#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PRAMEF1	65121	broad.mit.edu	37	1	12854400	12854400	+	Silent	SNP	A	A	G	rs201043652		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:12854400A>G	ENST00000332296.7	+	3	727	c.624A>G	c.(622-624)caA>caG	p.Q208Q	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	208					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATAGTATTCAAGAGCTGGAAA	0.398																																							uc001auj.1		NA																	0					0						c.(622-624)CAA>CAG		PRAME family member 1							361.0	332.0	342.0					1																	12854400		2203	4300	6503	SO:0001819	synonymous_variant	65121							g.chr1:12854400A>G	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.624A>G	1.37:g.12854400A>G			Somatic					p.Q208Q	NM_023013	NP_075389	WXS	Illumina HiSeq	Unspecified	O95521	PRAM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	3	727	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	208					Q9UQP2	Silent	SNP	ENST00000332296.7	37	c.624A>G	CCDS148.1																																																																																				0.398	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013		11	330	0	0	0	0.008291	0	11	330				
EPHA8	2046	broad.mit.edu	37	1	22923960	22923960	+	Missense_Mutation	SNP	A	A	G	rs373638442		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:22923960A>G	ENST00000166244.3	+	10	1993	c.1921A>G	c.(1921-1923)Atc>Gtc	p.I641V		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	641	Mediates interaction with PIK3CG and required for endocytosis. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CGAGAAAATCATCGGCTCTGG	0.657																																							uc001bfx.1		NA																	0				central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13						c.(1921-1923)ATC>GTC		ephrin receptor EphA8 isoform 1 precursor		A	VAL/ILE	1,4405	2.1+/-5.4	0,1,2202	56.0	65.0	62.0		1921	4.6	1.0	1		62	0,8600		0,0,4300	no	missense	EPHA8	NM_020526.3	29	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	possibly-damaging	641/1006	22923960	1,13005	2203	4300	6503	SO:0001583	missense	2046					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr1:22923960A>G	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1921A>G	1.37:g.22923960A>G	ENSP00000166244:p.Ile641Val		Somatic					p.I641V	NM_020526	NP_065387	WXS	Illumina HiSeq	Unspecified	P29322	EPHA8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	10	2046	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	641			Cytoplasmic (Potential).|ATP (By similarity).|Protein kinase.		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	37	c.1921A>G	CCDS225.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.181790	0.78677	2.27E-4	0.0	ENSG00000070886	ENST00000166244	T	0.68479	-0.33	4.6	4.6	0.57074	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75953	0.3920	M	0.62154	1.92	0.80722	D	1	P	0.47302	0.893	P	0.60789	0.879	T	0.76992	-0.2753	10	0.52906	T	0.07	.	11.4702	0.50264	1.0:0.0:0.0:0.0	.	641	P29322	EPHA8_HUMAN	V	641	ENSP00000166244:I641V	ENSP00000166244:I641V	I	+	1	0	EPHA8	22796547	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.278000	0.78587	1.933000	0.56026	0.402000	0.26972	ATC		0.657	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526		5	92	0	0	0	0.001984	0	5	92				
CSMD2	114784	broad.mit.edu	37	1	34006172	34006172	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:34006172G>A	ENST00000373381.4	-	60	9760	c.9584C>T	c.(9583-9585)aCc>aTc	p.T3195I		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3171	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TCCCTCACAGGTGAACACCGC	0.572																																							uc001bxn.1		NA																	0				ovary(6)|skin(5)|pancreas(1)	12						c.(9151-9153)ACC>ATC		CUB and Sushi multiple domains 2							111.0	95.0	100.0					1																	34006172		2203	4300	6503	SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34006172G>A	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9584C>T	1.37:g.34006172G>A	ENSP00000362479:p.Thr3195Ile		Somatic				CSMD2_uc001bxm.1_Missense_Mutation_p.T3195I	p.T3051I	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			59	9181	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	3051			Sushi 23.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37	c.9152C>T		.	.	.	.	.	.	.	.	.	.	G	24.7	4.560471	0.86335	.	.	ENSG00000121904	ENST00000373381	T	0.69175	-0.38	5.67	5.67	0.87782	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.81163	0.4765	M	0.70108	2.13	0.80722	D	1	D;D	0.71674	0.974;0.998	D;D	0.72625	0.934;0.978	T	0.79110	-0.1938	10	0.38643	T	0.18	.	18.7573	0.91837	0.0:0.0:1.0:0.0	.	3051;3195	Q7Z408;E7EUA6	CSMD2_HUMAN;.	I	3195	ENSP00000362479:T3195I	ENSP00000241312:T3051I	T	-	2	0	CSMD2	33778759	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.841000	0.99482	2.689000	0.91719	0.462000	0.41574	ACC		0.572	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		7	94	0	0	0	0.00308	0	7	94				
