2201	4295	6496	SO:0001583	missense	10249				acyl-CoA metabolic process|response to toxin|xenobiotic metabolic process	mitochondrial matrix	glycine N-acyltransferase activity|glycine N-benzoyltransferase activity	g.chr11:58478160G>A	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.391C>T	11.37:g.58478160G>A	ENSP00000340200:p.Arg131Cys		Somatic				GLYAT_uc001nnc.2_Missense_Mutation_p.R131C	p.R131C	NM_201648	NP_964011	WXS	Illumina HiSeq	Unspecified	Q6IB77	GLYAT_HUMAN			5	546	-		Breast(21;0.0044)|all_epithelial(135;0.0157)	131					O14833|Q96QK7	Missense_Mutation	SNP	ENST00000344743.3	37	c.391C>T	CCDS7970.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.419945	0.25552	.	.	ENSG00000149124	ENST00000344743;ENST00000529732;ENST00000278400	T;T;T	0.16743	2.32;2.32;2.32	5.88	-11.8	0.00035	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, N-terminal (1);	1.761000	0.02153	N	0.058160	T	0.03739	0.0106	N	0.01122	-1.005	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.33394	-0.9870	10	0.22706	T	0.39	-0.0383	4.6346	0.12518	0.1113:0.0801:0.2257:0.5829	.	131;131	Q6IB77-2;Q6IB77	.;GLYAT_HUMAN	C	131	ENSP00000340200:R131C;ENSP00000431688:R131C;ENSP00000278400:R131C	ENSP00000278400:R131C	R	-	1	0	GLYAT	58234736	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.479000	0.02327	-1.461000	0.01909	-1.147000	0.01851	CGC		0.428	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1			9	135	0	0	0	0.004482	0	9	135				
ATG2A	23130	broad.mit.edu	37	11	64662780	64662780	+	Silent	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:64662780G>C	ENST00000377264.3	-	40	5674	c.5562C>G	c.(5560-5562)gcC>gcG	p.A1854A	ATG2A_ENST00000421419.2_Silent_p.A1856A	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1854					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CTGTGTCGTAGGCCTTGGCCA	0.716																																							uc001obx.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(5560-5562)GCC>GCG		autophagy related 2A							33.0	37.0	36.0					11																	64662780		2200	4292	6492	SO:0001819	synonymous_variant	23130						protein binding	g.chr11:64662780G>C		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.5562C>G	11.37:g.64662780G>C			Somatic				uc009ypx.2_5'Flank|ATG2A_uc001obw.2_Silent_p.A619A	p.A1854A	NM_015104	NP_055919	WXS	Illumina HiSeq	Unspecified	Q2TAZ0	ATG2A_HUMAN			40	5677	-			1854					O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Silent	SNP	ENST00000377264.3	37	c.5562C>G	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	G	7.231	0.599264	0.13939	.	.	ENSG00000110046	ENST00000418259	.	.	.	3.7	0.619	0.17630	.	.	.	.	.	T	0.50956	0.1646	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35674	-0.9779	4	.	.	.	.	5.2138	0.15332	0.1037:0.0:0.3697:0.5265	.	.	.	.	V	1658	.	.	L	-	1	2	ATG2A	64419356	0.983000	0.35010	0.997000	0.53966	0.808000	0.45660	0.091000	0.15046	0.027000	0.15297	-0.314000	0.08810	CTA		0.716	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104		8	55	0	0	0	0.006214	0	8	55				
TPCN2	219931	broad.mit.edu	37	11	68822749	68822749	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:68822749C>G	ENST00000294309.3	+	4	459	c.358C>G	c.(358-360)Ccg>Gcg	p.P120A	TPCN2_ENST00000542467.1_Missense_Mutation_p.P120A|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	120					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TCCCTGGGAGCCGCCCTGCGG	0.637																																							uc001oos.2		NA																	0					0						c.(358-360)CCG>GCG		two pore segment channel 2							93.0	88.0	90.0					11																	68822749		2200	4294	6494	SO:0001583	missense	219931				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity	g.chr11:68822749C>G	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.358C>G	11.37:g.68822749C>G	ENSP00000294309:p.Pro120Ala		Somatic				TPCN2_uc009ysk.1_RNA|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Missense_Mutation_p.P120A	p.P120A	NM_139075	NP_620714	WXS	Illumina HiSeq	Unspecified	Q8NHX9	TPC2_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		4	474	+			120			Extracellular (Potential).		Q9NT82	Missense_Mutation	SNP	ENST00000294309.3	37	c.358C>G	CCDS8189.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813160	0.32053	.	.	ENSG00000162341	ENST00000356782;ENST00000294309;ENST00000542467	D;D	0.97279	-4.32;-4.32	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.95733	0.8612	L	0.55834	1.745	0.58432	D	0.999998	D;D	0.54397	0.966;0.966	P;P	0.45794	0.493;0.493	D	0.94458	0.7673	10	0.15952	T	0.53	-35.4643	18.1761	0.89761	0.0:1.0:0.0:0.0	.	120;120	E7ETX0;Q8NHX9	.;TPC2_HUMAN	A	50;120;120	ENSP00000294309:P120A;ENSP00000445551:P120A	ENSP00000294309:P120A	P	+	1	0	TPCN2	68579325	1.000000	0.71417	0.974000	0.42286	0.129000	0.20672	6.474000	0.73578	2.471000	0.83476	0.561000	0.74099	CCG		0.637	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075		19	96	0	0	0	0.008871	0	19	96				
PPFIA1	8500	broad.mit.edu	37	11	70171605	70171605	+	Splice_Site	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:70171605G>T	ENST00000253925.7	+	5	746		c.e5-1		CTA-797E19.2_ENST00000526017.1_RNA|AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Splice_Site	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1						cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TTTATTTTCAGGTGAGAGAGC	0.328																																							uc001opo.2		NA																	0				lung(2)|ovary(1)	3						c.e5-1		PTPRF interacting protein alpha 1 isoform b							109.0	103.0	105.0					11																	70171605		2200	4294	6494	SO:0001630	splice_region_variant	8500				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity	g.chr11:70171605G>T	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.532-1G>T	11.37:g.70171605G>T			Somatic				PPFIA1_uc001opn.1_Splice_Site_p.V178_splice|PPFIA1_uc001opp.2_Splice_Site|PPFIA1_uc001opq.1_5'Flank	p.V178_splice	NM_003626	NP_003617	WXS	Illumina HiSeq	Unspecified	Q13136	LIPA1_HUMAN	BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)		5	730	+								A6NLE3|Q13135|Q14567|Q8N4I2	Splice_Site	SNP	ENST00000253925.7	37	c.532_splice	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240906	0.79912	.	.	ENSG00000131626	ENST00000253925;ENST00000389547	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6421	0.91399	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PPFIA1	69849253	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.381000	0.97205	2.392000	0.81423	0.558000	0.71614	.		0.328	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	Intron	42	79	1	0	1.34996e-11	0.009718	1.82072e-11	42	79				
C2CD3	26005	broad.mit.edu	37	11	73820134	73820134	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:73820134C>A	ENST00000334126.7	-	12	2133	c.1907G>T	c.(1906-1908)tGg>tTg	p.W636L	C2CD3_ENST00000313663.7_Missense_Mutation_p.W636L			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	636					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.W636*(2)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GGAATTCCACCAGTGCTCTAT	0.438																																							uc001ouu.2		NA																	2	Substitution - Nonsense(2)		large_intestine(2)	ovary(4)|pancreas(2)|skin(1)	7						c.(1906-1908)TGG>TTG		C2 calcium-dependent domain containing 3							123.0	119.0	120.0					11																	73820134		2200	4293	6493	SO:0001583	missense	26005					centrosome		g.chr11:73820134C>A	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1907G>T	11.37:g.73820134C>A	ENSP00000334379:p.Trp636Leu		Somatic					p.W636L	NM_015531	NP_056346	WXS	Illumina HiSeq	Unspecified	Q4AC94	C2CD3_HUMAN			12	2134	-	Breast(11;4.16e-06)		636					C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37	c.1907G>T		.	.	.	.	.	.	.	.	.	.	C	29.9	5.042832	0.93685	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.52295	0.67;0.83	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.69744	0.3145	M	0.71581	2.175	0.52501	D	0.999959	D	0.89917	1.0	D	0.87578	0.998	T	0.72243	-0.4350	10	0.72032	D	0.01	-4.4669	18.9103	0.92481	0.0:1.0:0.0:0.0	.	636	Q4AC94-1	.	L	636	ENSP00000334379:W636L;ENSP00000323339:W636L	ENSP00000323339:W636L	W	-	2	0	C2CD3	73497782	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.479000	0.66813	2.561000	0.86390	0.650000	0.86243	TGG		0.438	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531		30	42	1	0	2.4375e-19	0.007291	3.60147e-19	30	42				
C2CD3	26005	broad.mit.edu	37	11	73844552	73844552	+	Missense_Mutation	SNP	T	T	C	rs138239571		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:73844552T>C	ENST00000334126.7	-	6	1232	c.1006A>G	c.(1006-1008)Atg>Gtg	p.M336V	C2CD3_ENST00000539061.1_Missense_Mutation_p.M336V|C2CD3_ENST00000313663.7_Missense_Mutation_p.M336V			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	336					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					CTTGATTTCATTGCAGAAATC	0.403																																							uc001ouu.2		NA																	0				ovary(4)|pancreas(2)|skin(1)	7						c.(1006-1008)ATG>GTG		C2 calcium-dependent domain containing 3							147.0	129.0	135.0					11																	73844552		2200	4293	6493	SO:0001583	missense	26005					centrosome		g.chr11:73844552T>C	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1006A>G	11.37:g.73844552T>C	ENSP00000334379:p.Met336Val		Somatic				C2CD3_uc001ouv.2_Missense_Mutation_p.M336V	p.M336V	NM_015531	NP_056346	WXS	Illumina HiSeq	Unspecified	Q4AC94	C2CD3_HUMAN			6	1233	-	Breast(11;4.16e-06)		336					C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37	c.1006A>G		.	.	.	.	.	.	.	.	.	.	T	16.47	3.132656	0.56828	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000289350;ENST00000539061	T;T	0.10192	2.9;2.94	5.79	5.79	0.91817	.	0.051153	0.85682	D	0.000000	T	0.31734	0.0806	M	0.69823	2.125	0.34523	D	0.708355	D;D	0.60160	0.987;0.982	P;D	0.68943	0.881;0.961	T	0.46020	-0.9221	10	0.72032	D	0.01	-15.6001	14.3675	0.66815	0.0:0.0:0.0:1.0	.	336;336	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	V	336	ENSP00000334379:M336V;ENSP00000323339:M336V	ENSP00000289350:M336V	M	-	1	0	C2CD3	73522200	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.680000	0.46918	2.212000	0.71576	0.533000	0.62120	ATG		0.403	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531		11	34	0	0	0	0.008291	0	11	34				
INTS4	92105	broad.mit.edu	37	11	77702195	77702195	+	Missense_Mutation	SNP	C	C	T	rs144227709		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:77702195C>T	ENST00000534064.1	-	2	239	c.205G>A	c.(205-207)Gta>Ata	p.V69I	INTS4_ENST00000527522.1_Missense_Mutation_p.V69I|INTS4_ENST00000529807.1_Missense_Mutation_p.V69I	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	69					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			ACTCCCTCTACGCTTTCCGCC	0.463																																							uc001oys.2		NA																	0				ovary(2)	2						c.(205-207)GTA>ATA		integrator complex subunit 4		C	ILE/VAL	1,4399	2.1+/-5.4	0,1,2199	135.0	125.0	128.0		205	5.4	1.0	11	dbSNP_134	128	1,8583	1.2+/-3.3	0,1,4291	yes	missense	INTS4	NM_033547.3	29	0,2,6490	TT,TC,CC		0.0116,0.0227,0.0154	benign	69/964	77702195	2,12982	2200	4292	6492	SO:0001583	missense	92105				snRNA processing	integrator complex	protein binding	g.chr11:77702195C>T	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.205G>A	11.37:g.77702195C>T	ENSP00000434466:p.Val69Ile		Somatic				INTS4_uc001oyt.2_RNA|INTS4_uc001oyu.1_Missense_Mutation_p.V69I|INTS4_uc001oyv.1_RNA	p.V69I	NM_033547	NP_291025	WXS	Illumina HiSeq	Unspecified	Q96HW7	INT4_HUMAN	Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)		2	233	-	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		69			HEAT 1.		Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	c.205G>A	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	C	34	5.317484	0.95682	2.27E-4	1.16E-4	ENSG00000149262	ENST00000534064;ENST00000529807;ENST00000527522	T;T	0.65732	-0.17;1.48	5.41	5.41	0.78517	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75642	0.3877	L	0.50333	1.59	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.76509	-0.2933	10	0.72032	D	0.01	-17.0841	19.3872	0.94563	0.0:1.0:0.0:0.0	.	69	Q96HW7	INT4_HUMAN	I	69	ENSP00000434466:V69I;ENSP00000433644:V69I	ENSP00000407787:V69I	V	-	1	0	INTS4	77379843	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.081000	0.76844	2.815000	0.96918	0.643000	0.83706	GTA		0.463	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547		11	109	0	0	0	0.001855	0	11	109				
PRCP	5547	broad.mit.edu	37	11	82549566	82549566	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:82549566C>T	ENST00000313010.3	-	8	1331	c.1137G>A	c.(1135-1137)atG>atA	p.M379I	PRCP_ENST00000535099.1_Missense_Mutation_p.M274I|PRCP_ENST00000393399.2_Missense_Mutation_p.M400I|PRCP_ENST00000525772.1_5'UTR	NM_005040.2	NP_005031.1	P42785	PCP_HUMAN	prolylcarboxypeptidase (angiotensinase C)	379					angiogenesis involved in wound healing (GO:0060055)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|energy homeostasis (GO:0097009)|glucose homeostasis (GO:0042593)|negative regulation of systemic arterial blood pressure (GO:0003085)|plasma kallikrein-kinin cascade (GO:0002353)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						GAGGTTCAAACATGTCATCGA	0.428																																							uc001ozs.2		NA																	0				skin(1)	1						c.(1135-1137)ATG>ATA		prolylcarboxypeptidase isoform 1 preproprotein							136.0	117.0	123.0					11																	82549566		2203	4300	6503	SO:0001583	missense	5547				blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity	g.chr11:82549566C>T	BC001500, BI827978, L13977	CCDS8262.1, CCDS41695.1	11q14	2005-10-04				ENSG00000137509			9344	protein-coding gene	gene with protein product		176785				8344943	Standard	NM_199418		Approved	PCP, HUMPCP	uc001ozr.3	P42785		ENST00000313010.3:c.1137G>A	11.37:g.82549566C>T	ENSP00000317362:p.Met379Ile		Somatic				PRCP_uc001ozr.2_Missense_Mutation_p.M400I	p.M379I	NM_005040	NP_005031	WXS	Illumina HiSeq	Unspecified	P42785	PCP_HUMAN			8	1250	-			379					A8MU24|B2R7B7|B3KRK5|B5BU34	Missense_Mutation	SNP	ENST00000313010.3	37	c.1137G>A	CCDS8262.1	.	.	.	.	.	.	.	.	.	.	C	34	5.403918	0.96051	.	.	ENSG00000137509	ENST00000313010;ENST00000393399;ENST00000535099	D;D;D	0.92545	-3.06;-3.06;-3.06	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.95840	0.8646	M	0.81802	2.56	0.80722	D	1	D;P	0.55172	0.97;0.859	P;P	0.59889	0.865;0.759	D	0.94786	0.7958	9	.	.	.	-27.0518	20.6208	0.99490	0.0:1.0:0.0:0.0	.	379;400	P42785;A8MU24	PCP_HUMAN;.	I	379;400;274	ENSP00000317362:M379I;ENSP00000377055:M400I;ENSP00000442077:M274I	.	M	-	3	0	PRCP	82227214	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.487000	0.81328	2.882000	0.98803	0.655000	0.94253	ATG		0.428	PRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391792.1	NM_005040		12	61	0	0	0	0.001368	0	12	61				
HEPHL1	341208	broad.mit.edu	37	11	93822121	93822121	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:93822121G>A	ENST00000315765.9	+	12	2289	c.2281G>A	c.(2281-2283)Gca>Aca	p.A761T		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	761	Plastocyanin-like 5.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GCACGTGGACGCAAGAGGGGA	0.542																																							uc001pep.2		NA																	0				ovary(3)	3						c.(2281-2283)GCA>ACA		hephaestin-like 1 precursor							69.0	74.0	72.0					11																	93822121		1979	4165	6144	SO:0001583	missense	341208				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity	g.chr11:93822121G>A	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2281G>A	11.37:g.93822121G>A	ENSP00000313699:p.Ala761Thr		Somatic				uc001pen.1_Intron	p.A761T	NM_001098672	NP_001092142	WXS	Illumina HiSeq	Unspecified	Q6MZM0	HPHL1_HUMAN			12	2438	+		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)	761			Plastocyanin-like 5.|Extracellular (Potential).		Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	c.2281G>A	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.131163	0.37630	.	.	ENSG00000181333	ENST00000315765	D	0.98876	-5.2	5.23	3.22	0.36961	Cupredoxin (2);	1.003370	0.08019	N	0.991664	D	0.95433	0.8517	N	0.17379	0.485	0.31423	N	0.674085	B	0.22211	0.066	B	0.10450	0.005	D	0.92238	0.5798	10	0.24483	T	0.36	.	11.7323	0.51744	0.0:0.0:0.6815:0.3185	.	761	Q6MZM0	HPHL1_HUMAN	T	761	ENSP00000313699:A761T	ENSP00000313699:A761T	A	+	1	0	HEPHL1	93461769	0.813000	0.29090	1.000000	0.80357	0.971000	0.66376	1.163000	0.31798	1.186000	0.42985	0.555000	0.69702	GCA		0.542	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947		9	83	0	0	0	0.004482	0	9	83				
PGR	5241	broad.mit.edu	37	11	100933199	100933199	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:100933199T>A	ENST00000325455.5	-	4	3644	c.2191A>T	c.(2191-2193)Aag>Tag	p.K731*	PGR_ENST00000263463.5_Intron|PGR_ENST00000534013.1_Nonsense_Mutation_p.K137*	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	731	Steroid-binding.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	TTAGACCACTTGACTACTGAA	0.333																																					Pancreas(124;2271 2354 21954 22882)	Pancreas(124;2271 2354 21954 22882)	uc001pgh.2		NA																	0				lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4						c.(2191-2193)AAG>TAG		progesterone receptor	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)						131.0	123.0	126.0					11																	100933199		2203	4300	6503	SO:0001587	stop_gained	5241				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr11:100933199T>A	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2191A>T	11.37:g.100933199T>A	ENSP00000325120:p.Lys731*		Somatic				PGR_uc001pgg.2_Nonsense_Mutation_p.K112*|PGR_uc001pgi.2_Intron|PGR_uc009yww.1_Intron|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	p.K731*	NM_000926	NP_000917	WXS	Illumina HiSeq	Unspecified	P06401	PRGR_HUMAN		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	4	2934	-		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)	731			Steroid-binding.		A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Nonsense_Mutation	SNP	ENST00000325455.5	37	c.2191A>T	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	T	41	8.746714	0.98937	.	.	ENSG00000082175	ENST00000325455;ENST00000534013	.	.	.	5.97	5.97	0.96955	.	0.047301	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	.	.	.	X	731;137	.	ENSP00000325120:K731X	K	-	1	0	PGR	100438409	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.894000	0.69806	2.288000	0.76882	0.533000	0.62120	AAG		0.333	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1			52	112	0	0	0	0.00361	0	52	112				
SIK2	23235	broad.mit.edu	37	11	111594504	111594504	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:111594504C>T	ENST00000304987.3	+	15	2605	c.2432C>T	c.(2431-2433)gCt>gTt	p.A811V		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	811					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						CCCCGGGCTGCTCCTCCTCTG	0.657																																							uc001plt.2		NA																	0				central_nervous_system(2)|skin(1)	3						c.(2431-2433)GCT>GTT		SNF1-like kinase 2							87.0	95.0	92.0					11																	111594504		2201	4297	6498	SO:0001583	missense	23235				intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:111594504C>T	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.2432C>T	11.37:g.111594504C>T	ENSP00000305976:p.Ala811Val		Somatic					p.A811V	NM_015191	NP_056006	WXS	Illumina HiSeq	Unspecified	Q9H0K1	SIK2_HUMAN			15	2550	+			811					A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	ENST00000304987.3	37	c.2432C>T	CCDS8347.1	.	.	.	.	.	.	.	.	.	.	C	3.232	-0.157221	0.06544	.	.	ENSG00000170145	ENST00000304987	T	0.23950	1.88	3.89	0.895	0.19247	.	0.479877	0.17593	N	0.168694	T	0.11196	0.0273	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.10450	0.005	T	0.21690	-1.0238	10	0.40728	T	0.16	.	6.4771	0.22043	0.0:0.66:0.0:0.34	.	811	Q9H0K1	SIK2_HUMAN	V	811	ENSP00000305976:A811V	ENSP00000305976:A811V	A	+	2	0	SIK2	111099714	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	1.256000	0.32921	0.145000	0.18977	-0.275000	0.10095	GCT		0.657	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191		27	132	0	0	0	0.005443	0	27	132				
SIK2	23235	broad.mit.edu	37	11	111594549	111594549	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:111594549C>T	ENST00000304987.3	+	15	2650	c.2477C>T	c.(2476-2478)cCa>cTa	p.P826L		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	826					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						ccgccaccgccaccaccccct	0.662																																							uc001plt.2		NA																	0				central_nervous_system(2)|skin(1)	3						c.(2476-2478)CCA>CTA		SNF1-like kinase 2							30.0	37.0	35.0					11																	111594549		2201	4297	6498	SO:0001583	missense	23235				intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:111594549C>T	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.2477C>T	11.37:g.111594549C>T	ENSP00000305976:p.Pro826Leu		Somatic					p.P826L	NM_015191	NP_056006	WXS	Illumina HiSeq	Unspecified	Q9H0K1	SIK2_HUMAN			15	2595	+			826					A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	ENST00000304987.3	37	c.2477C>T	CCDS8347.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.503161	0.00992	.	.	ENSG00000170145	ENST00000304987	T	0.23552	1.9	5.23	4.26	0.50523	.	0.196582	0.45606	D	0.000348	T	0.17408	0.0418	L	0.47716	1.5	0.09310	N	1	B	0.17038	0.02	B	0.14023	0.01	T	0.17837	-1.0356	10	0.13108	T	0.6	.	4.9148	0.13840	0.0:0.6419:0.1867:0.1714	.	826	Q9H0K1	SIK2_HUMAN	L	826	ENSP00000305976:P826L	ENSP00000305976:P826L	P	+	2	0	SIK2	111099759	0.036000	0.19791	0.025000	0.17156	0.025000	0.11179	1.521000	0.35910	2.465000	0.83290	0.561000	0.74099	CCA		0.662	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191		18	47	0	0	0	0.00499	0	18	47				
CBL	867	broad.mit.edu	37	11	119149351	119149351	+	Silent	SNP	A	A	G	rs34732429	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:119149351A>G	ENST00000264033.4	+	9	1735	c.1359A>G	c.(1357-1359)ccA>ccG	p.P453P		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	453	Asp/Glu-rich (acidic).				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E366_K477del(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CTCCCTCCCCAAATTATGATG	0.478			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																														uc001pwe.2		NA		"""Dom, Rec"""	yes		11	11q23.3	867		Cas-Br-M (murine) ecotropic retroviral transforming			L					1	Deletion - In frame(1)	p.E366_K477del(1)	haematopoietic_and_lymphoid_tissue(1)	haematopoietic_and_lymphoid_tissue(135)|lung(10)|central_nervous_system(2)|ovary(1)|breast(1)	149						c.(1357-1359)CCA>CCG		Cas-Br-M (murine) ecotropic retroviral							98.0	98.0	98.0					11																	119149351		2199	4295	6494	SO:0001819	synonymous_variant	867	CBL_gene-associated_Juvenile_Myelomonocytic_Leukemia_and_Developmental_Anomalies|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:119149351A>G	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.1359A>G	11.37:g.119149351A>G			Somatic					p.P453P	NM_005188	NP_005179	WXS	Illumina HiSeq	Unspecified	P22681	CBL_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)	9	1497	+		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	453			Asp/Glu-rich (acidic).		A3KMP8	Silent	SNP	ENST00000264033.4	37	c.1359A>G	CCDS8418.1																																																																																				0.478	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4	NM_005188		16	65	0	0	0	0.006122	0	16	65				
MCAM	4162	broad.mit.edu	37	11	119182639	119182639	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:119182639C>A	ENST00000264036.4	-	10	1178	c.1164G>T	c.(1162-1164)agG>agT	p.R388S	MCAM_ENST00000530144.2_5'Flank|MCAM_ENST00000392814.1_Missense_Mutation_p.R337S	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	388	Ig-like C2-type 2.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		GCACAGGCCCCCTTTCCAGCA	0.632																																							uc001pwf.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(1162-1164)AGG>AGT		melanoma cell adhesion molecule							105.0	107.0	106.0					11																	119182639		2199	4295	6494	SO:0001583	missense	4162				anatomical structure morphogenesis|cell adhesion	integral to membrane|plasma membrane		g.chr11:119182639C>A	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1164G>T	11.37:g.119182639C>A	ENSP00000264036:p.Arg388Ser		Somatic				MCAM_uc001pwg.1_5'Flank	p.R388S	NM_006500	NP_006491	WXS	Illumina HiSeq	Unspecified	P43121	MUC18_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)	10	1193	-		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	388			Ig-like C2-type 2.|Extracellular (Potential).		O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	37	c.1164G>T	CCDS31690.1	.	.	.	.	.	.	.	.	.	.	C	5.363	0.252306	0.10185	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.20463	2.07;2.07	4.73	2.7	0.31948	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.09949	0.0244	N	0.14661	0.345	0.20703	N	0.999864	B	0.27264	0.173	B	0.29524	0.103	T	0.35822	-0.9773	9	0.12430	T	0.62	-2.5698	3.7064	0.08403	0.2081:0.5848:0.0:0.2071	.	388	P43121	MUC18_HUMAN	S	388;337	ENSP00000264036:R388S;ENSP00000376561:R337S	ENSP00000264036:R388S	R	-	3	2	MCAM	118687849	0.037000	0.19845	0.537000	0.28052	0.059000	0.15707	0.482000	0.22276	1.208000	0.43306	-0.379000	0.06801	AGG		0.632	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2			22	119	1	0	5.35356e-11	0.00278	7.07531e-11	22	119				
OR10G9	219870	broad.mit.edu	37	11	123894335	123894335	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:123894335G>T	ENST00000375024.1	+	1	616	c.616G>T	c.(616-618)Gcc>Tcc	p.A206S		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TGGGCTAGTGGCCTCGGGCTG	0.547																																							uc010sad.1		NA																	0				skin(2)	2						c.(616-618)GCC>TCC		olfactory receptor, family 10, subfamily G,							254.0	220.0	231.0					11																	123894335		2201	4299	6500	SO:0001583	missense	219870				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123894335G>T	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.616G>T	11.37:g.123894335G>T	ENSP00000364164:p.Ala206Ser		Somatic					p.A206S	NM_001001953	NP_001001953	WXS	Illumina HiSeq	Unspecified	Q8NGN4	O10G9_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	616	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	206			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000375024.1	37	c.616G>T	CCDS31703.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.723896	0.00694	.	.	ENSG00000236981	ENST00000375024	T	0.36878	1.23	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000284	T	0.21590	0.0520	N	0.25201	0.72	0.19775	N	0.999952	B	0.18166	0.026	B	0.29524	0.103	T	0.24297	-1.0164	10	0.05833	T	0.94	.	10.2912	0.43596	0.0:0.0:0.8021:0.1979	.	206	Q8NGN4	O10G9_HUMAN	S	206	ENSP00000364164:A206S	ENSP00000364164:A206S	A	+	1	0	OR10G9	123399545	0.000000	0.05858	0.682000	0.30024	0.048000	0.14542	-0.029000	0.12329	1.938000	0.56188	0.655000	0.94253	GCC		0.547	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953		29	204	1	0	8.58068e-18	0.007291	1.25026e-17	29	204				
OR8B8	26493	broad.mit.edu	37	11	124310129	124310129	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:124310129G>T	ENST00000328064.2	-	1	925	c.853C>A	c.(853-855)Ctc>Atc	p.L285I		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	285					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		AATGGGTTGAGCATGGGCACC	0.423																																							uc010sal.1		NA																	0				ovary(1)	1						c.(853-855)CTC>ATC		olfactory receptor, family 8, subfamily B,							106.0	97.0	100.0					11																	124310129		2201	4299	6500	SO:0001583	missense	26493				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124310129G>T	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.853C>A	11.37:g.124310129G>T	ENSP00000330280:p.Leu285Ile		Somatic					p.L285I	NM_012378	NP_036510	WXS	Illumina HiSeq	Unspecified	Q15620	OR8B8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)	1	853	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	285			Helical; Name=7; (Potential).		A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	37	c.853C>A	CCDS8446.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.367426	0.42003	.	.	ENSG00000197125	ENST00000328064	T	0.44083	0.93	3.81	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41001	D	0.000971	T	0.53899	0.1825	M	0.86953	2.85	0.26851	N	0.968156	P	0.50943	0.94	P	0.51866	0.682	T	0.52719	-0.8538	10	0.72032	D	0.01	.	5.9472	0.19225	0.0922:0.0:0.5671:0.3407	.	285	Q15620	OR8B8_HUMAN	I	285	ENSP00000330280:L285I	ENSP00000330280:L285I	L	-	1	0	OR8B8	123815339	0.622000	0.27085	1.000000	0.80357	0.777000	0.43975	0.272000	0.18644	1.132000	0.42129	0.655000	0.94253	CTC		0.423	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378		27	78	1	0	3.73988e-18	0.00632	5.46438e-18	27	78				
STT3A	3703	broad.mit.edu	37	11	125478177	125478177	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr11:125478177G>T	ENST00000529196.1	+	10	1160	c.954G>T	c.(952-954)atG>atT	p.M318I	STT3A_ENST00000392708.4_Missense_Mutation_p.M318I|STT3A_ENST00000531491.1_Missense_Mutation_p.M226I			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	318					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		CTCTCCTCATGCTGACAGGTA	0.488																																							uc001qcd.2		NA																	0					0						c.(952-954)ATG>ATT		integral membrane protein 1							93.0	89.0	90.0					11																	125478177		2201	4299	6500	SO:0001583	missense	3703				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity	g.chr11:125478177G>T	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.954G>T	11.37:g.125478177G>T	ENSP00000436962:p.Met318Ile		Somatic				STT3A_uc009zbm.2_Missense_Mutation_p.M318I|STT3A_uc001qce.2_Missense_Mutation_p.M318I|STT3A_uc010sbg.1_Missense_Mutation_p.M226I|STT3A_uc009zbn.2_Missense_Mutation_p.M92I	p.M318I	NM_152713	NP_689926	WXS	Illumina HiSeq	Unspecified	P46977	STT3A_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)	9	1064	+	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)	318			Helical; (Potential).		B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Missense_Mutation	SNP	ENST00000529196.1	37	c.954G>T	CCDS8458.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687614	0.68157	.	.	ENSG00000134910	ENST00000392708;ENST00000529196;ENST00000531491	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.42854	0.1221	N	0.05383	-0.06	0.80722	D	1	B;B;B	0.21520	0.057;0.001;0.0	B;B;B	0.22386	0.039;0.005;0.012	T	0.29427	-1.0012	9	0.45353	T	0.12	-22.844	19.7105	0.96095	0.0:0.0:1.0:0.0	.	226;226;318	B4DJ24;E9PNQ1;P46977	.;.;STT3A_HUMAN	I	318;318;226	.	ENSP00000376472:M318I	M	+	3	0	STT3A	124983387	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.487000	0.97945	2.760000	0.94817	0.655000	0.94253	ATG		0.488	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386691.1	NM_152713		33	70	1	0	3.11337e-16	0.002836	4.43804e-16	33	70				
Unknown	0	broad.mit.edu	37	12	92018	92018	+	IGR	SNP	T	T	C	rs376561453		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:92018T>C								AC215219.1 (18696 upstream) : AC026369.1 (55033 downstream)																							GACTCCACACTCTCCTGGGTT	0.592																																							uc010sdi.1		NA																	0					NA						c.(292-294)AGT>GGT		SubName: Full=DEAD/H box polypeptide 11 like 11;																																				SO:0001628	intergenic_variant	0							g.chr12:92018T>C																													12.37:g.92018T>C			Somatic				uc010sdj.1_RNA	p.S98G			WXS	Illumina HiSeq	Unspecified					2	320	-									Missense_Mutation	SNP		37	c.292A>G																																																																																				0	0.592									3	9	0	0	0	0.004672	0	3	9				
TULP3	7289	broad.mit.edu	37	12	3040232	3040232	+	Silent	SNP	C	C	T	rs200046674		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:3040232C>T	ENST00000448120.2	+	6	573	c.522C>T	c.(520-522)gcC>gcT	p.A174A	TULP3_ENST00000397132.2_Silent_p.A174A|RNU7-166P_ENST00000459397.1_RNA	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	174				TSGSATAAQPADNL -> IPVLLLPPNQLITF (in Ref. 1; AAC95431). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CTGCTACTGCCGCCCAACCAG	0.488													A|||	1	0.000199681	0.0	0.0014	5008	,	,		15947	0.0		0.0	False		,,,				2504	0.0						uc010seh.1		NA																	0					0						c.(520-522)GCC>GCT		tubby like protein 3 isoform 1							126.0	122.0	123.0					12																	3040232		2203	4300	6503	SO:0001819	synonymous_variant	7289				G-protein coupled receptor protein signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|extracellular region|nucleus|plasma membrane	phosphatidylinositol-4,5-bisphosphate binding	g.chr12:3040232C>T	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.522C>T	12.37:g.3040232C>T			Somatic				TULP3_uc010sef.1_RNA|TULP3_uc009zec.1_5'UTR|TULP3_uc010seg.1_RNA|TULP3_uc001qlj.2_Silent_p.A174A|TULP3_uc010sei.1_Silent_p.A31A	p.A174A	NM_003324	NP_003315	WXS	Illumina HiSeq	Unspecified	O75386	TULP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000818)		6	603	+			174	TSGSATAAQPADNL -> IPVLLLPPNQLITF (in Ref. 1).				B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Silent	SNP	ENST00000448120.2	37	c.522C>T	CCDS8519.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	17.04	3.288310	0.59976	.	.	ENSG00000078246	ENST00000535226	.	.	.	5.67	-6.35	0.01975	.	.	.	.	.	T	0.24699	0.0599	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.35500	-0.9786	5	0.87932	D	0	-9.0272	0.7756	0.01031	0.1795:0.2784:0.1789:0.3633	.	.	.	.	C	167	.	ENSP00000443709:R167C	R	+	1	0	TULP3	2910493	0.001000	0.12720	0.000000	0.03702	0.123000	0.20343	-0.215000	0.09279	-1.776000	0.01285	-0.256000	0.11100	CGC		0.488	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324		34	122	0	0	0	0.005524	0	34	122				
CD163	9332	broad.mit.edu	37	12	7639341	7639341	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:7639341C>T	ENST00000359156.4	-	10	2414	c.2212G>A	c.(2212-2214)Ggc>Agc	p.G738S	CD163_ENST00000396620.3_Missense_Mutation_p.G771S|CD163_ENST00000539632.1_5'Flank|CD163_ENST00000541972.1_Missense_Mutation_p.G726S|CD163_ENST00000432237.2_Missense_Mutation_p.G738S	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	738	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	CCCCAGGAGCCCTCATGATAG	0.517																																							uc001qsz.3		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.(2212-2214)GGC>AGC		CD163 antigen isoform a							105.0	101.0	103.0					12																	7639341		2203	4300	6503	SO:0001583	missense	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7639341C>T	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2212G>A	12.37:g.7639341C>T	ENSP00000352071:p.Gly738Ser		Somatic				CD163_uc001qta.3_Missense_Mutation_p.G738S|CD163_uc009zfw.2_Missense_Mutation_p.G771S	p.G738S	NM_004244	NP_004235	WXS	Illumina HiSeq	Unspecified	Q86VB7	C163A_HUMAN			10	2340	-			738			SRCR 7.|Extracellular (Potential).		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	c.2212G>A	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	C	33	5.215430	0.95104	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.35421	1.31;1.31;1.31;1.31	5.54	5.54	0.83059	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.000000	0.64402	D	0.000001	T	0.65450	0.2692	M	0.89840	3.065	0.51767	D	0.99993	D;D;D	0.63046	0.981;0.992;0.989	P;P;P	0.62089	0.898;0.74;0.861	T	0.70655	-0.4812	10	0.52906	T	0.07	.	17.3432	0.87303	0.0:1.0:0.0:0.0	.	771;738;738	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	S	738;726;771;738	ENSP00000352071:G738S;ENSP00000444071:G726S;ENSP00000379863:G771S;ENSP00000403885:G738S	ENSP00000352071:G738S	G	-	1	0	CD163	7530608	0.110000	0.22057	0.968000	0.41197	0.805000	0.45488	3.328000	0.52052	2.776000	0.95493	0.650000	0.86243	GGC		0.517	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		46	123	0	0	0	0.00361	0	46	123				
CD163	9332	broad.mit.edu	37	12	7640527	7640527	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:7640527G>C	ENST00000359156.4	-	7	1779	c.1577C>G	c.(1576-1578)tCt>tGt	p.S526C	CD163_ENST00000396620.3_Missense_Mutation_p.S526C|CD163_ENST00000539632.1_5'Flank|CD163_ENST00000541972.1_Missense_Mutation_p.S514C|CD163_ENST00000432237.2_Missense_Mutation_p.S526C	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	526	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	CCCCAGGATAGAGACAACTGT	0.527																																							uc001qsz.3		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.(1576-1578)TCT>TGT		CD163 antigen isoform a							92.0	79.0	84.0					12																	7640527		2203	4300	6503	SO:0001583	missense	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7640527G>C	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1577C>G	12.37:g.7640527G>C	ENSP00000352071:p.Ser526Cys		Somatic				CD163_uc001qta.3_Missense_Mutation_p.S526C|CD163_uc009zfw.2_Missense_Mutation_p.S526C	p.S526C	NM_004244	NP_004235	WXS	Illumina HiSeq	Unspecified	Q86VB7	C163A_HUMAN			7	1705	-			526			SRCR 5.|Extracellular (Potential).		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	c.1577C>G	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.937032	0.52972	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.33	5.33	0.75918	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.258408	0.34531	N	0.003886	T	0.66137	0.2759	M	0.92691	3.335	0.30074	N	0.809793	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.971;0.999	T	0.71361	-0.4616	10	0.87932	D	0	.	10.3522	0.43943	0.0899:0.0:0.9101:0.0	.	526;526;526	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	C	526;514;526;526	ENSP00000352071:S526C;ENSP00000444071:S514C;ENSP00000379863:S526C;ENSP00000403885:S526C	ENSP00000352071:S526C	S	-	2	0	CD163	7531794	0.003000	0.15002	0.995000	0.50966	0.732000	0.41865	1.344000	0.33941	2.663000	0.90544	0.655000	0.94253	TCT		0.527	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		5	88	0	0	0	0.000602	0	5	88				
CLEC4C	170482	broad.mit.edu	37	12	7882323	7882323	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:7882323C>A	ENST00000542353.1	-	7	1001	c.511G>T	c.(511-513)Ggt>Tgt	p.G171C	CLEC4C_ENST00000540085.1_Missense_Mutation_p.G140C|CLEC4C_ENST00000360345.3_Missense_Mutation_p.G171C|CLEC4C_ENST00000354629.5_Missense_Mutation_p.G140C	NM_130441.2	NP_569708.1	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C	171	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				Kidney(36;0.0915)		TTGGGTTCACCTGAGTGCCAG	0.448																																							uc001qtg.1		NA																	0				ovary(2)|skin(1)	3						c.(511-513)GGT>TGT		C-type lectin domain family 4, member C isoform							138.0	129.0	132.0					12																	7882323		2203	4300	6503	SO:0001583	missense	170482				innate immune response	integral to membrane	sugar binding	g.chr12:7882323C>A	AF325460	CCDS8583.1, CCDS8584.1	12p13.2-p12.3	2008-02-05	2004-02-13	2005-02-11	ENSG00000198178	ENSG00000198178		"""C-type lectin domain containing"", ""CD molecules"""	13258	protein-coding gene	gene with protein product		606677	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 7"""	CLECSF11, CLECSF7		11031109, 11536172	Standard	NM_130441		Approved	HECL, DLEC, BDCA2, CD303	uc001qth.1	Q8WTT0	OTTHUMG00000168441	ENST00000542353.1:c.511G>T	12.37:g.7882323C>A	ENSP00000440428:p.Gly171Cys		Somatic				CLEC4C_uc001qth.1_Missense_Mutation_p.G171C|CLEC4C_uc001qti.1_Missense_Mutation_p.G140C	p.G171C	NM_130441	NP_569708	WXS	Illumina HiSeq	Unspecified	Q8WTT0	CLC4C_HUMAN		Kidney(36;0.0915)	6	685	-			171			Extracellular (Potential).|C-type lectin.		D3DUU3|Q3T1C3|Q6UXS8|Q8WXX8	Missense_Mutation	SNP	ENST00000542353.1	37	c.511G>T	CCDS8583.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054095	0.36277	.	.	ENSG00000198178	ENST00000542353;ENST00000354629;ENST00000540085;ENST00000360345;ENST00000543765	T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74	1.73	1.73	0.24493	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.55924	0.1951	M	0.93420	3.415	0.21822	N	0.999529	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	T	0.38714	-0.9648	9	0.87932	D	0	.	6.9111	0.24335	0.0:1.0:0.0:0.0	.	140;171	Q8WTT0-2;Q8WTT0	.;CLC4C_HUMAN	C	171;140;140;171;131	ENSP00000440428:G171C;ENSP00000346648:G140C;ENSP00000445338:G140C;ENSP00000353500:G171C;ENSP00000442457:G131C	ENSP00000346648:G140C	G	-	1	0	CLEC4C	7773590	0.125000	0.22332	0.431000	0.26735	0.043000	0.13939	0.582000	0.23834	1.280000	0.44463	0.561000	0.74099	GGT		0.448	CLEC4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399750.1	NM_203503		36	148	1	0	3.09479e-21	0.006999	4.67775e-21	36	148				
SLCO1B3	28234	broad.mit.edu	37	12	21069086	21069086	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:21069086G>T	ENST00000381545.3	+	16	2233	c.2014G>T	c.(2014-2016)Gaa>Taa	p.E672*	LST3_ENST00000540229.1_Intron|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron|SLCO1B3_ENST00000261196.2_Nonsense_Mutation_p.E672*|SLCO1B3_ENST00000553473.1_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	672					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	AGCAAACTTAGAATTCTTAAA	0.318																																							uc001rek.2		NA																	0				large_intestine(2)|ovary(1)|skin(1)	4						c.(2014-2016)GAA>TAA		solute carrier organic anion transporter family,							93.0	91.0	92.0					12																	21069086		2203	4300	6503	SO:0001587	stop_gained	28234				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity	g.chr12:21069086G>T		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.2014G>T	12.37:g.21069086G>T	ENSP00000370956:p.Glu672*		Somatic				SLCO1B3_uc001rel.2_Nonsense_Mutation_p.E672*|SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Intron	p.E672*	NM_019844	NP_062818	WXS	Illumina HiSeq	Unspecified	Q9NPD5	SO1B3_HUMAN			15	2140	+	Esophageal squamous(101;0.149)		672			Cytoplasmic (Potential).		E7EMT8|Q5JAR4	Nonsense_Mutation	SNP	ENST00000381545.3	37	c.2014G>T	CCDS8684.1	.	.	.	.	.	.	.	.	.	.	.	20.8	4.049692	0.75846	.	.	ENSG00000111700	ENST00000261196;ENST00000381545	.	.	.	3.48	2.56	0.30785	.	1.615580	0.02958	N	0.142748	.	.	.	.	.	.	0.20703	N	0.999865	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	8.2177	0.31521	0.0:0.0:0.7608:0.2392	.	.	.	.	X	672	.	ENSP00000261196:E672X	E	+	1	0	SLCO1B3	20960353	0.750000	0.28316	0.036000	0.18154	0.018000	0.09664	1.753000	0.38359	0.547000	0.28938	-0.554000	0.04202	GAA		0.318	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844		31	34	1	0	5.77227e-19	0.008361	8.5048e-19	31	34				
ABCC9	10060	broad.mit.edu	37	12	21970206	21970206	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:21970206C>A	ENST00000261201.4	-	31	3806	c.3807G>T	c.(3805-3807)ttG>ttT	p.L1269F	ABCC9_ENST00000345162.2_Missense_Mutation_p.L1233F|ABCC9_ENST00000261200.4_Missense_Mutation_p.L1269F	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1269	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CCAGGTCAGCCAAGTTCCTCA	0.383																																							uc001rfi.1		NA																	0				ovary(4)|skin(2)	6						c.(3805-3807)TTG>TTT		ATP-binding cassette, sub-family C, member 9	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						125.0	126.0	125.0					12																	21970206		2203	4300	6503	SO:0001583	missense	10060				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity	g.chr12:21970206C>A	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.3807G>T	12.37:g.21970206C>A	ENSP00000261201:p.Leu1269Phe		Somatic				ABCC9_uc001rfh.2_Missense_Mutation_p.L1269F|ABCC9_uc001rfj.1_Missense_Mutation_p.L1233F	p.L1269F	NM_005691	NP_005682	WXS	Illumina HiSeq	Unspecified	O60706	ABCC9_HUMAN			31	3827	-			1269			Cytoplasmic (Potential).|ABC transmembrane type-1 2.		O60707	Missense_Mutation	SNP	ENST00000261201.4	37	c.3807G>T	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281681	0.59758	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.94497	-3.44;-3.44;-3.44;-3.44	4.52	1.7	0.24286	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.64402	D	0.000001	D	0.84061	0.5389	N	0.16307	0.4	0.48341	D	0.999631	B;P	0.39480	0.409;0.675	B;B	0.30716	0.119;0.087	T	0.78583	-0.2148	10	0.35671	T	0.21	-13.3607	6.2675	0.20936	0.0:0.6314:0.1359:0.2327	.	1269;1269	O60706;O60706-2	ABCC9_HUMAN;.	F	1269;896;1269;1233	ENSP00000261200:L1269F;ENSP00000440521:L896F;ENSP00000261201:L1269F;ENSP00000261202:L1233F	ENSP00000261200:L1269F	L	-	3	2	ABCC9	21861473	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.966000	0.40481	0.659000	0.30945	0.650000	0.86243	TTG		0.383	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691		19	152	1	0	1.37522e-17	0.007413	1.99275e-17	19	152				
CMAS	55907	broad.mit.edu	37	12	22208541	22208542	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:22208541_22208542GG>TT	ENST00000229329.2	+	3	686_687	c.556_557GG>TT	c.(556-558)GGa>TTa	p.G186L		NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase	186					lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						AATTCAGAAAGGAGGTAATCTC	0.342																																							uc001rfm.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(556-558)GGA>TTA		cytidine monophospho-N-acetylneuraminic acid																																				SO:0001583	missense	55907				lipopolysaccharide biosynthetic process	nucleus	N-acylneuraminate cytidylyltransferase activity	g.chr12:22208541_22208542GG>TT	AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	Exception_encountered	12.37:g.22208541_22208542delinsTT	ENSP00000229329:p.Gly186Leu		Somatic				CMAS_uc001rfn.2_RNA	p.G186L	NM_018686	NP_061156	WXS	Illumina HiSeq	Unspecified	Q8NFW8	NEUA_HUMAN			3	635_636	+			186					Q96AX5|Q9NQZ0	Missense_Mutation	DNP	ENST00000229329.2	37	c.556_557GG>TT	CCDS8696.1																																																																																				0.342	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402235.1	NM_018686		32	56	0	0	0	0.004672	0	32	56				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	T	rs121913530		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:25398285C>T	ENST00000256078.4	-	2	97	c.34G>A	c.(34-36)Ggt>Agt	p.G12S	KRAS_ENST00000311936.3_Missense_Mutation_p.G12S|KRAS_ENST00000557334.1_Missense_Mutation_p.G12S|KRAS_ENST00000556131.1_Missense_Mutation_p.G12S	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>AGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>A	12.37:g.25398285C>T	ENSP00000256078:p.Gly12Ser	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12S|KRAS_uc001rgr.2_RNA	p.G12S	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>A	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	35	5.441396	0.96187	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.78559	0.4302	L	0.28344	0.845	0.80722	D	1	P;P	0.39665	0.557;0.682	P;P	0.50570	0.525;0.644	T	0.80254	-0.1459	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	S	12	ENSP00000308495:G12S;ENSP00000452512:G12S;ENSP00000256078:G12S;ENSP00000451856:G12S	ENSP00000256078:G12S	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		17	18	0	0	0	0.00499	0	17	18				
ARNTL2	56938	broad.mit.edu	37	12	27571064	27571064	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:27571064G>T	ENST00000266503.5	+	16	1727	c.1709G>T	c.(1708-1710)gGg>gTg	p.G570V	ARNTL2_ENST00000546179.1_Intron|RP11-165P7.1_ENST00000500498.2_RNA|ARNTL2_ENST00000542388.1_Missense_Mutation_p.G485V|ARNTL2_ENST00000311001.5_Missense_Mutation_p.G556V|ARNTL2_ENST00000544915.1_Missense_Mutation_p.G536V|ARNTL2_ENST00000395901.2_Missense_Mutation_p.G533V|ARNTL2_ENST00000261178.5_Missense_Mutation_p.G522V			Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear translocator-like 2	570					circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	21	Colorectal(261;0.0847)|Lung SC(9;0.184)					TCTGAAATGGGGGAGCTAGAG	0.458																																							uc001rht.1		NA																	0				ovary(1)|skin(1)	2						c.(1708-1710)GGG>GTG		aryl hydrocarbon receptor nuclear							100.0	99.0	99.0					12																	27571064		2203	4300	6503	SO:0001583	missense	56938				circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr12:27571064G>T	AF246961	CCDS8712.1, CCDS58219.1, CCDS58220.1, CCDS58221.1, CCDS58222.1	12p12.2-p11.2	2013-05-21			ENSG00000029153	ENSG00000029153		"""Basic helix-loop-helix proteins"""	18984	protein-coding gene	gene with protein product		614517				10864977, 10964693	Standard	NM_020183		Approved	BMAL2, MOP9, CLIF, PASD9, bHLHe6	uc001rht.2	Q8WYA1	OTTHUMG00000169257	ENST00000266503.5:c.1709G>T	12.37:g.27571064G>T	ENSP00000266503:p.Gly570Val		Somatic				ARNTL2_uc001rhw.2_Missense_Mutation_p.G533V|ARNTL2_uc010sjp.1_Intron|ARNTL2_uc001rhu.1_Missense_Mutation_p.G556V|ARNTL2_uc009zji.1_Missense_Mutation_p.G536V|ARNTL2_uc001rhv.1_Missense_Mutation_p.G522V|uc001rhx.2_Intron	p.G570V	NM_020183	NP_064568	WXS	Illumina HiSeq	Unspecified	Q8WYA1	BMAL2_HUMAN			16	1727	+	Colorectal(261;0.0847)|Lung SC(9;0.184)		570					B7Z429|F5H402|Q8WYA2|Q8WYA3|Q8WYA4|Q96J63|Q9H2M4|Q9NS70|Q9NYQ4|Q9NYQ5	Missense_Mutation	SNP	ENST00000266503.5	37	c.1709G>T	CCDS8712.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.22|12.22	1.871675|1.871675	0.33069|0.33069	.|.	.|.	ENSG00000029153|ENSG00000029153	ENST00000544915;ENST00000395901;ENST00000311001;ENST00000261178;ENST00000266503;ENST00000542388|ENST00000457040	T;T;T;T;T;T|T	0.06449|0.06608	3.35;3.33;3.31;3.34;3.3;3.35|3.28	3.27|3.27	2.35|2.35	0.29111|0.29111	.|.	1.763500|1.763500	0.02814|0.02814	N|N	0.124678|0.124678	T|T	0.12944|0.12944	0.0314|0.0314	M|M	0.64997|0.64997	1.995|1.995	0.09310|0.09310	N|N	0.999997|0.999997	B;P;P;B;P|.	0.42827|.	0.022;0.694;0.694;0.08;0.791|.	B;B;B;B;B|.	0.41860|.	0.022;0.328;0.328;0.067;0.368|.	T|T	0.27226|0.27226	-1.0080|-1.0080	10|8	0.45353|0.72032	T|D	0.12|0.01	.|.	4.3335|4.3335	0.11075|0.11075	0.3706:0.0:0.6294:0.0|0.3706:0.0:0.6294:0.0	.|.	536;533;522;556;570|.	Q8WYA1-5;Q8WYA1-3;Q8WYA1-4;Q8WYA1-2;Q8WYA1|.	.;.;.;.;BMAL2_HUMAN|.	V|W	536;533;556;522;570;485|522	ENSP00000442438:G536V;ENSP00000379238:G533V;ENSP00000312247:G556V;ENSP00000261178:G522V;ENSP00000266503:G570V;ENSP00000445836:G485V|ENSP00000400185:G522W	ENSP00000261178:G522V|ENSP00000400185:G522W	G|G	+|+	2|1	0|0	ARNTL2|ARNTL2	27462331|27462331	0.026000|0.026000	0.19158|0.19158	0.002000|0.002000	0.10522|0.10522	0.695000|0.695000	0.40330|0.40330	1.113000|1.113000	0.31184|0.31184	0.920000|0.920000	0.36970|0.36970	0.585000|0.585000	0.79938|0.79938	GGG|GGG		0.458	ARNTL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403162.1	NM_020183		13	96	1	0	3.41278e-10	0.00499	4.4544e-10	13	96				
KIAA1551	55196	broad.mit.edu	37	12	32140239	32140239	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:32140239A>C	ENST00000312561.4	+	5	5483	c.5069A>C	c.(5068-5070)aAa>aCa	p.K1690T	KIAA1551_ENST00000535596.1_3'UTR	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1690																	AGGACACAGAAAGACAGCCAA	0.299																																							uc001rks.2		NA																	0				ovary(1)|skin(1)	2						c.(5068-5070)AAA>ACA		hypothetical protein LOC55196							71.0	72.0	72.0					12																	32140239		2203	4298	6501	SO:0001583	missense	55196							g.chr12:32140239A>C	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.5069A>C	12.37:g.32140239A>C	ENSP00000310338:p.Lys1690Thr		Somatic				C12orf35_uc001rkt.2_RNA	p.K1690T	NM_018169	NP_060639	WXS	Illumina HiSeq	Unspecified	Q9HCM1	CL035_HUMAN	OV - Ovarian serous cystadenocarcinoma(6;0.0114)		5	5483	+	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		1690					B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	c.5069A>C	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	A	6.859	0.527714	0.13127	.	.	ENSG00000174718	ENST00000312561	T	0.14022	2.54	4.86	4.86	0.63082	.	0.409461	0.23268	N	0.050057	T	0.10551	0.0258	N	0.22421	0.69	0.09310	N	1	B	0.31290	0.318	B	0.29716	0.106	T	0.20605	-1.0270	10	0.62326	D	0.03	.	12.4814	0.55844	1.0:0.0:0.0:0.0	.	1690	Q9HCM1	CL035_HUMAN	T	1690	ENSP00000310338:K1690T	ENSP00000310338:K1690T	K	+	2	0	C12orf35	32031506	0.986000	0.35501	0.039000	0.18376	0.002000	0.02628	4.698000	0.61789	1.930000	0.55929	0.379000	0.24179	AAA		0.299	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169		9	46	0	0	0	0.001368	0	9	46				
TMEM117	84216	broad.mit.edu	37	12	44782260	44782260	+	Silent	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:44782260A>T	ENST00000266534.3	+	8	1477	c.1350A>T	c.(1348-1350)cgA>cgT	p.R450R	TMEM117_ENST00000551577.1_3'UTR|TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000536799.1_Silent_p.R346R	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117	450						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		GAATCACTCGAGAAAACACCC	0.423																																							uc001rod.2		NA																	0					0						c.(1348-1350)CGA>CGT		transmembrane protein 117							135.0	132.0	133.0					12																	44782260		2203	4300	6503	SO:0001819	synonymous_variant	84216					endoplasmic reticulum|integral to membrane		g.chr12:44782260A>T	BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.1350A>T	12.37:g.44782260A>T			Somatic				TMEM117_uc001roe.2_Silent_p.R346R|TMEM117_uc009zkc.2_3'UTR	p.R450R	NM_032256	NP_115632	WXS	Illumina HiSeq	Unspecified	Q9H0C3	TM117_HUMAN		GBM - Glioblastoma multiforme(48;0.124)	8	1416	+	Lung SC(27;0.192)		450						Silent	SNP	ENST00000266534.3	37	c.1350A>T	CCDS8745.1																																																																																				0.423	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403969.1	NM_032256		11	138	0	0	0	0.000978	0	11	138				
KRT82	3888	broad.mit.edu	37	12	52797629	52797629	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:52797629C>T	ENST00000257974.2	-	2	553	c.476G>A	c.(475-477)aGg>aAg	p.R159K	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	159	Linker 1.|Rod.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		CTGGCAGCACCTCTGCTGCTG	0.582																																							uc001sai.1		NA																	0				ovary(1)|skin(1)	2						c.(475-477)AGG>AAG		keratin 82							50.0	47.0	48.0					12																	52797629		2203	4300	6503	SO:0001583	missense	3888					keratin filament	protein binding|structural constituent of epidermis	g.chr12:52797629C>T	Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.476G>A	12.37:g.52797629C>T	ENSP00000257974:p.Arg159Lys		Somatic					p.R159K	NM_033033	NP_149022	WXS	Illumina HiSeq	Unspecified	Q9NSB4	KRT82_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.193)	2	591	-			159			Linker 1.|Rod.			Missense_Mutation	SNP	ENST00000257974.2	37	c.476G>A	CCDS8826.1	.	.	.	.	.	.	.	.	.	.	C	6.058	0.378944	0.11466	.	.	ENSG00000161850	ENST00000257974	T	0.75704	-0.96	5.14	1.79	0.24919	Filament (1);	0.240095	0.27609	N	0.018615	T	0.32194	0.0821	N	0.00642	-1.3	0.24669	N	0.993427	B	0.06786	0.001	B	0.09377	0.004	T	0.42464	-0.9450	10	0.02654	T	1	.	4.9672	0.14096	0.1803:0.5279:0.0:0.2918	.	159	Q9NSB4	KRT82_HUMAN	K	159	ENSP00000257974:R159K	ENSP00000257974:R159K	R	-	2	0	KRT82	51083896	0.000000	0.05858	0.990000	0.47175	0.979000	0.70002	0.670000	0.25157	0.682000	0.31407	0.462000	0.41574	AGG		0.582	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405189.1	NM_033033		17	61	0	0	0	0.00499	0	17	61				
KRT6A	3853	broad.mit.edu	37	12	52881579	52881579	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:52881579G>T	ENST00000330722.6	-	9	1688	c.1620C>A	c.(1618-1620)agC>agA	p.S540R		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	540	Tail.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCCAACAGAGCTGAGGCCAC	0.587																																							uc001sam.2		NA																	0		p.S540I(1)		ovary(4)|skin(1)	5						c.(1618-1620)AGC>AGA		keratin 6A							76.0	84.0	82.0					12																	52881579		2203	4296	6499	SO:0001583	missense	3853				cell differentiation|ectoderm development|positive regulation of cell proliferation	keratin filament	protein binding|structural constituent of cytoskeleton	g.chr12:52881579G>T	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1620C>A	12.37:g.52881579G>T	ENSP00000369317:p.Ser540Arg		Somatic					p.S540R	NM_005554	NP_005545	WXS	Illumina HiSeq	Unspecified	P02538	K2C6A_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	9	1829	-			540			Tail.		A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	c.1620C>A	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	g	7.855	0.724874	0.15439	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.88354	-2.37	4.53	2.69	0.31865	.	0.000000	0.56097	D	0.000023	D	0.83008	0.5161	L	0.55213	1.73	0.33020	D	0.52876	P	0.36733	0.567	B	0.37422	0.249	T	0.78942	-0.2005	10	0.11794	T	0.64	.	8.387	0.32505	0.3157:0.0:0.6843:0.0	.	540	P02538	K2C6A_HUMAN	R	540;496	ENSP00000369317:S540R	ENSP00000369317:S540R	S	-	3	2	KRT6A	51167846	0.013000	0.17824	0.997000	0.53966	0.967000	0.64934	0.817000	0.27281	0.612000	0.30071	0.650000	0.86243	AGC		0.587	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554		43	53	1	0	3.54561e-26	0.009718	5.51772e-26	43	53				
DNAJC14	85406	broad.mit.edu	37	12	56222188	56222188	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:56222188T>A	ENST00000357606.3	-	3	544	c.255A>T	c.(253-255)agA>agT	p.R85S	TMEM198B_ENST00000478241.1_RNA|DNAJC14_ENST00000317269.3_Missense_Mutation_p.R85S|RP11-762I7.5_ENST00000546837.1_5'Flank|DNAJC14_ENST00000317287.5_Missense_Mutation_p.R85S			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	85					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						CCTCTGCATCTCTAGGTGGTC	0.557																																							uc001shx.1		NA																	0				ovary(3)|large_intestine(1)	4						c.(253-255)AGA>AGT		dopamine receptor interacting protein							173.0	178.0	176.0					12																	56222188		2203	4300	6503	SO:0001583	missense	85406				protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding	g.chr12:56222188T>A	AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.255A>T	12.37:g.56222188T>A	ENSP00000350223:p.Arg85Ser		Somatic				DNAJC14_uc001shu.1_Missense_Mutation_p.R85S|DNAJC14_uc009zob.1_Missense_Mutation_p.R85S|DNAJC14_uc001shy.1_Missense_Mutation_p.R85S	p.R85S	NM_032364	NP_115740	WXS	Illumina HiSeq	Unspecified	Q6Y2X3	DJC14_HUMAN			2	459	-			85					A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	ENST00000357606.3	37	c.255A>T	CCDS8894.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.259617	0.23051	.	.	ENSG00000135392	ENST00000357606;ENST00000317269;ENST00000317287;ENST00000547445	T;T;T	0.35421	1.31;1.31;1.31	5.65	0.856	0.19019	.	0.660702	0.14553	N	0.312558	T	0.21307	0.0513	N	0.19112	0.55	0.09310	N	1	B;B	0.20052	0.041;0.005	B;B	0.16289	0.015;0.01	T	0.16600	-1.0397	10	0.54805	T	0.06	-0.5792	7.4829	0.27415	0.0:0.5046:0.0:0.4954	.	85;85	Q6Y2X3;A8K5A7	DJC14_HUMAN;.	S	85	ENSP00000350223:R85S;ENSP00000316240:R85S;ENSP00000317500:R85S	ENSP00000316240:R85S	R	-	3	2	DNAJC14	54508455	0.011000	0.17503	0.009000	0.14445	0.684000	0.39900	0.523000	0.22925	-0.053000	0.13289	-0.248000	0.11899	AGA		0.557	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364		33	245	0	0	0	0.002445	0	33	245				
R3HDM2	22864	broad.mit.edu	37	12	57662237	57662237	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:57662237G>A	ENST00000347140.3	-	18	2227	c.1837C>T	c.(1837-1839)Cca>Tca	p.P613S	R3HDM2_ENST00000358907.2_Missense_Mutation_p.P613S|R3HDM2_ENST00000402412.1_Missense_Mutation_p.P627S|R3HDM2_ENST00000413953.2_Missense_Mutation_p.P340S|R3HDM2_ENST00000441731.2_Missense_Mutation_p.P308S|R3HDM2_ENST00000546843.1_5'UTR|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000403821.2_Missense_Mutation_p.P647S			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	613	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CTACCCACTGGAACCTGGGTG	0.532																																							uc009zpm.1		NA																	0				ovary(2)	2						c.(1837-1839)CCA>TCA		R3H domain containing 2							71.0	63.0	66.0					12																	57662237		2203	4300	6503	SO:0001583	missense	22864					nucleus	nucleic acid binding	g.chr12:57662237G>A	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.1837C>T	12.37:g.57662237G>A	ENSP00000317903:p.Pro613Ser		Somatic				R3HDM2_uc010srn.1_RNA|R3HDM2_uc001snu.2_Missense_Mutation_p.P308S|R3HDM2_uc001snr.2_Missense_Mutation_p.P340S|R3HDM2_uc001sns.2_Missense_Mutation_p.P613S|R3HDM2_uc001snt.2_Missense_Mutation_p.P627S|R3HDM2_uc009zpn.1_Intron	p.P613S	NM_014925	NP_055740	WXS	Illumina HiSeq	Unspecified	Q9Y2K5	R3HD2_HUMAN			16	1872	-			613			Gln-rich.		Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	37	c.1837C>T	CCDS8937.2	.	.	.	.	.	.	.	.	.	.	G	13.93	2.383717	0.42308	.	.	ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821;ENST00000548161	T;T;T;T;T;T;T;T	0.41400	1.02;1.0;1.97;1.99;1.97;1.01;1.6;1.98	4.98	4.09	0.47781	.	0.000000	0.85682	D	0.000000	T	0.44222	0.1283	N	0.13235	0.315	0.48762	D	0.999704	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.996;0.996;0.998	T	0.28332	-1.0047	10	0.17369	T	0.5	-2.7041	14.2042	0.65724	0.0:0.0:0.8493:0.1507	.	647;627;613;340	B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;R3HD2_HUMAN;.	S	340;340;613;627;613;308;378;647;2	ENSP00000409146:P340S;ENSP00000377400:P340S;ENSP00000317903:P613S;ENSP00000385839:P627S;ENSP00000351784:P613S;ENSP00000408536:P308S;ENSP00000394676:P378S;ENSP00000385169:P647S	ENSP00000317903:P613S	P	-	1	0	R3HDM2	55948504	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.401000	0.52601	1.464000	0.47987	0.650000	0.86243	CCA		0.532	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925		21	55	0	0	0	0.001882	0	21	55				
B4GALNT1	2583	broad.mit.edu	37	12	58025111	58025111	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:58025111A>C	ENST00000341156.4	-	3	839	c.255T>G	c.(253-255)agT>agG	p.S85R	B4GALNT1_ENST00000449184.3_Missense_Mutation_p.S85R|B4GALNT1_ENST00000550943.1_Intron|B4GALNT1_ENST00000552350.1_Missense_Mutation_p.S85R|B4GALNT1_ENST00000550764.1_Missense_Mutation_p.S85R|B4GALNT1_ENST00000418555.2_Intron	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	85					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GGCCCCCCCCACTGGACTCAC	0.582																																							uc001spg.1		NA																	0					0						c.(253-255)AGT>AGG		beta-1,4-N-acetyl-galactosaminyl transferase 1							66.0	77.0	73.0					12																	58025111		2203	4300	6503	SO:0001583	missense	2583				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity	g.chr12:58025111A>C	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.255T>G	12.37:g.58025111A>C	ENSP00000341562:p.Ser85Arg		Somatic				B4GALNT1_uc010sru.1_Intron|B4GALNT1_uc010srv.1_Missense_Mutation_p.S85R|B4GALNT1_uc001sph.2_Missense_Mutation_p.S85R|B4GALNT1_uc001spi.2_Missense_Mutation_p.S85R|B4GALNT1_uc010srw.1_Missense_Mutation_p.S162R	p.S85R	NM_001478	NP_001469	WXS	Illumina HiSeq	Unspecified	Q00973	B4GN1_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.109)		3	687	-	Melanoma(17;0.122)		85			Lumenal (Potential).		B4DE26|Q8N636	Missense_Mutation	SNP	ENST00000341156.4	37	c.255T>G	CCDS8950.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.460172	0.26248	.	.	ENSG00000135454	ENST00000341156;ENST00000550764;ENST00000552350;ENST00000548888;ENST00000551220	T;T;T;T;T	0.47528	2.24;1.44;1.44;1.5;0.84	4.8	-3.54	0.04653	.	0.673120	0.15850	N	0.241557	T	0.31513	0.0799	N	0.22421	0.69	0.09310	N	1	P;B;B;B	0.50066	0.931;0.16;0.089;0.002	P;B;B;B	0.49192	0.602;0.128;0.023;0.001	T	0.37526	-0.9702	10	0.19590	T	0.45	0.0132	6.7302	0.23379	0.3363:0.1649:0.4988:0.0	.	162;85;85;85	B7Z7U3;B4DSP5;Q8N636;Q00973	.;.;.;B4GN1_HUMAN	R	85	ENSP00000341562:S85R;ENSP00000450303:S85R;ENSP00000448500:S85R;ENSP00000447945:S85R;ENSP00000446566:S85R	ENSP00000341562:S85R	S	-	3	2	B4GALNT1	56311378	0.000000	0.05858	0.207000	0.23584	0.877000	0.50540	-1.037000	0.03557	-0.539000	0.06273	-0.363000	0.07495	AGT		0.582	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407853.1	NM_001478		19	113	0	0	0	0.003954	0	19	113				
TBC1D15	64786	broad.mit.edu	37	12	72233547	72233547	+	5'UTR	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:72233547G>T	ENST00000550746.1	+	0	50				TBC1D15_ENST00000485960.2_5'UTR|TBC1D15_ENST00000393309.3_5'Flank|TBC1D15_ENST00000319106.8_5'UTR	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15						positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCATTACCAGGCACGCGCAGG	0.582																																							uc001swu.2		NA																	0					0						c.(52-54)GCA>TCA		TBC1 domain family, member 15 isoform 1							71.0	60.0	64.0					12																	72233547		2203	4300	6503	SO:0001623	5_prime_UTR_variant	64786						protein binding|Rab GTPase activator activity	g.chr12:72233547G>T	AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.-15G>T	12.37:g.72233547G>T			Somatic				TBC1D15_uc009zrv.2_5'UTR|TBC1D15_uc010stt.1_5'UTR|TBC1D15_uc001swv.2_Missense_Mutation_p.A18S|TBC1D15_uc001sww.2_5'UTR	p.A18S	NM_022771	NP_073608	WXS	Illumina HiSeq	Unspecified	Q8TC07	TBC15_HUMAN			1	61	+			Error:Variant_position_missing_in_Q8TC07_after_alignment					B4DMT9|B9A6L6|J3KNI9|Q9HA83	Missense_Mutation	SNP	ENST00000550746.1	37	c.52G>T	CCDS31858.1																																																																																				0.582	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351266.2	NM_022771		10	38	1	0	6.40141e-05	0.000978	7.16413e-05	10	38				
NAV3	89795	broad.mit.edu	37	12	78225320	78225320	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:78225320C>A	ENST00000397909.2	+	1	252	c.79C>A	c.(79-81)Cca>Aca	p.P27T	NAV3_ENST00000536525.2_Missense_Mutation_p.P27T|NAV3_ENST00000228327.6_Missense_Mutation_p.P27T|NAV3_ENST00000266692.7_Missense_Mutation_p.P27T			Q8IVL0	NAV3_HUMAN	neuron navigator 3	27						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCTTCCGATACCAAATCTTGG	0.458										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(79-81)CCA>ACA		neuron navigator 3							144.0	139.0	141.0					12																	78225320		1916	4132	6048	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78225320C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.79C>A	12.37:g.78225320C>A	ENSP00000381007:p.Pro27Thr	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.P27T	p.P27T	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			1	252	+			27					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.79C>A		.	.	.	.	.	.	.	.	.	.	C	21.0	4.075201	0.76415	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.60171	0.21;1.75;1.74;1.75;1.63	5.54	5.54	0.83059	Calponin homology domain (1);	.	.	.	.	T	0.66346	0.2780	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.67914	-0.5547	9	0.49607	T	0.09	-11.2884	19.4875	0.95035	0.0:1.0:0.0:0.0	.	27;27	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	T	27	ENSP00000446628:P27T;ENSP00000446132:P27T;ENSP00000381007:P27T;ENSP00000228327:P27T;ENSP00000266692:P27T	ENSP00000228327:P27T	P	+	1	0	NAV3	76749451	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.700000	0.61803	2.615000	0.88500	0.655000	0.94253	CCA		0.458	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		75	143	1	0	2.10328e-26	0.00361	3.28287e-26	75	143				
NAV3	89795	broad.mit.edu	37	12	78443862	78443862	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:78443862G>A	ENST00000397909.2	+	10	2286	c.2113G>A	c.(2113-2115)Ggg>Agg	p.G705R	RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000536525.2_Missense_Mutation_p.G705R|NAV3_ENST00000228327.6_Missense_Mutation_p.G705R|NAV3_ENST00000266692.7_Missense_Mutation_p.G705R			Q8IVL0	NAV3_HUMAN	neuron navigator 3	705						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CAGTCTTCGTGGGACTCAGAT	0.333										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2113-2115)GGG>AGG		neuron navigator 3							75.0	73.0	74.0					12																	78443862		1814	4076	5890	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78443862G>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2113G>A	12.37:g.78443862G>A	ENSP00000381007:p.Gly705Arg	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.G705R|NAV3_uc010sub.1_Missense_Mutation_p.G205R	p.G705R	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			10	2286	+			705			Potential.		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2113G>A		.	.	.	.	.	.	.	.	.	.	G	31	5.073471	0.94000	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.13901	2.55;2.55;2.55;2.55	5.58	5.58	0.84498	.	0.000000	0.40908	U	0.000992	T	0.40719	0.1128	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.07673	-1.0760	9	.	.	.	-11.637	19.5809	0.95467	0.0:0.0:1.0:0.0	.	705;705;705	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	R	705	ENSP00000446132:G705R;ENSP00000381007:G705R;ENSP00000228327:G705R;ENSP00000266692:G705R	.	G	+	1	0	NAV3	76967993	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.632000	0.89209	0.650000	0.86243	GGG		0.333	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		6	41	0	0	0	0.001984	0	6	41				
RASSF9	9182	broad.mit.edu	37	12	86199740	86199740	+	Splice_Site	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:86199740T>C	ENST00000361228.3	-	2	416	c.48A>G	c.(46-48)agA>agG	p.R16R		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	16					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TAGTTGGAGATCTGAAAGAAA	0.378																																							uc001taf.1		NA																	0				ovary(1)	1						c.(46-48)AGA>AGG		Ras association (RalGDS/AF-6) domain family							75.0	72.0	73.0					12																	86199740		1853	4107	5960	SO:0001630	splice_region_variant	9182				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity	g.chr12:86199740T>C		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.48-1A>G	12.37:g.86199740T>C			Somatic					p.R16R	NM_005447	NP_005438	WXS	Illumina HiSeq	Unspecified	O75901	RASF9_HUMAN			2	387	-			16					B3KMQ4|Q8N5U8	Silent	SNP	ENST00000361228.3	37	c.48A>G	CCDS44950.1																																																																																				0.378	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		Silent	11	45	0	0	0	0.008291	0	11	45				
APAF1	317	broad.mit.edu	37	12	99093342	99093342	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:99093342A>G	ENST00000551964.1	+	17	3197	c.2461A>G	c.(2461-2463)Atc>Gtc	p.I821V	APAF1_ENST00000549007.1_Missense_Mutation_p.I821V|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000547045.1_Missense_Mutation_p.I821V|APAF1_ENST00000359972.2_Missense_Mutation_p.I810V|APAF1_ENST00000339433.3_Missense_Mutation_p.I821V|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000357310.1_Missense_Mutation_p.I821V|APAF1_ENST00000550527.1_Missense_Mutation_p.I810V	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	821					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	AAAAAATAAAATCTTTGTAAG	0.328																																							uc001tfz.2		NA																	0				ovary(2)|lung(1)	3						c.(2461-2463)ATC>GTC		apoptotic peptidase activating factor 1 isoform	Adenosine triphosphate(DB00171)						90.0	93.0	92.0					12																	99093342		2203	4300	6503	SO:0001583	missense	317				activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding	g.chr12:99093342A>G	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.2461A>G	12.37:g.99093342A>G	ENSP00000448165:p.Ile821Val		Somatic				APAF1_uc001tfy.2_Missense_Mutation_p.I810V|APAF1_uc001tga.2_Missense_Mutation_p.I810V|APAF1_uc001tgb.2_Missense_Mutation_p.I821V|APAF1_uc001tgc.2_Intron|APAF1_uc009zto.2_Missense_Mutation_p.I230V	p.I821V	NM_181861	NP_863651	WXS	Illumina HiSeq	Unspecified	O14727	APAF_HUMAN			17	3038	+			821			WD 5.		B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	37	c.2461A>G	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	A	7.940	0.742566	0.15642	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.38077	1.58;2.2;2.29;1.16;1.58;2.29;1.16	6.07	-0.739	0.11120	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.451157	0.26079	N	0.026473	T	0.11922	0.0290	N	0.04959	-0.14	0.80722	D	1	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.08055	0.001;0.002;0.003;0.002;0.002	T	0.36986	-0.9725	10	0.02654	T	1	-21.756	7.0285	0.24954	0.3223:0.4492:0.2285:0.0	.	821;821;810;821;810	C9JLV4;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	V	821;810;821;821;810;821;821	ENSP00000448165:I821V;ENSP00000353059:I810V;ENSP00000349862:I821V;ENSP00000341830:I821V;ENSP00000448449:I810V;ENSP00000449791:I821V;ENSP00000448161:I821V	ENSP00000341830:I821V	I	+	1	0	APAF1	97617473	0.988000	0.35896	0.993000	0.49108	0.894000	0.52154	0.578000	0.23773	-0.047000	0.13423	0.533000	0.62120	ATC		0.328	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1		7	51	0	0	0	0.004482	0	7	51				
ACACB	32	broad.mit.edu	37	12	109612000	109612000	+	Missense_Mutation	SNP	C	C	T	rs376114199		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:109612000C>T	ENST00000338432.7	+	7	1300	c.1181C>T	c.(1180-1182)aCg>aTg	p.T394M	ACACB_ENST00000377854.5_Missense_Mutation_p.T394M|ACACB_ENST00000377848.3_Missense_Mutation_p.T394M			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	394	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GTCGCCCAGACGCTACAGGTC	0.602																																							uc001tob.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(1180-1182)ACG>ATG		acetyl-Coenzyme A carboxylase beta	Biotin(DB00121)	C	MET/THR	0,4406		0,0,2203	48.0	38.0	41.0		1181	5.8	1.0	12		41	1,8599	1.2+/-3.3	0,1,4299	no	missense	ACACB	NM_001093.3	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	394/2459	109612000	1,13005	2203	4300	6503	SO:0001583	missense	32				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding	g.chr12:109612000C>T	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1181C>T	12.37:g.109612000C>T	ENSP00000341044:p.Thr394Met		Somatic				ACACB_uc001toc.2_Missense_Mutation_p.T394M	p.T394M	NM_001093	NP_001084	WXS	Illumina HiSeq	Unspecified	O00763	ACACB_HUMAN			7	1300	+			394			Biotin carboxylation.		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	c.1181C>T	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.204598	0.79127	0.0	1.16E-4	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	D;D;D	0.97688	-4.49;-4.49;-4.49	5.85	5.85	0.93711	ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);	0.180406	0.64402	D	0.000017	D	0.98448	0.9483	M	0.73372	2.23	0.80722	D	1	D	0.89917	1.0	D	0.63488	0.915	D	0.99010	1.0814	10	0.62326	D	0.03	.	19.762	0.96323	0.0:1.0:0.0:0.0	.	394	O00763	ACACB_HUMAN	M	394	ENSP00000341044:T394M;ENSP00000367079:T394M;ENSP00000367085:T394M	ENSP00000341044:T394M	T	+	2	0	ACACB	108096383	0.995000	0.38212	0.966000	0.40874	0.718000	0.41266	2.940000	0.49003	2.770000	0.95276	0.650000	0.86243	ACG		0.602	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093		4	19	0	0	0	0.000602	0	4	19				
RBM19	9904	broad.mit.edu	37	12	114386709	114386710	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:114386709_114386710CC>AA	ENST00000545145.2	-	10	1282_1283	c.1204_1205GG>TT	c.(1204-1206)GGa>TTa	p.G402L	RBM19_ENST00000392561.3_Missense_Mutation_p.G402L|RBM19_ENST00000261741.5_Missense_Mutation_p.G402L	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	402	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					AAAGAGCCTTCCGGATTCGGCC	0.584																																							uc009zwi.2		NA																	0				skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6						c.(1204-1206)GGA>TTA		RNA binding motif protein 19																																				SO:0001583	missense	9904				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding	g.chr12:114386709_114386710CC>AA	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1204_1205delinsAA	12.37:g.114386709_114386710delinsAA	ENSP00000442053:p.Gly402Leu		Somatic				RBM19_uc001tvn.3_Missense_Mutation_p.G402L|RBM19_uc001tvm.2_Missense_Mutation_p.G402L	p.G402L	NM_001146699	NP_001140171	WXS	Illumina HiSeq	Unspecified	Q9Y4C8	RBM19_HUMAN			10	1348_1349	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		402			RRM 3.		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	DNP	ENST00000545145.2	37	c.1204_1205GG>TT	CCDS9172.1																																																																																				0.584	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196		15	106	0	0	0	0.004672	0	15	106				
ANAPC5	51433	broad.mit.edu	37	12	121766294	121766294	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:121766294C>G	ENST00000261819.3	-	10	1250	c.1129G>C	c.(1129-1131)Gcc>Ccc	p.A377P	ANAPC5_ENST00000536366.1_Silent_p.S198S|ANAPC5_ENST00000544314.1_5'UTR|ANAPC5_ENST00000344395.4_Intron|ANAPC5_ENST00000535482.1_Missense_Mutation_p.A43P|ANAPC5_ENST00000441917.2_Intron|ANAPC5_ENST00000541887.1_Intron	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	377					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCCAGGGAGGCGAGGTACTAA	0.478																																							uc001uag.2		NA																	0				skin(3)|breast(2)|kidney(1)	6						c.(1129-1131)GCC>CCC		anaphase-promoting complex subunit 5 isoform a							95.0	80.0	85.0					12																	121766294		2203	4300	6503	SO:0001583	missense	51433				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity	g.chr12:121766294C>G	AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.1129G>C	12.37:g.121766294C>G	ENSP00000261819:p.Ala377Pro		Somatic				ANAPC5_uc010szu.1_Missense_Mutation_p.A43P|ANAPC5_uc001uae.2_5'UTR|ANAPC5_uc010szv.1_5'UTR|ANAPC5_uc001uaf.2_RNA|ANAPC5_uc001uah.2_Intron|ANAPC5_uc001uai.1_Intron	p.A377P	NM_016237	NP_057321	WXS	Illumina HiSeq	Unspecified	Q9UJX4	APC5_HUMAN			10	1251	-	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		377					E9PFB2|Q8N4H7|Q9BQD4	Missense_Mutation	SNP	ENST00000261819.3	37	c.1129G>C	CCDS9220.1	.	.	.	.	.	.	.	.	.	.	C	34	5.360816	0.95877	.	.	ENSG00000089053	ENST00000261819;ENST00000535482	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.68860	0.3047	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.70956	-0.4731	9	0.72032	D	0.01	.	18.7166	0.91678	0.0:1.0:0.0:0.0	.	43;377	F5H0N1;Q9UJX4	.;APC5_HUMAN	P	377;43	.	ENSP00000261819:A377P	A	-	1	0	ANAPC5	120250677	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.077000	0.76814	2.668000	0.90789	0.591000	0.81541	GCC		0.478	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402582.1			6	41	0	0	0	0.00308	0	6	41				
KNTC1	9735	broad.mit.edu	37	12	123032049	123032049	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:123032049G>A	ENST00000333479.7	+	11	1081	c.904G>A	c.(904-906)Gaa>Aaa	p.E302K	KNTC1_ENST00000450485.2_Missense_Mutation_p.E265K	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	302					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TCTTACTACAGAAGCAGACTC	0.428																																							uc001ucv.2		NA																	0				ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10						c.(904-906)GAA>AAA		Rough Deal homolog, centromere/kinetochore							100.0	92.0	94.0					12																	123032049		1919	4122	6041	SO:0001583	missense	9735				cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding	g.chr12:123032049G>A		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.904G>A	12.37:g.123032049G>A	ENSP00000328236:p.Glu302Lys		Somatic				KNTC1_uc010taf.1_Missense_Mutation_p.E265K	p.E302K	NM_014708	NP_055523	WXS	Illumina HiSeq	Unspecified	P50748	KNTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)	11	1067	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		302					A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	c.904G>A	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064113	0.55432	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.63417	-0.04;-0.04	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.77811	0.4186	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.994;0.996	T	0.78254	-0.2275	10	0.72032	D	0.01	-25.4461	19.0584	0.93076	0.0:0.0:1.0:0.0	.	265;302	E7ES84;P50748	.;KNTC1_HUMAN	K	265;302	ENSP00000397992:E265K;ENSP00000328236:E302K	ENSP00000328236:E302K	E	+	1	0	KNTC1	121598002	1.000000	0.71417	0.940000	0.37924	0.119000	0.20118	7.244000	0.78228	2.738000	0.93877	0.637000	0.83480	GAA		0.428	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			7	15	0	0	0	0.001984	0	7	15				
DDX55	57696	broad.mit.edu	37	12	124097728	124097728	+	Silent	SNP	A	A	T	rs369679658		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:124097728A>T	ENST00000238146.4	+	8	803	c.753A>T	c.(751-753)gcA>gcT	p.A251A	DDX55_ENST00000538744.1_Silent_p.A251A	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	251						membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		TATGCAAGGCAGATGAGAAAT	0.378																																							uc001ufi.2		NA																	0				ovary(1)	1						c.(751-753)GCA>GCT		DEAD (Asp-Glu-Ala-Asp) box polypeptide 55							119.0	118.0	118.0					12																	124097728		2203	4300	6503	SO:0001819	synonymous_variant	57696						ATP binding|ATP-dependent helicase activity|RNA binding	g.chr12:124097728A>T	AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.753A>T	12.37:g.124097728A>T			Somatic				DDX55_uc001ufh.2_Silent_p.A104A|DDX55_uc001ufj.1_Silent_p.A104A|DDX55_uc001ufk.2_Silent_p.A104A	p.A251A	NM_020936	NP_065987	WXS	Illumina HiSeq	Unspecified	Q8NHQ9	DDX55_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)	8	777	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		251					Q658L6|Q8IYH0|Q9HCH7	Silent	SNP	ENST00000238146.4	37	c.753A>T	CCDS9251.1																																																																																				0.378	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400616.2			9	64	0	0	0	0.004482	0	9	64				
RIMBP2	23504	broad.mit.edu	37	12	130912804	130912804	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:130912804C>T	ENST00000261655.4	-	12	2444	c.2281G>A	c.(2281-2283)Gag>Aag	p.E761K		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	761					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		AGCTCCTCCTCGTCCTCCTCC	0.617																																							uc001uil.2		NA																	0				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11						c.(2281-2283)GAG>AAG		RIM-binding protein 2							93.0	74.0	80.0					12																	130912804		2203	4300	6503	SO:0001583	missense	23504					cell junction|synapse		g.chr12:130912804C>T	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2281G>A	12.37:g.130912804C>T	ENSP00000261655:p.Glu761Lys		Somatic					p.E761K	NM_015347	NP_056162	WXS	Illumina HiSeq	Unspecified	O15034	RIMB2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)	12	2445	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	761					Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	c.2281G>A	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	C	34	5.336402	0.95758	.	.	ENSG00000060709	ENST00000261655	T	0.23552	1.9	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.49287	0.1548	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.37934	-0.9684	10	0.26408	T	0.33	-35.7598	18.2467	0.89988	0.0:1.0:0.0:0.0	.	761	O15034	RIMB2_HUMAN	K	761	ENSP00000261655:E761K	ENSP00000261655:E761K	E	-	1	0	RIMBP2	129478757	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.791000	0.85805	2.306000	0.77630	0.561000	0.74099	GAG		0.617	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347		13	73	0	0	0	0.00245	0	13	73				
PUS1	80324	broad.mit.edu	37	12	132416843	132416843	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:132416843G>T	ENST00000376649.3	+	3	927	c.427G>T	c.(427-429)Gcc>Tcc	p.A143S	PUS1_ENST00000542167.2_Missense_Mutation_p.A90S|PUS1_ENST00000443358.2_Missense_Mutation_p.A115S|RP11-417L19.4_ENST00000539078.1_lincRNA|PUS1_ENST00000535067.1_Missense_Mutation_p.A115S|PUS1_ENST00000440818.2_Missense_Mutation_p.A115S	NM_025215.5	NP_079491.2	Q9Y606	TRUA_HUMAN	pseudouridylate synthase 1	143					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|tRNA pseudouridine synthesis (GO:0031119)	mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|pseudouridylate synthase activity (GO:0004730)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	11	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)		CCAGCGCTGCGCCCGGACAGA	0.562																																					Esophageal Squamous(102;671 2009 17384 45666)	Esophageal Squamous(102;671 2009 17384 45666)	uc001ujf.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(427-429)GCC>TCC		pseudouridine synthase 1 isoform 1							65.0	53.0	57.0					12																	132416843		2203	4300	6503	SO:0001583	missense	80324					mitochondrion	pseudouridine synthase activity|pseudouridylate synthase activity|RNA binding	g.chr12:132416843G>T	AF116238	CCDS9275.2, CCDS31928.1	12q24	2004-05-17			ENSG00000177192	ENSG00000177192			15508	protein-coding gene	gene with protein product		608109				10094309	Standard	NM_001002019		Approved		uc001ujf.3	Q9Y606	OTTHUMG00000128507	ENST00000376649.3:c.427G>T	12.37:g.132416843G>T	ENSP00000365837:p.Ala143Ser		Somatic				PUS1_uc001ujg.2_Missense_Mutation_p.A115S|PUS1_uc001ujh.2_Missense_Mutation_p.A115S|PUS1_uc001uji.2_Missense_Mutation_p.A90S	p.A143S	NM_025215	NP_079491	WXS	Illumina HiSeq	Unspecified	Q9Y606	TRUA_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)	3	906	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		143					A8K877|B3KQC1|Q8WYT2|Q9BU44	Missense_Mutation	SNP	ENST00000376649.3	37	c.427G>T	CCDS9275.2	.	.	.	.	.	.	.	.	.	.	G	23.6	4.431946	0.83776	.	.	ENSG00000177192	ENST00000443358;ENST00000376649;ENST00000322060;ENST00000440818;ENST00000542167;ENST00000538037;ENST00000456665;ENST00000544213;ENST00000535067;ENST00000537484	T;T;T;T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45	5.27	4.38	0.52667	Pseudouridine synthase I, TruA, N-terminal (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase I, TruA, alpha/beta domain (1);	0.000000	0.85682	D	0.000000	T	0.57946	0.2088	N	0.21324	0.655	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.71656	0.936;0.974	T	0.61729	-0.7003	10	0.56958	D	0.05	-4.9425	13.9197	0.63923	0.0737:0.0:0.9263:0.0	.	90;143	F5H1S9;Q9Y606	.;TRUA_HUMAN	S	115;143;115;115;90;115;115;143;115;115	ENSP00000392451:A115S;ENSP00000365837:A143S;ENSP00000324726:A115S;ENSP00000400032:A115S;ENSP00000438948:A90S;ENSP00000440326:A115S;ENSP00000409705:A115S;ENSP00000445819:A143S;ENSP00000443969:A115S;ENSP00000440179:A115S	ENSP00000324726:A115S	A	+	1	0	PUS1	130982796	1.000000	0.71417	0.461000	0.27105	0.926000	0.56050	9.869000	0.99810	1.244000	0.43870	0.462000	0.41574	GCC		0.562	PUS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250313.2	NM_025215		12	24	1	0	2.27111e-07	0.001368	2.73365e-07	12	24				
SLC7A1	6541	broad.mit.edu	37	13	30091719	30091719	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr13:30091719T>A	ENST00000380752.5	-	10	1887	c.1501A>T	c.(1501-1503)Agc>Tgc	p.S501C	SLC7A1_ENST00000473577.1_5'UTR	NM_003045.4	NP_003036.1	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 1	501					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)	p.S501G(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|stomach(1)|urinary_tract(2)	24		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CCTATGAGGCTGGTTGAAATG	0.488																																							uc001uso.2		NA																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(1501-1503)AGC>TGC		solute carrier family 7 (cationic amino acid	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)						149.0	147.0	147.0					13																	30091719		2203	4300	6503	SO:0001583	missense	6541				cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity	g.chr13:30091719T>A	AF078107	CCDS9333.1	13q12.3	2013-05-22			ENSG00000139514	ENSG00000139514		"""Solute carriers"""	11057	protein-coding gene	gene with protein product	"""ecotropic retroviral receptor"", ""amino acid transporter, cationic 1"""	104615		ERR, ATRC1		1348489	Standard	NM_003045		Approved	CAT-1, HCAT1, REC1L	uc001uso.3	P30825	OTTHUMG00000016658	ENST00000380752.5:c.1501A>T	13.37:g.30091719T>A	ENSP00000370128:p.Ser501Cys		Somatic					p.S501C	NM_003045	NP_003036	WXS	Illumina HiSeq	Unspecified	P30825	CTR1_HUMAN		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	10	1888	-		Lung SC(185;0.0257)|Breast(139;0.238)	501			Helical; (Potential).		Q5JR50	Missense_Mutation	SNP	ENST00000380752.5	37	c.1501A>T	CCDS9333.1	.	.	.	.	.	.	.	.	.	.	T	10.32	1.316804	0.23908	.	.	ENSG00000139514	ENST00000380752	D	0.85861	-2.04	5.24	1.56	0.23342	.	0.549745	0.21973	N	0.066432	T	0.74981	0.3788	L	0.43598	1.365	0.29441	N	0.859177	B	0.09022	0.002	B	0.12837	0.008	T	0.63541	-0.6614	10	0.38643	T	0.18	.	3.924	0.09256	0.1759:0.3575:0.0:0.4666	.	501	P30825	CTR1_HUMAN	C	501	ENSP00000370128:S501C	ENSP00000370128:S501C	S	-	1	0	SLC7A1	28989719	0.869000	0.29996	0.998000	0.56505	0.724000	0.41520	0.772000	0.26647	0.426000	0.26116	-0.256000	0.11100	AGC		0.488	SLC7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044337.2	NM_003045		34	108	0	0	0	0.004289	0	34	108				
LRCH1	23143	broad.mit.edu	37	13	47315804	47315804	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr13:47315804C>G	ENST00000389798.3	+	19	2205	c.2008C>G	c.(2008-2010)Ctg>Gtg	p.L670V	LRCH1_ENST00000311191.6_Intron|LRCH1_ENST00000389797.3_Missense_Mutation_p.L705V	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	670	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GTGTGACATCCTGCAGTTGGA	0.517																																							uc001vbj.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2008-2010)CTG>GTG		leucine-rich repeats and calponin homology (CH)							338.0	344.0	342.0					13																	47315804		2203	4300	6503	SO:0001583	missense	23143							g.chr13:47315804C>G	AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.2008C>G	13.37:g.47315804C>G	ENSP00000374448:p.Leu670Val		Somatic				LRCH1_uc001vbk.2_Missense_Mutation_p.L705V|LRCH1_uc001vbl.3_Intron	p.L670V	NM_015116	NP_055931	WXS	Illumina HiSeq	Unspecified	Q9Y2L9	LRCH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)	19	2244	+		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	670			CH.		B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	ENST00000389798.3	37	c.2008C>G	CCDS31972.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407407	0.83230	.	.	ENSG00000136141	ENST00000389798;ENST00000389797	D;D	0.94931	-3.56;-3.56	5.77	5.77	0.91146	Calponin homology domain (5);	0.074229	0.56097	D	0.000034	D	0.97445	0.9164	M	0.83483	2.645	0.49213	D	0.999763	D;D	0.76494	0.999;0.99	D;P	0.87578	0.998;0.78	D	0.96881	0.9646	10	0.48119	T	0.1	-9.4135	19.335	0.94312	0.0:1.0:0.0:0.0	.	705;670	F8W6F0;Q9Y2L9	.;LRCH1_HUMAN	V	670;705	ENSP00000374448:L670V;ENSP00000374447:L705V	ENSP00000374447:L705V	L	+	1	2	LRCH1	46213805	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.022000	0.49659	2.890000	0.99128	0.650000	0.86243	CTG		0.517	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	NM_015116		112	382	0	0	0	0.00361	0	112	382				
CKAP2	26586	broad.mit.edu	37	13	53049190	53049190	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr13:53049190A>T	ENST00000378037.5	+	9	2056	c.1966A>T	c.(1966-1968)Acg>Tcg	p.T656S	CKAP2_ENST00000490903.1_Missense_Mutation_p.T607S|CKAP2_ENST00000258607.5_Missense_Mutation_p.T655S	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2											breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		GGAACAGCTAACGGAGTTGGG	0.423																																							uc001vgv.2		NA																	0				ovary(1)|skin(1)	2						c.(1966-1968)ACG>TCG		cytoskeleton associated protein 2 isoform 2							144.0	135.0	138.0					13																	53049190		2203	4300	6503	SO:0001583	missense	26586				apoptosis|cell cycle	centrosome|microtubule|spindle pole		g.chr13:53049190A>T	AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.1966A>T	13.37:g.53049190A>T	ENSP00000367276:p.Thr656Ser		Somatic				CKAP2_uc001vgu.2_Missense_Mutation_p.T655S|CKAP2_uc010tha.1_Missense_Mutation_p.T607S	p.T656S	NM_001098525	NP_001091995	WXS	Illumina HiSeq	Unspecified	Q8WWK9	CKAP2_HUMAN		GBM - Glioblastoma multiforme(99;2.6e-08)	9	2163	+		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	656						Missense_Mutation	SNP	ENST00000378037.5	37	c.1966A>T	CCDS41893.1	.	.	.	.	.	.	.	.	.	.	.	7.840	0.721749	0.15372	.	.	ENSG00000136108	ENST00000258607;ENST00000378037;ENST00000490903	T;T;T	0.21191	2.02;2.02;2.02	5.98	-2.44	0.06502	.	1.140440	0.06276	N	0.696481	T	0.12646	0.0307	L	0.43923	1.385	0.09310	N	1	B;B;B	0.13594	0.008;0.008;0.008	B;B;B	0.14578	0.011;0.007;0.007	T	0.34825	-0.9813	10	0.10902	T	0.67	-0.3278	0.4596	0.00514	0.2329:0.2063:0.3188:0.242	.	607;656;655	E9PD90;Q8WWK9;B2RMQ4	.;CKAP2_HUMAN;.	S	655;656;607	ENSP00000258607:T655S;ENSP00000367276:T656S;ENSP00000417830:T607S	ENSP00000258607:T655S	T	+	1	0	CKAP2	51947191	1.000000	0.71417	0.337000	0.25536	0.682000	0.39822	1.443000	0.35057	-0.513000	0.06496	0.528000	0.53228	ACG		0.423	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355010.2			40	98	0	0	0	0.00623	0	40	98				
OLFM4	10562	broad.mit.edu	37	13	53617317	53617317	+	Silent	SNP	C	C	A	rs369197754		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr13:53617317C>A	ENST00000219022.2	+	4	726	c.648C>A	c.(646-648)atC>atA	p.I216I		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	216					cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		GCCGAGAAATCGTGGCTCTGA	0.443																																							uc001vhl.2		NA																	0				skin(1)	1						c.(646-648)ATC>ATA		olfactomedin 4 precursor							134.0	128.0	130.0					13																	53617317		2203	4300	6503	SO:0001819	synonymous_variant	10562				cell adhesion	extracellular space		g.chr13:53617317C>A	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.648C>A	13.37:g.53617317C>A			Somatic				OLFM4_uc001vhk.1_Intron	p.I216I	NM_006418	NP_006409	WXS	Illumina HiSeq	Unspecified	Q6UX06	OLFM4_HUMAN		GBM - Glioblastoma multiforme(99;3.13e-08)	4	648	+		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	216			Potential.		O95362|Q5VWG0|Q86T22	Silent	SNP	ENST00000219022.2	37	c.648C>A	CCDS9440.1																																																																																				0.443	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418		28	69	1	0	2.61193e-14	0.009535	3.67347e-14	28	69				
SLC10A2	6555	broad.mit.edu	37	13	103718589	103718589	+	Missense_Mutation	SNP	G	G	T	rs200273975		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr13:103718589G>T	ENST00000245312.3	-	1	607	c.11C>A	c.(10-12)cCg>cAg	p.P4Q		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	4					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.P4Q(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	ACAGCTGTTCGGATCATTCAT	0.517																																							uc001vpy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(10-12)CCG>CAG		solute carrier family 10 (sodium/bile acid							103.0	98.0	100.0					13																	103718589		2203	4300	6503	SO:0001583	missense	6555				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity	g.chr13:103718589G>T	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.11C>A	13.37:g.103718589G>T	ENSP00000245312:p.Pro4Gln		Somatic					p.P4Q	NM_000452	NP_000443	WXS	Illumina HiSeq	Unspecified	Q12908	NTCP2_HUMAN			1	608	-	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		4			Extracellular (Potential).		A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	c.11C>A	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	G	3.199	-0.164217	0.06502	.	.	ENSG00000125255	ENST00000245312	T	0.07908	3.15	5.67	-1.89	0.07689	.	2.004560	0.01754	N	0.030138	T	0.05090	0.0136	N	0.08118	0	0.09310	N	1	B	0.18461	0.028	B	0.14578	0.011	T	0.39663	-0.9603	10	0.56958	D	0.05	-25.5519	6.1255	0.20177	0.415:0.2182:0.3668:0.0	.	4	Q12908	NTCP2_HUMAN	Q	4	ENSP00000245312:P4Q	ENSP00000245312:P4Q	P	-	2	0	SLC10A2	102516590	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.013000	0.13310	-0.843000	0.04189	-0.819000	0.03115	CCG		0.517	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1			11	34	1	0	1.5842e-08	0.001855	1.96995e-08	11	34				
OR4K17	390436	broad.mit.edu	37	14	20585973	20585973	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:20585973C>G	ENST00000315543.4	+	1	408	c.408C>G	c.(406-408)caC>caG	p.H136Q		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TTCTCCTTCACTTACTGGGTG	0.433																																							uc001vwo.1		NA																	0				skin(3)	3						c.(406-408)CAC>CAG		olfactory receptor, family 4, subfamily K,							125.0	118.0	120.0					14																	20585973		2203	4300	6503	SO:0001583	missense	390436				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20585973C>G		CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.408C>G	14.37:g.20585973C>G	ENSP00000319197:p.His136Gln		Somatic					p.H136Q	NM_001004715	NP_001004715	WXS	Illumina HiSeq	Unspecified	Q8NGC6	OR4KH_HUMAN	Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)	1	408	+	all_cancers(95;0.00108)		108			Helical; Name=3; (Potential).		Q6IF12	Missense_Mutation	SNP	ENST00000315543.4	37	c.408C>G	CCDS32030.1	.	.	.	.	.	.	.	.	.	.	.	13.09	2.134362	0.37630	.	.	ENSG00000176230	ENST00000315543	T	0.00547	6.66	2.86	0.947	0.19555	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35466	U	0.003185	T	0.01940	0.0061	M	0.91510	3.215	0.23909	N	0.996498	D	0.71674	0.998	P	0.61003	0.882	T	0.20538	-1.0272	10	0.72032	D	0.01	.	8.0678	0.30672	0.0:0.7593:0.0:0.2407	.	108	Q8NGC6	OR4KH_HUMAN	Q	136	ENSP00000319197:H136Q	ENSP00000319197:H136Q	H	+	3	2	OR4K17	19655813	0.000000	0.05858	0.943000	0.38184	0.581000	0.36288	-2.060000	0.01392	0.510000	0.28216	0.404000	0.27445	CAC		0.433	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1			21	132	0	0	0	0.008871	0	21	132				
OR4N5	390437	broad.mit.edu	37	14	20612644	20612644	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:20612644G>T	ENST00000333629.1	+	1	750	c.750G>T	c.(748-750)atG>atT	p.M250I	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		TATTTCTCATGTTTGGACCTG	0.438																																							uc010tla.1		NA																	0				ovary(1)	1						c.(748-750)ATG>ATT		olfactory receptor, family 4, subfamily N,							196.0	204.0	202.0					14																	20612644		2203	4300	6503	SO:0001583	missense	390437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20612644G>T		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.750G>T	14.37:g.20612644G>T	ENSP00000332110:p.Met250Ile		Somatic					p.M250I	NM_001004724	NP_001004724	WXS	Illumina HiSeq	Unspecified	Q8IXE1	OR4N5_HUMAN	Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)	1	750	+	all_cancers(95;0.00108)		250			Helical; Name=6; (Potential).		Q6IF11	Missense_Mutation	SNP	ENST00000333629.1	37	c.750G>T	CCDS32031.1	.	.	.	.	.	.	.	.	.	.	G	4.841	0.156408	0.09236	.	.	ENSG00000184394	ENST00000333629	T	0.00051	8.81	3.77	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000058	T	0.00144	0.0004	N	0.03608	-0.345	0.33440	D	0.582313	D	0.62365	0.991	D	0.77004	0.989	D	0.84709	0.0733	10	0.46703	T	0.11	.	9.3775	0.38292	0.0:0.3503:0.6496:0.0	.	250	Q8IXE1	OR4N5_HUMAN	I	250	ENSP00000332110:M250I	ENSP00000332110:M250I	M	+	3	0	OR4N5	19682484	0.020000	0.18652	1.000000	0.80357	0.965000	0.64279	-0.528000	0.06193	2.086000	0.62901	0.655000	0.94253	ATG		0.438	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1			93	225	1	0	1.50986e-39	0.00361	2.46642e-39	93	225				
OR10G3	26533	broad.mit.edu	37	14	22037988	22037988	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:22037988C>T	ENST00000303532.1	-	1	887	c.888G>A	c.(886-888)gtG>gtA	p.V296V		NM_001005465.1	NP_001005465.1	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G, member 3	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)	15	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		GGGCCAGCTTCACCTCTTGGT	0.522																																							uc010tmb.1		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(886-888)GTG>GTA		olfactory receptor, family 10, subfamily G,							54.0	57.0	56.0					14																	22037988		2203	4300	6503	SO:0001819	synonymous_variant	26533				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22037988C>T		CCDS32046.1	14q11.2	2013-09-24			ENSG00000169208	ENSG00000169208		"""GPCR / Class A : Olfactory receptors"""	8171	protein-coding gene	gene with protein product						8188290	Standard	NM_001005465		Approved		uc010tmb.2	Q8NGC4	OTTHUMG00000168886	ENST00000303532.1:c.888G>A	14.37:g.22037988C>T			Somatic					p.V296V	NM_001005465	NP_001005465	WXS	Illumina HiSeq	Unspecified	Q8NGC4	O10G3_HUMAN		GBM - Glioblastoma multiforme(265;0.0139)	1	888	-	all_cancers(95;0.000987)		296			Cytoplasmic (Potential).		Q6IET7|Q96R77	Silent	SNP	ENST00000303532.1	37	c.888G>A	CCDS32046.1																																																																																				0.522	OR10G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401521.1			6	56	0	0	0	0.001168	0	6	56				
CTAGE5	4253	broad.mit.edu	37	14	39815112	39815112	+	Silent	SNP	A	A	G	rs146750332		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:39815112A>G	ENST00000280083.3	+	21	2150	c.1836A>G	c.(1834-1836)caA>caG	p.Q612Q	RP11-407N17.3_ENST00000603904.1_Silent_p.Q583Q|CTAGE5_ENST00000341749.3_Silent_p.Q600Q|RP11-407N17.3_ENST00000553728.1_Silent_p.Q1147Q|CTAGE5_ENST00000557038.1_Silent_p.Q532Q|CTAGE5_ENST00000341502.5_Silent_p.Q612Q|CTAGE5_ENST00000553352.1_Silent_p.Q583Q|CTAGE5_ENST00000348007.3_Silent_p.Q569Q|CTAGE5_ENST00000396165.4_Silent_p.Q583Q|CTAGE5_ENST00000396158.2_Silent_p.Q617Q|CTAGE5_ENST00000556148.1_Silent_p.Q537Q			O15320	CTGE5_HUMAN	CTAGE family, member 5	612	Pro-rich.				positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TTCTAGGACAATCATATCCTG	0.328													A|||	1	0.000199681	0.0	0.0	5008	,	,		17492	0.001		0.0	False		,,,				2504	0.0						uc001wvg.3		NA																	0					0						c.(1834-1836)CAA>CAG		CTAGE family, member 5 isoform 1		A	,,,	2,4404	4.2+/-10.8	0,2,2201	55.0	53.0	54.0		1836,1800,1707,1749	-4.4	0.3	14	dbSNP_134	54	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CTAGE5	NM_005930.3,NM_203354.2,NM_203355.2,NM_203356.2	,,,	0,2,6501	GG,GA,AA		0.0,0.0454,0.0154	,,,	612/805,600/793,569/762,583/776	39815112	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	4253						enzyme activator activity|protein binding	g.chr14:39815112A>G	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.1836A>G	14.37:g.39815112A>G			Somatic				CTAGE5_uc010tqe.1_Silent_p.Q574Q|CTAGE5_uc001wuz.3_Silent_p.Q600Q|CTAGE5_uc001wuy.3_Silent_p.Q532Q|CTAGE5_uc001wvb.3_Silent_p.Q540Q|CTAGE5_uc001wvc.3_Silent_p.Q514Q|CTAGE5_uc001wva.3_Silent_p.Q583Q|CTAGE5_uc001wvh.3_Silent_p.Q569Q|CTAGE5_uc001wvf.3_Silent_p.Q537Q|CTAGE5_uc001wvi.3_Silent_p.Q617Q|CTAGE5_uc010amz.2_Silent_p.Q228Q|CTAGE5_uc001wvj.3_Silent_p.Q583Q	p.Q612Q	NM_005930	NP_005921	WXS	Illumina HiSeq	Unspecified	O15320	CTGE5_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)	21	2172	+	Hepatocellular(127;0.213)		612			Pro-rich.		B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Silent	SNP	ENST00000280083.3	37	c.1836A>G	CCDS9674.1																																																																																				0.328	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276771.2	NM_005930		6	44	0	0	0	0.001168	0	6	44				
FRMD6	122786	broad.mit.edu	37	14	52186968	52186968	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:52186968G>T	ENST00000344768.5	+	11	1416	c.1220G>T	c.(1219-1221)gGg>gTg	p.G407V	FRMD6_ENST00000554167.1_Missense_Mutation_p.G330V|FRMD6_ENST00000395718.2_Missense_Mutation_p.G399V|FRMD6_ENST00000356218.4_Missense_Mutation_p.G399V|FRMD6_ENST00000553556.1_Missense_Mutation_p.G49V			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	407					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					CGGGACACGGGGCCAGAAGAC	0.612																																							uc001wzd.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1219-1221)GGG>GTG		FERM domain containing 6							64.0	61.0	62.0					14																	52186968		2203	4300	6503	SO:0001583	missense	122786					cytoskeleton|mitochondrion|plasma membrane	binding	g.chr14:52186968G>T	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1220G>T	14.37:g.52186968G>T	ENSP00000343899:p.Gly407Val		Somatic				FRMD6_uc001wzb.2_Missense_Mutation_p.G399V|FRMD6_uc001wzc.2_Missense_Mutation_p.G399V|FRMD6_uc001wze.2_Missense_Mutation_p.G330V|FRMD6_uc001wzf.2_Missense_Mutation_p.G100V|FRMD6_uc001wzg.2_Missense_Mutation_p.G49V	p.G407V	NM_152330	NP_689543	WXS	Illumina HiSeq	Unspecified	Q96NE9	FRMD6_HUMAN			11	1505	+	all_epithelial(31;0.0163)|Breast(41;0.089)		407					D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	ENST00000344768.5	37	c.1220G>T	CCDS58318.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.363325	0.24684	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000555197;ENST00000555703;ENST00000553556	T;T;T;T	0.76968	-1.06;-1.06;-0.83;-0.64	5.98	5.06	0.68205	.	0.000000	0.64402	D	0.000002	T	0.63331	0.2502	N	0.19112	0.55	0.80722	D	1	B;B;B	0.30824	0.2;0.296;0.2	B;B;B	0.25506	0.061;0.027;0.061	T	0.61574	-0.7035	10	0.31617	T	0.26	.	14.9857	0.71345	0.0:0.0:0.7452:0.2548	.	330;407;399	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	V	399;399;407;330;137;49;49	ENSP00000348550:G399V;ENSP00000379068:G399V;ENSP00000343899:G407V;ENSP00000451977:G330V	ENSP00000343899:G407V	G	+	2	0	FRMD6	51256718	1.000000	0.71417	0.327000	0.25402	0.098000	0.18820	4.074000	0.57577	2.838000	0.97847	0.591000	0.81541	GGG		0.612	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330		17	75	1	0	6.94344e-10	0.006122	8.97359e-10	17	75				
C14orf37	145407	broad.mit.edu	37	14	58471883	58471883	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:58471883C>A	ENST00000267485.7	-	7	2333	c.2139G>T	c.(2137-2139)ggG>ggT	p.G713G		NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	713						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						GCACCAGCATCCCAGACATGT	0.517																																							uc001xdc.2		NA																	0					0						c.(2137-2139)GGG>GGT		hypothetical protein LOC145407 precursor							82.0	78.0	79.0					14																	58471883		2203	4300	6503	SO:0001819	synonymous_variant	145407					integral to membrane	binding	g.chr14:58471883C>A		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.2139G>T	14.37:g.58471883C>A			Somatic				C14orf37_uc010tro.1_Silent_p.G751G|C14orf37_uc001xdd.2_Silent_p.G713G	p.G713G	NM_001001872	NP_001001872	WXS	Illumina HiSeq	Unspecified	Q86TY3	CN037_HUMAN			7	2250	-			713			Extracellular (Potential).		A8K8Z8|Q6P5Q1|Q86TY1	Silent	SNP	ENST00000267485.7	37	c.2139G>T	CCDS32089.1																																																																																				0.517	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412059.1	NM_001001872		12	76	1	0	2.61681e-11	0.00245	3.5024e-11	12	76				
SLC8A3	6547	broad.mit.edu	37	14	70634104	70634104	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:70634104G>T	ENST00000381269.2	-	2	1789	c.1036C>A	c.(1036-1038)Cac>Aac	p.H346N	SLC8A3_ENST00000528359.1_Missense_Mutation_p.H346N|SLC8A3_ENST00000357887.3_Missense_Mutation_p.H346N|SLC8A3_ENST00000534137.1_Missense_Mutation_p.H346N|SLC8A3_ENST00000356921.2_Missense_Mutation_p.H346N	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	346					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTCTGTTGGTGGGAAAGAGCA	0.488																																							uc001xly.2		NA																	0				skin(3)|ovary(2)|breast(2)	7						c.(1036-1038)CAC>AAC		solute carrier family 8 (sodium/calcium							98.0	99.0	99.0					14																	70634104		2203	4300	6503	SO:0001583	missense	6547				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding	g.chr14:70634104G>T	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1036C>A	14.37:g.70634104G>T	ENSP00000370669:p.His346Asn		Somatic				SLC8A3_uc001xlw.2_Missense_Mutation_p.H346N|SLC8A3_uc001xlx.2_Missense_Mutation_p.H346N|SLC8A3_uc001xlz.2_Missense_Mutation_p.H346N|SLC8A3_uc010ara.2_RNA	p.H346N	NM_183002	NP_892114	WXS	Illumina HiSeq	Unspecified	P57103	NAC3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)	2	1790	-			346			Cytoplasmic (Potential).		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	c.1036C>A	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.301656	0.60195	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.33654	1.48;1.4;1.54;1.48;1.54	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.55305	0.1912	L	0.55481	1.735	0.80722	D	1	D;D;P;D	0.58620	0.983;0.972;0.926;0.959	D;P;D;D	0.68192	0.917;0.827;0.956;0.956	T	0.34725	-0.9817	10	0.18276	T	0.48	.	20.1649	0.98147	0.0:0.0:1.0:0.0	.	346;346;346;346	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	N	346	ENSP00000349392:H346N;ENSP00000370669:H346N;ENSP00000350560:H346N;ENSP00000436688:H346N;ENSP00000433531:H346N	ENSP00000349392:H346N	H	-	1	0	SLC8A3	69703857	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.753000	0.94483	0.655000	0.94253	CAC		0.488	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			19	74	1	0	6.49762e-13	0.006122	8.94698e-13	19	74				
MOAP1	64112	broad.mit.edu	37	14	93649946	93649946	+	Silent	SNP	T	T	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:93649946T>G	ENST00000556883.1	-	2	1126	c.642A>C	c.(640-642)gcA>gcC	p.A214A	RP11-371E8.4_ENST00000557574.1_5'Flank|TMEM251_ENST00000415050.2_5'Flank|TMEM251_ENST00000283534.4_5'Flank|MOAP1_ENST00000298894.4_Silent_p.A214A			Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1	214					apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	13		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		taacatcaagtgctgggcctc	0.453																																							uc001ybj.2		NA																	0				skin(2)|ovary(1)	3						c.(640-642)GCA>GCC		modulator of apoptosis 1							95.0	105.0	102.0					14																	93649946		2203	4300	6503	SO:0001819	synonymous_variant	64112				activation of caspase activity|apoptotic nuclear change	cytoplasm	protein homodimerization activity	g.chr14:93649946T>G	BC015044	CCDS9908.1	14q32.12	2012-02-09			ENSG00000165943	ENSG00000165943		"""Paraneoplastic Ma antigens"""	16658	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 4"""	609485				11060313	Standard	NM_022151		Approved	MAP-1, PNMA4	uc001ybj.3	Q96BY2	OTTHUMG00000169184	ENST00000556883.1:c.642A>C	14.37:g.93649946T>G			Somatic				C14orf109_uc001ybk.3_5'Flank|C14orf109_uc010auo.2_5'Flank	p.A214A	NM_022151	NP_071434	WXS	Illumina HiSeq	Unspecified	Q96BY2	MOAP1_HUMAN		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)	3	1012	-		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)	214					B2RDF6|Q9H833|Q9HAS1	Silent	SNP	ENST00000556883.1	37	c.642A>C	CCDS9908.1																																																																																				0.453	MOAP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412685.1			19	125	0	0	0	0.008871	0	19	125				
SERPINA3	12	broad.mit.edu	37	14	95081052	95081052	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:95081052C>T	ENST00000467132.1	+	2	1422	c.274C>T	c.(274-276)Cat>Tat	p.H92Y	SERPINA3_ENST00000393080.4_Missense_Mutation_p.H92Y|RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393078.3_Missense_Mutation_p.H92Y|SERPINA3_ENST00000482740.1_5'Flank			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	92					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		TCTGGGGGCCCATAATACCAC	0.542																																							uc001ydp.2		NA																	0				ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6						c.(274-276)CAT>TAT		serpin peptidase inhibitor, clade A, member 3							79.0	79.0	79.0					14																	95081052		2203	4300	6503	SO:0001583	missense	12				acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity	g.chr14:95081052C>T	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.274C>T	14.37:g.95081052C>T	ENSP00000450540:p.His92Tyr		Somatic				SERPINA3_uc001ydo.3_Missense_Mutation_p.H117Y|SERPINA3_uc010avf.1_RNA|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Missense_Mutation_p.H92Y|SERPINA3_uc001yds.2_Missense_Mutation_p.H92Y|SERPINA3_uc010avg.2_Missense_Mutation_p.H92Y	p.H92Y	NM_001085	NP_001076	WXS	Illumina HiSeq	Unspecified	P01011	AACT_HUMAN		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)	2	353	+		all_cancers(154;0.0525)|all_epithelial(191;0.179)	92					B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Missense_Mutation	SNP	ENST00000467132.1	37	c.274C>T	CCDS32150.1	.	.	.	.	.	.	.	.	.	.	C	7.147	0.583057	0.13749	.	.	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000555820;ENST00000467132	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	5.03	0.589	0.17452	Serpin domain (3);	0.801790	0.10815	N	0.631165	T	0.81230	0.4779	L	0.60455	1.87	0.09310	N	1	B;P	0.36048	0.017;0.534	B;B	0.24394	0.052;0.053	T	0.69351	-0.5168	10	0.72032	D	0.01	.	9.4899	0.38953	0.6032:0.2847:0.1121:0.0	.	92;117	P01011;G3V5I3	AACT_HUMAN;.	Y	117;92;92;92;92	ENSP00000452367:H117Y;ENSP00000376793:H92Y;ENSP00000376795:H92Y;ENSP00000450540:H92Y	ENSP00000376793:H92Y	H	+	1	0	SERPINA3	94150805	0.000000	0.05858	0.195000	0.23364	0.172000	0.22775	0.765000	0.26546	0.185000	0.20105	-0.304000	0.09214	CAT		0.542	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085		18	102	0	0	0	0.007413	0	18	102				
C14orf177	283598	broad.mit.edu	37	14	99182651	99182651	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:99182651C>G	ENST00000325812.2	+	3	542	c.123C>G	c.(121-123)tgC>tgG	p.C41W		NM_182560.2	NP_872366.2	Q52M58	CN177_HUMAN	chromosome 14 open reading frame 177	41										endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	13		Melanoma(154;0.128)				AAGGGAAATGCCCAAGTTCTC	0.542																																							uc001yfz.1		NA																	0					0						c.(121-123)TGC>TGG		hypothetical protein LOC283598							136.0	98.0	111.0					14																	99182651		2203	4300	6503	SO:0001583	missense	283598							g.chr14:99182651C>G	AK098639	CCDS9948.1	14q32.2	2012-05-30			ENSG00000176605	ENSG00000176605			26375	protein-coding gene	gene with protein product						12477932	Standard	NM_182560		Approved	FLJ25773	uc001yfz.2	Q52M58	OTTHUMG00000167745	ENST00000325812.2:c.123C>G	14.37:g.99182651C>G	ENSP00000321360:p.Cys41Trp		Somatic					p.C41W	NM_182560	NP_872366	WXS	Illumina HiSeq	Unspecified	Q52M58	CN177_HUMAN			3	542	+		Melanoma(154;0.128)	41					Q8N7D2	Missense_Mutation	SNP	ENST00000325812.2	37	c.123C>G	CCDS9948.1	.	.	.	.	.	.	.	.	.	.	C	1.144	-0.648650	0.03506	.	.	ENSG00000176605	ENST00000325812;ENST00000541516	T;T	0.45668	1.03;0.89	3.29	-2.2	0.06994	.	.	.	.	.	T	0.26955	0.0660	N	0.08118	0	0.09310	N	1	D	0.56521	0.976	P	0.52454	0.699	T	0.14643	-1.0465	9	0.87932	D	0	.	3.076	0.06247	0.1968:0.3537:0.0:0.4494	.	41	Q52M58	CN177_HUMAN	W	41	ENSP00000321360:C41W;ENSP00000440687:C41W	ENSP00000321360:C41W	C	+	3	2	C14orf177	98252404	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.261000	0.08694	-0.406000	0.07588	-1.000000	0.02509	TGC		0.542	C14orf177-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396078.1	NM_182560		5	38	0	0	0	0.001168	0	5	38				
DLK1	8788	broad.mit.edu	37	14	101200875	101200875	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:101200875C>T	ENST00000341267.4	+	5	1036	c.794C>T	c.(793-795)gCc>gTc	p.A265V	DLK1_ENST00000331224.6_Intron	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	265					cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				TATGGGCTGGCCTACCGCCTG	0.637																																							uc001yhs.3		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(793-795)GCC>GTC		delta-like 1 homolog precursor							34.0	39.0	37.0					14																	101200875		2203	4298	6501	SO:0001583	missense	8788				multicellular organismal development	extracellular space|integral to membrane|soluble fraction		g.chr14:101200875C>T	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.794C>T	14.37:g.101200875C>T	ENSP00000340292:p.Ala265Val		Somatic				DLK1_uc001yhu.3_Intron	p.A265V	NM_003836	NP_003827	WXS	Illumina HiSeq	Unspecified	P80370	DLK1_HUMAN			5	947	+		Melanoma(154;0.155)	265			Extracellular (Potential).		P15803|Q96DW5	Missense_Mutation	SNP	ENST00000341267.4	37	c.794C>T	CCDS9963.1	.	.	.	.	.	.	.	.	.	.	C	9.616	1.132433	0.21041	.	.	ENSG00000185559	ENST00000341267	D	0.87179	-2.22	4.46	3.5	0.40072	.	0.879485	0.09962	N	0.733254	T	0.69940	0.3167	N	0.08118	0	0.80722	D	1	B	0.20368	0.044	B	0.19148	0.024	T	0.65578	-0.6134	9	.	.	.	.	2.7586	0.05300	0.2018:0.5284:0.1681:0.1016	.	265	P80370	DLK1_HUMAN	V	265	ENSP00000340292:A265V	.	A	+	2	0	DLK1	100270628	0.700000	0.27796	0.869000	0.34112	0.265000	0.26407	2.871000	0.48459	2.031000	0.59945	0.491000	0.48974	GCC		0.637	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1			19	47	0	0	0	0.006122	0	19	47				
MOK	5891	broad.mit.edu	37	14	102717268	102717268	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:102717268C>A	ENST00000361847.2	-	7	702	c.471G>T	c.(469-471)ccG>ccT	p.P157P	MOK_ENST00000193029.6_5'UTR|MOK_ENST00000522874.1_Silent_p.P156P|MOK_ENST00000524214.1_Silent_p.P127P	NM_014226.1	NP_055041.1	Q9UQ07	MOK_HUMAN	MOK protein kinase	157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)										ATTCCGTGTACGGCTGCTTGG	0.552																																							uc001ylm.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(469-471)CCG>CCT		MAPK/MAK/MRK overlapping kinase							82.0	84.0	84.0					14																	102717268		2203	4300	6503	SO:0001819	synonymous_variant	5891				signal transduction	Golgi apparatus	ATP binding|cyclin-dependent protein kinase activity|protein binding	g.chr14:102717268C>A	AB022694	CCDS9971.1, CCDS61552.1	14q32	2014-04-23	2011-09-06	2011-09-06	ENSG00000080823	ENSG00000080823			9833	protein-coding gene	gene with protein product		605762	"""renal tumor antigen"""	RAGE		8781117, 10421840	Standard	NM_014226		Approved	RAGE1, STK30	uc001ylm.4	Q9UQ07	OTTHUMG00000164896	ENST00000361847.2:c.471G>T	14.37:g.102717268C>A			Somatic				RAGE_uc010txv.1_Silent_p.P127P|RAGE_uc001yln.2_5'UTR	p.P157P	NM_014226	NP_055041	WXS	Illumina HiSeq	Unspecified	Q9UQ07	MOK_HUMAN			7	697	-			157			Protein kinase.		B2R6Z4|B7Z7P6|E7ER76|E7ERR8|Q92790|Q93067	Silent	SNP	ENST00000361847.2	37	c.471G>T	CCDS9971.1																																																																																				0.552	MOK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380848.3			19	124	1	0	2.89027e-11	0.002299	3.83909e-11	19	124				
AHNAK2	113146	broad.mit.edu	37	14	105412058	105412058	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:105412058G>C	ENST00000333244.5	-	7	9849	c.9730C>G	c.(9730-9732)Ccc>Gcc	p.P3244A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3244						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P3244T(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCTATCTGGGGGCCCTTGCGA	0.612																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(9730-9732)CCC>GCC		AHNAK nucleoprotein 2							131.0	94.0	106.0					14																	105412058		1872	4071	5943	SO:0001583	missense	113146					nucleus		g.chr14:105412058G>C	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9730C>G	14.37:g.105412058G>C	ENSP00000353114:p.Pro3244Ala		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.P3144A	p.P3244A	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	9850	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	3244					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.9730C>G	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	8.787	0.929600	0.18131	.	.	ENSG00000185567	ENST00000333244	T	0.02656	4.21	2.73	2.73	0.32206	.	.	.	.	.	T	0.17195	0.0413	M	0.93978	3.48	0.19775	N	0.999959	D	0.89917	1.0	D	0.91635	0.999	T	0.05683	-1.0870	9	0.49607	T	0.09	.	5.6562	0.17644	0.1563:0.0:0.8437:0.0	.	3244	Q8IVF2	AHNK2_HUMAN	A	3244	ENSP00000353114:P3244A	ENSP00000353114:P3244A	P	-	1	0	AHNAK2	104483103	0.035000	0.19736	0.009000	0.14445	0.002000	0.02628	0.000000	0.12993	1.536000	0.49237	0.313000	0.20887	CCC		0.612	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		91	145	0	0	0	0.00361	0	91	145				
AHNAK2	113146	broad.mit.edu	37	14	105420887	105420887	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:105420887C>T	ENST00000333244.5	-	7	1020	c.901G>A	c.(901-903)Gag>Aag	p.E301K	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	301						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGCTGGGCCTCTGTGTCTGTG	0.632																																							uc010axc.1		NA																	0				ovary(1)	1						c.(901-903)GAG>AAG		AHNAK nucleoprotein 2							32.0	35.0	34.0					14																	105420887		2137	4246	6383	SO:0001583	missense	113146					nucleus		g.chr14:105420887C>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.901G>A	14.37:g.105420887C>T	ENSP00000353114:p.Glu301Lys		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.E201K	p.E301K	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	1021	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	301					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.901G>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	24.9	4.577643	0.86645	.	.	ENSG00000185567	ENST00000333244	T	0.14766	2.48	5.08	5.08	0.68730	.	0.000000	0.36555	U	0.002537	T	0.33818	0.0876	L	0.59436	1.845	0.31717	N	0.638732	D	0.89917	1.0	D	0.91635	0.999	T	0.13764	-1.0497	10	0.33940	T	0.23	.	17.0127	0.86411	0.0:1.0:0.0:0.0	.	301	Q8IVF2	AHNK2_HUMAN	K	301	ENSP00000353114:E301K	ENSP00000353114:E301K	E	-	1	0	AHNAK2	104491932	0.491000	0.26019	0.939000	0.37840	0.842000	0.47809	3.969000	0.56816	2.534000	0.85438	0.650000	0.86243	GAG		0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		9	11	0	0	0	0.008291	0	9	11				
PACS2	23241	broad.mit.edu	37	14	105814896	105814896	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:105814896G>T	ENST00000325438.8	+	2	690	c.186G>T	c.(184-186)gtG>gtT	p.V62V	PACS2_ENST00000458164.2_Silent_p.V62V|PACS2_ENST00000430725.2_5'UTR|PACS2_ENST00000547217.1_Silent_p.V62V|PACS2_ENST00000447393.1_Silent_p.V62V			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	62					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		TGATCTCCGTGGTGATCGCTG	0.612																																							uc001yqt.2		NA																	0				pancreas(1)	1						c.(184-186)GTG>GTT		phosphofurin acidic cluster sorting protein 2							159.0	125.0	136.0					14																	105814896		2202	4299	6501	SO:0001819	synonymous_variant	23241				apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion		g.chr14:105814896G>T	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.186G>T	14.37:g.105814896G>T			Somatic				PACS2_uc001yqs.2_5'UTR|PACS2_uc001yqv.2_Silent_p.V62V|PACS2_uc001yqu.2_Silent_p.V62V	p.V62V	NM_015197	NP_056012	WXS	Illumina HiSeq	Unspecified	Q86VP3	PACS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)	2	361	+		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	62					A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Silent	SNP	ENST00000325438.8	37	c.186G>T	CCDS32168.1																																																																																				0.612	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355		23	74	1	0	2.89027e-11	0.002299	3.83909e-11	23	74				
DISP2	85455	broad.mit.edu	37	15	40659393	40659393	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:40659393C>T	ENST00000267889.3	+	8	1167	c.1080C>T	c.(1078-1080)gaC>gaT	p.D360D	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	360					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CCCAAGCTGACGCAGCCCGCA	0.642																																							uc001zlk.1		NA																	0				ovary(2)	2						c.(1078-1080)GAC>GAT		dispatched B							112.0	104.0	107.0					15																	40659393		2203	4300	6503	SO:0001819	synonymous_variant	85455				smoothened signaling pathway	integral to membrane		g.chr15:40659393C>T	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.1080C>T	15.37:g.40659393C>T			Somatic					p.D360D	NM_033510	NP_277045	WXS	Illumina HiSeq	Unspecified	A7MBM2	DISP2_HUMAN		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)	8	1169	+		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	360					Q6AHW3|Q9C0C1	Silent	SNP	ENST00000267889.3	37	c.1080C>T	CCDS10056.1																																																																																				0.642	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510		20	91	0	0	0	0.008871	0	20	91				
LTK	4058	broad.mit.edu	37	15	41796779	41796779	+	Missense_Mutation	SNP	C	C	T	rs199935291		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:41796779C>T	ENST00000263800.6	-	18	2276	c.2180G>A	c.(2179-2181)cGc>cAc	p.R727H	LTK_ENST00000453182.2_Missense_Mutation_p.R597H|LTK_ENST00000561619.1_Missense_Mutation_p.R425H|LTK_ENST00000355166.5_Missense_Mutation_p.R666H	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	727	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CTGGTTGGTGCGCCCAGGATA	0.627										TSP Lung(18;0.14)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18363	0.0		0.0	False		,,,				2504	0.001						uc001zoa.3		NA																	0				lung(6)|central_nervous_system(1)	7						c.(2179-2181)CGC>CAC		leukocyte receptor tyrosine kinase isoform 1		C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	68.0	72.0	70.0		1790,2180,1997	-1.0	0.0	15		70	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense	LTK	NM_001135685.1,NM_002344.5,NM_206961.3	29,29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign	597/735,727/865,666/804	41796779	2,13004	2203	4300	6503	SO:0001583	missense	4058				apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:41796779C>T	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.2180G>A	15.37:g.41796779C>T	ENSP00000263800:p.Arg727His	TSP Lung(18;0.14)	Somatic				LTK_uc001zob.3_Missense_Mutation_p.R666H|LTK_uc010ucx.1_Missense_Mutation_p.R597H|LTK_uc010bcg.2_Missense_Mutation_p.R425H	p.R727H	NM_002344	NP_002335	WXS	Illumina HiSeq	Unspecified	P29376	LTK_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)	18	2358	-		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)	727			Protein kinase.|Cytoplasmic (Potential).		A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	ENST00000263800.6	37	c.2180G>A	CCDS10077.1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816369	0.32145	0.0	2.33E-4	ENSG00000062524	ENST00000355166;ENST00000263800;ENST00000453182	D;D;D	0.82526	-1.62;-1.62;-1.62	4.43	-1.04	0.10068	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.512387	0.14560	N	0.312085	T	0.71584	0.3357	L	0.48877	1.53	0.09310	N	1	B;B;B;B	0.24533	0.048;0.009;0.085;0.105	B;B;B;B	0.24269	0.021;0.005;0.014;0.052	T	0.57207	-0.7851	10	0.37606	T	0.19	.	3.4548	0.07511	0.2932:0.2811:0.0:0.4257	.	597;597;666;727	E9PFX4;B4DL89;P29376-4;P29376	.;.;.;LTK_HUMAN	H	666;727;597	ENSP00000347293:R666H;ENSP00000263800:R727H;ENSP00000392196:R597H	ENSP00000263800:R727H	R	-	2	0	LTK	39584071	0.001000	0.12720	0.006000	0.13384	0.966000	0.64601	0.073000	0.14640	-0.407000	0.07576	0.655000	0.94253	CGC		0.627	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2			23	89	0	0	0	0.001882	0	23	89				
UNC13C	440279	broad.mit.edu	37	15	54305743	54305743	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:54305743G>T	ENST00000260323.11	+	1	643	c.643G>T	c.(643-645)Gac>Tac	p.D215Y	UNC13C_ENST00000537900.1_Missense_Mutation_p.D215Y|UNC13C_ENST00000545554.1_Missense_Mutation_p.D215Y	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	215					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TAAGTCTTTGGACAGAACTGT	0.423																																							uc002ack.2		NA																	0				ovary(5)|pancreas(2)	7						c.(643-645)GAC>TAC		unc-13 homolog C							85.0	85.0	85.0					15																	54305743		1855	4094	5949	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54305743G>T	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.643G>T	15.37:g.54305743G>T	ENSP00000260323:p.Asp215Tyr		Somatic					p.D215Y	NM_001080534	NP_001074003	WXS	Illumina HiSeq	Unspecified	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	1	643	+			215					Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.643G>T	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490519	0.64074	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.86497	-2.12;-2.13;-2.12	4.97	4.97	0.65823	.	.	.	.	.	D	0.88973	0.6583	L	0.27053	0.805	0.53005	D	0.999968	D	0.89917	1.0	D	0.65573	0.936	D	0.90846	0.4727	9	0.87932	D	0	.	17.243	0.87019	0.0:0.0:1.0:0.0	.	215	Q8NB66	UN13C_HUMAN	Y	215	ENSP00000260323:D215Y;ENSP00000438156:D215Y;ENSP00000442569:D215Y	ENSP00000260323:D215Y	D	+	1	0	UNC13C	52093035	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.785000	0.99042	2.281000	0.76405	0.650000	0.86243	GAC		0.423	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		50	57	1	0	9.90819e-18	0.00361	1.4397e-17	50	57				
CGNL1	84952	broad.mit.edu	37	15	57734609	57734609	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:57734609A>G	ENST00000281282.5	+	4	1814	c.1736A>G	c.(1735-1737)aAc>aGc	p.N579S		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	579						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AGGAAAGTCAACTTGGTCTTT	0.408																																							uc002aeg.2		NA																	0				skin(6)|ovary(4)|central_nervous_system(1)	11						c.(1735-1737)AAC>AGC		cingulin-like 1							97.0	91.0	93.0					15																	57734609		2192	4292	6484	SO:0001583	missense	84952					myosin complex|tight junction	motor activity	g.chr15:57734609A>G	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.1736A>G	15.37:g.57734609A>G	ENSP00000281282:p.Asn579Ser		Somatic				CGNL1_uc010bfw.2_Missense_Mutation_p.N579S	p.N579S	NM_032866	NP_116255	WXS	Illumina HiSeq	Unspecified	Q0VF96	CGNL1_HUMAN		all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)	4	1812	+			579					Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	37	c.1736A>G	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	A	18.80	3.700681	0.68501	.	.	ENSG00000128849	ENST00000281282	T	0.40476	1.03	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000012	T	0.35941	0.0949	L	0.35593	1.075	0.51767	D	0.999939	P	0.34662	0.462	B	0.35278	0.199	T	0.19289	-1.0310	10	0.46703	T	0.11	-25.5122	15.5325	0.75974	1.0:0.0:0.0:0.0	.	579	Q0VF96	CGNL1_HUMAN	S	579	ENSP00000281282:N579S	ENSP00000281282:N579S	N	+	2	0	CGNL1	55521901	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.617000	0.90927	2.065000	0.61736	0.455000	0.32223	AAC		0.408	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866		16	47	0	0	0	0.004007	0	16	47				
DENND4A	10260	broad.mit.edu	37	15	66034066	66034066	+	Silent	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:66034066T>C	ENST00000431932.2	-	5	826	c.618A>G	c.(616-618)gtA>gtG	p.V206V	DENND4A_ENST00000443035.3_Silent_p.V206V	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	206	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						CTTTGTAAGATACAGTGTTCG	0.318																																							uc002aph.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(616-618)GTA>GTG		DENN/MADD domain containing 4A isoform 2							109.0	102.0	104.0					15																	66034066		1819	4074	5893	SO:0001819	synonymous_variant	10260				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding	g.chr15:66034066T>C	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.618A>G	15.37:g.66034066T>C			Somatic				DENND4A_uc002api.2_Silent_p.V206V|DENND4A_uc002apj.3_Silent_p.V206V|DENND4A_uc010ujj.1_Silent_p.V206V	p.V206V	NM_005848	NP_005839	WXS	Illumina HiSeq	Unspecified	Q7Z401	MYCPP_HUMAN			5	996	-			206			UDENN.		E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	37	c.618A>G	CCDS45285.1																																																																																				0.318	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848		8	43	0	0	0	0.00308	0	8	43				
LARP6	55323	broad.mit.edu	37	15	71124472	71124472	+	Silent	SNP	G	G	T	rs150993636		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:71124472G>T	ENST00000299213.8	-	3	1465	c.1395C>A	c.(1393-1395)ccC>ccA	p.P465P	RP11-138H8.7_ENST00000592096.1_lincRNA	NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	465					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						GCACCCCTACGGGTAGCCCAT	0.577																																							uc002ass.2		NA																	0					0						c.(1393-1395)CCC>CCA		La ribonucleoprotein domain family, member 6							90.0	93.0	92.0					15																	71124472		2199	4297	6496	SO:0001819	synonymous_variant	55323				RNA processing	Golgi apparatus|nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding	g.chr15:71124472G>T	BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.1395C>A	15.37:g.71124472G>T			Somatic					p.P465P	NM_018357	NP_060827	WXS	Illumina HiSeq	Unspecified	Q9BRS8	LARP6_HUMAN			3	1466	-			465					Q5XKE4|Q8N3N2|Q9NUR0	Silent	SNP	ENST00000299213.8	37	c.1395C>A	CCDS32281.1																																																																																				0.577	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417197.2	NM_018357		33	98	1	0	1.06647e-15	0.003755	1.51612e-15	33	98				
TMC3	342125	broad.mit.edu	37	15	81624961	81624961	+	Missense_Mutation	SNP	G	G	T	rs115607037	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:81624961G>T	ENST00000359440.5	-	22	3237	c.3102C>A	c.(3100-3102)ttC>ttA	p.F1034L	RP11-761I4.3_ENST00000559781.1_RNA|RP11-761I4.3_ENST00000560851.1_RNA|RP11-761I4.3_ENST00000560973.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.F1035L	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3									p.F1038F(1)		autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						GGGATGGCTCGAACCTGGGCT	0.607													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17581	0.0		0.0	False		,,,				2504	0.0						uc002bgo.1		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(1)|liver(1)	2						c.(3100-3102)TTC>TTA		transmembrane channel-like 3		G	LEU/PHE	1,4233		0,1,2116	42.0	50.0	47.0		3102	-9.8	0.0	15	dbSNP_132	47	0,8462		0,0,4231	no	missense	TMC3	NM_001080532.1	22	0,1,6347	TT,TG,GG		0.0,0.0236,0.0079	benign	1034/1101	81624961	1,12695	2117	4231	6348	SO:0001583	missense	342125					integral to membrane		g.chr15:81624961G>T	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.3102C>A	15.37:g.81624961G>T	ENSP00000352413:p.Phe1034Leu		Somatic				TMC3_uc010blr.1_RNA	p.F1034L	NM_001080532	NP_001074001	WXS	Illumina HiSeq	Unspecified	Q7Z5M5	TMC3_HUMAN			22	3102	-			1034			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000359440.5	37	c.3102C>A	CCDS45324.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	0.144	-1.099129	0.01843	2.36E-4	0.0	ENSG00000188869	ENST00000359440	T	0.58652	0.32	4.89	-9.79	0.00494	.	0.806152	0.10118	U	0.713728	T	0.24509	0.0594	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16897	-1.0387	10	0.02654	T	1	-0.0148	10.108	0.42546	0.2363:0.1579:0.5459:0.0599	.	1034	Q7Z5M5	TMC3_HUMAN	L	1034	ENSP00000352413:F1034L	ENSP00000352413:F1034L	F	-	3	2	TMC3	79412016	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.974000	0.00666	-3.605000	0.00133	-2.048000	0.00412	TTC		0.607	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841		12	22	1	0	2.68362e-12	0.001368	3.676e-12	12	22				
ADAMTSL3	57188	broad.mit.edu	37	15	84659957	84659957	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:84659957C>A	ENST00000286744.5	+	23	4188	c.3964C>A	c.(3964-3966)Cct>Act	p.P1322T	AC027807.1_ENST00000408557.1_RNA|ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.P1322T	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1322	Ig-like C2-type 3.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AATCCGATGTCCTGTAAAAGG	0.502																																							uc002bjz.3		NA																	0				ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27						c.(3964-3966)CCT>ACT		ADAMTS-like 3 precursor							222.0	203.0	209.0					15																	84659957		2203	4299	6502	SO:0001583	missense	57188					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr15:84659957C>A	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3964C>A	15.37:g.84659957C>A	ENSP00000286744:p.Pro1322Thr		Somatic				ADAMTSL3_uc010bmt.1_Missense_Mutation_p.P1322T|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.P1322T	p.P1322T	NM_207517	NP_997400	WXS	Illumina HiSeq	Unspecified	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		23	4188	+			1322			Ig-like C2-type 3.		A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	c.3964C>A	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.777089	0.70107	.	.	ENSG00000156218	ENST00000286744	T	0.63580	-0.05	5.21	5.21	0.72293	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.318216	0.18167	N	0.149597	T	0.70316	0.3210	N	0.25060	0.705	0.53005	D	0.999968	D;D	0.89917	0.999;1.0	D;D	0.91635	0.994;0.999	T	0.74441	-0.3664	10	0.72032	D	0.01	.	18.774	0.91902	0.0:1.0:0.0:0.0	.	1322;1322	P82987-2;P82987	.;ATL3_HUMAN	T	1322	ENSP00000286744:P1322T	ENSP00000286744:P1322T	P	+	1	0	ADAMTSL3	82450961	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	4.378000	0.59568	2.415000	0.81967	0.561000	0.74099	CCT		0.502	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		106	106	1	0	1.48543e-65	0.00361	2.45703e-65	106	106				
NTRK3	4916	broad.mit.edu	37	15	88669511	88669511	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:88669511C>A	ENST00000360948.2	-	12	1548	c.1387G>T	c.(1387-1389)Gga>Tga	p.G463*	NTRK3_ENST00000394480.2_Nonsense_Mutation_p.G463*|NTRK3_ENST00000355254.2_Nonsense_Mutation_p.G463*|NTRK3_ENST00000557856.1_Nonsense_Mutation_p.G455*|NTRK3_ENST00000558676.1_Nonsense_Mutation_p.G455*|NTRK3_ENST00000357724.2_Nonsense_Mutation_p.G455*|NTRK3_ENST00000317501.3_Nonsense_Mutation_p.G463*|NTRK3_ENST00000558306.1_Intron|NTRK3_ENST00000542733.2_Nonsense_Mutation_p.G365*|NTRK3_ENST00000540489.2_Nonsense_Mutation_p.G463*	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	463					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CCCTTCATTCCAAATTTGGAC	0.443			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	0				soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(1387-1389)GGA>TGA		neurotrophic tyrosine kinase, receptor, type 3							105.0	91.0	96.0					15																	88669511		2201	4299	6500	SO:0001587	stop_gained	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88669511C>A	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1387G>T	15.37:g.88669511C>A	ENSP00000354207:p.Gly463*	TSP Lung(13;0.10)	Somatic				NTRK3_uc002bmh.2_Nonsense_Mutation_p.G455*|NTRK3_uc002bmf.1_Nonsense_Mutation_p.G463*|NTRK3_uc010upl.1_Nonsense_Mutation_p.G365*|NTRK3_uc010bnh.1_Nonsense_Mutation_p.G455*|NTRK3_uc002bmg.2_Nonsense_Mutation_p.G463*	p.G463*	NM_001012338	NP_001012338	WXS	Illumina HiSeq	Unspecified	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		12	1549	-			463			Cytoplasmic (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Nonsense_Mutation	SNP	ENST00000360948.2	37	c.1387G>T	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	42	9.491864	0.99186	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	.	.	.	5.39	4.46	0.54185	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.5473	0.68041	0.1472:0.8528:0.0:0.0	.	.	.	.	X	463;463;455;463;365;463;463	.	ENSP00000318328:G463X	G	-	1	0	NTRK3	86470515	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.829000	0.69316	1.252000	0.44001	0.655000	0.94253	GGA		0.443	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				11	31	1	0	5.50884e-06	0.001368	6.35449e-06	11	31				
UNC45A	55898	broad.mit.edu	37	15	91490084	91490084	+	Silent	SNP	G	G	T	rs146865609	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr15:91490084G>T	ENST00000418476.2	+	10	1480	c.1440G>T	c.(1438-1440)tcG>tcT	p.S480S	UNC45A_ENST00000394275.2_Silent_p.S465S	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	480					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			ATGGTGTCTCGCTGCTGAAGG	0.632																																							uc002bqg.2		NA																	0				ovary(2)	2						c.(1438-1440)TCG>TCT		smooth muscle cell associated protein-1 isoform							94.0	84.0	88.0					15																	91490084		2198	4298	6496	SO:0001819	synonymous_variant	55898				cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding	g.chr15:91490084G>T		CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.1440G>T	15.37:g.91490084G>T			Somatic				UNC45A_uc002bqd.2_Silent_p.S465S|UNC45A_uc010uqr.1_5'Flank|UNC45A_uc002bqi.2_5'Flank	p.S480S	NM_018671	NP_061141	WXS	Illumina HiSeq	Unspecified	Q9H3U1	UN45A_HUMAN	Lung(145;0.189)		10	1780	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		480					A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Silent	SNP	ENST00000418476.2	37	c.1440G>T	CCDS10367.1																																																																																				0.632	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671		62	43	1	0	3.07184e-27	0.00361	4.80889e-27	62	43				
RGS11	8786	broad.mit.edu	37	16	321439	321439	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:321439C>A	ENST00000397770.3	-	11	725	c.708G>T	c.(706-708)gcG>gcT	p.A236A	RGS11_ENST00000359740.5_Silent_p.A225A|ARHGDIG_ENST00000464609.1_Intron|RGS11_ENST00000316163.5_Silent_p.A215A			O94810	RGS11_HUMAN	regulator of G-protein signaling 11	236	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)	8		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				TCCTGCCCAGCGCTTTCCTGA	0.647																																							uc002cgj.1		NA																	0				lung(1)|pancreas(1)	2						c.(706-708)GCG>GCT		regulator of G-protein signalling 11 isoform 1							80.0	75.0	77.0					16																	321439		2203	4300	6503	SO:0001819	synonymous_variant	8786				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity	g.chr16:321439C>A	AF035153	CCDS10403.1, CCDS42088.1, CCDS66884.1	16p13.3	2008-07-28	2007-08-14		ENSG00000076344	ENSG00000076344		"""Regulators of G-protein signaling"""	9993	protein-coding gene	gene with protein product		603895	"""regulator of G-protein signalling 11"""			9789084	Standard	NM_001286486		Approved		uc002cgj.1	O94810	OTTHUMG00000064893	ENST00000397770.3:c.708G>T	16.37:g.321439C>A			Somatic				RGS11_uc002cgi.1_Silent_p.A215A|RGS11_uc010bqs.1_Silent_p.A225A|RGS11_uc002cgk.1_Silent_p.A52A	p.A236A	NM_183337	NP_899180	WXS	Illumina HiSeq	Unspecified	O94810	RGS11_HUMAN			11	711	-		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)	236			G protein gamma.		O75883|Q4TT71|Q4TT72	Silent	SNP	ENST00000397770.3	37	c.708G>T	CCDS42088.1																																																																																				0.647	RGS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139325.2			14	45	1	0	2.23348e-06	0.004007	2.61069e-06	14	45				
RPL3L	6123	broad.mit.edu	37	16	1994846	1994846	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:1994846C>A	ENST00000268661.7	-	10	1310	c.1216G>T	c.(1216-1218)Gac>Tac	p.D406Y	MSRB1_ENST00000399753.2_5'Flank|MSRB1_ENST00000361871.3_5'Flank|MSRB1_ENST00000489198.1_5'Flank|MSRB1_ENST00000564908.1_5'Flank	NM_005061.2	NP_005052.1	Q92901	RL3L_HUMAN	ribosomal protein L3-like	406					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|ribosome (GO:0005840)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	17						GCCTACAAGTCTCCCGAGGTC	0.592																																							uc002cnh.2		NA																	0					0						c.(1216-1218)GAC>TAC		ribosomal protein L3-like							158.0	162.0	161.0					16																	1994846		2199	4300	6499	SO:0001583	missense	6123				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome	g.chr16:1994846C>A	U65581	CCDS10450.1	16p13.3	2008-02-05			ENSG00000140986	ENSG00000140986		"""L ribosomal proteins"""	10351	protein-coding gene	gene with protein product						8921388	Standard	NM_005061		Approved		uc002cnh.3	Q92901	OTTHUMG00000128685	ENST00000268661.7:c.1216G>T	16.37:g.1994846C>A	ENSP00000268661:p.Asp406Tyr		Somatic				SEPX1_uc010uvs.1_5'Flank	p.D406Y	NM_005061	NP_005052	WXS	Illumina HiSeq	Unspecified	Q92901	RL3L_HUMAN			10	1263	-			406						Missense_Mutation	SNP	ENST00000268661.7	37	c.1216G>T	CCDS10450.1	.	.	.	.	.	.	.	.	.	.	C	9.543	1.113767	0.20795	.	.	ENSG00000140986	ENST00000268661	T	0.31247	1.5	4.49	3.52	0.40303	.	0.229428	0.35151	N	0.003406	T	0.15565	0.0375	N	0.08118	0	0.32631	N	0.521949	P	0.45531	0.86	B	0.38880	0.284	T	0.17410	-1.0370	10	0.72032	D	0.01	-21.1141	10.97	0.47434	0.0:0.9065:0.0:0.0935	.	406	Q92901	RL3L_HUMAN	Y	406	ENSP00000268661:D406Y	ENSP00000268661:D406Y	D	-	1	0	RPL3L	1934847	0.997000	0.39634	0.981000	0.43875	0.363000	0.29612	3.324000	0.52022	0.994000	0.38892	0.462000	0.41574	GAC		0.592	RPL3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250582.2	NM_005061		46	150	1	0	3.19069e-20	0.00361	4.75439e-20	46	150				
PPL	5493	broad.mit.edu	37	16	4941886	4941886	+	Nonsense_Mutation	SNP	C	C	A	rs139811413		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:4941886C>A	ENST00000345988.2	-	16	1983	c.1894G>T	c.(1894-1896)Gag>Tag	p.E632*	PPL_ENST00000590782.2_Nonsense_Mutation_p.E630*	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	632					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						AGATGGTTCTCGTGTGTGGCC	0.622																																							uc002cyd.1		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1894-1896)GAG>TAG		periplakin							107.0	101.0	103.0					16																	4941886		2197	4300	6497	SO:0001587	stop_gained	5493				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton	g.chr16:4941886C>A	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.1894G>T	16.37:g.4941886C>A	ENSP00000340510:p.Glu632*		Somatic					p.E632*	NM_002705	NP_002696	WXS	Illumina HiSeq	Unspecified	O60437	PEPL_HUMAN			16	1984	-			632			Potential.		O60314|O60454|Q14C98	Nonsense_Mutation	SNP	ENST00000345988.2	37	c.1894G>T	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	C	32	5.149412	0.94645	.	.	ENSG00000118898	ENST00000345988	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.0728	0.93147	0.0:1.0:0.0:0.0	.	.	.	.	X	632	.	ENSP00000340510:E632X	E	-	1	0	PPL	4881887	1.000000	0.71417	0.745000	0.31077	0.035000	0.12851	5.433000	0.66520	2.519000	0.84933	0.549000	0.68633	GAG		0.622	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705		6	137	1	0	0.00198382	0.001984	0.00211661	6	137				
RBFOX1	54715	broad.mit.edu	37	16	7680687	7680687	+	Splice_Site	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:7680687T>A	ENST00000550418.1	+	11	1745		c.e11+2		RBFOX1_ENST00000422070.4_Splice_Site|RBFOX1_ENST00000355637.4_Splice_Site|RBFOX1_ENST00000535565.2_Splice_Site|RBFOX1_ENST00000547372.1_Splice_Site|RBFOX1_ENST00000552089.1_Splice_Site|RBFOX1_ENST00000436368.2_Splice_Site|RBFOX1_ENST00000311745.5_Splice_Site|RBFOX1_ENST00000340209.4_Splice_Site|RBFOX1_ENST00000547338.1_Splice_Site|RBFOX1_ENST00000553186.1_Intron	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1						mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CTTCTGCAAGTAAGCCCACTG	0.517																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	0					0						c.e11+2		ataxin 2-binding protein 1 isoform 4							164.0	139.0	147.0					16																	7680687		2197	4300	6497	SO:0001630	splice_region_variant	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7680687T>A	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.757+2T>A	16.37:g.7680687T>A			Somatic				A2BP1_uc010buf.1_Splice_Site_p.M253_splice|A2BP1_uc002cyr.1_Splice_Site_p.M252_splice|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Splice_Site_p.M296_splice|A2BP1_uc010uya.1_Splice_Site_p.M210_splice|A2BP1_uc002cyv.1_Splice_Site_p.M253_splice|A2BP1_uc010uyb.1_Splice_Site_p.M253_splice|A2BP1_uc002cyw.2_Splice_Site_p.M273_splice|A2BP1_uc002cyy.2_Splice_Site_p.M273_splice|A2BP1_uc002cyx.2_Splice_Site_p.M273_splice|A2BP1_uc010uyc.1_Intron	p.M253_splice	NM_018723	NP_061193	WXS	Illumina HiSeq	Unspecified	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	11	1745	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)						Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Splice_Site	SNP	ENST00000550418.1	37	c.757_splice	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.953578	0.73902	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000340209	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1535	0.59503	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBFOX1	7620688	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.696000	0.61774	1.845000	0.53610	0.528000	0.53228	.		0.517	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	Intron	6	38	0	0	0	0.001168	0	6	38				
GRIN2A	2903	broad.mit.edu	37	16	9858403	9858403	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:9858403C>T	ENST00000396573.2	-	14	3307	c.2998G>A	c.(2998-3000)Gtg>Atg	p.V1000M	GRIN2A_ENST00000330684.3_Missense_Mutation_p.V1000M|GRIN2A_ENST00000404927.2_Missense_Mutation_p.V1000M|GRIN2A_ENST00000396575.2_Missense_Mutation_p.V1000M|GRIN2A_ENST00000535259.1_Missense_Mutation_p.V843M|GRIN2A_ENST00000562109.1_Missense_Mutation_p.V1000M	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1000					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCTGTGCTCACGGCCACCTCC	0.512																																							uc002czo.3		NA																	0				skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(2998-3000)GTG>ATG		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						97.0	92.0	94.0					16																	9858403		2197	4300	6497	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9858403C>T		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2998G>A	16.37:g.9858403C>T	ENSP00000379818:p.Val1000Met		Somatic				GRIN2A_uc010uym.1_Missense_Mutation_p.V1000M|GRIN2A_uc010uyn.1_Missense_Mutation_p.V843M|GRIN2A_uc002czr.3_Missense_Mutation_p.V1000M	p.V1000M	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			13	3546	-			1000			Cytoplasmic (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.2998G>A	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573505	0.65765	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.12774	2.66;2.65;2.66;2.66;2.66	5.33	5.33	0.75918	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.175656	0.49916	D	0.000121	T	0.37320	0.0999	M	0.65975	2.015	0.58432	D	0.999999	D;D;D	0.89917	0.993;0.995;1.0	P;P;D	0.87578	0.71;0.862;0.998	T	0.02942	-1.1091	9	.	.	.	.	18.0263	0.89270	0.0:1.0:0.0:0.0	.	843;1000;1000	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	M	1000;1000;843;1000;1000	ENSP00000379818:V1000M;ENSP00000385872:V1000M;ENSP00000441572:V843M;ENSP00000332549:V1000M;ENSP00000379820:V1000M	.	V	-	1	0	GRIN2A	9765904	1.000000	0.71417	0.986000	0.45419	0.957000	0.61999	5.669000	0.68081	2.491000	0.84063	0.655000	0.94253	GTG		0.512	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			17	77	0	0	0	0.004007	0	17	77				
PARN	5073	broad.mit.edu	37	16	14540779	14540779	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:14540779T>A	ENST00000437198.2	-	23	1971	c.1830A>T	c.(1828-1830)aaA>aaT	p.K610N	PARN_ENST00000420015.2_Missense_Mutation_p.K564N|PARN_ENST00000341484.7_Missense_Mutation_p.K549N|PARN_ENST00000539279.1_Missense_Mutation_p.K435N	NM_001134477.2|NM_002582.3	NP_001127949.1|NP_002573.1	O95453	PARN_HUMAN	poly(A)-specific ribonuclease	610					female gamete generation (GO:0007292)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA metabolic process (GO:0016070)|RNA modification (GO:0009451)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|nuclease activity (GO:0004518)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(A)-specific ribonuclease activity (GO:0004535)|protein kinase binding (GO:0019901)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|urinary_tract(1)	21						TTCTTTTTAATTTCTTGGCCT	0.488																																							uc010uzd.1		NA																	0				ovary(2)	2						c.(1828-1830)AAA>AAT		poly(A)-specific ribonuclease (deadenylation							126.0	121.0	123.0					16																	14540779		1835	4082	5917	SO:0001583	missense	5073				female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding	g.chr16:14540779T>A	AJ005698	CCDS45419.1, CCDS45420.1, CCDS58425.1	16p13	2014-08-08	2011-07-07		ENSG00000140694	ENSG00000140694	3.1.13.4		8609	protein-coding gene	gene with protein product	"""deadenylation nuclease"""	604212	"""poly(A)-specific ribonuclease (deadenylation nuclease)"""			10640832	Standard	NM_002582		Approved	DAN	uc010uzd.2	O95453	OTTHUMG00000173199	ENST00000437198.2:c.1830A>T	16.37:g.14540779T>A	ENSP00000387911:p.Lys610Asn		Somatic				PARN_uc010uzc.1_Missense_Mutation_p.K549N|PARN_uc010uze.1_Missense_Mutation_p.K564N|PARN_uc010uzf.1_Missense_Mutation_p.K435N	p.K610N	NM_002582	NP_002573	WXS	Illumina HiSeq	Unspecified	O95453	PARN_HUMAN			23	1972	-			610					B2RCB3|B4DDG8|B4DWR4|B4E1H6	Missense_Mutation	SNP	ENST00000437198.2	37	c.1830A>T	CCDS45419.1	.	.	.	.	.	.	.	.	.	.	T	13.52	2.260579	0.39995	.	.	ENSG00000140694	ENST00000437198;ENST00000341484;ENST00000420015;ENST00000539279	.	.	.	5.52	1.99	0.26369	.	0.324453	0.35067	N	0.003468	T	0.20333	0.0489	N	0.14661	0.345	0.28237	N	0.925877	B;B;B	0.10296	0.001;0.003;0.003	B;B;B	0.06405	0.002;0.002;0.002	T	0.09596	-1.0667	9	0.35671	T	0.21	-11.03	3.4479	0.07487	0.1626:0.2691:0.0:0.5683	.	435;564;610	B4DSB0;B4DWR4;O95453	.;.;PARN_HUMAN	N	610;549;564;435	.	ENSP00000345456:K549N	K	-	3	2	PARN	14448280	0.927000	0.31430	0.975000	0.42487	0.997000	0.91878	0.056000	0.14256	0.131000	0.18576	0.533000	0.62120	AAA		0.488	PARN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422383.1	NM_002582		17	73	0	0	0	0.007413	0	17	73				
XYLT1	64131	broad.mit.edu	37	16	17228333	17228333	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:17228333C>G	ENST00000261381.6	-	9	2108	c.2024G>C	c.(2023-2025)tGc>tCc	p.C675S	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	675					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGCTCACCGGCAGCTGTTCTC	0.607																																							uc002dfa.2		NA																	0				ovary(4)	4						c.(2023-2025)TGC>TCC		xylosyltransferase I							53.0	50.0	51.0					16																	17228333		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17228333C>G	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2024G>C	16.37:g.17228333C>G	ENSP00000261381:p.Cys675Ser		Somatic					p.C675S	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			9	2109	-			675	C->A: No effect.		Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.2024G>C	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159497	0.94686	.	.	ENSG00000103489	ENST00000261381	T	0.49139	0.79	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.66277	0.2773	M	0.75264	2.295	0.80722	D	1	D	0.54964	0.969	P	0.58077	0.832	T	0.70015	-0.4988	10	0.72032	D	0.01	.	18.2461	0.89986	0.0:1.0:0.0:0.0	.	675	Q86Y38	XYLT1_HUMAN	S	675	ENSP00000261381:C675S	ENSP00000261381:C675S	C	-	2	0	XYLT1	17135834	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.711000	0.84669	2.545000	0.85829	0.561000	0.74099	TGC		0.607	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		16	62	0	0	0	0.004007	0	16	62				
SMG1	23049	broad.mit.edu	37	16	18847769	18847769	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:18847769T>C	ENST00000446231.2	-	47	8102	c.7690A>G	c.(7690-7692)Ata>Gta	p.I2564V	SMG1_ENST00000389467.3_Missense_Mutation_p.I2564V			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2564					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TAATGTGTTATCCATTGTTCA	0.428																																							uc002dfm.2		NA																	0				breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						c.(7690-7692)ATA>GTA		PI-3-kinase-related kinase SMG-1							168.0	155.0	159.0					16																	18847769		1895	4133	6028	SO:0001583	missense	23049				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr16:18847769T>C	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.7690A>G	16.37:g.18847769T>C	ENSP00000402515:p.Ile2564Val		Somatic				SMG1_uc010bwb.2_Missense_Mutation_p.I2424V|SMG1_uc010bwa.2_Missense_Mutation_p.I1295V	p.I2564V	NM_015092	NP_055907	WXS	Illumina HiSeq	Unspecified	Q96Q15	SMG1_HUMAN			47	8053	-			2564					O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	c.7690A>G	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	T	15.28	2.785601	0.49997	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01145	5.27;5.27	6.17	6.17	0.99709	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.01454	0.0047	N	0.24115	0.695	0.45676	D	0.99859	P	0.41947	0.766	B	0.39935	0.314	T	0.75216	-0.3396	10	0.44086	T	0.13	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	2564	Q96Q15	SMG1_HUMAN	V	2564	ENSP00000402515:I2564V;ENSP00000374118:I2564V	ENSP00000374118:I2564V	I	-	1	0	SMG1	18755270	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.981000	0.88123	2.371000	0.80710	0.533000	0.62120	ATA		0.428	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092		20	57	0	0	0	0.008871	0	20	57				
GP2	2813	broad.mit.edu	37	16	20335184	20335184	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:20335184C>A	ENST00000381362.4	-	3	565	c.489G>T	c.(487-489)gtG>gtT	p.V163V	GP2_ENST00000341642.5_Intron|GP2_ENST00000302555.5_Silent_p.V163V|GP2_ENST00000573897.1_5'Flank|GP2_ENST00000381360.5_Intron	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	163					antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CCAACCGGTACACATGGTACC	0.572																																							uc002dgv.2		NA																	0				ovary(3)|skin(1)	4						c.(487-489)GTG>GTT		zymogen granule membrane glycoprotein 2 isoform							34.0	31.0	32.0					16																	20335184		2203	4300	6503	SO:0001819	synonymous_variant	2813					anchored to membrane|extracellular region|plasma membrane		g.chr16:20335184C>A	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.489G>T	16.37:g.20335184C>A			Somatic				GP2_uc002dgw.2_Silent_p.V163V|GP2_uc002dgx.2_Intron|GP2_uc002dgy.2_Intron	p.V163V	NM_001007240	NP_001007241	WXS	Illumina HiSeq	Unspecified	P55259	GP2_HUMAN			3	572	-			163					A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	ENST00000381362.4	37	c.489G>T	CCDS42128.1																																																																																				0.572	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295		4	16	1	0	0.00909568	0.009096	0.00956866	4	16				
DNAH3	55567	broad.mit.edu	37	16	20974768	20974768	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:20974768G>A	ENST00000261383.3	-	53	10437	c.10438C>T	c.(10438-10440)Cgg>Tgg	p.R3480W	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3480					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTGTCAGGCCGCAAACATCGA	0.522																																							uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(10438-10440)CGG>TGG		dynein, axonemal, heavy chain 3							95.0	80.0	85.0					16																	20974768		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:20974768G>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10438C>T	16.37:g.20974768G>A	ENSP00000261383:p.Arg3480Trp		Somatic				DNAH3_uc010vbd.1_Missense_Mutation_p.R915W	p.R3480W	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	53	10438	-			3480					O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.10438C>T	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506991	0.44558	.	.	ENSG00000158486	ENST00000261383	T	0.19105	2.17	5.39	3.33	0.38152	Dynein heavy chain (1);	0.000000	0.64402	D	0.000001	T	0.65729	0.2719	H	0.99545	4.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82713	-0.0321	10	0.87932	D	0	.	14.916	0.70798	0.0:0.0:0.5091:0.4909	.	3480	Q8TD57	DYH3_HUMAN	W	3480	ENSP00000261383:R3480W	ENSP00000261383:R3480W	R	-	1	2	DNAH3	20882269	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	2.614000	0.46359	1.250000	0.43966	-0.311000	0.09066	CGG		0.522	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		7	49	0	0	0	0.001984	0	7	49				
ARHGAP17	55114	broad.mit.edu	37	16	24931498	24931498	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:24931498G>C	ENST00000289968.6	-	20	2668	c.2599C>G	c.(2599-2601)Cgc>Ggc	p.R867G	ARHGAP17_ENST00000303665.5_Missense_Mutation_p.R789G|ARHGAP17_ENST00000441763.2_3'UTR	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	867					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		AGCAGGATGCGGCCAGGCACG	0.552																																							uc002dnb.2		NA																	0					0						c.(2599-2601)CGC>GGC		nadrin isoform 1							178.0	166.0	170.0					16																	24931498		2197	4300	6497	SO:0001583	missense	55114				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding	g.chr16:24931498G>C	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.2599C>G	16.37:g.24931498G>C	ENSP00000289968:p.Arg867Gly		Somatic				ARHGAP17_uc002dmx.2_3'UTR|ARHGAP17_uc002dmw.2_3'UTR|ARHGAP17_uc002dmy.2_Missense_Mutation_p.R312G|ARHGAP17_uc002dmz.2_Missense_Mutation_p.R391G|ARHGAP17_uc002dna.2_Missense_Mutation_p.R594G|ARHGAP17_uc002dnc.2_Missense_Mutation_p.R789G|ARHGAP17_uc010vcf.1_Missense_Mutation_p.R610G|ARHGAP17_uc002dnd.1_RNA|ARHGAP17_uc002dne.1_Silent_p.A124A	p.R867G	NM_001006634	NP_001006635	WXS	Illumina HiSeq	Unspecified	Q68EM7	RHG17_HUMAN		GBM - Glioblastoma multiforme(48;0.0407)	20	2692	-			867					A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	c.2599C>G	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693242	0.48202	.	.	ENSG00000140750	ENST00000289968;ENST00000303665	T;T	0.21734	1.99;2.08	6.08	4.15	0.48705	.	0.354593	0.20582	N	0.089518	T	0.29423	0.0733	L	0.44542	1.39	0.80722	D	1	B;B;D;B	0.69078	0.151;0.094;0.997;0.18	B;B;P;B	0.58172	0.082;0.037;0.834;0.077	T	0.01269	-1.1400	10	0.34782	T	0.22	.	9.4358	0.38637	0.1618:0.0:0.8382:0.0	.	789;867;400;700	Q68EM7-2;Q68EM7;Q68EM7-7;B4DWE9	.;RHG17_HUMAN;.;.	G	867;789	ENSP00000289968:R867G;ENSP00000303130:R789G	ENSP00000289968:R867G	R	-	1	0	ARHGAP17	24838999	1.000000	0.71417	0.999000	0.59377	0.889000	0.51656	3.388000	0.52509	0.920000	0.36970	-0.137000	0.14449	CGC		0.552	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054		26	70	0	0	0	0.004656	0	26	70				
SMPD3	55512	broad.mit.edu	37	16	68404942	68404942	+	Nonsense_Mutation	SNP	G	G	C	rs372627605		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:68404942G>C	ENST00000219334.5	-	3	1746	c.1143C>G	c.(1141-1143)taC>taG	p.Y381*	SMPD3_ENST00000563226.1_Nonsense_Mutation_p.Y381*|SMPD3_ENST00000566009.1_5'Flank|SMPD3_ENST00000568373.1_Nonsense_Mutation_p.Y381*	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	381					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	TGTACTCGAAGTAGCCGTGCA	0.597																																							uc002ewa.2		NA																	0				skin(1)	1						c.(1141-1143)TAC>TAG		neutral sphingomyelin phosphodiesterase 3	Phosphatidylserine(DB00144)						74.0	57.0	63.0					16																	68404942		2198	4300	6498	SO:0001587	stop_gained	55512				cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity	g.chr16:68404942G>C	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.1143C>G	16.37:g.68404942G>C	ENSP00000219334:p.Tyr381*		Somatic				SMPD3_uc010cfe.2_Nonsense_Mutation_p.Y381*|SMPD3_uc010vlh.1_Nonsense_Mutation_p.Y381*	p.Y381*	NM_018667	NP_061137	WXS	Illumina HiSeq	Unspecified	Q9NY59	NSMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	3	1565	-		Ovarian(137;0.0563)	381			Lumenal (Potential).		B7ZL82|Q2M1S8	Nonsense_Mutation	SNP	ENST00000219334.5	37	c.1143C>G	CCDS10867.1	.	.	.	.	.	.	.	.	.	.	G	32	5.118709	0.94385	.	.	ENSG00000103056	ENST00000219334	.	.	.	5.24	4.19	0.49359	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.5879	4.7409	0.13012	0.2613:0.0:0.7387:0.0	.	.	.	.	X	381	.	ENSP00000219334:Y381X	Y	-	3	2	SMPD3	66962443	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.768000	0.38511	2.447000	0.82792	0.563000	0.77884	TAC		0.597	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667		8	42	0	0	0	0.00308	0	8	42				
PHLPP2	23035	broad.mit.edu	37	16	71703215	71703215	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:71703215C>G	ENST00000568954.1	-	11	1969	c.1591G>C	c.(1591-1593)Gat>Cat	p.D531H	PHLPP2_ENST00000360429.3_Missense_Mutation_p.D531H|PHLPP2_ENST00000356272.3_Missense_Mutation_p.D531H|PHLPP2_ENST00000567016.1_Missense_Mutation_p.D566H|PHLPP2_ENST00000393524.2_Missense_Mutation_p.D531H			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	531					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						TAGCTCACATCTAATACTTCT	0.378																																							uc002fax.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1591-1593)GAT>CAT		PH domain and leucine rich repeat protein							105.0	108.0	107.0					16																	71703215		2198	4300	6498	SO:0001583	missense	23035					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity	g.chr16:71703215C>G	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.1591G>C	16.37:g.71703215C>G	ENSP00000457991:p.Asp531His		Somatic				PHLPP2_uc002fav.2_RNA|PHLPP2_uc010cgf.2_Missense_Mutation_p.D531H	p.D531H	NM_015020	NP_055835	WXS	Illumina HiSeq	Unspecified	Q6ZVD8	PHLP2_HUMAN			10	1597	-			531			LRR 13.		A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	ENST00000568954.1	37	c.1591G>C	CCDS32479.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898357	0.72639	.	.	ENSG00000040199	ENST00000299971;ENST00000360429;ENST00000356272;ENST00000393524	T;T;T	0.29655	1.56;2.03;1.93	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.60379	0.2264	M	0.85945	2.785	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.61168	-0.7117	10	0.32370	T	0.25	-17.0659	17.7894	0.88547	0.0:1.0:0.0:0.0	.	531;531	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	H	338;531;531;531	ENSP00000353610:D531H;ENSP00000348611:D531H;ENSP00000377159:D531H	ENSP00000299971:D338H	D	-	1	0	PHLPP2	70260716	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.440000	0.66563	2.444000	0.82710	0.563000	0.77884	GAT		0.378	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020		22	69	0	0	0	0.002299	0	22	69				