C1orf94	84970	broad.mit.edu	37	1	34663427	34663427	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:34663427C>T	ENST00000488417.1	+	2	1042	c.922C>T	c.(922-924)Cct>Tct	p.P308S	C1orf94_ENST00000373374.3_Missense_Mutation_p.P118S	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	308										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				CCCTGAGCTCCCTGCTCAGAA	0.617																																							uc001bxs.3		NA																	0					0						c.(352-354)CCT>TCT		hypothetical protein LOC84970 isoform b							54.0	49.0	51.0					1																	34663427		2203	4300	6503	SO:0001583	missense	84970						protein binding	g.chr1:34663427C>T	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.922C>T	1.37:g.34663427C>T	ENSP00000435634:p.Pro308Ser		Somatic				C1orf94_uc001bxt.2_Missense_Mutation_p.P308S	p.P118S	NM_032884	NP_116273	WXS	Illumina HiSeq	Unspecified	Q6P1W5	CA094_HUMAN			2	751	+		Myeloproliferative disorder(586;0.0393)	118					B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	ENST00000488417.1	37	c.352C>T	CCDS44108.1	.	.	.	.	.	.	.	.	.	.	C	8.050	0.765754	0.15983	.	.	ENSG00000142698	ENST00000373374;ENST00000488417	T;T	0.24538	1.85;1.85	4.99	1.03	0.20045	.	0.356827	0.24373	N	0.039091	T	0.11410	0.0278	N	0.14661	0.345	0.24037	N	0.996098	B	0.14805	0.011	B	0.12156	0.007	T	0.35351	-0.9792	10	0.12103	T	0.63	-2.1566	7.2151	0.25955	0.0:0.627:0.0:0.373	.	308	Q6P1W5	CA094_HUMAN	S	118;308	ENSP00000362472:P118S;ENSP00000435634:P308S	ENSP00000362472:P118S	P	+	1	0	C1orf94	34436014	0.635000	0.27199	0.804000	0.32291	0.797000	0.45037	0.534000	0.23098	-0.064000	0.13043	-1.031000	0.02408	CCT		0.617	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884		4	59	0	0	0	0.000248	0	4	59				
ANKRD13C	81573	broad.mit.edu	37	1	70740431	70740431	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:70740431T>A	ENST00000370944.4	-	11	1679	c.1366A>T	c.(1366-1368)Agc>Tgc	p.S456C	ANKRD13C_ENST00000464236.1_5'UTR|ANKRD13C_ENST00000262346.6_Missense_Mutation_p.S421C	NM_030816.4	NP_110443.3	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	456					protein retention in ER lumen (GO:0006621)|regulation of anoikis (GO:2000209)|regulation of receptor biosynthetic process (GO:0010869)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	19						AATTCCTGGCTCATGGCTATC	0.353																																							uc001dex.3		NA																	0					0						c.(1366-1368)AGC>TGC		ankyrin repeat domain 13C							187.0	192.0	190.0					1																	70740431		2203	4300	6503	SO:0001583	missense	81573				protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding	g.chr1:70740431T>A		CCDS648.2	1p32.3-p31.3	2013-01-10			ENSG00000118454	ENSG00000118454		"""Ankyrin repeat domain containing"""	25374	protein-coding gene	gene with protein product		615125				11230166	Standard	NM_030816		Approved	DKFZP566D1346, dJ677H15.3	uc001dex.4	Q8N6S4	OTTHUMG00000009343	ENST00000370944.4:c.1366A>T	1.37:g.70740431T>A	ENSP00000359982:p.Ser456Cys		Somatic				ANKRD13C_uc009wbk.2_Missense_Mutation_p.S421C	p.S456C	NM_030816	NP_110443	WXS	Illumina HiSeq	Unspecified	Q8N6S4	AN13C_HUMAN			11	1692	-			456					B3KQ97|Q5VYH4|Q5VYH5|Q6PJE4|Q9H0N9	Missense_Mutation	SNP	ENST00000370944.4	37	c.1366A>T	CCDS648.2	.	.	.	.	.	.	.	.	.	.	T	19.19	3.780529	0.70222	.	.	ENSG00000118454	ENST00000370944;ENST00000262346	T;T	0.56103	0.48;0.48	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.61464	0.2349	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	0.985;1.0	P;D	0.87578	0.891;0.998	T	0.61377	-0.7075	10	0.36615	T	0.2	-15.944	15.0635	0.71973	0.0:0.0:0.0:1.0	.	421;456	Q8N6S4-2;Q8N6S4	.;AN13C_HUMAN	C	456;421	ENSP00000359982:S456C;ENSP00000262346:S421C	ENSP00000262346:S421C	S	-	1	0	ANKRD13C	70513019	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.614000	0.82996	2.051000	0.60960	0.460000	0.39030	AGC		0.353	ANKRD13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025903.1	NM_030816		8	134	0	0	0	0.004482	0	8	134				
SYDE2	84144	broad.mit.edu	37	1	85648436	85648436	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:85648436G>C	ENST00000341460.5	-	3	1938	c.1889C>G	c.(1888-1890)aCa>aGa	p.T630R		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	630					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		AGCTTTAGTTGTAAGTTCAGG	0.358																																							uc009wcm.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1888-1890)ACA>AGA		synapse defective 1, Rho GTPase, homolog 2							92.0	83.0	85.0					1																	85648436		1841	4092	5933	SO:0001583	missense	84144				activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity	g.chr1:85648436G>C	AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.1889C>G	1.37:g.85648436G>C	ENSP00000340594:p.Thr630Arg		Somatic				SYDE2_uc001dku.3_Missense_Mutation_p.T630R	p.T630R	NM_032184	NP_115560	WXS	Illumina HiSeq	Unspecified	Q5VT97	SYDE2_HUMAN		all cancers(265;0.0126)|Epithelial(280;0.0336)	3	1938	-			630					Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	ENST00000341460.5	37	c.1889C>G	CCDS44169.1	.	.	.	.	.	.	.	.	.	.	G	9.319	1.057549	0.19907	.	.	ENSG00000097096	ENST00000341460	T	0.06528	3.29	5.56	3.2	0.36748	.	0.336904	0.34959	N	0.003548	T	0.00580	0.0019	N	0.00926	-1.1	0.22601	N	0.998949	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46373	-0.9196	10	0.15066	T	0.55	.	8.3992	0.32574	0.794:0.1363:0.0698:0.0	.	630;630	Q5VT97;Q5VT97-2	SYDE2_HUMAN;.	R	630	ENSP00000340594:T630R	ENSP00000340594:T630R	T	-	2	0	SYDE2	85421024	1.000000	0.71417	0.969000	0.41365	0.983000	0.72400	5.875000	0.69660	0.377000	0.24735	-0.417000	0.06048	ACA		0.358	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127989.2			6	32	0	0	0	0.001984	0	6	32				