WWOX	51741	broad.mit.edu	37	16	78198109	78198109	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:78198109C>T	ENST00000566780.1	+	5	805	c.439C>T	c.(439-441)Cat>Tat	p.H147Y	WWOX_ENST00000408984.3_Missense_Mutation_p.H147Y|WWOX_ENST00000402655.2_Intron|WWOX_ENST00000406884.2_Missense_Mutation_p.H147Y|WWOX_ENST00000539474.2_Intron|WWOX_ENST00000565791.1_3'UTR|WWOX_ENST00000355860.3_Missense_Mutation_p.H147Y	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	147	Interaction with MAPT. {ECO:0000250}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)			large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		TTTTGCCCTCCATGGTGCACA	0.443																																							uc002ffk.2		NA																	0					0						c.(439-441)CAT>TAT		WW domain-containing oxidoreductase isoform 1							126.0	125.0	125.0					16																	78198109		1962	4143	6105	SO:0001583	missense	51741				apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity	g.chr16:78198109C>T	AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.439C>T	16.37:g.78198109C>T	ENSP00000457230:p.His147Tyr		Somatic				WWOX_uc010vnk.1_Missense_Mutation_p.H34Y|WWOX_uc002ffl.2_Missense_Mutation_p.H147Y|WWOX_uc010che.2_Intron|WWOX_uc002ffj.1_Missense_Mutation_p.H147Y	p.H147Y	NM_016373	NP_057457	WXS	Illumina HiSeq	Unspecified	Q9NZC7	WWOX_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)	5	564	+		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)	147			Interaction with MAPT (By similarity).		A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	ENST00000566780.1	37	c.439C>T	CCDS42196.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007749	0.54361	.	.	ENSG00000186153	ENST00000408984;ENST00000355860;ENST00000406884	T;D;D	0.87334	1.94;-2.24;-2.24	5.58	5.58	0.84498	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.92179	0.7520	L	0.60957	1.885	0.52501	D	0.999955	D;D;B	0.71674	0.979;0.998;0.321	P;D;B	0.72338	0.784;0.977;0.281	D	0.91866	0.5503	10	0.51188	T	0.08	.	18.3289	0.90262	0.0:1.0:0.0:0.0	.	147;147;147	Q9NZC7-5;Q9NZC7;Q9NZC7-3	.;WWOX_HUMAN;.	Y	147	ENSP00000386161:H147Y;ENSP00000348119:H147Y;ENSP00000384495:H147Y	ENSP00000348119:H147Y	H	+	1	0	WWOX	76755610	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.626000	0.67777	2.623000	0.88846	0.655000	0.94253	CAT		0.443	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434328.1			23	27	0	0	0	0.00278	0	23	27				
ACSF3	197322	broad.mit.edu	37	16	89167225	89167225	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr16:89167225G>T	ENST00000317447.4	+	3	513	c.136G>T	c.(136-138)Gtg>Ttg	p.V46L	ACSF3_ENST00000378345.4_Intron|ACSF3_ENST00000406948.3_Missense_Mutation_p.V46L	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	46					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		GAGCGCCCCGGTGTTCACCCG	0.677																																							uc002fmp.2		NA																	0					0						c.(136-138)GTG>TTG		acyl-CoA synthetase family member 3 precursor							24.0	28.0	27.0					16																	89167225		2198	4300	6498	SO:0001583	missense	197322				fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding	g.chr16:89167225G>T	AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.136G>T	16.37:g.89167225G>T	ENSP00000320646:p.Val46Leu		Somatic				ACSF3_uc010cig.1_Missense_Mutation_p.V46L|ACSF3_uc010cih.1_Intron|ACSF3_uc002fmq.1_RNA|ACSF3_uc010cii.1_RNA|ACSF3_uc002fmr.1_5'Flank	p.V46L	NM_174917	NP_777577	WXS	Illumina HiSeq	Unspecified	Q4G176	ACSF3_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0281)	3	476	+			46					A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	ENST00000317447.4	37	c.136G>T	CCDS10974.1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511464	0.44660	.	.	ENSG00000176715	ENST00000317447;ENST00000537290;ENST00000406948	T;T;T	0.54479	1.03;0.57;1.03	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.53206	0.1782	M	0.72894	2.215	0.80722	D	1	B	0.23650	0.089	B	0.17722	0.019	T	0.51919	-0.8644	10	0.21540	T	0.41	-25.577	18.3457	0.90321	0.0:0.0:1.0:0.0	.	46	Q4G176	ACSF3_HUMAN	L	46	ENSP00000320646:V46L;ENSP00000440734:V46L;ENSP00000384627:V46L	ENSP00000320646:V46L	V	+	1	0	ACSF3	87694726	1.000000	0.71417	0.208000	0.23602	0.005000	0.04900	8.929000	0.92859	2.339000	0.79563	0.650000	0.86243	GTG		0.677	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1	NM_174917		25	21	1	0	4.47668e-21	0.003954	6.72781e-21	25	21				
OR1A2	26189	broad.mit.edu	37	17	3101695	3101695	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:3101695A>T	ENST00000381951.1	+	1	883	c.883A>T	c.(883-885)Atg>Ttg	p.M295L		NM_012352.1	NP_036484.1	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A, member 2	295					positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(4)|stomach(2)	18						AAATTGGGATATGAAGGCAGC	0.453																																							uc002fvd.1		NA																	0				skin(2)	2						c.(883-885)ATG>TTG		olfactory receptor, family 1, subfamily A,							101.0	100.0	100.0					17																	3101695		2203	4300	6503	SO:0001583	missense	26189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr17:3101695A>T	AF155225	CCDS11021.1	17p13.3	2012-08-09			ENSG00000172150	ENSG00000172150		"""GPCR / Class A : Olfactory receptors"""	8180	protein-coding gene	gene with protein product						10673334	Standard	NM_012352		Approved	OR17-6	uc002fvd.1	Q9Y585	OTTHUMG00000090638	ENST00000381951.1:c.883A>T	17.37:g.3101695A>T	ENSP00000371377:p.Met295Leu		Somatic					p.M295L	NM_012352	NP_036484	WXS	Illumina HiSeq	Unspecified	Q9Y585	OR1A2_HUMAN			1	883	+			295			Cytoplasmic (Potential).		Q3KPH3|Q6IFM0|Q6NTD8|Q96R86	Missense_Mutation	SNP	ENST00000381951.1	37	c.883A>T	CCDS11021.1	.	.	.	.	.	.	.	.	.	.	A	3.234	-0.156830	0.06544	.	.	ENSG00000172150	ENST00000381951	T	0.35048	1.33	4.0	2.89	0.33648	.	0.000000	0.64402	D	0.000010	T	0.18383	0.0441	N	0.20766	0.605	0.23180	N	0.99816	B	0.19073	0.033	B	0.20767	0.031	T	0.11494	-1.0585	10	0.38643	T	0.18	.	1.3134	0.02102	0.5271:0.1895:0.1012:0.1823	.	295	Q9Y585	OR1A2_HUMAN	L	295	ENSP00000371377:M295L	ENSP00000371377:M295L	M	+	1	0	OR1A2	3048445	0.948000	0.32251	0.987000	0.45799	0.006000	0.05464	0.969000	0.29370	0.676000	0.31285	-0.641000	0.03968	ATG		0.453	OR1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207293.1	NM_012352		67	70	0	0	0	0.00361	0	67	70				
TP53	7157	broad.mit.edu	37	17	7576897	7576897	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:7576897G>A	ENST00000269305.4	-	9	1138	c.949C>T	c.(949-951)Cag>Tag	p.Q317*	TP53_ENST00000455263.2_Nonsense_Mutation_p.Q317*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q317*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q317*|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q317*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	317	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		Q -> H (in a kidney cancer with no family history; germline mutation and in a sporadic cancer; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in a sporadic cancer; somatic mutation).|Q -> P (in a sporadic cancer; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q317*(29)|p.0?(8)|p.Q317K(3)|p.S315fs*22(1)|p.?(1)|p.S314fs*25(1)|p.L308fs*15(1)|p.Q317fs*28(1)|p.Q317fs*45(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTTTGGCTGGGGAGAGGAG	0.473		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		46	Substitution - Nonsense(29)|Whole gene deletion(8)|Deletion - Frameshift(4)|Substitution - Missense(3)|Insertion - Frameshift(1)|Unknown(1)	p.Q317*(19)|p.0?(7)|p.Q317K(3)|p.Q317R(2)|p.S315fs*22(1)|p.?(1)|p.S314fs*25(1)|p.L308fs*15(1)|p.Q317P(1)|p.Q317fs*28(1)|p.Q317fs*45(1)|p.Q317fs*19(1)	breast(7)|large_intestine(5)|skin(4)|bone(4)|upper_aerodigestive_tract(3)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(3)|ovary(3)|central_nervous_system(2)|lung(2)|NS(2)|pancreas(2)|thyroid(1)|stomach(1)|soft_tissue(1)|liver(1)|endometrium(1)|oesophagus(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(949-951)CAG>TAG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							129.0	119.0	122.0					17																	7576897		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7576897G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.949C>T	17.37:g.7576897G>A	ENSP00000269305:p.Gln317*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.Q317*|TP53_uc010cne.1_RNA|TP53_uc010cnf.1_Nonsense_Mutation_p.Q185*|TP53_uc010cng.1_Nonsense_Mutation_p.Q185*|TP53_uc002gii.1_Nonsense_Mutation_p.Q185*|TP53_uc010cnh.1_Nonsense_Mutation_p.Q317*|TP53_uc010cni.1_Nonsense_Mutation_p.Q317*|TP53_uc002gij.2_Nonsense_Mutation_p.Q317*	p.Q317*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	9	1143	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	317		Q -> H (in a kidney cancer with no family history; germline mutation and in a sporadic cancer; somatic mutation).|Q -> P (in a sporadic cancer; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in a sporadic cancer; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).	Bipartite nuclear localization signal.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.949C>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032676	0.93575	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.96	2.84	0.33178	.	1.146690	0.06159	N	0.675692	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-0.0856	5.403	0.16306	0.1029:0.0:0.6855:0.2116	.	.	.	.	X	317;317;317;317;317;306;185	.	ENSP00000269305:Q317X	Q	-	1	0	TP53	7517622	0.001000	0.12720	0.022000	0.16811	0.871000	0.50021	0.741000	0.26202	1.318000	0.45170	0.561000	0.74099	CAG		0.473	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		30	40	0	0	0	0.002096	0	30	40				
ARHGEF15	22899	broad.mit.edu	37	17	8219340	8219340	+	Silent	SNP	C	C	T	rs568213811		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:8219340C>T	ENST00000361926.3	+	9	1688	c.1578C>T	c.(1576-1578)gaC>gaT	p.D526D	ARHGEF15_ENST00000421050.1_Silent_p.D526D|AC135178.7_ENST00000458568.1_RNA	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	526	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						TCTGCAGGGACACCAACGTGC	0.687													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15090	0.0		0.0	False		,,,				2504	0.0						uc002glc.2		NA																	0				ovary(2)|skin(1)	3						c.(1576-1578)GAC>GAT		Rho guanine exchange factor 15							23.0	24.0	23.0					17																	8219340		2203	4297	6500	SO:0001819	synonymous_variant	22899				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr17:8219340C>T	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1578C>T	17.37:g.8219340C>T			Somatic				ARHGEF15_uc002gld.2_Silent_p.D526D|ARHGEF15_uc010vuw.1_Silent_p.D415D	p.D526D	NM_173728	NP_776089	WXS	Illumina HiSeq	Unspecified	O94989	ARHGF_HUMAN			9	1699	+			526			DH.		A8K6G1|Q8N449|Q9H8B4	Silent	SNP	ENST00000361926.3	37	c.1578C>T	CCDS11139.1																																																																																				0.687	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728		8	19	0	0	0	0.00308	0	8	19				
MYH2	4620	broad.mit.edu	37	17	10441133	10441133	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:10441133A>C	ENST00000245503.5	-	15	1820	c.1436T>G	c.(1435-1437)cTg>cGg	p.L479R	MYH2_ENST00000397183.2_Missense_Mutation_p.L479R|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Missense_Mutation_p.L479R	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	479	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GTTGATGCACAGCTGCTCCAG	0.378																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(1435-1437)CTG>CGG		myosin heavy chain IIa							106.0	98.0	101.0					17																	10441133		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10441133A>C		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1436T>G	17.37:g.10441133A>C	ENSP00000245503:p.Leu479Arg		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.L479R|MYH2_uc010coj.2_Missense_Mutation_p.L479R	p.L479R	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			15	1564	-			479			Myosin head-like.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.1436T>G	CCDS11156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.4|22.4	4.288122|4.288122	0.80803|0.80803	.|.	.|.	ENSG00000125414|ENSG00000214970	ENST00000532183;ENST00000245503;ENST00000397183|ENST00000399342	D;D;D|.	0.81908|.	-1.55;-1.55;-1.55|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Myosin head, motor domain (3);|.	0.000000|.	0.31312|.	U|.	0.007879|.	D|D	0.91717|0.91717	0.7381|0.7381	H|H	0.99815|0.99815	4.805|4.805	0.58432|0.58432	D|D	0.999995|0.999995	D;D|.	0.71674|.	0.998;0.97|.	D;D|.	0.87578|.	0.998;0.978|.	D|D	0.95292|0.95292	0.8396|0.8396	10|6	0.87932|0.87932	D|D	0|0	.|.	14.8155|14.8155	0.70031|0.70031	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	479;479|.	Q567P6;Q9UKX2|.	.;MYH2_HUMAN|.	R|R	479|69	ENSP00000433944:L479R;ENSP00000245503:L479R;ENSP00000380367:L479R|.	ENSP00000245503:L479R|ENSP00000382280:S69R	L|S	-|+	2|1	0|0	MYH2|AC005323.1	10381858|10381858	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.296000|9.296000	0.96104|0.96104	2.105000|2.105000	0.64084|0.64084	0.533000|0.533000	0.62120|0.62120	CTG|AGC		0.378	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		7	142	0	0	0	0.006214	0	7	142				
COX10	1352	broad.mit.edu	37	17	14005480	14005480	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:14005480G>T	ENST00000261643.3	+	4	622	c.545G>T	c.(544-546)gGc>gTc	p.G182V	COX10_ENST00000536205.1_Intron|COX10_ENST00000537334.1_5'UTR	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	182					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		TTGGCTCCGGGCCCTTTTGAC	0.502																																							uc002gof.3		NA																	0					0						c.(544-546)GGC>GTC		heme A:farnesyltransferase precursor							166.0	142.0	150.0					17																	14005480		2203	4300	6503	SO:0001583	missense	1352				heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity	g.chr17:14005480G>T	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.545G>T	17.37:g.14005480G>T	ENSP00000261643:p.Gly182Val		Somatic				COX10_uc010vvs.1_5'UTR|COX10_uc010vvt.1_Intron	p.G182V	NM_001303	NP_001294	WXS	Illumina HiSeq	Unspecified	Q12887	COX10_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)	4	749	+		all_lung(20;0.06)|Lung SC(565;0.168)	182			Helical; (Potential).		B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	ENST00000261643.3	37	c.545G>T	CCDS11166.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.467792	0.26335	.	.	ENSG00000006695	ENST00000261643	D	0.93189	-3.18	5.26	-1.65	0.08291	.	0.284775	0.33057	N	0.005338	D	0.83774	0.5327	L	0.37800	1.135	0.80722	D	1	B	0.02656	0.0	B	0.11329	0.006	T	0.65586	-0.6132	10	0.13108	T	0.6	-14.5573	3.163	0.06527	0.0818:0.1984:0.2459:0.4739	.	182	Q12887	COX10_HUMAN	V	182	ENSP00000261643:G182V	ENSP00000261643:G182V	G	+	2	0	COX10	13946205	0.997000	0.39634	0.027000	0.17364	0.953000	0.61014	2.522000	0.45572	0.015000	0.14971	0.650000	0.86243	GGC		0.502	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303		7	119	1	0	8.12818e-05	0.001984	9.03895e-05	7	119				
MAP2K3	5606	broad.mit.edu	37	17	21201776	21201777	+	Missense_Mutation	DNP	CC	CC	GG	rs145057136		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:21201776_21201777CC>GG	ENST00000342679.4	+	2	350_351	c.101_102CC>GG	c.(100-102)cCC>cGG	p.P34R	MAP2K3_ENST00000361818.5_Missense_Mutation_p.P5R|MAP2K3_ENST00000316920.6_Missense_Mutation_p.P5R	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	34					activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		TCCAAGCCACCCGCACCCAACC	0.564																																							uc002gys.2		NA																	0					0						c.(100-102)CCC>CGG		mitogen-activated protein kinase kinase 3																																				SO:0001583	missense	5606				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr17:21201776_21201777CC>GG	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	Exception_encountered	17.37:g.21201776_21201777delinsGG	ENSP00000345083:p.Pro34Arg		Somatic				MAP2K3_uc002gyt.2_Missense_Mutation_p.P5R|MAP2K3_uc002gyu.2_Missense_Mutation_p.P5R	p.P34R	NM_145109	NP_659731	WXS	Illumina HiSeq	Unspecified	P46734	MP2K3_HUMAN		COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)	2	366_367	+			34					B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	DNP	ENST00000342679.4	37	c.101_102CC>GG	CCDS11217.1																																																																																				0.564	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109		24	146	0	0	0	0.004672	0	24	146				
TNFAIP1	7126	broad.mit.edu	37	17	26667374	26667374	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:26667374C>A	ENST00000226225.2	+	3	512	c.245C>A	c.(244-246)aCc>aAc	p.T82N	TNFAIP1_ENST00000544907.2_5'UTR|TNFAIP1_ENST00000583213.1_Intron	NM_021137.4	NP_066960.1	Q13829	BACD2_HUMAN	tumor necrosis factor, alpha-induced protein 1 (endothelial)	82	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				apoptotic process (GO:0006915)|cell migration (GO:0016477)|DNA replication (GO:0006260)|embryo development (GO:0009790)|immune response (GO:0006955)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleolus (GO:0005730)	GTP-Rho binding (GO:0017049)			endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	12	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		CACTTTGGCACCATTTTGAAT	0.522																																							uc002hax.1		NA																	0					0						c.(244-246)ACC>AAC		tumor necrosis factor, alpha-induced protein 1							178.0	161.0	167.0					17																	26667374		2203	4300	6503	SO:0001583	missense	7126				apoptosis|cell migration|DNA replication|embryo development|immune response|negative regulation of Rho protein signal transduction|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|endosome|nucleus|voltage-gated potassium channel complex	GTP-Rho binding|voltage-gated potassium channel activity	g.chr17:26667374C>A		CCDS11227.1	17q22-q23	2013-01-09			ENSG00000109079	ENSG00000109079		"""BTB/POZ domain containing"""	11894	protein-coding gene	gene with protein product		191161		EDP1		2406243, 2233719	Standard	NM_021137		Approved	B61, B12, MGC2317, BTBD34	uc002hay.3	Q13829	OTTHUMG00000132501	ENST00000226225.2:c.245C>A	17.37:g.26667374C>A	ENSP00000226225:p.Thr82Asn		Somatic				TNFAIP1_uc002hay.2_Missense_Mutation_p.T82N|TNFAIP1_uc010waf.1_5'UTR	p.T82N	NM_021137	NP_066960	WXS	Illumina HiSeq	Unspecified	Q13829	BACD2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	3	264	+	all_lung(13;0.000294)|Lung NSC(42;0.000964)		82			BTB.		B7Z6M4|Q5TZQ1	Missense_Mutation	SNP	ENST00000226225.2	37	c.245C>A	CCDS11227.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987196	0.35036	.	.	ENSG00000109079	ENST00000226225	T	0.77358	-1.09	6.17	6.17	0.99709	BTB/POZ-like (2);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.165230	0.51477	D	0.000082	D	0.85173	0.5636	M	0.84433	2.695	0.45005	D	0.998022	B	0.32526	0.374	P	0.45794	0.493	T	0.81629	-0.0846	10	0.29301	T	0.29	-28.1097	15.3567	0.74431	0.0:0.8613:0.1387:0.0	.	82	Q13829	BACD2_HUMAN	N	82	ENSP00000226225:T82N	ENSP00000226225:T82N	T	+	2	0	TNFAIP1	23691501	0.994000	0.37717	1.000000	0.80357	0.996000	0.88848	2.179000	0.42528	2.941000	0.99782	0.655000	0.94253	ACC		0.522	TNFAIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255681.2	NM_021137		34	103	1	0	2.09667e-21	0.003755	3.17823e-21	34	103				
NEK8	284086	broad.mit.edu	37	17	27061972	27061972	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:27061972G>A	ENST00000268766.6	+	3	470	c.436G>A	c.(436-438)Ggt>Agt	p.G146S	NEK8_ENST00000593261.1_3'UTR|AC010761.6_ENST00000584779.1_RNA	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					CGTCAAGATCGGTGATTTCGG	0.562																																					NSCLC(6;19 293 14866 25253 49845)	NSCLC(6;19 293 14866 25253 49845)	uc002hcp.2		NA																	0				stomach(2)|ovary(1)|pancreas(1)|liver(1)|skin(1)	6						c.(436-438)GGT>AGT		NIMA-related kinase 8							207.0	167.0	181.0					17																	27061972		2203	4300	6503	SO:0001583	missense	284086					cytoplasm|primary cilium	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr17:27061972G>A	AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.436G>A	17.37:g.27061972G>A	ENSP00000268766:p.Gly146Ser		Somatic					p.G146S	NM_178170	NP_835464	WXS	Illumina HiSeq	Unspecified	Q86SG6	NEK8_HUMAN			3	436	+	Lung NSC(42;0.0158)		146			Protein kinase.		A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Missense_Mutation	SNP	ENST00000268766.6	37	c.436G>A	CCDS32597.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503756	0.85176	.	.	ENSG00000160602	ENST00000543014;ENST00000268766	T;T	0.23552	1.9;1.9	5.73	5.73	0.89815	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.49338	0.1551	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.65987	0.94	T	0.41556	-0.9502	10	0.59425	D	0.04	.	18.8738	0.92327	0.0:0.0:1.0:0.0	.	146	Q86SG6	NEK8_HUMAN	S	146	ENSP00000465859:G146S;ENSP00000268766:G146S	ENSP00000268766:G146S	G	+	1	0	NEK8	24086099	1.000000	0.71417	0.156000	0.22583	0.446000	0.32137	9.449000	0.97603	2.709000	0.92574	0.491000	0.48974	GGT		0.562	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446467.2			19	146	0	0	0	0.007413	0	19	146				
EVI2B	2124	broad.mit.edu	37	17	29631427	29631427	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:29631427G>A	ENST00000330927.4	-	2	1355	c.1201C>T	c.(1201-1203)Ctt>Ttt	p.L401F	EVI2B_ENST00000577894.1_Missense_Mutation_p.L401F|NF1_ENST00000358273.4_Intron|EVI2B_ENST00000544462.1_Missense_Mutation_p.L416F|NF1_ENST00000356175.3_Intron	NM_006495.3	NP_006486.3	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B	401						integral component of plasma membrane (GO:0005887)		p.0?(8)|p.?(3)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	12		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		GGCAAGTTAAGTGAGTCAAGC	0.418																																							uc002hgk.2		NA																	11	Whole gene deletion(8)|Unknown(3)		soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	ovary(2)	2						c.(1201-1203)CTT>TTT		ecotropic viral integration site 2B precursor							129.0	117.0	121.0					17																	29631427		2203	4300	6503	SO:0001583	missense	2124					cytoplasm|integral to plasma membrane		g.chr17:29631427G>A		CCDS11266.1	17q11.2	2011-08-11			ENSG00000185862	ENSG00000185862		"""CD molecules"""	3500	protein-coding gene	gene with protein product		158381				1903357	Standard	NM_006495		Approved	D17S376, EVDB, CD361	uc002hgk.2	P34910	OTTHUMG00000132869	ENST00000330927.4:c.1201C>T	17.37:g.29631427G>A	ENSP00000333779:p.Leu401Phe		Somatic				NF1_uc002hgg.2_Intron|NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2B_uc010csq.2_Missense_Mutation_p.L416F	p.L401F	NM_006495	NP_006486	WXS	Illumina HiSeq	Unspecified	P34910	EVI2B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)	2	1356	-		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)	401			Cytoplasmic (Potential).		B7Z4A7	Missense_Mutation	SNP	ENST00000330927.4	37	c.1201C>T	CCDS11266.1	.	.	.	.	.	.	.	.	.	.	G	3.313	-0.140386	0.06669	.	.	ENSG00000185862	ENST00000330927;ENST00000544462	T;T	0.47528	0.85;0.84	5.64	-4.53	0.03462	.	1.088890	0.07165	N	0.851407	T	0.21921	0.0528	N	0.11201	0.11	0.20821	N	0.999841	B;B	0.11235	0.004;0.004	B;B	0.11329	0.006;0.006	T	0.25187	-1.0139	10	0.13470	T	0.59	0.7977	6.3704	0.21479	0.4213:0.2239:0.3549:0.0	.	416;401	B7Z4A7;P34910	.;EVI2B_HUMAN	F	401;416	ENSP00000333779:L401F;ENSP00000439738:L416F	ENSP00000333779:L401F	L	-	1	0	EVI2B	26655553	0.000000	0.05858	0.488000	0.27440	0.675000	0.39556	-0.049000	0.11924	-0.630000	0.05567	0.655000	0.94253	CTT		0.418	EVI2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256349.2	NM_006495		40	88	0	0	0	0.005524	0	40	88				
CCL18	6362	broad.mit.edu	37	17	34391718	34391718	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:34391718G>T	ENST00000004921.3	+	1	79	c.16G>T	c.(16-18)Gct>Tct	p.A6S		NM_002988.2	NP_002979.1	P55774	CCL18_HUMAN	chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)	6					cell chemotaxis (GO:0060326)|cell communication (GO:0007154)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|response to biotic stimulus (GO:0009607)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)			endometrium(1)|large_intestine(2)|lung(1)	4		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GGGCCTTGCAGCTGCCCTCCT	0.582																																							uc002hku.2		NA																	0					0						c.(16-18)GCT>TCT		small inducible cytokine A18 precursor							176.0	144.0	155.0					17																	34391718		2203	4300	6503	SO:0001583	missense	6362				cell-cell signaling|chemotaxis|immune response|inflammatory response|response to biotic stimulus|signal transduction	extracellular space	chemokine activity	g.chr17:34391718G>T	Y13710	CCDS11306.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000006074	ENSG00000275385		"""Chemokine ligands"""	10616	protein-coding gene	gene with protein product		603757	"""small inducible cytokine subfamily A (Cys-Cys), member 18, pulmonary and activation-regulated"""	SCYA18		9233607, 10049593	Standard	NM_002988		Approved	DC-CK1, PARC, AMAC-1, DCCK1, MIP-4, CKb7	uc002hku.3	P55774	OTTHUMG00000188410	ENST00000004921.3:c.16G>T	17.37:g.34391718G>T	ENSP00000004921:p.Ala6Ser		Somatic					p.A6S	NM_002988	NP_002979	WXS	Illumina HiSeq	Unspecified	P55774	CCL18_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	1	76	+		Ovarian(249;0.17)	6					B5BUM2|Q53X71	Missense_Mutation	SNP	ENST00000004921.3	37	c.16G>T	CCDS11306.1	.	.	.	.	.	.	.	.	.	.	G	14.57	2.574822	0.45902	.	.	ENSG00000006074	ENST00000004921	T	0.03496	3.91	4.63	0.196	0.15159	.	0.874525	0.09952	N	0.734600	T	0.03434	0.0099	.	.	.	0.09310	N	1	D	0.54397	0.966	P	0.46144	0.505	T	0.44421	-0.9329	9	0.20519	T	0.43	.	4.6051	0.12372	0.2773:0.1602:0.5624:0.0	.	6	P55774	CCL18_HUMAN	S	6	ENSP00000004921:A6S	ENSP00000004921:A6S	A	+	1	0	CCL18	31415831	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.313000	0.19415	0.017000	0.15025	-0.336000	0.08194	GCT		0.582	CCL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256583.1	NM_002988		43	142	1	0	4.44401e-20	0.002522	6.60325e-20	43	142				
CRHR1	1394	broad.mit.edu	37	17	43912021	43912021	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:43912021G>T	ENST00000398285.3	+	14	1226	c.1226G>T	c.(1225-1227)cGg>cTg	p.R409L	CRHR1_ENST00000339069.5_Missense_Mutation_p.G234C|CRHR1_ENST00000293493.7_Missense_Mutation_p.R205L|CRHR1_ENST00000314537.5_Missense_Mutation_p.R380L|CRHR1_ENST00000352855.5_Missense_Mutation_p.R340L|CRHR1_ENST00000577353.1_Missense_Mutation_p.R366L	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	409					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		AGGTGGCACCGGTGGCAGGAC	0.657																																					Ovarian(110;57 1568 10207 38216 49865)	Ovarian(110;57 1568 10207 38216 49865)	uc010dap.2		NA																	0				lung(3)	3						c.(1225-1227)CGG>CTG		corticotropin releasing hormone receptor 1							47.0	59.0	55.0					17																	43912021		2182	4280	6462	SO:0001583	missense	1394				female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding	g.chr17:43912021G>T	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.1226G>T	17.37:g.43912021G>T	ENSP00000381333:p.Arg409Leu		Somatic				CRHR1_uc010wjx.1_Missense_Mutation_p.R205L|CRHR1_uc002ijp.2_Missense_Mutation_p.G234C|CRHR1_uc002ijm.2_Missense_Mutation_p.R380L|CRHR1_uc002ijn.2_Missense_Mutation_p.R340L|CRHR1_uc010dar.2_Missense_Mutation_p.R366L|CRHR1_uc010dao.2_Missense_Mutation_p.R279L|CRHR1_uc010daq.2_Missense_Mutation_p.R205L	p.R409L	NM_001145146	NP_001138618	WXS	Illumina HiSeq	Unspecified	P34998	CRFR1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.161)	14	1491	+	Colorectal(2;0.0416)		409			Cytoplasmic (Potential).		B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	ENST00000398285.3	37	c.1226G>T	CCDS45712.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.791311|5.791311	0.96945|0.96945	.|.	.|.	ENSG00000120088|ENSG00000120088	ENST00000339069|ENST00000293493;ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855	T|T;T;T;T	0.47528|0.74632	0.84|-0.86;-0.86;-0.86;-0.86	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83585|0.83585	0.5286|0.5286	M|M	0.69463|0.69463	2.115|2.115	0.80722|0.80722	D|D	1|1	P|D;D;P;D;D	0.43431|0.64830	0.807|0.98;0.994;0.935;0.961;0.98	B|P;P;P;P;P	0.44163|0.62014	0.443|0.859;0.897;0.727;0.859;0.859	D|D	0.85557|0.85557	0.1225|0.1225	9|10	0.87932|0.87932	D|D	0|0	.|.	16.3315|16.3315	0.83023|0.83023	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	234|366;409;279;340;380	B4DMR5|P34998-4;P34998;B3TIK8;P34998-3;P34998-2	.|.;CRFR1_HUMAN;.;.;.	C|L	234|205;409;380;366;340	ENSP00000340522:G234C|ENSP00000293493:R205L;ENSP00000381333:R409L;ENSP00000326060:R380L;ENSP00000344068:R340L	ENSP00000340522:G234C|ENSP00000293493:R205L	G|R	+|+	1|2	0|0	CRHR1|CRHR1	41267802|41267802	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.986000|0.986000	0.74619|0.74619	9.842000|9.842000	0.99487|0.99487	2.451000|2.451000	0.82905|0.82905	0.555000|0.555000	0.69702|0.69702	GGT|CGG		0.657	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3			17	44	1	0	2.35188e-11	0.006122	3.16391e-11	17	44				
ITGB3	3690	broad.mit.edu	37	17	45361945	45361945	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:45361945C>T	ENST00000559488.1	+	4	514	c.498C>T	c.(496-498)acC>acT	p.T166T	ITGB3_ENST00000435993.2_Silent_p.T119T|ITGB3_ENST00000560629.1_Missense_Mutation_p.P155S|ITGB3_ENST00000571680.1_Silent_p.T166T	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	166	VWFA.		T -> I (associated with neonatal thrombocytopenia; alloantigen Duv(a+); does not affect significantly the integrin function). {ECO:0000269|PubMed:12036875}.		activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	AGCTGGCCACCCAGATGCGAA	0.532																																							uc002ilj.2		NA																	0				central_nervous_system(5)|large_intestine(1)	6						c.(496-498)ACC>ACT		integrin beta chain, beta 3 precursor	Abciximab(DB00054)|Tirofiban(DB00775)						122.0	117.0	119.0					17																	45361945		2203	4300	6503	SO:0001819	synonymous_variant	3690				activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding	g.chr17:45361945C>T		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.498C>T	17.37:g.45361945C>T			Somatic				ITGB3_uc002ili.1_Silent_p.T166T|ITGB3_uc010wkr.1_RNA	p.T166T	NM_000212	NP_000203	WXS	Illumina HiSeq	Unspecified	P05106	ITB3_HUMAN			4	518	+			166		T -> I (associated with neonatal thrombocytopenia; alloantigen Duv(a+); does not affect significantly the integrin function).	VWFA.|Extracellular (Potential).		A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Silent	SNP	ENST00000559488.1	37	c.498C>T	CCDS11511.1																																																																																				0.532	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212		57	121	0	0	0	0.00361	0	57	121				
HOXB7	3217	broad.mit.edu	37	17	46685327	46685327	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:46685327C>A	ENST00000239165.7	-	2	629	c.531G>T	c.(529-531)acG>acT	p.T177T	HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB-AS3_ENST00000494420.1_RNA|HOXB7_ENST00000567101.2_5'UTR|HOXB6_ENST00000225648.3_5'Flank|HOXB-AS3_ENST00000491264.1_RNA|HOXB6_ENST00000484302.2_5'Flank	NM_004502.3	NP_004493.3	P09629	HXB7_HUMAN	homeobox B7	177					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	8						TCTGTCTTTCCGTGAGGCAGA	0.587																																							uc002inv.2		NA																	0					0						c.(529-531)ACG>ACT		homeobox B7							113.0	118.0	116.0					17																	46685327		2203	4300	6503	SO:0001819	synonymous_variant	3217					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46685327C>A		CCDS11532.1	17q21.32	2013-05-22	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	5118	protein-coding gene	gene with protein product		142962	"""homeo box B7"""	HOX2, HOX2C		1973146, 1358459	Standard	NM_004502		Approved		uc002inv.3	P09629	OTTHUMG00000170231	ENST00000239165.7:c.531G>T	17.37:g.46685327C>A			Somatic				HOXB6_uc002ins.1_5'Flank|HOXB6_uc010dbh.1_5'Flank	p.T177T	NM_004502	NP_004493	WXS	Illumina HiSeq	Unspecified	P09629	HXB7_HUMAN			2	634	-			177			Homeobox.		A8K3N8|Q15957|Q53FN3|Q96BQ6	Silent	SNP	ENST00000239165.7	37	c.531G>T	CCDS11532.1																																																																																				0.587	HOXB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358097.3			43	228	1	0	2.24722e-20	0.00361	3.35806e-20	43	228				
IGF2BP1	10642	broad.mit.edu	37	17	47120823	47120823	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:47120823G>T	ENST00000290341.3	+	10	1445	c.1111G>T	c.(1111-1113)Gct>Tct	p.A371S	IGF2BP1_ENST00000431824.2_Missense_Mutation_p.A232S	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	371	Necessary for interaction with ELAVL4 and binding to TAU mRNA. {ECO:0000250}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCTGAACCTGGCTGCTGTAGG	0.597																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)	Esophageal Squamous(198;1041 2123 8248 37119 38268)	uc002iom.2		NA																	0				kidney(1)	1						c.(1111-1113)GCT>TCT		insulin-like growth factor 2 mRNA binding							71.0	69.0	69.0					17																	47120823		2203	4300	6503	SO:0001583	missense	10642				CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	g.chr17:47120823G>T	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.1111G>T	17.37:g.47120823G>T	ENSP00000290341:p.Ala371Ser		Somatic				IGF2BP1_uc010dbj.2_Missense_Mutation_p.A232S	p.A371S	NM_006546	NP_006537	WXS	Illumina HiSeq	Unspecified	Q9NZI8	IF2B1_HUMAN			10	1445	+			371			Necessary for interaction with ELAVL4 and binding to TAU mRNA (By similarity).		C9JT33	Missense_Mutation	SNP	ENST00000290341.3	37	c.1111G>T	CCDS11543.1	.	.	.	.	.	.	.	.	.	.	G	8.976	0.974057	0.18736	.	.	ENSG00000159217	ENST00000290341;ENST00000431824	T;T	0.28666	2.3;1.6	5.42	5.42	0.78866	.	0.183328	0.47852	D	0.000218	T	0.25419	0.0618	N	0.05078	-0.115	0.38572	D	0.949973	P;B	0.44690	0.841;0.001	P;B	0.57204	0.815;0.004	T	0.07868	-1.0750	10	0.08599	T	0.76	-13.6172	12.3562	0.55176	0.0773:0.0:0.9227:0.0	.	232;371	C9JT33;Q9NZI8	.;IF2B1_HUMAN	S	371;232	ENSP00000290341:A371S;ENSP00000389135:A232S	ENSP00000290341:A371S	A	+	1	0	IGF2BP1	44475822	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	2.104000	0.41815	2.826000	0.97356	0.563000	0.77884	GCT		0.597	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364046.1	NM_006546		34	71	1	0	1.836e-18	0.003755	2.69007e-18	34	71				
NGFR	4804	broad.mit.edu	37	17	47590270	47590270	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:47590270A>T	ENST00000172229.3	+	6	1308	c.1183A>T	c.(1183-1185)Agc>Tgc	p.S395C	RP5-1029K10.2_ENST00000514506.1_RNA|NGFR_ENST00000504201.1_Missense_Mutation_p.S301C	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	395	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					CACCCAGGACAGCGCCACACT	0.687																																							uc002ioz.3		NA																	0				ovary(1)|lung(1)	2						c.(1183-1185)AGC>TGC		nerve growth factor receptor precursor							24.0	26.0	25.0					17																	47590270		2201	4299	6500	SO:0001583	missense	4804				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|membrane protein intracellular domain proteolysis|negative regulation of axonogenesis|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis	cell surface|cytosol|endosome|extracellular region|integral to plasma membrane|nucleoplasm		g.chr17:47590270A>T	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1183A>T	17.37:g.47590270A>T	ENSP00000172229:p.Ser395Cys		Somatic					p.S395C	NM_002507	NP_002498	WXS	Illumina HiSeq	Unspecified	P08138	TNR16_HUMAN			6	1308	+	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)		395			Cytoplasmic (Potential).|Death.		B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	c.1183A>T	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.564177	0.65651	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.90732	-2.72;-2.72	4.02	4.02	0.46733	Death (3);DEATH-like (2);	0.669696	0.14836	N	0.295594	D	0.91623	0.7353	L	0.33485	1.01	0.43527	D	0.995801	D	0.76494	0.999	D	0.69479	0.964	D	0.90716	0.4631	10	0.52906	T	0.07	-33.215	12.3602	0.55199	1.0:0.0:0.0:0.0	.	395	P08138	TNR16_HUMAN	C	395;301	ENSP00000172229:S395C;ENSP00000421731:S301C	ENSP00000172229:S395C	S	+	1	0	NGFR	44945269	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.673000	0.46858	1.812000	0.52913	0.459000	0.35465	AGC		0.687	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1			3	28	0	0	0	0.004672	0	3	28				
TRIM37	4591	broad.mit.edu	37	17	57057803	57057803	+	IGR	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:57057803A>G	ENST00000393066.3	-	0	3622				PPM1E_ENST00000308249.2_Missense_Mutation_p.Q560R	NM_001005207.2	NP_001005207.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					CCAGGGTCCCAAATCAACGTG	0.527									Mulibrey Nanism																														uc002iwx.2		NA																	0				breast(3)|lung(1)|skin(1)	5						c.(1678-1680)CAA>CGA		protein phosphatase 1E							88.0	80.0	83.0					17																	57057803		2203	4300	6503	SO:0001628	intergenic_variant	22843		Familial Cancer Database	Perheentupa syndrome	protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity	g.chr17:57057803A>G	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972			17.37:g.57057803A>G			Somatic				PPM1E_uc010ddd.2_Missense_Mutation_p.Q323R	p.Q560R	NM_014906	NP_055721	WXS	Illumina HiSeq	Unspecified	Q8WY54	PPM1E_HUMAN	BRCA - Breast invasive adenocarcinoma(1;5.76e-11)		7	1806	+	Medulloblastoma(34;0.127)|all_neural(34;0.237)		569					Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000393066.3	37	c.1679A>G	CCDS45746.1	.	.	.	.	.	.	.	.	.	.	A	10.88	1.475375	0.26511	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.18016	2.24	5.84	3.56	0.40772	.	0.599494	0.17363	N	0.176962	T	0.10252	0.0251	N	0.19112	0.55	0.23331	N	0.997893	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.27226	-1.0080	10	0.41790	T	0.15	-12.5429	6.2703	0.20951	0.6091:0.2955:0.0954:0.0	.	569;560	Q8WY54-3;Q8WY54-2	.;.	R	560;411	ENSP00000312411:Q560R	ENSP00000312411:Q560R	Q	+	2	0	PPM1E	54412585	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	1.633000	0.37113	0.433000	0.26313	0.402000	0.26972	CAA		0.527	TRIM37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445928.1	NM_015294		39	66	0	0	0	0.005524	0	39	66				
SMARCD2	6603	broad.mit.edu	37	17	61911557	61911557	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:61911557C>G	ENST00000448276.2	-	8	1318	c.1053G>C	c.(1051-1053)gaG>gaC	p.E351D	SMARCD2_ENST00000225742.9_Missense_Mutation_p.E276D|SMARCD2_ENST00000323347.10_Missense_Mutation_p.E303D	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	351	SWIB.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						AGTTGATGTACTCCCGCTCGT	0.602											OREG0024642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010deb.1		NA																	0					0						c.(1051-1053)GAG>GAC		SWI/SNF-related matrix-associated							36.0	37.0	37.0					17																	61911557		2100	4221	6321	SO:0001583	missense	6603				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	SWI/SNF complex	protein binding|transcription coactivator activity	g.chr17:61911557C>G	U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.1053G>C	17.37:g.61911557C>G	ENSP00000392617:p.Glu351Asp		Somatic	OREG0024642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1057	SMARCD2_uc010wpt.1_Missense_Mutation_p.E303D|SMARCD2_uc010dea.1_Missense_Mutation_p.E276D|SMARCD2_uc010dec.1_Missense_Mutation_p.E330D	p.E351D	NM_001098426	NP_001091896	WXS	Illumina HiSeq	Unspecified	Q92925	SMRD2_HUMAN			8	1370	-			351			SWIB.		A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Missense_Mutation	SNP	ENST00000448276.2	37	c.1053G>C	CCDS45756.1	.	.	.	.	.	.	.	.	.	.	.	4.354	0.065101	0.08388	.	.	ENSG00000108604	ENST00000448276;ENST00000225742;ENST00000450364;ENST00000323347	T;T	0.46451	0.87;0.89	5.44	0.0222	0.14132	SWIB/MDM2 domain (2);	0.000000	0.85682	D	0.000000	T	0.49660	0.1570	L	0.39566	1.225	0.58432	D	0.999999	D;D;D	0.71674	0.99;0.998;0.998	D;D;D	0.83275	0.971;0.994;0.996	T	0.30475	-0.9977	10	0.30078	T	0.28	-11.5394	12.3299	0.55033	0.0:0.6996:0.0:0.3004	.	303;314;351	Q92925-3;B9EGA3;Q92925	.;.;SMRD2_HUMAN	D	351;293;314;303	ENSP00000392617:E351D;ENSP00000318451:E303D	ENSP00000225742:E293D	E	-	3	2	SMARCD2	59265289	0.997000	0.39634	0.995000	0.50966	0.000000	0.00434	0.611000	0.24268	-0.042000	0.13535	-2.048000	0.00412	GAG		0.602	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444544.1	NM_001098426		3	9	0	0	0	0.009096	0	3	9				
SCN4A	6329	broad.mit.edu	37	17	62022372	62022372	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:62022372G>C	ENST00000435607.1	-	20	3845	c.3769C>G	c.(3769-3771)Cgg>Ggg	p.R1257G	SCN4A_ENST00000578147.1_Missense_Mutation_p.R1257G	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1257					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCACCTCCCGGGAGTCCACG	0.617																																							uc002jds.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(3769-3771)CGG>GGG		voltage-gated sodium channel type 4 alpha	Lamotrigine(DB00555)						57.0	65.0	62.0					17																	62022372		2088	4241	6329	SO:0001583	missense	6329				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr17:62022372G>C	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3769C>G	17.37:g.62022372G>C	ENSP00000396320:p.Arg1257Gly		Somatic					p.R1257G	NM_000334	NP_000325	WXS	Illumina HiSeq	Unspecified	P35499	SCN4A_HUMAN			20	3846	-			1257			III.		Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	c.3769C>G	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	G	19.27	3.796281	0.70567	.	.	ENSG00000007314	ENST00000435607	D	0.98090	-4.71	3.6	3.6	0.41247	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98311	0.9440	M	0.85041	2.73	0.49051	D	0.999749	D	0.64830	0.994	P	0.58013	0.831	D	0.99066	1.0832	10	0.87932	D	0	.	14.7605	0.69602	0.0:0.0:1.0:0.0	.	1257	P35499	SCN4A_HUMAN	G	1257	ENSP00000396320:R1257G	ENSP00000396320:R1257G	R	-	1	2	SCN4A	59376104	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.842000	0.48230	2.015000	0.59207	0.561000	0.74099	CGG		0.617	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334		6	36	0	0	0	0.001168	0	6	36				
MAP2K6	5608	broad.mit.edu	37	17	67532289	67532289	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:67532289C>A	ENST00000590474.1	+	11	1202	c.915C>A	c.(913-915)taC>taA	p.Y305*	MAP2K6_ENST00000589647.1_Nonsense_Mutation_p.Y249*	NM_002758.3	NP_002749.2	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6	305	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cell cycle arrest (GO:0007050)|cellular response to sorbitol (GO:0072709)|DNA damage induced protein phosphorylation (GO:0006975)|innate immune response (GO:0045087)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to ischemia (GO:0002931)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	20	Breast(10;6.05e-10)					GGCCTACATACCCAGAGCTAA	0.318																																							uc002jij.2		NA																	0				lung(2)|stomach(1)|ovary(1)|pancreas(1)	5						c.(913-915)TAC>TAA		mitogen-activated protein kinase kinase 6							135.0	129.0	131.0					17																	67532289		2203	4300	6503	SO:0001587	stop_gained	5608				activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr17:67532289C>A	U39064	CCDS11686.1	17q	2011-06-09						"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6846	protein-coding gene	gene with protein product	"""protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6)"""	601254		PRKMK6		8621675	Standard	XM_005257515		Approved	MEK6, MKK6, SAPKK3, MAPKK6	uc002jij.3	P52564		ENST00000590474.1:c.915C>A	17.37:g.67532289C>A	ENSP00000468348:p.Tyr305*		Somatic					p.Y305*	NM_002758	NP_002749	WXS	Illumina HiSeq	Unspecified	P52564	MP2K6_HUMAN			11	1203	+	Breast(10;6.05e-10)		305			Protein kinase.			Nonsense_Mutation	SNP	ENST00000590474.1	37	c.915C>A	CCDS11686.1	.	.	.	.	.	.	.	.	.	.	C	35	5.450132	0.96205	.	.	ENSG00000108984	ENST00000359094	.	.	.	5.91	-1.24	0.09435	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.9705	11.5024	0.50446	0.0:0.4867:0.0:0.5133	.	.	.	.	X	305	.	.	Y	+	3	2	MAP2K6	65043884	0.984000	0.35163	0.986000	0.45419	0.584000	0.36387	0.264000	0.18497	-0.060000	0.13132	-0.793000	0.03317	TAC		0.318	MAP2K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450689.1	NM_002758		15	150	1	0	1.15088e-07	0.004007	1.39164e-07	15	150				
ASPSCR1	79058	broad.mit.edu	37	17	79954652	79954652	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:79954652G>T	ENST00000306739.4	+	7	960	c.863G>T	c.(862-864)gGc>gTc	p.G288V	ASPSCR1_ENST00000306729.7_Missense_Mutation_p.G288V|ASPSCR1_ENST00000580534.1_Missense_Mutation_p.G211V	NM_024083.3	NP_076988.1	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region, candidate 1	288					glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|regulation of glucose import (GO:0046324)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)			ASPSCR1/TFE3(167)	breast(2)|large_intestine(2)	4	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			TCCAAGTCGGGCCAGGATCCC	0.647			T	TFE3	alveolar soft part sarcoma																																		uc002kcx.2		NA		Dom	yes		17	17q25	79058	T	"""alveolar soft part sarcoma chromosome region, candidate 1"""			M	TFE3		alveolar soft part sarcoma	ASPSCR1/TFE3(161)	0				soft_tissue(118)|kidney(43)|breast(1)	162						c.(862-864)GGC>GTC		alveolar soft part sarcoma chromosome region,							37.0	45.0	42.0					17																	79954652		2200	4297	6497	SO:0001583	missense	79058						protein binding	g.chr17:79954652G>T	AF324219	CCDS11796.1, CCDS58611.1	17q25	2011-06-28				ENSG00000169696		"""UBX domain containing"""	13825	protein-coding gene	gene with protein product	"""UBX domain protein 9"""	606236				11244503, 10506710	Standard	NM_024083		Approved	ASPS, ASPL, UBXD9, UBXN9	uc002kcy.3	Q9BZE9		ENST00000306739.4:c.863G>T	17.37:g.79954652G>T	ENSP00000302176:p.Gly288Val		Somatic				ASPSCR1_uc002kcw.1_Missense_Mutation_p.G288V|ASPSCR1_uc002kcy.2_Missense_Mutation_p.G288V|ASPSCR1_uc002kcz.2_Missense_Mutation_p.G182V|ASPSCR1_uc002kda.2_Missense_Mutation_p.G211V|ASPSCR1_uc002kdb.1_Missense_Mutation_p.G211V	p.G288V	NM_024083	NP_076988	WXS	Illumina HiSeq	Unspecified	Q9BZE9	ASPC1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)		7	960	+	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		288					A8K3K9|Q7Z6N7|Q8WV59|Q96LS5|Q96M40	Missense_Mutation	SNP	ENST00000306739.4	37	c.863G>T	CCDS11796.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.797509	0.31777	.	.	ENSG00000169696	ENST00000306739;ENST00000306729;ENST00000344865	T;T	0.09723	2.95;2.95	4.79	4.79	0.61399	.	0.891112	0.10052	N	0.722105	T	0.30665	0.0772	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;0.999;1.0	D;D;D;D;D	0.77557	0.99;0.974;0.99;0.966;0.985	T	0.00398	-1.1764	10	0.29301	T	0.29	-15.4246	15.7589	0.78063	0.0:0.0:1.0:0.0	.	211;211;288;288;211	Q9BZE9-3;Q9BZE9-4;Q9BZE9-2;Q9BZE9;C9JAL9	.;.;.;ASPC1_HUMAN;.	V	288;288;211	ENSP00000302176:G288V;ENSP00000306625:G288V	ENSP00000306625:G288V	G	+	2	0	ASPSCR1	77547941	1.000000	0.71417	0.486000	0.27416	0.667000	0.39255	5.845000	0.69437	2.466000	0.83321	0.561000	0.74099	GGC		0.647	ASPSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441972.1	NM_024083		10	156	1	0	0.00829132	0.008291	0.00873995	10	156				
ANKRD30B	374860	broad.mit.edu	37	18	14851707	14851707	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr18:14851707C>T	ENST00000358984.4	+	36	3587	c.3407C>T	c.(3406-3408)aCa>aTa	p.T1136I		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1136										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AAACAGAAAACAGTAACAAAA	0.358																																							uc010dlo.2		NA																	0				ovary(1)|skin(1)	2						c.(3406-3408)ACA>ATA		ankyrin repeat domain 30B							53.0	42.0	45.0					18																	14851707		692	1590	2282	SO:0001583	missense	374860							g.chr18:14851707C>T	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3407C>T	18.37:g.14851707C>T	ENSP00000351875:p.Thr1136Ile		Somatic				ANKRD30B_uc010xal.1_Missense_Mutation_p.T278I	p.T1136I	NM_001145029	NP_001138501	WXS	Illumina HiSeq	Unspecified	Q9BXX2	AN30B_HUMAN			36	3587	+			1221			Potential.		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.3407C>T	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	C	2.393	-0.339387	0.05243	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.14893	2.47	1.39	1.39	0.22231	.	.	.	.	.	T	0.28699	0.0711	L	0.48642	1.525	0.80722	D	1	D;D	0.69078	0.994;0.997	D;D	0.68483	0.953;0.958	T	0.04229	-1.0967	9	0.59425	D	0.04	.	8.7313	0.34501	0.0:1.0:0.0:0.0	.	1221;1136	Q9BXX2;F8WAG3	AN30B_HUMAN;.	I	1136;530;556	ENSP00000351875:T1136I	ENSP00000277669:T556I	T	+	2	0	ANKRD30B	14841707	0.995000	0.38212	0.107000	0.21349	0.058000	0.15608	2.201000	0.42734	1.076000	0.40961	0.173000	0.16961	ACA		0.358	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		9	53	0	0	0	0.006214	0	9	53				
DSC2	1824	broad.mit.edu	37	18	28666625	28666625	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr18:28666625C>A	ENST00000280904.6	-	7	1299	c.856G>T	c.(856-858)Ggg>Tgg	p.G286W	DSC2_ENST00000251081.6_Missense_Mutation_p.G286W	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	286	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			GGCACCTGCCCAATGATGGAG	0.473																																							uc002kwl.3		NA																	0				ovary(2)|skin(1)	3						c.(856-858)GGG>TGG		desmocollin 2 isoform Dsc2a preproprotein							298.0	247.0	264.0					18																	28666625		2203	4300	6503	SO:0001583	missense	1824				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28666625C>A	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.856G>T	18.37:g.28666625C>A	ENSP00000280904:p.Gly286Trp		Somatic				DSC2_uc002kwk.3_Missense_Mutation_p.G286W	p.G286W	NM_024422	NP_077740	WXS	Illumina HiSeq	Unspecified	Q02487	DSC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.0241)		7	1310	-			286			Extracellular (Potential).|Cadherin 2.			Missense_Mutation	SNP	ENST00000280904.6	37	c.856G>T	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.388620	0.42308	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.54479	0.57;0.57	5.61	3.8	0.43715	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.64216	0.2578	M	0.68593	2.085	0.23406	N	0.997741	D;D	0.60160	0.987;0.983	P;P	0.58520	0.84;0.753	T	0.55140	-0.8187	9	0.87932	D	0	.	9.4487	0.38712	0.1531:0.5511:0.2958:0.0	.	286;286	Q02487;Q02487-2	DSC2_HUMAN;.	W	286;286;52;299	ENSP00000251081:G286W;ENSP00000280904:G286W	ENSP00000251081:G286W	G	-	1	0	DSC2	26920623	0.290000	0.24343	0.528000	0.27938	0.128000	0.20619	1.055000	0.30467	0.699000	0.31761	0.655000	0.94253	GGG		0.473	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949		38	68	1	0	1.04594e-18	0.00623	1.53677e-18	38	68				
STARD6	147323	broad.mit.edu	37	18	51858176	51858176	+	Silent	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr18:51858176G>C	ENST00000581310.1	-	7	694	c.321C>G	c.(319-321)tcC>tcG	p.S107S	STARD6_ENST00000307844.3_Silent_p.S107S|STARD6_ENST00000580990.2_Missense_Mutation_p.P15A			P59095	STAR6_HUMAN	StAR-related lipid transfer (START) domain containing 6	107	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				lipid transport (GO:0006869)		lipid binding (GO:0008289)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)	8				Colorectal(16;0.021)|READ - Rectum adenocarcinoma(59;0.188)		AGTCTCGAGGGGAAATGGAGC	0.368																																							uc010xdt.1		NA																	0				ovary(1)	1						c.(319-321)TCC>TCG		START domain containing protein 6							117.0	108.0	111.0					18																	51858176		2203	4300	6503	SO:0001819	synonymous_variant	147323				lipid transport		lipid binding	g.chr18:51858176G>C	AF480305	CCDS11955.1	18q21.2	2011-09-12	2007-08-16		ENSG00000174448	ENSG00000174448		"""StAR-related lipid transfer (START) domain containing"""	18066	protein-coding gene	gene with protein product		607051	"""START domain containing 6"""			12011452	Standard	NM_139171		Approved		uc010xdt.2	P59095	OTTHUMG00000132702	ENST00000581310.1:c.321C>G	18.37:g.51858176G>C			Somatic					p.S107S	NM_139171	NP_631910	WXS	Illumina HiSeq	Unspecified	P59095	STAR6_HUMAN		Colorectal(16;0.021)|READ - Rectum adenocarcinoma(59;0.188)	4	321	-			107			START.			Silent	SNP	ENST00000581310.1	37	c.321C>G	CCDS11955.1																																																																																				0.368	STARD6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256000.3	NM_139171		19	31	0	0	0	0.008871	0	19	31				
SERPINB11	89778	broad.mit.edu	37	18	61379925	61379925	+	RNA	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr18:61379925C>T	ENST00000382749.5	+	0	600				SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000538847.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				GGCATTTCATCAGGTAAGTCC	0.433																																					Ovarian(27;496 784 5942 8975 23930)	Ovarian(27;496 784 5942 8975 23930)	uc002ljk.3		NA																	0				breast(1)	1						c.(355-357)CAG>TAG		serpin peptidase inhibitor, clade B, member 11							104.0	100.0	101.0					18																	61379925		1905	4122	6027			89778				regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity	g.chr18:61379925C>T			18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61379925C>T			Somatic				SERPINB11_uc010xes.1_5'UTR|SERPINB11_uc010dqd.2_Nonsense_Mutation_p.Q5*|SERPINB11_uc002ljj.3_Nonsense_Mutation_p.Q5*|SERPINB11_uc010dqe.2_Nonsense_Mutation_p.Q5*|SERPINB11_uc010dqf.2_Intron	p.Q119*	NM_080475	NP_536723	WXS	Illumina HiSeq	Unspecified	Q96P15	SPB11_HUMAN			5	417	+		Esophageal squamous(42;0.129)	119					A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Nonsense_Mutation	SNP	ENST00000382749.5	37	c.355C>T		.	.	.	.	.	.	.	.	.	.	C	17.18	3.322719	0.60634	.	.	ENSG00000206072	ENST00000544088	.	.	.	5.44	-0.0403	0.13872	.	.	.	.	.	.	.	.	.	.	.	0.42125	D	0.991446	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	13.4004	0.60879	0.1266:0.2906:0.5828:0.0	.	.	.	.	X	119	.	ENSP00000421854:Q119X	Q	+	1	0	SERPINB11	59530905	0.055000	0.20627	0.512000	0.27736	0.007000	0.05969	0.007000	0.13174	-0.322000	0.08615	-0.340000	0.08031	CAG		0.433	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000207392.3	NM_080475		6	63	0	0	0	0.001168	0	6	63				
AMH	268	broad.mit.edu	37	19	2251711	2251711	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:2251711C>T	ENST00000221496.4	+	5	1460	c.1438C>T	c.(1438-1440)Ccc>Tcc	p.P480S	MIR4321_ENST00000592276.1_RNA	NM_000479.3	NP_000470	P03971	MIS_HUMAN	anti-Mullerian hormone	480					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			lung(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTACTCATCCCCGAGACCTA	0.716									Persistant Mullerian Duct Syndrome (type I and II)																														uc002lvh.2		NA																	0					0						c.(1438-1440)CCC>TCC		anti-Mullerian hormone precursor							30.0	31.0	31.0					19																	2251711		2202	4299	6501	SO:0001583	missense	268	Persistant_Mullerian_Duct_Syndrome_(type_I_and_II)	Familial Cancer Database	PMDS, Persistent Oviduct Syndrome	cell differentiation|cell-cell signaling|gonadal mesoderm development|Mullerian duct regression|positive regulation of gene expression|sex determination	extracellular space	growth factor activity|hormone activity	g.chr19:2251711C>T	K03474	CCDS12085.1	19p13.3	2014-01-30				ENSG00000104899		"""Endogenous ligands"""	464	protein-coding gene	gene with protein product		600957				3754790, 18784351	Standard	NM_000479		Approved	MIS	uc002lvh.2	P03971		ENST00000221496.4:c.1438C>T	19.37:g.2251711C>T	ENSP00000221496:p.Pro480Ser		Somatic					p.P480S	NM_000479	NP_000470	WXS	Illumina HiSeq	Unspecified	P03971	MIS_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1657	+		Hepatocellular(1079;0.137)	480					O75246|Q6GTN3	Missense_Mutation	SNP	ENST00000221496.4	37	c.1438C>T	CCDS12085.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700603	0.68501	.	.	ENSG00000104899	ENST00000221496	D	0.90444	-2.67	3.77	3.77	0.43336	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	U	0.000000	D	0.95843	0.8647	M	0.89601	3.045	0.47245	D	0.99936	D	0.89917	1.0	D	0.91635	0.999	D	0.96794	0.9584	10	0.87932	D	0	-20.236	14.6433	0.68742	0.0:1.0:0.0:0.0	.	480	P03971	MIS_HUMAN	S	480	ENSP00000221496:P480S	ENSP00000221496:P480S	P	+	1	0	AMH	2202711	1.000000	0.71417	0.998000	0.56505	0.666000	0.39218	2.580000	0.46068	1.680000	0.50976	0.306000	0.20318	CCC		0.716	AMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451276.3	NM_000479		6	27	0	0	0	0.006214	0	6	27				
CACTIN	58509	broad.mit.edu	37	19	3623819	3623819	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:3623819C>A	ENST00000429344.2	-	2	561	c.509G>T	c.(508-510)cGg>cTg	p.R170L	CACTIN_ENST00000221899.3_Missense_Mutation_p.R102L|CACTIN_ENST00000248420.5_Missense_Mutation_p.R170L	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	170					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CTTGGCCAGCCGCCGTGCGCG	0.657																																							uc002lyh.2		NA																	0					0						c.(508-510)CGG>CTG		chromosome 19 open reading frame 29							30.0	37.0	35.0					19																	3623819		2100	4208	6308	SO:0001583	missense	58509					catalytic step 2 spliceosome	protein binding	g.chr19:3623819C>A	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.509G>T	19.37:g.3623819C>A	ENSP00000415078:p.Arg170Leu		Somatic				C19orf29_uc010dtn.2_5'Flank|C19orf29_uc002lyi.3_Missense_Mutation_p.R170L|C19orf29_uc010dto.2_RNA	p.R170L	NM_001080543	NP_001074012	WXS	Illumina HiSeq	Unspecified	Q8WUQ7	CS029_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	2	562	-		Hepatocellular(1079;0.137)	170			Potential.		A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	37	c.509G>T	CCDS45920.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.640527	0.67244	.	.	ENSG00000105298	ENST00000429344;ENST00000248420;ENST00000221899	.	.	.	5.09	4.02	0.46733	.	0.199468	0.41938	D	0.000790	T	0.78541	0.4299	M	0.84773	2.715	0.58432	D	0.999998	D	0.65815	0.995	P	0.61592	0.891	T	0.82692	-0.0331	9	0.87932	D	0	.	14.2517	0.66023	0.0:0.8497:0.1503:0.0	.	170	Q8WUQ7	CS029_HUMAN	L	170;170;102	.	ENSP00000221899:R102L	R	-	2	0	C19orf29	3574819	1.000000	0.71417	0.954000	0.39281	0.160000	0.22226	7.687000	0.84139	1.082000	0.41137	0.561000	0.74099	CGG		0.657	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2			8	25	1	0	0.000157383	0.00308	0.000174281	8	25				
MATK	4145	broad.mit.edu	37	19	3779703	3779703	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:3779703C>A	ENST00000310132.6	-	9	1233	c.835G>T	c.(835-837)Gtc>Ttc	p.V279F	MATK_ENST00000395040.2_Missense_Mutation_p.V238F|MATK_ENST00000585778.1_Missense_Mutation_p.V279F|MATK_ENST00000395045.2_Missense_Mutation_p.V280F	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	279	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CACGTCATGACGGCCGTCTCG	0.667																																							uc002lyt.2		NA																	0				stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5						c.(835-837)GTC>TTC		megakaryocyte-associated tyrosine kinase isoform							53.0	52.0	52.0					19																	3779703		2203	4300	6503	SO:0001583	missense	4145				cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr19:3779703C>A	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.835G>T	19.37:g.3779703C>A	ENSP00000308734:p.Val279Phe		Somatic				MATK_uc002lyv.2_Missense_Mutation_p.V280F|MATK_uc002lyu.2_Missense_Mutation_p.V238F|MATK_uc010dtq.2_Missense_Mutation_p.V279F	p.V279F	NM_139355	NP_647612	WXS	Illumina HiSeq	Unspecified	P42679	MATK_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)	9	1235	-		Hepatocellular(1079;0.137)	279			Protein kinase.		B3KNZ9|Q9NST8	Missense_Mutation	SNP	ENST00000310132.6	37	c.835G>T	CCDS12114.1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.814924	0.32053	.	.	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	T;T;T	0.63744	-0.06;-0.06;-0.06	4.07	4.07	0.47477	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.083864	0.48286	U	0.000197	T	0.54631	0.1870	L	0.42529	1.33	0.44711	D	0.9977	P;B;P	0.37781	0.608;0.421;0.608	B;B;B	0.39971	0.315;0.249;0.315	T	0.60662	-0.7219	10	0.87932	D	0	-40.4293	9.5275	0.39173	0.0:0.9001:0.0:0.0999	.	279;280;279	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	F	280;279;238	ENSP00000378485:V280F;ENSP00000308734:V279F;ENSP00000378481:V238F	ENSP00000308734:V279F	V	-	1	0	MATK	3730703	1.000000	0.71417	0.991000	0.47740	0.151000	0.21798	4.421000	0.59848	2.004000	0.58718	0.306000	0.20318	GTC		0.667	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453639.1	NM_139355		14	41	1	0	3.27435e-08	0.00245	4.03351e-08	14	41				
ZNF560	147741	broad.mit.edu	37	19	9578992	9578992	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:9578992C>T	ENST00000301480.4	-	10	844	c.631G>A	c.(631-633)Gag>Aag	p.E211K		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	211					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TAGAGTTCCTCTCCATTTTGG	0.363																																							uc002mlp.1		NA																	0				skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						c.(631-633)GAG>AAG		zinc finger protein 560							74.0	59.0	64.0					19																	9578992		2203	4300	6503	SO:0001583	missense	147741				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9578992C>T	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.631G>A	19.37:g.9578992C>T	ENSP00000301480:p.Glu211Lys		Somatic				ZNF560_uc010dwr.1_Missense_Mutation_p.E105K	p.E211K	NM_152476	NP_689689	WXS	Illumina HiSeq	Unspecified	Q96MR9	ZN560_HUMAN			10	841	-			211					Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	c.631G>A	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.298886	0.23650	.	.	ENSG00000198028	ENST00000301480	T	0.29142	1.58	2.15	1.03	0.20045	.	.	.	.	.	T	0.24699	0.0599	L	0.54323	1.7	0.09310	N	1	P	0.39216	0.664	B	0.33454	0.164	T	0.09773	-1.0659	9	0.46703	T	0.11	.	8.4465	0.32845	0.0:0.7555:0.2445:0.0	.	211	Q96MR9	ZN560_HUMAN	K	211	ENSP00000301480:E211K	ENSP00000301480:E211K	E	-	1	0	ZNF560	9439992	0.000000	0.05858	0.001000	0.08648	0.149000	0.21700	0.072000	0.14617	0.421000	0.25980	0.561000	0.74099	GAG		0.363	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		15	48	0	0	0	0.003163	0	15	48				
OR7A17	26333	broad.mit.edu	37	19	14991763	14991763	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:14991763G>A	ENST00000327462.2	-	1	501	c.405C>T	c.(403-405)atC>atT	p.I135I		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					GAGGGTTCATGATGACTGTGT	0.488																																							uc010xob.1		NA																	0					0						c.(403-405)ATC>ATT		olfactory receptor, family 7, subfamily A,							117.0	111.0	113.0					19																	14991763		2203	4300	6503	SO:0001819	synonymous_variant	26333				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:14991763G>A	X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.405C>T	19.37:g.14991763G>A			Somatic					p.I135I	NM_030901	NP_112163	WXS	Illumina HiSeq	Unspecified	O14581	OR7AH_HUMAN			1	405	-	Ovarian(108;0.203)		135			Cytoplasmic (Potential).		Q6IFQ6|Q96R98	Silent	SNP	ENST00000327462.2	37	c.405C>T	CCDS12319.1																																																																																				0.488	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466523.1	NM_030901		39	43	0	0	0	0.004878	0	39	43				
ZNF536	9745	broad.mit.edu	37	19	31025799	31025799	+	Missense_Mutation	SNP	C	C	G	rs144474545	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:31025799C>G	ENST00000355537.3	+	3	2363	c.2216C>G	c.(2215-2217)gCg>gGg	p.A739G		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	739					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CAGCAACCAGCGCTGCTTCGC	0.567																																							uc002nsu.1		NA																	0		p.A739A(1)		ovary(7)|large_intestine(2)|skin(2)	11						c.(2215-2217)GCG>GGG		zinc finger protein 536							115.0	116.0	116.0					19																	31025799		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31025799C>G		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2216C>G	19.37:g.31025799C>G	ENSP00000347730:p.Ala739Gly		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.A739G	p.A739G	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			3	2354	+	Esophageal squamous(110;0.0834)		739					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.2216C>G	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939460	0.34189	.	.	ENSG00000198597	ENST00000355537	T	0.08807	3.05	5.81	4.78	0.61160	.	0.166898	0.53938	D	0.000042	T	0.06600	0.0169	N	0.14661	0.345	0.39772	D	0.97217	D;D	0.54601	0.967;0.967	B;B	0.42386	0.386;0.386	T	0.43750	-0.9372	10	0.38643	T	0.18	-22.012	14.9999	0.71464	0.0:0.9318:0.0:0.0682	.	739;739	A7E228;O15090	.;ZN536_HUMAN	G	739	ENSP00000347730:A739G	ENSP00000347730:A739G	A	+	2	0	ZNF536	35717639	0.992000	0.36948	0.825000	0.32803	0.888000	0.51559	5.773000	0.68898	1.457000	0.47850	0.591000	0.81541	GCG		0.567	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		26	168	0	0	0	0.00333	0	26	168				
ZNF536	9745	broad.mit.edu	37	19	31040344	31040344	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:31040344C>T	ENST00000355537.3	+	4	3965	c.3818C>T	c.(3817-3819)tCt>tTt	p.S1273F		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1273					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.S1273F(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GCCTACAGTTCTGATGGCTTA	0.557																																							uc002nsu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(2)|skin(2)	11						c.(3817-3819)TCT>TTT		zinc finger protein 536							40.0	39.0	39.0					19																	31040344		2193	4280	6473	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31040344C>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3818C>T	19.37:g.31040344C>T	ENSP00000347730:p.Ser1273Phe		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.S1273F	p.S1273F	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	3956	+	Esophageal squamous(110;0.0834)		1273					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.3818C>T	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.201876	0.38905	.	.	ENSG00000198597	ENST00000355537	T	0.10192	2.9	5.01	3.94	0.45596	.	0.309941	0.34879	N	0.003610	T	0.09512	0.0234	L	0.29908	0.895	0.34513	D	0.70736	P;P	0.37955	0.612;0.612	B;B	0.33890	0.172;0.172	T	0.14420	-1.0473	10	0.87932	D	0	-1.6265	15.5019	0.75705	0.0:0.8502:0.1498:0.0	.	1273;1273	A7E228;O15090	.;ZN536_HUMAN	F	1273	ENSP00000347730:S1273F	ENSP00000347730:S1273F	S	+	2	0	ZNF536	35732184	0.992000	0.36948	0.093000	0.20910	0.869000	0.49853	3.725000	0.54970	1.027000	0.39758	0.650000	0.86243	TCT		0.557	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		11	50	0	0	0	0.001855	0	11	50				
TSHZ3	57616	broad.mit.edu	37	19	31767742	31767742	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:31767742C>G	ENST00000240587.4	-	2	3284	c.2957G>C	c.(2956-2958)aGg>aCg	p.R986T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	986					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GGAAGGAGTCCTGATTTGGGA	0.483																																							uc002nsy.3		NA																	0				ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(2956-2958)AGG>ACG		zinc finger protein 537							101.0	90.0	94.0					19																	31767742		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31767742C>G	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2957G>C	19.37:g.31767742C>G	ENSP00000240587:p.Arg986Thr		Somatic					p.R986T	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	3022	-	Esophageal squamous(110;0.226)		986			C2H2-type 4.		Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.2957G>C	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266533	0.80358	.	.	ENSG00000121297	ENST00000240587	T	0.20069	2.1	5.84	5.84	0.93424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.46210	0.1381	L	0.57536	1.79	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	T	0.27971	-1.0058	10	0.87932	D	0	-39.9546	20.1434	0.98067	0.0:1.0:0.0:0.0	.	986	Q63HK5	TSH3_HUMAN	T	986	ENSP00000240587:R986T	ENSP00000240587:R986T	R	-	2	0	TSHZ3	36459582	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.461000	0.80834	2.760000	0.94817	0.591000	0.81541	AGG		0.483	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		17	67	0	0	0	0.008871	0	17	67				
ZNF567	163081	broad.mit.edu	37	19	37210634	37210634	+	Silent	SNP	G	G	T	rs117657033	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:37210634G>T	ENST00000536254.2	+	6	1230	c.1008G>T	c.(1006-1008)tcG>tcT	p.S336S	ZNF567_ENST00000585696.1_Silent_p.S305S|ZNF567_ENST00000588311.1_Silent_p.S305S|ZNF567_ENST00000392163.2_Silent_p.S305S|ZNF567_ENST00000360729.4_Silent_p.S305S|ZNF850_ENST00000589390.1_Intron			Q8N184	ZN567_HUMAN	zinc finger protein 567	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GGGAGAAATCGTATGAATGTC	0.453																																							uc010xtl.1		NA																	0					0						c.(1006-1008)TCG>TCT		zinc finger protein 567							73.0	68.0	69.0					19																	37210634		2203	4300	6503	SO:0001819	synonymous_variant	163081				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37210634G>T	AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.1008G>T	19.37:g.37210634G>T			Somatic				ZNF567_uc002oeo.1_Silent_p.S336S|ZNF567_uc010xtk.1_Silent_p.S336S|ZNF567_uc002oep.3_Silent_p.S305S|ZNF567_uc002oeq.1_Silent_p.S305S	p.S336S	NM_152603	NP_689816	WXS	Illumina HiSeq	Unspecified	Q8N184	ZN567_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		6	1230	+	Esophageal squamous(110;0.198)		336					B3KX49|Q6N044	Silent	SNP	ENST00000536254.2	37	c.1008G>T																																																																																					0.453	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603		8	63	1	0	0.000274275	0.004482	0.000299935	8	63				
FCGBP	8857	broad.mit.edu	37	19	40433095	40433095	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:40433095A>T	ENST00000221347.6	-	2	1181	c.1174T>A	c.(1174-1176)Tcg>Acg	p.S392T		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	392	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCAGCATACGAGAACTCACTG	0.612																																							uc002omp.3		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(1174-1176)TCG>ACG		Fc fragment of IgG binding protein precursor							121.0	92.0	102.0					19																	40433095		2203	4300	6503	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40433095A>T	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.1174T>A	19.37:g.40433095A>T	ENSP00000221347:p.Ser392Thr		Somatic					p.S392T	NM_003890	NP_003881	WXS	Illumina HiSeq	Unspecified	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		2	1182	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		392			IgGFc-binding.		O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.1174T>A	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	A	8.719	0.913994	0.17907	.	.	ENSG00000090920	ENST00000221347	T	0.21361	2.01	4.36	4.36	0.52297	.	0.100480	0.40818	N	0.001012	T	0.37892	0.1020	L	0.57536	1.79	0.25532	N	0.987263	D	0.63880	0.993	D	0.72625	0.978	T	0.18366	-1.0339	10	0.15952	T	0.53	.	13.4903	0.61390	1.0:0.0:0.0:0.0	.	392	Q9Y6R7	FCGBP_HUMAN	T	392	ENSP00000221347:S392T	ENSP00000221347:S392T	S	-	1	0	FCGBP	45124935	1.000000	0.71417	0.990000	0.47175	0.181000	0.23173	6.970000	0.76099	2.192000	0.70111	0.533000	0.62120	TCG		0.612	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		5	47	0	0	0	0.000602	0	5	47				
CYP2A13	1553	broad.mit.edu	37	19	41599626	41599626	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:41599626C>A	ENST00000330436.3	+	6	923	c.923C>A	c.(922-924)aCc>aAc	p.T308N		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	308					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	ACCGTGAGCACCACCCTGCGC	0.562																																							uc002opt.2		NA																	0				ovary(2)|skin(1)	3						c.(922-924)ACC>AAC		cytochrome P450, family 2, subfamily A,	Clomipramine(DB01242)|Nicotine(DB00184)						107.0	89.0	95.0					19																	41599626		2203	4300	6503	SO:0001583	missense	1553				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding	g.chr19:41599626C>A	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.923C>A	19.37:g.41599626C>A	ENSP00000332679:p.Thr308Asn		Somatic					p.T308N	NM_000766	NP_000757	WXS	Illumina HiSeq	Unspecified	Q16696	CP2AD_HUMAN			6	932	+			308					Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	37	c.923C>A	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	13.54	2.268648	0.40095	.	.	ENSG00000197838	ENST00000330436	T	0.69561	-0.41	4.58	2.41	0.29592	.	0.207181	0.39083	N	0.001464	T	0.64427	0.2597	L	0.38733	1.17	0.27816	N	0.941964	P	0.41345	0.746	P	0.51101	0.659	T	0.59542	-0.7435	10	0.72032	D	0.01	.	9.0755	0.36519	0.0:0.7677:0.1483:0.0839	.	308	Q16696	CP2AD_HUMAN	N	308	ENSP00000332679:T308N	ENSP00000332679:T308N	T	+	2	0	CYP2A13	46291466	0.323000	0.24643	0.016000	0.15963	0.145000	0.21501	2.133000	0.42093	0.555000	0.29079	0.485000	0.47835	ACC		0.562	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766		12	78	1	0	7.03913e-09	0.001368	8.83671e-09	12	78				
ATP1A3	478	broad.mit.edu	37	19	42492646	42492646	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:42492646G>T	ENST00000302102.5	-	2	225	c.75C>A	c.(73-75)ctC>ctA	p.L25L	ATP1A3_ENST00000545399.1_Silent_p.L38L|ATP1A3_ENST00000468774.2_5'UTR|ATP1A3_ENST00000602133.1_5'UTR|ATP1A3_ENST00000543770.1_Silent_p.L36L	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	25					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						CCTCCTTCTTGAGGTCATCCA	0.597																																							uc002osg.2		NA																	0				ovary(1)|pancreas(1)	2						c.(73-75)CTC>CTA		Na+/K+ -ATPase alpha 3 subunit							305.0	245.0	265.0					19																	42492646		2203	4300	6503	SO:0001819	synonymous_variant	478				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr19:42492646G>T		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.75C>A	19.37:g.42492646G>T			Somatic				ATP1A3_uc010xwf.1_Silent_p.L36L|ATP1A3_uc010xwg.1_5'UTR|ATP1A3_uc010xwh.1_Silent_p.L38L|ATP1A3_uc002osh.2_Silent_p.L25L	p.L25L	NM_152296	NP_689509	WXS	Illumina HiSeq	Unspecified	P13637	AT1A3_HUMAN			2	229	-			25			Cytoplasmic (Potential).		B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Silent	SNP	ENST00000302102.5	37	c.75C>A	CCDS12594.1																																																																																				0.597	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296		11	265	1	0	1.58986e-06	0.008291	1.87085e-06	11	265				
PSG1	5669	broad.mit.edu	37	19	43373130	43373130	+	Missense_Mutation	SNP	C	C	T	rs369332823		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:43373130C>T	ENST00000436291.2	-	4	882	c.766G>A	c.(766-768)Gat>Aat	p.D256N	PSG1_ENST00000312439.6_Missense_Mutation_p.D256N|PSG1_ENST00000403380.3_Missense_Mutation_p.D163N|PSG1_ENST00000595356.1_Missense_Mutation_p.D256N|PSG1_ENST00000244296.2_Missense_Mutation_p.D256N|PSG1_ENST00000595124.1_Missense_Mutation_p.D163N	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	256	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				TTTAAGACATCCTTATTCTCC	0.493																																							uc002ovb.2		NA																	0				ovary(2)	2						c.(766-768)GAT>AAT		pregnancy specific beta-1-glycoprotein 1							237.0	254.0	248.0					19																	43373130		1509	2709	4218	SO:0001583	missense	5669				female pregnancy	extracellular region		g.chr19:43373130C>T		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.766G>A	19.37:g.43373130C>T	ENSP00000413041:p.Asp256Asn		Somatic				PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Missense_Mutation_p.D256N|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_RNA|PSG1_uc002our.1_Missense_Mutation_p.D256N|PSG1_uc010eio.1_Missense_Mutation_p.D256N|PSG1_uc002oux.1_Missense_Mutation_p.D185N|PSG1_uc002ouy.1_Intron|PSG1_uc002ouz.1_Missense_Mutation_p.D256N|PSG1_uc002ova.1_Missense_Mutation_p.D163N|PSG1_uc002ovc.2_Missense_Mutation_p.D163N|PSG1_uc002ovd.1_Missense_Mutation_p.D256N	p.D256N	NM_006905	NP_008836	WXS	Illumina HiSeq	Unspecified	P11464	PSG1_HUMAN			4	904	-		Prostate(69;0.00682)	256			Ig-like C2-type 2.		O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	ENST00000436291.2	37	c.766G>A	CCDS54275.1	.	.	.	.	.	.	.	.	.	.	N	0.005	-2.142928	0.00332	.	.	ENSG00000231924	ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	T;T;T;T	0.10099	2.91;2.91;2.91;2.91	1.47	0.284	0.15701	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.24890	0.0604	M	0.87971	2.92	0.09310	N	1	B;P;P;B;D;B;B	0.76494	0.179;0.883;0.655;0.077;0.999;0.195;0.058	B;P;P;B;D;B;B	0.70016	0.083;0.871;0.679;0.363;0.967;0.381;0.105	T	0.36648	-0.9739	9	0.02654	T	1	.	5.045	0.14479	0.0:0.7784:0.0:0.2216	.	256;163;256;163;256;128;256	P11464-4;G5E9F7;P11464;Q8NBY8;P11464-3;B4DTG5;P11464-2	.;.;PSG1_HUMAN;.;.;.;.	N	256;163;256;256	ENSP00000413041:D256N;ENSP00000385386:D163N;ENSP00000308970:D256N;ENSP00000244296:D256N	ENSP00000244296:D256N	D	-	1	0	PSG1	48064970	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	0.033000	0.13754	-0.177000	0.10690	-1.109000	0.02080	GAT		0.493	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1			12	258	0	0	0	0.001368	0	12	258				
ZNF112	7771	broad.mit.edu	37	19	44833222	44833222	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:44833222C>A	ENST00000337401.4	-	5	1194	c.1106G>T	c.(1105-1107)aGt>aTt	p.S369I	ZNF112_ENST00000354340.4_Missense_Mutation_p.S363I|ZNF112_ENST00000536500.1_Missense_Mutation_p.S386I	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	369					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TAAGCTATGACTGAAGGCTTT	0.378																																						Melanoma(53;975 1202 7512 15993 27273)	uc010ejj.2		NA																	0				ovary(3)|skin(2)	5						c.(1105-1107)AGT>ATT		zinc finger protein 228 isoform 1							99.0	86.0	91.0					19																	44833222		2203	4300	6503	SO:0001583	missense	7771				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44833222C>A	AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.1106G>T	19.37:g.44833222C>A	ENSP00000337081:p.Ser369Ile		Somatic				ZFP112_uc002ozc.3_Missense_Mutation_p.S363I|ZFP112_uc010xwy.1_Missense_Mutation_p.S386I|ZFP112_uc010xwz.1_Missense_Mutation_p.S368I	p.S369I	NM_001083335	NP_001076804	WXS	Illumina HiSeq	Unspecified	Q9UJU3	ZF112_HUMAN			5	1219	-			369					A4FU53|Q9HCA7	Missense_Mutation	SNP	ENST00000337401.4	37	c.1106G>T	CCDS54276.1	.	.	.	.	.	.	.	.	.	.	C	9.284	1.048841	0.19827	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.06371	3.31;3.32;3.32	4.85	0.206	0.15208	.	0.598788	0.13929	N	0.353044	T	0.08358	0.0208	L	0.50919	1.6	0.09310	N	1	P;D;P	0.53151	0.93;0.958;0.93	P;P;P	0.51135	0.459;0.66;0.459	T	0.29701	-1.0003	10	0.19147	T	0.46	0.0185	4.6048	0.12372	0.0:0.3886:0.2852:0.3262	.	368;386;369	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	I	369;369;363;386;368	ENSP00000337081:S369I;ENSP00000346305:S363I;ENSP00000441990:S386I	ENSP00000253426:S368I	S	-	2	0	ZNF285	49525062	0.000000	0.05858	0.000000	0.03702	0.586000	0.36452	-2.244000	0.01193	0.065000	0.16485	-0.258000	0.10820	AGT		0.378	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380		4	71	1	0	0.00024832	0.009096	0.000272685	4	71				
TPRX1	284355	broad.mit.edu	37	19	48305244	48305244	+	Missense_Mutation	SNP	C	C	A	rs188760456		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:48305244C>A	ENST00000322175.3	-	2	1179	c.1024G>T	c.(1024-1026)Gac>Tac	p.D342Y	TPRX1_ENST00000535759.1_Missense_Mutation_p.D439Y|TPRX1_ENST00000543508.1_Missense_Mutation_p.D332Y	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	342						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		GGCAAGAAGTCGGAGGCATCG	0.612																																					Esophageal Squamous(123;175 2281 3051 32395)	Esophageal Squamous(123;175 2281 3051 32395)	uc002php.1		NA																	0					0						c.(1024-1026)GAC>TAC		tetra-peptide repeat homeobox							69.0	70.0	69.0					19																	48305244		2203	4300	6503	SO:0001583	missense	284355					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:48305244C>A		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.1024G>T	19.37:g.48305244C>A	ENSP00000323455:p.Asp342Tyr		Somatic					p.D342Y	NM_198479	NP_940881	WXS	Illumina HiSeq	Unspecified	Q8N7U7	TPRX1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)	2	1095	-		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)	342					A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	c.1024G>T	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	c	9.491	1.100803	0.20552	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.92858	-1.96;-3.12	1.27	-2.54	0.06307	.	.	.	.	.	D	0.87172	0.6111	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	P	0.61592	0.891	T	0.77824	-0.2444	9	0.72032	D	0.01	.	5.2186	0.15356	0.0:0.4193:0.0:0.5807	.	342	Q8N7U7	TPRX1_HUMAN	Y	342;439;332	ENSP00000323455:D342Y;ENSP00000438832:D439Y	ENSP00000323455:D342Y	D	-	1	0	TPRX1	52997056	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.922000	0.04004	-0.780000	0.04553	-0.658000	0.03865	GAC		0.612	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479		11	55	1	0	0.000673444	0.008291	0.000728872	11	55				
GPR32	2854	broad.mit.edu	37	19	51274268	51274268	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:51274268G>T	ENST00000270590.4	+	1	548	c.411G>T	c.(409-411)gtG>gtT	p.V137V		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	137					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TCATCTCTGTGGACCGTTGCA	0.612																																					Esophageal Squamous(113;152 1581 5732 15840 44398)	Esophageal Squamous(113;152 1581 5732 15840 44398)	uc010ycf.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(409-411)GTG>GTT		G protein-coupled receptor 32							180.0	172.0	175.0					19																	51274268		2203	4300	6503	SO:0001819	synonymous_variant	2854					integral to plasma membrane	N-formyl peptide receptor activity	g.chr19:51274268G>T	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.411G>T	19.37:g.51274268G>T			Somatic					p.V137V	NM_001506	NP_001497	WXS	Illumina HiSeq	Unspecified	O75388	GPR32_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)	1	411	+		all_neural(266;0.131)	137			Helical; Name=3; (Potential).		Q502U7|Q6NWS5	Silent	SNP	ENST00000270590.4	37	c.411G>T	CCDS12801.1																																																																																				0.612	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1			15	141	1	0	1.33834e-09	0.007413	1.71281e-09	15	141				
KIR3DL3	115653	broad.mit.edu	37	19	55246763	55246763	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:55246763C>A	ENST00000291860.1	+	6	1011	c.993C>A	c.(991-993)gtC>gtA	p.V331V	KIR3DL1_ENST00000402254.2_Intron|KIR3DL1_ENST00000538269.1_Intron|KIR2DL4_ENST00000396284.2_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000541392.1_Intron	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	331						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		CCTCAGTGGTCATCATCCCCT	0.478																																							uc002qgu.1		NA																	0				ovary(2)	2						c.(991-993)GTC>GTA		killer cell immunoglobulin-like receptor, three							244.0	197.0	213.0					19																	55246763		1995	3948	5943	SO:0001819	synonymous_variant	115653					integral to membrane|plasma membrane	receptor activity	g.chr19:55246763C>A	AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.993C>A	19.37:g.55246763C>A			Somatic				KIR2DL3_uc002qgv.2_Intron	p.V331V	NM_153443	NP_703144	WXS	Illumina HiSeq	Unspecified	Q8N743	KI3L3_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	6	1011	+			331			Helical; (Potential).		A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Silent	SNP	ENST00000291860.1	37	c.993C>A	CCDS12903.1																																																																																				0.478	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141147.1	NM_153443		55	95	1	0	3.84483e-29	0.00361	6.05504e-29	55	95				
KIR3DL1	3811	broad.mit.edu	37	19	55266475	55266475	+	Intron	SNP	A	A	T	rs531143478		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:55266475A>T	ENST00000538269.1	+	1	61				KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR2DL3_ENST00000434419.2_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000541392.1_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CGGCAGCACCATGTCGCTCAC	0.597																																							uc010yfi.1		NA																	0					0						c.(1-3)ATG>TTG		killer-cell Ig-like receptor							76.0	71.0	73.0					19																	55266475		678	1531	2209	SO:0001627	intron_variant	768329							g.chr19:55266475A>T	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.34+30440A>T	19.37:g.55266475A>T			Somatic				KIR2DS4_uc010yfj.1_5'UTR|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron	p.M1L	NM_001015070	NP_001015070	WXS	Illumina HiSeq	Unspecified				GBM - Glioblastoma multiforme(193;0.0192)	1	2	+								O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37	c.1A>T																																																																																					0.597	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289		22	63	0	0	0	0.002299	0	22	63				
NLRP2	55655	broad.mit.edu	37	19	55494735	55494735	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:55494735T>A	ENST00000543010.1	+	6	1812	c.1669T>A	c.(1669-1671)Tcc>Acc	p.S557T	NLRP2_ENST00000391721.4_Missense_Mutation_p.S533T|NLRP2_ENST00000448584.2_Missense_Mutation_p.S557T|NLRP2_ENST00000538819.1_Missense_Mutation_p.S533T|NLRP2_ENST00000339757.7_Missense_Mutation_p.S535T|NLRP2_ENST00000537859.1_Missense_Mutation_p.S535T|NLRP2_ENST00000263437.6_Missense_Mutation_p.S554T|NLRP2_ENST00000427260.2_Missense_Mutation_p.S534T	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	557					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		AGGCTACTACTCCTTTGGCCT	0.557																																							uc002qij.2		NA																	0				ovary(1)|skin(1)	2						c.(1669-1671)TCC>ACC		NLR family, pyrin domain containing 2							81.0	75.0	77.0					19																	55494735		2203	4300	6503	SO:0001583	missense	55655				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding	g.chr19:55494735T>A	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1669T>A	19.37:g.55494735T>A	ENSP00000445135:p.Ser557Thr		Somatic				NLRP2_uc010yfp.1_Missense_Mutation_p.S534T|NLRP2_uc010esn.2_Missense_Mutation_p.S533T|NLRP2_uc010eso.2_Missense_Mutation_p.S554T|NLRP2_uc010esp.2_Missense_Mutation_p.S535T	p.S557T	NM_017852	NP_060322	WXS	Illumina HiSeq	Unspecified	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)	6	1755	+			557					B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	c.1669T>A	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	T	9.054	0.992753	0.18966	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.73575	-0.72;-0.65;-0.65;-0.72;-0.65;-0.76;-0.65;-0.72	1.79	-0.359	0.12571	.	2.263620	0.03387	N	0.201250	T	0.55737	0.1939	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.20052	0.041;0.038;0.022;0.038;0.022	B;B;B;B;B	0.25506	0.036;0.038;0.028;0.061;0.028	T	0.49952	-0.8884	10	0.87932	D	0	.	4.2304	0.10601	0.0:0.3885:0.0:0.6115	.	534;535;554;533;557	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	T	557;533;535;557;535;534;533;554	ENSP00000445135:S557T;ENSP00000375601:S533T;ENSP00000344074:S535T;ENSP00000409370:S557T;ENSP00000440601:S535T;ENSP00000402474:S534T;ENSP00000441133:S533T;ENSP00000263437:S554T	ENSP00000263437:S554T	S	+	1	0	NLRP2	60186547	0.014000	0.17966	0.001000	0.08648	0.002000	0.02628	-0.211000	0.09332	-0.169000	0.10834	0.459000	0.35465	TCC		0.557	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852		13	66	0	0	0	0.001368	0	13	66				
NLRP11	204801	broad.mit.edu	37	19	56321418	56321418	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:56321418G>A	ENST00000589093.1	-	3	651	c.558C>T	c.(556-558)ctC>ctT	p.L186L	NLRP11_ENST00000592953.1_Silent_p.L87L|NLRP11_ENST00000589824.2_Silent_p.L186L|NLRP11_ENST00000360133.3_Silent_p.L186L|NLRP11_ENST00000443188.1_Silent_p.L186L			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	186	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CGTGAGCAGTGAGGTGAACGA	0.502																																							uc010ygf.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(556-558)CTC>CTT		NLR family, pyrin domain containing 11							134.0	118.0	124.0					19																	56321418		2203	4300	6503	SO:0001819	synonymous_variant	204801						ATP binding	g.chr19:56321418G>A	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.558C>T	19.37:g.56321418G>A			Somatic				NLRP11_uc002qlz.2_Silent_p.L87L|NLRP11_uc002qmb.2_Silent_p.L87L|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	p.L186L	NM_145007	NP_659444	WXS	Illumina HiSeq	Unspecified	P59045	NAL11_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	5	1269	-		Colorectal(82;0.0002)	186			NACHT.		C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Silent	SNP	ENST00000589093.1	37	c.558C>T	CCDS12935.1																																																																																				0.502	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007		7	31	0	0	0	0.001984	0	7	31				
NLRP4	147945	broad.mit.edu	37	19	56388492	56388492	+	Missense_Mutation	SNP	C	C	T	rs147716168		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:56388492C>T	ENST00000301295.6	+	8	3078	c.2656C>T	c.(2656-2658)Cgg>Tgg	p.R886W	NLRP4_ENST00000587891.1_Missense_Mutation_p.R811W|NLRP4_ENST00000346986.5_Missense_Mutation_p.R830W	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	886					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.R886W(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GCTGTTGTGTCGGGCTCTGAC	0.498													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20933	0.0		0.0	False		,,,				2504	0.0						uc002qmd.3		NA																	1	Substitution - Missense(1)	p.R886W(1)	upper_aerodigestive_tract(1)	ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.(2656-2658)CGG>TGG		NLR family, pyrin domain containing 4		C	TRP/ARG	0,4406		0,0,2203	204.0	194.0	198.0		2656	-0.8	0.0	19	dbSNP_134	198	1,8599	1.2+/-3.3	0,1,4299	no	missense	NLRP4	NM_134444.4	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	886/995	56388492	1,13005	2203	4300	6503	SO:0001583	missense	147945						ATP binding	g.chr19:56388492C>T	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2656C>T	19.37:g.56388492C>T	ENSP00000301295:p.Arg886Trp		Somatic				NLRP4_uc002qmf.2_Missense_Mutation_p.R811W|NLRP4_uc010etf.2_Missense_Mutation_p.R661W	p.R886W	NM_134444	NP_604393	WXS	Illumina HiSeq	Unspecified	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	8	3078	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	886			LRR 6.		Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	c.2656C>T	CCDS12936.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	14.12	2.440920	0.43326	0.0	1.16E-4	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.46451	0.87;0.87	3.91	-0.796	0.10912	.	.	.	.	.	T	0.42988	0.1227	L	0.61036	1.89	0.09310	N	1	P;P;P	0.52316	0.901;0.899;0.952	B;P;P	0.49301	0.123;0.599;0.606	T	0.34675	-0.9819	9	0.87932	D	0	.	4.6632	0.12652	0.2055:0.3526:0.442:0.0	.	830;811;886	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	W	886;830	ENSP00000301295:R886W;ENSP00000344787:R830W	ENSP00000301295:R886W	R	+	1	2	NLRP4	61080304	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.032000	0.13732	-0.117000	0.11872	-0.211000	0.12701	CGG		0.498	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		26	100	0	0	0	0.007291	0	26	100				
SNTG2	54221	broad.mit.edu	37	2	1168816	1168816	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:1168816T>C	ENST00000308624.5	+	8	667	c.538T>C	c.(538-540)Tcc>Ccc	p.S180P	SNTG2_ENST00000467759.1_3'UTR|SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	180					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CAGTGGGGCCTCCTCTCCCCT	0.473																																							uc002qwq.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)	3						c.(538-540)TCC>CCC		syntrophin, gamma 2							146.0	152.0	150.0					2																	1168816		1964	4141	6105	SO:0001583	missense	54221				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding	g.chr2:1168816T>C	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.538T>C	2.37:g.1168816T>C	ENSP00000311837:p.Ser180Pro		Somatic				SNTG2_uc010ewi.2_Intron	p.S180P	NM_018968	NP_061841	WXS	Illumina HiSeq	Unspecified	Q9NY99	SNTG2_HUMAN		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)	8	666	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)	180					Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	c.538T>C	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.461101	0.63513	.	.	ENSG00000172554	ENST00000308624	T	0.43294	0.95	4.73	4.73	0.59995	.	0.060105	0.64402	D	0.000002	T	0.56630	0.1998	M	0.72894	2.215	0.80722	D	1	D	0.64830	0.994	P	0.58077	0.832	T	0.58940	-0.7547	10	0.45353	T	0.12	.	12.4711	0.55787	0.0:0.0:0.0:1.0	.	180	Q9NY99	SNTG2_HUMAN	P	180	ENSP00000311837:S180P	ENSP00000311837:S180P	S	+	1	0	SNTG2	1158816	1.000000	0.71417	0.646000	0.29493	0.628000	0.37860	5.105000	0.64591	1.748000	0.51833	0.523000	0.50628	TCC		0.473	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968		26	198	0	0	0	0.002096	0	26	198				
MYT1L	23040	broad.mit.edu	37	2	1890352	1890352	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:1890352T>G	ENST00000399161.2	-	18	3417	c.2670A>C	c.(2668-2670)aaA>aaC	p.K890N	MYT1L_ENST00000428368.2_Missense_Mutation_p.K888N	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	890					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TTCGAATGCTTTTGTCCGCCA	0.458																																							uc002qxe.2		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(2668-2670)AAA>AAC		myelin transcription factor 1-like							50.0	51.0	51.0					2																	1890352		1863	4111	5974	SO:0001583	missense	23040				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:1890352T>G	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2670A>C	2.37:g.1890352T>G	ENSP00000382114:p.Lys890Asn		Somatic				MYT1L_uc002qxd.2_Missense_Mutation_p.K888N|MYT1L_uc010ewl.1_RNA	p.K890N	NM_015025	NP_055840	WXS	Illumina HiSeq	Unspecified	Q9UL68	MYT1L_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)	18	3497	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)	890					A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37	c.2670A>C		.	.	.	.	.	.	.	.	.	.	T	19.52	3.843296	0.71488	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.57107	0.43;0.42	5.66	3.19	0.36642	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.83118	2.625	0.58432	D	0.999999	P;D	0.54601	0.955;0.967	P;P	0.55508	0.756;0.777	T	0.67110	-0.5753	10	0.72032	D	0.01	-36.9459	9.4235	0.38565	0.0:0.1554:0.0:0.8446	.	890;888	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	N	890;836;888	ENSP00000382114:K890N;ENSP00000396103:K888N	ENSP00000295067:K836N	K	-	3	2	MYT1L	1869359	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.155000	0.58131	0.379000	0.24794	-0.290000	0.09829	AAA		0.458	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		10	64	0	0	0	0.008291	0	10	64				
KCNS3	3790	broad.mit.edu	37	2	18112790	18112790	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:18112790G>T	ENST00000403915.1	+	3	966	c.515G>T	c.(514-516)tGg>tTg	p.W172L	KCNS3_ENST00000304101.4_Missense_Mutation_p.W172L|KCNS3_ENST00000465292.1_Intron	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	172					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AAGAAAATCTGGATTAGAATG	0.512																																							uc002rcv.2		NA																	0				ovary(4)	4						c.(514-516)TGG>TTG		potassium voltage-gated channel							60.0	65.0	63.0					2																	18112790		2203	4300	6503	SO:0001583	missense	3790				energy reserve metabolic process|regulation of insulin secretion	Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity	g.chr2:18112790G>T	AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.515G>T	2.37:g.18112790G>T	ENSP00000385968:p.Trp172Leu		Somatic				KCNS3_uc002rcw.2_Missense_Mutation_p.W172L	p.W172L	NM_002252	NP_002243	WXS	Illumina HiSeq	Unspecified	Q9BQ31	KCNS3_HUMAN			3	966	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)		172			Cytoplasmic (Potential).		D6W520|O43651|Q4ZFY1|Q96B56	Missense_Mutation	SNP	ENST00000403915.1	37	c.515G>T	CCDS1692.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222378	0.39300	.	.	ENSG00000170745	ENST00000403915;ENST00000304101	D;D	0.98135	-4.74;-4.74	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.99013	0.9663	M	0.90595	3.13	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	D	0.99453	1.0941	10	0.87932	D	0	.	20.2422	0.98381	0.0:0.0:1.0:0.0	.	172	Q9BQ31	KCNS3_HUMAN	L	172	ENSP00000385968:W172L;ENSP00000305824:W172L	ENSP00000305824:W172L	W	+	2	0	KCNS3	17976271	1.000000	0.71417	1.000000	0.80357	0.135000	0.20990	9.869000	0.99810	2.782000	0.95742	0.655000	0.94253	TGG		0.512	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323808.1	NM_002252		14	56	1	0	1.5842e-08	0.001855	1.96995e-08	14	56				
AGBL5	60509	broad.mit.edu	37	2	27278943	27278943	+	Silent	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:27278943T>C	ENST00000360131.4	+	7	1461	c.1302T>C	c.(1300-1302)caT>caC	p.H434H	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Silent_p.H434H	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	434					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGACCTGCATGGACATGCTT	0.512																																							uc002rie.2		NA																	0				ovary(1)|breast(1)	2						c.(1300-1302)CAT>CAC		ATP/GTP binding protein-like 5 isoform 1							175.0	174.0	174.0					2																	27278943		2203	4300	6503	SO:0001819	synonymous_variant	60509				protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr2:27278943T>C	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1302T>C	2.37:g.27278943T>C			Somatic				AGBL5_uc002ric.2_Silent_p.H434H|AGBL5_uc002rid.2_Silent_p.H434H|AGBL5_uc002rif.2_RNA	p.H434H	NM_021831	NP_068603	WXS	Illumina HiSeq	Unspecified	Q8NDL9	CBPC5_HUMAN			7	1519	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		434				Zinc (By similarity).	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	ENST00000360131.4	37	c.1302T>C	CCDS1732.3																																																																																				0.512	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831		55	258	0	0	0	0.00361	0	55	258				
TCF23	150921	broad.mit.edu	37	2	27375636	27375636	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:27375636C>A	ENST00000296096.5	+	3	676	c.546C>A	c.(544-546)agC>agA	p.S182R		NM_175769.2	NP_786951.1	Q7RTU1	TCF23_HUMAN	transcription factor 23	182					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	nucleus (GO:0005634)				large_intestine(2)|lung(11)|prostate(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCACCCCCAGCCAAAGAACAA	0.557																																							uc010ylg.1		NA																	0					0						c.(544-546)AGC>AGA		transcription factor 23							86.0	83.0	84.0					2																	27375636		2203	4300	6503	SO:0001583	missense	150921				cell differentiation|muscle organ development|regulation of transcription, DNA-dependent	nucleus		g.chr2:27375636C>A	AC013403	CCDS33163.1	2p23.3	2013-05-21			ENSG00000163792	ENSG00000163792		"""Basic helix-loop-helix proteins"""	18602	protein-coding gene	gene with protein product		609635				11701948, 10652346	Standard	NM_175769		Approved	OUT, bHLHa24	uc010ylg.2	Q7RTU1	OTTHUMG00000152031	ENST00000296096.5:c.546C>A	2.37:g.27375636C>A	ENSP00000296096:p.Ser182Arg		Somatic					p.S182R	NM_175769	NP_786951	WXS	Illumina HiSeq	Unspecified	Q7RTU1	TCF23_HUMAN			3	546	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		182					B2RNZ3	Missense_Mutation	SNP	ENST00000296096.5	37	c.546C>A	CCDS33163.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850795	0.32699	.	.	ENSG00000163792	ENST00000296096	D	0.97328	-4.34	4.87	1.87	0.25490	.	1.165970	0.06047	N	0.655955	D	0.93232	0.7844	L	0.36672	1.1	0.09310	N	1	B	0.19583	0.037	B	0.20955	0.032	D	0.84188	0.0443	10	0.29301	T	0.29	-0.0429	3.2471	0.06801	0.179:0.5512:0.1734:0.0964	.	182	Q7RTU1	TCF23_HUMAN	R	182	ENSP00000296096:S182R	ENSP00000296096:S182R	S	+	3	2	TCF23	27229140	0.004000	0.15560	0.067000	0.19924	0.093000	0.18481	0.010000	0.13242	0.589000	0.29677	-0.127000	0.14921	AGC		0.557	TCF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324980.1	NM_175769		34	75	1	0	5.09552e-08	0.002096	6.24765e-08	34	75				
SUPT7L	9913	broad.mit.edu	37	2	27880518	27880518	+	Silent	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:27880518C>G	ENST00000337768.5	-	4	1007	c.438G>C	c.(436-438)gtG>gtC	p.V146V	SUPT7L_ENST00000406540.1_Silent_p.V144V|SUPT7L_ENST00000404798.2_Silent_p.V11V|SUPT7L_ENST00000464789.2_Silent_p.V144V|SUPT7L_ENST00000405491.1_Silent_p.V144V	NM_001282729.1|NM_014860.1	NP_001269658.1|NP_055675.1	O94864	ST65G_HUMAN	suppressor of Ty 7 (S. cerevisiae)-like	146					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|maintenance of protein location in nucleus (GO:0051457)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)					TGAGTTCAGTCACAGGTTCCC	0.542																																							uc002rlh.1		NA																	0				skin(2)	2						c.(436-438)GTG>GTC		SPTF-associated factor 65 gamma							32.0	33.0	33.0					2																	27880518		1969	4140	6109	SO:0001819	synonymous_variant	9913				histone H3 acetylation|maintenance of protein location in nucleus|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity	g.chr2:27880518C>G	AF197954	CCDS42667.1, CCDS62885.1, CCDS62886.1	2p23.3	2008-02-05			ENSG00000119760	ENSG00000119760			30632	protein-coding gene	gene with protein product		612762				9872452, 11564863	Standard	NM_001282732		Approved	STAF65, gamma, KIAA0764, SPT7L	uc002rli.1	O94864	OTTHUMG00000151947	ENST00000337768.5:c.438G>C	2.37:g.27880518C>G			Somatic				SUPT7L_uc002rli.1_Silent_p.V146V|SUPT7L_uc010ymf.1_Silent_p.V11V|SUPT7L_uc002rlj.1_Silent_p.V144V|SUPT7L_uc010ezh.1_Silent_p.V144V	p.V146V	NM_014860	NP_055675	WXS	Illumina HiSeq	Unspecified	O94864	ST65G_HUMAN			4	781	-	Acute lymphoblastic leukemia(172;0.155)		146					B4E3W3|Q6IB21|Q9H2T6	Silent	SNP	ENST00000337768.5	37	c.438G>C	CCDS42667.1																																																																																				0.542	SUPT7L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324568.1	NM_014860		5	54	0	0	0	0.001168	0	5	54				
RASGRP3	25780	broad.mit.edu	37	2	33747028	33747028	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:33747028C>T	ENST00000403687.3	+	7	1115	c.375C>T	c.(373-375)tcC>tcT	p.S125S	RASGRP3_ENST00000402538.3_Silent_p.S125S|RASGRP3_ENST00000407811.1_Silent_p.S125S	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	125	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					ATAGTCCTTCCTATGACTGGA	0.443																																							uc002rox.2		NA																	0				lung(3)|ovary(1)|pancreas(1)	5						c.(373-375)TCC>TCT		RAS guanyl releasing protein 3 (calcium and							112.0	109.0	110.0					2																	33747028		1882	4101	5983	SO:0001819	synonymous_variant	25780				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity	g.chr2:33747028C>T	AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.375C>T	2.37:g.33747028C>T			Somatic				RASGRP3_uc010ync.1_Silent_p.S125S|RASGRP3_uc002roy.2_Silent_p.S125S	p.S125S	NM_170672	NP_733772	WXS	Illumina HiSeq	Unspecified	Q8IV61	GRP3_HUMAN			8	1002	+	all_hematologic(175;0.115)		125			N-terminal Ras-GEF.		D6W583|O94931|Q53SD7	Silent	SNP	ENST00000403687.3	37	c.375C>T	CCDS46256.1																																																																																				0.443	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376		17	113	0	0	0	0.007413	0	17	113				
SLC8A1	6546	broad.mit.edu	37	2	40655749	40655749	+	Missense_Mutation	SNP	C	C	A	rs368092520		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:40655749C>A	ENST00000403092.1	-	2	1705	c.1672G>T	c.(1672-1674)Gtg>Ttg	p.V558L	SLC8A1_ENST00000405901.3_Missense_Mutation_p.V558L|SLC8A1_ENST00000332839.4_Missense_Mutation_p.V558L|SLC8A1_ENST00000405269.1_Missense_Mutation_p.V558L|SLC8A1_ENST00000406391.2_Missense_Mutation_p.V558L|SLC8A1_ENST00000402441.1_Missense_Mutation_p.V558L|SLC8A1_ENST00000542024.1_Missense_Mutation_p.V558L|SLC8A1_ENST00000542756.1_Missense_Mutation_p.V558L|SLC8A1_ENST00000406785.2_Missense_Mutation_p.V558L|SLC8A1_ENST00000408028.2_Missense_Mutation_p.V558L			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	558	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AATACTTTCACCTCCATGATG	0.458																																							uc002rrx.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1672-1674)GTG>TTG		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						144.0	147.0	146.0					2																	40655749		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40655749C>A		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1672G>T	2.37:g.40655749C>A	ENSP00000384763:p.Val558Leu		Somatic				SLC8A1_uc002rry.2_Missense_Mutation_p.V558L|SLC8A1_uc002rrz.2_Missense_Mutation_p.V558L|SLC8A1_uc002rsa.2_Missense_Mutation_p.V558L|SLC8A1_uc002rsd.3_Missense_Mutation_p.V558L|SLC8A1_uc002rsb.1_Missense_Mutation_p.V558L|SLC8A1_uc010fan.1_Missense_Mutation_p.V558L|SLC8A1_uc002rsc.1_Missense_Mutation_p.V558L	p.V558L	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			1	1696	-			558			Calx-beta 2.|Cytoplasmic (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.1672G>T	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.104716	0.37145	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74	6.17	6.17	0.99709	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.35393	0.0930	L	0.28115	0.83	0.80722	D	1	B;P;B;B;B	0.48016	0.042;0.904;0.257;0.033;0.011	B;P;B;B;B	0.59115	0.02;0.852;0.084;0.044;0.034	T	0.00950	-1.1503	10	0.22109	T	0.4	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	558;558;558;558;558	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	L	558	ENSP00000383886:V558L;ENSP00000440727:V558L;ENSP00000384763:V558L;ENSP00000385678:V558L;ENSP00000385188:V558L;ENSP00000385535:V558L;ENSP00000332931:V558L;ENSP00000384908:V558L;ENSP00000385811:V558L;ENSP00000443515:V558L	ENSP00000332931:V558L	V	-	1	0	SLC8A1	40509253	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.663000	0.83820	2.941000	0.99782	0.655000	0.94253	GTG		0.458	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		18	148	1	0	5.3912e-06	0.006122	6.2462e-06	18	148				
NRXN1	9378	broad.mit.edu	37	2	50699530	50699530	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:50699530T>A	ENST00000406316.2	-	16	4626	c.3150A>T	c.(3148-3150)caA>caT	p.Q1050H	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000401669.2_Missense_Mutation_p.Q1050H|NRXN1_ENST00000402717.3_Missense_Mutation_p.Q1042H|NRXN1_ENST00000401710.1_Missense_Mutation_p.Q59H|NRXN1_ENST00000406859.3_Missense_Mutation_p.Q1050H|NRXN1_ENST00000405472.3_Missense_Mutation_p.Q1042H|NRXN1_ENST00000404971.1_Missense_Mutation_p.Q1090H	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1050	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CCAGGCAGCCTTGAAAGCCTT	0.428																																							uc010fbq.2		NA																	0				ovary(2)	2						c.(3268-3270)CAA>CAT		neurexin 1 isoform alpha2 precursor							93.0	90.0	91.0					2																	50699530		1860	4102	5962	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50699530T>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3150A>T	2.37:g.50699530T>A	ENSP00000384311:p.Gln1050His		Somatic				NRXN1_uc002rxb.3_Missense_Mutation_p.Q722H|NRXN1_uc002rxe.3_Missense_Mutation_p.Q1050H|NRXN1_uc002rxc.1_RNA	p.Q1090H	NM_001135659	NP_001129131	WXS	Illumina HiSeq	Unspecified	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		16	4747	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	229			Extracellular (Potential).|Laminin G-like.		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.3270A>T	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	T	19.27	3.795226	0.70452	.	.	ENSG00000179915	ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04;-1.04;-1.04	5.42	1.8	0.24995	.	0.000000	0.85682	D	0.000000	T	0.81978	0.4937	L	0.49455	1.56	0.34607	D	0.717201	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.976;0.98;0.996	D	0.84160	0.0428	10	0.62326	D	0.03	.	8.9516	0.35792	0.0:0.2121:0.0:0.7879	.	1090;1050;1042	Q9ULB1-3;F8WB18;A7E294	.;.;.	H	59;1090;1050;1042;1050;1091;1042;1050	ENSP00000385580:Q59H;ENSP00000385142:Q1090H;ENSP00000384311:Q1050H;ENSP00000434015:Q1042H;ENSP00000385017:Q1050H;ENSP00000385434:Q1042H;ENSP00000385681:Q1050H	ENSP00000385017:Q1050H	Q	-	3	2	NRXN1	50553034	0.991000	0.36638	1.000000	0.80357	0.989000	0.77384	0.249000	0.18216	0.450000	0.26774	0.533000	0.62120	CAA		0.428	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			8	37	0	0	0	0.004482	0	8	37				
ALMS1	7840	broad.mit.edu	37	2	73677809	73677809	+	Silent	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:73677809A>G	ENST00000264448.6	+	8	4263	c.4152A>G	c.(4150-4152)acA>acG	p.T1384T	ALMS1_ENST00000377715.1_Silent_p.T1384T|ALMS1_ENST00000409009.1_Silent_p.T1342T	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1384	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CACAACATACAGAGAAGCCGA	0.468																																							uc002sje.1		NA																	0				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(4156-4158)ACA>ACG		Alstrom syndrome 1							85.0	87.0	87.0					2																	73677809		1862	4103	5965	SO:0001819	synonymous_variant	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73677809A>G	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.4152A>G	2.37:g.73677809A>G			Somatic				ALMS1_uc002sjf.1_Silent_p.T1342T|ALMS1_uc002sjg.2_Silent_p.T772T|ALMS1_uc002sjh.1_Silent_p.T772T	p.T1386T	NM_015120	NP_055935	WXS	Illumina HiSeq	Unspecified	Q8TCU4	ALMS1_HUMAN			10	4269	+			1384			18.|34 X 47 AA approximate tandem repeat.		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	37	c.4158A>G	CCDS42697.1																																																																																				0.468	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		48	123	0	0	0	0.00361	0	48	123				
TET3	200424	broad.mit.edu	37	2	74274191	74274191	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:74274191C>G	ENST00000409262.3	+	1	742	c.742C>G	c.(742-744)Ccc>Gcc	p.P248A		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	248					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGCTTCTTGCCCCCTTCCTGA	0.592																																							uc002skb.3		NA																	0					0						c.(742-744)CCC>GCC		tet oncogene family member 3							50.0	53.0	52.0					2																	74274191		2015	4177	6192	SO:0001583	missense	200424						metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr2:74274191C>G		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.742C>G	2.37:g.74274191C>G	ENSP00000386869:p.Pro248Ala		Somatic				TET3_uc010fez.1_Missense_Mutation_p.P248A	p.P248A	NM_144993	NP_659430	WXS	Illumina HiSeq	Unspecified	O43151	TET3_HUMAN			1	742	+			248					A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	c.742C>G	CCDS46339.1	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465054	0.43839	.	.	ENSG00000187605	ENST00000305799;ENST00000409262;ENST00000233310	T;T	0.24538	1.85;2.73	5.84	4.96	0.65561	.	.	.	.	.	T	0.17280	0.0415	N	0.14661	0.345	0.37765	D	0.926465	B	0.20368	0.044	B	0.18561	0.022	T	0.06180	-1.0841	9	0.46703	T	0.11	.	13.9125	0.63876	0.0:0.9257:0.0:0.0743	.	248	O43151	TET3_HUMAN	A	290;248;248	ENSP00000307803:P290A;ENSP00000386869:P248A	ENSP00000233310:P248A	P	+	1	0	TET3	74127699	0.990000	0.36364	0.985000	0.45067	0.814000	0.46013	1.931000	0.40134	1.483000	0.48342	-0.258000	0.10820	CCC		0.592	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4			38	48	0	0	0	0.004878	0	38	48				
LRRTM4	80059	broad.mit.edu	37	2	77745595	77745595	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:77745595C>A	ENST00000409093.1	-	3	1736	c.1400G>T	c.(1399-1401)cGg>cTg	p.R467L	LRRTM4_ENST00000409088.3_Missense_Mutation_p.R467L|LRRTM4_ENST00000409282.1_Missense_Mutation_p.R468L|LRRTM4_ENST00000409884.1_Missense_Mutation_p.R467L|LRRTM4_ENST00000409911.1_Missense_Mutation_p.R468L			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	467					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		GGCCTTTTTCCGCCGCCTCTT	0.463																																							uc002snr.2		NA																	0				pancreas(3)|ovary(1)	4						c.(1399-1401)CGG>CTG		leucine rich repeat transmembrane neuronal 4							72.0	71.0	71.0					2																	77745595		1899	4136	6035	SO:0001583	missense	80059					integral to membrane		g.chr2:77745595C>A	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1400G>T	2.37:g.77745595C>A	ENSP00000386357:p.Arg467Leu		Somatic				LRRTM4_uc002snq.2_Missense_Mutation_p.R467L|LRRTM4_uc002sns.2_Missense_Mutation_p.R467L|LRRTM4_uc002snt.2_Missense_Mutation_p.R468L	p.R467L	NM_001134745	NP_001128217	WXS	Illumina HiSeq	Unspecified	Q86VH4	LRRT4_HUMAN		Colorectal(11;0.059)	3	1815	-			467			Cytoplasmic (Potential).		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	c.1400G>T	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988439	0.53934	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	5.68	5.68	0.88126	.	0.191091	0.46442	D	0.000295	D	0.87249	0.6130	M	0.71581	2.175	0.53005	D	0.999967	D;D;D	0.63880	0.989;0.993;0.989	P;D;P	0.66602	0.883;0.945;0.883	D	0.88069	0.2799	10	0.87932	D	0	.	18.3564	0.90358	0.0:1.0:0.0:0.0	.	468;467;467	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	L	468;467;467;467;468	ENSP00000387228:R468L;ENSP00000387297:R467L;ENSP00000386357:R467L;ENSP00000386236:R467L;ENSP00000386286:R468L	ENSP00000386236:R467L	R	-	2	0	LRRTM4	77599103	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.266000	0.51569	2.670000	0.90874	0.655000	0.94253	CGG		0.463	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		16	46	1	0	6.72482e-11	0.003163	8.84314e-11	16	46				
REG3A	5068	broad.mit.edu	37	2	79385590	79385590	+	Splice_Site	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:79385590C>T	ENST00000409839.3	-	4	232		c.e4-1		REG3A_ENST00000305165.2_Splice_Site|AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000393878.1_Splice_Site	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha						acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)	p.?(1)		breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						GGCAGGCCAGCTTTGAGGGCA	0.567																																							uc002sod.1		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e3-1		pancreatitis-associated protein precursor							77.0	70.0	73.0					2																	79385590		2203	4300	6503	SO:0001630	splice_region_variant	5068				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding	g.chr2:79385590C>T	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.196-1G>A	2.37:g.79385590C>T			Somatic				REG3A_uc002soe.1_Splice_Site_p.L66_splice|REG3A_uc002sof.1_Splice_Site_p.L66_splice	p.L66_splice	NM_138938	NP_620355	WXS	Illumina HiSeq	Unspecified	Q06141	REG3A_HUMAN			3	451	-									Splice_Site	SNP	ENST00000409839.3	37	c.196_splice	CCDS1965.1	.	.	.	.	.	.	.	.	.	.	C	3.416	-0.119094	0.06838	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	.	.	.	4.02	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9367	0.52878	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	REG3A	79239098	0.808000	0.29022	0.193000	0.23327	0.007000	0.05969	1.740000	0.38228	2.529000	0.85273	0.603000	0.83216	.		0.567	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580	Intron	13	78	0	0	0	0.004007	0	13	78				
LONRF2	164832	broad.mit.edu	37	2	100906881	100906881	+	Splice_Site	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:100906881G>C	ENST00000393437.3	-	10	2398	c.1759C>G	c.(1759-1761)Ctt>Gtt	p.L587V	LONRF2_ENST00000409647.1_Splice_Site_p.L344V	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	587	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						TACTCTGAAAGCCTGAAAAGA	0.433																																							uc002tal.3		NA																	0				large_intestine(1)|skin(1)	2						c.(1759-1761)CTT>GTT		LON peptidase N-terminal domain and ring finger							96.0	89.0	91.0					2																	100906881		2203	4300	6503	SO:0001630	splice_region_variant	164832				proteolysis		ATP-dependent peptidase activity|zinc ion binding	g.chr2:100906881G>C	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1758-1C>G	2.37:g.100906881G>C			Somatic				LONRF2_uc010yvs.1_RNA	p.L587V	NM_198461	NP_940863	WXS	Illumina HiSeq	Unspecified	Q1L5Z9	LONF2_HUMAN			10	2399	-			587			Lon.		B9A006|Q6ZSR4	Missense_Mutation	SNP	ENST00000393437.3	37	c.1759C>G	CCDS2046.2	.	.	.	.	.	.	.	.	.	.	G	8.282	0.815705	0.16607	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	T;T	0.43294	0.95;0.95	4.77	0.794	0.18638	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.178164	0.49916	N	0.000140	T	0.23727	0.0574	L	0.28694	0.88	0.25738	N	0.985195	B	0.20887	0.049	B	0.25759	0.063	T	0.10245	-1.0638	10	0.40728	T	0.16	-9.9483	0.9563	0.01386	0.4038:0.1109:0.1255:0.3598	.	587	Q1L5Z9	LONF2_HUMAN	V	587;344	ENSP00000377086:L587V;ENSP00000386823:L344V	ENSP00000377086:L587V	L	-	1	0	LONRF2	100273313	1.000000	0.71417	0.665000	0.29768	0.011000	0.07611	2.834000	0.48167	0.216000	0.20781	-0.262000	0.10625	CTT		0.433	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461	Missense_Mutation	40	83	0	0	0	0.006999	0	40	83				
RGPD3	653489	broad.mit.edu	37	2	107040515	107040515	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:107040515G>C	ENST00000409886.3	-	20	3995	c.3908C>G	c.(3907-3909)tCt>tGt	p.S1303C	RGPD3_ENST00000304514.7_Missense_Mutation_p.S1303C	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1303					protein targeting to Golgi (GO:0000042)			p.K1304fs*5(2)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						AGGAGACTTAGATAGACTCAA	0.403																																							uc010ywi.1		NA																	2	Deletion - Frameshift(2)		breast(2)	ovary(1)	1						c.(3907-3909)TCT>TGT		RANBP2-like and GRIP domain containing 3							4.0	10.0	9.0					2																	107040515		329	921	1250	SO:0001583	missense	653489				intracellular transport		binding	g.chr2:107040515G>C		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.3908C>G	2.37:g.107040515G>C	ENSP00000386588:p.Ser1303Cys		Somatic					p.S1303C	NM_001144013	NP_001137485	WXS	Illumina HiSeq	Unspecified	A6NKT7	RGPD3_HUMAN			20	3965	-			1303					B8ZZM4	Missense_Mutation	SNP	ENST00000409886.3	37	c.3908C>G	CCDS46379.1	.	.	.	.	.	.	.	.	.	.	.	8.656	0.899476	0.17686	.	.	ENSG00000153165	ENST00000409886;ENST00000304514	T;T	0.44881	0.91;0.91	2.35	2.35	0.29111	.	.	.	.	.	T	0.51432	0.1674	L	0.36672	1.1	0.25054	N	0.991116	D	0.89917	1.0	D	0.76575	0.988	T	0.34502	-0.9826	9	0.62326	D	0.03	-28.6093	10.4115	0.44296	0.0:0.0:1.0:0.0	.	1303	A6NKT7	RGPD3_HUMAN	C	1303	ENSP00000386588:S1303C;ENSP00000303659:S1303C	ENSP00000303659:S1303C	S	-	2	0	RGPD3	106406947	1.000000	0.71417	0.999000	0.59377	0.363000	0.29612	6.362000	0.73077	1.314000	0.45095	0.186000	0.17326	TCT		0.403	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931		71	127	0	0	0	0.00361	0	71	127				
ST6GAL2	84620	broad.mit.edu	37	2	107459800	107459800	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:107459800C>T	ENST00000409382.3	-	2	1244	c.634G>A	c.(634-636)Gtc>Atc	p.V212I	AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.V212I|ST6GAL2_ENST00000409087.3_Missense_Mutation_p.V212I	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	212					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						TTGGAAGAGACGTTCCCCTTC	0.637																																							uc002tdq.2		NA																	0		p.V212G(1)		pancreas(6)|ovary(4)|skin(1)	11						c.(634-636)GTC>ATC		ST6 beta-galactosamide							56.0	55.0	56.0					2																	107459800		2203	4300	6503	SO:0001583	missense	84620				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	g.chr2:107459800C>T	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.634G>A	2.37:g.107459800C>T	ENSP00000386942:p.Val212Ile		Somatic				ST6GAL2_uc002tdr.2_Missense_Mutation_p.V212I|ST6GAL2_uc002tds.3_Missense_Mutation_p.V212I	p.V212I	NM_001142351	NP_001135823	WXS	Illumina HiSeq	Unspecified	Q96JF0	SIAT2_HUMAN			2	753	-			212			Lumenal (Potential).		D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	c.634G>A	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695815	0.68386	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.35605	2.33;2.33;1.3	5.14	5.14	0.70334	.	0.328747	0.31472	N	0.007582	T	0.45115	0.1326	M	0.72894	2.215	0.49299	D	0.999779	D;P	0.57571	0.98;0.789	P;B	0.45195	0.473;0.217	T	0.52320	-0.8591	10	0.54805	T	0.06	-17.8831	17.59	0.87993	0.0:1.0:0.0:0.0	.	212;212	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	I	212	ENSP00000355273:V212I;ENSP00000386942:V212I;ENSP00000387332:V212I	ENSP00000355273:V212I	V	-	1	0	ST6GAL2	106826232	1.000000	0.71417	0.022000	0.16811	0.900000	0.52787	4.419000	0.59835	2.403000	0.81681	0.561000	0.74099	GTC		0.637	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		4	39	0	0	0	0.009096	0	4	39				
SH3RF3	344558	broad.mit.edu	37	2	110065767	110065767	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:110065767C>T	ENST00000309415.6	+	8	1970	c.1970C>T	c.(1969-1971)cCg>cTg	p.P657L		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	657							zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CACCAGCCCCCGGTGCAGATG	0.677																																							uc010ywt.1		NA																	0				ovary(1)	1						c.(1969-1971)CCG>CTG		SH3 domain containing ring finger 3							22.0	30.0	27.0					2																	110065767		2142	4246	6388	SO:0001583	missense	344558						zinc ion binding	g.chr2:110065767C>T	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.1970C>T	2.37:g.110065767C>T	ENSP00000309186:p.Pro657Leu		Somatic					p.P657L	NM_001099289	NP_001092759	WXS	Illumina HiSeq	Unspecified	Q8TEJ3	SH3R3_HUMAN			8	1970	+			657					A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	37	c.1970C>T		.	.	.	.	.	.	.	.	.	.	C	8.899	0.955820	0.18507	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.61742	0.08;2.01	4.84	2.93	0.34026	.	0.352391	0.30329	N	0.009862	T	0.43344	0.1243	.	.	.	0.46981	D	0.99927	B	0.25521	0.128	B	0.14578	0.011	T	0.28138	-1.0053	9	0.45353	T	0.12	-14.6231	7.8185	0.29274	0.0:0.7313:0.0:0.2687	.	657	Q8TEJ3	SH3R3_HUMAN	L	657	ENSP00000414997:P657L;ENSP00000309186:P657L	ENSP00000309186:P657L	P	+	2	0	SH3RF3	109432199	0.003000	0.15002	0.483000	0.27378	0.110000	0.19582	0.829000	0.27449	0.565000	0.29255	0.655000	0.94253	CCG		0.677	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289		3	23	0	0	0	0.000602	0	3	23				
SEPT10	151011	broad.mit.edu	37	2	110325451	110325451	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:110325451G>A	ENST00000397712.2	-	6	1081	c.703C>T	c.(703-705)Cag>Tag	p.Q235*	SEPT10_ENST00000415095.1_Nonsense_Mutation_p.Q235*|SEPT10_ENST00000545389.1_Nonsense_Mutation_p.Q68*|SEPT10_ENST00000437928.1_Nonsense_Mutation_p.Q220*|SEPT10_ENST00000356688.4_Nonsense_Mutation_p.Q235*|SEPT10_ENST00000397714.2_Nonsense_Mutation_p.Q212*|SEPT10_ENST00000468616.1_5'Flank|SEPT10_ENST00000334001.6_Nonsense_Mutation_p.Q102*	NM_144710.3	NP_653311.1	Q9P0V9	SEP10_HUMAN	septin 10	235	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(3)|large_intestine(4)|lung(8)|prostate(1)	18						TGGTATATCTGGACGCCATTG	0.393																																							uc002tew.2		NA																	0					0						c.(703-705)CAG>TAG		septin 10 isoform 1							126.0	117.0	120.0					2																	110325451		1978	4181	6159	SO:0001587	stop_gained	151011				cell cycle|cell division	septin complex	GTP binding	g.chr2:110325451G>A	AF146760	CCDS42726.1, CCDS46383.1	2q13	2013-01-21			ENSG00000186522	ENSG00000186522		"""Septins"""	14349	protein-coding gene	gene with protein product	"""sept1-like"""	611737				12711328	Standard	NM_144710		Approved	FLJ11619	uc002tew.4	Q9P0V9	OTTHUMG00000154957	ENST00000397712.2:c.703C>T	2.37:g.110325451G>A	ENSP00000380824:p.Gln235*		Somatic				SEPT10_uc010ywu.1_Nonsense_Mutation_p.Q68*|SEPT10_uc002tex.2_Nonsense_Mutation_p.Q212*|SEPT10_uc002tey.2_Nonsense_Mutation_p.Q235*|SEPT10_uc010ywv.1_Nonsense_Mutation_p.Q101*|SEPT10_uc002tev.1_Nonsense_Mutation_p.Q42*|SEPT10_uc010fjo.2_RNA|SEPT10_uc002tez.1_Nonsense_Mutation_p.Q10*	p.Q235*	NM_144710	NP_653311	WXS	Illumina HiSeq	Unspecified	Q9P0V9	SEP10_HUMAN			6	1082	-			235					B3KRQ9|Q86VP5|Q9HAH6	Nonsense_Mutation	SNP	ENST00000397712.2	37	c.703C>T	CCDS46383.1	.	.	.	.	.	.	.	.	.	.	G	37	6.565907	0.97667	.	.	ENSG00000186522	ENST00000352314;ENST00000356688;ENST00000397712;ENST00000397714;ENST00000334001;ENST00000437928;ENST00000545389;ENST00000415095;ENST00000493445;ENST00000423520	.	.	.	5.77	5.77	0.91146	.	0.084597	0.50627	D	0.000113	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	.	.	.	X	193;235;235;212;102;220;68;235;42;68	.	ENSP00000334234:Q102X	Q	-	1	0	SEPT10	109682740	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	9.282000	0.95840	2.885000	0.99019	0.655000	0.94253	CAG		0.393	SEPT10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337804.1	NM_144710		20	100	0	0	0	0.002299	0	20	100				
CNTNAP5	129684	broad.mit.edu	37	2	125547612	125547612	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:125547612C>G	ENST00000431078.1	+	18	3247	c.2883C>G	c.(2881-2883)agC>agG	p.S961R		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	961	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.			PGHCSS -> SIKKLK (in Ref. 4; BAB71205). {ECO:0000305}.	cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCCACTGCAGCAGCTACGGCA	0.547																																							uc002tno.2		NA																	0				ovary(10)	10						c.(2881-2883)AGC>AGG		contactin associated protein-like 5 precursor							45.0	53.0	50.0					2																	125547612		2117	4240	6357	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125547612C>G	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2883C>G	2.37:g.125547612C>G	ENSP00000399013:p.Ser961Arg		Somatic				CNTNAP5_uc010flu.2_Missense_Mutation_p.S962R	p.S961R	NM_130773	NP_570129	WXS	Illumina HiSeq	Unspecified	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	18	3247	+			961	PGHCSS -> SIKKLK (in Ref. 4; BAB71205).		EGF-like 2.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.2883C>G	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.593212	0.46214	.	.	ENSG00000155052	ENST00000431078	T	0.79554	-1.28	5.24	2.23	0.28157	Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000010	T	0.78438	0.4283	M	0.80616	2.505	0.50039	D	0.999848	P	0.48089	0.905	B	0.41988	0.372	T	0.73607	-0.3929	10	0.27785	T	0.31	.	9.8928	0.41300	0.0:0.6844:0.0:0.3156	.	961	Q8WYK1	CNTP5_HUMAN	R	961	ENSP00000399013:S961R	ENSP00000399013:S961R	S	+	3	2	CNTNAP5	125264082	1.000000	0.71417	1.000000	0.80357	0.264000	0.26372	3.148000	0.50647	0.218000	0.20820	-0.150000	0.13652	AGC		0.547	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			18	31	0	0	0	0.010504	0	18	31				
RAB3GAP1	22930	broad.mit.edu	37	2	135893295	135893295	+	Silent	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:135893295A>T	ENST00000264158.8	+	17	1759	c.1716A>T	c.(1714-1716)ggA>ggT	p.G572G	RAB3GAP1_ENST00000442034.1_Silent_p.G572G|ZRANB3_ENST00000412849.1_5'Flank|RAB3GAP1_ENST00000487003.1_3'UTR|RAB3GAP1_ENST00000539493.1_Silent_p.G528G|SNORA40_ENST00000385573.1_RNA	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	572					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		GAGAGGTAGGAAAATCTTGGG	0.408																																							uc002tuj.2		NA																	0				ovary(1)|skin(1)	2						c.(1714-1716)GGA>GGT		RAB3 GTPase-activating protein							82.0	80.0	81.0					2																	135893295		2203	4300	6503	SO:0001819	synonymous_variant	22930					centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding	g.chr2:135893295A>T	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.1716A>T	2.37:g.135893295A>T			Somatic				RAB3GAP1_uc010fnf.2_Silent_p.G572G|RAB3GAP1_uc010fng.2_Silent_p.G397G|RAB3GAP1_uc010fnh.1_RNA	p.G572G	NM_012233	NP_036365	WXS	Illumina HiSeq	Unspecified	Q15042	RB3GP_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.117)	17	1741	+			572					A6H8Z3|C9J837|Q659F5|Q8TBB4	Silent	SNP	ENST00000264158.8	37	c.1716A>T	CCDS33294.1																																																																																				0.408	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233		17	30	0	0	0	0.00499	0	17	30				
UBXN4	23190	broad.mit.edu	37	2	136536537	136536537	+	Missense_Mutation	SNP	G	G	T	rs373377908		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:136536537G>T	ENST00000272638.9	+	11	1384	c.1073G>T	c.(1072-1074)gGt>gTt	p.G358V	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	358	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.				response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						AACACTTACGGTAATTTTTCG	0.348																																							uc002tur.2		NA																	0				skin(2)	2						c.(1072-1074)GGT>GTT		UBX domain containing 2		G	VAL/GLY	0,3636		0,0,1818	85.0	83.0	83.0		1073	5.2	1.0	2		83	1,8149		0,1,4074	no	missense	UBXN4	NM_014607.3	109	0,1,5892	TT,TG,GG		0.0123,0.0,0.0085	probably-damaging	358/509	136536537	1,11785	1818	4075	5893	SO:0001583	missense	23190				response to unfolded protein	endoplasmic reticulum membrane|nuclear envelope	protein binding	g.chr2:136536537G>T	D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.1073G>T	2.37:g.136536537G>T	ENSP00000272638:p.Gly358Val		Somatic				UBXN4_uc002tus.2_Missense_Mutation_p.G124V|UBXN4_uc002tut.2_5'UTR	p.G358V	NM_014607	NP_055422	WXS	Illumina HiSeq	Unspecified	Q92575	UBXN4_HUMAN			11	1384	+			358			UBX.|Cytoplasmic (Potential).		A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	ENST00000272638.9	37	c.1073G>T	CCDS42761.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141017	0.77775	0.0	1.23E-4	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.50277	0.75	5.21	5.21	0.72293	UBX (3);	0.048744	0.85682	D	0.000000	T	0.60907	0.2305	L	0.45051	1.395	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.52983	-0.8502	10	0.17832	T	0.49	.	18.7767	0.91913	0.0:0.0:1.0:0.0	.	358	Q92575	UBXN4_HUMAN	V	358;340	ENSP00000272638:G358V	ENSP00000272638:G358V	G	+	2	0	UBXN4	136253007	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.950000	0.93019	2.439000	0.82584	0.655000	0.94253	GGT		0.348	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331696.1	NM_014607		17	94	1	0	5.26018e-13	0.001882	7.28119e-13	17	94				
LRP1B	53353	broad.mit.edu	37	2	141242913	141242913	+	Splice_Site	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:141242913C>A	ENST00000389484.3	-	59	10395	c.9424G>T	c.(9424-9426)Gga>Tga	p.G3142*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3142					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTACAAACCCAGCTTGAGGA	0.333										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(9424-9426)GGA>TGA		low density lipoprotein-related protein 1B							78.0	76.0	76.0					2																	141242913		2203	4300	6503	SO:0001630	splice_region_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141242913C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9425+1G>T	2.37:g.141242913C>A		TSP Lung(27;0.18)	Somatic					p.G3142*	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	59	10396	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3142			Extracellular (Potential).|LDL-receptor class B 30.		Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	c.9424G>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	55	24.398207	0.99960	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	19.213	0.93765	0.0:1.0:0.0:0.0	.	.	.	.	X	3142;3080	.	ENSP00000374135:G3142X	G	-	1	0	LRP1B	140959383	1.000000	0.71417	0.993000	0.49108	0.686000	0.39977	7.412000	0.80091	2.595000	0.87683	0.655000	0.94253	GGA		0.333	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Nonsense_Mutation	20	47	1	0	1.28384e-07	0.001882	1.54885e-07	20	47				
FMNL2	114793	broad.mit.edu	37	2	153473647	153473647	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:153473647A>C	ENST00000288670.9	+	13	1622	c.1255A>C	c.(1255-1257)Aag>Cag	p.K419Q	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	419	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						AGCCATGTCCAAGATTGTGGA	0.443																																							uc002tye.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1255-1257)AAG>CAG		formin-like 2							137.0	128.0	131.0					2																	153473647		1927	4144	6071	SO:0001583	missense	114793				actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding	g.chr2:153473647A>C	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1255A>C	2.37:g.153473647A>C	ENSP00000288670:p.Lys419Gln		Somatic				FMNL2_uc010fob.2_5'Flank|FMNL2_uc002tyf.2_5'Flank	p.K419Q	NM_052905	NP_443137	WXS	Illumina HiSeq	Unspecified	Q96PY5	FMNL2_HUMAN			13	1622	+			419			GBD/FH3.		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000288670.9	37	c.1255A>C	CCDS46429.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.653710	0.88056	.	.	ENSG00000157827	ENST00000288670	T	0.50277	0.75	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.69115	0.3075	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.67110	-0.5753	10	0.20519	T	0.43	.	16.2167	0.82231	1.0:0.0:0.0:0.0	.	419	Q96PY5-3	.	Q	419	ENSP00000288670:K419Q	ENSP00000288670:K419Q	K	+	1	0	FMNL2	153181893	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.339000	0.96797	2.231000	0.72958	0.533000	0.62120	AAG		0.443	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905		12	74	0	0	0	0.001368	0	12	74				
GALNT5	11227	broad.mit.edu	37	2	158115649	158115649	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:158115649G>T	ENST00000259056.4	+	1	1540	c.1055G>T	c.(1054-1056)gGt>gTt	p.G352V		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	352					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						AAAGTATTGGGTAAAAGCCAA	0.393																																							uc002tzg.2		NA																	0				breast(3)|skin(1)	4						c.(1054-1056)GGT>GTT		N-acetylgalactosaminyltransferase 5							81.0	84.0	83.0					2																	158115649		2203	4300	6503	SO:0001583	missense	11227				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:158115649G>T	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.1055G>T	2.37:g.158115649G>T	ENSP00000259056:p.Gly352Val		Somatic				GALNT5_uc010zci.1_RNA	p.G352V	NM_014568	NP_055383	WXS	Illumina HiSeq	Unspecified	Q7Z7M9	GALT5_HUMAN			1	1310	+			352			Lumenal (Potential).		A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	37	c.1055G>T	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.143917	0.37825	.	.	ENSG00000136542	ENST00000259056	T	0.58652	0.32	5.66	0.167	0.15006	.	2.699140	0.01109	N	0.005552	T	0.54615	0.1869	L	0.32530	0.975	0.26463	N	0.975402	P	0.48694	0.914	P	0.46758	0.526	T	0.50541	-0.8816	10	0.54805	T	0.06	.	8.8083	0.34952	0.4696:0.0:0.5304:0.0	.	352	Q7Z7M9	GALT5_HUMAN	V	352	ENSP00000259056:G352V	ENSP00000259056:G352V	G	+	2	0	GALNT5	157823895	0.003000	0.15002	0.025000	0.17156	0.082000	0.17680	0.368000	0.20399	0.139000	0.18822	0.655000	0.94253	GGT		0.393	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568		26	111	1	0	4.47668e-21	0.003954	6.72781e-21	26	111				
ITGB6	3694	broad.mit.edu	37	2	160964351	160964351	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:160964351G>A	ENST00000283249.2	-	14	2344	c.2107C>T	c.(2107-2109)Ccg>Tcg	p.P703S	ITGB6_ENST00000428609.2_Missense_Mutation_p.P661S|ITGB6_ENST00000409967.2_Missense_Mutation_p.P596S|ITGB6_ENST00000409872.1_Missense_Mutation_p.P703S	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	703					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						GGAGGCTTCGGACAATCTGCA	0.403																																							uc002ubh.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(2107-2109)CCG>TCG		integrin, beta 6 precursor							59.0	62.0	61.0					2																	160964351		2203	4300	6503	SO:0001583	missense	3694				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity	g.chr2:160964351G>A		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.2107C>T	2.37:g.160964351G>A	ENSP00000283249:p.Pro703Ser		Somatic				ITGB6_uc010fou.2_Missense_Mutation_p.P703S|ITGB6_uc010zcq.1_Missense_Mutation_p.P661S|ITGB6_uc010fov.1_Missense_Mutation_p.P703S	p.P703S	NM_000888	NP_000879	WXS	Illumina HiSeq	Unspecified	P18564	ITB6_HUMAN			14	2123	-			703			Extracellular (Potential).		B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	c.2107C>T	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876550	0.51801	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	5.93	5.93	0.95920	Integrin beta subunit, tail (2);	0.053858	0.85682	D	0.000000	D	0.86489	0.5945	M	0.73319	2.225	0.80722	D	1	B;B	0.28850	0.225;0.225	B;B	0.20767	0.031;0.031	D	0.84401	0.0560	10	0.56958	D	0.05	.	17.2595	0.87066	0.0:0.1251:0.8749:0.0	.	661;703	E9PEE8;P18564	.;ITB6_HUMAN	S	703;661;596;703	ENSP00000283249:P703S;ENSP00000408024:P661S;ENSP00000386828:P596S;ENSP00000386367:P703S	ENSP00000283249:P703S	P	-	1	0	ITGB6	160672597	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.560000	0.60802	2.826000	0.97356	0.655000	0.94253	CCG		0.403	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888		6	53	0	0	0	0.001984	0	6	53				
MYO3B	140469	broad.mit.edu	37	2	171262116	171262116	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:171262116C>A	ENST00000408978.4	+	21	2636	c.2493C>A	c.(2491-2493)tgC>tgA	p.C831*	MYO3B_ENST00000409044.3_Nonsense_Mutation_p.C831*|MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000334231.6_Nonsense_Mutation_p.C840*	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	831	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TGGAACTGTGCTTTGGCATTC	0.413																																							uc002ufy.2		NA																	0				lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						c.(2491-2493)TGC>TGA		myosin IIIB isoform 2							116.0	109.0	111.0					2																	171262116		1904	4131	6035	SO:0001587	stop_gained	140469				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity	g.chr2:171262116C>A		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2493C>A	2.37:g.171262116C>A	ENSP00000386213:p.Cys831*		Somatic				MYO3B_uc002ufv.2_Nonsense_Mutation_p.C818*|MYO3B_uc010fqb.1_Nonsense_Mutation_p.C818*|MYO3B_uc002ufz.2_Nonsense_Mutation_p.C831*|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	p.C831*	NM_138995	NP_620482	WXS	Illumina HiSeq	Unspecified	Q8WXR4	MYO3B_HUMAN			21	2636	+			831			Myosin head-like.		B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Nonsense_Mutation	SNP	ENST00000408978.4	37	c.2493C>A	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	C	39	7.662398	0.98419	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	.	.	.	5.5	3.66	0.41972	.	0.170488	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	3.2949	0.06963	0.1944:0.4862:0.0:0.3194	.	.	.	.	X	831;831;830;840;840	.	ENSP00000314213:C830X	C	+	3	2	MYO3B	170970362	0.865000	0.29922	1.000000	0.80357	0.997000	0.91878	-0.033000	0.12246	1.433000	0.47394	0.655000	0.94253	TGC		0.413	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1			21	88	1	0	7.87624e-14	0.00278	1.10477e-13	21	88				
TTN	7273	broad.mit.edu	37	2	179428882	179428882	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:179428882T>G	ENST00000591111.1	-	276	77278	c.77054A>C	c.(77053-77055)aAa>aCa	p.K25685T	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K18386T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K18261T|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K18453T|TTN_ENST00000342992.6_Missense_Mutation_p.K24758T|TTN_ENST00000589042.1_Missense_Mutation_p.K27326T|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25685	Ig-like 125.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATAGTAGATTTAATTTCCAT	0.378																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(74272-74274)AAA>ACA		titin isoform N2-A							166.0	173.0	171.0					2																	179428882		1863	4096	5959	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179428882T>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.77054A>C	2.37:g.179428882T>G	ENSP00000465570:p.Lys25685Thr		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.K18453T|TTN_uc010zfi.1_Missense_Mutation_p.K18386T|TTN_uc010zfj.1_Missense_Mutation_p.K18261T	p.K24758T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	74497	-			25685					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.74273A>C		.	.	.	.	.	.	.	.	.	.	T	13.28	2.189686	0.38707	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	6.07	6.07	0.98685	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72566	0.3476	N	0.25485	0.75	0.58432	D	0.999998	D;D;D;D	0.76494	0.998;0.998;0.998;0.999	D;D;D;D	0.67900	0.918;0.918;0.918;0.954	T	0.76113	-0.3078	9	0.87932	D	0	.	16.6268	0.84972	0.0:0.0:0.0:1.0	.	18261;18386;18453;25685	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	24758;18261;18453;18386;18259	ENSP00000343764:K24758T;ENSP00000434586:K18261T;ENSP00000340554:K18453T;ENSP00000352154:K18386T	ENSP00000340554:K18453T	K	-	2	0	TTN	179137128	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.194000	0.72082	2.326000	0.78906	0.528000	0.53228	AAA		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		30	203	0	0	0	0.002836	0	30	203				
TTN	7273	broad.mit.edu	37	2	179547582	179547582	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:179547582T>G	ENST00000591111.1	-	133	32209	c.31985A>C	c.(31984-31986)gAa>gCa	p.E10662A	TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.E9735A|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E10979A|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAAACAGCTTCTTCTTCTAG	0.328																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(29203-29205)GAA>GCA		titin isoform N2-A							187.0	158.0	167.0					2																	179547582		1832	4080	5912	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179547582T>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.31985A>C	2.37:g.179547582T>G	ENSP00000465570:p.Glu10662Ala		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E6396A|TTN_uc010fre.1_Missense_Mutation_p.E582A	p.E9735A	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		132	29428	-			10662					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.29204A>C		.	.	.	.	.	.	.	.	.	.	T	2.678	-0.276024	0.05679	.	.	ENSG00000155657	ENST00000342992;ENST00000414766	D;T	0.81739	-1.53;-0.2	5.18	4.01	0.46588	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.68531	0.3011	L	0.27053	0.805	0.80722	D	1	B;B	0.28350	0.001;0.208	B;B	0.22152	0.001;0.038	T	0.66658	-0.5868	9	0.87932	D	0	.	10.8596	0.46819	0.0:0.0:0.1582:0.8418	.	10662;10398	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	A	9735;593	ENSP00000343764:E9735A;ENSP00000401501:E593A	ENSP00000343764:E9735A	E	-	2	0	TTN	179255827	0.732000	0.28121	0.926000	0.36857	0.241000	0.25554	0.983000	0.29552	0.896000	0.36366	0.533000	0.62120	GAA		0.328	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		13	29	0	0	0	0.001368	0	13	29				
CCDC141	285025	broad.mit.edu	37	2	179701812	179701812	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:179701812G>T	ENST00000420890.2	-	23	4251	c.4134C>A	c.(4132-4134)acC>acA	p.T1378T	CCDC141_ENST00000480419.1_5'UTR|CCDC141_ENST00000295723.5_Silent_p.T803T	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1378										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			AGCCCCTGCTGGTGCCTGATT	0.488																																							uc002unf.1		NA																	0				ovary(7)|pancreas(2)|skin(1)	10						c.(2407-2409)ACC>ACA		coiled-coil domain containing 141							43.0	45.0	44.0					2																	179701812		2203	4300	6503	SO:0001819	synonymous_variant	285025						protein binding	g.chr2:179701812G>T	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.4134C>A	2.37:g.179701812G>T			Somatic				CCDC141_uc002une.1_Silent_p.T253T	p.T803T	NM_173648	NP_775919	WXS	Illumina HiSeq	Unspecified	Q6ZP82	CC141_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)		13	2466	-			803					H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	ENST00000420890.2	37	c.2409C>A																																																																																					0.488	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		19	29	1	0	2.4624e-09	0.008871	3.11351e-09	19	29				
ZNF804A	91752	broad.mit.edu	37	2	185802849	185802849	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:185802849A>T	ENST00000302277.6	+	4	3320	c.2726A>T	c.(2725-2727)gAt>gTt	p.D909V		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	909							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GAATTGTCAGATGTTTCCAAT	0.413																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(2725-2727)GAT>GTT		zinc finger protein 804A							94.0	89.0	90.0					2																	185802849		2203	4300	6503	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185802849A>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2726A>T	2.37:g.185802849A>T	ENSP00000303252:p.Asp909Val		Somatic					p.D909V	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	3320	+			909					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.2726A>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	A	7.117	0.577200	0.13686	.	.	ENSG00000170396	ENST00000302277	T	0.06294	3.32	5.57	5.57	0.84162	.	0.444040	0.20939	N	0.082947	T	0.05547	0.0146	N	0.19112	0.55	0.28306	N	0.922916	P	0.36048	0.534	B	0.32289	0.143	T	0.18335	-1.0340	10	0.66056	D	0.02	-2.154	14.903	0.70696	1.0:0.0:0.0:0.0	.	909	Q7Z570	Z804A_HUMAN	V	909	ENSP00000303252:D909V	ENSP00000303252:D909V	D	+	2	0	ZNF804A	185511094	0.776000	0.28616	0.054000	0.19295	0.013000	0.08279	2.904000	0.48719	2.111000	0.64477	0.482000	0.46254	GAT		0.413	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		16	88	0	0	0	0.004007	0	16	88				
MYO1B	4430	broad.mit.edu	37	2	192250719	192250719	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:192250719A>G	ENST00000392318.3	+	16	1710	c.1463A>G	c.(1462-1464)cAt>cGt	p.H488R	MYO1B_ENST00000339514.4_Missense_Mutation_p.H488R|MYO1B_ENST00000304164.4_Missense_Mutation_p.H488R|MYO1B_ENST00000392316.1_Missense_Mutation_p.H488R	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	488	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			ACCCACCAGCATTTTGAGAGC	0.522																																							uc010fsg.2		NA																	0				central_nervous_system(5)|large_intestine(2)|ovary(1)	8						c.(1462-1464)CAT>CGT		myosin IB isoform 1							237.0	217.0	224.0					2																	192250719		2203	4300	6503	SO:0001583	missense	4430					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr2:192250719A>G	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.1463A>G	2.37:g.192250719A>G	ENSP00000376132:p.His488Arg		Somatic				MYO1B_uc002usq.2_Missense_Mutation_p.H488R|MYO1B_uc002usr.2_Missense_Mutation_p.H488R|MYO1B_uc002ust.1_Missense_Mutation_p.H126R	p.H488R	NM_001130158	NP_001123630	WXS	Illumina HiSeq	Unspecified	O43795	MYO1B_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)		16	1718	+			488			Myosin head-like.		O43794|Q7Z6L5	Missense_Mutation	SNP	ENST00000392318.3	37	c.1463A>G	CCDS46477.1	.	.	.	.	.	.	.	.	.	.	A	17.70	3.454270	0.63290	.	.	ENSG00000128641	ENST00000339514;ENST00000392318;ENST00000304164;ENST00000392316	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.33	5.33	0.75918	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.83275	0.5219	L	0.31845	0.965	0.80722	D	1	B;B;B	0.24092	0.097;0.097;0.02	B;B;B	0.33254	0.16;0.16;0.043	T	0.79405	-0.1817	10	0.32370	T	0.25	.	15.5993	0.76611	1.0:0.0:0.0:0.0	.	488;488;488	B0I1S9;O43795;O43795-2	.;MYO1B_HUMAN;.	R	488	ENSP00000341903:H488R;ENSP00000376132:H488R;ENSP00000306382:H488R;ENSP00000376130:H488R	ENSP00000306382:H488R	H	+	2	0	MYO1B	191958964	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.287000	0.95975	2.148000	0.66965	0.472000	0.43445	CAT		0.522	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223		67	240	0	0	0	0.00361	0	67	240				
PLCL1	5334	broad.mit.edu	37	2	198950576	198950576	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:198950576G>T	ENST00000428675.1	+	2	2733	c.2335G>T	c.(2335-2337)Gat>Tat	p.D779Y	PLCL1_ENST00000437704.2_Missense_Mutation_p.D681Y	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	779	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TCCTATTTTTGATGAAACTTT	0.388																																							uc010fsp.2		NA																	0				ovary(1)|skin(1)	2						c.(2335-2337)GAT>TAT		RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	Quinacrine(DB01103)						119.0	113.0	115.0					2																	198950576		2203	4300	6503	SO:0001583	missense	5334				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr2:198950576G>T	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2335G>T	2.37:g.198950576G>T	ENSP00000402861:p.Asp779Tyr		Somatic				PLCL1_uc002uuv.3_Missense_Mutation_p.D700Y	p.D779Y	NM_001114661	NP_001108133	WXS	Illumina HiSeq	Unspecified	Q15111	PLCL1_HUMAN			2	2626	+			779			C2.		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	c.2335G>T	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372345	0.61624	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.15834	2.39;2.39	5.36	5.36	0.76844	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.168555	0.42172	D	0.000755	T	0.52175	0.1718	M	0.90759	3.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.59726	-0.7400	9	.	.	.	.	19.2914	0.94102	0.0:0.0:1.0:0.0	.	779;705	Q15111;B4DYZ4	PLCL1_HUMAN;.	Y	779;681	ENSP00000402861:D779Y;ENSP00000414138:D681Y	.	D	+	1	0	PLCL1	198658821	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.643000	0.98464	2.793000	0.96121	0.561000	0.74099	GAT		0.388	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226		13	134	1	0	9.31168e-06	0.001855	1.07176e-05	13	134				
ZDBF2	57683	broad.mit.edu	37	2	207171954	207171954	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:207171954A>C	ENST00000374423.3	+	5	3088	c.2702A>C	c.(2701-2703)cAg>cCg	p.Q901P		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	901							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AAAGAAGAGCAGGTACACTTA	0.368																																							uc002vbp.2		NA																	0				ovary(3)	3						c.(2701-2703)CAG>CCG		zinc finger, DBF-type containing 2							47.0	44.0	45.0					2																	207171954		1833	4093	5926	SO:0001583	missense	57683						nucleic acid binding|zinc ion binding	g.chr2:207171954A>C	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2702A>C	2.37:g.207171954A>C	ENSP00000363545:p.Gln901Pro		Somatic					p.Q901P	NM_020923	NP_065974	WXS	Illumina HiSeq	Unspecified	Q9HCK1	ZDBF2_HUMAN			5	2952	+			901					Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	c.2702A>C	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	A	7.753	0.703663	0.15172	.	.	ENSG00000204186	ENST00000374423	T	0.48201	0.82	4.29	0.701	0.18104	.	0.928689	0.08841	N	0.885789	T	0.38665	0.1049	L	0.46157	1.445	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.30966	-0.9960	10	0.36615	T	0.2	.	7.3659	0.26772	0.7495:0.0:0.2505:0.0	.	901	Q9HCK1	ZDBF2_HUMAN	P	901	ENSP00000363545:Q901P	ENSP00000363545:Q901P	Q	+	2	0	ZDBF2	206880199	0.024000	0.19004	0.000000	0.03702	0.034000	0.12701	1.591000	0.36665	0.120000	0.18254	0.533000	0.62120	CAG		0.368	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		9	38	0	0	0	0.004482	0	9	38				
ZDBF2	57683	broad.mit.edu	37	2	207174447	207174447	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:207174447T>G	ENST00000374423.3	+	5	5581	c.5195T>G	c.(5194-5196)cTa>cGa	p.L1732R		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1732							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						CGTTCGAAGCTAAAACATAGA	0.448																																							uc002vbp.2		NA																	0				ovary(3)	3						c.(5194-5196)CTA>CGA		zinc finger, DBF-type containing 2							76.0	74.0	74.0					2																	207174447		1866	4104	5970	SO:0001583	missense	57683						nucleic acid binding|zinc ion binding	g.chr2:207174447T>G	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5195T>G	2.37:g.207174447T>G	ENSP00000363545:p.Leu1732Arg		Somatic					p.L1732R	NM_020923	NP_065974	WXS	Illumina HiSeq	Unspecified	Q9HCK1	ZDBF2_HUMAN			5	5445	+			1732					Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	c.5195T>G	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.381851	0.42207	.	.	ENSG00000204186	ENST00000374423	T	0.64438	-0.1	3.9	-0.825	0.10809	.	.	.	.	.	T	0.35451	0.0932	N	0.14661	0.345	0.09310	N	1	B	0.32203	0.36	B	0.24848	0.056	T	0.15206	-1.0445	9	0.42905	T	0.14	.	3.4921	0.07641	0.0:0.3362:0.2114:0.4524	.	1732	Q9HCK1	ZDBF2_HUMAN	R	1732	ENSP00000363545:L1732R	ENSP00000363545:L1732R	L	+	2	0	ZDBF2	206882692	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.016000	0.13377	-0.101000	0.12219	-0.417000	0.06048	CTA		0.448	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		13	48	0	0	0	0.001368	0	13	48				
DES	1674	broad.mit.edu	37	2	220285636	220285636	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:220285636C>G	ENST00000373960.3	+	5	1070	c.984C>G	c.(982-984)atC>atG	p.I328M		NM_001927.3	NP_001918.3	P17661	DESM_HUMAN	desmin	328	Coil 2B.|Rod.				cytoskeleton organization (GO:0007010)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart contraction (GO:0008016)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)	18		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		GACACCAGATCCAGTCCTACA	0.602																																							uc002vll.2		NA																	0				central_nervous_system(2)	2						c.(982-984)ATC>ATG		desmin							97.0	86.0	90.0					2																	220285636		2203	4300	6503	SO:0001583	missense	1674				cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton	g.chr2:220285636C>G	AF521879	CCDS33383.1	2q35	2014-09-17			ENSG00000175084	ENSG00000175084		"""Intermediate filaments type III"""	2770	protein-coding gene	gene with protein product	"""intermediate filament protein"""	125660				2673923, 9736733	Standard	NM_001927		Approved	CMD1I, CSM1, CSM2	uc002vll.3	P17661	OTTHUMG00000058924	ENST00000373960.3:c.984C>G	2.37:g.220285636C>G	ENSP00000363071:p.Ile328Met		Somatic					p.I328M	NM_001927	NP_001918	WXS	Illumina HiSeq	Unspecified	P17661	DESM_HUMAN		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)	5	1070	+		Renal(207;0.0183)	328			Rod.|Coil 2B.		Q15787|Q549R7|Q549R8|Q549R9|Q8IZR1|Q8IZR6|Q8NES2|Q8NEU6|Q8TAC4|Q8TCX2|Q8TD99|Q9UHN5|Q9UJ80	Missense_Mutation	SNP	ENST00000373960.3	37	c.984C>G	CCDS33383.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963406	0.74016	.	.	ENSG00000175084	ENST00000373960	D	0.95918	-3.85	4.91	4.91	0.64330	Filament (1);	0.000000	0.49305	D	0.000147	D	0.95503	0.8539	L	0.58510	1.815	0.45272	D	0.998279	P	0.50443	0.935	P	0.53518	0.728	D	0.95340	0.8437	10	0.87932	D	0	.	11.4025	0.49878	0.0:0.9164:0.0:0.0836	.	328	P17661	DESM_HUMAN	M	328	ENSP00000363071:I328M	ENSP00000363071:I328M	I	+	3	3	DES	219993880	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.670000	0.61583	2.533000	0.85409	0.561000	0.74099	ATC		0.602	DES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130240.1	NM_001927		10	30	0	0	0	0.006214	0	10	30				
FARSB	10056	broad.mit.edu	37	2	223436741	223436741	+	Splice_Site	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:223436741C>A	ENST00000281828.6	-	17	1882	c.1619G>T	c.(1618-1620)gGg>gTg	p.G540V	FARSB_ENST00000536361.1_Splice_Site_p.G441V|RP11-16P6.1_ENST00000568928.1_RNA	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	540					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	GAAAGCAGGCCCTGAAAAAGA	0.423																																							uc002vne.1		NA																	0				ovary(1)	1						c.(1618-1620)GGG>GTG		phenylalanyl-tRNA synthetase, beta subunit	L-Phenylalanine(DB00120)						32.0	33.0	33.0					2																	223436741		2203	4300	6503	SO:0001630	splice_region_variant	10056				phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|RNA binding	g.chr2:223436741C>A	AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.1619-1G>T	2.37:g.223436741C>A			Somatic				FARSB_uc010zlq.1_Missense_Mutation_p.G560V|FARSB_uc002vnf.1_Missense_Mutation_p.G441V	p.G540V	NM_005687	NP_005678	WXS	Illumina HiSeq	Unspecified	Q9NSD9	SYFB_HUMAN		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	17	1654	-		Renal(207;0.0183)	540					B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Missense_Mutation	SNP	ENST00000281828.6	37	c.1619G>T	CCDS2454.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111717	0.37242	.	.	ENSG00000116120	ENST00000281828;ENST00000536361	.	.	.	5.49	3.69	0.42338	.	0.148487	0.64402	D	0.000010	T	0.43389	0.1245	N	0.22421	0.69	0.80722	D	1	B;B	0.23650	0.001;0.089	B;B	0.31337	0.01;0.128	T	0.42766	-0.9432	9	0.72032	D	0.01	.	7.7785	0.29051	0.0:0.6977:0.0:0.3023	.	540;540	A8K666;Q9NSD9	.;SYFB_HUMAN	V	540;441	.	ENSP00000281828:G540V	G	-	2	0	FARSB	223144985	0.998000	0.40836	0.762000	0.31397	0.497000	0.33675	3.299000	0.51826	1.315000	0.45114	0.655000	0.94253	GGG		0.423	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256855.2	NM_005687	Missense_Mutation	7	47	1	0	0.00198382	0.001984	0.00211661	7	47				
KCNE4	23704	broad.mit.edu	37	2	223917638	223917638	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:223917638C>A	ENST00000281830.3	+	2	574	c.243C>A	c.(241-243)agC>agA	p.S81R	KCNE4_ENST00000604125.1_Missense_Mutation_p.S30R|KCNE4_ENST00000488477.2_Intron			Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related family, member 4	81						apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	voltage-gated potassium channel activity (GO:0005249)			large_intestine(2)|lung(5)|ovary(2)|skin(1)	10		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		GCGGCGGCAGCGGCAATGGCA	0.597																																							uc002vnl.3		NA																	0				ovary(1)	1						c.(88-90)AGC>AGA		potassium voltage-gated channel, Isk-related							72.0	60.0	64.0					2																	223917638		2203	4300	6503	SO:0001583	missense	23704					integral to membrane	voltage-gated potassium channel activity	g.chr2:223917638C>A	AY065987	CCDS2456.1, CCDS2456.2	2q36.1	2008-02-05			ENSG00000152049	ENSG00000152049		"""Potassium channels"""	6244	protein-coding gene	gene with protein product		607775				10219239, 12670483	Standard	NM_080671		Approved	MiRP3	uc002vnl.5	Q8WWG9	OTTHUMG00000133161	ENST00000281830.3:c.243C>A	2.37:g.223917638C>A	ENSP00000281830:p.Ser81Arg		Somatic					p.S30R	NM_080671	NP_542402	WXS	Illumina HiSeq	Unspecified	Q8WWG9	KCNE4_HUMAN		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)	2	244	+		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)	30					B7Z275|Q53SM4|Q96CC4	Missense_Mutation	SNP	ENST00000281830.3	37	c.90C>A		.	.	.	.	.	.	.	.	.	.	C	9.751	1.167456	0.21621	.	.	ENSG00000152049	ENST00000281830	.	.	.	5.63	-0.0381	0.13881	.	1.004310	0.08000	N	0.988686	T	0.33381	0.0861	L	0.47716	1.5	0.09310	N	1	B	0.31383	0.321	B	0.28784	0.094	T	0.22626	-1.0211	9	0.30854	T	0.27	11.5171	8.6875	0.34247	0.0:0.5106:0.0:0.4894	.	30	Q8WWG9	KCNE4_HUMAN	R	30	.	ENSP00000281830:S30R	S	+	3	2	KCNE4	223625882	0.000000	0.05858	0.001000	0.08648	0.034000	0.12701	-0.590000	0.05760	-0.050000	0.13356	-0.671000	0.03813	AGC		0.597	KCNE4-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000330997.2	NM_080671		57	69	1	0	7.47603e-22	0.00361	1.13653e-21	57	69				
SLC16A14	151473	broad.mit.edu	37	2	230911413	230911413	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:230911413C>A	ENST00000295190.4	-	4	887	c.429G>T	c.(427-429)ctG>ctT	p.L143L		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		CCACCGCTGGCAGGTAGGCCA	0.602																																							uc002vqd.1		NA																	0				ovary(4)|skin(2)	6						c.(427-429)CTG>CTT		solute carrier family 16 (monocarboxylic acid							24.0	25.0	24.0					2																	230911413		2197	4277	6474	SO:0001819	synonymous_variant	151473					integral to membrane|plasma membrane	symporter activity	g.chr2:230911413C>A	BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.429G>T	2.37:g.230911413C>A			Somatic				FBXO36_uc010fxi.1_Intron|SLC16A14_uc002vqe.2_Silent_p.L143L|SLC16A14_uc002vqf.2_Silent_p.L143L	p.L143L	NM_152527	NP_689740	WXS	Illumina HiSeq	Unspecified	Q7RTX9	MOT14_HUMAN		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)	4	792	-		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)	143			Helical; (Potential).		A8KA08|Q53R92|Q96NI7	Silent	SNP	ENST00000295190.4	37	c.429G>T	CCDS2473.1																																																																																				0.602	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527		6	61	1	0	0.00116845	0.001168	0.00125686	6	61				
UGT1A4	54657	broad.mit.edu	37	2	234627778	234627778	+	Silent	SNP	A	A	G	rs373602050		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:234627778A>G	ENST00000373409.3	+	1	355	c.312A>G	c.(310-312)gaA>gaG	p.E104E	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A6_ENST00000480628.1_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	104					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	TTGAAACAGAACATCTTCTGA	0.433																																					Melanoma(99;1011 1962 13201 26492)	Melanoma(99;1011 1962 13201 26492)	uc002vux.2		NA																	0				skin(1)	1						c.(310-312)GAA>GAG		UDP glycosyltransferase 1 family, polypeptide A4	Imipramine(DB00458)|Lamotrigine(DB00555)|Paricalcitol(DB00910)|Trifluoperazine(DB00831)	A	,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	134.0	134.0	134.0		,312,,,,,,	0.3	0.0	2		134	0,8600		0,0,4300	no	intron,coding-synonymous,intron,intron,intron,intron,intron,intron	UGT1A10,UGT1A8,UGT1A7,UGT1A6,UGT1A5,UGT1A9,UGT1A4	NM_001072.3,NM_007120.2,NM_019075.2,NM_019076.4,NM_019077.2,NM_019078.1,NM_021027.2,NM_205862.1	,,,,,,,	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	,,,,,,,	,104/535,,,,,,	234627778	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54657				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity	g.chr2:234627778A>G	M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.312A>G	2.37:g.234627778A>G			Somatic				UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Silent_p.E104E	p.E104E	NM_007120	NP_009051	WXS	Illumina HiSeq	Unspecified	P22310	UD14_HUMAN		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	1	341	+		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)	104					B2R937|B8K288|Q5DT00	Silent	SNP	ENST00000373409.3	37	c.312A>G	CCDS33405.1																																																																																				0.433	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130984.1	NM_007120		137	95	0	0	0	0.00361	0	137	95				
COL6A3	1293	broad.mit.edu	37	2	238245021	238245021	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:238245021C>T	ENST00000295550.4	-	40	9174	c.8722G>A	c.(8722-8724)Gcc>Acc	p.A2908T	COL6A3_ENST00000346358.4_Missense_Mutation_p.A2708T|COL6A3_ENST00000472056.1_Missense_Mutation_p.A2301T|COL6A3_ENST00000347401.3_Missense_Mutation_p.A2707T|COL6A3_ENST00000353578.4_Missense_Mutation_p.A2702T|COL6A3_ENST00000409809.1_Missense_Mutation_p.A2702T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2908	Ala-rich.|Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTTGCAGCGGCTGGCTTCACA	0.577																																							uc002vwl.2		NA																	0				ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(8722-8724)GCC>ACC		alpha 3 type VI collagen isoform 1 precursor							107.0	119.0	115.0					2																	238245021		2203	4300	6503	SO:0001583	missense	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238245021C>T	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8722G>A	2.37:g.238245021C>T	ENSP00000295550:p.Ala2908Thr		Somatic				COL6A3_uc002vwo.2_Missense_Mutation_p.A2702T|COL6A3_uc010znj.1_Missense_Mutation_p.A2301T|COL6A3_uc002vwj.2_Missense_Mutation_p.A289T	p.A2908T	NM_004369	NP_004360	WXS	Illumina HiSeq	Unspecified	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	40	9007	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	2908			Nonhelical region.|Ala-rich.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	c.8722G>A	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	11.27	1.590153	0.28357	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.89196	-2.48;-2.44;-2.43;-2.44;-2.43;-2.42	5.46	2.64	0.31445	.	0.387155	0.21551	N	0.072737	D	0.82435	0.5036	L	0.56769	1.78	0.09310	N	1	B;B;B	0.30281	0.18;0.275;0.18	B;B;B	0.30179	0.083;0.112;0.052	T	0.65738	-0.6095	10	0.15499	T	0.54	.	5.0181	0.14347	0.0:0.6414:0.1742:0.1844	.	2301;2702;2908	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	T	2908;2707;2702;2301;2702;2708	ENSP00000295550:A2908T;ENSP00000315609:A2707T;ENSP00000315873:A2702T;ENSP00000418285:A2301T;ENSP00000386844:A2702T;ENSP00000295546:A2708T	ENSP00000295550:A2908T	A	-	1	0	COL6A3	237909760	0.070000	0.21116	0.005000	0.12908	0.103000	0.19146	2.158000	0.42329	0.646000	0.30693	0.563000	0.77884	GCC		0.577	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		11	224	0	0	0	0.001855	0	11	224				
OR6B3	150681	broad.mit.edu	37	2	240985297	240985297	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:240985297A>T	ENST00000319423.4	-	1	192	c.193T>A	c.(193-195)Tcc>Acc	p.S65T	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		AAAGACATGGAGCTCAGAAAG	0.557																																							uc010zoe.1		NA																	0					0						c.(193-195)TCC>ACC		olfactory receptor, family 6, subfamily B,							100.0	107.0	105.0					2																	240985297		2081	4210	6291	SO:0001583	missense	150681				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr2:240985297A>T		CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.193T>A	2.37:g.240985297A>T	ENSP00000322435:p.Ser65Thr		Somatic				PRR21_uc010zod.1_5'Flank	p.S65T	NM_173351	NP_775486	WXS	Illumina HiSeq	Unspecified	Q8NGW1	OR6B3_HUMAN		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)	1	193	-		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)	65			Helical; Name=2; (Potential).		Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	c.193T>A	CCDS42837.1	.	.	.	.	.	.	.	.	.	.	A	9.794	1.178640	0.21787	.	.	ENSG00000178586	ENST00000319423	T	0.03004	4.08	3.97	-7.94	0.01152	GPCR, rhodopsin-like superfamily (1);	1.551240	0.04226	N	0.334358	T	0.02047	0.0064	N	0.10760	0.04	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.47156	-0.9139	10	0.51188	T	0.08	.	7.4022	0.26971	0.6447:0.08:0.0:0.2752	.	65	Q8NGW1	OR6B3_HUMAN	T	65	ENSP00000322435:S65T	ENSP00000322435:S65T	S	-	1	0	OR6B3	240633970	0.000000	0.05858	0.000000	0.03702	0.594000	0.36715	-2.487000	0.00977	-1.645000	0.01515	-0.732000	0.03574	TCC		0.557	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1			20	95	0	0	0	0.010504	0	20	95				