SLC44A3	126969	broad.mit.edu	37	1	95356740	95356740	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:95356740G>A	ENST00000271227.6	+	13	1639	c.1537G>A	c.(1537-1539)Gat>Aat	p.D513N	SLC44A3_ENST00000529450.1_Missense_Mutation_p.D480N|SLC44A3_ENST00000532427.1_Missense_Mutation_p.D433N|SLC44A3_ENST00000527077.1_Missense_Mutation_p.D445N|SLC44A3_ENST00000530397.1_3'UTR|SLC44A3_ENST00000467909.1_Missense_Mutation_p.D465N|SLC44A3_ENST00000446120.2_Missense_Mutation_p.D477N	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	513					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	ATCAGCAAAAGATGCATTCAA	0.313																																							uc001dqv.3		NA																	0				kidney(1)	1						c.(1537-1539)GAT>AAT		solute carrier family 44, member 3 isoform 1	Choline(DB00122)						98.0	107.0	104.0					1																	95356740		2203	4300	6503	SO:0001583	missense	126969					integral to membrane|plasma membrane	choline transmembrane transporter activity	g.chr1:95356740G>A	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1537G>A	1.37:g.95356740G>A	ENSP00000271227:p.Asp513Asn		Somatic				SLC44A3_uc001dqx.3_Missense_Mutation_p.D512N|SLC44A3_uc010otq.1_Missense_Mutation_p.D445N|SLC44A3_uc010otr.1_Missense_Mutation_p.D477N|SLC44A3_uc001dqw.3_Missense_Mutation_p.D465N|SLC44A3_uc010ots.1_Missense_Mutation_p.D433N|SLC44A3_uc009wds.2_Missense_Mutation_p.D416N|SLC44A3_uc010ott.1_Missense_Mutation_p.D432N|SLC44A3_uc010otu.1_RNA	p.D513N	NM_001114106	NP_001107578	WXS	Illumina HiSeq	Unspecified	Q8N4M1	CTL3_HUMAN		all cancers(265;0.039)|Epithelial(280;0.124)	13	1644	+		all_lung(203;0.000712)|Lung NSC(277;0.00316)	513					B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	ENST00000271227.6	37	c.1537G>A	CCDS44176.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.972725	0.92919	.	.	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000527077;ENST00000529450;ENST00000467909;ENST00000532427;ENST00000532670	T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;1.78	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000005	T	0.35566	0.0936	L	0.41079	1.255	0.51482	D	0.999927	D;P;D;D;D	0.89917	1.0;0.86;1.0;1.0;1.0	D;P;D;D;D	0.91635	0.999;0.561;0.999;0.995;0.999	T	0.00701	-1.1603	10	0.28530	T	0.3	-20.5166	20.5752	0.99366	0.0:0.0:1.0:0.0	.	433;477;445;480;513	E9PIC5;Q8N4M1-3;E9PJY8;E9PJH2;Q8N4M1	.;.;.;.;CTL3_HUMAN	N	477;513;445;480;465;433;48	ENSP00000389143:D477N;ENSP00000271227:D513N;ENSP00000433641:D445N;ENSP00000431836:D480N;ENSP00000432789:D465N;ENSP00000436661:D433N;ENSP00000432880:D48N	ENSP00000271227:D513N	D	+	1	0	SLC44A3	95129328	1.000000	0.71417	0.998000	0.56505	0.840000	0.47671	8.509000	0.90529	2.868000	0.98415	0.557000	0.71058	GAT		0.313	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369		9	90	0	0	0	0.004482	0	9	90				
VAV3	10451	broad.mit.edu	37	1	108507399	108507399	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:108507399G>T	ENST00000370056.4	-	1	367	c.93C>A	c.(91-93)ttC>ttA	p.F31L	VAV3-AS1_ENST00000438318.1_RNA|VAV3_ENST00000527011.1_Missense_Mutation_p.F31L|VAV3_ENST00000371846.4_5'UTR	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	31	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		GCGCAAGGTCGAACACCTGAG	0.637																																							uc001dvk.1		NA																	0				ovary(5)|lung(2)|breast(2)	9						c.(91-93)TTC>TTA		vav 3 guanine nucleotide exchange factor isoform							68.0	56.0	60.0					1																	108507399		2203	4300	6503	SO:0001583	missense	10451				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity	g.chr1:108507399G>T	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.93C>A	1.37:g.108507399G>T	ENSP00000359073:p.Phe31Leu		Somatic				VAV3_uc010ouw.1_Missense_Mutation_p.F31L|VAV3_uc001dvl.1_5'Flank|VAV3_uc010oux.1_Missense_Mutation_p.F31L	p.F31L	NM_006113	NP_006104	WXS	Illumina HiSeq	Unspecified	Q9UKW4	VAV3_HUMAN		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)	1	147	-		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)	31			CH.		B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	c.93C>A	CCDS785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.029325|4.029325	0.75504|0.75504	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000370056;ENST00000527011|ENST00000490388	T;T|.	0.58797|.	0.31;0.31|.	5.05|5.05	-0.842|-0.842	0.10748|0.10748	Calponin homology domain (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.43567|.	0.1253|.	L|L	0.52905|0.52905	1.665|1.665	0.80722|0.80722	D|D	1|1	B;D;B|.	0.71674|.	0.008;0.998;0.164|.	B;D;B|.	0.74023|.	0.056;0.982;0.286|.	T|.	0.45381|.	-0.9265|.	10|.	0.02654|.	T|.	1|.	.|.	10.3933|10.3933	0.44185|0.44185	0.4894:0.0:0.5106:0.0|0.4894:0.0:0.5106:0.0	.|.	31;31;31|.	B7ZLR1;E9PQ97;Q9UKW4|.	.;.;VAV3_HUMAN|.	L|X	31|26	ENSP00000359073:F31L;ENSP00000432540:F31L|.	ENSP00000359073:F31L|.	F|S	-|-	3|2	2|0	VAV3|VAV3	108308922|108308922	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.952000|0.952000	0.60782|0.60782	0.702000|0.702000	0.25631|0.25631	-0.034000|-0.034000	0.13713|0.13713	0.456000|0.456000	0.33151|0.33151	TTC|TCG		0.637	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113		3	33	1	0	0.000602214	0.000602	0.000712216	3	33				
CSDE1	7812	broad.mit.edu	37	1	115266587	115266587	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:115266587T>A	ENST00000358528.4	-	16	2216	c.1790A>T	c.(1789-1791)tAc>tTc	p.Y597F	CSDE1_ENST00000369530.1_Missense_Mutation_p.Y612F|CSDE1_ENST00000261443.5_Missense_Mutation_p.Y566F|CSDE1_ENST00000339438.6_Missense_Mutation_p.Y566F|CSDE1_ENST00000534699.1_Missense_Mutation_p.Y597F|CSDE1_ENST00000438362.2_Missense_Mutation_p.Y643F|CSDE1_ENST00000530886.1_Missense_Mutation_p.Y467F	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	597					male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTGCCAGAGTAAATGGTGGG	0.413																																							uc001efk.2		NA																	0				ovary(1)	1						c.(1789-1791)TAC>TTC		upstream of NRAS isoform 1							178.0	156.0	163.0					1																	115266587		2203	4300	6503	SO:0001583	missense	7812				male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding	g.chr1:115266587T>A		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.1790A>T	1.37:g.115266587T>A	ENSP00000351329:p.Tyr597Phe		Somatic				CSDE1_uc001efi.2_Missense_Mutation_p.Y643F|CSDE1_uc001efj.2_RNA|CSDE1_uc001efl.2_Missense_Mutation_p.Y566F|CSDE1_uc001efm.2_Missense_Mutation_p.Y612F|CSDE1_uc009wgv.2_Missense_Mutation_p.Y597F|CSDE1_uc001efn.2_Missense_Mutation_p.Y566F	p.Y597F	NM_001007553	NP_001007554	WXS	Illumina HiSeq	Unspecified	O75534	CSDE1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	16	2256	-	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	597					A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	c.1790A>T	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	T	16.21	3.058775	0.55325	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	6.17	6.17	0.99709	.	0.242483	0.45606	D	0.000360	T	0.52175	0.1718	N	0.19112	0.55	0.38630	D	0.951345	B;B;D	0.56035	0.255;0.118;0.974	B;B;D	0.70487	0.078;0.017;0.969	T	0.53387	-0.8446	9	0.24483	T	0.36	-7.4474	16.8222	0.85835	0.0:0.0:0.0:1.0	.	612;597;643	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	F	566;643;597;566;467;612;597	.	ENSP00000261443:Y566F	Y	-	2	0	CSDE1	115068110	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.755000	0.55197	2.371000	0.80710	0.533000	0.62120	TAC		0.413	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158		16	141	0	0	0	0.00499	0	16	141				
FAM46C	54855	broad.mit.edu	37	1	118166407	118166407	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:118166407A>G	ENST00000369448.3	+	2	1164	c.917A>G	c.(916-918)tAc>tGc	p.Y306C		NM_017709.3	NP_060179.2	Q5VWP2	FA46C_HUMAN	family with sequence similarity 46, member C	306										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	15	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		AAGTACGACTACCTCATGATC	0.527			"""Mis, F, O"""		MM					Multiple Myeloma(3;1.13e-06)																													uc001ehe.2		NA		Rec	yes		1	1p12	54855		"""family with sequence similarity 46, member C"""			L					0					0						c.(916-918)TAC>TGC		hypothetical protein LOC54855							148.0	129.0	135.0					1																	118166407		2203	4300	6503	SO:0001583	missense	54855							g.chr1:118166407A>G	BC036516	CCDS896.1	1p12	2008-02-05			ENSG00000183508	ENSG00000183508			24712	protein-coding gene	gene with protein product		613952				12477932	Standard	NM_017709		Approved	FLJ20202	uc001ehe.3	Q5VWP2	OTTHUMG00000013703	ENST00000369448.3:c.917A>G	1.37:g.118166407A>G	ENSP00000358458:p.Tyr306Cys	Multiple Myeloma(3;1.13e-06)	Somatic					p.Y306C	NM_017709	NP_060179	WXS	Illumina HiSeq	Unspecified	Q5VWP2	FA46C_HUMAN		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)	2	1116	+	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)	306					A3KMG2|Q8NE25|Q9NXK0	Missense_Mutation	SNP	ENST00000369448.3	37	c.917A>G	CCDS896.1	.	.	.	.	.	.	.	.	.	.	A	16.77	3.214800	0.58452	.	.	ENSG00000183508	ENST00000369448	T	0.27557	1.66	5.7	5.7	0.88788	Domain of unknown function DUF1693 (1);	0.000000	0.64402	D	0.000010	T	0.42630	0.1211	L	0.59967	1.855	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.27971	-1.0058	10	0.42905	T	0.14	-15.5209	15.1401	0.72604	1.0:0.0:0.0:0.0	.	306	Q5VWP2	FA46C_HUMAN	C	306	ENSP00000358458:Y306C	ENSP00000358458:Y306C	Y	+	2	0	FAM46C	117967930	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.938000	0.92943	2.169000	0.68431	0.533000	0.62120	TAC		0.527	FAM46C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038424.1	NM_017709		3	64	0	0	0	0.000248	0	3	64				
SPAG17	200162	broad.mit.edu	37	1	118570994	118570994	+	Silent	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:118570994A>T	ENST00000336338.5	-	26	3698	c.3633T>A	c.(3631-3633)ccT>ccA	p.P1211P		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1211						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTTGTAAAACAGGTTCTGGTT	0.398																																							uc001ehk.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(3631-3633)CCT>CCA		sperm associated antigen 17							102.0	102.0	102.0					1																	118570994		2203	4300	6503	SO:0001819	synonymous_variant	200162					cilium|flagellar axoneme|microtubule		g.chr1:118570994A>T		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.3633T>A	1.37:g.118570994A>T			Somatic					p.P1211P	NM_206996	NP_996879	WXS	Illumina HiSeq	Unspecified	Q6Q759	SPG17_HUMAN		Lung(183;0.0858)	26	3701	-	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)	1211					Q8NAZ1|Q9NT21	Silent	SNP	ENST00000336338.5	37	c.3633T>A	CCDS899.1																																																																																				0.398	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996		21	73	0	0	0	0.001523	0	21	73				