TTLL9	164395	broad.mit.edu	37	20	30525286	30525286	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr20:30525286C>A	ENST00000375938.4	+	13	1345	c.1092C>A	c.(1090-1092)acC>acA	p.T364T	TTLL9_ENST00000310998.4_Silent_p.T329T|TTLL9_ENST00000535842.1_Silent_p.T364T|TTLL9_ENST00000375921.2_3'UTR|TTLL9_ENST00000375934.4_3'UTR|TTLL9_ENST00000375922.4_Silent_p.T306T			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	364	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGGAAGACACCCTGCATGTTG	0.582																																							uc010gdx.1		NA																	0				ovary(2)	2						c.(1090-1092)ACC>ACA		tubulin tyrosine ligase-like family, member 9							71.0	77.0	75.0					20																	30525286		2115	4236	6351	SO:0001819	synonymous_variant	164395				protein modification process	cilium|microtubule|microtubule basal body	ATP binding|tubulin-tyrosine ligase activity	g.chr20:30525286C>A	AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.1092C>A	20.37:g.30525286C>A			Somatic				TTLL9_uc002wwy.1_RNA|TTLL9_uc002wwz.1_RNA|TTLL9_uc002wxa.1_RNA|TTLL9_uc002wxb.1_RNA|TTLL9_uc010zto.1_RNA|TTLL9_uc002wxc.2_Silent_p.T266T|TTLL9_uc010ztp.1_RNA|TTLL9_uc010ztq.1_RNA	p.T364T	NM_001008409	NP_001008409	WXS	Illumina HiSeq	Unspecified	Q3SXZ7	TTLL9_HUMAN	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)		13	1345	+			364			TTL.		A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Silent	SNP	ENST00000375938.4	37	c.1092C>A	CCDS42863.1																																																																																				0.582	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001008409		9	35	1	0	1.12685e-05	0.004482	1.29416e-05	9	35				
SNTA1	6640	broad.mit.edu	37	20	32026748	32026748	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr20:32026748C>G	ENST00000217381.2	-	2	666	c.395G>C	c.(394-396)gGg>gCg	p.G132A		NM_003098.2	NP_003089.1	Q13424	SNTA1_HUMAN	syntrophin, alpha 1	132	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.|PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|neuromuscular junction development (GO:0007528)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of vasoconstriction by circulating norepinephrine (GO:0003117)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular (GO:0005622)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	ATPase binding (GO:0051117)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)			breast(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(1)	13						GATGGCATCCCCCACAAAAAG	0.547																																							uc002wzd.1		NA																	0				skin(1)	1						c.(394-396)GGG>GCG		acidic alpha 1 syntrophin							141.0	133.0	136.0					20																	32026748		2203	4300	6503	SO:0001583	missense	6640				muscle contraction	cell junction|cytoplasm|cytoskeleton|sarcolemma	actin binding|calmodulin binding	g.chr20:32026748C>G	U40571	CCDS13220.1	20q11.2	2014-09-17	2012-06-15		ENSG00000101400	ENSG00000101400			11167	protein-coding gene	gene with protein product	"""pro-TGF-alpha cytoplasmic domain-interacting protein 1"", ""dystrophin-associated protein A1, 59kDa, acidic component"""	601017	"""syntrophin, alpha 1 (dystrophin-associated protein A1, 59kD, acidic component)"""	SNT1		8576247, 8612778	Standard	NM_003098		Approved	TACIP1, LQT12	uc002wzd.1	Q13424	OTTHUMG00000032259	ENST00000217381.2:c.395G>C	20.37:g.32026748C>G	ENSP00000217381:p.Gly132Ala		Somatic				SNTA1_uc010zuf.1_Missense_Mutation_p.G132A	p.G132A	NM_003098	NP_003089	WXS	Illumina HiSeq	Unspecified	Q13424	SNTA1_HUMAN			2	667	-			132			PH 1.|PDZ.		A8K7H9|B4DX40|E1P5N1|Q16438	Missense_Mutation	SNP	ENST00000217381.2	37	c.395G>C	CCDS13220.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191710	0.78902	.	.	ENSG00000101400	ENST00000217381	T	0.59083	0.29	5.03	5.03	0.67393	PDZ/DHR/GLGF (4);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.84538	0.5494	H	0.96805	3.885	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.998;0.999	D	0.89836	0.3999	10	0.87932	D	0	-10.9869	18.1836	0.89786	0.0:1.0:0.0:0.0	.	132;132	B4DX40;Q13424	.;SNTA1_HUMAN	A	132	ENSP00000217381:G132A	ENSP00000217381:G132A	G	-	2	0	SNTA1	31490409	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	7.307000	0.78920	2.614000	0.88457	0.561000	0.74099	GGG		0.547	SNTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078704.2	NM_003098		16	162	0	0	0	0.002299	0	16	162				
ZNF341	84905	broad.mit.edu	37	20	32354696	32354696	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr20:32354696C>A	ENST00000375200.1	+	9	1627	c.1262C>A	c.(1261-1263)gCc>gAc	p.A421D	ZNF341_ENST00000342427.2_Missense_Mutation_p.A414D	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						CAGCCCCAGGCCTTGTCCACA	0.622																																							uc002wzy.2		NA																	0				ovary(2)	2						c.(1261-1263)GCC>GAC		zinc finger protein 341							134.0	133.0	134.0					20																	32354696		2203	4300	6503	SO:0001583	missense	84905				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:32354696C>A	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.1262C>A	20.37:g.32354696C>A	ENSP00000364346:p.Ala421Asp		Somatic				ZNF341_uc002wzx.2_Missense_Mutation_p.A414D|ZNF341_uc010geq.2_Missense_Mutation_p.A331D|ZNF341_uc010ger.2_RNA	p.A421D	NM_032819	NP_116208	WXS	Illumina HiSeq	Unspecified	Q9BYN7	ZN341_HUMAN			9	1282	+			421					A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	ENST00000375200.1	37	c.1262C>A		.	.	.	.	.	.	.	.	.	.	C	10.57	1.386730	0.25031	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.09911	3.17;2.93	5.27	4.32	0.51571	.	0.811510	0.11414	N	0.566460	T	0.06325	0.0163	N	0.12182	0.205	0.29024	N	0.886131	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.001;0.002	T	0.12941	-1.0528	10	0.30078	T	0.28	-7.8279	8.0344	0.30484	0.1707:0.7455:0.0:0.0838	.	362;421;414	Q504V9;Q9BYN7;Q9BYN7-2	.;ZN341_HUMAN;.	D	414;421	ENSP00000344308:A414D;ENSP00000364346:A421D	ENSP00000344308:A414D	A	+	2	0	ZNF341	31818357	1.000000	0.71417	0.997000	0.53966	0.354000	0.29330	1.069000	0.30641	2.642000	0.89623	0.462000	0.41574	GCC		0.622	ZNF341-201	KNOWN	basic	protein_coding	protein_coding				14	298	1	0	1.49906e-05	0.00245	1.71042e-05	14	298				
TOP1	7150	broad.mit.edu	37	20	39726903	39726903	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr20:39726903G>C	ENST00000361337.2	+	11	1151	c.901G>C	c.(901-903)Gat>Cat	p.D301H	RP1-1J6.2_ENST00000454626.1_RNA	NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	301					chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	AAGCAAATGTGATTTTACCCA	0.368			T	NUP98	AML*																																		uc002xjl.2		NA		Dom	yes		20	20q12-q13.1	7150	T	topoisomerase (DNA) I			L	NUP98		AML*		0				breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7						c.(901-903)GAT>CAT		DNA topoisomerase I	Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)						101.0	101.0	101.0					20																	39726903		2203	4300	6503	SO:0001583	missense	7150				DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding	g.chr20:39726903G>C		CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.901G>C	20.37:g.39726903G>C	ENSP00000354522:p.Asp301His		Somatic					p.D301H	NM_003286	NP_003277	WXS	Illumina HiSeq	Unspecified	P11387	TOP1_HUMAN			11	1147	+		Myeloproliferative disorder(115;0.00878)	301					A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Missense_Mutation	SNP	ENST00000361337.2	37	c.901G>C	CCDS13312.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.506105	0.85282	.	.	ENSG00000198900	ENST00000361337	T	0.60171	0.21	6.03	6.03	0.97812	DNA topoisomerase I, domain 1 (1);DNA topoisomerase I, DNA binding, eukaryotic-type (2);	0.082809	0.85682	D	0.000000	D	0.83358	0.5237	M	0.93594	3.435	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.86414	0.1750	10	0.87932	D	0	-23.8202	20.5568	0.99304	0.0:0.0:1.0:0.0	.	301	P11387	TOP1_HUMAN	H	301	ENSP00000354522:D301H	ENSP00000354522:D301H	D	+	1	0	TOP1	39160317	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.388000	0.59633	2.861000	0.98227	0.655000	0.94253	GAT		0.368	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2			36	72	0	0	0	0.003755	0	36	72				
ACOT8	10005	broad.mit.edu	37	20	44470570	44470570	+	Silent	SNP	C	C	T	rs368111029		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr20:44470570C>T	ENST00000217455.4	-	6	957	c.867G>A	c.(865-867)ggG>ggA	p.G289G	SNX21_ENST00000344780.4_3'UTR|SNX21_ENST00000342644.5_Intron	NM_005469.3	NP_005460.2	O14734	ACOT8_HUMAN	acyl-CoA thioesterase 8	289					acyl-CoA metabolic process (GO:0006637)|alpha-linolenic acid metabolic process (GO:0036109)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|dicarboxylic acid catabolic process (GO:0043649)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|peroxisome fission (GO:0016559)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|viral process (GO:0016032)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|choloyl-CoA hydrolase activity (GO:0033882)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			kidney(2)|large_intestine(3)|lung(4)|skin(1)	10		Myeloproliferative disorder(115;0.0122)				GCCACAGCCGCCCATGGACCA	0.567																																							uc002xqa.1		NA																	0				skin(1)	1						c.(865-867)GGG>GGA		peroxisomal acyl-CoA thioesterase 1 isoform a							67.0	72.0	70.0					20																	44470570		2203	4300	6503	SO:0001819	synonymous_variant	10005				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase|interspecies interaction between organisms|peroxisome organization	peroxisomal matrix	acetyl-CoA hydrolase activity|acyl-CoA thioesterase activity|carboxylesterase activity|choloyl-CoA hydrolase activity|protein binding	g.chr20:44470570C>T	AF014404	CCDS13378.1	20q13.12	2012-05-16	2005-09-19	2005-09-19	ENSG00000101473	ENSG00000101473	3.1.2.27	"""Acyl CoA thioesterases"""	15919	protein-coding gene	gene with protein product	"""choloyl-CoA hydrolase"""	608123	"""peroxisomal acyl-CoA thioesterase"", ""peroxisomal acyl-CoA thioesterase 1"""	PTE1		10092594, 9153233, 16103133, 16940157	Standard	NM_005469		Approved	hACTE-III, hTE, PTE-2	uc002xqa.2	O14734	OTTHUMG00000033045	ENST00000217455.4:c.867G>A	20.37:g.44470570C>T			Somatic				SNX21_uc002xps.1_Intron|SNX21_uc002xpt.1_3'UTR|SNX21_uc002xpu.1_3'UTR|SNX21_uc002xpv.1_3'UTR|SNX21_uc002xpw.1_3'UTR|SNX21_uc002xpx.2_3'UTR|SNX21_uc010zxd.1_3'UTR|SNX21_uc002xpy.1_3'UTR|SNX21_uc002xpz.1_3'UTR	p.G289G	NM_005469	NP_005460	WXS	Illumina HiSeq	Unspecified	O14734	ACOT8_HUMAN			6	948	-		Myeloproliferative disorder(115;0.0122)	289					O15261|Q17RX4	Silent	SNP	ENST00000217455.4	37	c.867G>A	CCDS13378.1	.	.	.	.	.	.	.	.	.	.	C	9.713	1.157621	0.21454	.	.	ENSG00000101473	ENST00000487205	.	.	.	5.11	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.52853	0.1760	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46830	-0.9163	6	0.39692	T	0.17	.	4.2794	0.10825	0.2667:0.494:0.0:0.2392	.	.	.	.	D	179	.	ENSP00000419403:G179D	G	-	2	0	ACOT8	43903977	0.970000	0.33590	1.000000	0.80357	0.988000	0.76386	0.048000	0.14078	0.737000	0.32582	-0.291000	0.09656	GGC		0.567	ACOT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080338.2	NM_183386		7	19	0	0	0	0.004482	0	7	19				
SLC12A5	57468	broad.mit.edu	37	20	44673636	44673636	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr20:44673636G>T	ENST00000454036.2	+	12	1544	c.1495G>T	c.(1495-1497)Gtg>Ttg	p.V499L	SLC12A5_ENST00000243964.3_Missense_Mutation_p.V476L	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	499					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CAACCTCGTGGTGGGCACTCT	0.602																																							uc010zxl.1		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(1495-1497)GTG>TTG		solute carrier family 12 (potassium-chloride	Bumetanide(DB00887)|Potassium Chloride(DB00761)						181.0	166.0	171.0					20																	44673636		2203	4300	6503	SO:0001583	missense	57468				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity	g.chr20:44673636G>T	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.1495G>T	20.37:g.44673636G>T	ENSP00000387694:p.Val499Leu		Somatic				SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Missense_Mutation_p.V476L	p.V499L	NM_001134771	NP_001128243	WXS	Illumina HiSeq	Unspecified	Q9H2X9	S12A5_HUMAN			12	1571	+		Myeloproliferative disorder(115;0.0122)	499			Helical; (Potential).		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	ENST00000454036.2	37	c.1495G>T	CCDS46610.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990262	0.35131	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	D;D	0.98531	-4.98;-4.98	4.12	4.12	0.48240	Amino acid permease domain (1);	0.082659	0.50627	D	0.000105	D	0.96546	0.8873	L	0.46567	1.45	0.80722	D	1	B;B	0.16802	0.019;0.007	B;B	0.26693	0.072;0.029	D	0.95369	0.8462	10	0.59425	D	0.04	.	15.1071	0.72329	0.0:0.0:1.0:0.0	.	499;476	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	L	499;476	ENSP00000387694:V499L;ENSP00000243964:V476L	ENSP00000243964:V476L	V	+	1	0	SLC12A5	44107043	1.000000	0.71417	1.000000	0.80357	0.356000	0.29392	7.187000	0.77730	2.117000	0.64856	0.313000	0.20887	GTG		0.602	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1			38	180	1	0	4.32679e-17	0.006999	6.21829e-17	38	180				
C20orf85	128602	broad.mit.edu	37	20	56735869	56735869	+	Silent	SNP	C	C	A	rs140824842		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr20:56735869C>A	ENST00000371168.3	+	4	466	c.405C>A	c.(403-405)ggC>ggA	p.G135G		NM_178456.2	NP_848551.1	Q9H1P6	CT085_HUMAN	chromosome 20 open reading frame 85	135										kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	13	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			CCAAGCAGGGCGTGCACTGAA	0.602																																							uc002xyv.2		NA																	0				ovary(1)	1						c.(403-405)GGC>GGA		hypothetical protein LOC128602							55.0	44.0	48.0					20																	56735869		2203	4300	6503	SO:0001819	synonymous_variant	128602							g.chr20:56735869C>A	AL354776	CCDS13465.1	20q13.32	2012-10-29			ENSG00000124237	ENSG00000124237			16216	protein-coding gene	gene with protein product	"""Low in Lung Cancer 1"""						Standard	NM_178456		Approved	bA196N14.1, LLC1	uc002xyv.3	Q9H1P6	OTTHUMG00000032836	ENST00000371168.3:c.405C>A	20.37:g.56735869C>A			Somatic					p.G135G	NM_178456	NP_848551	WXS	Illumina HiSeq	Unspecified	Q9H1P6	CT085_HUMAN	BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)		4	443	+	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		135						Silent	SNP	ENST00000371168.3	37	c.405C>A	CCDS13465.1																																																																																				0.602	C20orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079866.2	NM_178456		12	29	1	0	5.50884e-06	0.001368	6.35449e-06	12	29				
KCNQ2	3785	broad.mit.edu	37	20	62078122	62078122	+	Nonsense_Mutation	SNP	G	G	T	rs118192194		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr20:62078122G>T	ENST00000359125.2	-	2	539	c.365C>A	c.(364-366)tCg>tAg	p.S122*	KCNQ2_ENST00000359689.1_Nonsense_Mutation_p.S122*|KCNQ2_ENST00000354587.3_Nonsense_Mutation_p.S122*|KCNQ2_ENST00000344425.5_Nonsense_Mutation_p.S122*|KCNQ2_ENST00000370224.1_Nonsense_Mutation_p.S122*|KCNQ2_ENST00000360480.3_Nonsense_Mutation_p.S122*|RP11-358D14.2_ENST00000436263.1_RNA|KCNQ2_ENST00000357249.2_Nonsense_Mutation_p.S122*|KCNQ2_ENST00000344462.4_Nonsense_Mutation_p.S122*	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	122					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.S122L(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GGCCCCCTCCGAGCTCTTCTC	0.632																																							uc002yey.1		NA																	1	Substitution - Missense(1)		skin(1)	upper_aerodigestive_tract(1)|ovary(1)	2	GRCh37	CM068333	KCNQ2	M	rs118192194	c.(364-366)TCG>TAG		potassium voltage-gated channel KQT-like protein	Amitriptyline(DB00321)						58.0	59.0	59.0					20																	62078122		2203	4300	6503	SO:0001587	stop_gained	3785				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr20:62078122G>T	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.365C>A	20.37:g.62078122G>T	ENSP00000352035:p.Ser122*		Somatic				KCNQ2_uc002yez.1_Nonsense_Mutation_p.S122*|KCNQ2_uc002yfa.1_Nonsense_Mutation_p.S122*|KCNQ2_uc002yfb.1_Nonsense_Mutation_p.S122*|KCNQ2_uc011aax.1_Nonsense_Mutation_p.S122*|KCNQ2_uc002yfc.1_Nonsense_Mutation_p.S122*	p.S122*	NM_172107	NP_742105	WXS	Illumina HiSeq	Unspecified	O43526	KCNQ2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		2	542	-	all_cancers(38;1.24e-11)		122			Extracellular (Potential).		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Nonsense_Mutation	SNP	ENST00000359125.2	37	c.365C>A	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	G	37	6.259715	0.97421	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222;ENST00000370221;ENST00000344425	.	.	.	3.88	3.88	0.44766	.	0.000000	0.64402	U	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	1.6495	15.8451	0.78883	0.0:0.0:1.0:0.0	.	.	.	.	X	122	.	ENSP00000345523:S122X	S	-	2	0	KCNQ2	61548566	1.000000	0.71417	0.862000	0.33874	0.786000	0.44442	9.500000	0.97977	1.724000	0.51502	0.306000	0.20318	TCG		0.632	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109		43	76	1	0	3.21987e-24	0.00361	4.93776e-24	43	76				
EEF1A2	1917	broad.mit.edu	37	20	62126415	62126415	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr20:62126415C>A	ENST00000298049.7	-	3	434	c.364G>T	c.(364-366)Gag>Tag	p.E122*	EEF1A2_ENST00000217182.3_Nonsense_Mutation_p.E122*			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	122	tr-type G.				positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GCCTCGAACTCGCCCACGCCC	0.682																																							uc002yfd.1		NA																	0					0						c.(364-366)GAG>TAG		eukaryotic translation elongation factor 1 alpha							47.0	52.0	50.0					20																	62126415		2200	4295	6495	SO:0001587	stop_gained	1917					nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity	g.chr20:62126415C>A	AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.364G>T	20.37:g.62126415C>A	ENSP00000298049:p.Glu122*		Somatic				EEF1A2_uc002yfe.1_Nonsense_Mutation_p.E122*|EEF1A2_uc010gkg.1_Nonsense_Mutation_p.E122*	p.E122*	NM_001958	NP_001949	WXS	Illumina HiSeq	Unspecified	Q05639	EF1A2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.22e-05)		3	465	-	all_cancers(38;9.45e-12)		122					B5BUF3|E1P5J1|P54266|Q0VGC7	Nonsense_Mutation	SNP	ENST00000298049.7	37	c.364G>T	CCDS13522.1	.	.	.	.	.	.	.	.	.	.	C	37	6.487712	0.97607	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	.	.	.	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-30.2017	16.1929	0.82005	0.0:1.0:0.0:0.0	.	.	.	.	X	122	.	ENSP00000217182:E122X	E	-	1	0	EEF1A2	61596859	1.000000	0.71417	0.970000	0.41538	0.886000	0.51366	7.663000	0.83820	1.891000	0.54761	0.313000	0.20887	GAG		0.682	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080495.1	NM_001958		26	101	1	0	1.16021e-09	0.007291	1.48846e-09	26	101				
POTED	317754	broad.mit.edu	37	21	14982875	14982875	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr21:14982875G>A	ENST00000299443.5	+	1	378	c.326G>A	c.(325-327)tGc>tAc	p.C109Y		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	109						plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						TTCCCCTGCTGCAGGGGGAGC	0.582																																							uc002yjb.1		NA																	0				ovary(3)|skin(3)	6						c.(325-327)TGC>TAC		pote protein							19.0	31.0	29.0					21																	14982875		825	3115	3940	SO:0001583	missense	317754					plasma membrane		g.chr21:14982875G>A	AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.326G>A	21.37:g.14982875G>A	ENSP00000299443:p.Cys109Tyr		Somatic					p.C109Y	NM_174981	NP_778146	WXS	Illumina HiSeq	Unspecified	Q86YR6	POTED_HUMAN			1	378	+			109					C9JCF7	Missense_Mutation	SNP	ENST00000299443.5	37	c.326G>A	CCDS13562.1	.	.	.	.	.	.	.	.	.	.	G	0.174	-1.069049	0.01918	.	.	ENSG00000166351	ENST00000299443	T	0.32272	1.46	0.418	-0.836	0.10770	.	.	.	.	.	T	0.37210	0.0995	L	0.59436	1.845	0.09310	N	1	P	0.51240	0.943	P	0.58013	0.831	T	0.34378	-0.9831	8	0.54805	T	0.06	.	.	.	.	.	109	Q86YR6	POTED_HUMAN	Y	109	ENSP00000299443:C109Y	ENSP00000299443:C109Y	C	+	2	0	POTED	13904746	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.732000	0.01851	-1.871000	0.01138	-1.109000	0.02080	TGC		0.582	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1	NM_174981		6	27	0	0	0	0.001368	0	6	27				
KRTAP21-1	337977	broad.mit.edu	37	21	32127668	32127668	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr21:32127668C>A	ENST00000335093.3	-	1	78	c.29G>T	c.(28-30)tGt>tTt	p.C10F		NM_181619.1	NP_853650.1	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	10						intermediate filament (GO:0005882)				breast(1)|endometrium(1)|lung(4)|urinary_tract(1)	7						gccatagccacagGAGTTGCC	0.532																																							uc011adi.1		NA																	0				breast(1)	1						c.(28-30)TGT>TTT		keratin associated protein 21-1							123.0	115.0	118.0					21																	32127668		2203	4300	6503	SO:0001583	missense	337977					intermediate filament		g.chr21:32127668C>A	AP001709	CCDS13606.1	21q22.1	2006-03-13			ENSG00000187005	ENSG00000187005		"""Keratin associated proteins"""	18945	protein-coding gene	gene with protein product						12359730	Standard	NM_181619		Approved	KAP21.1	uc011adi.2	Q3LI58	OTTHUMG00000057777	ENST00000335093.3:c.29G>T	21.37:g.32127668C>A	ENSP00000335566:p.Cys10Phe		Somatic					p.C10F	NM_181619	NP_853650	WXS	Illumina HiSeq	Unspecified	Q3LI58	KR211_HUMAN			1	29	-			10						Missense_Mutation	SNP	ENST00000335093.3	37	c.29G>T	CCDS13606.1	.	.	.	.	.	.	.	.	.	.	C	3.873	-0.027475	0.07589	.	.	ENSG00000187005	ENST00000335093	.	.	.	4.57	0.689	0.18033	.	.	.	.	.	T	0.35682	0.0940	.	.	.	0.24455	N	0.99447	B	0.31209	0.313	B	0.36092	0.217	T	0.36359	-0.9751	7	0.72032	D	0.01	.	7.1715	0.25721	0.0:0.609:0.0:0.391	.	10	Q3LI58	KR211_HUMAN	F	10	.	ENSP00000335566:C10F	C	-	2	0	KRTAP21-1	31049539	0.995000	0.38212	0.503000	0.27626	0.312000	0.27988	1.081000	0.30791	0.004000	0.14682	0.591000	0.81541	TGT		0.532	KRTAP21-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128229.2			89	119	1	0	2.16136e-38	0.00361	3.49807e-38	89	119				
KRTAP10-4	386672	broad.mit.edu	37	21	45993707	45993707	+	Silent	SNP	C	C	T	rs371962927	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr21:45993707C>T	ENST00000400374.3	+	1	102	c.72C>T	c.(70-72)tcC>tcT	p.S24S	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_5'Flank	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	24						keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						ACTCTTGCTCCGACTCCTGGC	0.682													.|||	10	0.00199681	0.0	0.0	5008	,	,		15778	0.0089		0.0	False		,,,				2504	0.001						uc002zfk.1		NA																	0					0						c.(70-72)TCC>TCT		keratin associated protein 10-4							79.0	89.0	86.0					21																	45993707		2135	4243	6378	SO:0001819	synonymous_variant	386672					keratin filament		g.chr21:45993707C>T	AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.72C>T	21.37:g.45993707C>T			Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.S24S	NM_198687	NP_941960	WXS	Illumina HiSeq	Unspecified	P60372	KR104_HUMAN			1	102	+			24					Q08AS0	Silent	SNP	ENST00000400374.3	37	c.72C>T	CCDS42957.1																																																																																				0.682	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128045.1	NM_198687		6	90	0	0	0	0.001168	0	6	90				
ITGB2	3689	broad.mit.edu	37	21	46323351	46323351	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr21:46323351A>G	ENST00000397850.2	-	6	880	c.428T>C	c.(427-429)cTc>cCc	p.L143P	ITGB2_ENST00000397857.1_Missense_Mutation_p.L143P|ITGB2_ENST00000397852.1_Missense_Mutation_p.L143P|ITGB2_ENST00000302347.5_Missense_Mutation_p.L143P|ITGB2_ENST00000355153.4_Missense_Mutation_p.L143P|ITGB2_ENST00000397854.3_Intron			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	143	VWFA.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GACATTCCTGAGGTCATCAAG	0.607																																							uc002zgd.2		NA																	0				ovary(4)|central_nervous_system(3)|breast(2)	9						c.(427-429)CTC>CCC		integrin, beta 2 precursor	Simvastatin(DB00641)						124.0	102.0	110.0					21																	46323351		2203	4300	6503	SO:0001583	missense	3689				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity	g.chr21:46323351A>G	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.428T>C	21.37:g.46323351A>G	ENSP00000380948:p.Leu143Pro		Somatic				ITGB2_uc002zge.2_Missense_Mutation_p.L143P|ITGB2_uc002zgf.3_Missense_Mutation_p.L143P|ITGB2_uc011afl.1_Missense_Mutation_p.L65P|ITGB2_uc010gpw.2_Intron|ITGB2_uc002zgg.2_Missense_Mutation_p.L143P	p.L143P	NM_001127491	NP_001120963	WXS	Illumina HiSeq	Unspecified	P05107	ITB2_HUMAN		Colorectal(79;0.0669)	4	472	-			143			Extracellular (Potential).|VWFA.		B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	37	c.428T>C	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.986546	0.53934	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000355153;ENST00000397850;ENST00000302347;ENST00000320216;ENST00000523663;ENST00000522931	D;D;D;D;D;D;D;D	0.98060	-4.69;-4.69;-4.69;-4.69;-4.69;-4.69;-4.69;-4.69	4.73	3.58	0.41010	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	.	.	.	.	D	0.98871	0.9618	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98683	1.0693	9	0.87932	D	0	.	8.3989	0.32574	0.9063:0.0:0.0937:0.0	.	143	P05107	ITB2_HUMAN	P	143;143;143;143;143;134;143;143	ENSP00000380950:L143P;ENSP00000380955:L143P;ENSP00000347279:L143P;ENSP00000380948:L143P;ENSP00000303242:L143P;ENSP00000317697:L134P;ENSP00000428503:L143P;ENSP00000428979:L143P	ENSP00000303242:L143P	L	-	2	0	ITGB2	45147779	1.000000	0.71417	0.898000	0.35279	0.292000	0.27327	8.599000	0.90856	0.852000	0.35287	0.454000	0.30748	CTC		0.607	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211		4	69	0	0	0	0.000602	0	4	69				
PLA2G3	50487	broad.mit.edu	37	22	31534710	31534710	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr22:31534710T>A	ENST00000215885.3	-	2	842	c.590A>T	c.(589-591)aAc>aTc	p.N197I		NM_015715.3	NP_056530.2	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III	197	Phospholipase A2-like.				acrosome assembly (GO:0001675)|cilium morphogenesis (GO:0060271)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|lipoxygenase pathway (GO:0019372)|mast cell degranulation (GO:0043303)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|sperm axoneme assembly (GO:0007288)	centriole (GO:0005814)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	18						GATGCCATAGTTGTACTGCAA	0.607																																							uc003aka.2		NA																	0					0						c.(589-591)AAC>ATC		phospholipase A2, group III precursor							321.0	249.0	273.0					22																	31534710		2203	4300	6503	SO:0001583	missense	50487				cilium morphogenesis|lipid catabolic process|phospholipid metabolic process	centriole|extracellular space|plasma membrane	calcium ion binding|calcium-dependent phospholipase A2 activity	g.chr22:31534710T>A	AF220490	CCDS13889.1	22q12.2	2008-09-19			ENSG00000100078	ENSG00000100078	3.1.1.4		17934	protein-coding gene	gene with protein product		611651				10713052	Standard	NM_015715		Approved	GIII-SPLA2	uc003aka.3	Q9NZ20	OTTHUMG00000151255	ENST00000215885.3:c.590A>T	22.37:g.31534710T>A	ENSP00000215885:p.Asn197Ile		Somatic					p.N197I	NM_015715	NP_056530	WXS	Illumina HiSeq	Unspecified	Q9NZ20	PA2G3_HUMAN			2	719	-			197			Phospholipase A2-like.		O95768	Missense_Mutation	SNP	ENST00000215885.3	37	c.590A>T	CCDS13889.1	.	.	.	.	.	.	.	.	.	.	T	16.78	3.218550	0.58560	.	.	ENSG00000100078	ENST00000215885	T	0.28454	1.61	5.22	3.03	0.35002	Phospholipase A2 (3);	0.584163	0.18691	N	0.133849	T	0.41465	0.1160	L	0.60455	1.87	0.09310	N	1	D	0.54397	0.966	P	0.60541	0.876	T	0.21518	-1.0243	10	0.51188	T	0.08	-4.3464	4.3857	0.11316	0.0:0.1771:0.1706:0.6523	.	197	Q9NZ20	PA2G3_HUMAN	I	197	ENSP00000215885:N197I	ENSP00000215885:N197I	N	-	2	0	PLA2G3	29864710	0.844000	0.29557	0.853000	0.33588	0.851000	0.48451	0.045000	0.14013	0.286000	0.22352	0.459000	0.35465	AAC		0.607	PLA2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321938.1	NM_015715		62	44	0	0	0	0.00361	0	62	44				
SSUH2	51066	broad.mit.edu	37	3	8672548	8672548	+	Silent	SNP	A	A	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:8672548A>C	ENST00000317371.4	-	13	1627	c.402T>G	c.(400-402)ccT>ccG	p.P134P	SSUH2_ENST00000415132.1_Silent_p.P134P|SSUH2_ENST00000544814.1_Silent_p.P156P|SSUH2_ENST00000341795.3_Silent_p.P134P			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)	134						cytoplasm (GO:0005737)											GAAACATCGGAGGACCTTGAA	0.532																																							uc003bqu.2		NA																	0				skin(1)	1						c.(400-402)CCT>CCG		hypothetical protein LOC51066							124.0	102.0	110.0					3																	8672548		2203	4300	6503	SO:0001819	synonymous_variant	51066							g.chr3:8672548A>C	AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.402T>G	3.37:g.8672548A>C			Somatic				C3orf32_uc003bqz.2_Silent_p.P134P|C3orf32_uc003bqt.2_Silent_p.P83P|C3orf32_uc011atg.1_Silent_p.P156P|C3orf32_uc003bqv.2_Silent_p.P83P|C3orf32_uc003bqw.2_RNA|C3orf32_uc003bqx.2_RNA|C3orf32_uc003bqy.2_Silent_p.P134P	p.P134P	NM_015931	NP_057015	WXS	Illumina HiSeq	Unspecified	Q9Y2M2	CC032_HUMAN			6	648	-			134					A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Silent	SNP	ENST00000317371.4	37	c.402T>G	CCDS2568.1																																																																																				0.532	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337900.1	NM_015931		25	33	0	0	0	0.004656	0	25	33				
NGLY1	55768	broad.mit.edu	37	3	25778828	25778828	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:25778828T>C	ENST00000280700.5	-	6	1160	c.1000A>G	c.(1000-1002)Aca>Gca	p.T334A	NGLY1_ENST00000422724.2_3'UTR|NGLY1_ENST00000428257.1_Missense_Mutation_p.T334A|NGLY1_ENST00000417874.2_Missense_Mutation_p.T292A|NGLY1_ENST00000396649.3_Missense_Mutation_p.T334A	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1	334					glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						tctgtacctgtgTAATCCCAA	0.483																																							uc003cdl.2		NA																	0				breast(1)	1						c.(1000-1002)ACA>GCA		N-glycanase 1 isoform 1							80.0	69.0	73.0					3																	25778828		2203	4300	6503	SO:0001583	missense	55768				glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding	g.chr3:25778828T>C	AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.1000A>G	3.37:g.25778828T>C	ENSP00000280700:p.Thr334Ala		Somatic				NGLY1_uc010hfg.2_Missense_Mutation_p.T334A|NGLY1_uc003cdm.2_Missense_Mutation_p.T334A|NGLY1_uc011awo.1_Missense_Mutation_p.T292A|NGLY1_uc003cdk.2_RNA	p.T334A	NM_018297	NP_060767	WXS	Illumina HiSeq	Unspecified	Q96IV0	NGLY1_HUMAN			6	1108	-			334					B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Missense_Mutation	SNP	ENST00000280700.5	37	c.1000A>G	CCDS33719.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.483746	0.84854	.	.	ENSG00000151092	ENST00000428257;ENST00000280700;ENST00000396649;ENST00000308710;ENST00000417874	T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08	5.28	5.28	0.74379	Transglutaminase-like (2);	0.000000	0.85682	D	0.000000	T	0.50017	0.1591	M	0.83774	2.66	0.80722	D	1	P;P;P;D	0.89917	0.641;0.889;0.892;1.0	P;P;P;D	0.81914	0.717;0.869;0.828;0.995	T	0.55159	-0.8184	10	0.54805	T	0.06	.	15.4986	0.75677	0.0:0.0:0.0:1.0	.	292;334;334;334	B4DJE9;Q96IV0-2;Q96IV0-3;Q96IV0	.;.;.;NGLY1_HUMAN	A	334;334;334;331;292	ENSP00000387430:T334A;ENSP00000280700:T334A;ENSP00000379886:T334A;ENSP00000307980:T331A;ENSP00000389888:T292A	ENSP00000280700:T334A	T	-	1	0	NGLY1	25753832	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.737000	0.84957	2.107000	0.64212	0.533000	0.62120	ACA		0.483	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340832.2			5	22	0	0	0	0.001168	0	5	22				
XIRP1	165904	broad.mit.edu	37	3	39227571	39227571	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:39227571C>T	ENST00000340369.3	-	2	3594	c.3366G>A	c.(3364-3366)agG>agA	p.R1122R	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1122					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CTTGCTCTTCCCTACTGACCT	0.607																																							uc003cjk.1		NA																	0				ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8						c.(3364-3366)AGG>AGA		xin actin-binding repeat containing 1							66.0	71.0	69.0					3																	39227571		2203	4300	6503	SO:0001819	synonymous_variant	165904						actin binding	g.chr3:39227571C>T	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.3366G>A	3.37:g.39227571C>T			Somatic				XIRP1_uc003cji.2_Intron|XIRP1_uc003cjj.2_Intron	p.R1122R	NM_194293	NP_919269	WXS	Illumina HiSeq	Unspecified	Q702N8	XIRP1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)	2	3587	-			1122					A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Silent	SNP	ENST00000340369.3	37	c.3366G>A	CCDS2683.1																																																																																				0.607	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522		17	80	0	0	0	0.008871	0	17	80				
XIRP1	165904	broad.mit.edu	37	3	39228427	39228427	+	Missense_Mutation	SNP	C	C	T	rs150075136		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:39228427C>T	ENST00000340369.3	-	2	2738	c.2510G>A	c.(2509-2511)cGg>cAg	p.R837Q	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.R837Q	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	837					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CACATCTGGCCGGCGCAGGAC	0.602																																							uc003cjk.1		NA																	0				ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8						c.(2509-2511)CGG>CAG		xin actin-binding repeat containing 1		C	GLN/ARG,GLN/ARG	3,4403	4.2+/-10.8	0,3,2200	49.0	49.0	49.0		2510,2510	3.3	1.0	3	dbSNP_134	49	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	XIRP1	NM_001198621.1,NM_194293.2	43,43	0,4,6499	TT,TC,CC		0.0116,0.0681,0.0308	probably-damaging,probably-damaging	837/1122,837/1844	39228427	4,13002	2203	4300	6503	SO:0001583	missense	165904						actin binding	g.chr3:39228427C>T	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.2510G>A	3.37:g.39228427C>T	ENSP00000343140:p.Arg837Gln		Somatic				XIRP1_uc003cji.2_Missense_Mutation_p.R837Q|XIRP1_uc003cjj.2_Intron	p.R837Q	NM_194293	NP_919269	WXS	Illumina HiSeq	Unspecified	Q702N8	XIRP1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)	2	2731	-			837					A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	c.2510G>A	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.392763	0.62066	6.81E-4	1.16E-4	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.05717	3.4;3.78	4.23	3.35	0.38373	.	0.298435	0.28921	U	0.013701	T	0.16041	0.0386	L	0.56769	1.78	0.09310	N	0.999999	D;D	0.76494	0.994;0.999	P;P	0.62649	0.669;0.905	T	0.00992	-1.1488	10	0.59425	D	0.04	.	9.844	0.41015	0.0:0.8954:0.0:0.1046	.	837;837	Q702N8;Q702N8-2	XIRP1_HUMAN;.	Q	837	ENSP00000379550:R837Q;ENSP00000343140:R837Q	ENSP00000343140:R837Q	R	-	2	0	XIRP1	39203431	0.688000	0.27680	0.999000	0.59377	0.914000	0.54420	1.052000	0.30429	2.372000	0.80975	0.563000	0.77884	CGG		0.602	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522		5	59	0	0	0	0.001984	0	5	59				
NBEAL2	23218	broad.mit.edu	37	3	47042821	47042821	+	Missense_Mutation	SNP	G	G	A	rs367809683		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:47042821G>A	ENST00000450053.3	+	29	4716	c.4537G>A	c.(4537-4539)Gtg>Atg	p.V1513M	NBEAL2_ENST00000292309.5_Missense_Mutation_p.V1329M|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1513					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		AGAGGCCCCCGTGGGGGTCCT	0.607																																							uc003cqp.2		NA																	0				ovary(1)	1						c.(4537-4539)GTG>ATG		neurobeachin-like 2		G	MET/VAL	1,4153		0,1,2076	44.0	53.0	50.0		4537	-2.8	0.0	3		50	1,8441		0,1,4220	no	missense	NBEAL2	NM_015175.1	21	0,2,6296	AA,AG,GG		0.0118,0.0241,0.0159	benign	1513/2755	47042821	2,12594	2077	4221	6298	SO:0001583	missense	23218						binding	g.chr3:47042821G>A	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.4537G>A	3.37:g.47042821G>A	ENSP00000415034:p.Val1513Met		Somatic				NBEAL2_uc010hjm.1_Missense_Mutation_p.V890M|NBEAL2_uc010hjn.1_5'Flank	p.V1513M	NM_015175	NP_055990	WXS	Illumina HiSeq	Unspecified	Q6ZNJ1	NBEL2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)	29	4716	+		Acute lymphoblastic leukemia(5;0.0534)	1513					O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	c.4537G>A	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	G	2.926	-0.222030	0.06061	2.41E-4	1.18E-4	ENSG00000160796	ENST00000292309;ENST00000450053	T;T	0.56776	0.44;0.45	5.13	-2.75	0.05914	.	0.802457	0.11739	N	0.534235	T	0.31136	0.0787	N	0.14661	0.345	0.09310	N	0.999999	B	0.12630	0.006	B	0.04013	0.001	T	0.11616	-1.0580	10	0.33940	T	0.23	.	10.7771	0.46356	0.2812:0.2414:0.4774:0.0	.	1513	Q6ZNJ1	NBEL2_HUMAN	M	1329;1513	ENSP00000292309:V1329M;ENSP00000415034:V1513M	ENSP00000292309:V1329M	V	+	1	0	NBEAL2	47017825	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.474000	0.06607	-0.892000	0.03935	-0.214000	0.12660	GTG		0.607	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064		27	39	0	0	0	0.002096	0	27	39				
MAP4	4134	broad.mit.edu	37	3	47957762	47957762	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:47957762C>A	ENST00000360240.6	-	7	2073	c.1555G>T	c.(1555-1557)Gat>Tat	p.D519Y	MAP4_ENST00000426837.2_Missense_Mutation_p.D536Y|MAP4_ENST00000383737.4_Intron|MAP4_ENST00000395734.3_Missense_Mutation_p.D519Y	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	519	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	GGAGTCACATCCTTGCCCAGA	0.517																																							uc003csb.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1555-1557)GAT>TAT		microtubule-associated protein 4 isoform 1							163.0	153.0	156.0					3																	47957762		2203	4300	6503	SO:0001583	missense	4134				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr3:47957762C>A		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1555G>T	3.37:g.47957762C>A	ENSP00000353375:p.Asp519Tyr		Somatic				MAP4_uc003csc.3_Missense_Mutation_p.D519Y|MAP4_uc011bbf.1_Missense_Mutation_p.D496Y|MAP4_uc003csf.3_Missense_Mutation_p.D536Y	p.D519Y	NM_002375	NP_002366	WXS	Illumina HiSeq	Unspecified	P27816	MAP4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	7	2081	-			519			17 X 14 AA tandem repeats.		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	ENST00000360240.6	37	c.1555G>T	CCDS33750.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882618	0.33255	.	.	ENSG00000047849	ENST00000395734;ENST00000426837;ENST00000360240	T;T;T	0.13089	2.81;2.62;2.72	4.27	3.39	0.38822	.	.	.	.	.	T	0.34948	0.0915	M	0.79475	2.455	0.23620	N	0.997274	D;D;D	0.76494	0.999;0.998;0.993	D;D;P	0.68353	0.931;0.957;0.885	T	0.06862	-1.0803	9	0.72032	D	0.01	-3.8923	9.9134	0.41419	0.0:0.8988:0.0:0.1012	.	496;519;519	C9JFC3;P27816-6;P27816	.;.;MAP4_HUMAN	Y	519;536;519	ENSP00000379083:D519Y;ENSP00000407602:D536Y;ENSP00000353375:D519Y	ENSP00000353375:D519Y	D	-	1	0	MAP4	47932766	0.000000	0.05858	0.005000	0.12908	0.007000	0.05969	-0.748000	0.04818	1.132000	0.42129	0.655000	0.94253	GAT		0.517	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375		18	107	1	0	2.4624e-09	0.008871	3.11351e-09	18	107				
NEK4	6787	broad.mit.edu	37	3	52800267	52800267	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:52800267A>G	ENST00000233027.5	-	3	687	c.485T>C	c.(484-486)aTg>aCg	p.M162T	NEK4_ENST00000383721.4_Missense_Mutation_p.M162T|NEK4_ENST00000535191.1_Missense_Mutation_p.M73T	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	162	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		GGTGCTAGCCATGTCACAGTG	0.448																																							uc003dfq.3		NA																	0				large_intestine(1)	1						c.(484-486)ATG>ACG		NIMA-related kinase 4							260.0	212.0	228.0					3																	52800267		2203	4300	6503	SO:0001583	missense	6787				cell division|mitosis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr3:52800267A>G	L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.485T>C	3.37:g.52800267A>G	ENSP00000233027:p.Met162Thr		Somatic				NEK4_uc011bej.1_Missense_Mutation_p.M73T|NEK4_uc003dfr.2_Missense_Mutation_p.M162T	p.M162T	NM_003157	NP_003148	WXS	Illumina HiSeq	Unspecified	P51957	NEK4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)	3	674	-			162			Protein kinase.		A5YM70|B2R633|B7Z200|Q6P576	Missense_Mutation	SNP	ENST00000233027.5	37	c.485T>C	CCDS2863.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.424140	0.83667	.	.	ENSG00000114904	ENST00000233027;ENST00000535191;ENST00000383721;ENST00000461689	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.76	5.76	0.90799	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69744	0.3145	N	0.25890	0.77	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.997;0.986;0.994	T	0.73662	-0.3912	10	0.72032	D	0.01	.	16.0745	0.80960	1.0:0.0:0.0:0.0	.	73;162;162	B7Z200;P51957-2;P51957	.;.;NEK4_HUMAN	T	162;73;162;73	ENSP00000233027:M162T;ENSP00000437703:M73T;ENSP00000373227:M162T;ENSP00000419666:M73T	ENSP00000233027:M162T	M	-	2	0	NEK4	52775307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.957000	0.93082	2.188000	0.69820	0.533000	0.62120	ATG		0.448	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352386.2	NM_003157		22	18	0	0	0	0.001882	0	22	18				
POPDC2	64091	broad.mit.edu	37	3	119373406	119373406	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:119373406G>T	ENST00000264231.3	-	2	712	c.546C>A	c.(544-546)ttC>ttA	p.F182L	POPDC2_ENST00000474523.1_5'UTR|POPDC2_ENST00000493094.1_Missense_Mutation_p.F182L|POPDC2_ENST00000538678.1_Missense_Mutation_p.F182L|POPDC2_ENST00000468801.1_Missense_Mutation_p.F182L	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	182					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		GAGAGTCCATGAACTGGTATG	0.547																																							uc003ecx.1		NA																	0				central_nervous_system(1)	1						c.(544-546)TTC>TTA		popeye protein 2							108.0	96.0	100.0					3																	119373406		2203	4300	6503	SO:0001583	missense	64091					integral to membrane		g.chr3:119373406G>T	AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.546C>A	3.37:g.119373406G>T	ENSP00000264231:p.Phe182Leu		Somatic				POPDC2_uc010hqw.1_Missense_Mutation_p.F182L|POPDC2_uc003ecy.1_5'UTR	p.F182L	NM_022135	NP_071418	WXS	Illumina HiSeq	Unspecified	Q9HBU9	POPD2_HUMAN		GBM - Glioblastoma multiforme(114;0.242)	2	680	-			182					Q86UE7	Missense_Mutation	SNP	ENST00000264231.3	37	c.546C>A	CCDS2992.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473256	0.84640	.	.	ENSG00000121577	ENST00000264231;ENST00000493094;ENST00000468801;ENST00000538678	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.55	4.55	0.56014	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.103293	0.64402	D	0.000002	T	0.59689	0.2212	M	0.84948	2.725	0.80722	D	1	P;D	0.58620	0.945;0.983	P;P	0.54544	0.641;0.755	T	0.67421	-0.5675	10	0.87932	D	0	.	12.0121	0.53293	0.0839:0.0:0.9161:0.0	.	182;182	Q9HBU9-2;Q9HBU9	.;POPD2_HUMAN	L	182	ENSP00000264231:F182L;ENSP00000417250:F182L;ENSP00000420715:F182L;ENSP00000438271:F182L	ENSP00000264231:F182L	F	-	3	2	POPDC2	120856096	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.348000	0.52209	2.374000	0.81015	0.561000	0.74099	TTC		0.547	POPDC2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355378.1	NM_022135		8	58	1	0	5.4927e-09	0.004482	6.91187e-09	8	58				
PLS1	5357	broad.mit.edu	37	3	142430746	142430746	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:142430746C>G	ENST00000337777.3	+	16	2000	c.1787C>G	c.(1786-1788)gCc>gGc	p.A596G	PLS1_ENST00000497002.1_Missense_Mutation_p.A596G|PLS1_ENST00000457734.2_Missense_Mutation_p.A596G	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	596	Actin-binding 2.|CH 4. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						AAGATCGGTGCCCGGATATAT	0.378																																							uc010huv.2		NA																	0				ovary(1)	1						c.(1786-1788)GCC>GGC		plastin 1							173.0	167.0	169.0					3																	142430746		2203	4300	6503	SO:0001583	missense	5357					cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr3:142430746C>G	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.1787C>G	3.37:g.142430746C>G	ENSP00000336831:p.Ala596Gly		Somatic				PLS1_uc003euz.2_Missense_Mutation_p.A596G|PLS1_uc003eva.2_Missense_Mutation_p.A596G	p.A596G	NM_001145319	NP_001138791	WXS	Illumina HiSeq	Unspecified	Q14651	PLSI_HUMAN			16	1946	+			596			CH 4.|Actin-binding 2.		A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	ENST00000337777.3	37	c.1787C>G	CCDS3125.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578571	0.86645	.	.	ENSG00000120756	ENST00000457734;ENST00000337777;ENST00000497002	D;D;D	0.96073	-3.9;-3.9;-3.9	5.7	5.7	0.88788	Calponin homology domain (5);	0.046784	0.85682	D	0.000000	D	0.97539	0.9194	M	0.84082	2.675	0.80722	D	1	P	0.35242	0.492	P	0.51055	0.657	D	0.97515	1.0069	10	0.87932	D	0	-12.4059	19.8297	0.96630	0.0:1.0:0.0:0.0	.	596	Q14651	PLSI_HUMAN	G	596	ENSP00000387890:A596G;ENSP00000336831:A596G;ENSP00000418700:A596G	ENSP00000336831:A596G	A	+	2	0	PLS1	143913436	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.052000	0.71080	2.697000	0.92050	0.557000	0.71058	GCC		0.378	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670		62	96	0	0	0	0.00361	0	62	96				
PEX5L	51555	broad.mit.edu	37	3	179527326	179527326	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:179527326A>G	ENST00000467460.1	-	12	1615	c.1285T>C	c.(1285-1287)Tac>Cac	p.Y429H	PEX5L_ENST00000472994.1_Missense_Mutation_p.Y370H|PEX5L_ENST00000464614.1_Missense_Mutation_p.Y321H|PEX5L_ENST00000465751.1_Missense_Mutation_p.Y405H|PEX5L_ENST00000476138.1_Missense_Mutation_p.Y386H|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000468741.1_Missense_Mutation_p.Y237H|PEX5L_ENST00000392649.3_Missense_Mutation_p.Y321H|PEX5L_ENST00000263962.8_Missense_Mutation_p.Y427H|PEX5L_ENST00000485199.1_Missense_Mutation_p.Y394H	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	429					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TTCACAAGGTATTTGTACTTT	0.463																																							uc003fki.1		NA																	0				ovary(3)|large_intestine(1)	4						c.(1285-1287)TAC>CAC		peroxisomal biogenesis factor 5-like							162.0	147.0	152.0					3																	179527326		2203	4300	6503	SO:0001583	missense	51555				protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding	g.chr3:179527326A>G	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1285T>C	3.37:g.179527326A>G	ENSP00000419975:p.Tyr429His		Somatic				PEX5L_uc011bqd.1_Missense_Mutation_p.Y386H|PEX5L_uc011bqe.1_Missense_Mutation_p.Y237H|PEX5L_uc011bqf.1_Missense_Mutation_p.Y321H|PEX5L_uc003fkj.1_Missense_Mutation_p.Y394H|PEX5L_uc010hxd.1_Missense_Mutation_p.Y427H|PEX5L_uc011bqg.1_Missense_Mutation_p.Y405H|PEX5L_uc011bqh.1_Missense_Mutation_p.Y370H	p.Y429H	NM_016559	NP_057643	WXS	Illumina HiSeq	Unspecified	Q8IYB4	PEX5R_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)		12	1415	-	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		429					B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	ENST00000467460.1	37	c.1285T>C	CCDS3236.1	.	.	.	.	.	.	.	.	.	.	A	4.931	0.173007	0.09391	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	T;T;T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	6.03	3.65	0.41850	Tetratricopeptide repeat-containing (1);	0.231661	0.46145	N	0.000320	T	0.36771	0.0979	N	0.00387	-1.565	0.41104	D	0.985697	B;B;B;B;B;B	0.09022	0.0;0.0;0.0;0.002;0.001;0.001	B;B;B;B;B;B	0.10450	0.001;0.001;0.001;0.005;0.003;0.002	T	0.41305	-0.9516	10	0.02654	T	1	-2.6511	5.4593	0.16607	0.7374:0.0:0.134:0.1286	.	370;405;321;427;394;429	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	H	429;427;394;427;321;237;386;317;370;321;405	ENSP00000419975:Y429H;ENSP00000263962:Y427H;ENSP00000418440:Y394H;ENSP00000376420:Y321H;ENSP00000418665:Y237H;ENSP00000420555:Y386H;ENSP00000418054:Y370H;ENSP00000417270:Y321H;ENSP00000419348:Y405H	ENSP00000263962:Y427H	Y	-	1	0	PEX5L	181010020	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	3.572000	0.53849	0.522000	0.28464	0.455000	0.32223	TAC		0.463	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559		10	90	0	0	0	0.008291	0	10	90				
IGF2BP2	10644	broad.mit.edu	37	3	185390392	185390392	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:185390392G>A	ENST00000382199.2	-	10	1232	c.1137C>T	c.(1135-1137)tcC>tcT	p.S379S	IGF2BP2_ENST00000421047.2_Silent_p.S322S|IGF2BP2_ENST00000346192.3_Intron|IGF2BP2_ENST00000494906.1_Intron|IGF2BP2_ENST00000457616.2_Silent_p.S385S	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	379					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			GAGATAGCACGGACAGTCCTG	0.552																																							uc003fpo.2		NA																	0					0						c.(1135-1137)TCC>TCT		insulin-like growth factor 2 mRNA binding							73.0	65.0	68.0					3																	185390392		2203	4300	6503	SO:0001819	synonymous_variant	10644				anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	g.chr3:185390392G>A	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.1137C>T	3.37:g.185390392G>A			Somatic				IGF2BP2_uc010hyi.2_Silent_p.S322S|IGF2BP2_uc010hyj.2_Silent_p.S316S|IGF2BP2_uc010hyk.2_Silent_p.S243S|IGF2BP2_uc010hyl.2_Intron|IGF2BP2_uc003fpp.2_Intron|IGF2BP2_uc003fpq.2_Silent_p.S384S	p.S379S	NM_006548	NP_006539	WXS	Illumina HiSeq	Unspecified	Q9Y6M1	IF2B2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)		10	1216	-	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		379					A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Silent	SNP	ENST00000382199.2	37	c.1137C>T	CCDS3273.2																																																																																				0.552	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157087.2	NM_006548		17	21	0	0	0	0.006122	0	17	21				
FYTTD1	84248	broad.mit.edu	37	3	197505313	197505313	+	Missense_Mutation	SNP	A	A	C	rs201805371		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr3:197505313A>C	ENST00000241502.4	+	8	1058	c.836A>C	c.(835-837)gAc>gCc	p.D279A	FYTTD1_ENST00000492360.1_3'UTR|FYTTD1_ENST00000424384.2_Missense_Mutation_p.D212A|FYTTD1_ENST00000428395.2_Missense_Mutation_p.D188A|FYTTD1_ENST00000415708.2_Missense_Mutation_p.D253A	NM_032288.6	NP_115664.2	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1	279					mRNA export from nucleus (GO:0006406)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		CTGCAGTTTGACATAAACAGT	0.353																																							uc003fyi.2		NA																	0					0						c.(835-837)GAC>GCC		forty-two-three domain containing 1 isoform 1							72.0	71.0	72.0					3																	197505313		2203	4300	6503	SO:0001583	missense	84248				mRNA export from nucleus	nuclear speck	mRNA binding|protein binding	g.chr3:197505313A>C	AJ344094	CCDS3329.1, CCDS43196.1, CCDS43196.2	3q29	2011-03-03			ENSG00000122068	ENSG00000122068			25407	protein-coding gene	gene with protein product	"""UAP56-interacting factor"""					19836239	Standard	NM_001011537		Approved	DKFZp761B1514, UIF	uc003fyi.2	Q96QD9	OTTHUMG00000155453	ENST00000241502.4:c.836A>C	3.37:g.197505313A>C	ENSP00000241502:p.Asp279Ala		Somatic				FYTTD1_uc011bui.1_Missense_Mutation_p.D253A|FYTTD1_uc011buj.1_RNA|FYTTD1_uc011buk.1_Missense_Mutation_p.D212A	p.D279A	NM_032288	NP_115664	WXS	Illumina HiSeq	Unspecified	Q96QD9	UIF_HUMAN	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)	8	1055	+	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	279					A8MY74|B2RCB2|B7Z3R4|B7Z7V1|B7Z8I0|B7ZAJ3|C9J7P6|C9JNG6|C9JTH3|C9JY50|Q96SL9|Q9BQI8	Missense_Mutation	SNP	ENST00000241502.4	37	c.836A>C	CCDS3329.1	.	.	.	.	.	.	.	.	.	.	A	16.99	3.273740	0.59649	.	.	ENSG00000122068	ENST00000415708;ENST00000428395;ENST00000241502;ENST00000424384	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.69672	0.3137	M	0.66939	2.045	0.53688	D	0.999977	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	T	0.73515	-0.3958	10	0.87932	D	0	-3.7204	13.4516	0.61174	1.0:0.0:0.0:0.0	.	253;279	Q96QD9-2;Q96QD9	.;UIF_HUMAN	A	253;188;279;212	ENSP00000393746:D253A;ENSP00000391157:D188A;ENSP00000241502:D279A;ENSP00000394631:D212A	ENSP00000241502:D279A	D	+	2	0	FYTTD1	198989710	1.000000	0.71417	1.000000	0.80357	0.577000	0.36160	7.270000	0.78493	1.985000	0.57927	0.378000	0.23410	GAC		0.353	FYTTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340185.3	NM_032288		8	34	0	0	0	0.006214	0	8	34				
CPZ	8532	broad.mit.edu	37	4	8621184	8621185	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:8621184_8621185CC>AA	ENST00000360986.4	+	11	1973_1974	c.1799_1800CC>AA	c.(1798-1800)cCC>cAA	p.P600Q	CPZ_ENST00000382480.2_Missense_Mutation_p.P463Q|CPZ_ENST00000315782.6_Missense_Mutation_p.P589Q|CPZ_ENST00000429646.2_Missense_Mutation_p.P208Q	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	600					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AGGACTGGGCCCCACGACCCAC	0.673																																							uc003glm.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1798-1800)CCC>CAA		carboxypeptidase Z isoform 1																																				SO:0001583	missense	8532				proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding	g.chr4:8621184_8621185CC>AA	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	Exception_encountered	4.37:g.8621184_8621185delinsAA	ENSP00000354255:p.Pro600Gln		Somatic				CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Missense_Mutation_p.P463Q|CPZ_uc003glo.2_Missense_Mutation_p.P589Q|CPZ_uc003glp.2_RNA	p.P600Q	NM_001014447	NP_001014447	WXS	Illumina HiSeq	Unspecified	Q66K79	CBPZ_HUMAN			11	1925_1926	+			600					O00520|Q96MX2	Missense_Mutation	DNP	ENST00000360986.4	37	c.1799_1800CC>AA	CCDS33953.1																																																																																				0.673	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652		18	40	0	0	0	0.004672	0	18	40				
CLNK	116449	broad.mit.edu	37	4	10542121	10542121	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:10542121G>T	ENST00000226951.6	-	11	838	c.599C>A	c.(598-600)cCc>cAc	p.P200H	CLNK_ENST00000442825.2_Missense_Mutation_p.P158H|CLNK_ENST00000507719.1_Missense_Mutation_p.P158H	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	200					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						CTCTCACCTGGGCATTCTCTG	0.522																																					GBM(87;402 1286 6949 13902 35851)	GBM(87;402 1286 6949 13902 35851)	uc003gmo.3		NA																	0				ovary(1)	1						c.(598-600)CCC>CAC		mast cell immunoreceptor signal transducer							74.0	75.0	74.0					4																	10542121		1989	4166	6155	SO:0001583	missense	116449				immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity	g.chr4:10542121G>T	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.599C>A	4.37:g.10542121G>T	ENSP00000226951:p.Pro200His		Somatic				CLNK_uc003gmp.2_Missense_Mutation_p.P158H	p.P200H	NM_052964	NP_443196	WXS	Illumina HiSeq	Unspecified	Q7Z7G1	CLNK_HUMAN			11	736	-			200					Q05C27|Q9P2U9	Missense_Mutation	SNP	ENST00000226951.6	37	c.599C>A	CCDS47024.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.751115	0.49257	.	.	ENSG00000109684	ENST00000226951;ENST00000429087;ENST00000442825;ENST00000507719	T;T;T	0.47528	1.8;0.84;0.84	5.68	4.84	0.62591	.	0.691901	0.13300	N	0.398330	T	0.55673	0.1935	L	0.32530	0.975	0.34525	D	0.708547	D;D	0.76494	0.999;0.993	D;P	0.65874	0.939;0.72	T	0.64715	-0.6342	10	0.87932	D	0	.	10.6993	0.45918	0.088:0.0:0.912:0.0	.	158;200	Q7Z7G1-2;Q7Z7G1	.;CLNK_HUMAN	H	200;164;158;158	ENSP00000226951:P200H;ENSP00000390744:P158H;ENSP00000427208:P158H	ENSP00000226951:P200H	P	-	2	0	CLNK	10151219	0.958000	0.32768	0.957000	0.39632	0.335000	0.28730	1.256000	0.32921	1.386000	0.46466	0.655000	0.94253	CCC		0.522	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359047.1	NM_052964		4	43	1	0	0.000602214	0.000602	0.000653123	4	43				
RAB28	9364	broad.mit.edu	37	4	13378210	13378210	+	Missense_Mutation	SNP	G	G	A	rs375680071		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:13378210G>A	ENST00000330852.5	-	6	746	c.532C>T	c.(532-534)Ctt>Ttt	p.L178F	RAB28_ENST00000288723.4_Missense_Mutation_p.L178F|RAB28_ENST00000338176.4_Missense_Mutation_p.L178F	NM_001017979.2	NP_001017979.1	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family	178					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	8						TTGATCCCAAGGATTTCAGCA	0.299																																							uc003gmu.2		NA																	0				ovary(1)|skin(1)	2						c.(532-534)CTT>TTT		RAB28, member RAS oncogene family isoform 1							75.0	71.0	73.0					4																	13378210		2203	4299	6502	SO:0001583	missense	9364				small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity	g.chr4:13378210G>A	X94703	CCDS3409.1, CCDS33961.1, CCDS54741.1	4p16.1	2014-04-24			ENSG00000157869	ENSG00000157869		"""RAB, member RAS oncogene"""	9768	protein-coding gene	gene with protein product		612994				8647132	Standard	NM_004249		Approved		uc003gmu.2	P51157	OTTHUMG00000090543	ENST00000330852.5:c.532C>T	4.37:g.13378210G>A	ENSP00000328551:p.Leu178Phe		Somatic				RAB28_uc003gmt.2_Missense_Mutation_p.L178F|RAB28_uc011bwz.1_Missense_Mutation_p.L178F|RAB28_uc003gmv.2_RNA	p.L178F	NM_001017979	NP_001017979	WXS	Illumina HiSeq	Unspecified	P51157	RAB28_HUMAN			6	747	-			178					G8JLC5|Q8IYR8|Q8NI05	Missense_Mutation	SNP	ENST00000330852.5	37	c.532C>T	CCDS33961.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.35|19.35	3.811643|3.811643	0.70797|0.70797	.|.	.|.	ENSG00000157869|ENSG00000157869	ENST00000330852;ENST00000288723;ENST00000338176|ENST00000511649	T;T;T|.	0.80994|.	-1.44;-1.44;-1.44|.	4.79|4.79	3.95|3.95	0.45737|0.45737	.|.	0.067566|.	0.64402|.	D|.	0.000011|.	T|T	0.68906|0.68906	0.3052|0.3052	L|L	0.56769|0.56769	1.78|1.78	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.67145|.	0.994;0.996|.	D;D|.	0.65987|.	0.94;0.928|.	T|T	0.67352|0.67352	-0.5692|-0.5692	10|5	0.46703|.	T|.	0.11|.	.|.	15.1596|15.1596	0.72771|0.72771	0.0:0.1419:0.8581:0.0|0.0:0.1419:0.8581:0.0	.|.	178;178|.	P51157;P51157-2|.	RAB28_HUMAN;.|.	F|L	178|100	ENSP00000328551:L178F;ENSP00000288723:L178F;ENSP00000340079:L178F|.	ENSP00000288723:L178F|.	L|P	-|-	1|2	0|0	RAB28|RAB28	12987308|12987308	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	5.887000|5.887000	0.69751|0.69751	1.013000|1.013000	0.39391|0.39391	-0.384000|-0.384000	0.06662|0.06662	CTT|CCT		0.299	RAB28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207068.2	NM_001017979		13	62	0	0	0	0.00245	0	13	62				
RHOH	399	broad.mit.edu	37	4	40245386	40245386	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:40245386G>T	ENST00000381799.5	+	3	1104	c.380G>T	c.(379-381)aGg>aTg	p.R127M	RHOH_ENST00000505618.1_Missense_Mutation_p.R127M	NM_001278363.1|NM_001278365.1|NM_001278366.1|NM_001278367.1|NM_001278369.1|NM_004310.4	NP_001265292.1|NP_001265294.1|NP_001265295.1|NP_001265296.1|NP_001265298.1|NP_004301.1	Q15669	RHOH_HUMAN	ras homolog family member H	127					mast cell activation (GO:0045576)|negative regulation of catalytic activity (GO:0043086)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of phosphorylation (GO:0042326)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase inhibitor activity (GO:0005095)|kinase inhibitor activity (GO:0019210)|Rho GTPase binding (GO:0017048)			kidney(1)|large_intestine(3)|lung(7)|ovary(1)	12						GGGCCCCACAGGGCCTCCTGC	0.582																																							uc003guz.2		NA																	0				ovary(1)|lung(1)	2						c.(379-381)AGG>ATG		ras homolog gene family, member H precursor							52.0	54.0	53.0					4																	40245386		2203	4300	6503	SO:0001583	missense	399				negative regulation of I-kappaB kinase/NF-kappaB cascade|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|T cell differentiation	cytosol|mitochondrion|plasma membrane	GTP binding|GTPase inhibitor activity|kinase inhibitor activity|Rho GTPase binding	g.chr4:40245386G>T	Z35227	CCDS3458.1	4p13	2014-09-17	2012-02-27	2004-03-24	ENSG00000168421	ENSG00000168421			686	protein-coding gene	gene with protein product		602037	"""ras homolog gene family, member H"""	ARHH		7784061	Standard	NM_001278359		Approved	RhoH, TTF	uc003guz.2	Q15669	OTTHUMG00000099373	ENST00000381799.5:c.380G>T	4.37:g.40245386G>T	ENSP00000371219:p.Arg127Met		Somatic					p.R127M	NM_004310	NP_004301	WXS	Illumina HiSeq	Unspecified	Q15669	RHOH_HUMAN			3	1104	+			127						Missense_Mutation	SNP	ENST00000381799.5	37	c.380G>T	CCDS3458.1	.	.	.	.	.	.	.	.	.	.	g	23.7	4.448035	0.84101	.	.	ENSG00000168421	ENST00000505618;ENST00000381799	T;T	0.70399	-0.48;-0.48	5.92	5.92	0.95590	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.81645	0.4866	M	0.78801	2.425	0.80722	D	1	P	0.52842	0.956	P	0.57009	0.811	T	0.82924	-0.0216	10	0.62326	D	0.03	.	15.7716	0.78173	0.0:0.1355:0.8645:0.0	.	127	Q15669	RHOH_HUMAN	M	127	ENSP00000425010:R127M;ENSP00000371219:R127M	ENSP00000371219:R127M	R	+	2	0	RHOH	39921781	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	5.176000	0.65026	2.810000	0.96702	0.585000	0.79938	AGG		0.582	RHOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216820.3	NM_004310		18	47	1	0	7.07596e-05	0.006122	7.90224e-05	18	47				
LPHN3	23284	broad.mit.edu	37	4	62598771	62598771	+	Missense_Mutation	SNP	G	G	T	rs529635872		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:62598771G>T	ENST00000514591.1	+	7	1023	c.694G>T	c.(694-696)Gat>Tat	p.D232Y	LPHN3_ENST00000504896.1_Missense_Mutation_p.D232Y|LPHN3_ENST00000508693.1_Missense_Mutation_p.D300Y|LPHN3_ENST00000506700.1_Missense_Mutation_p.D232Y|LPHN3_ENST00000512091.2_Missense_Mutation_p.D232Y|LPHN3_ENST00000514157.1_Missense_Mutation_p.D232Y|LPHN3_ENST00000514996.1_Missense_Mutation_p.D232Y|LPHN3_ENST00000509896.1_Missense_Mutation_p.D300Y|LPHN3_ENST00000508946.1_Missense_Mutation_p.D232Y|LPHN3_ENST00000506746.1_Missense_Mutation_p.D300Y|LPHN3_ENST00000507164.1_Missense_Mutation_p.D300Y|LPHN3_ENST00000545650.1_Missense_Mutation_p.D232Y|LPHN3_ENST00000506720.1_Missense_Mutation_p.D300Y|LPHN3_ENST00000511324.1_Missense_Mutation_p.D300Y|LPHN3_ENST00000507625.1_Missense_Mutation_p.D300Y			Q9HAR2	LPHN3_HUMAN	latrophilin 3	232	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AGTAAAGTTTGATTTGCGGAC	0.458																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(694-696)GAT>TAT		latrophilin 3 precursor							77.0	73.0	74.0					4																	62598771		1906	4117	6023	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62598771G>T	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.694G>T	4.37:g.62598771G>T	ENSP00000422533:p.Asp232Tyr		Somatic				LPHN3_uc003hcq.3_Missense_Mutation_p.D232Y|LPHN3_uc010ihg.1_Missense_Mutation_p.D300Y|LPHN3_uc003hcs.1_Missense_Mutation_p.D61Y	p.D232Y	NM_015236	NP_056051	WXS	Illumina HiSeq	Unspecified	Q9HAR2	LPHN3_HUMAN			5	867	+			232			Extracellular (Potential).|Olfactomedin-like.		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.694G>T	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607698	0.66558	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.97542	0.9195	M	0.92122	3.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.98514	1.0620	10	0.87932	D	0	.	17.8426	0.88719	0.0:0.0:1.0:0.0	.	232;300;232	E9PE04;E7EN28;Q9HAR2-2	.;.;.	Y	232;232;300;300;232;232;232;232;232;300;300;300;232;232;232;300;300;232	ENSP00000423388:D232Y;ENSP00000422533:D232Y;ENSP00000423787:D300Y;ENSP00000425033:D300Y;ENSP00000424120:D232Y;ENSP00000439831:D232Y;ENSP00000421476:D300Y;ENSP00000424030:D300Y;ENSP00000421372:D300Y;ENSP00000425201:D232Y;ENSP00000423434:D232Y;ENSP00000421627:D232Y;ENSP00000420931:D300Y;ENSP00000425884:D300Y;ENSP00000424258:D232Y	ENSP00000280009:D232Y	D	+	1	0	LPHN3	62281366	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.863000	0.87023	2.458000	0.83093	0.557000	0.71058	GAT		0.458	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			8	34	1	0	1.76689e-08	0.006214	2.18679e-08	8	34				
STATH	6779	broad.mit.edu	37	4	70864186	70864186	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:70864186C>T	ENST00000246895.4	+	2	143	c.32C>T	c.(31-33)gCt>gTt	p.A11V	STATH_ENST00000381060.2_Missense_Mutation_p.A11V	NM_003154.2	NP_003145.1	P02808	STAT_HUMAN	statherin	11					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|ossification (GO:0001503)|saliva secretion (GO:0046541)	extracellular region (GO:0005576)	extracellular matrix constituent, lubricant activity (GO:0030197)|hydroxyapatite binding (GO:0046848)|structural constituent of tooth enamel (GO:0030345)			lung(2)|skin(1)	3						TTCATCTTGGCTCTCATGGTT	0.388																																							uc003heu.1		NA																	0				skin(1)	1						c.(31-33)GCT>GTT		statherin isoform a							179.0	157.0	164.0					4																	70864186		2203	4300	6503	SO:0001583	missense	6779				biomineral tissue development|negative regulation of bone mineralization|ossification|saliva secretion	extracellular region	extracellular matrix constituent, lubricant activity|hydroxyapatite binding|protein binding|structural constituent of tooth enamel	g.chr4:70864186C>T		CCDS3533.1, CCDS33998.1	4q13.3	2012-10-02			ENSG00000126549	ENSG00000126549			11369	protein-coding gene	gene with protein product		184470				3502720	Standard	NM_003154		Approved	STR	uc003heu.1	P02808	OTTHUMG00000129394	ENST00000246895.4:c.32C>T	4.37:g.70864186C>T	ENSP00000246895:p.Ala11Val		Somatic				STATH_uc003hev.1_Missense_Mutation_p.A11V	p.A11V	NM_003154	NP_003145	WXS	Illumina HiSeq	Unspecified	P02808	STAT_HUMAN			2	142	+			11					A6NKE9|B2R4F8	Missense_Mutation	SNP	ENST00000246895.4	37	c.32C>T	CCDS3533.1	.	.	.	.	.	.	.	.	.	.	C	3.779	-0.045946	0.07452	.	.	ENSG00000126549	ENST00000246895;ENST00000381060	.	.	.	3.88	3.88	0.44766	.	.	.	.	.	T	0.66187	0.2764	.	.	.	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.54840	-0.8233	7	0.87932	D	0	.	11.6401	0.51228	0.0:1.0:0.0:0.0	.	11;11	A6NKE9;P02808	.;STAT_HUMAN	V	11	.	ENSP00000246895:A11V	A	+	2	0	STATH	70898775	0.328000	0.24687	0.256000	0.24389	0.043000	0.13939	0.765000	0.26546	2.457000	0.83068	0.655000	0.94253	GCT		0.388	STATH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251550.1	NM_003154		7	78	0	0	0	0.006214	0	7	78				
CSN3	1448	broad.mit.edu	37	4	71114826	71114826	+	Missense_Mutation	SNP	C	C	T	rs200877675		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:71114826C>T	ENST00000304954.3	+	4	285	c.199C>T	c.(199-201)Cca>Tca	p.P67S		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	0					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						CCAACGTAGACCAGCTATAGC	0.413																																							uc003hfe.3		NA																	0				ovary(2)|kidney(1)|central_nervous_system(1)	4						c.(199-201)CCA>TCA		casein kappa precursor							125.0	120.0	122.0					4																	71114826		2203	4300	6503	SO:0001583	missense	1448					extracellular region	protein binding	g.chr4:71114826C>T	U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.199C>T	4.37:g.71114826C>T	ENSP00000304822:p.Pro67Ser		Somatic					p.P67S	NM_005212	NP_005203	WXS	Illumina HiSeq	Unspecified	P07498	CASK_HUMAN			4	257	+			67					B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	ENST00000304954.3	37	c.199C>T	CCDS3538.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976698	0.34848	.	.	ENSG00000171209	ENST00000304954	T	0.21361	2.01	4.17	-2.41	0.06562	.	1.266860	0.05309	N	0.524405	T	0.11836	0.0288	N	0.21097	0.63	0.09310	N	1	B	0.30634	0.288	B	0.27608	0.081	T	0.24693	-1.0153	10	0.48119	T	0.1	-18.0303	2.6976	0.05139	0.4041:0.2426:0.2649:0.0884	.	67	P07498	CASK_HUMAN	S	67	ENSP00000304822:P67S	ENSP00000304822:P67S	P	+	1	0	CSN3	71149415	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.421000	0.07053	-0.552000	0.06167	0.557000	0.71058	CCA		0.413	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251555.1	NM_005212		9	114	0	0	0	0.004482	0	9	114				
CXXC4	80319	broad.mit.edu	37	4	105412377	105412377	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:105412377T>G	ENST00000426831.1	-	1	90	c.76A>C	c.(76-78)Act>Cct	p.T26P	CXXC4_ENST00000466963.1_Intron|AC004053.1_ENST00000500179.1_RNA|AC093628.1_ENST00000606234.1_RNA|CXXC4_ENST00000394767.2_Missense_Mutation_p.T195P			Q9H2H0	CXXC4_HUMAN	CXXC finger protein 4	26					negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)	DNA binding (GO:0003677)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		AGGAAATTAGTATTTGCCATT	0.577																																							uc003hxg.2		NA																	0				ovary(1)	1						c.(76-78)ACT>CCT		CXXC finger 4							124.0	138.0	133.0					4																	105412377		2203	4300	6503	SO:0001583	missense	80319				negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway|zygotic specification of dorsal/ventral axis		DNA binding|PDZ domain binding|zinc ion binding	g.chr4:105412377T>G		CCDS3665.1, CCDS3665.2	4q22-q24	2014-02-18	2011-12-01		ENSG00000168772	ENSG00000168772			24593	protein-coding gene	gene with protein product	"""Dvl-binding protein IDAX (inhibition of the Dvl and Axin complex)"""	611645				11113207	Standard	NM_025212		Approved	IDAX	uc003hxf.2	Q9H2H0	OTTHUMG00000131121	ENST00000426831.1:c.76A>C	4.37:g.105412377T>G	ENSP00000412267:p.Thr26Pro		Somatic				uc003hxh.1_Intron|CXXC4_uc010ilo.2_Intron	p.T26P	NM_025212	NP_079488	WXS	Illumina HiSeq	Unspecified	Q9H2H0	CXXC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)	1	91	-			26						Missense_Mutation	SNP	ENST00000426831.1	37	c.76A>C		.	.	.	.	.	.	.	.	.	.	T	11.34	1.609703	0.28623	.	.	ENSG00000168772	ENST00000394767;ENST00000426831	.	.	.	2.9	2.9	0.33743	.	0.062140	0.64402	D	0.000010	T	0.25158	0.0611	N	0.08118	0	0.32693	N	0.513902	B	0.18166	0.026	B	0.20384	0.029	T	0.21552	-1.0242	9	0.52906	T	0.07	-3.4852	7.4075	0.27000	0.0:0.1139:0.0:0.8861	.	26	Q9H2H0	CXXC4_HUMAN	P	26	.	ENSP00000378248:T26P	T	-	1	0	CXXC4	105631826	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.707000	0.54838	1.359000	0.45940	0.248000	0.18094	ACT		0.577	CXXC4-201	KNOWN	basic	protein_coding	protein_coding		NM_025212		17	214	0	0	0	0.008871	0	17	214				
NDST4	64579	broad.mit.edu	37	4	115760534	115760534	+	Splice_Site	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:115760534C>T	ENST00000264363.2	-	11	2964	c.2286G>A	c.(2284-2286)caG>caA	p.Q762Q		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	762	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AGGACATTACCTGAGAAGTAG	0.333																																							uc003ibu.2		NA																	0				skin(3)|ovary(1)	4						c.(2284-2286)CAG>CAA		heparan sulfate N-deacetylase/N-sulfotransferase							115.0	109.0	111.0					4																	115760534		2203	4300	6503	SO:0001630	splice_region_variant	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115760534C>T	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.2286+1G>A	4.37:g.115760534C>T			Somatic				NDST4_uc010imw.2_RNA	p.Q762Q	NM_022569	NP_072091	WXS	Illumina HiSeq	Unspecified	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	11	2965	-		Ovarian(17;0.156)	762			Lumenal (Potential).|Heparan sulfate N-sulfotransferase 4.		Q2KHM8	Silent	SNP	ENST00000264363.2	37	c.2286G>A	CCDS3706.1																																																																																				0.333	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	Silent	14	72	0	0	0	0.004007	0	14	72				
SPATA5	166378	broad.mit.edu	37	4	123900432	123900432	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:123900432C>A	ENST00000274008.4	+	10	1829	c.1760C>A	c.(1759-1761)cCt>cAt	p.P587H	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	587					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						CCTAACCTCCCTGATGTCAAG	0.423																																							uc003iez.3		NA																	0					0						c.(1759-1761)CCT>CAT		spermatogenesis associated 5							115.0	109.0	111.0					4																	123900432		2203	4300	6503	SO:0001583	missense	166378				cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity	g.chr4:123900432C>A	AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.1760C>A	4.37:g.123900432C>A	ENSP00000274008:p.Pro587His		Somatic				SPATA5_uc003iey.2_Missense_Mutation_p.P586H	p.P587H	NM_145207	NP_660208	WXS	Illumina HiSeq	Unspecified	Q8NB90	SPAT5_HUMAN			10	1833	+			587					C9JT97|Q86XW1|Q8NI20|Q8TDL7	Missense_Mutation	SNP	ENST00000274008.4	37	c.1760C>A	CCDS3730.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977006	0.34848	.	.	ENSG00000145375	ENST00000274008	D	0.94537	-3.45	5.02	5.02	0.67125	.	0.224022	0.39407	N	0.001368	D	0.92355	0.7574	L	0.38953	1.18	0.30522	N	0.768358	P;P	0.38148	0.62;0.569	B;P	0.46110	0.235;0.504	D	0.90931	0.4790	10	0.56958	D	0.05	-27.8196	10.0922	0.42453	0.0:0.784:0.1397:0.0763	.	587;587	Q8NB90;Q8NB90-3	SPAT5_HUMAN;.	H	587	ENSP00000274008:P587H	ENSP00000274008:P587H	P	+	2	0	SPATA5	124119882	0.914000	0.31030	0.984000	0.44739	0.093000	0.18481	1.489000	0.35562	2.594000	0.87642	0.591000	0.81541	CCT		0.423	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256714.2	NM_145207		12	50	1	0	0.00010058	0.001368	0.000111614	12	50				
PCDH10	57575	broad.mit.edu	37	4	134072556	134072556	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:134072556C>A	ENST00000264360.5	+	1	2087	c.1261C>A	c.(1261-1263)Ctg>Atg	p.L421M	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	421	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CGAAGCCCCCCTGGACCGAGA	0.592																																							uc003iha.2		NA																	0				ovary(2)	2						c.(1261-1263)CTG>ATG		protocadherin 10 isoform 1 precursor							149.0	164.0	159.0					4																	134072556		2202	4300	6502	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134072556C>A	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1261C>A	4.37:g.134072556C>A	ENSP00000264360:p.Leu421Met		Somatic				uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.L421M	p.L421M	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	2087	+			421			Cadherin 4.|Extracellular (Potential).		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.1261C>A	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.597551	0.46318	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.74842	-0.88	4.68	2.88	0.33553	Cadherin (4);Cadherin-like (1);	0.000000	0.35436	N	0.003212	D	0.87350	0.6155	M	0.93854	3.465	0.47183	D	0.999347	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.994	D	0.87589	0.2489	10	0.87932	D	0	.	8.0705	0.30687	0.0:0.7382:0.0:0.2618	.	421;421	Q9P2E7;Q96SF0	PCD10_HUMAN;.	M	421	ENSP00000264360:L421M	ENSP00000264360:L421M	L	+	1	2	PCDH10	134292006	0.981000	0.34729	0.948000	0.38648	0.952000	0.60782	2.548000	0.45794	1.160000	0.42584	0.561000	0.74099	CTG		0.592	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		44	173	1	0	5.99346e-17	0.00361	8.59008e-17	44	173				
NPY5R	4889	broad.mit.edu	37	4	164271568	164271568	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:164271568A>G	ENST00000515560.1	+	4	1665	c.143A>G	c.(142-144)tAt>tGt	p.Y48C	NPY5R_ENST00000506953.1_Missense_Mutation_p.Y48C|NPY5R_ENST00000338566.3_Missense_Mutation_p.Y48C			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	48					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				ATTGGGCTCTATACATTTGTA	0.388																																					Melanoma(139;1287 1774 9781 19750 25599)	Melanoma(139;1287 1774 9781 19750 25599)	uc003iqn.2		NA																	0				lung(6)|skin(1)	7						c.(142-144)TAT>TGT		neuropeptide Y receptor Y5							123.0	117.0	119.0					4																	164271568		2203	4300	6503	SO:0001583	missense	4889				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane		g.chr4:164271568A>G	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.143A>G	4.37:g.164271568A>G	ENSP00000423917:p.Tyr48Cys		Somatic					p.Y48C	NM_006174	NP_006165	WXS	Illumina HiSeq	Unspecified	Q15761	NPY5R_HUMAN			4	325	+	all_hematologic(180;0.166)	Prostate(90;0.109)	48			Helical; Name=1; (Potential).		Q6GTR7|Q92916	Missense_Mutation	SNP	ENST00000515560.1	37	c.143A>G	CCDS3804.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683595	0.68157	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.42513	0.97;0.97;0.97	5.35	5.35	0.76521	.	0.000000	0.52532	D	0.000062	T	0.54647	0.1871	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58657	-0.7598	10	0.87932	D	0	.	15.6362	0.76953	1.0:0.0:0.0:0.0	.	48	Q15761	NPY5R_HUMAN	C	48	ENSP00000339377:Y48C;ENSP00000423917:Y48C;ENSP00000423474:Y48C	ENSP00000339377:Y48C	Y	+	2	0	NPY5R	164491018	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.419000	0.90253	2.155000	0.67459	0.533000	0.62120	TAT		0.388	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174		14	126	0	0	0	0.001855	0	14	126				
SORBS2	8470	broad.mit.edu	37	4	186544784	186544784	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:186544784G>C	ENST00000284776.7	-	13	2296	c.1787C>G	c.(1786-1788)tCc>tGc	p.S596C	SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000355634.5_Missense_Mutation_p.S696C|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.S596C|SORBS2_ENST00000418609.1_Missense_Mutation_p.S500C|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000437304.2_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	596					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GTCGCTGTCGGAAAACTCCAC	0.587																																					Esophageal Squamous(153;41 2433 9491 36028)	Esophageal Squamous(153;41 2433 9491 36028)	uc003iyl.2		NA																	0				ovary(1)	1						c.(1786-1788)TCC>TGC		sorbin and SH3 domain containing 2 isoform 2							57.0	55.0	56.0					4																	186544784		2203	4300	6503	SO:0001583	missense	8470					actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chr4:186544784G>C		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1787C>G	4.37:g.186544784G>C	ENSP00000284776:p.Ser596Cys		Somatic				SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Missense_Mutation_p.S696C|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Missense_Mutation_p.S500C|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Missense_Mutation_p.S710C|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	p.S596C	NM_021069	NP_066547	WXS	Illumina HiSeq	Unspecified	O94875	SRBS2_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)	13	2645	-		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)	596					A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	c.1787C>G	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	G	18.78	3.696811	0.68386	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.50548	0.83;0.83;0.74;0.82	5.88	5.88	0.94601	.	0.103423	0.64402	D	0.000002	T	0.67970	0.2950	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.81914	0.995;0.993;0.995	T	0.68047	-0.5512	10	0.87932	D	0	-23.2772	20.2405	0.98372	0.0:0.0:1.0:0.0	.	500;696;596	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	C	596;596;500;696	ENSP00000284776:S596C;ENSP00000411764:S596C;ENSP00000397482:S500C;ENSP00000347852:S696C	ENSP00000284776:S596C	S	-	2	0	SORBS2	186781778	1.000000	0.71417	0.941000	0.38009	0.540000	0.34992	9.869000	0.99810	2.797000	0.96272	0.561000	0.74099	TCC		0.587	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603		5	45	0	0	0	0.001168	0	5	45				
NKD2	85409	broad.mit.edu	37	5	1037950	1037950	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:1037950C>T	ENST00000296849.5	+	10	1047	c.818C>T	c.(817-819)cCc>cTc	p.P273L	NKD2_ENST00000382730.2_Intron|NKD2_ENST00000274150.4_3'UTR	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	273					exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			AAGCAGGAGCCCCAGGGCAGG	0.657																																							uc003jbt.1		NA																	0					0						c.(817-819)CCC>CTC		naked cuticle homolog 2							19.0	22.0	21.0					5																	1037950		2186	4276	6462	SO:0001583	missense	85409				exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding	g.chr5:1037950C>T	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.818C>T	5.37:g.1037950C>T	ENSP00000296849:p.Pro273Leu		Somatic				NKD2_uc010itf.1_3'UTR	p.P273L	NM_033120	NP_149111	WXS	Illumina HiSeq	Unspecified	Q969F2	NKD2_HUMAN	Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)		10	823	+	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		273					Q96EK8|Q9BSN0	Missense_Mutation	SNP	ENST00000296849.5	37	c.818C>T	CCDS3859.1	.	.	.	.	.	.	.	.	.	.	C	5.977	0.364181	0.11296	.	.	ENSG00000145506	ENST00000296849	T	0.40225	1.04	3.85	1.3	0.21679	.	0.427258	0.22467	N	0.059672	T	0.25901	0.0631	N	0.12887	0.27	0.80722	D	1	P	0.36535	0.557	B	0.41860	0.368	T	0.03555	-1.1025	10	0.35671	T	0.21	-12.4033	7.929	0.29891	0.5537:0.4463:0.0:0.0	.	273	Q969F2	NKD2_HUMAN	L	273	ENSP00000296849:P273L	ENSP00000296849:P273L	P	+	2	0	NKD2	1090950	0.514000	0.26202	0.260000	0.24451	0.184000	0.23303	1.072000	0.30678	-0.022000	0.13986	0.305000	0.20034	CCC		0.657	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120		9	30	0	0	0	0.000978	0	9	30				
SLC12A7	10723	broad.mit.edu	37	5	1089150	1089150	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:1089150C>A	ENST00000264930.5	-	4	479	c.436G>T	c.(436-438)Ggg>Tgg	p.G146W		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	146					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CCAGCCACCCCCACGATCCAC	0.657																																							uc003jbu.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(436-438)GGG>TGG		solute carrier family 12 (potassium/chloride	Potassium Chloride(DB00761)						181.0	149.0	160.0					5																	1089150		2202	4300	6502	SO:0001583	missense	10723				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity	g.chr5:1089150C>A	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.436G>T	5.37:g.1089150C>A	ENSP00000264930:p.Gly146Trp		Somatic					p.G146W	NM_006598	NP_006589	WXS	Illumina HiSeq	Unspecified	Q9Y666	S12A7_HUMAN	Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		4	502	-	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		146			Helical; (Potential).		A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	c.436G>T	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918077	0.73098	.	.	ENSG00000113504	ENST00000264930;ENST00000343658	D	0.98876	-5.2	3.61	3.61	0.41365	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.99468	0.9811	H	0.98295	4.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97938	1.0324	10	0.87932	D	0	.	14.1755	0.65539	0.0:1.0:0.0:0.0	.	146	Q9Y666	S12A7_HUMAN	W	146	ENSP00000264930:G146W	ENSP00000264930:G146W	G	-	1	0	SLC12A7	1142150	1.000000	0.71417	0.994000	0.49952	0.749000	0.42624	6.945000	0.75947	1.739000	0.51704	0.561000	0.74099	GGG		0.657	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598		17	102	1	0	5.03518e-11	0.007413	6.6713e-11	17	102				
SEMA6A	57556	broad.mit.edu	37	5	115782666	115782666	+	Silent	SNP	G	G	A	rs376332713		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:115782666G>A	ENST00000343348.6	-	19	3523	c.2736C>T	c.(2734-2736)taC>taT	p.Y912Y	CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000513137.1_Silent_p.Y339Y|SEMA6A_ENST00000257414.8_Silent_p.Y929Y|CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000510263.1_Silent_p.Y912Y|CTB-118N6.3_ENST00000508424.1_RNA|SEMA6A_ENST00000282394.6_Silent_p.Y389Y|SEMA6A_ENST00000503865.1_Silent_p.Y291Y|CTB-118N6.3_ENST00000512128.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	912					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		AGTCAACCCCGTAGGAAGAGG	0.577																																							uc010jck.2		NA																	0				ovary(2)	2						c.(2734-2736)TAC>TAT		sema domain, transmembrane domain (TM), and		G		1,3935		0,1,1967	58.0	64.0	62.0		2736	-1.3	0.9	5		62	2,8326		0,2,4162	no	coding-synonymous	SEMA6A	NM_020796.3		0,3,6129	AA,AG,GG		0.024,0.0254,0.0245		912/1031	115782666	3,12261	1968	4164	6132	SO:0001819	synonymous_variant	57556				apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity	g.chr5:115782666G>A	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.2736C>T	5.37:g.115782666G>A			Somatic				SEMA6A_uc003krx.3_Silent_p.Y929Y|SEMA6A_uc011cwe.1_Silent_p.Y291Y|SEMA6A_uc003krv.3_Silent_p.Y339Y|SEMA6A_uc003krw.3_Silent_p.Y389Y|SEMA6A_uc010jcj.2_Silent_p.Y456Y	p.Y912Y	NM_020796	NP_065847	WXS	Illumina HiSeq	Unspecified	Q9H2E6	SEM6A_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)	19	3445	-		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)	912			Cytoplasmic (Potential).		Q9P2H9	Silent	SNP	ENST00000343348.6	37	c.2736C>T	CCDS47256.1	.	.	.	.	.	.	.	.	.	.	G	3.513	-0.099316	0.07010	2.54E-4	2.4E-4	ENSG00000092421	ENST00000515129	.	.	.	5.22	-1.28	0.09318	.	.	.	.	.	T	0.51126	0.1656	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40440	-0.9563	4	.	.	.	.	6.5502	0.22429	0.3966:0.0:0.4953:0.108	.	.	.	.	M	427	.	.	T	-	2	0	SEMA6A	115810565	1.000000	0.71417	0.898000	0.35279	0.990000	0.78478	1.018000	0.30002	-0.306000	0.08818	-0.251000	0.11542	ACG		0.577	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796		21	68	0	0	0	0.010504	0	21	68				
CSNK1G3	1456	broad.mit.edu	37	5	122893250	122893250	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:122893250G>T	ENST00000361991.2	+	3	311	c.281G>T	c.(280-282)gGa>gTa	p.G94V	CSNK1G3_ENST00000512718.3_Missense_Mutation_p.G19V|CSNK1G3_ENST00000360683.2_Missense_Mutation_p.G94V|CSNK1G3_ENST00000521364.1_Missense_Mutation_p.G94V|CSNK1G3_ENST00000395412.1_Missense_Mutation_p.G94V|CSNK1G3_ENST00000511130.2_Intron|CSNK1G3_ENST00000395411.1_Missense_Mutation_p.G94V|CSNK1G3_ENST00000510842.2_Missense_Mutation_p.G94V|CSNK1G3_ENST00000345990.4_Missense_Mutation_p.G94V			Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3	94	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(1)	15		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		AAGCAGTTAGGATCTGGAGGT	0.294																																					Pancreas(187;2868 2964 4353 6297)	Pancreas(187;2868 2964 4353 6297)	uc003ktm.2		NA																	0					0						c.(280-282)GGA>GTA		casein kinase 1, gamma 3 isoform 1							51.0	55.0	53.0					5																	122893250		2203	4298	6501	SO:0001583	missense	1456				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr5:122893250G>T	AF049090	CCDS4135.1, CCDS34218.1, CCDS43355.1, CCDS59491.1, CCDS59492.1, CCDS59493.1	5q23	2013-01-17			ENSG00000151292	ENSG00000151292			2456	protein-coding gene	gene with protein product		604253				9925945	Standard	NM_004384		Approved		uc031skv.1	Q9Y6M4	OTTHUMG00000128923	ENST00000361991.2:c.281G>T	5.37:g.122893250G>T	ENSP00000354942:p.Gly94Val		Somatic				CSNK1G3_uc003ktl.2_Missense_Mutation_p.G94V|CSNK1G3_uc003ktn.2_Missense_Mutation_p.G94V|CSNK1G3_uc003kto.2_Missense_Mutation_p.G94V|CSNK1G3_uc011cwr.1_Missense_Mutation_p.G19V|CSNK1G3_uc011cws.1_Intron|CSNK1G3_uc010jda.2_Missense_Mutation_p.G94V	p.G94V	NM_004384	NP_004375	WXS	Illumina HiSeq	Unspecified	Q9Y6M4	KC1G3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)	4	1000	+		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	94			Protein kinase.		A8K040|B4DSH2|B7Z9Q4|E7EVD0|Q86WZ7|Q9Y6M3	Missense_Mutation	SNP	ENST00000361991.2	37	c.281G>T	CCDS4135.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818770	0.71028	.	.	ENSG00000151292	ENST00000395412;ENST00000395411;ENST00000345990;ENST00000512718;ENST00000521364;ENST00000510842;ENST00000361991;ENST00000360683	T;T;T;T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04	5.29	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.39009	0.1062	L	0.41632	1.29	0.80722	D	1	D;D;P;D;D	0.67145	0.986;0.992;0.951;0.996;0.985	D;D;P;D;P	0.72075	0.953;0.953;0.721;0.976;0.877	T	0.02179	-1.1200	10	0.45353	T	0.12	.	18.5899	0.91206	0.0:0.0:1.0:0.0	.	19;94;94;94;94	B4DSH2;A8K040;Q9Y6M4-3;Q9Y6M4;Q9Y6M4-2	.;.;.;KC1G3_HUMAN;.	V	94;94;94;19;94;94;94;94	ENSP00000378807:G94V;ENSP00000378806:G94V;ENSP00000334735:G94V;ENSP00000421998:G19V;ENSP00000429412:G94V;ENSP00000423838:G94V;ENSP00000354942:G94V;ENSP00000353904:G94V	ENSP00000334735:G94V	G	+	2	0	CSNK1G3	122921149	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.871000	0.87180	2.865000	0.98341	0.655000	0.94253	GGA		0.294	CSNK1G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250900.1	NM_004384		13	17	1	0	4.93089e-13	0.00245	6.8615e-13	13	17				
BRD8	10902	broad.mit.edu	37	5	137501759	137501760	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:137501759_137501760CC>AA	ENST00000254900.5	-	11	1406_1407	c.1035_1036GG>TT	c.(1033-1038)gtGGgg>gtTTgg	p.G346W	BRD8_ENST00000411594.2_Missense_Mutation_p.G349W|BRD8_ENST00000455658.2_Missense_Mutation_p.G305W|BRD8_ENST00000230901.5_Missense_Mutation_p.G419W|BRD8_ENST00000515014.1_5'Flank|BRD8_ENST00000402931.1_Missense_Mutation_p.G346W	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	346					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGTGGATCCCCCACAGCCTCCA	0.46																																							uc003lcf.1		NA																	0				ovary(1)	1						c.(1033-1038)GTGGGG>GTTTGG		bromodomain containing 8 isoform 2																																				SO:0001583	missense	10902				cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity	g.chr5:137501759_137501760CC>AA	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.1035_1036delinsAA	5.37:g.137501759_137501760delinsAA	ENSP00000254900:p.Gly346Trp		Somatic				BRD8_uc003lcc.1_RNA|BRD8_uc011cyl.1_Missense_Mutation_p.G125W|BRD8_uc003lcg.2_Missense_Mutation_p.G419W|BRD8_uc003lci.2_Missense_Mutation_p.G349W|BRD8_uc003lch.2_Missense_Mutation_p.G240W|BRD8_uc011cym.1_Missense_Mutation_p.G330W|BRD8_uc010jer.1_Missense_Mutation_p.G315W|BRD8_uc011cyn.1_Missense_Mutation_p.G305W	p.G346W	NM_139199	NP_631938	WXS	Illumina HiSeq	Unspecified	Q9H0E9	BRD8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		11	1090_1091	-			346					O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	DNP	ENST00000254900.5	37	c.1035_1036GG>TT	CCDS4198.1																																																																																				0.460	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696		47	69	0	0	0	0.004672	0	47	69				
FAM53C	51307	broad.mit.edu	37	5	137681066	137681066	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:137681066G>T	ENST00000239906.5	+	4	1117	c.689G>T	c.(688-690)cGc>cTc	p.R230L	RP11-256P1.1_ENST00000504539.1_RNA|FAM53C_ENST00000513056.1_Intron|FAM53C_ENST00000434981.2_Missense_Mutation_p.R230L|FAM53C_ENST00000507506.1_3'UTR	NM_016605.2	NP_057689.1	Q9NYF3	FA53C_HUMAN	family with sequence similarity 53, member C	230										breast(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CCTCAGCGCCGCTTCTCCCTG	0.672																																							uc003lcv.2		NA																	0				ovary(1)	1						c.(688-690)CGC>CTC		hypothetical protein LOC51307							76.0	87.0	83.0					5																	137681066		2203	4300	6503	SO:0001583	missense	51307							g.chr5:137681066G>T	AF251040	CCDS4204.1	5q31	2008-02-05	2004-11-24	2004-11-26	ENSG00000120709	ENSG00000120709			1336	protein-coding gene	gene with protein product		609372	"""chromosome 5 open reading frame 6"""	C5orf6		11087669, 11161817	Standard	NM_001135647		Approved		uc003lcv.3	Q9NYF3	OTTHUMG00000129201	ENST00000239906.5:c.689G>T	5.37:g.137681066G>T	ENSP00000239906:p.Arg230Leu		Somatic				FAM53C_uc003lcw.2_Missense_Mutation_p.R230L|FAM53C_uc011cyq.1_Intron|FAM53C_uc011cyr.1_Intron	p.R230L	NM_001135647	NP_001129119	WXS	Illumina HiSeq	Unspecified	Q9NYF3	FA53C_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)		4	1159	+			230					B2RDJ5|D3DQB9	Missense_Mutation	SNP	ENST00000239906.5	37	c.689G>T	CCDS4204.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780512	0.70222	.	.	ENSG00000120709	ENST00000434981;ENST00000239906	T;T	0.49720	0.77;0.77	5.55	5.55	0.83447	.	0.226277	0.45361	D	0.000365	T	0.50973	0.1647	M	0.71206	2.165	0.80722	D	1	P	0.38395	0.629	B	0.37601	0.254	T	0.50398	-0.8833	9	.	.	.	-9.6554	18.4386	0.90656	0.0:0.0:1.0:0.0	.	230	Q9NYF3	FA53C_HUMAN	L	230	ENSP00000403705:R230L;ENSP00000239906:R230L	.	R	+	2	0	FAM53C	137708965	0.997000	0.39634	1.000000	0.80357	0.951000	0.60555	3.523000	0.53488	2.894000	0.99253	0.655000	0.94253	CGC		0.672	FAM53C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251278.2	NM_016605		50	78	1	0	1.32667e-27	0.00361	2.08307e-27	50	78				
PCDHB3	56132	broad.mit.edu	37	5	140481673	140481673	+	Silent	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:140481673A>T	ENST00000231130.2	+	1	1440	c.1440A>T	c.(1438-1440)tcA>tcT	p.S480S	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	480	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAGAGACTCAGGCACCAACG	0.647																																							uc003lio.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1438-1440)TCA>TCT		protocadherin beta 3 precursor							88.0	91.0	90.0					5																	140481673		2203	4298	6501	SO:0001819	synonymous_variant	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140481673A>T	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1440A>T	5.37:g.140481673A>T			Somatic				uc003lin.2_Intron	p.S480S	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1440	+			480			Extracellular (Potential).|Cadherin 5.		B2R8P2	Silent	SNP	ENST00000231130.2	37	c.1440A>T	CCDS4245.1																																																																																				0.647	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		81	286	0	0	0	0.00361	0	81	286				
PCDHB7	56129	broad.mit.edu	37	5	140553848	140553848	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:140553848A>T	ENST00000231137.3	+	1	1606	c.1432A>T	c.(1432-1434)Aga>Tga	p.R478*		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	478	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCACAGACAGAGACTCGGG	0.642																																							uc003lit.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1432-1434)AGA>TGA		protocadherin beta 7 precursor							105.0	103.0	104.0					5																	140553848		2203	4299	6502	SO:0001587	stop_gained	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140553848A>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1432A>T	5.37:g.140553848A>T	ENSP00000231137:p.Arg478*		Somatic					p.R478*	NM_018940	NP_061763	WXS	Illumina HiSeq	Unspecified	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1606	+			478			Extracellular (Potential).|Cadherin 5.		A1L3Y8	Nonsense_Mutation	SNP	ENST00000231137.3	37	c.1432A>T	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	a	15.49	2.848333	0.51164	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	.	.	.	4.27	-4.55	0.03441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.9171	0.01307	0.2158:0.3281:0.2349:0.2212	.	.	.	.	X	478;261	.	ENSP00000231137:R478X	R	+	1	2	PCDHB7	140534032	0.000000	0.05858	0.010000	0.14722	0.122000	0.20287	-2.094000	0.01351	-1.057000	0.03201	-0.388000	0.06559	AGA		0.642	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		61	100	0	0	0	0.00361	0	61	100				
PCDHB8	56128	broad.mit.edu	37	5	140559961	140559961	+	Silent	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:140559961A>T	ENST00000239444.2	+	1	2591	c.2346A>T	c.(2344-2346)ccA>ccT	p.P782P	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	782					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTTTTGGGCCAGAAATGGAAC	0.378																																							uc011dai.1		NA																	0				skin(4)	4						c.(2344-2346)CCA>CCT		protocadherin beta 8 precursor							76.0	83.0	80.0					5																	140559961		2203	4300	6503	SO:0001819	synonymous_variant	56128				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140559961A>T	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.2346A>T	5.37:g.140559961A>T			Somatic				PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	p.P782P	NM_019120	NP_061993	WXS	Illumina HiSeq	Unspecified	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2532	+			782			Cytoplasmic (Potential).		B9EGV1	Silent	SNP	ENST00000239444.2	37	c.2346A>T	CCDS4250.1																																																																																				0.378	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120		46	46	0	0	0	0.003214	0	46	46				
PCDHB10	56126	broad.mit.edu	37	5	140572515	140572515	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:140572515G>T	ENST00000239446.4	+	1	574	c.390G>T	c.(388-390)gcG>gcT	p.A130A		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	130	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGATCACGCGCCAGTATTTC	0.423																																							uc003lix.2		NA																	0				ovary(1)|skin(1)	2						c.(388-390)GCG>GCT		protocadherin beta 10 precursor							84.0	88.0	86.0					5																	140572515		2203	4300	6503	SO:0001819	synonymous_variant	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140572515G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.390G>T	5.37:g.140572515G>T			Somatic					p.A130A	NM_018930	NP_061753	WXS	Illumina HiSeq	Unspecified	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	564	+			130			Extracellular (Potential).|Cadherin 1.		Q96T99	Silent	SNP	ENST00000239446.4	37	c.390G>T	CCDS4252.1																																																																																				0.423	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		54	55	1	0	8.28887e-21	0.00361	1.24215e-20	54	55				
PCDHB10	56126	broad.mit.edu	37	5	140573763	140573763	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:140573763G>T	ENST00000239446.4	+	1	1822	c.1638G>T	c.(1636-1638)ctG>ctT	p.L546L		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	546	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGAGGCGCTGGTGCGCGTGC	0.711																																							uc003lix.2		NA																	0				ovary(1)|skin(1)	2						c.(1636-1638)CTG>CTT		protocadherin beta 10 precursor							31.0	45.0	40.0					5																	140573763		2173	4266	6439	SO:0001819	synonymous_variant	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140573763G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1638G>T	5.37:g.140573763G>T			Somatic					p.L546L	NM_018930	NP_061753	WXS	Illumina HiSeq	Unspecified	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1812	+			546			Cadherin 5.|Extracellular (Potential).		Q96T99	Silent	SNP	ENST00000239446.4	37	c.1638G>T	CCDS4252.1																																																																																				0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		34	33	1	0	2.47872e-24	0.002522	3.82349e-24	34	33				
GRIA1	2890	broad.mit.edu	37	5	153078536	153078536	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:153078536A>G	ENST00000285900.5	+	10	1698	c.1355A>G	c.(1354-1356)tAc>tGc	p.Y452C	GRIA1_ENST00000518142.1_Missense_Mutation_p.Y372C|GRIA1_ENST00000448073.4_Missense_Mutation_p.Y462C|GRIA1_ENST00000340592.5_Missense_Mutation_p.Y452C|GRIA1_ENST00000518783.1_Missense_Mutation_p.Y462C|GRIA1_ENST00000521843.2_Missense_Mutation_p.Y383C	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	452					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CACGTGGGCTACTCCTACCGT	0.537																																							uc003lva.3		NA																	0				ovary(4)|skin(2)	6						c.(1354-1356)TAC>TGC		glutamate receptor, ionotropic, AMPA 1 isoform	Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						105.0	94.0	97.0					5																	153078536		2203	4300	6503	SO:0001583	missense	2890				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding	g.chr5:153078536A>G		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1355A>G	5.37:g.153078536A>G	ENSP00000285900:p.Tyr452Cys		Somatic				GRIA1_uc003luy.3_Missense_Mutation_p.Y452C|GRIA1_uc003luz.3_Missense_Mutation_p.Y357C|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.Y372C|GRIA1_uc011dcx.1_Missense_Mutation_p.Y383C|GRIA1_uc011dcy.1_Missense_Mutation_p.Y462C|GRIA1_uc011dcz.1_Missense_Mutation_p.Y462C|GRIA1_uc010jia.1_Missense_Mutation_p.Y432C	p.Y452C	NM_001114183	NP_001107655	WXS	Illumina HiSeq	Unspecified	P42261	GRIA1_HUMAN	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		10	1720	+		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	452			Extracellular (Potential).		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	c.1355A>G	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	A	13.95	2.388681	0.42308	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.77098	1.62;1.62;-1.07;1.62;1.62;1.62;-1.07	5.44	5.44	0.79542	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.058312	0.64402	D	0.000001	T	0.67906	0.2943	L	0.32530	0.975	0.54753	D	0.999987	B;B;B;B;B;B	0.10296	0.002;0.002;0.003;0.002;0.001;0.001	B;B;B;B;B;B	0.18263	0.007;0.007;0.021;0.007;0.002;0.013	T	0.66208	-0.5981	10	0.87932	D	0	.	9.9893	0.41860	0.8491:0.0:0.0:0.1509	.	462;462;372;462;452;452	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	C	452;452;372;406;452;383;383;462;462	ENSP00000285900:Y452C;ENSP00000427920:Y372C;ENSP00000339343:Y452C;ENSP00000427864:Y383C;ENSP00000442108:Y383C;ENSP00000428994:Y462C;ENSP00000415569:Y462C	ENSP00000285900:Y452C	Y	+	2	0	GRIA1	153058729	0.834000	0.29399	1.000000	0.80357	0.998000	0.95712	1.759000	0.38420	2.060000	0.61445	0.533000	0.62120	TAC		0.537	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3			27	33	0	0	0	0.003954	0	27	33				
GRIA1	2890	broad.mit.edu	37	5	153182019	153182019	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:153182019A>G	ENST00000285900.5	+	15	2832	c.2489A>G	c.(2488-2490)tAc>tGc	p.Y830C	GRIA1_ENST00000518142.1_Missense_Mutation_p.Y750C|GRIA1_ENST00000448073.4_Missense_Mutation_p.Y840C|GRIA1_ENST00000340592.5_Missense_Mutation_p.Y830C|GRIA1_ENST00000518783.1_Missense_Mutation_p.Y840C|GRIA1_ENST00000521843.2_Missense_Mutation_p.Y761C	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	830					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GAGTTCTGCTACAAATCCCGT	0.532																																							uc003lva.3		NA																	0				ovary(4)|skin(2)	6						c.(2488-2490)TAC>TGC		glutamate receptor, ionotropic, AMPA 1 isoform	Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						254.0	233.0	240.0					5																	153182019		2203	4300	6503	SO:0001583	missense	2890				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding	g.chr5:153182019A>G		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2489A>G	5.37:g.153182019A>G	ENSP00000285900:p.Tyr830Cys		Somatic				GRIA1_uc003luy.3_Missense_Mutation_p.Y830C|GRIA1_uc003luz.3_Missense_Mutation_p.Y735C|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.Y750C|GRIA1_uc011dcx.1_Missense_Mutation_p.Y761C|GRIA1_uc011dcy.1_Missense_Mutation_p.Y840C|GRIA1_uc011dcz.1_Missense_Mutation_p.Y840C	p.Y830C	NM_001114183	NP_001107655	WXS	Illumina HiSeq	Unspecified	P42261	GRIA1_HUMAN	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		15	2854	+		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	830			Cytoplasmic (Potential).		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	c.2489A>G	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.445984	0.84101	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.86239	0.5885	M	0.79693	2.465	0.80722	D	1	D;D;P;D;D	0.89917	0.997;0.997;0.6;0.998;1.0	P;P;B;D;D	0.75484	0.817;0.817;0.149;0.911;0.986	D	0.88272	0.2930	10	0.87932	D	0	.	14.559	0.68123	1.0:0.0:0.0:0.0	.	840;840;750;830;830	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	C	830;830;750;830;763;761;840;840	ENSP00000285900:Y830C;ENSP00000427920:Y750C;ENSP00000339343:Y830C;ENSP00000427864:Y763C;ENSP00000442108:Y761C;ENSP00000428994:Y840C;ENSP00000415569:Y840C	ENSP00000285900:Y830C	Y	+	2	0	GRIA1	153162212	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.069000	0.93967	2.036000	0.60181	0.533000	0.62120	TAC		0.532	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3			70	86	0	0	0	0.00361	0	70	86				
GALNT10	55568	broad.mit.edu	37	5	153789304	153789304	+	Silent	SNP	G	G	T	rs139278178	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:153789304G>T	ENST00000297107.6	+	9	1505	c.1368G>T	c.(1366-1368)ccG>ccT	p.P456P	SAP30L-AS1_ENST00000519727.1_RNA|GALNT10_ENST00000377661.2_Silent_p.P394P|GALNT10_ENST00000377657.3_Silent_p.P129P|SAP30L-AS1_ENST00000524264.1_RNA	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	456					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TGGAGCCCCCGGCTGCAGCTT	0.522																																							uc003lvh.2		NA																	0				skin(2)	2						c.(1366-1368)CCG>CCT		GalNAc transferase 10 isoform a							52.0	60.0	58.0					5																	153789304		2203	4300	6503	SO:0001819	synonymous_variant	55568					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr5:153789304G>T	AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.1368G>T	5.37:g.153789304G>T			Somatic				GALNT10_uc010jic.2_RNA|GALNT10_uc010jid.2_Silent_p.P297P|uc003lvi.2_Intron|GALNT10_uc003lvj.2_Silent_p.P127P	p.P456P	NM_198321	NP_938080	WXS	Illumina HiSeq	Unspecified	Q86SR1	GLT10_HUMAN	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)		9	1500	+	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	456			Lumenal (Potential).		B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Silent	SNP	ENST00000297107.6	37	c.1368G>T	CCDS4325.1																																																																																				0.522	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	NM_198321		44	56	1	0	3.21987e-24	0.00361	4.93776e-24	44	56				
KIF4B	285643	broad.mit.edu	37	5	154395457	154395457	+	Missense_Mutation	SNP	C	C	T	rs369199447		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:154395457C>T	ENST00000435029.4	+	1	2198	c.2038C>T	c.(2038-2040)Cgt>Tgt	p.R680C		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	680	Interaction with PRC1. {ECO:0000250}.		R -> H (in dbSNP:rs17116710). {ECO:0000269|PubMed:16201836}.		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGAACGAGACCGTAAGAGGCA	0.433																																							uc010jih.1		NA																	0				ovary(1)	1						c.(2038-2040)CGT>TGT		kinesin family member 4B		C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	128.0	131.0	130.0		2038	2.3	1.0	5		130	0,8600		0,0,4300	no	missense	KIF4B	NM_001099293.1	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	680/1235	154395457	1,13005	2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154395457C>T	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2038C>T	5.37:g.154395457C>T	ENSP00000387875:p.Arg680Cys		Somatic					p.R680C	NM_001099293	NP_001092763	WXS	Illumina HiSeq	Unspecified	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	2198	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	680			Interaction with PRC1 (By similarity).|Potential.			Missense_Mutation	SNP	ENST00000435029.4	37	c.2038C>T	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	c	15.20	2.762706	0.49574	2.27E-4	0.0	ENSG00000226650	ENST00000435029	T	0.22743	1.94	2.34	2.34	0.29019	.	.	.	.	.	T	0.47875	0.1469	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55186	-0.8180	9	0.87932	D	0	.	10.3246	0.43785	0.0:1.0:0.0:0.0	.	680	Q2VIQ3	KIF4B_HUMAN	C	680	ENSP00000387875:R680C	ENSP00000387875:R680C	R	+	1	0	KIF4B	154375650	0.963000	0.33076	0.963000	0.40424	0.748000	0.42578	1.466000	0.35310	1.330000	0.45394	0.563000	0.77884	CGT		0.433	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			47	59	0	0	0	0.00361	0	47	59				
SPDL1	54908	broad.mit.edu	37	5	169015423	169015423	+	Start_Codon_SNP	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:169015423G>T	ENST00000265295.4	+	2	282	c.3G>T	c.(1-3)atG>atT	p.M1I	SPDL1_ENST00000510751.1_3'UTR	NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		AAAAGAACATGGAGGCAGATA	0.343																																							uc003mae.3		NA																	0				ovary(1)|liver(1)	2						c.(1-3)ATG>ATT		coiled-coil domain containing 99							48.0	49.0	49.0					5																	169015423		2203	4300	6503	SO:0001582	initiator_codon_variant	54908				cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding	g.chr5:169015423G>T	BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.3G>T	5.37:g.169015423G>T	ENSP00000265295:p.Met1Ile		Somatic				CCDC99_uc010jjj.2_5'UTR|CCDC99_uc011deq.1_5'UTR|CCDC99_uc010jjk.2_5'UTR	p.M1I	NM_017785	NP_060255	WXS	Illumina HiSeq	Unspecified	Q96EA4	SPDLY_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		2	282	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	1						Missense_Mutation	SNP	ENST00000265295.4	37	c.3G>T	CCDS4370.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422210	0.62622	.	.	ENSG00000040275	ENST00000265295;ENST00000274631;ENST00000506574;ENST00000515224;ENST00000508247;ENST00000513941;ENST00000513795	T	0.38722	1.12	5.41	4.55	0.56014	.	0.267684	0.45867	D	0.000326	T	0.39759	0.1090	.	.	.	0.80722	D	1	P	0.42296	0.775	B	0.39660	0.306	T	0.36383	-0.9750	9	0.52906	T	0.07	-13.2741	14.304	0.66373	0.0716:0.0:0.9284:0.0	.	1	Q96EA4	SPDLY_HUMAN	I	1	ENSP00000265295:M1I	ENSP00000265295:M1I	M	+	3	0	CCDC99	168948001	1.000000	0.71417	1.000000	0.80357	0.352000	0.29268	4.262000	0.58847	1.426000	0.47256	0.655000	0.94253	ATG		0.343	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	Missense_Mutation	4	39	1	0	0.00024832	0.009096	0.000272685	4	39				
BTNL3	10917	broad.mit.edu	37	5	180419848	180419848	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr5:180419848C>A	ENST00000342868.6	+	2	269	c.85C>A	c.(85-87)Cag>Aag	p.Q29K		NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	29						integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			CAAGTTTGTCCAGGCCTTGGT	0.542																																							uc003mmr.2		NA																	0					0						c.(85-87)CAG>AAG		butyrophilin-like 3 precursor							84.0	75.0	78.0					5																	180419848		2088	3913	6001	SO:0001583	missense	10917				lipid metabolic process	integral to membrane		g.chr5:180419848C>A	AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192				10429365	Standard	NM_197975		Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.85C>A	5.37:g.180419848C>A	ENSP00000341787:p.Gln29Lys		Somatic					p.Q29K	NM_197975	NP_932079	WXS	Illumina HiSeq	Unspecified	Q6UXE8	BTNL3_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)		2	213	+	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	29			Extracellular (Potential).		Q496L7|Q9Y2C7	Missense_Mutation	SNP	ENST00000342868.6	37	c.85C>A	CCDS47358.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.456158	0.26161	.	.	ENSG00000168903	ENST00000342868;ENST00000376852	T	0.64803	-0.12	2.74	-0.951	0.10369	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.44726	0.1307	L	0.40543	1.245	0.09310	N	1	B	0.34372	0.451	B	0.33042	0.157	T	0.36114	-0.9761	9	0.52906	T	0.07	.	1.3642	0.02197	0.3923:0.3116:0.1678:0.1283	.	29	Q6UXE8	BTNL3_HUMAN	K	29	ENSP00000341787:Q29K	ENSP00000341787:Q29K	Q	+	1	0	BTNL3	180352454	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.086000	0.03386	-0.424000	0.07382	0.400000	0.26472	CAG		0.542	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367176.2	NM_197975		41	53	1	0	7.63091e-17	0.007835	1.09072e-16	41	53				
HUS1B	135458	broad.mit.edu	37	6	656832	656832	+	Missense_Mutation	SNP	C	C	A	rs528790996	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:656832C>A	ENST00000380907.2	-	1	131	c.113G>T	c.(112-114)aGc>aTc	p.S38I	EXOC2_ENST00000448181.3_Intron|EXOC2_ENST00000230449.4_Intron	NM_148959.3	NP_683762.2	Q8NHY5	HUS1B_HUMAN	HUS1 checkpoint homolog b (S. pombe)	38					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)	checkpoint clamp complex (GO:0030896)|nucleolus (GO:0005730)				endometrium(3)|large_intestine(1)|lung(7)	11	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)		GAAGCACAGGCTGTCAGGGCG	0.672																																							uc003mtg.2		NA																	0					0						c.(112-114)AGC>ATC		HUS1 checkpoint protein B							23.0	22.0	23.0					6																	656832		2201	4296	6497	SO:0001583	missense	135458							g.chr6:656832C>A	AF508547	CCDS4470.1	6p25.3	2008-08-08	2001-11-28		ENSG00000188996	ENSG00000188996			16485	protein-coding gene	gene with protein product		609713	"""HUS1 (S. pombe) checkpoint homolog b"""			11944979	Standard	NM_148959		Approved		uc003mtg.3	Q8NHY5	OTTHUMG00000090059	ENST00000380907.2:c.113G>T	6.37:g.656832C>A	ENSP00000370293:p.Ser38Ile		Somatic				EXOC2_uc003mtd.2_Intron|EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	p.S38I	NM_148959	NP_683762	WXS	Illumina HiSeq	Unspecified	Q8NHY5	HUS1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)	1	133	-	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)	38					Q5T4Z2	Missense_Mutation	SNP	ENST00000380907.2	37	c.113G>T	CCDS4470.1	.	.	.	.	.	.	.	.	.	.	C	9.897	1.205719	0.22205	.	.	ENSG00000188996	ENST00000380907	T	0.11604	2.76	2.63	-5.26	0.02772	.	0.607447	0.14478	U	0.317093	T	0.01523	0.0049	L	0.34521	1.04	0.09310	N	1	B	0.15141	0.012	B	0.20384	0.029	T	0.43458	-0.9390	10	0.37606	T	0.19	.	0.6717	0.00860	0.1912:0.278:0.145:0.3858	.	38	Q8NHY5	HUS1B_HUMAN	I	38	ENSP00000370293:S38I	ENSP00000370293:S38I	S	-	2	0	HUS1B	601832	0.175000	0.23083	0.000000	0.03702	0.002000	0.02628	0.062000	0.14389	-1.542000	0.01725	-0.339000	0.08088	AGC		0.672	HUS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205617.2	NM_148959		7	18	1	0	0.00198382	0.001984	0.00211661	7	18				
SLC22A23	63027	broad.mit.edu	37	6	3410511	3410511	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:3410511G>A	ENST00000406686.3	-	3	823	c.824C>T	c.(823-825)gCa>gTa	p.A275V	SLC22A23_ENST00000436008.2_Missense_Mutation_p.A275V|SLC22A23_ENST00000490273.1_5'UTR|SLC22A23_ENST00000380298.2_Missense_Mutation_p.A275V|SLC22A23_ENST00000380302.4_5'UTR	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	275					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				CACTGACAGTGCCACAGTCAG	0.468																																							uc003mvm.3		NA																	0				ovary(1)	1						c.(823-825)GCA>GTA		solute carrier family 22, member 23 isoform a							90.0	78.0	82.0					6																	3410511		2203	4300	6503	SO:0001583	missense	63027				ion transport	integral to membrane	transmembrane transporter activity	g.chr6:3410511G>A	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.824C>T	6.37:g.3410511G>A	ENSP00000385028:p.Ala275Val		Somatic				SLC22A23_uc003mvn.3_5'UTR|SLC22A23_uc003mvo.3_5'UTR|SLC22A23_uc003mvp.1_RNA|SLC22A23_uc010jnn.2_Missense_Mutation_p.A275V|SLC22A23_uc010jno.2_Missense_Mutation_p.A275V	p.A275V	NM_015482	NP_056297	WXS	Illumina HiSeq	Unspecified	A1A5C7	S22AN_HUMAN			3	824	-	Ovarian(93;0.0493)	all_hematologic(90;0.0905)	275			Helical; (Potential).		A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	37	c.824C>T	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	G	36	5.599821	0.96614	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000485307;ENST00000467177;ENST00000380298	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	5.17	5.17	0.71159	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.	.	.	.	T	0.76550	0.4003	M	0.76938	2.355	0.58432	D	0.999997	D;D	0.67145	0.996;0.978	D;D	0.76575	0.988;0.959	T	0.78677	-0.2111	9	0.56958	D	0.05	-7.9689	18.6697	0.91506	0.0:0.0:1.0:0.0	.	275;275	C9J4Z0;A1A5C7	.;S22AN_HUMAN	V	275;275;103;101;275	ENSP00000410245:A275V;ENSP00000385028:A275V;ENSP00000418134:A103V;ENSP00000418985:A101V;ENSP00000369653:A275V	ENSP00000369653:A275V	A	-	2	0	SLC22A23	3355510	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	9.272000	0.95707	2.421000	0.82119	0.563000	0.77884	GCA		0.468	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945		12	25	0	0	0	0.001368	0	12	25				
SLC22A23	63027	broad.mit.edu	37	6	3410527	3410527	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:3410527A>G	ENST00000406686.3	-	3	807	c.808T>C	c.(808-810)Ttt>Ctt	p.F270L	SLC22A23_ENST00000436008.2_Missense_Mutation_p.F270L|SLC22A23_ENST00000490273.1_5'UTR|SLC22A23_ENST00000380298.2_Missense_Mutation_p.F270L|SLC22A23_ENST00000380302.4_5'UTR	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	270					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				GTCAGTCCAAAGATCAGAATG	0.463																																							uc003mvm.3		NA																	0				ovary(1)	1						c.(808-810)TTT>CTT		solute carrier family 22, member 23 isoform a							81.0	71.0	75.0					6																	3410527		2203	4300	6503	SO:0001583	missense	63027				ion transport	integral to membrane	transmembrane transporter activity	g.chr6:3410527A>G	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.808T>C	6.37:g.3410527A>G	ENSP00000385028:p.Phe270Leu		Somatic				SLC22A23_uc003mvn.3_5'UTR|SLC22A23_uc003mvo.3_5'UTR|SLC22A23_uc003mvp.1_RNA|SLC22A23_uc010jnn.2_Missense_Mutation_p.F270L|SLC22A23_uc010jno.2_Missense_Mutation_p.F270L	p.F270L	NM_015482	NP_056297	WXS	Illumina HiSeq	Unspecified	A1A5C7	S22AN_HUMAN			3	808	-	Ovarian(93;0.0493)	all_hematologic(90;0.0905)	270			Helical; (Potential).		A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	37	c.808T>C	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	A	10.32	1.317116	0.23908	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000485307;ENST00000467177;ENST00000380298	T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;-0.82	5.3	4.13	0.48395	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.	.	.	.	T	0.62744	0.2453	N	0.25647	0.755	0.46874	D	0.999236	P;P	0.48764	0.915;0.915	P;P	0.54815	0.717;0.761	T	0.68496	-0.5393	9	0.66056	D	0.02	-4.9349	11.0002	0.47600	0.9267:0.0:0.0733:0.0	.	270;270	C9J4Z0;A1A5C7	.;S22AN_HUMAN	L	270;270;98;96;270	ENSP00000410245:F270L;ENSP00000385028:F270L;ENSP00000418134:F98L;ENSP00000418985:F96L;ENSP00000369653:F270L	ENSP00000369653:F270L	F	-	1	0	SLC22A23	3355526	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.770000	0.91746	0.866000	0.35629	-0.256000	0.11100	TTT		0.463	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945		10	23	0	0	0	0.006214	0	10	23				
BLOC1S5-TXNDC5	100526836	broad.mit.edu	37	6	7986935	7986935	+	Intron	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:7986935G>T	ENST00000439343.2	-	4	372				TXNDC5_ENST00000539054.1_Intron					BLOC1S5-TXNDC5 readthrough (NMD candidate)																		CCATCGAGGTGTCGATTCCTC	0.512																																							uc003mxx.3		NA																	0					0						c.(166-168)GTC>TTC		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																				SO:0001627	intron_variant	206426							g.chr6:7986935G>T			6p24.3	2013-05-09	2013-05-09	2012-08-01	ENSG00000259040	ENSG00000259040			42001	other	readthrough			"""MUTED-TXNDC5 readthrough (non-protein coding)"""	MUTED-TXNDC5			Standard	NR_037616		Approved				OTTHUMG00000171453	ENST00000439343.2:c.372+39664C>A	6.37:g.7986935G>T			Somatic				TXNDC5_uc003mxw.2_Intron	p.V56F	NR_027712		WXS	Illumina HiSeq	Unspecified					1	601	+									Missense_Mutation	SNP	ENST00000439343.2	37	c.166G>T																																																																																					0.512	BLOC1S5-TXNDC5-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000413472.1	NR_037616.1		7	44	1	0	1.06961e-07	0.00308	1.30235e-07	7	44				
HIVEP1	3096	broad.mit.edu	37	6	12125963	12125963	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:12125963G>T	ENST00000379388.2	+	4	6267	c.5935G>T	c.(5935-5937)Ggt>Tgt	p.G1979C	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1979					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				AAATCCACTCGGTTTGCCCAC	0.418																																							uc003nac.2		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(5935-5937)GGT>TGT		human immunodeficiency virus type I enhancer							112.0	109.0	110.0					6																	12125963		1872	4109	5981	SO:0001583	missense	3096				transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:12125963G>T	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.5935G>T	6.37:g.12125963G>T	ENSP00000368698:p.Gly1979Cys		Somatic				HIVEP1_uc011diq.1_RNA	p.G1979C	NM_002114	NP_002105	WXS	Illumina HiSeq	Unspecified	P15822	ZEP1_HUMAN			4	6114	+	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)	1979					B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	c.5935G>T	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348584	0.82132	.	.	ENSG00000095951	ENST00000379388	T	0.22336	1.96	6.07	5.2	0.72013	.	0.000000	0.37012	N	0.002292	T	0.43389	0.1245	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.53606	-0.8415	9	.	.	.	-21.8989	15.7673	0.78138	0.0655:0.0:0.9345:0.0	.	1979	P15822	ZEP1_HUMAN	C	1979	ENSP00000368698:G1979C	.	G	+	1	0	HIVEP1	12233949	1.000000	0.71417	0.946000	0.38457	0.973000	0.67179	6.788000	0.75105	1.569000	0.49696	0.655000	0.94253	GGT		0.418	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		58	54	1	0	2.23044e-30	0.00361	3.54444e-30	58	54				
HDGFL1	154150	broad.mit.edu	37	6	22570035	22570035	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:22570035G>T	ENST00000230012.3	+	1	358	c.231G>T	c.(229-231)gcG>gcT	p.A77A	HDGFL1_ENST00000510882.2_Silent_p.A77A	NM_138574.2	NP_612641.2	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	77										kidney(1)|large_intestine(3)|lung(7)	11	Ovarian(93;0.163)					GCTTCAGCGCGGGGCTGTGGG	0.647																																							uc003nds.2		NA																	0					0						c.(229-231)GCG>GCT		hepatoma derived growth factor-like 1							37.0	35.0	36.0					6																	22570035		2203	4300	6503	SO:0001819	synonymous_variant	154150							g.chr6:22570035G>T	AK056824	CCDS34347.1	6p22.2	2008-02-05	2005-04-07	2005-04-07	ENSG00000112273	ENSG00000112273			21095	protein-coding gene	gene with protein product			"""PWWP domain containing 1"""	PWWP1			Standard	NM_138574		Approved	dJ309H15.1	uc003nds.3	Q5TGJ6	OTTHUMG00000016206	ENST00000230012.3:c.231G>T	6.37:g.22570035G>T			Somatic					p.A77A	NM_138574	NP_612641	WXS	Illumina HiSeq	Unspecified	Q5TGJ6	HDGL1_HUMAN			1	358	+	Ovarian(93;0.163)		77					Q96MJ6	Silent	SNP	ENST00000230012.3	37	c.231G>T	CCDS34347.1																																																																																				0.647	HDGFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043500.1	NM_138574		6	15	1	0	3.59834e-05	0.001168	4.06164e-05	6	15				
PEX6	5190	broad.mit.edu	37	6	42934550	42934550	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:42934550C>A	ENST00000304611.8	-	9	2000	c.1931G>T	c.(1930-1932)cGg>cTg	p.R644L	PEX6_ENST00000244546.4_Missense_Mutation_p.R644L	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	644					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCAGGCTGCCCGGCTGCTGTG	0.577																																							uc003otf.2		NA																	0				ovary(1)	1						c.(1930-1932)CGG>CTG		peroxisomal biogenesis factor 6							189.0	189.0	189.0					6																	42934550		2203	4300	6503	SO:0001583	missense	5190				protein import into peroxisome matrix, translocation|protein stabilization	cytosol|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding	g.chr6:42934550C>A	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.1931G>T	6.37:g.42934550C>A	ENSP00000303511:p.Arg644Leu		Somatic				PEX6_uc010jya.2_RNA	p.R644L	NM_000287	NP_000278	WXS	Illumina HiSeq	Unspecified	Q13608	PEX6_HUMAN	all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)		9	2024	-			644					Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	ENST00000304611.8	37	c.1931G>T	CCDS4877.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452086	0.63290	.	.	ENSG00000124587	ENST00000304611;ENST00000244546	T;T	0.76709	-1.04;-1.04	5.35	5.35	0.76521	.	0.175592	0.51477	D	0.000084	T	0.39358	0.1075	N	0.11756	0.17	0.44295	D	0.997161	P	0.46952	0.887	B	0.40864	0.342	T	0.57757	-0.7756	10	0.02654	T	1	-20.2515	11.3632	0.49655	0.0:0.9156:0.0:0.0844	.	644	Q13608	PEX6_HUMAN	L	644	ENSP00000303511:R644L;ENSP00000244546:R644L	ENSP00000244546:R644L	R	-	2	0	PEX6	43042528	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	2.522000	0.45572	2.495000	0.84180	0.462000	0.41574	CGG		0.577	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287		100	180	1	0	1.54877e-32	0.00361	2.4913e-32	100	180				
COL21A1	81578	broad.mit.edu	37	6	55922555	55922556	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:55922555_55922556CC>AA	ENST00000244728.5	-	30	3170_3171	c.2773_2774GG>TT	c.(2773-2775)GGa>TTa	p.G925L	COL21A1_ENST00000535941.1_Missense_Mutation_p.G925L|COL21A1_ENST00000370819.1_Missense_Mutation_p.G922L|COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370808.2_Missense_Mutation_p.G291L	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	925	Collagen-like 7.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CCCTTGGATTCCAGGTTTTCCA	0.515																																							uc003pcs.2		NA																	0				ovary(2)	2						c.(2773-2775)GGA>TTA		collagen, type XXI, alpha 1 precursor																																				SO:0001583	missense	81578				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr6:55922555_55922556CC>AA	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2773_2774delinsAA	6.37:g.55922555_55922556delinsAA	ENSP00000244728:p.Gly925Leu		Somatic				COL21A1_uc010jzz.2_Missense_Mutation_p.G310L|COL21A1_uc011dxg.1_Missense_Mutation_p.G298L|COL21A1_uc011dxh.1_Missense_Mutation_p.G276L|COL21A1_uc003pcr.2_Missense_Mutation_p.G282L	p.G925L	NM_030820	NP_110447	WXS	Illumina HiSeq	Unspecified	Q96P44	COLA1_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)		30	3005_3006	-	Lung NSC(77;0.0483)		925					A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	DNP	ENST00000244728.5	37	c.2773_2774GG>TT	CCDS55025.1																																																																																				0.515	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2			9	13	0	0	0	0.004672	0	9	13				
PRIM2	5558	broad.mit.edu	37	6	57246828	57246828	+	Splice_Site	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:57246828G>T	ENST00000389488.2	+	7	642		c.e7-1		PRIM2_ENST00000607273.1_Splice_Site			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TCTTAATTCAGATCCCTTTTG	0.363																																							uc003pdx.2		NA																	0					0						c.e7-1		DNA primase polypeptide 2							126.0	105.0	112.0					6																	57246828		1912	4146	6058	SO:0001630	splice_region_variant	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57246828G>T		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.643-1G>T	6.37:g.57246828G>T			Somatic				PRIM2_uc003pdw.2_Splice_Site_p.I186_splice	p.I186_splice	NM_000947	NP_000938	WXS	Illumina HiSeq	Unspecified	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	7	643	+								Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Splice_Site	SNP	ENST00000389488.2	37	c.556_splice																																																																																					0.363	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947	Intron	5	30	1	0	0.00116845	0.001168	0.00125686	5	30				
PRIM2	5558	broad.mit.edu	37	6	57398165	57398165	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:57398165C>T	ENST00000607273.1	+	10	955	c.868C>T	c.(868-870)Cag>Tag	p.Q290*	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	290					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTACATGCATCAGTTACATAA	0.388																																							uc003pdx.2		NA																	0					0						c.(868-870)CAG>TAG		DNA primase polypeptide 2							272.0	248.0	256.0					6																	57398165		1922	4135	6057	SO:0001587	stop_gained	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57398165C>T		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.868C>T	6.37:g.57398165C>T	ENSP00000475738:p.Gln290*		Somatic					p.Q290*	NM_000947	NP_000938	WXS	Illumina HiSeq	Unspecified	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	10	955	+			290					Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Nonsense_Mutation	SNP	ENST00000607273.1	37	c.868C>T																																																																																					0.388	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947		49	101	0	0	0	0.00361	0	49	101				
TTK	7272	broad.mit.edu	37	6	80717571	80717571	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:80717571C>T	ENST00000369798.2	+	3	296	c.185C>T	c.(184-186)cCa>cTa	p.P62L	TTK_ENST00000230510.3_Missense_Mutation_p.P62L|TTK_ENST00000509894.1_Missense_Mutation_p.P62L	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	62					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		GCAAACAACCCAGAGGACTGG	0.348																																							uc003pjc.2		NA																	0				ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11						c.(184-186)CCA>CTA		TTK protein kinase							44.0	43.0	43.0					6																	80717571		2203	4300	6503	SO:0001583	missense	7272				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr6:80717571C>T		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.185C>T	6.37:g.80717571C>T	ENSP00000358813:p.Pro62Leu		Somatic				TTK_uc003pjb.3_Missense_Mutation_p.P62L	p.P62L	NM_003318	NP_003309	WXS	Illumina HiSeq	Unspecified	P33981	TTK_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0321)	3	259	+		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)	62					A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	c.185C>T	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901740	0.92035	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798;ENST00000502580;ENST00000511260;ENST00000504040	D;D;D;D;D;T	0.89196	-2.48;-2.48;-2.48;-2.48;-2.48;1.2	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.92606	0.7651	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.90211	0.4264	10	0.34782	T	0.22	.	19.1131	0.93326	0.0:1.0:0.0:0.0	.	62;62	P33981;A8K8U5	TTK_HUMAN;.	L	62	ENSP00000422936:P62L;ENSP00000230510:P62L;ENSP00000358813:P62L;ENSP00000424851:P62L;ENSP00000421636:P62L;ENSP00000427483:P62L	ENSP00000230510:P62L	P	+	2	0	TTK	80774290	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.350000	0.73017	2.832000	0.97577	0.655000	0.94253	CCA		0.348	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2			22	37	0	0	0	0.001882	0	22	37				
HTR1E	3354	broad.mit.edu	37	6	87725316	87725316	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:87725316G>T	ENST00000305344.5	+	2	967	c.264G>T	c.(262-264)tgG>tgT	p.W88C		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	88					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	TGGATCGCTGGAAGCTTGGGT	0.562																																							uc003pli.2		NA																	0				ovary(2)|skin(1)	3						c.(262-264)TGG>TGT		5-hydroxytryptamine (serotonin) receptor 1E	Eletriptan(DB00216)						156.0	134.0	141.0					6																	87725316		2203	4300	6503	SO:0001583	missense	3354				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity	g.chr6:87725316G>T		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.264G>T	6.37:g.87725316G>T	ENSP00000307766:p.Trp88Cys		Somatic					p.W88C	NM_000865	NP_000856	WXS	Illumina HiSeq	Unspecified	P28566	5HT1E_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.055)	2	967	+		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)	88			Extracellular (By similarity).		E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	c.264G>T	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.942230	0.53079	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.77877	-1.13;-1.13	4.57	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000016	D	0.91321	0.7263	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94504	0.7712	10	0.87932	D	0	.	17.3338	0.87274	0.0:0.0:1.0:0.0	.	88	P28566	5HT1E_HUMAN	C	88	ENSP00000307766:W88C;ENSP00000358597:W88C	ENSP00000307766:W88C	W	+	3	0	HTR1E	87782035	1.000000	0.71417	1.000000	0.80357	0.575000	0.36095	9.219000	0.95173	2.085000	0.62840	0.404000	0.27445	TGG		0.562	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865		21	86	1	0	7.45023e-12	0.010504	1.01261e-11	21	86				
ZNF292	23036	broad.mit.edu	37	6	87968813	87968813	+	Silent	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:87968813A>G	ENST00000369577.3	+	8	5509	c.5466A>G	c.(5464-5466)aaA>aaG	p.K1822K	ZNF292_ENST00000339907.4_Silent_p.K1817K	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1822						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TGCCAACAAAAAGTAACATTC	0.333																																							uc003plm.3		NA																	0				ovary(4)	4						c.(5464-5466)AAA>AAG		zinc finger protein 292							27.0	27.0	27.0					6																	87968813		1850	4087	5937	SO:0001819	synonymous_variant	23036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:87968813A>G	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.5466A>G	6.37:g.87968813A>G			Somatic					p.K1822K	NM_015021	NP_055836	WXS	Illumina HiSeq	Unspecified	O60281	ZN292_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0199)	8	5507	+		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)	1822					Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Silent	SNP	ENST00000369577.3	37	c.5466A>G	CCDS47457.1																																																																																				0.333	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021		18	12	0	0	0	0.00499	0	18	12				
KLHL32	114792	broad.mit.edu	37	6	97533105	97533105	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:97533105C>A	ENST00000369261.4	+	6	878	c.515C>A	c.(514-516)tCt>tAt	p.S172Y	KLHL32_ENST00000539200.1_Missense_Mutation_p.S103Y|KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000536676.1_Missense_Mutation_p.S136Y	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	172										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		AAACATCTCTCTGAACTCCTG	0.468																																							uc010kcm.1		NA																	0				ovary(3)|skin(1)	4						c.(514-516)TCT>TAT		kelch-like 32							107.0	105.0	106.0					6																	97533105		2203	4300	6503	SO:0001583	missense	114792							g.chr6:97533105C>A	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.515C>A	6.37:g.97533105C>A	ENSP00000358265:p.Ser172Tyr		Somatic				KLHL32_uc003poy.2_Missense_Mutation_p.S172Y|KLHL32_uc011ead.1_Missense_Mutation_p.S136Y|KLHL32_uc003poz.2_Intron|KLHL32_uc011eae.1_Missense_Mutation_p.S103Y|KLHL32_uc003ppa.2_RNA	p.S172Y	NM_052904	NP_443136	WXS	Illumina HiSeq	Unspecified	Q96NJ5	KLH32_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0558)	6	987	+		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)	172					B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	c.515C>A	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367963	0.82463	.	.	ENSG00000186231	ENST00000369255;ENST00000369261;ENST00000536676;ENST00000539200;ENST00000447886	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	6.01	5.15	0.70609	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.68100	0.2964	L	0.54323	1.7	0.80722	D	1	D;D;P;D	0.76494	0.998;0.999;0.461;0.999	D;D;B;D	0.87578	0.971;0.998;0.383;0.993	T	0.66642	-0.5872	10	0.14656	T	0.56	.	15.3796	0.74645	0.0:0.9332:0.0:0.0667	.	103;136;172;172	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	Y	98;172;136;103;68	ENSP00000358265:S172Y;ENSP00000440382:S136Y;ENSP00000441527:S103Y;ENSP00000389310:S68Y	ENSP00000358259:S98Y	S	+	2	0	KLHL32	97639826	1.000000	0.71417	0.893000	0.35052	0.991000	0.79684	5.592000	0.67543	1.546000	0.49388	0.655000	0.94253	TCT		0.468	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904		12	81	1	0	6.40141e-05	0.000978	7.16413e-05	12	81				
KLHL32	114792	broad.mit.edu	37	6	97562130	97562130	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:97562130A>G	ENST00000369261.4	+	7	1462	c.1099A>G	c.(1099-1101)Act>Gct	p.T367A	KLHL32_ENST00000539200.1_Missense_Mutation_p.T298A|KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000536676.1_Missense_Mutation_p.T331A	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	367										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TGCTGTGAGGACTGCCTGTCG	0.572																																							uc010kcm.1		NA																	0				ovary(3)|skin(1)	4						c.(1099-1101)ACT>GCT		kelch-like 32							85.0	77.0	80.0					6																	97562130		2203	4300	6503	SO:0001583	missense	114792							g.chr6:97562130A>G	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.1099A>G	6.37:g.97562130A>G	ENSP00000358265:p.Thr367Ala		Somatic				KLHL32_uc003poy.2_Missense_Mutation_p.T367A|KLHL32_uc011ead.1_Missense_Mutation_p.T331A|KLHL32_uc003poz.2_Intron|KLHL32_uc011eae.1_Missense_Mutation_p.T298A|KLHL32_uc003ppa.2_Intron	p.T367A	NM_052904	NP_443136	WXS	Illumina HiSeq	Unspecified	Q96NJ5	KLH32_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0558)	7	1571	+		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)	367			Kelch 2.		B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	c.1099A>G	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.055565	0.75960	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200	T;T;T	0.66815	-0.23;-0.23;-0.23	5.36	5.36	0.76844	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.72228	0.3434	L	0.49126	1.545	0.80722	D	1	P;D;P;D	0.69078	0.536;0.997;0.642;0.997	B;D;P;D	0.79108	0.299;0.992;0.667;0.962	T	0.75010	-0.3468	10	0.56958	D	0.05	.	15.522	0.75874	1.0:0.0:0.0:0.0	.	298;331;367;367	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	A	367;331;298	ENSP00000358265:T367A;ENSP00000440382:T331A;ENSP00000441527:T298A	ENSP00000358265:T367A	T	+	1	0	KLHL32	97668851	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.725000	0.91468	2.231000	0.72958	0.533000	0.62120	ACT		0.572	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904		27	20	0	0	0	0.004656	0	27	20				
BCLAF1	9774	broad.mit.edu	37	6	136599608	136599608	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:136599608C>T	ENST00000531224.1	-	4	663	c.411G>A	c.(409-411)agG>agA	p.R137R	BCLAF1_ENST00000530767.1_Silent_p.R137R|BCLAF1_ENST00000527759.1_Silent_p.R135R|BCLAF1_ENST00000353331.4_Silent_p.R135R|BCLAF1_ENST00000527536.1_Silent_p.R137R|BCLAF1_ENST00000392348.2_Silent_p.R135R	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	137					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ATCTTGGAGACCTAGAAGATC	0.443																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	0				ovary(1)	1						c.(409-411)AGG>AGA		BCL2-associated transcription factor 1 isoform							194.0	206.0	202.0					6																	136599608		2203	4300	6503	SO:0001819	synonymous_variant	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136599608C>T	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.411G>A	6.37:g.136599608C>T			Somatic				BCLAF1_uc003qgw.1_Silent_p.R137R|BCLAF1_uc003qgy.1_Silent_p.R135R|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Silent_p.R135R	p.R137R	NM_014739	NP_055554	WXS	Illumina HiSeq	Unspecified	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	4	664	-	Colorectal(23;0.24)		137					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Silent	SNP	ENST00000531224.1	37	c.411G>A	CCDS5177.1																																																																																				0.443	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		56	336	0	0	0	0.00361	0	56	336				
MLLT4	4301	broad.mit.edu	37	6	168281113	168281113	+	Silent	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:168281113A>T	ENST00000447894.2	+	6	813	c.813A>T	c.(811-813)acA>acT	p.T271T	MLLT4_ENST00000344191.4_Silent_p.T271T|MLLT4_ENST00000392108.3_Silent_p.T271T|MLLT4_ENST00000366806.2_Silent_p.T271T|MLLT4_ENST00000392112.1_Silent_p.T270T|MLLT4_ENST00000351017.4_Silent_p.T271T|MLLT4_ENST00000400822.3_Silent_p.T270T			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	271	Ras-associating 2. {ECO:0000255|PROSITE- ProRule:PRU00166}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TGTCTACTACAGATCCTGCAG	0.393			T	MLL	AL																																		uc003qwd.2		NA		Dom	yes		6	6q27	4301	T	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""			L	MLL		AL		0				ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5						c.(808-810)ACA>ACT		myeloid/lymphoid or mixed-lineage leukemia							144.0	155.0	151.0					6																	168281113		2203	4296	6499	SO:0001819	synonymous_variant	4301				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding	g.chr6:168281113A>T	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.813A>T	6.37:g.168281113A>T			Somatic				MLLT4_uc003qwb.1_Silent_p.T270T|MLLT4_uc003qwc.1_Silent_p.T271T|MLLT4_uc003qwf.2_5'UTR	p.T270T	NM_001040001	NP_001035090	WXS	Illumina HiSeq	Unspecified	P55196	AFAD_HUMAN		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)	6	952	+		Breast(66;1.07e-05)|Ovarian(120;0.024)	271			Ras-associating 2.		O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Silent	SNP	ENST00000447894.2	37	c.810A>T																																																																																					0.393	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936		38	144	0	0	0	0.004878	0	38	144				
THBS2	7058	broad.mit.edu	37	6	169622404	169622404	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr6:169622404G>T	ENST00000366787.3	-	20	3410	c.3161C>A	c.(3160-3162)cCc>cAc	p.P1054H	XXyac-YX65C7_A.2_ENST00000444188.1_RNA|THBS2_ENST00000488355.1_5'UTR	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	1054	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GGCCCGCGTGGGCTGGTCCTC	0.627																																					Esophageal Squamous(91;219 1934 18562 44706)	Esophageal Squamous(91;219 1934 18562 44706)	uc003qwt.2		NA																	0				ovary(5)	5						c.(3160-3162)CCC>CAC		thrombospondin 2 precursor							57.0	50.0	52.0					6																	169622404		2202	4300	6502	SO:0001583	missense	7058				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity	g.chr6:169622404G>T		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.3161C>A	6.37:g.169622404G>T	ENSP00000355751:p.Pro1054His		Somatic					p.P1054H	NM_003247	NP_003238	WXS	Illumina HiSeq	Unspecified	P35442	TSP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)	20	3409	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	1054			TSP C-terminal.		A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	c.3161C>A	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805189	0.70682	.	.	ENSG00000186340	ENST00000366787;ENST00000392099	D	0.97232	-4.3	4.32	4.32	0.51571	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.40908	U	0.001000	D	0.98425	0.9476	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.99808	1.1039	10	0.87932	D	0	-32.9557	16.8272	0.85934	0.0:0.0:1.0:0.0	.	1054	P35442	TSP2_HUMAN	H	1054;312	ENSP00000355751:P1054H	ENSP00000355751:P1054H	P	-	2	0	THBS2	169364329	1.000000	0.71417	1.000000	0.80357	0.520000	0.34377	9.166000	0.94766	1.948000	0.56530	0.297000	0.19635	CCC		0.627	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		19	21	1	0	6.49762e-13	0.006122	8.94698e-13	19	21				
FERD3L	222894	broad.mit.edu	37	7	19184873	19184873	+	Missense_Mutation	SNP	G	G	C	rs377664801		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:19184873G>C	ENST00000275461.3	-	1	171	c.113C>G	c.(112-114)tCc>tGc	p.S38C	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	38					cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						GTCCCCCAAGGAGACCCCGGG	0.662																																							uc003suo.1		NA																	0				large_intestine(1)	1						c.(112-114)TCC>TGC		nephew of atonal 3							41.0	37.0	38.0					7																	19184873		2203	4299	6502	SO:0001583	missense	222894				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr7:19184873G>C	AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.113C>G	7.37:g.19184873G>C	ENSP00000275461:p.Ser38Cys		Somatic				uc003sun.1_RNA	p.S38C	NM_152898	NP_690862	WXS	Illumina HiSeq	Unspecified	Q96RJ6	FER3L_HUMAN			1	172	-			38					Q495K0	Missense_Mutation	SNP	ENST00000275461.3	37	c.113C>G	CCDS5368.1	.	.	.	.	.	.	.	.	.	.	G	8.786	0.929421	0.18131	.	.	ENSG00000146618	ENST00000275461	D	0.96802	-4.13	5.39	3.5	0.40072	.	1.833080	0.02305	N	0.071552	D	0.93374	0.7887	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.82733	-0.0311	10	0.62326	D	0.03	-23.7132	12.0048	0.53252	0.0:0.1318:0.7311:0.1371	.	38	Q96RJ6	FER3L_HUMAN	C	38	ENSP00000275461:S38C	ENSP00000275461:S38C	S	-	2	0	FERD3L	19151398	0.003000	0.15002	0.088000	0.20740	0.013000	0.08279	1.273000	0.33121	0.583000	0.29574	0.650000	0.86243	TCC		0.662	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207627.1			24	51	0	0	0	0.005443	0	24	51				
FAM221A	340277	broad.mit.edu	37	7	23731012	23731012	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:23731012C>G	ENST00000344962.4	+	4	523	c.434C>G	c.(433-435)tCc>tGc	p.S145C	FAM221A_ENST00000409994.3_Missense_Mutation_p.S87C|FAM221A_ENST00000409653.1_Missense_Mutation_p.S87C|FAM221A_ENST00000409192.3_Missense_Mutation_p.S145C	NM_199136.3	NP_954587.2	A4D161	F221A_HUMAN	family with sequence similarity 221, member A	145																	GATTCAGGTTCCAAGTGTTCA	0.438																																							uc003swo.3		NA																	0					0						c.(433-435)TCC>TGC		hypothetical protein LOC340277 isoform 1							129.0	119.0	123.0					7																	23731012		2203	4300	6503	SO:0001583	missense	340277							g.chr7:23731012C>G		CCDS5385.1, CCDS47561.1, CCDS47562.1, CCDS75570.1	7p15.3	2012-04-02	2012-04-02	2012-04-02	ENSG00000188732	ENSG00000188732			27977	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 46"""	C7orf46		12477932	Standard	XR_242080		Approved	FLJ45875, MGC72075, DKFZp686F0810	uc003swo.4	A4D161	OTTHUMG00000128463	ENST00000344962.4:c.434C>G	7.37:g.23731012C>G	ENSP00000342576:p.Ser145Cys		Somatic				C7orf46_uc003swq.3_Missense_Mutation_p.S145C|C7orf46_uc003swr.3_Missense_Mutation_p.S87C|C7orf46_uc003swp.3_RNA|C7orf46_uc010kup.2_RNA	p.S145C	NM_199136	NP_954587	WXS	Illumina HiSeq	Unspecified	A4D161	CG046_HUMAN			4	523	+			145					Q05CG4|Q4G0Q7|Q6P519	Missense_Mutation	SNP	ENST00000344962.4	37	c.434C>G	CCDS5385.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849592	0.32699	.	.	ENSG00000188732	ENST00000409192;ENST00000344962;ENST00000409653;ENST00000409994	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.46	4.54	0.55810	.	0.396079	0.28971	N	0.013558	T	0.10680	0.0261	N	0.03881	-0.34	0.37704	D	0.924337	B;B;B	0.21071	0.051;0.007;0.016	B;B;B	0.20955	0.023;0.015;0.032	T	0.20472	-1.0274	10	0.26408	T	0.33	-10.755	15.6382	0.76973	0.1377:0.8623:0.0:0.0	.	87;145;145	A4D161-3;A4D161-2;A4D161	.;.;CG046_HUMAN	C	145;145;87;87	ENSP00000386927:S145C;ENSP00000342576:S145C;ENSP00000386900:S87C;ENSP00000386631:S87C	ENSP00000342576:S145C	S	+	2	0	C7orf46	23697537	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.384000	0.44362	2.567000	0.86603	0.467000	0.42956	TCC		0.438	FAM221A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250261.1	NM_199136		52	113	0	0	0	0.00361	0	52	113				
NEUROD6	63974	broad.mit.edu	37	7	31378046	31378046	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:31378046C>T	ENST00000297142.3	-	2	1159	c.837G>A	c.(835-837)ttG>ttA	p.L279L		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	279					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						TACCATAGTCCAAGGTTTCTT	0.507																																							uc003tch.2		NA																	0				ovary(2)	2						c.(835-837)TTG>TTA		neurogenic differentiation 6							88.0	87.0	87.0					7																	31378046		2203	4300	6503	SO:0001819	synonymous_variant	63974				cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr7:31378046C>T	AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.837G>A	7.37:g.31378046C>T			Somatic					p.L279L	NM_022728	NP_073565	WXS	Illumina HiSeq	Unspecified	Q96NK8	NDF6_HUMAN			2	1190	-			279					Q548T9|Q9H3H6	Silent	SNP	ENST00000297142.3	37	c.837G>A	CCDS5434.1																																																																																				0.507	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728		7	67	0	0	0	0.001984	0	7	67				
GLI3	2737	broad.mit.edu	37	7	42005160	42005160	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:42005160C>A	ENST00000395925.3	-	15	3595	c.3511G>T	c.(3511-3513)Gac>Tac	p.D1171Y	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1171					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GAGGACAGGTCGGCGCTTCCG	0.667									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																														uc011kbh.1		NA																	0				lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						c.(3511-3513)GAC>TAC		GLI-Kruppel family member GLI3							82.0	99.0	93.0					7																	42005160		2200	4294	6494	SO:0001583	missense	2737	Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome	Familial Cancer Database	;	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:42005160C>A		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3511G>T	7.37:g.42005160C>A	ENSP00000379258:p.Asp1171Tyr		Somatic				GLI3_uc011kbg.1_Missense_Mutation_p.D1112Y	p.D1171Y	NM_000168	NP_000159	WXS	Illumina HiSeq	Unspecified	P10071	GLI3_HUMAN			15	3602	-			1171					A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	c.3511G>T	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669703	0.67814	.	.	ENSG00000106571	ENST00000395925	T	0.29142	1.58	5.67	4.79	0.61399	.	0.216909	0.56097	D	0.000040	T	0.49745	0.1575	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.51849	-0.8653	10	0.66056	D	0.02	.	14.7865	0.69808	0.0:0.9307:0.0:0.0693	.	1171	P10071	GLI3_HUMAN	Y	1171	ENSP00000379258:D1171Y	ENSP00000379258:D1171Y	D	-	1	0	GLI3	41971685	1.000000	0.71417	0.516000	0.27786	0.470000	0.32858	7.759000	0.85235	1.392000	0.46585	0.563000	0.77884	GAC		0.667	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		30	183	1	0	3.73148e-12	0.007291	5.08486e-12	30	183				
MYL7	58498	broad.mit.edu	37	7	44179170	44179170	+	Splice_Site	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:44179170T>A	ENST00000223364.3	-	6	404		c.e6-2		MYL7_ENST00000434895.1_5'UTR|MYL7_ENST00000458240.1_Splice_Site	NM_021223.2	NP_067046.1	Q01449	MLRA_HUMAN	myosin, light chain 7, regulatory							A band (GO:0031672)|dendritic spine (GO:0043197)|myosin complex (GO:0016459)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	12						TGCTTGAACCTGGGGGGTGAG	0.632																																							uc003tkg.2		NA																	0					0						c.e6-1		myosin light chain 2a							79.0	73.0	75.0					7																	44179170		2203	4300	6503	SO:0001630	splice_region_variant	58498				actin filament-based movement|smooth muscle contraction	A band|myosin complex	ATPase activity, coupled|calcium ion binding|microfilament motor activity	g.chr7:44179170T>A	M94547	CCDS5478.1	7p21-p11.2	2013-01-10	2006-09-29		ENSG00000106631	ENSG00000106631		"""Myosins / Light chain"", ""EF-hand domain containing"""	21719	protein-coding gene	gene with protein product		613993	"""myosin, light polypeptide 7, regulatory"""			8207020	Standard	NM_021223		Approved	MYLC2A, MYL2A	uc003tkg.3	Q01449	OTTHUMG00000023125	ENST00000223364.3:c.378-2A>T	7.37:g.44179170T>A			Somatic					p.E126_splice	NM_021223	NP_067046	WXS	Illumina HiSeq	Unspecified	Q01449	MLRA_HUMAN			6	390	-								B2R4L3	Splice_Site	SNP	ENST00000223364.3	37	c.378_splice	CCDS5478.1	.	.	.	.	.	.	.	.	.	.	t	16.97	3.269267	0.59540	.	.	ENSG00000106631	ENST00000446581;ENST00000223364;ENST00000458240;ENST00000457314;ENST00000447951	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4374	0.61092	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYL7	44145695	1.000000	0.71417	0.993000	0.49108	0.694000	0.40290	5.219000	0.65262	1.827000	0.53221	0.533000	0.62120	.		0.632	MYL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059446.4	NM_021223	Intron	18	104	0	0	0	0.001882	0	18	104				
C7orf69	80099	broad.mit.edu	37	7	47857769	47857769	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:47857769T>A	ENST00000258776.4	+	2	299	c.254T>A	c.(253-255)aTg>aAg	p.M85K	PKD1L1_ENST00000289672.2_Intron|C7orf69_ENST00000418326.2_Missense_Mutation_p.M66K	NM_025031.2	NP_079307.2	Q9H7B7	CG069_HUMAN	chromosome 7 open reading frame 69	85						extracellular region (GO:0005576)				lung(2)	2						AGAACACAGATGGAGACAGAG	0.488																																							uc003tnz.3		NA																	0					0						c.(253-255)ATG>AAG		hypothetical protein LOC80099 precursor							59.0	57.0	58.0					7																	47857769		1996	4175	6171	SO:0001583	missense	80099					extracellular region		g.chr7:47857769T>A	BC113681	CCDS43581.1	7p12	2011-12-09			ENSG00000136275	ENSG00000136275			21911	protein-coding gene	gene with protein product							Standard	NM_025031		Approved	FLJ21075	uc003tnz.4	Q9H7B7	OTTHUMG00000155648	ENST00000258776.4:c.254T>A	7.37:g.47857769T>A	ENSP00000258776:p.Met85Lys		Somatic				PKD1L1_uc003tny.1_Intron|C7orf69_uc003toa.1_Intron|PKD1L1_uc003tob.2_Intron	p.M85K	NM_025031	NP_079307	WXS	Illumina HiSeq	Unspecified	Q9H7B7	CG069_HUMAN			2	299	+			85					A4D2F1|Q14CN7|Q75MJ5	Missense_Mutation	SNP	ENST00000258776.4	37	c.254T>A	CCDS43581.1	.	.	.	.	.	.	.	.	.	.	T	1.377	-0.584597	0.03827	.	.	ENSG00000136275	ENST00000258776;ENST00000418326	T	0.50548	0.74	2.43	-4.85	0.03142	.	.	.	.	.	T	0.19167	0.0460	N	0.19112	0.55	0.09310	N	1	B	0.17667	0.023	B	0.09377	0.004	T	0.34850	-0.9812	9	0.05351	T	0.99	.	0.8845	0.01241	0.4627:0.2076:0.1566:0.1731	.	85	Q9H7B7	CG069_HUMAN	K	85;66	ENSP00000258776:M85K	ENSP00000258776:M85K	M	+	2	0	C7orf69	47824294	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.448000	0.06820	-2.212000	0.00736	0.379000	0.24179	ATG		0.488	C7orf69-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340973.1	NM_025031		4	36	0	0	0	0.000602	0	4	36				
PKD1L1	168507	broad.mit.edu	37	7	47913531	47913531	+	Missense_Mutation	SNP	G	G	T	rs374546648		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:47913531G>T	ENST00000289672.2	-	24	3912	c.3862C>A	c.(3862-3864)Cgc>Agc	p.R1288S		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1288	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CCATGGTAGCGGGGCAGCACA	0.512																																							uc003tny.1		NA																	0		p.R1288H(1)		ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(3862-3864)CGC>AGC		polycystin-1L1							127.0	104.0	112.0					7																	47913531		2203	4300	6503	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47913531G>T	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.3862C>A	7.37:g.47913531G>T	ENSP00000289672:p.Arg1288Ser		Somatic					p.R1288S	NM_138295	NP_612152	WXS	Illumina HiSeq	Unspecified	Q8TDX9	PK1L1_HUMAN			24	3862	-			1288			Extracellular (Potential).|REJ.		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.3862C>A	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.514609	0.27123	.	.	ENSG00000158683	ENST00000289672	T	0.69175	-0.38	4.54	1.46	0.22682	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.977247	0.08328	N	0.962716	T	0.49474	0.1559	L	0.33485	1.01	0.09310	N	0.999999	P	0.35242	0.492	B	0.34991	0.193	T	0.35624	-0.9781	10	0.21540	T	0.41	-0.5538	3.435	0.07442	0.2074:0.0:0.4931:0.2994	.	1288	Q8TDX9	PK1L1_HUMAN	S	1288	ENSP00000289672:R1288S	ENSP00000289672:R1288S	R	-	1	0	PKD1L1	47880056	0.008000	0.16893	0.552000	0.28243	0.631000	0.37964	0.199000	0.17237	0.603000	0.29913	-0.251000	0.11542	CGC		0.512	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		6	71	1	0	1.06961e-07	0.00308	1.30235e-07	6	71				
PKD1L1	168507	broad.mit.edu	37	7	47955083	47955083	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:47955083C>G	ENST00000289672.2	-	8	1224	c.1174G>C	c.(1174-1176)Gaa>Caa	p.E392Q		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	392					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						tctgagtcttccaggcagctg	0.393																																							uc003tny.1		NA																	0				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(1174-1176)GAA>CAA		polycystin-1L1							111.0	105.0	107.0					7																	47955083		2203	4300	6503	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47955083C>G	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1174G>C	7.37:g.47955083C>G	ENSP00000289672:p.Glu392Gln		Somatic					p.E392Q	NM_138295	NP_612152	WXS	Illumina HiSeq	Unspecified	Q8TDX9	PK1L1_HUMAN			8	1174	-			392			Extracellular (Potential).		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.1174G>C	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	C	0.622	-0.820843	0.02755	.	.	ENSG00000158683	ENST00000289672	T	0.24151	1.87	0.391	-0.629	0.11533	.	2587.450000	0.00166	U	0.000000	T	0.11324	0.0276	N	0.08118	0	0.09310	N	1	B	0.31931	0.347	B	0.18561	0.022	T	0.08932	-1.0698	9	0.33141	T	0.24	.	.	.	.	.	392	Q8TDX9	PK1L1_HUMAN	Q	392	ENSP00000289672:E392Q	ENSP00000289672:E392Q	E	-	1	0	PKD1L1	47921608	0.034000	0.19679	0.022000	0.16811	0.230000	0.25150	0.305000	0.19254	-0.396000	0.07703	-0.384000	0.06662	GAA		0.393	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		16	118	0	0	0	0.004007	0	16	118				
ABCA13	154664	broad.mit.edu	37	7	48411901	48411901	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:48411901C>T	ENST00000435803.1	+	33	10964	c.10940C>T	c.(10939-10941)aCc>aTc	p.T3647I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3647					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CACAGCAATACCTTTATTGTT	0.468																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(10939-10941)ACC>ATC		ATP binding cassette, sub-family A (ABC1),							283.0	278.0	280.0					7																	48411901		2047	4202	6249	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48411901C>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.10940C>T	7.37:g.48411901C>T	ENSP00000411096:p.Thr3647Ile		Somatic				ABCA13_uc010kys.1_Missense_Mutation_p.T721I|ABCA13_uc003tos.1_Missense_Mutation_p.T473I	p.T3647I	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			33	10965	+			3647					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.10940C>T	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.391473	0.25118	.	.	ENSG00000179869	ENST00000435803	D	0.86432	-2.12	5.77	4.89	0.63831	.	0.127459	0.35495	N	0.003174	T	0.76162	0.3949	N	0.08118	0	0.51482	D	0.999927	B;B	0.20887	0.001;0.049	B;B	0.18871	0.001;0.023	T	0.72465	-0.4285	10	0.49607	T	0.09	.	14.9987	0.71455	0.0:0.6086:0.3914:0.0	.	1349;3647	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	I	3647	ENSP00000411096:T3647I	ENSP00000411096:T3647I	T	+	2	0	ABCA13	48382447	0.613000	0.27009	0.046000	0.18839	0.640000	0.38277	1.266000	0.33039	1.575000	0.49775	-0.150000	0.13652	ACC		0.468	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		9	202	0	0	0	0.004482	0	9	202				
ZPBP	11055	broad.mit.edu	37	7	50070791	50070791	+	Silent	SNP	C	C	A	rs368068090		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:50070791C>A	ENST00000046087.2	-	5	672	c.603G>T	c.(601-603)ctG>ctT	p.L201L	ZPBP_ENST00000491129.1_Intron|ZPBP_ENST00000419417.1_Silent_p.L200L	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	201					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					GGTCAAGAAGCAGTTTGCTTA	0.333																																							uc003tou.2		NA																	0					0						c.(601-603)CTG>CTT		zona pellucida binding protein isoform 1		C	,	0,4406		0,0,2203	66.0	70.0	69.0		600,603	2.3	1.0	7		69	1,8597		0,1,4298	no	coding-synonymous,coding-synonymous	ZPBP	NM_001159878.1,NM_007009.2	,	0,1,6501	AA,AC,CC		0.0116,0.0,0.0077	,	200/351,201/352	50070791	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	11055				binding of sperm to zona pellucida	extracellular region		g.chr7:50070791C>A	D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.603G>T	7.37:g.50070791C>A			Somatic				ZPBP_uc011kci.1_Silent_p.L127L|ZPBP_uc010kyw.2_Silent_p.L200L	p.L201L	NM_007009	NP_008940	WXS	Illumina HiSeq	Unspecified	Q9BS86	ZPBP1_HUMAN			5	673	-	Glioma(55;0.08)|all_neural(89;0.245)		201					A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Silent	SNP	ENST00000046087.2	37	c.603G>T	CCDS5509.1																																																																																				0.333	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251374.1	NM_007009		19	68	1	0	1.67942e-08	0.006122	2.08343e-08	19	68				
DDC	1644	broad.mit.edu	37	7	50547497	50547497	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:50547497G>T	ENST00000444124.2	-	10	1209	c.1009C>A	c.(1009-1011)Cat>Aat	p.H337N	DDC_ENST00000431062.1_Missense_Mutation_p.H244N|DDC_ENST00000426377.1_Missense_Mutation_p.H259N|DDC_ENST00000357936.5_Missense_Mutation_p.H337N	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	337					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	GAATCCTGATGGCTGTGCTTC	0.507																																							uc003tpf.3		NA																	0				ovary(2)	2						c.(1009-1011)CAT>AAT		dopa decarboxylase (aromatic L-amino acid	Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)						208.0	186.0	193.0					7																	50547497		2203	4300	6503	SO:0001583	missense	1644				cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding	g.chr7:50547497G>T		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.1009C>A	7.37:g.50547497G>T	ENSP00000403644:p.His337Asn		Somatic				DDC_uc010kza.2_Missense_Mutation_p.H252N|DDC_uc003tpg.3_Missense_Mutation_p.H337N	p.H337N	NM_000790	NP_000781	WXS	Illumina HiSeq	Unspecified	P20711	DDC_HUMAN			10	1095	-	Glioma(55;0.08)|all_neural(89;0.245)		337					C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	ENST00000444124.2	37	c.1009C>A	CCDS5511.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.800061	0.50208	.	.	ENSG00000132437	ENST00000357936;ENST00000431062;ENST00000426377;ENST00000444124	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.91	4.96	0.65561	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.184499	0.64402	D	0.000020	T	0.18800	0.0451	N	0.05574	-0.02	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.23018	0.043;0.043	T	0.10543	-1.0625	10	0.18710	T	0.47	-28.4894	10.5809	0.45255	0.0772:0.0:0.7784:0.1444	.	337;337	Q53Y41;P20711	.;DDC_HUMAN	N	337;244;259;337	ENSP00000350616:H337N;ENSP00000399184:H244N;ENSP00000395069:H259N;ENSP00000403644:H337N	ENSP00000350616:H337N	H	-	1	0	DDC	50514991	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.321000	0.59209	2.808000	0.96608	0.655000	0.94253	CAT		0.507	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1			13	123	1	0	4.36969e-10	0.001855	5.6752e-10	13	123				
MRPS17	51373	broad.mit.edu	37	7	56022736	56022736	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:56022736C>T	ENST00000285298.4	+	3	387	c.258C>T	c.(256-258)ttC>ttT	p.F86F	MRPS17_ENST00000426595.1_Silent_p.F181F	NM_015969.2	NP_057053.1	Q9Y2R5	RT17_HUMAN	mitochondrial ribosomal protein S17	86					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	8	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AGATCGTTTTCAAAGTTGGAA	0.478																																							uc003trd.2		NA																	0					0						c.(256-258)TTC>TTT		mitochondrial ribosomal protein S17 precursor							121.0	121.0	121.0					7																	56022736		2203	4300	6503	SO:0001819	synonymous_variant	51373				translation	mitochondrial small ribosomal subunit	rRNA binding|structural constituent of ribosome	g.chr7:56022736C>T	AB051352	CCDS5520.1	7p11-q11.21	2012-09-13			ENSG00000239789	ENSG00000239789		"""Mitochondrial ribosomal proteins / small subunits"""	14047	protein-coding gene	gene with protein product	"""28S ribosomal protein S17, mitochondrial"""	611980				11279123	Standard	NM_015969		Approved	HSPC011, RPMS17, MRP-S17	uc003trd.3	Q9Y2R5	OTTHUMG00000023153	ENST00000285298.4:c.258C>T	7.37:g.56022736C>T			Somatic				MRPS17_uc003trb.2_Silent_p.F181F	p.F86F	NM_015969	NP_057053	WXS	Illumina HiSeq	Unspecified	Q9Y2R5	RT17_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		3	288	+	Breast(14;0.214)		86					Q86X15	Silent	SNP	ENST00000285298.4	37	c.258C>T	CCDS5520.1																																																																																				0.478	MRPS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251527.2	NM_015969		22	207	0	0	0	0.002299	0	22	207				
ZNF716	441234	broad.mit.edu	37	7	57529061	57529061	+	Silent	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:57529061T>C	ENST00000420713.1	+	4	1006	c.894T>C	c.(892-894)tgT>tgC	p.C298C		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	298					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						CCTACACATGTGAAGAATGTG	0.423																																							uc011kdi.1		NA																	0				ovary(2)	2						c.(892-894)TGT>TGC		zinc finger protein 716							38.0	38.0	38.0					7																	57529061		692	1591	2283	SO:0001819	synonymous_variant	441234							g.chr7:57529061T>C	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.894T>C	7.37:g.57529061T>C			Somatic					p.C298C	NM_001159279	NP_001152751	WXS	Illumina HiSeq	Unspecified					4	1006	+									Silent	SNP	ENST00000420713.1	37	c.894T>C	CCDS55112.1																																																																																				0.423	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		14	27	0	0	0	0.001855	0	14	27				