HSD3B2	3284	broad.mit.edu	37	1	119965152	119965152	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:119965152A>G	ENST00000543831.1	+	4	1277	c.1028A>G	c.(1027-1029)tAc>tGc	p.Y343C	HSD3B2_ENST00000369416.3_Missense_Mutation_p.Y343C	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	343					androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	AAGCCACTCTACAGCTGGGAG	0.502																																							uc001ehs.2		NA																	0				ovary(2)	2						c.(1027-1029)TAC>TGC		3 beta-hydroxysteroid dehydrogenase 2	NADH(DB00157)|Trilostane(DB01108)						64.0	59.0	61.0					1																	119965152		2203	4300	6503	SO:0001583	missense	3284				androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity	g.chr1:119965152A>G	BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.1028A>G	1.37:g.119965152A>G	ENSP00000445122:p.Tyr343Cys		Somatic				HSD3B2_uc001eht.2_Missense_Mutation_p.Y343C|HSD3B2_uc001ehu.2_Intron	p.Y343C	NM_000198	NP_000189	WXS	Illumina HiSeq	Unspecified	P26439	3BHS2_HUMAN		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	3	1801	+	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)	343					A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Missense_Mutation	SNP	ENST00000543831.1	37	c.1028A>G	CCDS902.1	.	.	.	.	.	.	.	.	.	.	-	15.07	2.723871	0.48728	.	.	ENSG00000203859	ENST00000543831;ENST00000369416	D;D	0.89552	-2.53;-2.53	4.32	0.308	0.15815	.	0.297919	0.37669	N	0.001997	D	0.90000	0.6878	M	0.82323	2.585	0.42224	D	0.991862	D	0.67145	0.996	P	0.60345	0.873	D	0.88622	0.3163	9	.	.	.	-17.3996	10.7852	0.46401	0.7037:0.0:0.0:0.2963	.	343	P26439	3BHS2_HUMAN	C	343	ENSP00000445122:Y343C;ENSP00000358424:Y343C	.	Y	+	2	0	HSD3B2	119766675	1.000000	0.71417	0.787000	0.31911	0.844000	0.47949	1.365000	0.34182	-0.224000	0.09928	0.248000	0.18094	TAC		0.502	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034994.1	NM_000198		4	52	0	0	0	0.000248	0	4	52				
NBPF15	284565	broad.mit.edu	37	1	148754896	148754896	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:148754896T>G	ENST00000417839.1	+	14	1742	c.1552T>G	c.(1552-1554)Tat>Gat	p.Y518D		NM_001102663.1	NP_001096133	Q5SXJ2	NBPFG_HUMAN		518	NBPF 5. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4	all_hematologic(923;0.032)					ACTGGATAGATATTATTCAAC	0.463																																							uc010pba.1		NA																	0					0						c.(1552-1554)TGT>GGT		hypothetical protein LOC728936							1.0	1.0	1.0					1																	148754896		232	504	736	SO:0001583	missense	728936							g.chr1:148754896T>G																												ENST00000417839.1:c.1552T>G	1.37:g.148754896T>G	ENSP00000395369:p.Tyr518Asp		Somatic				NBPF16_uc009wkt.1_Missense_Mutation_p.Y298D	p.C518G	NM_001102663	NP_001096133	WXS	Illumina HiSeq	Unspecified					14	1743	+	all_hematologic(923;0.032)							A8MPT6	Missense_Mutation	SNP	ENST00000417839.1	37	c.1552T>G	CCDS41384.1	.	.	.	.	.	.	.	.	.	.	t	2.246	-0.372639	0.05034	.	.	ENSG00000203827	ENST00000417839;ENST00000254372	T	0.06449	3.3	0.109	0.109	0.14578	DUF1220 (2);	.	.	.	.	T	0.01156	0.0038	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.47497	-0.9113	8	0.72032	D	0.01	.	.	.	.	.	518	Q5SXJ2	NBPFG_HUMAN	D	518	ENSP00000395369:Y518D	ENSP00000254372:Y518D	Y	+	1	0	NBPF16	147021520	0.998000	0.40836	0.042000	0.18584	0.042000	0.13812	0.650000	0.24858	0.156000	0.19299	0.155000	0.16302	TAT		0.463	NBPF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097693.1			4	5	0	0	0	0.000248	0	4	5				
FLG2	388698	broad.mit.edu	37	1	152324407	152324407	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:152324407C>G	ENST00000388718.5	-	3	5927	c.5855G>C	c.(5854-5856)gGa>gCa	p.G1952A	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1952					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGGCCAGATCCCCTTCTTCC	0.527																																							uc001ezw.3		NA																	0				ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(5854-5856)GGA>GCA		filaggrin family member 2							326.0	307.0	313.0					1																	152324407		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152324407C>G	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5855G>C	1.37:g.152324407C>G	ENSP00000373370:p.Gly1952Ala		Somatic				uc001ezv.2_Intron	p.G1952A	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	5928	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1952			Filaggrin 8.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.5855G>C	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	c	1.767	-0.485355	0.04352	.	.	ENSG00000143520	ENST00000388718	T	0.04360	3.64	3.91	-3.47	0.04753	.	.	.	.	.	T	0.01222	0.0040	L	0.59436	1.845	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48305	-0.9047	9	0.10377	T	0.69	0.2959	6.2752	0.20977	0.0:0.2193:0.4883:0.2924	.	1952	Q5D862	FILA2_HUMAN	A	1952	ENSP00000373370:G1952A	ENSP00000373370:G1952A	G	-	2	0	FLG2	150591031	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-1.819000	0.01716	-0.486000	0.06744	-0.371000	0.07208	GGA		0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		4	350	0	0	0	0.001168	0	4	350				