CACNA2D1	781	broad.mit.edu	37	7	81598227	81598227	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:81598227G>T	ENST00000356253.5	-	29	2662	c.2407C>A	c.(2407-2409)Caa>Aaa	p.Q803K	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.Q791K|CACNA2D1_ENST00000535308.1_Intron			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	803					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	AGTTTCCCTTGAATATATATT	0.289																																							uc003uhr.1		NA																	0				ovary(5)|pancreas(1)	6						c.(2371-2373)CAA>AAA		calcium channel, voltage-dependent, alpha	Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)						92.0	100.0	97.0					7																	81598227		2203	4293	6496	SO:0001583	missense	781					voltage-gated calcium channel complex	metal ion binding	g.chr7:81598227G>T	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2407C>A	7.37:g.81598227G>T	ENSP00000348589:p.Gln803Lys		Somatic				CACNA2D1_uc011kgy.1_Intron	p.Q791K	NM_000722	NP_000713	WXS	Illumina HiSeq	Unspecified	P54289	CA2D1_HUMAN			29	2627	-			803			Extracellular (Potential).		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37	c.2371C>A		.	.	.	.	.	.	.	.	.	.	G	13.13	2.145725	0.37923	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	T;T	0.69435	-0.4;-0.4	5.07	3.14	0.36123	.	0.210392	0.49916	D	0.000136	T	0.39172	0.1068	N	0.08118	0	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.24512	-1.0158	10	0.18276	T	0.48	-13.3475	7.1271	0.25477	0.0:0.2494:0.4229:0.3277	.	791	P54289-2	.	K	791;810;803	ENSP00000349320:Q791K;ENSP00000348589:Q803K	ENSP00000284088:Q810K	Q	-	1	0	CACNA2D1	81436163	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.467000	0.35321	2.518000	0.84900	0.484000	0.47621	CAA		0.289	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				12	98	1	0	0.00400662	0.004007	0.00425754	12	98				
PCLO	27445	broad.mit.edu	37	7	82451886	82451886	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:82451886G>C	ENST00000333891.9	-	20	15053	c.14716C>G	c.(14716-14718)Cag>Gag	p.Q4906E	PCLO_ENST00000423517.2_Missense_Mutation_p.Q4906E|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGGTGGGTCTGAGTGACGCTG	0.498																																							uc003uhx.2		NA																	0				ovary(7)	7						c.(14716-14718)CAG>GAG		piccolo isoform 1							180.0	194.0	190.0					7																	82451886		2086	4219	6305	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82451886G>C	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14716C>G	7.37:g.82451886G>C	ENSP00000334319:p.Gln4906Glu		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.Q4906E|PCLO_uc003uht.1_Missense_Mutation_p.Q348E|PCLO_uc003uhu.1_Missense_Mutation_p.Q327E	p.Q4906E	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			20	15005	-			4768						Missense_Mutation	SNP	ENST00000333891.9	37	c.14716C>G	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102779	0.56183	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.17528	2.31;2.27	5.35	5.35	0.76521	.	.	.	.	.	T	0.28101	0.0693	N	0.19112	0.55	0.80722	D	1	D;D;P;B	0.69078	0.997;0.997;0.571;0.435	D;D;B;B	0.64042	0.921;0.921;0.291;0.152	T	0.08617	-1.0713	9	0.87932	D	0	.	19.0582	0.93076	0.0:0.0:1.0:0.0	.	4906;4906;327;394	Q9Y6V0-5;Q9Y6V0-6;Q9Y6V0-3;Q32P40	.;.;.;.	E	4906;4906;393	ENSP00000334319:Q4906E;ENSP00000388393:Q4906E	ENSP00000334319:Q4906E	Q	-	1	0	PCLO	82289822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.824000	0.99380	2.500000	0.84329	0.655000	0.94253	CAG		0.498	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		26	236	0	0	0	0.004656	0	26	236				
PCLO	27445	broad.mit.edu	37	7	82585212	82585212	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:82585212T>C	ENST00000333891.9	-	5	5394	c.5057A>G	c.(5056-5058)cAg>cGg	p.Q1686R	PCLO_ENST00000423517.2_Missense_Mutation_p.Q1686R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGTTTTTTTCTGTGATGACTC	0.418																																							uc003uhx.2		NA																	0				ovary(7)	7						c.(5056-5058)CAG>CGG		piccolo isoform 1							87.0	81.0	83.0					7																	82585212		1857	4095	5952	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82585212T>C	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5057A>G	7.37:g.82585212T>C	ENSP00000334319:p.Gln1686Arg		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.Q1686R	p.Q1686R	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			5	5346	-			1617						Missense_Mutation	SNP	ENST00000333891.9	37	c.5057A>G	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	7.244	0.601781	0.13939	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17528	2.27;2.28	5.56	3.13	0.36017	.	.	.	.	.	T	0.12263	0.0298	L	0.29908	0.895	0.80722	D	1	B;B	0.12013	0.005;0.005	B;B	0.13407	0.009;0.009	T	0.07065	-1.0792	9	0.87932	D	0	.	7.233	0.26053	0.0:0.0719:0.2741:0.654	.	1686;1686	Q9Y6V0-5;Q9Y6V0-6	.;.	R	1617;1686;1686	ENSP00000334319:Q1686R;ENSP00000388393:Q1686R	ENSP00000334319:Q1686R	Q	-	2	0	PCLO	82423148	1.000000	0.71417	0.946000	0.38457	0.963000	0.63663	1.023000	0.30065	0.377000	0.24735	0.528000	0.53228	CAG		0.418	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		16	64	0	0	0	0.003163	0	16	64				
GRM3	2913	broad.mit.edu	37	7	86416098	86416098	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:86416098C>A	ENST00000361669.2	+	3	2089	c.990C>A	c.(988-990)gtC>gtA	p.V330V	GRM3_ENST00000536043.1_Silent_p.V202V|AC005009.2_ENST00000418031.1_RNA|GRM3_ENST00000439827.1_Silent_p.V330V|GRM3_ENST00000394720.2_Silent_p.V328V|AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000546348.1_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	330					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					CCCAGCCTGTCCGCCAGTTCG	0.647																																					GBM(52;969 1098 3139 52280)	GBM(52;969 1098 3139 52280)	uc003uid.2		NA																	0				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13						c.(988-990)GTC>GTA		glutamate receptor, metabotropic 3 precursor	Acamprosate(DB00659)|Nicotine(DB00184)						35.0	36.0	35.0					7																	86416098		2203	4300	6503	SO:0001819	synonymous_variant	2913				synaptic transmission	integral to plasma membrane		g.chr7:86416098C>A		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.990C>A	7.37:g.86416098C>A			Somatic				GRM3_uc010lef.2_Silent_p.V328V|GRM3_uc010leg.2_Silent_p.V202V|GRM3_uc010leh.2_Intron	p.V330V	NM_000840	NP_000831	WXS	Illumina HiSeq	Unspecified	Q14832	GRM3_HUMAN			3	2089	+	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)		330			Extracellular (Potential).		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Silent	SNP	ENST00000361669.2	37	c.990C>A	CCDS5600.1																																																																																				0.647	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2			5	39	1	0	0.000602214	0.000602	0.000653123	5	39				
CCDC132	55610	broad.mit.edu	37	7	92987717	92987717	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:92987717C>A	ENST00000305866.5	+	28	2992	c.2864C>A	c.(2863-2865)gCt>gAt	p.A955D	CCDC132_ENST00000544910.1_Missense_Mutation_p.A925D|CCDC132_ENST00000535481.1_Missense_Mutation_p.A675D|CCDC132_ENST00000541136.1_3'UTR	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	955						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CTTCTAGCAGCTATAGATGAT	0.388																																							uc003umo.2		NA																	0					0						c.(2863-2865)GCT>GAT		coiled-coil domain containing 132 isoform a							134.0	126.0	128.0					7																	92987717		1850	4088	5938	SO:0001583	missense	55610							g.chr7:92987717C>A	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.2864C>A	7.37:g.92987717C>A	ENSP00000307666:p.Ala955Asp		Somatic				CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.A925D|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.A675D	p.A955D	NM_017667	NP_060137	WXS	Illumina HiSeq	Unspecified	Q96JG6	CC132_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		28	2992	+	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		955					B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	c.2864C>A	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079771	0.94050	.	.	ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000535481	.	.	.	5.42	5.42	0.78866	Protein of unknown function DUF2451, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64136	0.2571	N	0.14661	0.345	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.997;0.994;0.997	T	0.70197	-0.4938	9	0.72032	D	0.01	-16.7608	19.6722	0.95915	0.0:1.0:0.0:0.0	.	675;925;955	B4DS55;F5H5U7;Q96JG6	.;.;CC132_HUMAN	D	955;925;675	.	ENSP00000307666:A955D	A	+	2	0	CCDC132	92825653	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.435000	0.80391	2.714000	0.92807	0.650000	0.86243	GCT		0.388	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667		28	121	1	0	1.04121e-07	0.005443	1.27367e-07	28	121				
CYP3A5	1577	broad.mit.edu	37	7	99264642	99264642	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:99264642T>A	ENST00000222982.4	-	5	464	c.365A>T	c.(364-366)gAg>gTg	p.E122V	CYP3A5_ENST00000339843.2_3'UTR|CYP3A5_ENST00000343703.5_Missense_Mutation_p.E112V|CYP3A5_ENST00000480723.1_5'UTR	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	122					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	TTCTTCATCCTCAGCTAAAGA	0.393																																							uc003urq.2		NA																	0					0						c.(364-366)GAG>GTG		cytochrome P450, family 3, subfamily A,	Alfentanil(DB00802)|Clopidogrel(DB00758)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Indinavir(DB00224)|Irinotecan(DB00762)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Mephenytoin(DB00532)|Midazolam(DB00683)|Mifepristone(DB00834)|Phenytoin(DB00252)|Quinine(DB00468)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Troleandomycin(DB01361)|Verapamil(DB00661)|Vincristine(DB00541)						114.0	103.0	107.0					7																	99264642		2203	4300	6503	SO:0001583	missense	1577				alkaloid catabolic process|drug catabolic process|oxidative demethylation|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding	g.chr7:99264642T>A	L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.365A>T	7.37:g.99264642T>A	ENSP00000222982:p.Glu122Val		Somatic				ZNF498_uc003urn.2_Intron|CYP3A5_uc003urp.2_5'UTR|CYP3A5_uc003urr.2_Missense_Mutation_p.E9V|CYP3A5_uc011kiy.1_Missense_Mutation_p.E112V|CYP3A5_uc003urs.2_Intron|CYP3A5_uc010lgg.2_Intron	p.E122V	NM_000777	NP_000768	WXS	Illumina HiSeq	Unspecified	P20815	CP3A5_HUMAN			5	452	-	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)		122					A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Missense_Mutation	SNP	ENST00000222982.4	37	c.365A>T	CCDS5672.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.817425	0.32145	.	.	ENSG00000106258	ENST00000222982;ENST00000343703	T;T	0.69685	-0.42;-0.42	3.74	2.57	0.30868	.	0.102147	0.64402	D	0.000004	T	0.65729	0.2719	M	0.79011	2.435	0.80722	D	1	B;B	0.22346	0.068;0.034	B;B	0.31495	0.08;0.131	T	0.61574	-0.7035	10	0.51188	T	0.08	.	7.2904	0.26362	0.0:0.1129:0.0:0.887	.	112;122	F5H4S0;P20815	.;CP3A5_HUMAN	V	122;112	ENSP00000222982:E122V;ENSP00000342969:E112V	ENSP00000222982:E122V	E	-	2	0	CYP3A5	99102578	0.044000	0.20184	0.254000	0.24359	0.351000	0.29236	2.457000	0.45005	0.431000	0.26258	0.533000	0.62120	GAG		0.393	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345469.1			9	83	0	0	0	0.006214	0	9	83				
CYP3A4	1576	broad.mit.edu	37	7	99366022	99366022	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:99366022T>C	ENST00000336411.2	-	7	808	c.625A>G	c.(625-627)Aag>Gag	p.K209E	CYP3A4_ENST00000354593.2_Missense_Mutation_p.K59E|RP11-757A13.1_ENST00000608397.1_RNA	NM_001202855.2|NM_017460.5	NP_001189784.1|NP_059488.2	P08684	CP3A4_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 4	209					alkaloid catabolic process (GO:0009822)|androgen metabolic process (GO:0008209)|calcitriol biosynthetic process from calciol (GO:0036378)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|lipid metabolic process (GO:0006629)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	albendazole monooxygenase activity (GO:0047638)|caffeine oxidase activity (GO:0034875)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)|quinine 3-monooxygenase activity (GO:0050591)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)|taurochenodeoxycholate 6alpha-hydroxylase activity (GO:0033780)|testosterone 6-beta-hydroxylase activity (GO:0050649)|vitamin D 24-hydroxylase activity (GO:0070576)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(3)|central_nervous_system(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Abiraterone(DB05812)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetazolamide(DB00819)|Adinazolam(DB00546)|ado-trastuzumab emtansine(DB05773)|Albendazole(DB00518)|Alclometasone(DB00240)|Aldesleukin(DB00041)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Alimemazine(DB01246)|Aliskiren(DB01258)|Allylestrenol(DB01431)|Almotriptan(DB00918)|Alogliptin(DB06203)|Alosetron(DB00969)|Alprazolam(DB00404)|Ambroxol(DB06742)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Arsenic trioxide(DB01169)|Artemether(DB06697)|Asenapine(DB06216)|Astemizole(DB00637)|Atazanavir(DB01072)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Avanafil(DB06237)|Axitinib(DB06626)|Azatadine(DB00719)|Azelastine(DB00972)|Azithromycin(DB00207)|Bedaquiline(DB08903)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bezafibrate(DB01393)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bisoprolol(DB00612)|Boceprevir(DB08873)|Bortezomib(DB00188)|Bosentan(DB00559)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Brinzolamide(DB01194)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Brompheniramine(DB00835)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Buspirone(DB00490)|Busulfan(DB01008)|Cabazitaxel(DB06772)|Cabergoline(DB00248)|Cabozantinib(DB08875)|Caffeine(DB00201)|Calcitriol(DB00136)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Caspofungin(DB00520)|Cefradine(DB01333)|Celecoxib(DB00482)|Cephalexin(DB00567)|Cevimeline(DB00185)|Chenodeoxycholic acid(DB06777)|Chloramphenicol(DB00446)|Chlordiazepoxide(DB00475)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clemastine(DB00283)|Clevidipine(DB04920)|Clindamycin(DB01190)|Clobazam(DB00349)|Clofazimine(DB00845)|Clofibrate(DB00636)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonazepam(DB01068)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Codeine(DB00318)|Colchicine(DB01394)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cortisone acetate(DB01380)|Crizotinib(DB08865)|Cyclobenzaprine(DB00924)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Cytarabine(DB00987)|Dabrafenib(DB08912)|Dalfopristin(DB01764)|Danazol(DB01406)|Dantrolene(DB01219)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Deferasirox(DB01609)|Delavirdine(DB00705)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Dicloxacillin(DB00485)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydrocodeine(DB01551)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Disopyramide(DB00280)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dofetilide(DB00204)|Dolasetron(DB00757)|Dolutegravir(DB08930)|Domperidone(DB01184)|Donepezil(DB00843)|Dorzolamide(DB00869)|Doxepin(DB01142)|Doxorubicin(DB00997)|Doxycycline(DB00254)|Dronabinol(DB00470)|Dronedarone(DB04855)|Dutasteride(DB01126)|Econazole(DB01127)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Epinephrine(DB00668)|Eplerenone(DB00700)|Ergocalciferol(DB00153)|Ergoloid mesylate(DB01049)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Estradiol valerate/Dienogest(DB08866)|Estradiol(DB00783)|Estramustine(DB01196)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Etravirine(DB06414)|Everolimus(DB01590)|Exemestane(DB00990)|Ezetimibe(DB00973)|Famciclovir(DB00426)|Felbamate(DB00949)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Finasteride(DB01216)|Fingolimod(DB08868)|Flucloxacillin(DB00301)|Fluconazole(DB00196)|Flunisolide(DB00180)|Flunitrazepam(DB01544)|Fluorometholone(DB00324)|Fluoxetine(DB00472)|Flurazepam(DB00690)|Flutamide(DB00499)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosamprenavir(DB01319)|Fosphenytoin(DB01320)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Glipizide(DB01067)|Glyburide(DB01016)|Granisetron(DB00889)|Griseofulvin(DB00400)|Guanethidine(DB01170)|Guanfacine(DB01018)|Halofantrine(DB01218)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Hydralazine(DB01275)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|Indacaterol(DB05039)|Indapamide(DB00808)|Indinavir(DB00224)|Ipratropium bromide(DB00332)|Irbesartan(DB01029)|Irinotecan(DB00762)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ixabepilone(DB04845)|Josamycin(DB01321)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Levomethadyl Acetate(DB01227)|Levomilnacipran(DB08918)|Levonorgestrel(DB00367)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Lisuride(DB00589)|Lomitapide(DB08827)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumefantrine(DB06708)|Lurasidone(DB08815)|MACITENTAN(DB08932)|Maraviroc(DB04835)|Mebendazole(DB00643)|Medroxyprogesterone Acetate(DB00603)|Mefloquine(DB00358)|Meloxicam(DB00814)|Mequitazine(DB01071)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Methylergometrine(DB00353)|Methylprednisolone(DB00959)|Methyltestosterone(DB06710)|Metronidazole(DB00916)|Metyrapone(DB01011)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mirtazapine(DB00370)|Mitoxantrone(DB01204)|Modafinil(DB00745)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nafcillin(DB00607)|Naloxone(DB01183)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nitric Oxide(DB00435)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Olopatadine(DB00768)|Omeprazole(DB00338)|Ondansetron(DB00904)|Orlistat(DB01083)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paramethasone(DB01384)|Paricalcitol(DB00910)|Pazopanib(DB06589)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perampanel(DB08883)|Pergolide(DB01186)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenoxybenzamine(DB00925)|Phenprocoumon(DB00946)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pilocarpine(DB01085)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Prazepam(DB01588)|Praziquantel(DB01058)|Prednisolone(DB00860)|Prednisone(DB00635)|Primaquine(DB01087)|Primidone(DB00794)|Probenecid(DB01032)|Prochlorperazine(DB00433)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Pyridostigmine(DB00545)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Quinupristin(DB01369)|Rabeprazole(DB01129)|Raloxifene(DB00481)|Ramelteon(DB00980)|Ranitidine(DB00863)|Ranolazine(DB00243)|Reboxetine(DB00234)|Regorafenib(DB08896)|Repaglinide(DB00912)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rifapentine(DB01201)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Rimonabant(DB06155)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rivastigmine(DB00989)|Rolitetracycline(DB01301)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosuvastatin(DB01098)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Rufinamide(DB06201)|Ruxolitinib(DB08877)|Salbutamol(DB01001)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Selegiline(DB01037)|Sertindole(DB06144)|Sertraline(DB01104)|Sevoflurane(DB01236)|Sibutramine(DB01105)|Sildenafil(DB00203)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Sitaxentan(DB06268)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sufentanil(DB00708)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfanilamide(DB00259)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Tamsulosin(DB00706)|Tasosartan(DB01349)|Telaprevir(DB05521)|Telithromycin(DB00976)|Temazepam(DB00231)|Temozolomide(DB00853)|Temsirolimus(DB06287)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Thiopental(DB00599)|Thiotepa(DB04572)|Tiagabine(DB00906)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tioconazole(DB01007)|Tiotropium(DB01409)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tofisopam(DB08811)|Tolterodine(DB01036)|Tolvaptan(DB06212)|Topiramate(DB00273)|Topotecan(DB01030)|Toremifene(DB00539)|Trabectedin(DB05109)|Tramadol(DB00193)|Trametinib(DB08911)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Tretinoin(DB00755)|Triamcinolone(DB00620)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vandetanib(DB05294)|Vardenafil(DB00862)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Yohimbine(DB01392)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Zidovudine(DB00495)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)|Zopiclone(DB01198)	CTTAAAAGCTTCTTGGTGTTT	0.373																																							uc003urv.1		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(625-627)AAG>GAG		cytochrome P450, family 3, subfamily A,	Albendazole(DB00518)|Alclometasone(DB00240)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Aliskiren(DB01258)|Almotriptan(DB00918)|Alosetron(DB00969)|Alprazolam(DB00404)|Amlodipine(DB00381)|Amprenavir(DB00701)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Benazepril(DB00542)|Bepridil(DB01244)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bortezomib(DB00188)|Bosentan(DB00559)|Bromocriptine(DB01200)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Buspirone(DB00490)|Busulfan(DB01008)|Carbamazepine(DB00564)|Cevimeline(DB00185)|Chlorpheniramine(DB01114)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cinacalcet(DB01012)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clindamycin(DB01190)|Clofibrate(DB00636)|Clonazepam(DB01068)|Clopidogrel(DB00758)|Cocaine(DB00907)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cyproterone(DB04839)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Delavirdine(DB00705)|Desogestrel(DB00304)|Dexamethasone(DB01234)|Diazepam(DB00829)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dofetilide(DB00204)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Doxorubicin(DB00997)|Drospirenone(DB01395)|Dutasteride(DB01126)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Epirubicin(DB00445)|Eplerenone(DB00700)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Exemestane(DB00990)|Felodipine(DB01023)|Fentanyl(DB00813)|Fexofenadine(DB00950)|Finasteride(DB01216)|Fluconazole(DB00196)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Fosamprenavir(DB01319)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Granisetron(DB00889)|Grepafloxacin(DB00365)|Halofantrine(DB01218)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Imatinib(DB00619)|Indinavir(DB00224)|Ipratropium(DB00332)|Irinotecan(DB00762)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levomethadyl Acetate(DB01227)|Levothyroxine(DB00451)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Maraviroc(DB04835)|Marinol(DB00470)|Mebendazole(DB00643)|Medroxyprogesterone(DB00603)|Methadone(DB00333)|Methylprednisolone(DB00959)|Metyrapone(DB01011)|Mibefradil(DB01388)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirtazapine(DB00370)|Modafinil(DB00745)|Mometasone(DB00764)|Montelukast(DB00471)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norgestrel(DB00506)|Nystatin(DB00646)|Ondansetron(DB00904)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paricalcitol(DB00910)|Phenmetrazine(DB00830)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prednisolone(DB00860)|Prednisone(DB00635)|Prochlorperazine(DB00433)|Quetiapine(DB01224)|Quinapril(DB00881)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranolazine(DB00243)|Reboxetine(DB00234)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampin(DB01045)|Rimonabant(DB06155)|Ritonavir(DB00503)|Rofecoxib(DB00533)|Roxithromycin(DB00778)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sertindole(DB06144)|Sibutramine(DB01105)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Terconazole(DB00251)|Terfenadine(DB00342)|Testosterone(DB00624)|Tiagabine(DB00906)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tiotropium(DB01409)|Tipranavir(DB00932)|Toremifene(DB00539)|Triazolam(DB00897)|Trimetrexate(DB01157)|Troglitazone(DB00197)|Valdecoxib(DB00580)|Vardenafil(DB00862)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Voriconazole(DB00582)|Zaleplon(DB00962)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)						122.0	117.0	119.0					7																	99366022		2203	4300	6503	SO:0001583	missense	1576				alkaloid catabolic process|androgen metabolic process|exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|oxidative demethylation|steroid catabolic process|xenobiotic metabolic process	cell surface|endoplasmic reticulum membrane|integral to membrane|microsome	albendazole monooxygenase activity|caffeine oxidase activity|electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding|quinine 3-monooxygenase activity|steroid binding|taurochenodeoxycholate 6alpha-hydroxylase activity|testosterone 6-beta-hydroxylase activity|vitamin D 24-hydroxylase activity|vitamin D3 25-hydroxylase activity	g.chr7:99366022T>C	AF280107	CCDS5674.1	7q21.1	2011-06-21	2003-01-14		ENSG00000160868	ENSG00000160868	1.1.1.161	"""Cytochrome P450s"""	2637	protein-coding gene	gene with protein product		124010	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 4"""	CYP3A3		8269949, 1391968	Standard	NM_001202855		Approved		uc003urv.2	P08684	OTTHUMG00000156651	ENST00000336411.2:c.625A>G	7.37:g.99366022T>C	ENSP00000337915:p.Lys209Glu		Somatic				CYP3A4_uc003urw.1_Missense_Mutation_p.K209E|CYP3A4_uc011kiz.1_Missense_Mutation_p.K168E|CYP3A4_uc011kja.1_Missense_Mutation_p.K160E|CYP3A4_uc011kjb.1_Missense_Mutation_p.K59E	p.K209E	NM_017460	NP_059488	WXS	Illumina HiSeq	Unspecified	P08684	CP3A4_HUMAN			7	729	-	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)		209					P05184|Q16757|Q9UK50	Missense_Mutation	SNP	ENST00000336411.2	37	c.625A>G	CCDS5674.1	.	.	.	.	.	.	.	.	.	.	T	15.16	2.749976	0.49257	.	.	ENSG00000160868	ENST00000354593;ENST00000336411;ENST00000544160	T;T	0.66638	-0.22;-0.22	4.33	4.33	0.51752	.	0.090434	0.85682	D	0.000000	T	0.69602	0.3129	L	0.49126	1.545	0.44254	D	0.997106	B;P;B;B;B	0.44380	0.403;0.834;0.046;0.046;0.046	B;P;B;B;B	0.51866	0.244;0.682;0.096;0.096;0.096	T	0.72090	-0.4395	10	0.62326	D	0.03	.	11.4075	0.49906	0.0:0.0:0.0:1.0	.	59;136;209;209;209	E7EVM8;Q7Z448;Q6GRK0;Q86SK3;P08684	.;.;.;.;CP3A4_HUMAN	E	59;209;65	ENSP00000346607:K59E;ENSP00000337915:K209E	ENSP00000337915:K209E	K	-	1	0	CYP3A4	99203958	1.000000	0.71417	0.053000	0.19242	0.284000	0.27059	5.817000	0.69229	1.578000	0.49821	0.402000	0.26972	AAG		0.373	CYP3A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345059.1			18	113	0	0	0	0.008871	0	18	113				
MUC17	140453	broad.mit.edu	37	7	100677847	100677847	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:100677847C>T	ENST00000306151.4	+	3	3214	c.3150C>T	c.(3148-3150)agC>agT	p.S1050S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1050	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TGCCTGTCAGCACCACAATGG	0.502																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(3148-3150)AGC>AGT		mucin 17 precursor							512.0	393.0	433.0					7																	100677847		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100677847C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3150C>T	7.37:g.100677847C>T			Somatic				MUC17_uc010lho.1_RNA	p.S1050S	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	3203	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1050			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|15.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.3150C>T	CCDS34711.1																																																																																				0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		64	858	0	0	0	0.00361	0	64	858				
MUC17	140453	broad.mit.edu	37	7	100686347	100686347	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:100686347A>G	ENST00000306151.4	+	3	11714	c.11650A>G	c.(11650-11652)Aca>Gca	p.T3884A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3884					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TGTCAGCACCACACTTCCAAC	0.478																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(11650-11652)ACA>GCA		mucin 17 precursor							158.0	148.0	151.0					7																	100686347		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100686347A>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11650A>G	7.37:g.100686347A>G	ENSP00000302716:p.Thr3884Ala		Somatic				MUC17_uc010lho.1_RNA	p.T3884A	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	11703	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3884			Extracellular (Potential).		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.11650A>G	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	a	8.318	0.823665	0.16678	.	.	ENSG00000169876	ENST00000306151	T	0.01821	4.62	1.14	-0.904	0.10530	.	.	.	.	.	T	0.01695	0.0054	N	0.19112	0.55	0.09310	N	0.999999	P	0.41008	0.735	P	0.47251	0.542	T	0.47142	-0.9140	9	0.21540	T	0.41	.	3.786	0.08700	0.6044:0.3956:0.0:0.0	.	3884	Q685J3	MUC17_HUMAN	A	3884	ENSP00000302716:T3884A	ENSP00000302716:T3884A	T	+	1	0	MUC17	100473067	0.000000	0.05858	0.004000	0.12327	0.030000	0.12068	0.011000	0.13264	-0.493000	0.06678	0.158000	0.16466	ACA		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		11	159	0	0	0	0.000978	0	11	159				
SLC26A3	1811	broad.mit.edu	37	7	107431532	107431532	+	Silent	SNP	C	C	A	rs543522300		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:107431532C>A	ENST00000340010.5	-	5	715	c.531G>T	c.(529-531)gcG>gcT	p.A177A	SLC26A3_ENST00000422236.2_Silent_p.A142A	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	177					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						ATGCCGCCGCCGCCACCCTCA	0.483																																							uc003ver.2		NA																	0				ovary(3)|skin(1)	4						c.(529-531)GCG>GCT		solute carrier family 26, member 3							93.0	81.0	85.0					7																	107431532		2203	4300	6503	SO:0001819	synonymous_variant	1811				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity	g.chr7:107431532C>A	L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.531G>T	7.37:g.107431532C>A			Somatic				SLC26A3_uc003ves.2_Silent_p.A142A	p.A177A	NM_000111	NP_000102	WXS	Illumina HiSeq	Unspecified	P40879	S26A3_HUMAN			5	742	-			177			Helical; (Potential).			Silent	SNP	ENST00000340010.5	37	c.531G>T	CCDS5748.1																																																																																				0.483	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111		24	37	1	0	6.44725e-10	0.002299	8.35284e-10	24	37				
CPED1	79974	broad.mit.edu	37	7	120876791	120876791	+	Silent	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:120876791A>T	ENST00000310396.5	+	17	2546	c.2079A>T	c.(2077-2079)ccA>ccT	p.P693P	CPED1_ENST00000423795.1_Silent_p.P473P|CPED1_ENST00000450913.2_Silent_p.P693P	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	693						endoplasmic reticulum (GO:0005783)											TGATTCATCCAGAGGAAACCT	0.333																																							uc003vjq.3		NA																	0				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(2077-2079)CCA>CCT		hypothetical protein LOC79974 isoform 1							110.0	108.0	108.0					7																	120876791		2203	4300	6503	SO:0001819	synonymous_variant	79974					endoplasmic reticulum		g.chr7:120876791A>T		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2079A>T	7.37:g.120876791A>T			Somatic				C7orf58_uc003vjs.3_Silent_p.P693P|C7orf58_uc003vjt.3_Silent_p.P473P	p.P693P	NM_024913	NP_079189	WXS	Illumina HiSeq	Unspecified	A4D0V7	CG058_HUMAN			17	2526	+	all_neural(327;0.117)		693					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	ENST00000310396.5	37	c.2079A>T	CCDS34739.1																																																																																				0.333	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		14	60	0	0	0	0.00499	0	14	60				
FSCN3	29999	broad.mit.edu	37	7	127235724	127235724	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:127235724G>A	ENST00000265825.5	+	2	727	c.508G>A	c.(508-510)Gca>Aca	p.A170T	FSCN3_ENST00000420086.2_Missense_Mutation_p.A36T|GCC1_ENST00000497650.1_5'Flank	NM_020369.2	NP_065102.1	Q9NQT6	FSCN3_HUMAN	fascin actin-bundling protein 3, testicular	170						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.A170T(1)		endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30						CTGGGTGGACGCAGCAGTTCC	0.607																																							uc003vmd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(508-510)GCA>ACA		fascin 3							146.0	117.0	127.0					7																	127235724		2203	4300	6503	SO:0001583	missense	29999					actin cytoskeleton|cytoplasm	actin filament binding|protein binding, bridging	g.chr7:127235724G>A		CCDS34746.1	7q31.3	2014-02-03	2014-02-03		ENSG00000106328	ENSG00000106328		"""Fascins"""	3961	protein-coding gene	gene with protein product		615800	"""fascin (Strongylocentrotus purpuratus) homolog 3 (actin-bundling protein, testicular)"", ""fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)"""			11925108	Standard	NM_020369		Approved		uc003vmd.2	Q9NQT6	OTTHUMG00000022935	ENST00000265825.5:c.508G>A	7.37:g.127235724G>A	ENSP00000265825:p.Ala170Thr		Somatic				FSCN3_uc003vmc.1_Missense_Mutation_p.A125T|FSCN3_uc011kog.1_RNA|FSCN3_uc011koh.1_Missense_Mutation_p.A36T|FSCN3_uc010llc.1_Missense_Mutation_p.A170T	p.A170T	NM_020369	NP_065102	WXS	Illumina HiSeq	Unspecified	Q9NQT6	FSCN3_HUMAN			2	727	+			170					A4D0Z2|A6NLL7|B2RA62|B4DU68	Missense_Mutation	SNP	ENST00000265825.5	37	c.508G>A	CCDS34746.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.661319	0.47572	.	.	ENSG00000106328	ENST00000265825;ENST00000420086	T;T	0.47869	1.44;0.83	5.58	3.79	0.43588	Actin cross-linking (1);	0.094859	0.46758	N	0.000271	T	0.57330	0.2046	M	0.63428	1.95	0.29264	N	0.871122	D;D	0.76494	0.999;0.999	D;D	0.65443	0.935;0.912	T	0.52503	-0.8567	10	0.18276	T	0.48	-18.6912	8.6813	0.34209	0.1746:0.0:0.8254:0.0	.	36;170	B4DU68;Q9NQT6	.;FSCN3_HUMAN	T	170;36	ENSP00000265825:A170T;ENSP00000412243:A36T	ENSP00000265825:A170T	A	+	1	0	FSCN3	127022960	0.005000	0.15991	0.037000	0.18230	0.665000	0.39181	0.482000	0.22276	0.845000	0.35118	0.650000	0.86243	GCA		0.607	FSCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059256.2	NM_020369		14	80	0	0	0	0.001855	0	14	80				
CPA2	1358	broad.mit.edu	37	7	129906730	129906730	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:129906730G>A	ENST00000222481.4	+	1	64	c.9G>A	c.(7-9)atG>atA	p.M3I		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	3					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					CCATGGCCATGAGGTTGATCC	0.443																																							uc003vpq.2		NA																	0				ovary(1)	1						c.(7-9)ATG>ATA		carboxypeptidase A2 (pancreatic) precursor							225.0	203.0	210.0					7																	129906730		2203	4300	6503	SO:0001583	missense	1358				proteolysis|vacuolar protein catabolic process	extracellular region|vacuole	metallocarboxypeptidase activity|zinc ion binding	g.chr7:129906730G>A	U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.9G>A	7.37:g.129906730G>A	ENSP00000222481:p.Met3Ile		Somatic				CPA2_uc011kpc.1_Missense_Mutation_p.M3I	p.M3I	NM_001869	NP_001860	WXS	Illumina HiSeq	Unspecified	P48052	CBPA2_HUMAN			1	28	+	Melanoma(18;0.0435)		3					A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Missense_Mutation	SNP	ENST00000222481.4	37	c.9G>A	CCDS5817.2	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939544	0.52972	.	.	ENSG00000158516	ENST00000222481	T	0.09350	2.99	6.01	5.13	0.70059	.	0.205916	0.49916	D	0.000127	T	0.35480	0.0933	M	0.87456	2.885	0.36583	D	0.873637	D;D	0.69078	0.997;0.997	D;D	0.66602	0.945;0.926	T	0.52953	-0.8506	10	0.72032	D	0.01	.	12.4259	0.55546	0.0776:0.0:0.9224:0.0	.	1;3	B4DDX9;P48052	.;CBPA2_HUMAN	I	3	ENSP00000222481:M3I	ENSP00000222481:M3I	M	+	3	0	CPA2	129693966	1.000000	0.71417	0.989000	0.46669	0.316000	0.28119	3.761000	0.55242	1.573000	0.49748	0.558000	0.71614	ATG		0.443	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347124.2	NM_001869		40	119	0	0	0	0.006999	0	40	119				
PLXNA4	91584	broad.mit.edu	37	7	131913175	131913175	+	Missense_Mutation	SNP	G	G	A	rs187775340		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:131913175G>A	ENST00000359827.3	-	6	2620	c.1658C>T	c.(1657-1659)tCg>tTg	p.S553L	PLXNA4_ENST00000321063.4_Missense_Mutation_p.S553L			Q9HCM2	PLXA4_HUMAN	plexin A4	553	PSI 1.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CTTCATCTCCGAGGCAAACCT	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		17571	0.0		0.001	False		,,,				2504	0.0						uc003vra.3		NA																	0				ovary(1)	1						c.(1657-1659)TCG>TTG		plexin A4 isoform 1							76.0	80.0	79.0					7																	131913175		1989	4167	6156	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131913175G>A	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1658C>T	7.37:g.131913175G>A	ENSP00000352882:p.Ser553Leu		Somatic					p.S553L	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			6	1887	-			553			PSI 1.|Extracellular (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.1658C>T	CCDS43646.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	27.7	4.853770	0.91355	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.17213	2.29;2.29	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	L	0.58428	1.81	0.80722	D	1	D	0.55800	0.973	P	0.46659	0.523	T	0.00569	-1.1666	10	0.51188	T	0.08	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	553	Q9HCM2	PLXA4_HUMAN	L	553	ENSP00000323194:S553L;ENSP00000352882:S553L	ENSP00000323194:S553L	S	-	2	0	PLXNA4	131563715	1.000000	0.71417	0.967000	0.41034	0.974000	0.67602	9.699000	0.98703	2.793000	0.96121	0.655000	0.94253	TCG		0.607	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		4	47	0	0	0	0.009096	0	4	47				
CHRM2	1129	broad.mit.edu	37	7	136699780	136699780	+	Silent	SNP	C	C	G	rs78847341		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:136699780C>G	ENST00000445907.2	+	3	696	c.168C>G	c.(166-168)acC>acG	p.T56T	hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000401861.1_Silent_p.T56T|hsa-mir-490_ENST00000439694.1_RNA|CHRM2_ENST00000402486.3_Silent_p.T56T|hsa-mir-490_ENST00000592183.1_RNA|CHRM2_ENST00000397608.3_Silent_p.T56T|hsa-mir-490_ENST00000425981.2_RNA|CHRM2_ENST00000453373.1_Silent_p.T56T|hsa-mir-490_ENST00000586239.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000320658.5_Silent_p.T56T	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	56					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	ACCTCCAGACCGTCAACAATT	0.458																																							uc003vtf.1		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(166-168)ACC>ACG		cholinergic receptor, muscarinic 2	Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)						210.0	177.0	188.0					7																	136699780		2203	4300	6503	SO:0001819	synonymous_variant	1129				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding	g.chr7:136699780C>G		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.168C>G	7.37:g.136699780C>G			Somatic				CHRM2_uc003vtg.1_Silent_p.T56T|CHRM2_uc003vtj.1_Silent_p.T56T|CHRM2_uc003vtk.1_Silent_p.T56T|CHRM2_uc003vtl.1_Silent_p.T56T|CHRM2_uc003vtm.1_Silent_p.T56T|CHRM2_uc003vti.1_Silent_p.T56T|CHRM2_uc003vto.1_Silent_p.T56T|CHRM2_uc003vtn.1_Silent_p.T56T|uc003vtp.1_Intron	p.T56T	NM_001006630	NP_001006631	WXS	Illumina HiSeq	Unspecified	P08172	ACM2_HUMAN			4	791	+			56			Cytoplasmic (By similarity).		Q4VBK6|Q9P1X9	Silent	SNP	ENST00000445907.2	37	c.168C>G	CCDS5843.1																																																																																				0.458	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1			20	135	0	0	0	0.007413	0	20	135				
MGAM	8972	broad.mit.edu	37	7	141802436	141802436	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:141802436A>T	ENST00000549489.2	+	46	5377	c.5282A>T	c.(5281-5283)tAt>tTt	p.Y1761F	MGAM_ENST00000475668.2_Missense_Mutation_p.Y2657F	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1761	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCAGATACCTATGGGAAAGGA	0.423																																							uc003vwy.2		NA																	0				ovary(2)	2						c.(5281-5283)TAT>TTT		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						159.0	145.0	150.0					7																	141802436		1889	4124	6013	SO:0001583	missense	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141802436A>T	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.5282A>T	7.37:g.141802436A>T	ENSP00000447378:p.Tyr1761Phe		Somatic					p.Y1761F	NM_004668	NP_004659	WXS	Illumina HiSeq	Unspecified	O43451	MGA_HUMAN			46	5336	+	Melanoma(164;0.0272)		1761			Glucoamylase.|Lumenal (Potential).		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	c.5282A>T	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	A	7.960	0.746717	0.15710	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.89939	-2.59	6.07	3.6	0.41247	.	.	.	.	.	T	0.81959	0.4933	L	0.33710	1.025	0.20074	N	0.999935	B	0.12630	0.006	B	0.09377	0.004	T	0.67941	-0.5540	9	0.35671	T	0.21	.	8.7042	0.34345	0.6956:0.0:0.0:0.3044	.	1761	O43451	MGA_HUMAN	F	1761;2658	ENSP00000447378:Y1761F	ENSP00000373973:Y1761F	Y	+	2	0	MGAM	141448905	0.932000	0.31603	0.525000	0.27900	0.942000	0.58702	0.899000	0.28417	0.472000	0.27344	0.533000	0.62120	TAT		0.423	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			4	30	0	0	0	0.009096	0	4	30				
PRSS1	5644	broad.mit.edu	37	7	142459841	142459841	+	Nonsense_Mutation	SNP	C	C	A	rs141847266	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:142459841C>A	ENST00000311737.7	+	3	423	c.417C>A	c.(415-417)tgC>tgA	p.C139*	PRSS1_ENST00000486171.1_Nonsense_Mutation_p.C153*	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	139	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		C -> F (in PCTT). {ECO:0000269|PubMed:11866271}.		cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GCACGAAGTGCCTCATCTCTG	0.562																																							uc003wak.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(415-417)TGC>TGA		protease, serine, 1 preproprotein							65.0	69.0	68.0					7																	142459841		2203	4300	6503	SO:0001587	stop_gained	5644	Hereditary_Pancreatitis			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity	g.chr7:142459841C>A	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.417C>A	7.37:g.142459841C>A	ENSP00000308720:p.Cys139*		Somatic				uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_3'UTR|PRSS1_uc003wam.2_Nonsense_Mutation_p.C79*	p.C139*	NM_002769	NP_002760	WXS	Illumina HiSeq	Unspecified	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		3	434	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	139		C -> F (in PCTT).	Peptidase S1.		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Nonsense_Mutation	SNP	ENST00000311737.7	37	c.417C>A	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	C	9.973	1.226087	0.22542	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	.	.	.	3.28	1.33	0.21861	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.7454	0.34583	0.0:0.7983:0.0:0.2017	.	.	.	.	X	153;139;129;89	.	ENSP00000308720:C139X	C	+	3	2	PRSS1	142139415	0.952000	0.32445	0.973000	0.42090	0.037000	0.13140	0.404000	0.20999	0.168000	0.19655	0.398000	0.26397	TGC		0.562	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			22	72	1	0	1.10923e-09	0.00278	1.42654e-09	22	72				
EPHB6	2051	broad.mit.edu	37	7	142562249	142562250	+	Missense_Mutation	DNP	AC	AC	TA			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	AC	AC	-	-	AC	AC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:142562249_142562250AC>TA	ENST00000392957.2	+	7	1478_1479	c.691_692AC>TA	c.(691-693)ACc>TAc	p.T231Y	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Missense_Mutation_p.T231Y	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	231	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CTTCTCCTACACCTGCCCTGCC	0.668																																							uc011kst.1		NA																	0				lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(691-693)ACC>TAC		ephrin receptor EphB6 precursor																																				SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142562249_142562250AC>TA	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	Exception_encountered	7.37:g.142562249_142562250delinsTA	ENSP00000376684:p.Thr231Tyr		Somatic				EPHB6_uc011ksu.1_Missense_Mutation_p.T231Y|EPHB6_uc003wbs.2_5'UTR|EPHB6_uc003wbt.2_Intron|EPHB6_uc003wbu.2_5'UTR|EPHB6_uc003wbv.2_5'Flank	p.T231Y	NM_004445	NP_004436	WXS	Illumina HiSeq	Unspecified	O15197	EPHB6_HUMAN			7	1478_1479	+	Melanoma(164;0.059)		231			Extracellular (Potential).|Cys-rich.		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	DNP	ENST00000392957.2	37	c.691_692AC>TA	CCDS5873.2																																																																																				0.668	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			29	116	0	0	0	0.004672	0	29	116				
TRPV6	55503	broad.mit.edu	37	7	142575012	142575012	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:142575012C>T	ENST00000359396.3	-	4	615	c.370G>A	c.(370-372)Gct>Act	p.A124T	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	124					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					TTCACAACAGCGATGTGCAGT	0.627																																							uc003wbx.1		NA																	0				ovary(2)	2						c.(370-372)GCT>ACT		transient receptor potential cation channel,							86.0	80.0	82.0					7																	142575012		2203	4300	6503	SO:0001583	missense	55503				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding	g.chr7:142575012C>T	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.370G>A	7.37:g.142575012C>T	ENSP00000352358:p.Ala124Thr		Somatic				TRPV6_uc003wbw.1_5'Flank|TRPV6_uc010lou.1_5'UTR	p.A124T	NM_018646	NP_061116	WXS	Illumina HiSeq	Unspecified	Q9H1D0	TRPV6_HUMAN			4	586	-	Melanoma(164;0.059)		124			ANK 3.|Cytoplasmic (Potential).		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	c.370G>A	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227596	0.79576	.	.	ENSG00000165125	ENST00000359396;ENST00000431833	D;T	0.81996	-1.56;-1.43	3.86	3.86	0.44501	Ankyrin repeat-containing domain (4);	0.053052	0.85682	D	0.000000	D	0.91942	0.7448	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.66196	0.942	D	0.93893	0.7181	10	0.72032	D	0.01	-12.2989	14.9814	0.71313	0.0:1.0:0.0:0.0	.	124	Q9H1D0	TRPV6_HUMAN	T	124;51	ENSP00000352358:A124T;ENSP00000415917:A51T	ENSP00000352358:A124T	A	-	1	0	TRPV6	142285134	1.000000	0.71417	0.550000	0.28217	0.993000	0.82548	7.209000	0.77916	1.995000	0.58328	0.655000	0.94253	GCT		0.627	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274		32	58	0	0	0	0.002445	0	32	58				
TRPV5	56302	broad.mit.edu	37	7	142612512	142612512	+	Silent	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:142612512T>C	ENST00000265310.1	-	10	1599	c.1251A>G	c.(1249-1251)ggA>ggG	p.G417G		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	417					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					GAATCGTCTTTCCAAAATAGC	0.507																																							uc003wby.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.(1249-1251)GGA>GGG		transient receptor potential cation channel,							146.0	141.0	142.0					7																	142612512		2203	4300	6503	SO:0001819	synonymous_variant	56302				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	g.chr7:142612512T>C	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1251A>G	7.37:g.142612512T>C			Somatic					p.G417G	NM_019841	NP_062815	WXS	Illumina HiSeq	Unspecified	Q9NQA5	TRPV5_HUMAN			10	1515	-	Melanoma(164;0.059)		417			Cytoplasmic (Potential).		A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	ENST00000265310.1	37	c.1251A>G	CCDS5875.1																																																																																				0.507	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		29	114	0	0	0	0.002445	0	29	114				
TRPV5	56302	broad.mit.edu	37	7	142622786	142622786	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:142622786C>T	ENST00000265310.1	-	8	1308	c.960G>A	c.(958-960)aaG>aaA	p.K320K	TRPV5_ENST00000442623.1_Silent_p.K320K	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	320					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					ACTTGTTCCACTTGAAGCTCA	0.532																																							uc003wby.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.(958-960)AAG>AAA		transient receptor potential cation channel,							123.0	104.0	111.0					7																	142622786		2203	4300	6503	SO:0001819	synonymous_variant	56302				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	g.chr7:142622786C>T	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.960G>A	7.37:g.142622786C>T			Somatic				TRPV5_uc003wbz.2_Silent_p.K320K	p.K320K	NM_019841	NP_062815	WXS	Illumina HiSeq	Unspecified	Q9NQA5	TRPV5_HUMAN			8	1224	-	Melanoma(164;0.059)		320			Cytoplasmic (Potential).		A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	ENST00000265310.1	37	c.960G>A	CCDS5875.1																																																																																				0.532	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		4	37	0	0	0	0.000602	0	4	37				
KEL	3792	broad.mit.edu	37	7	142649608	142649608	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:142649608C>A	ENST00000355265.2	-	10	1665	c.1191G>T	c.(1189-1191)gaG>gaT	p.E397D	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	397					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					TGGGTGGTTGCTCTGTCAGTT	0.532																																							uc003wcb.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1189-1191)GAG>GAT		Kell blood group, metallo-endopeptidase							141.0	120.0	127.0					7																	142649608		2203	4300	6503	SO:0001583	missense	3792				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr7:142649608C>A	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1191G>T	7.37:g.142649608C>A	ENSP00000347409:p.Glu397Asp		Somatic					p.E397D	NM_000420	NP_000411	WXS	Illumina HiSeq	Unspecified	P23276	KELL_HUMAN			10	1401	-	Melanoma(164;0.059)		397			Extracellular (Potential).		B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	c.1191G>T	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985259	0.35036	.	.	ENSG00000197993	ENST00000355265	T	0.76709	-1.04	5.28	-8.28	0.01013	Peptidase M13 (1);	0.586829	0.16154	N	0.227137	T	0.67887	0.2941	M	0.62723	1.935	0.09310	N	1	P	0.51537	0.946	P	0.48952	0.596	T	0.59161	-0.7506	10	0.27785	T	0.31	-7.8898	2.9761	0.05937	0.0999:0.1858:0.1994:0.5149	.	397	P23276	KELL_HUMAN	D	397	ENSP00000347409:E397D	ENSP00000347409:E397D	E	-	3	2	KEL	142359730	0.000000	0.05858	0.000000	0.03702	0.987000	0.75469	-1.013000	0.03645	-1.654000	0.01499	-0.136000	0.14681	GAG		0.532	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		9	67	1	0	3.86212e-05	0.008291	4.34076e-05	9	67				
CASP2	835	broad.mit.edu	37	7	142997328	142997328	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:142997328C>T	ENST00000310447.5	+	8	1149	c.908C>T	c.(907-909)gCc>gTc	p.A303V	CASP2_ENST00000493642.1_3'UTR|RN7SL481P_ENST00000477764.2_RNA	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	303					aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					TTTGACAACGCCAACTGCCCA	0.527																																							uc003wco.2		NA																	0				lung(2)|ovary(1)	3						c.(907-909)GCC>GTC		caspase 2 isoform 1 preproprotein							83.0	75.0	78.0					7																	142997328		2203	4300	6503	SO:0001583	missense	835				apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein maturation by peptide bond cleavage	cytosol	cysteine-type endopeptidase activity|enzyme binding|protein binding|protein domain specific binding	g.chr7:142997328C>T	AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.908C>T	7.37:g.142997328C>T	ENSP00000312664:p.Ala303Val		Somatic				CASP2_uc003wcp.2_3'UTR|CASP2_uc011kta.1_Missense_Mutation_p.A187V|CASP2_uc003wcq.2_RNA|CASP2_uc011ktb.1_Missense_Mutation_p.A53V	p.A303V	NM_032982	NP_116764	WXS	Illumina HiSeq	Unspecified	P42575	CASP2_HUMAN			8	1055	+	Melanoma(164;0.059)		303					A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	ENST00000310447.5	37	c.908C>T	CCDS5879.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923128	0.92319	.	.	ENSG00000106144	ENST00000310447;ENST00000392923	T	0.20332	2.08	5.52	5.52	0.82312	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.000000	0.85682	D	0.000000	T	0.29028	0.0721	L	0.31664	0.95	0.80722	D	1	D	0.69078	0.997	P	0.53722	0.733	T	0.00797	-1.1562	10	0.38643	T	0.18	.	19.5137	0.95154	0.0:1.0:0.0:0.0	.	303	P42575	CASP2_HUMAN	V	303;272	ENSP00000312664:A303V	ENSP00000312664:A303V	A	+	2	0	CASP2	142707450	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.580000	0.67464	2.612000	0.88384	0.644000	0.83932	GCC		0.527	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059962.3	NM_032982		6	87	0	0	0	0.001984	0	6	87				
OR2A25	392138	broad.mit.edu	37	7	143771910	143771910	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:143771910G>T	ENST00000408898.2	+	1	636	c.598G>T	c.(598-600)Gca>Tca	p.A200S		NM_001004488.1	NP_001004488.1	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A, member 25	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(16)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	24	Melanoma(164;0.0783)					AATGGTTTTGGCAGGGGCAGT	0.443																																							uc011ktx.1		NA																	0					0						c.(598-600)GCA>TCA		olfactory receptor, family 2, subfamily A,							136.0	141.0	140.0					7																	143771910		2035	4220	6255	SO:0001583	missense	392138				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143771910G>T		CCDS43669.1	7q35	2012-08-09		2004-03-10	ENSG00000221933	ENSG00000221933		"""GPCR / Class A : Olfactory receptors"""	19562	protein-coding gene	gene with protein product				OR2A25P, OR2A27			Standard	NM_001004488		Approved		uc011ktx.2	A4D2G3	OTTHUMG00000158013	ENST00000408898.2:c.598G>T	7.37:g.143771910G>T	ENSP00000386167:p.Ala200Ser		Somatic					p.A200S	NM_001004488	NP_001004488	WXS	Illumina HiSeq	Unspecified	A4D2G3	O2A25_HUMAN			1	598	+	Melanoma(164;0.0783)		200			Helical; Name=5; (Potential).		B2RNC9	Missense_Mutation	SNP	ENST00000408898.2	37	c.598G>T	CCDS43669.1	.	.	.	.	.	.	.	.	.	.	G	3.981	-0.006519	0.07773	.	.	ENSG00000221933	ENST00000408898	T	0.00130	8.69	4.84	-1.5	0.08691	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	L	0.45051	1.395	0.09310	N	1	B	0.23891	0.093	B	0.26693	0.072	T	0.09228	-1.0684	9	0.49607	T	0.09	-0.8758	5.246	0.15496	0.4907:0.0:0.3695:0.1398	.	200	A4D2G3	O2A25_HUMAN	S	200	ENSP00000386167:A200S	ENSP00000386167:A200S	A	+	1	0	OR2A25	143402843	0.000000	0.05858	0.764000	0.31436	0.012000	0.07955	0.132000	0.15891	-0.225000	0.09913	-0.214000	0.12660	GCA		0.443	OR2A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350000.1			22	168	1	0	2.70639e-06	0.002299	3.15646e-06	22	168				
ZBED6CL	113763	broad.mit.edu	37	7	150027807	150027807	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:150027807A>G	ENST00000343855.4	+	1	870	c.314A>G	c.(313-315)tAc>tGc	p.Y105C	LRRC61_ENST00000323078.7_Intron|LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000359623.4_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	105																	GTCCTCGTGTACAAGGTGAAG	0.577																																							uc003wgy.2		NA																	0				ovary(1)	1						c.(313-315)TAC>TGC		hypothetical protein LOC113763							73.0	74.0	73.0					7																	150027807		2203	4300	6503	SO:0001583	missense	113763							g.chr7:150027807A>G	BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.314A>G	7.37:g.150027807A>G	ENSP00000343242:p.Tyr105Cys		Somatic				LRRC61_uc003wgv.2_Intron|LRRC61_uc003wgx.2_Intron|LRRC61_uc003wgw.2_Intron	p.Y105C	NM_138434	NP_612443	WXS	Illumina HiSeq	Unspecified	Q96FA7	CG029_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.011)		1	870	+			105						Missense_Mutation	SNP	ENST00000343855.4	37	c.314A>G	CCDS5900.1	.	.	.	.	.	.	.	.	.	.	A	10.91	1.483767	0.26598	.	.	ENSG00000188707	ENST00000343855	.	.	.	3.75	2.62	0.31277	.	2.570310	0.02179	U	0.060302	T	0.45438	0.1342	N	0.19112	0.55	0.22996	N	0.998459	D	0.89917	1.0	D	0.73380	0.98	T	0.45116	-0.9283	9	0.59425	D	0.04	.	6.7428	0.23445	0.8828:0.0:0.1172:0.0	.	105	Q96FA7	CG029_HUMAN	C	105	.	ENSP00000343242:Y105C	Y	+	2	0	C7orf29	149658740	0.996000	0.38824	1.000000	0.80357	0.753000	0.42808	0.817000	0.27281	1.674000	0.50907	0.456000	0.33151	TAC		0.577	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350702.1	NM_138434		12	106	0	0	0	0.000978	0	12	106				
CSMD1	64478	broad.mit.edu	37	8	2830736	2830736	+	Silent	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:2830736G>C	ENST00000520002.1	-	58	9384	c.8829C>G	c.(8827-8829)ctC>ctG	p.L2943L	CSMD1_ENST00000537824.1_Silent_p.L2942L|CSMD1_ENST00000602723.1_Silent_p.L2885L|CSMD1_ENST00000400186.3_Silent_p.L2885L|CSMD1_ENST00000542608.1_Silent_p.L2884L|CSMD1_ENST00000602557.1_Silent_p.L2943L			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2943	Sushi 22. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGGAGAAGCGGAGAAGACTCT	0.537																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(8827-8829)CTC>CTG		CUB and Sushi multiple domains 1 precursor							113.0	117.0	116.0					8																	2830736		1944	4145	6089	SO:0001819	synonymous_variant	64478					integral to membrane		g.chr8:2830736G>C			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8829C>G	8.37:g.2830736G>C			Somatic				CSMD1_uc011kwj.1_Silent_p.L2272L|CSMD1_uc010lrg.2_Silent_p.L953L	p.L2943L	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	57	9219	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2943			Extracellular (Potential).|Sushi 22.		Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37	c.8829C>G		.	.	.	.	.	.	.	.	.	.	G	0.072	-1.200926	0.01581	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.21	-10.4	0.00318	.	.	.	.	.	T	0.33381	0.0861	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43653	-0.9378	4	.	.	.	.	2.5341	0.04710	0.3083:0.3729:0.1381:0.1807	.	.	.	.	A	2360	.	.	P	-	1	0	CSMD1	2818143	0.001000	0.12720	0.003000	0.11579	0.113000	0.19764	-1.698000	0.01908	-3.048000	0.00261	-0.844000	0.03045	CCG		0.537	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		24	84	0	0	0	0.002299	0	24	84				
RP1L1	94137	broad.mit.edu	37	8	10470122	10470122	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:10470122C>G	ENST00000382483.3	-	4	1709	c.1486G>C	c.(1486-1488)Gga>Cga	p.G496R		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	496					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		AGGCTCCCTCCAGCTTTCCGC	0.706																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1486-1488)GGA>CGA		retinitis pigmentosa 1-like 1							27.0	31.0	29.0					8																	10470122		1912	4125	6037	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10470122C>G	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1486G>C	8.37:g.10470122C>G	ENSP00000371923:p.Gly496Arg		Somatic					p.G496R	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	1715	-			496					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.1486G>C	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.694161	0.30052	.	.	ENSG00000183638	ENST00000382483	T	0.04862	3.54	4.43	-0.979	0.10276	.	.	.	.	.	T	0.03959	0.0111	L	0.29908	0.895	0.09310	N	1	B	0.29085	0.232	B	0.24848	0.056	T	0.42258	-0.9462	9	0.72032	D	0.01	1.2543	0.7048	0.00914	0.1703:0.3615:0.1662:0.302	.	496	A6NKC6	.	R	496	ENSP00000371923:G496R	ENSP00000371923:G496R	G	-	1	0	RP1L1	10507532	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.117000	0.10708	-0.173000	0.10761	-0.424000	0.05967	GGA		0.706	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			13	20	0	0	0	0.001855	0	13	20				
NAT1	9	broad.mit.edu	37	8	18080399	18080399	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:18080399C>A	ENST00000517492.1	+	3	1481	c.843C>A	c.(841-843)ccC>ccA	p.P281P	NAT1_ENST00000520546.1_Silent_p.P281P|NAT1_ENST00000541942.1_Silent_p.P281P|NAT1_ENST00000545197.1_Silent_p.P343P|NAT1_ENST00000535084.1_Silent_p.P281P|NAT1_ENST00000539092.1_Silent_p.P281P|NAT1_ENST00000307719.4_Silent_p.P281P|NAT1_ENST00000518029.1_Silent_p.P281P			Q8IZM9	S38A6_HUMAN	N-acetyltransferase 1 (arylamine N-acetyltransferase)	0					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(2)|urinary_tract(1)	9				Colorectal(111;0.0519)|COAD - Colon adenocarcinoma(73;0.208)		AGCTTGTGCCCAAACATGGTG	0.333																																							uc010ltd.2		NA																	0					0						c.(841-843)CCC>CCA		N-acetyltransferase 1 isoform a							32.0	34.0	34.0					8																	18080399		2191	4299	6490	SO:0001819	synonymous_variant	9				xenobiotic metabolic process	cytosol	arylamine N-acetyltransferase activity	g.chr8:18080399C>A	BC047666	CCDS6007.1, CCDS55205.1	8p22	2012-01-18			ENSG00000171428	ENSG00000171428	2.3.1.5		7645	protein-coding gene	gene with protein product		108345		AAC1		7773298	Standard	NM_001160174		Approved		uc003wyt.3	P18440	OTTHUMG00000097001	ENST00000517492.1:c.843C>A	8.37:g.18080399C>A			Somatic				NAT1_uc003wyt.2_Silent_p.P343P|NAT1_uc003wyu.2_Silent_p.P281P|NAT1_uc003wyv.2_Silent_p.P281P|NAT1_uc010ltc.2_Silent_p.P281P|NAT1_uc003wys.2_Silent_p.P343P|NAT1_uc003wyr.2_Silent_p.P281P|NAT1_uc003wyq.2_Silent_p.P281P|NAT1_uc011kyl.1_Silent_p.P281P	p.P281P	NM_001160179	NP_001153651	WXS	Illumina HiSeq	Unspecified	P18440	ARY1_HUMAN		Colorectal(111;0.0519)|COAD - Colon adenocarcinoma(73;0.208)	5	1210	+			281					C9JWA6|Q86SY5	Silent	SNP	ENST00000517492.1	37	c.843C>A	CCDS6007.1																																																																																				0.333	NAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374828.1	NM_000662		6	20	1	0	8.12818e-05	0.001984	9.03895e-05	6	20				
PXDNL	137902	broad.mit.edu	37	8	52366085	52366085	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:52366085C>A	ENST00000356297.4	-	10	1343	c.1243G>T	c.(1243-1245)Gta>Tta	p.V415L	PXDNL_ENST00000543296.1_Missense_Mutation_p.V415L	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	415					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				ATACCTTGTACAATTATGTTT	0.408																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(1243-1245)GTA>TTA		peroxidasin homolog-like precursor							107.0	108.0	108.0					8																	52366085		2043	4191	6234	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52366085C>A		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1243G>T	8.37:g.52366085C>A	ENSP00000348645:p.Val415Leu		Somatic					p.V415L	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			10	1344	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	415					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.1243G>T	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389530	0.42410	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.60299	0.2;0.2	4.08	4.08	0.47627	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77329	0.4114	M	0.91196	3.185	0.32914	D	0.514831	D	0.54207	0.965	P	0.61722	0.893	D	0.84474	0.0601	9	0.52906	T	0.07	.	11.805	0.52150	0.0:1.0:0.0:0.0	.	415	A1KZ92	PXDNL_HUMAN	L	415	ENSP00000348645:V415L;ENSP00000444865:V415L	ENSP00000348645:V415L	V	-	1	0	PXDNL	52528638	1.000000	0.71417	0.920000	0.36463	0.038000	0.13279	6.139000	0.71728	1.799000	0.52666	0.650000	0.86243	GTA		0.408	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		17	64	1	0	4.96729e-08	0.008871	6.10466e-08	17	64				
KCNB2	9312	broad.mit.edu	37	8	73850139	73850139	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:73850139G>A	ENST00000523207.1	+	3	3137	c.2549G>A	c.(2548-2550)aGt>aAt	p.S850N		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	850					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GAAGAGGGCAGTGTGGGCTCT	0.532																																							uc003xzb.2		NA																	0				skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(2548-2550)AGT>AAT		potassium voltage-gated channel, Shab-related							85.0	83.0	84.0					8																	73850139		2203	4300	6503	SO:0001583	missense	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73850139G>A	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.2549G>A	8.37:g.73850139G>A	ENSP00000430846:p.Ser850Asn		Somatic					p.S850N	NM_004770	NP_004761	WXS	Illumina HiSeq	Unspecified	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		3	3137	+	Breast(64;0.137)		850			Cytoplasmic (Potential).		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	c.2549G>A	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	0.074	-1.197118	0.01594	.	.	ENSG00000182674	ENST00000523207	D	0.97455	-4.39	5.46	-0.0949	0.13643	.	3.741070	0.01371	U	0.012589	D	0.93138	0.7815	N	0.24115	0.695	0.09310	N	1	B	0.26258	0.145	B	0.21360	0.034	D	0.85563	0.1229	10	0.22706	T	0.39	.	9.8811	0.41233	0.1571:0.4886:0.3543:0.0	.	850	Q92953	KCNB2_HUMAN	N	850	ENSP00000430846:S850N	ENSP00000430846:S850N	S	+	2	0	KCNB2	74012693	0.000000	0.05858	0.373000	0.26003	0.264000	0.26372	-0.009000	0.12765	-0.115000	0.11915	0.591000	0.81541	AGT		0.532	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		16	61	0	0	0	0.003163	0	16	61				
ZFHX4	79776	broad.mit.edu	37	8	77763201	77763201	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:77763201G>A	ENST00000521891.2	+	10	4492	c.4044G>A	c.(4042-4044)caG>caA	p.Q1348Q	ZFHX4_ENST00000455469.2_Silent_p.Q1303Q|ZFHX4_ENST00000050961.6_Silent_p.Q1303Q|ZFHX4_ENST00000518282.1_Silent_p.Q1322Q	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATGAGGAGCAGAAACCGACTA	0.408										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(3907-3909)CAG>CAA		zinc finger homeodomain 4							66.0	63.0	64.0					8																	77763201		1851	4088	5939	SO:0001819	synonymous_variant	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77763201G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4044G>A	8.37:g.77763201G>A		HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Silent_p.Q1348Q|ZFHX4_uc003yaw.1_Silent_p.Q1303Q	p.Q1303Q	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	4296	+			1303					G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	c.3909G>A	CCDS47878.2																																																																																				0.408	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		5	14	0	0	0	0.000602	0	5	14				
VPS13B	157680	broad.mit.edu	37	8	100026089	100026089	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:100026089G>A	ENST00000358544.2	+	2	184	c.73G>A	c.(73-75)Gat>Aat	p.D25N	VPS13B_ENST00000395996.1_Missense_Mutation_p.D25N|RP11-410L14.2_ENST00000521696.1_lincRNA|VPS13B_ENST00000355155.1_Missense_Mutation_p.D25N|VPS13B_ENST00000357162.2_Missense_Mutation_p.D25N|VPS13B_ENST00000441350.2_Missense_Mutation_p.D25N	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	25					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAAGCCGTCGGATCTACAGCT	0.428																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(73-75)GAT>AAT		vacuolar protein sorting 13B isoform 5							190.0	176.0	181.0					8																	100026089		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100026089G>A	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.73G>A	8.37:g.100026089G>A	ENSP00000351346:p.Asp25Asn		Somatic				VPS13B_uc003yiw.2_Missense_Mutation_p.D25N|VPS13B_uc003yit.2_Missense_Mutation_p.D25N|VPS13B_uc003yiu.1_Missense_Mutation_p.D25N|VPS13B_uc003yis.2_Missense_Mutation_p.D25N|VPS13B_uc011lgy.1_5'UTR	p.D25N	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		2	184	+	Breast(36;3.73e-07)		25					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.73G>A	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	33	5.243500	0.95272	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350	D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.84042	0.5385	N	0.11845	0.185	0.80722	D	1	D;D;D;D;P	0.89917	0.998;1.0;0.998;1.0;0.729	D;D;D;D;B	0.91635	0.995;0.999;0.985;0.999;0.32	D	0.87285	0.2295	10	0.62326	D	0.03	.	18.1701	0.89743	0.0:0.0:1.0:0.0	.	25;25;25;25;25	Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4;Q7Z7G8-5	.;VP13B_HUMAN;.;.;.	N	25	ENSP00000347281:D25N;ENSP00000349685:D25N;ENSP00000351346:D25N;ENSP00000379318:D25N;ENSP00000398472:D25N	ENSP00000347281:D25N	D	+	1	0	VPS13B	100095265	1.000000	0.71417	0.690000	0.30148	0.979000	0.70002	9.419000	0.97397	2.507000	0.84556	0.557000	0.71058	GAT		0.428	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		37	229	0	0	0	0.004878	0	37	229				
VPS13B	157680	broad.mit.edu	37	8	100523444	100523444	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:100523444G>C	ENST00000358544.2	+	29	4523	c.4412G>C	c.(4411-4413)cGa>cCa	p.R1471P	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.R1446P	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1471					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGAAATGAGCGAAGAAGTTTT	0.373																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(4411-4413)CGA>CCA		vacuolar protein sorting 13B isoform 5							138.0	139.0	139.0					8																	100523444		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100523444G>C	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4412G>C	8.37:g.100523444G>C	ENSP00000351346:p.Arg1471Pro		Somatic				VPS13B_uc003yiw.2_Missense_Mutation_p.R1446P|VPS13B_uc003yix.1_Missense_Mutation_p.R941P	p.R1471P	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		29	4523	+	Breast(36;3.73e-07)		1471					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.4412G>C	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523067	0.85600	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.48522	0.81;0.81	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000002	T	0.67230	0.2871	L	0.58101	1.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.981;0.998;0.997	T	0.66991	-0.5783	10	0.54805	T	0.06	.	19.4366	0.94798	0.0:0.0:1.0:0.0	.	1470;1446;1471	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8	.;.;VP13B_HUMAN	P	1446;1471	ENSP00000349685:R1446P;ENSP00000351346:R1471P	ENSP00000349685:R1446P	R	+	2	0	VPS13B	100592620	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.495000	0.97964	2.669000	0.90835	0.585000	0.79938	CGA		0.373	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		44	79	0	0	0	0.00874	0	44	79				
CSMD3	114788	broad.mit.edu	37	8	114326875	114326875	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:114326875G>C	ENST00000297405.5	-	2	570	c.326C>G	c.(325-327)tCa>tGa	p.S109*	CSMD3_ENST00000343508.3_Nonsense_Mutation_p.S69*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.S109*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.S109*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	109	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TAGAGCAAATGACTGAAAAAC	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(325-327)TCA>TGA		CUB and Sushi multiple domains 3 isoform 1							159.0	150.0	153.0					8																	114326875		2203	4300	6503	SO:0001587	stop_gained	114788					integral to membrane|plasma membrane		g.chr8:114326875G>C	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.326C>G	8.37:g.114326875G>C	ENSP00000297405:p.Ser109*	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003ynt.2_Nonsense_Mutation_p.S69*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.S109*|CSMD3_uc010mcx.1_Nonsense_Mutation_p.S109*|CSMD3_uc003ynx.3_Nonsense_Mutation_p.S109*	p.S109*	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			2	485	-			109			Extracellular (Potential).|CUB 1.		Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	37	c.326C>G	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	37	6.444941	0.97572	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	.	.	.	5.72	5.72	0.89469	.	0.000000	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	18.8756	0.92334	0.0:0.0:1.0:0.0	.	.	.	.	X	69;109;109;109	.	ENSP00000297405:S109X	S	-	2	0	CSMD3	114396051	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.860000	0.99555	2.697000	0.92050	0.557000	0.71058	TCA		0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		22	78	0	0	0	0.002299	0	22	78				
COL22A1	169044	broad.mit.edu	37	8	139737644	139737644	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:139737644G>T	ENST00000303045.6	-	24	2625	c.2179C>A	c.(2179-2181)Ccg>Acg	p.P727T	COL22A1_ENST00000435777.1_Missense_Mutation_p.P727T	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	727	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GAACCTCCCGGTCCAGGGGGG	0.582										HNSCC(7;0.00092)																													uc003yvd.2		NA																	0				ovary(11)|pancreas(1)|skin(1)	13						c.(2179-2181)CCG>ACG		collagen, type XXII, alpha 1							57.0	64.0	62.0					8																	139737644		2203	4300	6503	SO:0001583	missense	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139737644G>T	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2179C>A	8.37:g.139737644G>T	ENSP00000303153:p.Pro727Thr	HNSCC(7;0.00092)	Somatic				COL22A1_uc011ljo.1_Missense_Mutation_p.P27T	p.P727T	NM_152888	NP_690848	WXS	Illumina HiSeq	Unspecified	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		24	2626	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		727			Collagen-like 5.|Pro-rich.|Gly-rich.		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	c.2179C>A	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	8.325	0.825130	0.16678	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.96856	-4.15;-4.15	4.94	4.94	0.65067	.	0.000000	0.49916	D	0.000133	D	0.94997	0.8381	L	0.33792	1.035	0.36492	D	0.868485	P;D	0.56746	0.944;0.977	P;P	0.57057	0.628;0.812	D	0.93196	0.6587	10	0.10377	T	0.69	.	14.401	0.67047	0.0:0.0:1.0:0.0	.	727;727	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	T	727;727;440	ENSP00000303153:P727T;ENSP00000387655:P727T	ENSP00000303153:P727T	P	-	1	0	COL22A1	139806826	1.000000	0.71417	0.991000	0.47740	0.668000	0.39293	4.378000	0.59568	2.659000	0.90383	0.655000	0.94253	CCG		0.582	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		40	55	1	0	4.14194e-30	0.002852	6.56222e-30	40	55				
EEF1D	1936	broad.mit.edu	37	8	144662698	144662698	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:144662698G>C	ENST00000529272.1	-	6	990	c.590C>G	c.(589-591)tCc>tGc	p.S197C	NAPRT1_ENST00000449291.2_5'Flank|EEF1D_ENST00000419152.2_Missense_Mutation_p.S197C|EEF1D_ENST00000532741.1_Missense_Mutation_p.S613C|EEF1D_ENST00000524624.1_Missense_Mutation_p.S173C|EEF1D_ENST00000423316.2_Missense_Mutation_p.S563C|NAPRT1_ENST00000276844.7_5'Flank|EEF1D_ENST00000531621.1_Missense_Mutation_p.S154C|EEF1D_ENST00000532400.1_Intron|NAPRT1_ENST00000426292.3_5'Flank|EEF1D_ENST00000395119.3_Missense_Mutation_p.S197C|RP11-661A12.7_ENST00000529247.1_RNA|EEF1D_ENST00000526838.1_Missense_Mutation_p.S178C|NAPRT1_ENST00000435154.3_5'Flank|EEF1D_ENST00000442189.2_Missense_Mutation_p.S563C|EEF1D_ENST00000528610.1_Missense_Mutation_p.S173C|EEF1D_ENST00000317198.6_Missense_Mutation_p.S197C			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	197	Catalytic (GEF).				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CAGCAGGATGGAGGACTTGGC	0.667																																							uc011lki.1		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(589-591)TCC>TGC		eukaryotic translation elongation factor 1 delta							66.0	62.0	63.0					8																	144662698		2202	4300	6502	SO:0001583	missense	1936				positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|signal transducer activity|translation elongation factor activity	g.chr8:144662698G>C	AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.590C>G	8.37:g.144662698G>C	ENSP00000434872:p.Ser197Cys		Somatic				NAPRT1_uc003yym.3_5'Flank|NAPRT1_uc003yyn.3_5'Flank|NAPRT1_uc011lkh.1_5'Flank|NAPRT1_uc003yyo.3_5'Flank|EEF1D_uc003yyp.1_Missense_Mutation_p.S539C|EEF1D_uc003yyq.1_Missense_Mutation_p.S613C|EEF1D_uc011lkj.1_Missense_Mutation_p.S562C|EEF1D_uc003yyr.2_Missense_Mutation_p.S563C|EEF1D_uc003yyt.2_Missense_Mutation_p.S563C|EEF1D_uc011lkk.1_Missense_Mutation_p.S197C|EEF1D_uc003yys.2_Missense_Mutation_p.S197C|EEF1D_uc003yyv.2_Missense_Mutation_p.S173C|EEF1D_uc003yyu.2_Missense_Mutation_p.S197C|EEF1D_uc011lkl.1_Missense_Mutation_p.S178C	p.S197C	NM_001130057	NP_001123529	WXS	Illumina HiSeq	Unspecified	P29692	EF1D_HUMAN	Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		6	859	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		197					B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	ENST00000529272.1	37	c.590C>G	CCDS6405.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729738	0.89390	.	.	ENSG00000104529	ENST00000419152;ENST00000529576;ENST00000532741;ENST00000526838;ENST00000442189;ENST00000528610;ENST00000395119;ENST00000529272;ENST00000423316;ENST00000356793;ENST00000317198;ENST00000337369;ENST00000531621;ENST00000524624;ENST00000534380;ENST00000534377;ENST00000533204;ENST00000530191;ENST00000531218	.	.	.	4.62	4.62	0.57501	Translation elongation factor EF1B/ribosomal protein S6 (1);Translation elongation factor EF1B, beta/delta subunit, guanine nucleotide exchange (3);	0.000000	0.85682	D	0.000000	D	0.87493	0.6191	H	0.96547	3.84	0.80722	D	1	P;D;D;D;D;D	0.89917	0.868;1.0;0.987;1.0;0.989;1.0	P;D;D;D;D;D	0.87578	0.761;0.998;0.973;0.998;0.984;0.997	D	0.91707	0.5378	9	0.72032	D	0.01	.	16.8093	0.85715	0.0:0.0:1.0:0.0	.	178;563;491;197;613;563	E9PBQ9;D3DWK1;F8W934;P29692;E9PRY8;P29692-2	.;.;.;EF1D_HUMAN;.;.	C	197;37;613;178;563;173;197;197;563;491;197;563;154;173;197;173;197;197;197	.	ENSP00000317399:S197C	S	-	2	0	EEF1D	144733841	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.691000	0.98679	2.291000	0.77112	0.313000	0.20887	TCC		0.667	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382592.2	NM_032378		38	54	0	0	0	0.004878	0	38	54				
SLC1A1	6505	broad.mit.edu	37	9	4573997	4573997	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:4573997G>T	ENST00000262352.3	+	8	1094	c.858G>T	c.(856-858)atG>atT	p.M286I		NM_004170.5	NP_004161.4	P43005	EAA3_HUMAN	solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1	286					D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|pancreas(1)|skin(1)	15		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|Pregabalin(DB00230)	GCCTTTACATGGCCACAGTCC	0.453																																							uc003zij.1		NA																	0					0						c.(856-858)ATG>ATT		solute carrier family 1, member 1	L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)						133.0	134.0	133.0					9																	4573997		2203	4300	6503	SO:0001583	missense	6505				D-aspartate import|L-glutamate import|synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity	g.chr9:4573997G>T		CCDS6452.1	9p24	2013-05-22			ENSG00000106688	ENSG00000106688		"""Solute carriers"""	10939	protein-coding gene	gene with protein product		133550				8020993	Standard	NM_004170		Approved	EAAC1, EAAT3	uc003zij.2	P43005	OTTHUMG00000019468	ENST00000262352.3:c.858G>T	9.37:g.4573997G>T	ENSP00000262352:p.Met286Ile		Somatic				C9orf68_uc003zik.2_Intron	p.M286I	NM_004170	NP_004161	WXS	Illumina HiSeq	Unspecified	P43005	EAA3_HUMAN		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	8	1094	+		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)	286					O75587|Q5VZ24|Q8N199|Q9UEW2	Missense_Mutation	SNP	ENST00000262352.3	37	c.858G>T	CCDS6452.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.21|15.21	2.767229|2.767229	0.49574|0.49574	.|.	.|.	ENSG00000106688|ENSG00000106688	ENST00000422398|ENST00000262352	.|T	.|0.57273	.|0.41	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.072794	.|0.85682	.|D	.|0.000000	T|T	0.49813|0.49813	0.1579|0.1579	L|L	0.39467|0.39467	1.215|1.215	0.80722|0.80722	D|D	1|1	.|B	.|0.27316	.|0.175	.|B	.|0.27608	.|0.081	T|T	0.48875|0.48875	-0.8996|-0.8996	5|10	.|0.72032	.|D	.|0.01	.|.	19.9261|19.9261	0.97102|0.97102	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|286	.|P43005	.|EAA3_HUMAN	C|I	49|286	.|ENSP00000262352:M286I	.|ENSP00000262352:M286I	G|M	+|+	1|3	0|0	SLC1A1|SLC1A1	4563997|4563997	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.754000|6.754000	0.74909|0.74909	2.789000|2.789000	0.95967|0.95967	0.655000|0.655000	0.94253|0.94253	GGC|ATG		0.453	SLC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051571.1			53	99	1	0	4.0181e-32	0.00361	6.44366e-32	53	99				
JAK2	3717	broad.mit.edu	37	9	5054660	5054660	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:5054660C>A	ENST00000381652.3	+	7	1206	c.712C>A	c.(712-714)Cag>Aag	p.Q238K	JAK2_ENST00000539801.1_Missense_Mutation_p.Q238K|JAK2_ENST00000544510.1_Missense_Mutation_p.Q89K	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	238	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CAGATTTATTCAGCAATTCAG	0.368		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																														uc010mhm.2		1		Dom	yes		9	9p24	3717	T|Mis|O	Janus kinase 2			L	ETV6|PCM1|BCR		ALL|AML|MPD| CML	PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	0				haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641						c.(712-714)CAG>AAG		Janus kinase 2							95.0	101.0	99.0					9																	5054660		2203	4300	6503	SO:0001583	missense	3717	Polycythemia_Vera_Familial	Familial Cancer Database		actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding	g.chr9:5054660C>A		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.712C>A	9.37:g.5054660C>A	ENSP00000371067:p.Gln238Lys		Somatic				JAK2_uc003ziw.2_Missense_Mutation_p.Q238K	p.Q238K	NM_004972	NP_004963	WXS	Illumina HiSeq	Unspecified	O60674	JAK2_HUMAN		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	6	825	+	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)	238			Interaction with cytokine/interferon/growth hormone receptors (By similarity).|FERM.		O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	c.712C>A	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.108099	0.37242	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	T;T;T	0.41065	1.01;1.01;1.01	5.81	4.92	0.64577	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);	0.159012	0.56097	D	0.000023	T	0.32164	0.0820	L	0.41573	1.285	0.58432	D	0.999999	P	0.37141	0.584	B	0.35114	0.196	T	0.09509	-1.0671	10	0.06625	T	0.88	-0.1508	16.1604	0.81700	0.0:0.8462:0.1538:0.0	.	238	O60674	JAK2_HUMAN	K	238;238;89	ENSP00000440387:Q238K;ENSP00000371067:Q238K;ENSP00000443103:Q89K	ENSP00000371067:Q238K	Q	+	1	0	JAK2	5044660	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.929000	0.70096	1.459000	0.47892	0.655000	0.94253	CAG		0.368	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1			18	124	1	0	3.51602e-12	0.008871	4.8037e-12	18	124				
JAK2	3717	broad.mit.edu	37	9	5054741	5054741	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:5054741T>G	ENST00000381652.3	+	7	1287	c.793T>G	c.(793-795)Ttc>Gtc	p.F265V	JAK2_ENST00000539801.1_Missense_Mutation_p.F265V|JAK2_ENST00000544510.1_Missense_Mutation_p.F116V	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	265	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GCAGTCTGCCTTCTACACAGA	0.393		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																														uc010mhm.2		1		Dom	yes		9	9p24	3717	T|Mis|O	Janus kinase 2			L	ETV6|PCM1|BCR		ALL|AML|MPD| CML	PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	0				haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641						c.(793-795)TTC>GTC		Janus kinase 2							71.0	76.0	74.0					9																	5054741		2203	4300	6503	SO:0001583	missense	3717	Polycythemia_Vera_Familial	Familial Cancer Database		actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding	g.chr9:5054741T>G		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.793T>G	9.37:g.5054741T>G	ENSP00000371067:p.Phe265Val		Somatic				JAK2_uc003ziw.2_Missense_Mutation_p.F265V	p.F265V	NM_004972	NP_004963	WXS	Illumina HiSeq	Unspecified	O60674	JAK2_HUMAN		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	6	906	+	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)	265			FERM.		O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	c.793T>G	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	T	15.38	2.816757	0.50633	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	T;T;T	0.22945	1.93;1.93;1.93	5.83	5.83	0.93111	Band 4.1 domain (1);FERM domain (1);	0.046412	0.85682	D	0.000000	T	0.30293	0.0760	M	0.69185	2.1	0.58432	D	0.999998	B	0.31581	0.329	B	0.27076	0.076	T	0.05209	-1.0899	10	0.49607	T	0.09	-9.8345	16.2041	0.82108	0.0:0.0:0.0:1.0	.	265	O60674	JAK2_HUMAN	V	265;265;116	ENSP00000440387:F265V;ENSP00000371067:F265V;ENSP00000443103:F116V	ENSP00000371067:F265V	F	+	1	0	JAK2	5044741	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.001000	0.57046	2.219000	0.72066	0.533000	0.62120	TTC		0.393	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1			11	67	0	0	0	0.008291	0	11	67				
JAK2	3717	broad.mit.edu	37	9	5054743	5054743	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:5054743C>G	ENST00000381652.3	+	7	1289	c.795C>G	c.(793-795)ttC>ttG	p.F265L	JAK2_ENST00000539801.1_Missense_Mutation_p.F265L|JAK2_ENST00000544510.1_Missense_Mutation_p.F116L	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	265	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	AGTCTGCCTTCTACACAGAGA	0.393		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																														uc010mhm.2		1		Dom	yes		9	9p24	3717	T|Mis|O	Janus kinase 2			L	ETV6|PCM1|BCR		ALL|AML|MPD| CML	PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	0				haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641						c.(793-795)TTC>TTG		Janus kinase 2							70.0	75.0	73.0					9																	5054743		2203	4300	6503	SO:0001583	missense	3717	Polycythemia_Vera_Familial	Familial Cancer Database		actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding	g.chr9:5054743C>G		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.795C>G	9.37:g.5054743C>G	ENSP00000371067:p.Phe265Leu		Somatic				JAK2_uc003ziw.2_Missense_Mutation_p.F265L	p.F265L	NM_004972	NP_004963	WXS	Illumina HiSeq	Unspecified	O60674	JAK2_HUMAN		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	6	908	+	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)	265			FERM.		O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	c.795C>G	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523917	0.44866	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	T;T;T	0.22945	1.93;1.93;1.93	5.83	5.83	0.93111	Band 4.1 domain (1);FERM domain (1);	0.046412	0.85682	D	0.000000	T	0.25121	0.0610	L	0.37697	1.125	0.58432	D	0.999999	B	0.10296	0.003	B	0.11329	0.006	T	0.03130	-1.1069	10	0.25751	T	0.34	-9.8345	20.126	0.97982	0.0:1.0:0.0:0.0	.	265	O60674	JAK2_HUMAN	L	265;265;116	ENSP00000440387:F265L;ENSP00000371067:F265L;ENSP00000443103:F116L	ENSP00000371067:F265L	F	+	3	2	JAK2	5044743	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.949000	0.49074	2.749000	0.94314	0.655000	0.94253	TTC		0.393	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1			11	64	0	0	0	0.008291	0	11	64				
TRPM3	80036	broad.mit.edu	37	9	73461370	73461370	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:73461370C>A	ENST00000377111.2	-	4	843	c.600G>T	c.(598-600)aaG>aaT	p.K200N	TRPM3_ENST00000423814.3_Missense_Mutation_p.K202N|TRPM3_ENST00000396283.1_Missense_Mutation_p.K47N|TRPM3_ENST00000360823.2_Missense_Mutation_p.K47N|TRPM3_ENST00000396292.4_Missense_Mutation_p.K47N|TRPM3_ENST00000396280.5_Missense_Mutation_p.K47N|TRPM3_ENST00000361823.5_Missense_Mutation_p.K47N|TRPM3_ENST00000377106.1_Missense_Mutation_p.K47N|TRPM3_ENST00000377101.1_Missense_Mutation_p.K47N|TRPM3_ENST00000408909.2_Missense_Mutation_p.K47N|TRPM3_ENST00000377097.3_Missense_Mutation_p.K47N|TRPM3_ENST00000358082.3_Missense_Mutation_p.K47N|TRPM3_ENST00000377105.1_Missense_Mutation_p.K47N|TRPM3_ENST00000357533.2_Missense_Mutation_p.K202N|TRPM3_ENST00000377110.3_Missense_Mutation_p.K200N|TRPM3_ENST00000396285.1_Missense_Mutation_p.K47N	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	200					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CAAAGACTTGCTTGAGTTTTG	0.483																																							uc004aid.2		NA																	0				ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						c.(598-600)AAG>AAT		transient receptor potential cation channel,							188.0	187.0	187.0					9																	73461370		2203	4300	6503	SO:0001583	missense	80036					integral to membrane	calcium channel activity	g.chr9:73461370C>A	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.600G>T	9.37:g.73461370C>A	ENSP00000366315:p.Lys200Asn		Somatic				TRPM3_uc004ahu.2_Missense_Mutation_p.K30N|TRPM3_uc004ahv.2_Missense_Mutation_p.K30N|TRPM3_uc004ahw.2_Missense_Mutation_p.K47N|TRPM3_uc004ahx.2_Missense_Mutation_p.K47N|TRPM3_uc004ahy.2_Missense_Mutation_p.K47N|TRPM3_uc004ahz.2_Missense_Mutation_p.K47N|TRPM3_uc004aia.2_Missense_Mutation_p.K47N|TRPM3_uc004aib.2_Missense_Mutation_p.K47N|TRPM3_uc004aic.2_Missense_Mutation_p.K200N|TRPM3_uc010mor.2_Missense_Mutation_p.K200N|TRPM3_uc004aie.2_Missense_Mutation_p.K47N|TRPM3_uc004aif.2_Missense_Mutation_p.K47N|TRPM3_uc004aig.2_Missense_Mutation_p.K47N|TRPM3_uc004aii.2_Missense_Mutation_p.K202N	p.K200N	NM_001007471	NP_001007472	WXS	Illumina HiSeq	Unspecified	Q9HCF6	TRPM3_HUMAN			4	844	-			200			Cytoplasmic (Potential).		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37	c.600G>T		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	14.10|14.10|14.10	2.434723|2.434723|2.434723	0.43224|0.43224|0.43224	.|.|.	.|.|.	ENSG00000083067|ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101;ENST00000396283;ENST00000361823;ENST00000455451|ENST00000377097	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	.|0.06294|.	.|3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32|.	5.6|5.6|5.6	2.75|2.75|2.75	0.32379|0.32379|0.32379	.|.|.	.|0.097707|.	.|0.64402|.	.|D|.	.|0.000002|.	T|T|T	0.74756|0.74756|0.74756	0.3758|0.3758|0.3758	M|M|M	0.86028|0.86028|0.86028	2.79|2.79|2.79	0.47621|0.47621|0.47621	D|D|D	0.999472|0.999472|0.999472	.|P;D;B;B;B;D;B;B;D;B;B|.	.|0.76494|.	.|0.849;0.991;0.264;0.107;0.232;0.999;0.126;0.233;0.999;0.36;0.146|.	.|B;P;B;B;B;D;B;B;D;B;B|.	.|0.78314|.	.|0.382;0.9;0.16;0.06;0.115;0.991;0.064;0.081;0.991;0.135;0.197|.	T|T|T	0.75687|0.75687|0.75687	-0.3231|-0.3231|-0.3231	5|10|5	.|0.87932|.	.|D|.	.|0|.	-17.4305|-17.4305|-17.4305	10.7965|10.7965|10.7965	0.46464|0.46464|0.46464	0.0:0.736:0.0:0.264|0.0:0.736:0.0:0.264|0.0:0.736:0.0:0.264	.|.|.	.|200;202;47;200;200;200;202;47;47;200;47|.	.|Q9HCF6;Q4VXD2;Q504Y1;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3|.	.|TRPM3_HUMAN;.;.;.;.;.;.;.;.;.;.|.	S|N|I	47|200;200;47;47;47;202;47;47;47;47;202;47;47;47;47|90	.|ENSP00000366315:K200N;ENSP00000366314:K200N;ENSP00000366310:K47N;ENSP00000354066:K47N;ENSP00000366309:K47N;ENSP00000350140:K202N;ENSP00000386127:K47N;ENSP00000379581:K47N;ENSP00000379587:K47N;ENSP00000350791:K47N;ENSP00000389542:K202N;ENSP00000366305:K47N;ENSP00000379579:K47N;ENSP00000355395:K47N|.	.|ENSP00000350140:K202N|.	A|K|S	-|-|-	1|3|2	0|2|0	TRPM3|TRPM3|TRPM3	72651190|72651190|72651190	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.984000|0.984000|0.984000	0.73092|0.73092|0.73092	0.996000|0.996000|0.996000	0.29719|0.29719|0.29719	0.730000|0.730000|0.730000	0.32425|0.32425|0.32425	-0.145000|-0.145000|-0.145000	0.13849|0.13849|0.13849	GCA|AAG|AGC		0.483	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945		51	183	1	0	7.84493e-40	0.00361	1.28549e-39	51	183				
TMEM2	23670	broad.mit.edu	37	9	74312911	74312911	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:74312911C>G	ENST00000377044.4	-	20	4126	c.3587G>C	c.(3586-3588)gGc>gCc	p.G1196A	TMEM2_ENST00000396272.3_Missense_Mutation_p.G189A|TMEM2_ENST00000377066.5_Missense_Mutation_p.G1133A	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1196					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		CTGCCGAGTGCCACAGCCTTG	0.483																																							uc011lsa.1		NA																	0				ovary(2)	2						c.(3586-3588)GGC>GCC		transmembrane protein 2 isoform a							88.0	73.0	78.0					9																	74312911		2203	4300	6503	SO:0001583	missense	23670					integral to membrane		g.chr9:74312911C>G		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3587G>C	9.37:g.74312911C>G	ENSP00000366243:p.Gly1196Ala		Somatic				TMEM2_uc011lrz.1_Missense_Mutation_p.G189A|TMEM2_uc010mos.2_Missense_Mutation_p.G1133A|TMEM2_uc011lsb.1_RNA|TMEM2_uc004aik.2_Missense_Mutation_p.G30A	p.G1196A	NM_013390	NP_037522	WXS	Illumina HiSeq	Unspecified	Q9UHN6	TMEM2_HUMAN		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)	20	4127	-		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)	1196					A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	c.3587G>C	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257085	0.80246	.	.	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000396272	T;T;T	0.47869	0.83;0.83;0.83	5.8	5.8	0.92144	.	0.093983	0.64402	D	0.000001	T	0.68760	0.3036	M	0.72118	2.19	0.80722	D	1	P;D	0.69078	0.939;0.997	P;D	0.65443	0.706;0.935	T	0.69837	-0.5037	10	0.66056	D	0.02	.	19.6724	0.95915	0.0:1.0:0.0:0.0	.	1196;1133	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	A	1196;1133;189	ENSP00000366243:G1196A;ENSP00000366266:G1133A;ENSP00000379569:G189A	ENSP00000366243:G1196A	G	-	2	0	TMEM2	73502731	1.000000	0.71417	0.918000	0.36340	0.503000	0.33858	6.859000	0.75467	2.730000	0.93505	0.563000	0.77884	GGC		0.483	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390		14	48	0	0	0	0.003163	0	14	48				
PRUNE2	158471	broad.mit.edu	37	9	79318455	79318455	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:79318455A>T	ENST00000376718.3	-	9	8197	c.8074T>A	c.(8074-8076)Tct>Act	p.S2692T	PRUNE2_ENST00000428286.1_Missense_Mutation_p.S2333T	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2692					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						ACTGGACCAGAGGCTTCCTCT	0.542																																							uc010mpk.2		NA																	0					0						c.(8074-8076)TCT>ACT		prune homolog 2							80.0	72.0	75.0					9																	79318455		1568	3582	5150	SO:0001583	missense	158471				apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity	g.chr9:79318455A>T	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.8074T>A	9.37:g.79318455A>T	ENSP00000365908:p.Ser2692Thr		Somatic				PRUNE2_uc004akj.3_Missense_Mutation_p.S145T|PRUNE2_uc010mpl.1_Missense_Mutation_p.S145T	p.S2692T	NM_015225	NP_056040	WXS	Illumina HiSeq	Unspecified	Q8WUY3	PRUN2_HUMAN			9	8198	-			2692					B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	c.8074T>A	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.897|9.897	1.205823|1.205823	0.22205|0.22205	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000426088|ENST00000376718;ENST00000428286;ENST00000422033	.|T;T	.|0.53423	.|0.62;0.64	5.93|5.93	-1.18|-1.18	0.09617|0.09617	.|.	.|1.341990	.|0.04645	.|N	.|0.406005	T|T	0.34019|0.34019	0.0883|0.0883	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	0.999997|0.999997	.|P;B	.|0.41848	.|0.763;0.264	.|B;B	.|0.36608	.|0.229;0.044	T|T	0.31308|0.31308	-0.9948|-0.9948	5|10	.|0.72032	.|D	.|0.01	-1.5721|-1.5721	0.7505|0.7505	0.00989|0.00989	0.3972:0.2427:0.1365:0.2235|0.3972:0.2427:0.1365:0.2235	.|.	.|2692;2692	.|Q8WUY3-3;Q8WUY3	.|.;PRUN2_HUMAN	H|T	2013|2692;2333;2691	.|ENSP00000365908:S2692T;ENSP00000397425:S2333T	.|ENSP00000365908:S2692T	L|S	-|-	2|1	0|0	PRUNE2|PRUNE2	78508275|78508275	0.881000|0.881000	0.30235|0.30235	0.001000|0.001000	0.08648|0.08648	0.944000|0.944000	0.59088|0.59088	1.181000|1.181000	0.32017|0.32017	-0.106000|-0.106000	0.12110|0.12110	0.482000|0.482000	0.46254|0.46254	CTC|TCT		0.542	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		8	91	0	0	0	0.006214	0	8	91				
PRUNE2	158471	broad.mit.edu	37	9	79318981	79318981	+	Silent	SNP	T	T	C			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:79318981T>C	ENST00000376718.3	-	9	7671	c.7548A>G	c.(7546-7548)gaA>gaG	p.E2516E	PRUNE2_ENST00000428286.1_Silent_p.E2157E	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2516					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GAATTGTTTTTTCTTCTTCCA	0.368																																							uc010mpk.2		NA																	0					0						c.(7546-7548)GAA>GAG		prune homolog 2							135.0	125.0	128.0					9																	79318981		1568	3582	5150	SO:0001819	synonymous_variant	158471				apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity	g.chr9:79318981T>C	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.7548A>G	9.37:g.79318981T>C			Somatic				PRUNE2_uc004akj.3_5'UTR|PRUNE2_uc010mpl.1_5'UTR	p.E2516E	NM_015225	NP_056040	WXS	Illumina HiSeq	Unspecified	Q8WUY3	PRUN2_HUMAN			9	7672	-			2516					B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	37	c.7548A>G	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	T	4.207	0.037204	0.08148	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.76	0.848	0.18966	.	.	.	.	.	T	0.43919	0.1269	.	.	.	0.36737	D	0.882028	.	.	.	.	.	.	T	0.38802	-0.9644	4	.	.	.	-15.2323	3.7272	0.08478	0.1521:0.2494:0.0:0.5984	.	.	.	.	E	1838	.	.	K	-	1	0	PRUNE2	78508801	0.000000	0.05858	0.727000	0.30756	0.624000	0.37722	-0.135000	0.10420	0.120000	0.18254	0.533000	0.62120	AAA		0.368	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		43	134	0	0	0	0.00874	0	43	134				
CEP78	84131	broad.mit.edu	37	9	80858483	80858483	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:80858483A>T	ENST00000424347.2	+	5	998	c.709A>T	c.(709-711)Aac>Tac	p.N237Y	CEP78_ENST00000415759.2_Missense_Mutation_p.N237Y|CEP78_ENST00000277082.5_Missense_Mutation_p.N237Y|CEP78_ENST00000376598.2_Missense_Mutation_p.N237Y|CEP78_ENST00000376597.4_Missense_Mutation_p.N237Y			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	237				CN -> GY (in Ref. 3; BAB14190). {ECO:0000305}.	G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						ACTGAATTGCAACACACTTAT	0.443																																							uc004akx.2		NA																	0				ovary(1)	1						c.(709-711)AAC>TAC		centrosomal protein 78kDa isoform b							172.0	161.0	165.0					9																	80858483		1965	4159	6124	SO:0001583	missense	84131				G2/M transition of mitotic cell cycle	centrosome|cytosol		g.chr9:80858483A>T	BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.709A>T	9.37:g.80858483A>T	ENSP00000411284:p.Asn237Tyr		Somatic				CEP78_uc004aky.3_Missense_Mutation_p.N237Y|CEP78_uc010mpp.2_Missense_Mutation_p.N237Y|CEP78_uc011lsp.1_Missense_Mutation_p.N150Y	p.N237Y	NM_032171	NP_115547	WXS	Illumina HiSeq	Unspecified	Q5JTW2	CEP78_HUMAN			5	985	+			237	CN -> GY (in Ref. 3; BAB14190).				A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Missense_Mutation	SNP	ENST00000424347.2	37	c.709A>T		.	.	.	.	.	.	.	.	.	.	A	22.9	4.343622	0.82022	.	.	ENSG00000148019	ENST00000424347;ENST00000415085;ENST00000415759;ENST00000376597;ENST00000277082;ENST00000376598	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.83450	0.5257	M	0.85197	2.74	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.999;0.999	D	0.86308	0.1684	10	0.87932	D	0	-19.9538	15.1582	0.72761	1.0:0.0:0.0:0.0	.	150;237;237;237	B7Z8H9;E9PHX5;Q5JTW2-2;Q5JTW2	.;.;.;CEP78_HUMAN	Y	237	ENSP00000411284:N237Y;ENSP00000399286:N237Y;ENSP00000365782:N237Y;ENSP00000277082:N237Y;ENSP00000365783:N237Y	ENSP00000277082:N237Y	N	+	1	0	CEP78	80048303	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	8.285000	0.89914	2.165000	0.68154	0.533000	0.62120	AAC		0.443	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000052766.2	XM_095991		16	39	0	0	0	0.004007	0	16	39				
TMEM38B	55151	broad.mit.edu	37	9	108510377	108510377	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:108510377G>T	ENST00000374692.3	+	5	683	c.566G>T	c.(565-567)gGg>gTg	p.G189V	TMEM38B_ENST00000374688.1_Missense_Mutation_p.G135V	NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	189						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						ACCCTGCTGGGGTCAGTTATC	0.383																																							uc004bcu.1		NA																	0				ovary(1)|skin(1)	2						c.(565-567)GGG>GTG		transmembrane protein 38B							96.0	88.0	91.0					9																	108510377		2203	4300	6503	SO:0001583	missense	55151					integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity	g.chr9:108510377G>T	BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.566G>T	9.37:g.108510377G>T	ENSP00000363824:p.Gly189Val		Somatic				TMEM38B_uc010mtn.1_Intron	p.G189V	NM_018112	NP_060582	WXS	Illumina HiSeq	Unspecified	Q9NVV0	TM38B_HUMAN			5	683	+			189			Lumenal (Potential).		Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Missense_Mutation	SNP	ENST00000374692.3	37	c.566G>T	CCDS6768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.91|18.91	3.723384|3.723384	0.68959|0.68959	.|.	.|.	ENSG00000095209|ENSG00000095209	ENST00000435034|ENST00000374692;ENST00000374688	.|T;T	.|0.46451	.|0.87;0.88	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.65417|0.65417	0.2689|0.2689	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.63296|0.63296	-0.6669|-0.6669	7|10	0.56958|0.41790	D|T	0.05|0.15	-11.5524|-11.5524	17.3933|17.3933	0.87439|0.87439	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|189	.|Q9NVV0	.|TM38B_HUMAN	C|V	126|189;135	.|ENSP00000363824:G189V;ENSP00000363820:G135V	ENSP00000410800:G126C|ENSP00000363820:G135V	G|G	+|+	1|2	0|0	TMEM38B|TMEM38B	107550198|107550198	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.598000|0.598000	0.36846|0.36846	7.028000|7.028000	0.76470|0.76470	2.767000|2.767000	0.95098|0.95098	0.591000|0.591000	0.81541|0.81541	GGT|GGG		0.383	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053517.1	NM_018112		27	62	1	0	1.77063e-15	0.005443	2.51038e-15	27	62				
ACTL7A	10881	broad.mit.edu	37	9	111625106	111625106	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:111625106G>T	ENST00000333999.3	+	1	504	c.504G>T	c.(502-504)ttG>ttT	p.L168F		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	168						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						ATGCGGTCTTGGTTTCAGACC	0.522																																					Esophageal Squamous(177;1480 3591 17554)	Esophageal Squamous(177;1480 3591 17554)	uc004bdj.1		NA																	0					0						c.(502-504)TTG>TTT		actin-like 7A							94.0	90.0	92.0					9																	111625106		2203	4300	6503	SO:0001583	missense	10881					cytoplasm|cytoskeleton|protein complex	structural constituent of cytoskeleton	g.chr9:111625106G>T	BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.504G>T	9.37:g.111625106G>T	ENSP00000334300:p.Leu168Phe		Somatic					p.L168F	NM_006687	NP_006678	WXS	Illumina HiSeq	Unspecified	Q9Y615	ACL7A_HUMAN			1	504	+			168					B2RC83|Q5JSV0	Missense_Mutation	SNP	ENST00000333999.3	37	c.504G>T	CCDS6772.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919771	0.73098	.	.	ENSG00000187003	ENST00000333999	D	0.97114	-4.25	5.98	5.03	0.67393	.	0.000000	0.37261	N	0.002168	D	0.98391	0.9465	M	0.85945	2.785	0.52501	D	0.999954	D	0.89917	1.0	D	0.97110	1.0	D	0.98643	1.0676	10	0.87932	D	0	.	14.4187	0.67168	0.0:0.1484:0.8516:0.0	.	168	Q9Y615	ACL7A_HUMAN	F	168	ENSP00000334300:L168F	ENSP00000334300:L168F	L	+	3	2	ACTL7A	110664927	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	3.237000	0.51344	2.835000	0.97688	0.650000	0.86243	TTG		0.522	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053570.1	NM_006687		26	47	1	0	4.4004e-07	0.00333	5.27246e-07	26	47				
TMEM245	23731	broad.mit.edu	37	9	111798569	111798569	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:111798569T>A	ENST00000374586.3	-	16	2347	c.2316A>T	c.(2314-2316)ttA>ttT	p.L772F		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	772						integral component of membrane (GO:0016021)											CCTTGCATCCTAACCCTTGTG	0.448																																							uc004bdt.3		NA																	0				central_nervous_system(1)	1						c.(2314-2316)TTA>TTT		hypothetical protein LOC23731							96.0	97.0	97.0					9																	111798569		1984	4160	6144	SO:0001583	missense	23731					integral to membrane		g.chr9:111798569T>A	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.2316A>T	9.37:g.111798569T>A	ENSP00000363714:p.Leu772Phe		Somatic				C9orf5_uc004bds.3_RNA|C9orf5_uc004bdr.3_Missense_Mutation_p.L764F	p.L772F	NM_032012	NP_114401	WXS	Illumina HiSeq	Unspecified	Q9H330	CI005_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)	16	2348	-		Myeloproliferative disorder(63;0.204)	772					B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Missense_Mutation	SNP	ENST00000374586.3	37	c.2316A>T	CCDS43858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.78|17.78	3.472789|3.472789	0.63737|0.63737	.|.	.|.	ENSG00000106771|ENSG00000106771	ENST00000374586;ENST00000223608|ENST00000413712	T|.	0.22539|.	1.95|.	5.53|5.53	0.532|0.532	0.17114|0.17114	.|.	0.337088|.	0.29152|.	N|.	0.012993|.	T|T	0.22322|0.22322	0.0538|0.0538	N|N	0.08118|0.08118	0|0	0.31881|0.31881	N|N	0.618505|0.618505	P;P|.	0.52577|.	0.61;0.954|.	B;P|.	0.48952|.	0.187;0.596|.	T|T	0.34551|0.34551	-0.9824|-0.9824	10|5	0.44086|.	T|.	0.13|.	-9.5066|-9.5066	9.8136|9.8136	0.40838|0.40838	0.0:0.4028:0.0:0.5972|0.0:0.4028:0.0:0.5972	.|.	772;772|.	Q9H330-2;Q9H330|.	.;CI005_HUMAN|.	F|W	772|365	ENSP00000363714:L772F|.	ENSP00000223608:L772F|.	L|R	-|-	3|1	2|2	C9orf5|C9orf5	110838390|110838390	0.994000|0.994000	0.37717|0.37717	0.990000|0.990000	0.47175|0.47175	0.995000|0.995000	0.86356|0.86356	0.312000|0.312000	0.19397|0.19397	0.062000|0.062000	0.16340|0.16340	-0.408000|-0.408000	0.06270|0.06270	TTA|AGG		0.448	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053587.2	NM_032012		6	65	0	0	0	0.001168	0	6	65				
KIAA1958	158405	broad.mit.edu	37	9	115421717	115421717	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:115421717A>T	ENST00000337530.6	+	4	1815	c.1519A>T	c.(1519-1521)Acc>Tcc	p.T507S	KIAA1958_ENST00000536272.1_Missense_Mutation_p.T535S	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	507										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						CAGCTCCTCCACCAAGAAACT	0.582																																							uc004bgf.1		NA																	0				skin(1)	1						c.(1519-1521)ACC>TCC		hypothetical protein LOC158405							46.0	42.0	43.0					9																	115421717		2203	4300	6503	SO:0001583	missense	158405							g.chr9:115421717A>T	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1519A>T	9.37:g.115421717A>T	ENSP00000336940:p.Thr507Ser		Somatic				KIAA1958_uc011lwx.1_Missense_Mutation_p.T535S	p.T507S	NM_133465	NP_597722	WXS	Illumina HiSeq	Unspecified	Q8N8K9	K1958_HUMAN			4	1694	+			507					B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	ENST00000337530.6	37	c.1519A>T	CCDS35108.1	.	.	.	.	.	.	.	.	.	.	A	9.072	0.997204	0.19043	.	.	ENSG00000165185	ENST00000337530;ENST00000536272	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	T	0.15825	0.0381	N	0.03608	-0.345	0.21184	N	0.999767	B;B	0.12013	0.005;0.001	B;B	0.08055	0.003;0.001	T	0.16719	-1.0393	8	0.08599	T	0.76	.	10.5309	0.44975	0.8555:0.0:0.0:0.1445	.	535;507	B7ZKW6;Q8N8K9	.;K1958_HUMAN	S	507;535	.	ENSP00000336940:T507S	T	+	1	0	KIAA1958	114461538	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.496000	0.53288	2.101000	0.63845	0.533000	0.62120	ACC		0.582	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465		5	30	0	0	0	0.000602	0	5	30				
ZNF618	114991	broad.mit.edu	37	9	116811305	116811305	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:116811305C>A	ENST00000374126.5	+	15	1822	c.1723C>A	c.(1723-1725)Cac>Aac	p.H575N	ZNF618_ENST00000288466.7_Missense_Mutation_p.H482N|ZNF618_ENST00000470105.1_3'UTR			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	575					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						CGAGGGCAACCACATCAAGAG	0.597																																							uc004bid.2		NA																	0					0						c.(1723-1725)CAC>AAC		zinc finger protein 618							44.0	46.0	46.0					9																	116811305		2191	4282	6473	SO:0001583	missense	114991				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:116811305C>A	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.1723C>A	9.37:g.116811305C>A	ENSP00000363241:p.His575Asn		Somatic				ZNF618_uc004bic.2_Missense_Mutation_p.H482N|ZNF618_uc011lxi.1_Missense_Mutation_p.H542N|ZNF618_uc011lxj.1_Missense_Mutation_p.H543N|ZNF618_uc010mvb.2_Missense_Mutation_p.H165N	p.H575N	NM_133374	NP_588615	WXS	Illumina HiSeq	Unspecified	Q5T7W0	ZN618_HUMAN			15	1822	+			575					B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Missense_Mutation	SNP	ENST00000374126.5	37	c.1723C>A		.	.	.	.	.	.	.	.	.	.	C	11.90	1.776600	0.31411	.	.	ENSG00000157657	ENST00000374126;ENST00000288466	T;T	0.22336	1.96;1.96	4.93	4.93	0.64822	Ribonuclease H-like (1);	0.174068	0.51477	D	0.000091	T	0.20292	0.0488	.	.	.	0.37105	D	0.900074	B;B;B	0.30634	0.255;0.255;0.288	B;B;B	0.27380	0.038;0.053;0.079	T	0.10337	-1.0634	9	0.45353	T	0.12	-24.1198	17.496	0.87717	0.0:1.0:0.0:0.0	.	542;575;482	B9EG82;Q5T7W0;Q5T7W0-2	.;ZN618_HUMAN;.	N	575;482	ENSP00000363241:H575N;ENSP00000288466:H482N	ENSP00000288466:H482N	H	+	1	0	ZNF618	115851126	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.294000	0.51787	2.440000	0.82611	0.462000	0.41574	CAC		0.597	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053749.1	XM_054983		19	40	1	0	2.94398e-08	0.007413	3.63506e-08	19	40				
TLR4	7099	broad.mit.edu	37	9	120474958	120474958	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:120474958C>A	ENST00000355622.6	+	3	653	c.552C>A	c.(550-552)agC>agA	p.S184R	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.S144R	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	184					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ACCTTTCCAGCAACAAGATTC	0.383																																							uc004bjz.2		NA																	0				lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(550-552)AGC>AGA		toll-like receptor 4 precursor							86.0	94.0	91.0					9																	120474958		2203	4299	6502	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120474958C>A	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.552C>A	9.37:g.120474958C>A	ENSP00000363089:p.Ser184Arg		Somatic				TLR4_uc004bka.2_Missense_Mutation_p.S144R|TLR4_uc004bkb.2_5'UTR	p.S184R	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	843	+			184			Extracellular (Potential).|LRR 6.		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.552C>A	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	C	2.654	-0.281370	0.05642	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.09723	2.95;2.95	5.35	-3.3	0.05003	.	1.132960	0.06465	N	0.730097	T	0.07098	0.0180	L	0.33245	0.995	0.19945	N	0.999946	P	0.39391	0.671	B	0.40329	0.326	T	0.34675	-0.9819	10	0.18276	T	0.48	.	2.2461	0.04032	0.1856:0.342:0.1026:0.3698	.	184	O00206	TLR4_HUMAN	R	144;184	ENSP00000377997:S144R;ENSP00000363089:S184R	ENSP00000363089:S184R	S	+	3	2	TLR4	119514779	0.001000	0.12720	0.458000	0.27068	0.021000	0.10359	-0.342000	0.07801	-0.215000	0.10063	-1.147000	0.01851	AGC		0.383	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		31	85	1	0	1.7881e-09	0.008361	2.28287e-09	31	85				
MORN5	254956	broad.mit.edu	37	9	124936822	124936822	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:124936822G>T	ENST00000373764.3	+	4	417	c.355G>T	c.(355-357)Ggc>Tgc	p.G119C	MORN5_ENST00000536616.1_Missense_Mutation_p.G119C|MORN5_ENST00000486801.1_3'UTR	NM_198469.2	NP_940871.2	Q5VZ52	MORN5_HUMAN	MORN repeat containing 5	119										endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	9						AATCCCCAAGGGCTATTACGA	0.463																																							uc004blw.2		NA																	0					0						c.(355-357)GGC>TGC		MORN repeat containing 5							105.0	101.0	103.0					9																	124936822		2203	4300	6503	SO:0001583	missense	254956							g.chr9:124936822G>T	AK128877	CCDS6836.1, CCDS75894.1	9q34.11	2008-06-23	2008-06-23	2008-06-23	ENSG00000185681	ENSG00000185681			17841	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 113"", ""chromosome 9 open reading frame 18"""	C9orf113, C9orf18			Standard	XM_005251878		Approved	FLJ46909	uc004blw.2	Q5VZ52	OTTHUMG00000020599	ENST00000373764.3:c.355G>T	9.37:g.124936822G>T	ENSP00000362869:p.Gly119Cys		Somatic				MORN5_uc011lyn.1_Missense_Mutation_p.G119C|MORN5_uc011lyo.1_Missense_Mutation_p.R81S	p.G119C	NM_198469	NP_940871	WXS	Illumina HiSeq	Unspecified	Q5VZ52	MORN5_HUMAN			4	417	+			119					B7Z7I5|Q6ZQN1	Missense_Mutation	SNP	ENST00000373764.3	37	c.355G>T	CCDS6836.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033638	0.75504	.	.	ENSG00000185681	ENST00000373764;ENST00000536616;ENST00000418632	T;T;T	0.32023	1.86;1.81;1.47	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.64538	0.2607	M	0.90369	3.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.71659	-0.4526	10	0.87932	D	0	-8.2448	17.2786	0.87122	0.0:0.0:1.0:0.0	.	119;119	B7Z7I5;Q5VZ52	.;MORN5_HUMAN	C	119;119;103	ENSP00000362869:G119C;ENSP00000437483:G119C;ENSP00000409949:G103C	ENSP00000362869:G119C	G	+	1	0	MORN5	123976643	1.000000	0.71417	0.303000	0.25071	0.612000	0.37316	5.146000	0.64845	2.672000	0.90937	0.650000	0.86243	GGC		0.463	MORN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053910.2	NM_198469		9	91	1	0	3.09899e-07	0.004482	3.72161e-07	9	91				
OR1J4	26219	broad.mit.edu	37	9	125281709	125281709	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:125281709G>T	ENST00000340750.1	+	1	290	c.290G>T	c.(289-291)tGt>tTt	p.C97F		NM_001004452.1	NP_001004452.1	Q8NGS1	OR1J4_HUMAN	olfactory receptor, family 1, subfamily J, member 4	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	20						TATGCAGGGTGTGTAACTCAG	0.423																																							uc011lyw.1		NA																	0					0						c.(289-291)TGT>TTT		olfactory receptor, family 1, subfamily J,							209.0	196.0	200.0					9																	125281709		2203	4300	6503	SO:0001583	missense	26219				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125281709G>T	X64979	CCDS35122.1	9q33.2	2013-09-20			ENSG00000239590	ENSG00000239590		"""GPCR / Class A : Olfactory receptors"""	8211	protein-coding gene	gene with protein product						1370859	Standard	NM_001004452		Approved	HTPCRX01, HSHTPCRX01	uc011lyw.2	Q8NGS1	OTTHUMG00000020606	ENST00000340750.1:c.290G>T	9.37:g.125281709G>T	ENSP00000343521:p.Cys97Phe		Somatic					p.C97F	NM_001004452	NP_001004452	WXS	Illumina HiSeq	Unspecified	Q8NGS1	OR1J4_HUMAN			1	290	+			97			Extracellular (Potential).		A3KFM0|Q6IEZ3|Q96R89	Missense_Mutation	SNP	ENST00000340750.1	37	c.290G>T	CCDS35122.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608998	0.46527	.	.	ENSG00000197233;ENSG00000239590	ENST00000444856;ENST00000340750	T	0.16897	2.31	5.54	5.54	0.83059	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36338	U	0.002650	T	0.63593	0.2524	H	0.99475	4.585	0.58432	D	0.999999	D	0.89917	1.0	D	0.69142	0.962	T	0.80256	-0.1458	10	0.87932	D	0	.	18.4898	0.90843	0.0:0.0:1.0:0.0	.	97	Q8NGS1	OR1J4_HUMAN	F	263;97	ENSP00000343521:C97F	ENSP00000407987:C263F	C	+	2	0	OR1J2;OR1J4	124321530	1.000000	0.71417	0.120000	0.21714	0.004000	0.04260	5.471000	0.66762	2.902000	0.99343	0.650000	0.86243	TGT		0.423	OR1J4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053936.1			58	136	1	0	2.27459e-33	0.00361	3.67005e-33	58	136				
PDCL	5082	broad.mit.edu	37	9	125582562	125582562	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:125582562C>T	ENST00000259467.4	-	4	873	c.708G>A	c.(706-708)ctG>ctA	p.L236L		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	236					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						TATAGATCAGCAGGGCAGGAA	0.517																																							uc004bmz.1		NA																	0					0						c.(706-708)CTG>CTA		phosducin-like							76.0	68.0	71.0					9																	125582562		2203	4300	6503	SO:0001819	synonymous_variant	5082				signal transduction|visual perception			g.chr9:125582562C>T	AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.708G>A	9.37:g.125582562C>T			Somatic				PDCL_uc004bna.2_3'UTR	p.L236L	NM_005388	NP_005379	WXS	Illumina HiSeq	Unspecified	Q13371	PHLP_HUMAN			4	804	-			236					Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Silent	SNP	ENST00000259467.4	37	c.708G>A	CCDS6845.1																																																																																				0.517	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053956.1	NM_005388		12	67	0	0	0	0.000978	0	12	67				
CRB2	286204	broad.mit.edu	37	9	126133381	126133381	+	Missense_Mutation	SNP	G	G	T	rs372093386		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:126133381G>T	ENST00000373631.3	+	8	1961	c.1960G>T	c.(1960-1962)Gcc>Tcc	p.A654S	CRB2_ENST00000359999.3_Missense_Mutation_p.A654S|CRB2_ENST00000373629.2_Missense_Mutation_p.A322S	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	654	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CTTGGGAGGCGCCCCAAGCTC	0.617																																							uc004bnx.1		NA																	0				ovary(1)	1						c.(1960-1962)GCC>TCC		crumbs homolog 2 precursor							81.0	91.0	87.0					9																	126133381		2203	4300	6503	SO:0001583	missense	286204					extracellular region|integral to membrane|plasma membrane	calcium ion binding	g.chr9:126133381G>T	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.1960G>T	9.37:g.126133381G>T	ENSP00000362734:p.Ala654Ser		Somatic				CRB2_uc004bnw.1_Missense_Mutation_p.A654S	p.A654S	NM_173689	NP_775960	WXS	Illumina HiSeq	Unspecified	Q5IJ48	CRUM2_HUMAN			8	2052	+			654			Extracellular (Potential).|Laminin G-like 2.		A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	c.1960G>T	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	.	0.060	-1.226114	0.01518	.	.	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	T;T;T	0.74526	-0.85;-0.85;-0.85	5.16	-5.86	0.02304	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	1.130590	0.06759	N	0.781497	T	0.42854	0.1221	N	0.03930	-0.32	0.09310	N	1	B;B	0.16802	0.006;0.019	B;B	0.12156	0.003;0.007	T	0.43475	-0.9389	10	0.07813	T	0.8	.	8.2962	0.31986	0.3099:0.0:0.5411:0.149	.	654;654	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	S	654;654;322	ENSP00000353092:A654S;ENSP00000362734:A654S;ENSP00000362732:A322S	ENSP00000353092:A654S	A	+	1	0	CRB2	125173202	0.000000	0.05858	0.038000	0.18304	0.046000	0.14306	-0.010000	0.12743	-0.361000	0.08125	-1.079000	0.02226	GCC		0.617	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689		68	130	1	0	1.77791e-30	0.00361	2.83389e-30	68	130				
DNM1	1759	broad.mit.edu	37	9	131008720	131008720	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:131008720G>T	ENST00000372923.3	+	16	1811	c.1719G>T	c.(1717-1719)cgG>cgT	p.R573R	DNM1_ENST00000475805.1_Silent_p.R573R|MIR199B_ENST00000384849.1_RNA|DNM1_ENST00000393594.3_Silent_p.R573R|DNM1_ENST00000493925.1_3'UTR|MIR3154_ENST00000577829.1_RNA|DNM1_ENST00000341179.7_Silent_p.R573R|DNM1_ENST00000486160.1_Silent_p.R573R	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	573	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						TCAAGCTGCGGGACGTGGAGA	0.562																																					GBM(113;146 1575 2722 28670 29921)	GBM(113;146 1575 2722 28670 29921)	uc011mau.1		NA																	0				ovary(2)	2						c.(1717-1719)CGG>CGT		dynamin 1 isoform 1							208.0	153.0	172.0					9																	131008720		2203	4300	6503	SO:0001819	synonymous_variant	1759				receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity	g.chr9:131008720G>T	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1719G>T	9.37:g.131008720G>T			Somatic				DNM1_uc011mat.1_Silent_p.R573R|DNM1_uc004bub.1_5'UTR|DNM1_uc004buc.1_Silent_p.R40R|DNM1_uc004bud.3_RNA|uc004bue.1_5'Flank|MIR199B_hsa-mir-199b|MI0000282_5'Flank|hsa-mir-3154|MI0014182_5'Flank	p.R573R	NM_004408	NP_004399	WXS	Illumina HiSeq	Unspecified	Q05193	DYN1_HUMAN			16	1806	+			573			PH.		A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Silent	SNP	ENST00000372923.3	37	c.1719G>T	CCDS6895.1																																																																																				0.562	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1	NM_004408		15	44	1	0	6.72482e-11	0.003163	8.84314e-11	15	44				
GOLGA2	2801	broad.mit.edu	37	9	131023512	131023512	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:131023512T>A	ENST00000421699.2	-	16	1290	c.1278A>T	c.(1276-1278)gaA>gaT	p.E426D	GOLGA2_ENST00000609374.1_Missense_Mutation_p.E414D	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	426					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						TCATGCTACATTCCTTCTCCT	0.597																																							uc011maw.1		NA																	0				ovary(1)	1						c.(1276-1278)GAA>GAT		Golgi autoantigen, golgin subfamily a, 2							123.0	121.0	122.0					9																	131023512		2203	4300	6503	SO:0001583	missense	2801					Golgi cisterna membrane	protein binding	g.chr9:131023512T>A	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.1278A>T	9.37:g.131023512T>A	ENSP00000416097:p.Glu426Asp		Somatic				GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004buh.2_5'Flank|GOLGA2_uc004bul.1_Missense_Mutation_p.E327D|uc004bun.2_5'Flank	p.E426D	NM_004486	NP_004477	WXS	Illumina HiSeq	Unspecified	Q08379	GOGA2_HUMAN			16	1291	-			426			Potential.		Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	ENST00000421699.2	37	c.1278A>T	CCDS6896.2	.	.	.	.	.	.	.	.	.	.	t	13.07	2.127502	0.37533	.	.	ENSG00000167110	ENST00000421699;ENST00000450617	T;T	0.25414	1.8;1.8	5.04	-3.11	0.05299	.	0.216546	0.47093	D	0.000244	T	0.16214	0.0390	L	0.52573	1.65	0.09310	N	1	B	0.30146	0.27	B	0.28139	0.086	T	0.18587	-1.0332	10	0.25106	T	0.35	.	6.3484	0.21363	0.0:0.4123:0.2224:0.3652	.	426	Q08379	GOGA2_HUMAN	D	426;453	ENSP00000416097:E426D;ENSP00000409271:E453D	ENSP00000416097:E426D	E	-	3	2	GOLGA2	130063333	0.000000	0.05858	0.023000	0.16930	0.448000	0.32197	-0.380000	0.07427	-0.379000	0.07906	-0.756000	0.03474	GAA		0.597	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486		14	116	0	0	0	0.00499	0	14	116				
TOR1B	27348	broad.mit.edu	37	9	132571214	132571214	+	Silent	SNP	G	G	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:132571214G>T	ENST00000259339.2	+	4	732	c.672G>T	c.(670-672)acG>acT	p.T224T		NM_014506.1	NP_055321.1	O14657	TOR1B_HUMAN	torsin family 1, member B (torsin B)	224					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum organization (GO:0007029)|nuclear membrane organization (GO:0071763)|protein homooligomerization (GO:0051260)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)	12		Ovarian(14;0.0586)				TAACTAAGACGGCTCTTGACT	0.463																																							uc004byk.1		NA																	0					0						c.(670-672)ACG>ACT		torsin family 1, member B (torsin B) precursor							80.0	91.0	87.0					9																	132571214		2203	4300	6503	SO:0001819	synonymous_variant	27348				chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen	ATP binding|nucleoside-triphosphatase activity|unfolded protein binding	g.chr9:132571214G>T	AF007872	CCDS6929.1	9q34	2008-07-21			ENSG00000136816	ENSG00000136816			11995	protein-coding gene	gene with protein product		608050				9288096, 10644435	Standard	NM_014506		Approved	DQ1, MGC4386	uc004byk.1	O14657	OTTHUMG00000020795	ENST00000259339.2:c.672G>T	9.37:g.132571214G>T			Somatic					p.T224T	NM_014506	NP_055321	WXS	Illumina HiSeq	Unspecified	O14657	TOR1B_HUMAN			4	732	+		Ovarian(14;0.0586)	224						Silent	SNP	ENST00000259339.2	37	c.672G>T	CCDS6929.1																																																																																				0.463	TOR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054615.1	NM_014506		48	78	1	0	2.43468e-25	0.00361	3.76659e-25	48	78				
ABL1	25	broad.mit.edu	37	9	133759423	133759424	+	Missense_Mutation	DNP	CG	CG	AA	rs373147618		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:133759423_133759424CG>AA	ENST00000318560.5	+	11	2127_2128	c.1746_1747CG>AA	c.(1744-1749)ggCGgc>ggAAgc	p.G583S		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	583					actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	CCCCGGAGGGCGGCCTGAATGA	0.554			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																		uc004bzw.2		NA		Dom	yes		9	9q34.1	25	T|Mis	v-abl Abelson murine leukemia viral oncogene homolog 1			L	BCR|ETV6|NUP214		CML|ALL|T-ALL		0				haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817						c.(1744-1749)GGCGGC>GGAAGC		c-abl oncogene 1, receptor tyrosine kinase	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)																																			SO:0001583	missense	25				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding	g.chr9:133759423_133759424CG>AA	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	Exception_encountered	9.37:g.133759423_133759424delinsAA	ENSP00000323315:p.Gly583Ser		Somatic				ABL1_uc004bzv.2_Missense_Mutation_p.G602S	p.G583S	NM_005157	NP_005148	WXS	Illumina HiSeq	Unspecified	P00519	ABL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	11	1749_1750	+		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)	583					A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	DNP	ENST00000318560.5	37	c.1746_1747CG>AA	CCDS35166.1																																																																																				0.554	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313		39	163	0	0	0	0.004672	0	39	163				
NTNG2	84628	broad.mit.edu	37	9	135116431	135116431	+	Splice_Site	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:135116431C>A	ENST00000393229.3	+	7	2133	c.1357C>A	c.(1357-1359)Ccc>Acc	p.P453T	NTNG2_ENST00000490694.1_3'UTR|NTNG2_ENST00000393228.4_Splice_Site_p.P445T|NTNG2_ENST00000360670.3_Splice_Site_p.P459T	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	453	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GGGCTGCTACCGTGAGTGCGC	0.761																																							uc004cbh.2		NA																	0					0						c.(1357-1359)CCC>ACC		netrin G2 precursor							12.0	12.0	12.0					9																	135116431		2181	4277	6458	SO:0001630	splice_region_variant	84628				axonogenesis	anchored to plasma membrane		g.chr9:135116431C>A	AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.1357+1C>A	9.37:g.135116431C>A			Somatic					p.P453T	NM_032536	NP_115925	WXS	Illumina HiSeq	Unspecified	Q96CW9	NTNG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)	7	2133	+			453			Laminin EGF-like 3.		Q5JUJ2|Q6UXY0|Q96JH0	Missense_Mutation	SNP	ENST00000393229.3	37	c.1357C>A	CCDS6946.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609043	0.87258	.	.	ENSG00000196358	ENST00000393229;ENST00000393228;ENST00000360670	T;T;T	0.62232	0.04;0.04;0.04	4.2	4.2	0.49525	EGF-like, laminin (2);Epidermal growth factor-like, type 3 (1);	0.079694	0.49916	U	0.000127	T	0.80834	0.4699	M	0.88181	2.935	0.80722	D	1	D	0.63046	0.992	D	0.64877	0.93	D	0.85330	0.1089	10	0.62326	D	0.03	.	15.9079	0.79445	0.0:1.0:0.0:0.0	.	453	Q96CW9	NTNG2_HUMAN	T	453;445;459	ENSP00000376921:P453T;ENSP00000376920:P445T;ENSP00000353888:P459T	ENSP00000353888:P459T	P	+	1	0	NTNG2	134106252	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.543000	0.67225	2.051000	0.60960	0.491000	0.48974	CCC		0.761	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	NM_032536	Missense_Mutation	6	12	1	0	4.096e-09	0.001168	5.16666e-09	6	12				
CELP	1057	broad.mit.edu	37	9	135961698	135961698	+	RNA	SNP	A	A	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:135961698A>G	ENST00000411440.2	+	0	533					NR_001275.2				carboxyl ester lipase pseudogene																		ATGCCCGTCTACCCCAAATGG	0.617																																							uc011mcu.1		NA																	0					0						c.(439-441)TAC>TGC		Homo sapiens cDNA FLJ25862 fis, clone CBR01781.																																						1057							g.chr9:135961698A>G	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135961698A>G			Somatic					p.Y147C	NR_001275		WXS	Illumina HiSeq	Unspecified					4	533	+									Missense_Mutation	SNP	ENST00000411440.2	37	c.440A>G																																																																																					0.617	CELP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000339837.1	NM_001808		8	28	0	0	0	0.004482	0	8	28				
VAV2	7410	broad.mit.edu	37	9	136661611	136661611	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:136661611C>G	ENST00000371850.3	-	11	1003	c.972G>C	c.(970-972)aaG>aaC	p.K324N	VAV2_ENST00000371851.1_Missense_Mutation_p.K319N|VAV2_ENST00000406606.3_Missense_Mutation_p.K319N	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	324	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GGTCTTGCAGCTTAAATTTTC	0.612																																							uc004ces.2		NA																	0				central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						c.(970-972)AAG>AAC		vav 2 guanine nucleotide exchange factor isoform							95.0	80.0	85.0					9																	136661611		2203	4300	6503	SO:0001583	missense	7410				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity	g.chr9:136661611C>G		CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.972G>C	9.37:g.136661611C>G	ENSP00000360916:p.Lys324Asn		Somatic				VAV2_uc004cer.2_Missense_Mutation_p.K319N	p.K324N	NM_001134398	NP_001127870	WXS	Illumina HiSeq	Unspecified	P52735	VAV2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)	11	1018	-			324			DH.		A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	ENST00000371850.3	37	c.972G>C	CCDS48053.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.647969	0.29336	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	T;T;T	0.68025	-0.3;-0.3;-0.3	4.24	0.679	0.17975	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.62097	0.2400	N	0.11698	0.16	0.58432	D	0.999998	D;P	0.71674	0.998;0.864	D;P	0.71656	0.974;0.62	T	0.57825	-0.7744	10	0.33940	T	0.23	.	11.2678	0.49120	0.0:0.6247:0.0:0.3753	.	324;319	P52735;P52735-3	VAV2_HUMAN;.	N	324;319;319;319	ENSP00000360916:K324N;ENSP00000360917:K319N;ENSP00000385362:K319N	ENSP00000317258:K319N	K	-	3	2	VAV2	135651432	1.000000	0.71417	0.997000	0.53966	0.103000	0.19146	1.233000	0.32648	0.047000	0.15862	-1.598000	0.00824	AAG		0.612	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1			9	31	0	0	0	0.000978	0	9	31				
COL5A1	1289	broad.mit.edu	37	9	137716610	137716610	+	Silent	SNP	G	G	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:137716610G>A	ENST00000371817.3	+	62	5277	c.4863G>A	c.(4861-4863)gaG>gaA	p.E1621E		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1621	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TGAAGCTGGAGATTGAGCAGA	0.627																																							uc004cfe.2		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11						c.(4861-4863)GAG>GAA		alpha 1 type V collagen preproprotein							70.0	62.0	65.0					9																	137716610		2203	4300	6503	SO:0001819	synonymous_variant	1289				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	g.chr9:137716610G>A	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4863G>A	9.37:g.137716610G>A			Somatic				uc004cff.2_Intron	p.E1621E	NM_000093	NP_000084	WXS	Illumina HiSeq	Unspecified	P20908	CO5A1_HUMAN		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	62	5245	+		Myeloproliferative disorder(178;0.0341)	1621			Fibrillar collagen NC1.		Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	37	c.4863G>A	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.254347	0.22965	.	.	ENSG00000130635	ENST00000371820	.	.	.	4.16	2.95	0.34219	.	.	.	.	.	T	0.45716	0.1356	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41680	-0.9495	4	.	.	.	.	3.2628	0.06854	0.448:0.0:0.552:0.0	.	.	.	.	N	41	.	.	D	+	1	0	COL5A1	136856431	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.167000	0.64972	2.065000	0.61736	0.539000	0.68188	GAT		0.627	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		5	65	0	0	0	0.000602	0	5	65				
OLFM1	10439	broad.mit.edu	37	9	138011928	138011928	+	Silent	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr9:138011928C>T	ENST00000371793.3	+	6	1613	c.1362C>T	c.(1360-1362)taC>taT	p.Y454Y	OLFM1_ENST00000371796.3_Silent_p.Y427Y|OLFM1_ENST00000252854.4_Silent_p.Y436Y	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	454	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		TGCTGGACTACAACCCCAAGG	0.537																																							uc010nar.2		NA																	0				ovary(1)|skin(1)	2						c.(1360-1362)TAC>TAT		olfactomedin related ER localized protein							131.0	118.0	122.0					9																	138011928		2203	4300	6503	SO:0001819	synonymous_variant	10439				nervous system development	endoplasmic reticulum lumen	protein binding	g.chr9:138011928C>T	AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1362C>T	9.37:g.138011928C>T			Somatic				OLFM1_uc004cfl.3_Silent_p.Y436Y|OLFM1_uc004cfn.3_Silent_p.Y205Y	p.Y454Y	NM_014279	NP_055094	WXS	Illumina HiSeq	Unspecified	Q99784	NOE1_HUMAN		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)	6	1678	+		Myeloproliferative disorder(178;0.0333)	454			Olfactomedin-like.		Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Silent	SNP	ENST00000371793.3	37	c.1362C>T																																																																																					0.537	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279		25	106	0	0	0	0.00278	0	25	106				
NLGN4X	57502	broad.mit.edu	37	X	5821840	5821840	+	Silent	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chrX:5821840C>A	ENST00000381095.3	-	5	1506	c.879G>T	c.(877-879)ccG>ccT	p.P293P	NLGN4X_ENST00000381093.2_Silent_p.P313P|NLGN4X_ENST00000538097.1_Silent_p.P293P|NLGN4X_ENST00000381092.1_Silent_p.P293P|NLGN4X_ENST00000275857.6_Silent_p.P293P	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	293					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TGTACTTGGCCGGCTGGTAGT	0.542																																							uc010ndh.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(877-879)CCG>CCT		X-linked neuroligin 4 precursor							103.0	79.0	87.0					X																	5821840		2203	4300	6503	SO:0001819	synonymous_variant	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5821840C>A	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.879G>T	X.37:g.5821840C>A			Somatic				NLGN4X_uc004crp.2_Silent_p.P313P|NLGN4X_uc004crq.2_Silent_p.P293P|NLGN4X_uc010ndi.2_Silent_p.P330P|NLGN4X_uc004crr.2_Silent_p.P293P|NLGN4X_uc010ndj.2_Silent_p.P293P	p.P293P	NM_181332	NP_851849	WXS	Illumina HiSeq	Unspecified	Q8N0W4	NLGNX_HUMAN			5	1380	-			293			Extracellular (Potential).		Q6UX10|Q9ULG0	Silent	SNP	ENST00000381095.3	37	c.879G>T	CCDS14126.1																																																																																				0.542	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		19	28	1	0	5.3912e-06	0.006122	6.2462e-06	19	28				
GLRA2	2742	broad.mit.edu	37	X	14625333	14625333	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chrX:14625333C>A	ENST00000218075.4	+	6	1188	c.658C>A	c.(658-660)Cag>Aag	p.Q220K	GLRA2_ENST00000355020.4_Missense_Mutation_p.Q220K|GLRA2_ENST00000443437.2_Missense_Mutation_p.Q131K	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	220					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	GACCCTGCCCCAGTTTATTTT	0.388																																							uc010nep.2		NA																	0				ovary(1)|lung(1)	2						c.(658-660)CAG>AAG		glycine receptor, alpha 2 isoform A	Ethanol(DB00898)|Glycine(DB00145)						147.0	135.0	139.0					X																	14625333		2203	4300	6503	SO:0001583	missense	2742				neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chrX:14625333C>A		CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.658C>A	X.37:g.14625333C>A	ENSP00000218075:p.Gln220Lys		Somatic				GLRA2_uc010neq.2_Missense_Mutation_p.Q220K|GLRA2_uc004cwe.3_Missense_Mutation_p.Q220K|GLRA2_uc011mio.1_Missense_Mutation_p.Q131K|GLRA2_uc011mip.1_Missense_Mutation_p.Q198K	p.Q220K	NM_001118885	NP_001112357	WXS	Illumina HiSeq	Unspecified	P23416	GLRA2_HUMAN			7	990	+	Hepatocellular(33;0.128)		220			Extracellular (Probable).		A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	ENST00000218075.4	37	c.658C>A	CCDS14160.1	.	.	.	.	.	.	.	.	.	.	C	31	5.104485	0.94245	.	.	ENSG00000101958	ENST00000443437;ENST00000218075;ENST00000355020;ENST00000415367	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.41	5.41	0.78517	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.90208	0.6939	M	0.89353	3.025	0.80722	D	1	D;P;D	0.67145	0.996;0.843;0.987	D;P;P	0.83275	0.996;0.893;0.828	D	0.91638	0.5324	10	0.62326	D	0.03	.	18.4764	0.90793	0.0:1.0:0.0:0.0	.	204;220;220	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	K	131;220;220;204	ENSP00000387756:Q131K;ENSP00000218075:Q220K;ENSP00000347123:Q220K;ENSP00000391606:Q204K	ENSP00000218075:Q220K	Q	+	1	0	GLRA2	14535254	1.000000	0.71417	0.973000	0.42090	0.993000	0.82548	7.701000	0.84566	2.391000	0.81399	0.600000	0.82982	CAG		0.388	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055829.1			31	31	1	0	7.11191e-15	0.002836	1.00291e-14	31	31				
SATL1	340562	broad.mit.edu	37	X	84362581	84362581	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chrX:84362581C>A	ENST00000395409.3	-	1	1393	c.833G>T	c.(832-834)aGt>aTt	p.S278I	SATL1_ENST00000509231.1_Missense_Mutation_p.S465I|SATL1_ENST00000332921.5_Missense_Mutation_p.S278I			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	278	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						TTGGTTCTTACTTGATTGGCT	0.582																																							uc011mqx.1		NA																	0				breast(2)	2						c.(1393-1395)AGT>ATT		spermidine/spermine N1-acetyl transferase-like 1							136.0	106.0	116.0					X																	84362581		2203	4300	6503	SO:0001583	missense	340562						N-acetyltransferase activity	g.chrX:84362581C>A	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.833G>T	X.37:g.84362581C>A	ENSP00000378804:p.Ser278Ile		Somatic				SATL1_uc004een.2_Missense_Mutation_p.S465I	p.S465I	NM_001163541	NP_001157013	WXS	Illumina HiSeq	Unspecified	Q86VE3	SATL1_HUMAN			1	1394	-			278			Gln-rich.		A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	ENST00000395409.3	37	c.1394G>T		.	.	.	.	.	.	.	.	.	.	C	9.389	1.075052	0.20227	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.43688	0.94;0.94;0.94	3.72	-2.42	0.06542	.	1.470830	0.04808	N	0.434726	T	0.21509	0.0518	N	0.14661	0.345	0.09310	N	1	B;B	0.33379	0.41;0.004	B;B	0.31812	0.136;0.004	T	0.06481	-1.0824	10	0.40728	T	0.16	-0.0107	1.2338	0.01949	0.1492:0.2865:0.1456:0.4188	.	278;465	Q86VE3;E9PB72	SATL1_HUMAN;.	I	278;278;465	ENSP00000378804:S278I;ENSP00000329115:S278I;ENSP00000425421:S465I	ENSP00000329115:S278I	S	-	2	0	SATL1	84249237	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.675000	0.05227	-0.919000	0.03803	0.600000	0.82982	AGT		0.582	SATL1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_291339		22	52	1	0	2.89027e-11	0.002299	3.83909e-11	22	52				
GABRA3	2556	broad.mit.edu	37	X	151366116	151366116	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chrX:151366116C>A	ENST00000370314.4	-	8	1158	c.920G>T	c.(919-921)cGt>cTt	p.R307L	GABRA3_ENST00000535043.1_Missense_Mutation_p.R307L	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	307					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	AAAGACTGTACGGGCAGGAAC	0.463																																					NSCLC(142;2578 2613 10251 16743)	NSCLC(142;2578 2613 10251 16743)	uc010ntk.1		NA																	0				ovary(1)	1						c.(919-921)CGT>CTT		gamma-aminobutyric acid A receptor, alpha 3	Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						136.0	107.0	117.0					X																	151366116		2203	4300	6503	SO:0001583	missense	2556				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chrX:151366116C>A		CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.920G>T	X.37:g.151366116C>A	ENSP00000359337:p.Arg307Leu		Somatic					p.R307L	NM_000808	NP_000799	WXS	Illumina HiSeq	Unspecified	P34903	GBRA3_HUMAN			8	1160	-	Acute lymphoblastic leukemia(192;6.56e-05)		307			Helical; (Probable).		Q8TAF9	Missense_Mutation	SNP	ENST00000370314.4	37	c.920G>T	CCDS14706.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.237970	0.79800	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	D;D;D	0.88509	-2.39;-2.39;-2.39	4.98	4.98	0.66077	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95999	0.8697	H	0.95187	3.635	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.97232	0.9885	10	0.87932	D	0	.	14.6645	0.68896	0.0:1.0:0.0:0.0	.	307	P34903	GBRA3_HUMAN	L	307	ENSP00000359337:R307L;ENSP00000359334:R307L;ENSP00000443527:R307L	ENSP00000359334:R307L	R	-	2	0	GABRA3	151116772	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	7.770000	0.85390	2.043000	0.60533	0.538000	0.68166	CGT		0.463	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808		37	10	1	0	3.3946e-10	0.005524	4.45277e-10	37	10				
HCFC1	3054	broad.mit.edu	37	X	153225260	153225260	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chrX:153225260C>G	ENST00000310441.7	-	8	2403	c.1437G>C	c.(1435-1437)agG>agC	p.R479S	HCFC1_ENST00000461098.1_5'Flank|HCFC1_ENST00000369984.4_Missense_Mutation_p.R479S|HCFC1_ENST00000354233.3_Missense_Mutation_p.R410S	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	479					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCTTGAGTCCTGGCTGCGG	0.677																																							uc004fjp.2		NA																	0				ovary(2)	2						c.(1435-1437)AGG>AGC		host cell factor 1							41.0	46.0	44.0					X																	153225260		2032	4173	6205	SO:0001583	missense	3054				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chrX:153225260C>G		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.1437G>C	X.37:g.153225260C>G	ENSP00000309555:p.Arg479Ser		Somatic					p.R479S	NM_005334	NP_005325	WXS	Illumina HiSeq	Unspecified	P51610	HCFC1_HUMAN			8	1965	-	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		479					Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	37	c.1437G>C	CCDS44020.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797811	0.31777	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.02916	4.11;4.13;4.11	5.3	4.38	0.52667	Fibronectin, type III (1);	0.060817	0.64402	D	0.000005	T	0.02230	0.0069	L	0.29908	0.895	0.33348	D	0.570726	B	0.22080	0.064	B	0.17722	0.019	T	0.30966	-0.9960	10	0.15499	T	0.54	.	7.0749	0.25199	0.2881:0.5562:0.1557:0.0	.	479	P51610	HCFC1_HUMAN	S	479;479;410	ENSP00000309555:R479S;ENSP00000359001:R479S;ENSP00000346174:R410S	ENSP00000309555:R479S	R	-	3	2	HCFC1	152878454	0.994000	0.37717	0.999000	0.59377	0.696000	0.40369	0.137000	0.15995	2.202000	0.70862	0.544000	0.68410	AGG		0.677	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334		27	15	0	0	0	0.00632	0	27	15				
FLNA	2316	broad.mit.edu	37	X	153577387	153577387	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chrX:153577387C>T	ENST00000369850.3	-	48	8010	c.7774G>A	c.(7774-7776)Gtg>Atg	p.V2592M	FLNA_ENST00000369856.3_Missense_Mutation_p.V725M|FLNA_ENST00000498491.1_5'UTR|FLNA_ENST00000344736.4_Missense_Mutation_p.V2552M|FLNA_ENST00000360319.4_Missense_Mutation_p.V2584M|FLNA_ENST00000422373.1_Missense_Mutation_p.V2584M	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	2592	Self-association site, tail.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGAACCCCCACCAGCAGCATG	0.642																																							uc004fkk.2		NA																	0				breast(6)	6						c.(7774-7776)GTG>ATG		filamin A, alpha isoform 2							37.0	40.0	39.0					X																	153577387		2062	4184	6246	SO:0001583	missense	2316				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding	g.chrX:153577387C>T	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.7774G>A	X.37:g.153577387C>T	ENSP00000358866:p.Val2592Met		Somatic				FLNA_uc004fki.2_Missense_Mutation_p.V632M|FLNA_uc011mzn.1_Missense_Mutation_p.V725M|FLNA_uc010nuu.1_Missense_Mutation_p.V2584M	p.V2592M	NM_001110556	NP_001104026	WXS	Illumina HiSeq	Unspecified	P21333	FLNA_HUMAN			48	8023	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		2592			Self-association site, tail.|Filamin 24.		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	c.7774G>A	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.469596	0.84533	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000369856;ENST00000344736	D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45	5.74	4.88	0.63580	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	D	0.94434	0.8209	M	0.83852	2.665	0.53688	D	0.999979	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.91635	0.994;0.972;0.999;0.999	D	0.94820	0.7986	10	0.87932	D	0	.	13.909	0.63855	0.0:0.9253:0.0:0.0747	.	725;2584;2592;2592	E9PHF0;P21333-2;P21333;E9KL45	.;.;FLNA_HUMAN;.	M	2584;2260;2584;2592;725;2552	ENSP00000353467:V2584M;ENSP00000416926:V2584M;ENSP00000358866:V2592M;ENSP00000358872:V725M;ENSP00000358863:V2552M	ENSP00000358863:V2552M	V	-	1	0	FLNA	153230581	1.000000	0.71417	0.998000	0.56505	0.894000	0.52154	7.805000	0.86005	1.199000	0.43173	0.529000	0.55759	GTG		0.642	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			6	8	0	0	0	0.001168	0	6	8				
SLC18A3	6572	broad.mit.edu	37	10	50819100	50819100	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr10:50819100delG	ENST00000374115.3	+	1	754	c.314delG	c.(313-315)tggfs	p.W105fs	CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000337653.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	105					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						ACAGCTGCGTGGCCAGCGGGC	0.677																																							uc001jhw.2		NA																	0				ovary(2)	2						c.(313-315)TGGfs		vesicular acetylcholine transporter							47.0	49.0	49.0					10																	50819100		2202	4300	6502	SO:0001589	frameshift_variant	6572				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity	g.chr10:50819100delG	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.314delG	10.37:g.50819100delG	ENSP00000363229:p.Trp105fs		Somatic				CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank	p.W105fs	NM_003055	NP_003046	WXS	Illumina HiSeq	Unspecified	Q16572	VACHT_HUMAN			1	754	+			105			Lumenal, vesicle (Potential).		B2R7S1	Frame_Shift_Del	DEL	ENST00000374115.3	37	c.314delG	CCDS7231.1																																																																																				0.677	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		24	82	NA	NA	NA	NA	NA	24	82	---	---	---	---
YBX3	8531	broad.mit.edu	37	12	10854578	10854578	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:10854578delG	ENST00000228251.4	-	8	1234	c.1034delC	c.(1033-1035)cctfs	p.P345fs	YBX3_ENST00000279550.7_Frame_Shift_Del_p.P276fs|YBX3_ENST00000546164.1_5'UTR	NM_003651.4	NP_003642.3	P16989	YBOX3_HUMAN	Y box binding protein 3	345					3'-UTR-mediated mRNA stabilization (GO:0070935)|cellular hyperosmotic response (GO:0071474)|cellular response to tumor necrosis factor (GO:0071356)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of necroptotic process (GO:0060546)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoplasmic translation (GO:2000767)|positive regulation of organ growth (GO:0046622)|response to cold (GO:0009409)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|tight junction (GO:0005923)	double-stranded DNA binding (GO:0003690)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|Rho GTPase binding (GO:0017048)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)										ATCTTGTGAAGGAGCGTTAGG	0.507																																							uc001qyt.2		NA																	0				ovary(2)|lung(1)|large_intestine(1)	4						c.(1033-1035)CCTfs		cold shock domain protein A isoform a							212.0	205.0	207.0					12																	10854578		2203	4300	6503	SO:0001589	frameshift_variant	8531				negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr12:10854578delG	L29064	CCDS8630.1, CCDS44831.1	12p13.1	2013-03-13	2013-03-13	2013-03-13	ENSG00000060138	ENSG00000060138			2428	protein-coding gene	gene with protein product	"""cold-shock domain containing A1"""	603437	"""cold shock domain protein A"""	CSDA		2977358, 8710501	Standard	NM_003651		Approved	dbpA, ZONAB, CSDA1	uc001qyt.3	P16989	OTTHUMG00000168409	ENST00000228251.4:c.1034delC	12.37:g.10854578delG	ENSP00000228251:p.Pro345fs		Somatic				CSDA_uc001qyu.2_Frame_Shift_Del_p.P276fs	p.P345fs	NM_003651	NP_003642	WXS	Illumina HiSeq	Unspecified	P16989	DBPA_HUMAN			8	1277	-	Glioma(1;0.155)		345					B2RBW6|Q14121|Q969N6|Q96B76	Frame_Shift_Del	DEL	ENST00000228251.4	37	c.1034delC	CCDS8630.1																																																																																				0.507	YBX3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399628.1	NM_003651		11	382	NA	NA	NA	NA	NA	11	382	---	---	---	---
DDX11	1663	broad.mit.edu	37	12	31242861	31242862	+	In_Frame_Ins	INS	-	-	GGC	rs200751040|rs531309221	byFrequency	TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr12:31242861_31242862insGGC	ENST00000407793.2	+	9	1173_1174	c.922_923insGGC	c.(922-924)agg>aGGCgg	p.308_308R>RR	DDX11_ENST00000228264.6_In_Frame_Ins_p.282_282R>RR|DDX11_ENST00000350437.4_In_Frame_Ins_p.308_308R>RR|DDX11_ENST00000545668.1_In_Frame_Ins_p.308_308R>RR|DDX11_ENST00000542838.1_In_Frame_Ins_p.308_308R>RR|DDX11_ENST00000251758.5_3'UTR	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	308	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.R308R(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					AAAGAGGAGGAGGCAGGAGAAG	0.589										Multiple Myeloma(12;0.14)				32	0.00638978	0.0234	0.0014	5008	,	,		20906	0.0		0.0	False		,,,				2504	0.0						uc001rjt.1		NA																	2	Substitution - coding silent(2)		kidney(2)	breast(3)	3						c.(922-924)AGG>AGGCGG		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11			,,	77,3553		0,77,1738					,,	-8.0	0.0			6	8,7262		0,8,3627	no	coding,coding,coding	DDX11	NM_152438.1,NM_030653.3,NM_004399.2	,,	0,85,5365	A1A1,A1R,RR		0.11,2.1212,0.7798	,,	,,		85,10815				SO:0001652	inframe_insertion	1663				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding	g.chr12:31242861_31242862insGGC	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.923_925dupGGC	12.37:g.31242862_31242864dupGGC	ENSP00000384703:p.Arg308dup	Multiple Myeloma(12;0.14)	Somatic				DDX11_uc010sjw.1_3'UTR|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_In_Frame_Ins_p.308_308R>RR|DDX11_uc001rjs.1_In_Frame_Ins_p.308_308R>RR|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_In_Frame_Ins_p.308_308R>RR|DDX11_uc001rjw.1_In_Frame_Ins_p.282_282R>RR|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_RNA	p.308_308R>RR	NM_152438	NP_689651	WXS	Illumina HiSeq	Unspecified	Q96FC9	DDX11_HUMAN			9	1173_1174	+	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)		308			Helicase ATP-binding.		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	In_Frame_Ins	INS	ENST00000407793.2	37	c.922_923insGGC	CCDS44856.1																																																																																				0.589	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653		11	18	NA	NA	NA	NA	NA	11	18	---	---	---	---
KLHL1	57626	broad.mit.edu	37	13	70314545	70314545	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr13:70314545delC	ENST00000377844.4	-	8	2542	c.1783delG	c.(1783-1785)gtafs	p.V595fs	KLHL1_ENST00000545028.1_Frame_Shift_Del_p.V402fs	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	595					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		AATGCTGCTACACCAACTGTG	0.333																																							uc001vip.2		NA																	0					0						c.(1783-1785)GTAfs		kelch-like 1 protein							84.0	73.0	77.0					13																	70314545		2203	4300	6503	SO:0001589	frameshift_variant	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70314545delC	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1783delG	13.37:g.70314545delC	ENSP00000367075:p.Val595fs		Somatic				KLHL1_uc010thm.1_Frame_Shift_Del_p.V534fs	p.V595fs	NM_020866	NP_065917	WXS	Illumina HiSeq	Unspecified	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	8	2577	-		Breast(118;0.000162)	595			Kelch 3.		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Frame_Shift_Del	DEL	ENST00000377844.4	37	c.1783delG	CCDS9445.1																																																																																				0.333	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		8	31	NA	NA	NA	NA	NA	8	31	---	---	---	---
ARID4A	5926	broad.mit.edu	37	14	58830971	58830972	+	Frame_Shift_Ins	INS	-	-	A			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr14:58830971_58830972insA	ENST00000355431.3	+	20	2537_2538	c.2164_2165insA	c.(2164-2166)gaafs	p.E722fs	ARID4A_ENST00000431317.2_Frame_Shift_Ins_p.E722fs|ARID4A_ENST00000348476.3_Frame_Shift_Ins_p.E722fs|ARID4A_ENST00000395168.3_Frame_Shift_Ins_p.E722fs	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	722					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AGATGAACTAGAAAAAAATGAA	0.277																																							uc001xdp.2		NA																	0				ovary(3)|skin(2)|lung(1)	6						c.(2164-2166)GAAfs		retinoblastoma-binding protein 1 isoform I																																				SO:0001589	frameshift_variant	5926				negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:58830971_58830972insA	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2171dupA	14.37:g.58830978_58830978dupA	ENSP00000347602:p.Glu722fs		Somatic				ARID4A_uc001xdo.2_Frame_Shift_Ins_p.E722fs|ARID4A_uc001xdq.2_Frame_Shift_Ins_p.E722fs|ARID4A_uc010apg.1_Frame_Shift_Ins_p.E400fs	p.E722fs	NM_002892	NP_002883	WXS	Illumina HiSeq	Unspecified	P29374	ARI4A_HUMAN			20	2418_2419	+			722					Q15991|Q15992|Q15993	Frame_Shift_Ins	INS	ENST00000355431.3	37	c.2164_2165insA	CCDS9732.1																																																																																				0.277	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001		13	66	NA	NA	NA	NA	NA	13	66	---	---	---	---
SPECC1	92521	broad.mit.edu	37	17	20209395	20209395	+	Splice_Site	DEL	G	G	-			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr17:20209395delG	ENST00000261503.5	+	14	3168	c.3117delG	c.(3115-3117)ctg>ct	p.L1039fs	SPECC1_ENST00000395527.4_Splice_Site_p.L1039fs|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395530.2_Splice_Site_p.L958fs|SPECC1_ENST00000536879.1_Splice_Site_p.L379fs	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	1039	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AACCCAGCCTGGTACGTATCC	0.358																																							uc002gwq.2		NA																	0					0						c.(3115-3117)CTGfs		spectrin domain with coiled-coils 1 NSP5b3b							152.0	144.0	147.0					17																	20209395		2203	4300	6503	SO:0001630	splice_region_variant	92521					nucleus		g.chr17:20209395delG	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.3117+1G>-	17.37:g.20209395delG			Somatic				CYTSB_uc002gws.2_Frame_Shift_Del_p.L1039fs|CYTSB_uc002gwv.2_Frame_Shift_Del_p.L958fs|CYTSB_uc010vzf.1_Frame_Shift_Del_p.L379fs|CYTSB_uc002gww.2_Frame_Shift_Del_p.L776fs	p.L1039fs	NM_001033553	NP_001028725	WXS	Illumina HiSeq	Unspecified	Q5M775	CYTSB_HUMAN			14	3262	+			1039			CH.		B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Frame_Shift_Del	DEL	ENST00000261503.5	37	c.3117delG	CCDS32590.1																																																																																				0.358	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	Frame_Shift_Del	42	49	NA	NA	NA	NA	NA	42	49	---	---	---	---
ZNF14	7561	broad.mit.edu	37	19	19822589	19822592	+	Frame_Shift_Del	DEL	TCTC	TCTC	-			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	TCTC	TCTC	-	-	TCTC	TCTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:19822589_19822592delTCTC	ENST00000344099.3	-	4	1636_1639	c.1498_1501delGAGA	c.(1498-1503)gagaaafs	p.EK500fs		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				TCATAGGGTTTCTCTCCAGTGTGT	0.387																																							uc002nnk.1		NA																	0				ovary(3)	3						c.(1498-1503)GAGAAAfs		zinc finger protein 14																																				SO:0001589	frameshift_variant	7561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:19822589_19822592delTCTC	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.1498_1501delGAGA	19.37:g.19822589_19822592delTCTC	ENSP00000340514:p.Glu500fs		Somatic					p.E500fs	NM_021030	NP_066358	WXS	Illumina HiSeq	Unspecified	P17017	ZNF14_HUMAN			4	1652_1655	-		Renal(1328;0.0474)	500_501					B9EGA4|Q9ULZ5	Frame_Shift_Del	DEL	ENST00000344099.3	37	c.1498_1501delGAGA	CCDS12409.1																																																																																				0.387	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030		16	172	NA	NA	NA	NA	NA	16	172	---	---	---	---
ISOC2	79763	broad.mit.edu	37	19	55967772	55967772	+	Frame_Shift_Del	DEL	G	G	-	rs201404288		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr19:55967772delG	ENST00000425675.2	-	2	142	c.82delC	c.(82-84)cgcfs	p.R28fs	ISOC2_ENST00000085068.3_Frame_Shift_Del_p.R28fs|ISOC2_ENST00000438389.2_Frame_Shift_Del_p.R28fs			Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2	28					protein destabilization (GO:0031648)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			endometrium(1)|lung(4)|ovary(1)|stomach(1)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		ATGTTGTGGCGGAACTTCTCC	0.622																																							uc002qlb.2		NA																	0				ovary(1)	1						c.(82-84)CGCfs		isochorismatase domain containing 2 isoform 1							178.0	147.0	158.0					19																	55967772		2203	4300	6503	SO:0001589	frameshift_variant	79763				protein destabilization	mitochondrion|nucleus	catalytic activity|protein binding	g.chr19:55967772delG	AK027122	CCDS12925.1, CCDS46194.1, CCDS46195.1	19q13.42	2011-07-14			ENSG00000063241	ENSG00000063241			26278	protein-coding gene	gene with protein product		612928				17658461	Standard	NM_024710		Approved	FLJ23469	uc002qla.3	Q96AB3		ENST00000425675.2:c.82delC	19.37:g.55967772delG	ENSP00000401726:p.Arg28fs		Somatic				ISOC2_uc002qla.2_Frame_Shift_Del_p.R28fs|ISOC2_uc002qlc.2_Frame_Shift_Del_p.R28fs	p.R28fs	NM_001136201	NP_001129673	WXS	Illumina HiSeq	Unspecified	Q96AB3	ISOC2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)	2	256	-	Breast(117;0.155)		28					Q6ZN91|Q9H5G0	Frame_Shift_Del	DEL	ENST00000425675.2	37	c.82delC	CCDS46195.1																																																																																				0.622	ISOC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453179.1	NM_024710		19	107	NA	NA	NA	NA	NA	19	107	---	---	---	---
DARS	1615	broad.mit.edu	37	2	136680448	136680449	+	Frame_Shift_Ins	INS	-	-	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr2:136680448_136680449insT	ENST00000264161.4	-	9	931_932	c.716_717insA	c.(715-717)tatfs	p.Y239fs	DARS_ENST00000537273.1_Frame_Shift_Ins_p.Y139fs	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	239					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	TATTTTTAAAATATGACACAGT	0.337																																							uc002tux.1		NA																	0				ovary(1)	1						c.(715-717)TATfs		aspartyl-tRNA synthetase	L-Aspartic Acid(DB00128)																																			SO:0001589	frameshift_variant	1615				aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding	g.chr2:136680448_136680449insT	J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.717dupA	2.37:g.136680449_136680449dupT	ENSP00000264161:p.Tyr239fs		Somatic				DARS_uc010fnj.1_Frame_Shift_Ins_p.Y139fs	p.Y239fs	NM_001349	NP_001340	WXS	Illumina HiSeq	Unspecified	P14868	SYDC_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.168)	9	900_901	-			239					A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Frame_Shift_Ins	INS	ENST00000264161.4	37	c.716_717insA	CCDS2180.1																																																																																				0.337	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349		7	71	NA	NA	NA	NA	NA	7	71	---	---	---	---
CHRNA9	55584	broad.mit.edu	37	4	40337967	40337967	+	Frame_Shift_Del	DEL	C	C	-	rs375832887		TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr4:40337967delC	ENST00000310169.2	+	2	327	c.188delC	c.(187-189)acgfs	p.T63fs		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	63					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)	p.T63M(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	CTGCAGATTACGCTCTCTCAG	0.388																																					Esophageal Squamous(115;1297 1602 22235 25158 43327)	Esophageal Squamous(115;1297 1602 22235 25158 43327)	uc003gva.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	breast(3)|skin(3)|central_nervous_system(1)	7						c.(187-189)ACGfs		cholinergic receptor, nicotinic, alpha 9	Nicotine(DB00184)						183.0	171.0	175.0					4																	40337967		2203	4300	6503	SO:0001589	frameshift_variant	55584				elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity	g.chr4:40337967delC	AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.188delC	4.37:g.40337967delC	ENSP00000312663:p.Thr63fs		Somatic					p.T63fs	NM_017581	NP_060051	WXS	Illumina HiSeq	Unspecified	Q9UGM1	ACHA9_HUMAN			2	204	+			63			Extracellular (Potential).		Q14CY7|Q4W5A2|Q9NYV2	Frame_Shift_Del	DEL	ENST00000310169.2	37	c.188delC	CCDS3459.1																																																																																				0.388	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1			23	133	NA	NA	NA	NA	NA	23	133	---	---	---	---
NAT16	375607	broad.mit.edu	37	7	100815599	100815599	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:100815599delC	ENST00000300303.2	-	4	1109	c.871delG	c.(871-873)gacfs	p.D291fs	NAT16_ENST00000455377.1_Frame_Shift_Del_p.D291fs	NM_198571.2	NP_940973.2	Q8N8M0	NAT16_HUMAN	N-acetyltransferase 16 (GCN5-related, putative)	291							N-acetyltransferase activity (GO:0008080)										CAAGTGCCGTCCCCTCCGTGC	0.736																																							uc003uxy.1		NA																	0				ovary(1)	1						c.(871-873)GACfs		hypothetical protein LOC375607							10.0	11.0	10.0					7																	100815599		2171	4243	6414	SO:0001589	frameshift_variant	375607						N-acetyltransferase activity	g.chr7:100815599delC	AK096556	CCDS5713.1	7q22.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000167011	ENSG00000167011			22030	protein-coding gene	gene with protein product		615783	"""chromosome 7 open reading frame 52"""	C7orf52			Standard	NM_198571		Approved	FLJ39237	uc003uxy.2	Q8N8M0	OTTHUMG00000157110	ENST00000300303.2:c.871delG	7.37:g.100815599delC	ENSP00000300303:p.Asp291fs		Somatic				C7orf52_uc003uxz.1_Frame_Shift_Del_p.D291fs	p.D291fs	NM_198571	NP_940973	WXS	Illumina HiSeq	Unspecified	Q8N8M0	CG052_HUMAN			4	1110	-	Lung NSC(181;0.168)|all_lung(186;0.215)		291					B3KRS2|Q8NDR1	Frame_Shift_Del	DEL	ENST00000300303.2	37	c.871delG	CCDS5713.1																																																																																				0.736	NAT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347465.1	NM_198571		9	15	NA	NA	NA	NA	NA	9	15	---	---	---	---
COL26A1	136227	broad.mit.edu	37	7	101200670	101200671	+	RNA	INS	-	-	T			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:101200670_101200671insT	ENST00000397927.3	+	0	1398_1399				COL26A1_ENST00000528707.1_RNA|COL26A1_ENST00000313669.7_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)											CCTCCCCAGAGGAGGTTCTGGC	0.609																																							uc010lhy.1		NA																	0				ovary(1)	1						c.(1180-1182)GGAfs		EMI domain containing 2																																						136227					collagen		g.chr7:101200670_101200671insT	AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101200670_101200671insT			Somatic				EMID2_uc003uyo.1_Frame_Shift_Ins_p.E395fs	p.G394fs	NM_133457	NP_597714	WXS	Illumina HiSeq	Unspecified	Q96A83	EMID2_HUMAN			14	1372_1373	+	Lung NSC(181;0.215)		396					Q32M90	Frame_Shift_Ins	INS	ENST00000397927.3	37	c.1180_1181insT																																																																																					0.609	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000315898.2	NM_133457		7	47	NA	NA	NA	NA	NA	7	47	---	---	---	---
KMT2E	55904	broad.mit.edu	37	7	104753135	104753136	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr7:104753135_104753136delGA	ENST00000311117.3	+	27	5477_5478	c.4932_4933delGA	c.(4930-4935)ccgaatfs	p.N1645fs	SRPK2_ENST00000493638.1_Intron|KMT2E_ENST00000334877.4_Frame_Shift_Del_p.N1603fs|KMT2E_ENST00000257745.4_Frame_Shift_Del_p.N1645fs	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1645	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TACAACAGCCGAATTCCCATCA	0.554																																							uc003vcm.2		NA																	0				ovary(2)|pancreas(1)	3						c.(4930-4935)CCGAATfs		myeloid/lymphoid or mixed-lineage leukemia 5																																				SO:0001589	frameshift_variant	55904				cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding	g.chr7:104753135_104753136delGA	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.4932_4933delGA	7.37:g.104753135_104753136delGA	ENSP00000312379:p.Asn1645fs		Somatic				MLL5_uc010ljc.2_Frame_Shift_Del_p.P1644fs|MLL5_uc010ljf.1_Intron|MLL5_uc010ljg.2_Frame_Shift_Del_p.P378fs	p.P1644fs	NM_182931	NP_891847	WXS	Illumina HiSeq	Unspecified	Q8IZD2	MLL5_HUMAN			27	5466_5467	+			1644_1645			Pro-rich.		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Frame_Shift_Del	DEL	ENST00000311117.3	37	c.4932_4933delGA	CCDS34723.1																																																																																				0.554	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1			17	105	NA	NA	NA	NA	NA	17	105	---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113697722	113697722	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7576-01A-11D-2063-08	TCGA-55-7576-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	c8e60b5b-1c41-426f-90a8-b63c97124d04	ce851db4-b8ff-4b99-9474-f9e393d89791	g.chr8:113697722delG	ENST00000297405.5	-	15	2639	c.2395delC	c.(2395-2397)catfs	p.H799fs	CSMD3_ENST00000343508.3_Frame_Shift_Del_p.H759fs|CSMD3_ENST00000352409.3_Frame_Shift_Del_p.H799fs|CSMD3_ENST00000455883.2_Frame_Shift_Del_p.H695fs	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	799	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTAGTAAGATGGGAAGGCACC	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(2395-2397)CATfs		CUB and Sushi multiple domains 3 isoform 1							92.0	91.0	91.0					8																	113697722		2203	4300	6503	SO:0001589	frameshift_variant	114788					integral to membrane|plasma membrane		g.chr8:113697722delG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2395delC	8.37:g.113697722delG	ENSP00000297405:p.His799fs	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Frame_Shift_Del_p.H71fs|CSMD3_uc003ynt.2_Frame_Shift_Del_p.H759fs|CSMD3_uc011lhx.1_Frame_Shift_Del_p.H695fs	p.H799fs	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			15	2554	-			799			Extracellular (Potential).|CUB 4.		Q96PZ3	Frame_Shift_Del	DEL	ENST00000297405.5	37	c.2395delC	CCDS6315.1																																																																																				0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		11	112	NA	NA	NA	NA	NA	11	112	---	---	---	---