FLG2	388698	broad.mit.edu	37	1	152325595	152325595	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:152325595G>T	ENST00000388718.5	-	3	4739	c.4667C>A	c.(4666-4668)tCt>tAt	p.S1556Y	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1556					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S1556C(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCATGACCAGAGTAGGAATG	0.483																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		urinary_tract(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(4666-4668)TCT>TAT		filaggrin family member 2							279.0	263.0	268.0					1																	152325595		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152325595G>T	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4667C>A	1.37:g.152325595G>T	ENSP00000373370:p.Ser1556Tyr		Somatic				uc001ezv.2_Intron	p.S1556Y	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	4740	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1556					Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.4667C>A	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	g	0.013	-1.618160	0.00828	.	.	ENSG00000143520	ENST00000388718	T	0.08634	3.07	3.97	-0.3	0.12804	.	.	.	.	.	T	0.01976	0.0062	L	0.43923	1.385	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.44711	-0.9310	9	0.45353	T	0.12	4.3491	3.2349	0.06761	0.2087:0.0:0.4303:0.361	.	1556	Q5D862	FILA2_HUMAN	Y	1556	ENSP00000373370:S1556Y	ENSP00000373370:S1556Y	S	-	2	0	FLG2	150592219	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.682000	0.25335	-0.006000	0.14370	-0.758000	0.03466	TCT		0.483	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		33	280	1	0	3.11337e-16	0.002836	4.24753e-16	33	280				
FLG2	388698	broad.mit.edu	37	1	152327320	152327320	+	Nonsense_Mutation	SNP	G	G	T	rs370804010		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:152327320G>T	ENST00000388718.5	-	3	3014	c.2942C>A	c.(2941-2943)tCa>tAa	p.S981*	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	981	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S981*(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGATTTTCCTGAGCCTGACTC	0.493																																							uc001ezw.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(2941-2943)TCA>TAA		filaggrin family member 2							257.0	259.0	258.0					1																	152327320		2203	4300	6503	SO:0001587	stop_gained	388698						calcium ion binding|structural molecule activity	g.chr1:152327320G>T	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2942C>A	1.37:g.152327320G>T	ENSP00000373370:p.Ser981*		Somatic				uc001ezv.2_Intron	p.S981*	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	3015	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		981			Ser-rich.		Q9H4U1	Nonsense_Mutation	SNP	ENST00000388718.5	37	c.2942C>A	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	37	6.319915	0.97471	.	.	ENSG00000143520	ENST00000388718	.	.	.	3.96	3.05	0.35203	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	6.1134	7.5738	0.27924	0.1186:0.0:0.8814:0.0	.	.	.	.	X	981	.	ENSP00000373370:S981X	S	-	2	0	FLG2	150593944	0.001000	0.12720	0.002000	0.10522	0.003000	0.03518	0.800000	0.27042	0.883000	0.36040	-0.254000	0.11334	TCA		0.493	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		52	331	1	0	3.40343e-31	0.00361	4.69353e-31	52	331				
SPRR2F	6705	broad.mit.edu	37	1	153085023	153085023	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:153085023A>T	ENST00000468739.1	-	2	247	c.187T>A	c.(187-189)Tgc>Agc	p.C63S	SPRR2B_ENST00000368752.4_Intron	NM_001014450.1	NP_001014450.1	Q96RM1	SPR2F_HUMAN	small proline-rich protein 2F	63					epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	4	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTTGGCTGGCAGGGTGGGGAA	0.557																																							uc001fbi.2		NA																	0					0						c.(187-189)TGC>AGC		small proline-rich protein 2F							258.0	240.0	246.0					1																	153085023		2203	4298	6501	SO:0001583	missense	6705				keratinization	cornified envelope|cytoplasm		g.chr1:153085023A>T	AF333956	CCDS30867.1	1q21-q22	2008-02-05			ENSG00000244094	ENSG00000244094			11266	protein-coding gene	gene with protein product						8325635, 11279051	Standard	NM_001014450		Approved		uc001fbi.3	Q96RM1	OTTHUMG00000014398	ENST00000468739.1:c.187T>A	1.37:g.153085023A>T	ENSP00000418193:p.Cys63Ser		Somatic				SPRR2D_uc009wnz.2_Intron|SPRR2A_uc001fbf.2_Intron|SPRR2A_uc009woa.2_Intron	p.C63S	NM_001014450	NP_001014450	WXS	Illumina HiSeq	Unspecified	Q96RM1	SPR2F_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	246	-	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		63					Q5T9T3	Missense_Mutation	SNP	ENST00000468739.1	37	c.187T>A	CCDS30867.1	.	.	.	.	.	.	.	.	.	.	A	9.238	1.037443	0.19669	.	.	ENSG00000244094	ENST00000468739	T	0.49139	0.79	4.0	2.82	0.32997	.	0.205406	0.24757	N	0.035849	T	0.16428	0.0395	.	.	.	0.24179	N	0.995596	B	0.22909	0.077	B	0.18263	0.021	T	0.17561	-1.0365	9	0.87932	D	0	.	6.3814	0.21536	0.7809:0.0:0.0:0.2191	.	63	Q96RM1	SPR2F_HUMAN	S	63	ENSP00000418193:C63S	ENSP00000418193:C63S	C	-	1	0	SPRR2F	151351647	0.900000	0.30661	0.587000	0.28692	0.859000	0.49053	0.574000	0.23714	0.565000	0.29255	0.254000	0.18369	TGC		0.557	SPRR2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040056.1			24	357	0	0	0	0.002096	0	24	357				
DENND4B	9909	broad.mit.edu	37	1	153907281	153907281	+	Missense_Mutation	SNP	G	G	C	rs3835302		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:153907281G>C	ENST00000361217.4	-	18	3146	c.2728C>G	c.(2728-2730)Cag>Gag	p.Q910E	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	910	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ACctgctcctgctgctgctgc	0.637																																							uc001fdd.1		NA																	0				ovary(1)	1						c.(2728-2730)CAG>GAG		DENN/MADD domain containing 4B							23.0	26.0	25.0					1																	153907281		2184	4283	6467	SO:0001583	missense	9909							g.chr1:153907281G>C	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2728C>G	1.37:g.153907281G>C	ENSP00000354597:p.Gln910Glu		Somatic				uc001fdc.1_RNA	p.Q910E	NM_014856	NP_055671	WXS	Illumina HiSeq	Unspecified	O75064	DEN4B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		18	3129	-	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		910			Gln-rich.		Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	c.2728C>G	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	G	1.472	-0.559641	0.03967	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.06142	3.35;3.34	3.46	-0.019	0.13961	.	5.533310	0.00166	N	0.000005	T	0.00784	0.0026	N	0.08118	0	0.18873	N	0.999986	B	0.02656	0.0	B	0.01281	0.0	T	0.32455	-0.9906	10	0.05833	T	0.94	.	5.5137	0.16894	0.0:0.2087:0.4093:0.382	.	910	O75064	DEN4B_HUMAN	E	910;921	ENSP00000354597:Q910E;ENSP00000357635:Q921E	ENSP00000354597:Q910E	Q	-	1	0	DENND4B	152173905	0.001000	0.12720	0.930000	0.37139	0.549000	0.35272	0.424000	0.21330	0.270000	0.21984	0.264000	0.19307	CAG		0.637	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806		3	29	0	0	0	0.004672	0	3	29				
NUP210L	91181	broad.mit.edu	37	1	154091215	154091215	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:154091215T>A	ENST00000368559.3	-	11	1467	c.1396A>T	c.(1396-1398)Atg>Ttg	p.M466L	NUP210L_ENST00000271854.3_Missense_Mutation_p.M466L	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	466					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GGTGTAAGCATGATGGGAAAA	0.338																																							uc001fdw.2		NA																	0				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11						c.(1396-1398)ATG>TTG		nucleoporin 210kDa-like isoform 1							178.0	179.0	179.0					1																	154091215		1823	4080	5903	SO:0001583	missense	91181					integral to membrane		g.chr1:154091215T>A	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1396A>T	1.37:g.154091215T>A	ENSP00000357547:p.Met466Leu		Somatic				NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Missense_Mutation_p.M466L	p.M466L	NM_207308	NP_997191	WXS	Illumina HiSeq	Unspecified	Q5VU65	P210L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)		11	1468	-	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		466					E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	c.1396A>T	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.948385	0.34377	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.39997	1.05;1.05	5.0	2.58	0.30949	Invasin/intimin cell-adhesion (1);	0.540167	0.18039	N	0.153678	T	0.08133	0.0203	N	0.08118	0	0.20821	N	0.999843	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35276	-0.9795	10	0.27785	T	0.31	-23.895	10.4037	0.44243	0.0:0.0:0.3293:0.6707	.	466;466	E7EP56;Q5VU65	.;P210L_HUMAN	L	466	ENSP00000357547:M466L;ENSP00000271854:M466L	ENSP00000271854:M466L	M	-	1	0	NUP210L	152357839	0.998000	0.40836	0.970000	0.41538	0.700000	0.40528	1.910000	0.39927	0.234000	0.21139	0.377000	0.23210	ATG		0.338	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308		5	121	0	0	0	0.001168	0	5	121				
FCRL4	83417	broad.mit.edu	37	1	157559211	157559211	+	Silent	SNP	T	T	C	rs62640947	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:157559211T>C	ENST00000271532.1	-	3	225	c.90A>G	c.(88-90)ccA>ccG	p.P30P	FCRL4_ENST00000448509.2_5'Flank	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	30	Ig-like C2-type 1.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				ATGTGGTCCATGGAGGATGGA	0.498																																							uc001fqw.2		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(88-90)CCA>CCG		Fc receptor-like 4 precursor							75.0	64.0	68.0					1																	157559211		2203	4300	6503	SO:0001819	synonymous_variant	83417					integral to membrane|plasma membrane	receptor activity	g.chr1:157559211T>C	AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.90A>G	1.37:g.157559211T>C			Somatic				FCRL4_uc010phy.1_RNA	p.P30P	NM_031282	NP_112572	WXS	Illumina HiSeq	Unspecified	Q96PJ5	FCRL4_HUMAN			3	226	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)	30			Extracellular (Potential).|Ig-like C2-type 1.		Q96PJ3|Q96RE0	Silent	SNP	ENST00000271532.1	37	c.90A>G	CCDS1166.1																																																																																				0.498	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282		5	50	0	0	0	0.00308	0	5	50				
SPTA1	6708	broad.mit.edu	37	1	158615301	158615301	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:158615301A>T	ENST00000368147.4	-	28	4160	c.3980T>A	c.(3979-3981)tTg>tAg	p.L1327*		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1327					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCTCTCCAGCAAGATCTCTAT	0.438																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(3979-3981)TTG>TAG		spectrin, alpha, erythrocytic 1							154.0	150.0	151.0					1																	158615301		1998	4163	6161	SO:0001587	stop_gained	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158615301A>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3980T>A	1.37:g.158615301A>T	ENSP00000357129:p.Leu1327*		Somatic					p.L1327*	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			28	4179	-	all_hematologic(112;0.0378)		1327			Spectrin 13.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Nonsense_Mutation	SNP	ENST00000368147.4	37	c.3980T>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	44	11.198068	0.99529	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8001	0.63194	1.0:0.0:0.0:0.0	.	.	.	.	X	1327	.	ENSP00000357129:L1327X	L	-	2	0	SPTA1	156881925	1.000000	0.71417	0.985000	0.45067	0.877000	0.50540	6.512000	0.73737	2.126000	0.65437	0.528000	0.53228	TTG		0.438	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		8	157	0	0	0	0.004482	0	8	157				
OR6K6	128371	broad.mit.edu	37	1	158725536	158725536	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:158725536T>C	ENST00000368144.2	+	1	1027	c.931T>C	c.(931-933)Ttt>Ctt	p.F311L		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					CCTTGCTCCCTTTTTCAACCC	0.438																																							uc001fsw.1		NA																	0				skin(1)	1						c.(931-933)TTT>CTT		olfactory receptor, family 6, subfamily K,							149.0	140.0	143.0					1																	158725536		2203	4300	6503	SO:0001583	missense	128371				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158725536T>C	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.931T>C	1.37:g.158725536T>C	ENSP00000357126:p.Phe311Leu		Somatic					p.F311L	NM_001005184	NP_001005184	WXS	Illumina HiSeq	Unspecified	Q8NGW6	OR6K6_HUMAN			1	931	+	all_hematologic(112;0.0378)		311			Helical; Name=7; (Potential).		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	c.931T>C	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	T	7.953	0.745283	0.15710	.	.	ENSG00000180433	ENST00000368144	T	0.35789	1.29	5.33	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	D	0.000869	T	0.05914	0.0154	N	0.03281	-0.365	0.29167	N	0.877357	B	0.28667	0.219	B	0.27380	0.079	T	0.16070	-1.0415	10	0.40728	T	0.16	-17.7057	7.5224	0.27635	0.1408:0.0:0.147:0.7122	.	311	Q8NGW6	OR6K6_HUMAN	L	311	ENSP00000357126:F311L	ENSP00000357126:F311L	F	+	1	0	OR6K6	156992160	0.000000	0.05858	0.973000	0.42090	0.816000	0.46133	-1.108000	0.03313	1.043000	0.40175	-0.257000	0.10917	TTT		0.438	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184		4	99	0	0	0	0.001168	0	4	99				
OR10J1	26476	broad.mit.edu	37	1	159410334	159410334	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:159410334C>A	ENST00000423932.3	+	1	823	c.786C>A	c.(784-786)taC>taA	p.Y262*	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	262					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					TTGTCCACTACAGCTGTGCCT	0.507																																							uc010piv.1		NA																	0				ovary(1)	1						c.(784-786)TAC>TAA		olfactory receptor, family 10, subfamily J,							171.0	143.0	152.0					1																	159410334		2203	4300	6503	SO:0001587	stop_gained	26476				sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity	g.chr1:159410334C>A	X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.786C>A	1.37:g.159410334C>A	ENSP00000399078:p.Tyr262*		Somatic				uc001fts.3_Intron	p.Y262*	NM_012351	NP_036483	WXS	Illumina HiSeq	Unspecified	P30954	O10J1_HUMAN			1	786	+	all_hematologic(112;0.0429)		262			Helical; Name=6; (Potential).		Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Nonsense_Mutation	SNP	ENST00000423932.3	37	c.786C>A	CCDS1185.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.567115	0.28003	.	.	ENSG00000196184	ENST00000423932	.	.	.	4.42	-2.79	0.05841	.	0.000000	0.37623	N	0.002015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.6029	0.17363	0.0:0.34:0.1416:0.5184	.	.	.	.	X	262	.	ENSP00000399078:Y262X	Y	+	3	2	OR10J1	157676958	0.000000	0.05858	0.324000	0.25361	0.099000	0.18886	-1.732000	0.01851	-0.562000	0.06086	-0.300000	0.09419	TAC		0.507	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059020.1	NM_012351		13	91	1	0	1.5739e-10	0.004007	2.08038e-10	13	91				
RC3H1	149041	broad.mit.edu	37	1	173930982	173930982	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:173930982C>T	ENST00000367696.2	-	12	2434	c.2083G>A	c.(2083-2085)Gag>Aag	p.E695K	RC3H1_ENST00000258349.4_Missense_Mutation_p.E695K|RC3H1_ENST00000367694.2_Missense_Mutation_p.E695K			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	695	Pro-rich.				B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						GGTGGAATCTCAATGGGTATA	0.473																																							uc001gju.3		NA																	0				ovary(2)	2						c.(2083-2085)GAG>AAG		roquin							324.0	319.0	321.0					1																	173930982		2203	4300	6503	SO:0001583	missense	149041				cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:173930982C>T	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2083G>A	1.37:g.173930982C>T	ENSP00000356669:p.Glu695Lys		Somatic				RC3H1_uc010pms.1_Missense_Mutation_p.E695K|RC3H1_uc001gjv.2_Missense_Mutation_p.E695K|RC3H1_uc010pmt.1_Missense_Mutation_p.E695K	p.E695K	NM_172071	NP_742068	WXS	Illumina HiSeq	Unspecified	Q5TC82	RC3H1_HUMAN			11	2170	-			695			Pro-rich.		B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	c.2083G>A	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.247066	0.80024	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.48836	0.8;0.8;0.8	5.78	5.78	0.91487	.	0.140469	0.64402	D	0.000006	T	0.32912	0.0845	L	0.44542	1.39	0.43088	D	0.994758	B;B;B;B	0.27656	0.058;0.058;0.184;0.048	B;B;B;B	0.26094	0.022;0.022;0.066;0.021	T	0.12344	-1.0551	10	0.48119	T	0.1	-9.312	20.0044	0.97430	0.0:1.0:0.0:0.0	.	695;695;695;695	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	K	695	ENSP00000356669:E695K;ENSP00000258349:E695K;ENSP00000356667:E695K	ENSP00000258349:E695K	E	-	1	0	RC3H1	172197605	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.961000	0.70356	2.714000	0.92807	0.650000	0.86243	GAG		0.473	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071		23	238	0	0	0	0.003954	0	23	238				
RC3H1	149041	broad.mit.edu	37	1	173952657	173952657	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:173952657C>A	ENST00000367696.2	-	4	842	c.491G>T	c.(490-492)cGa>cTa	p.R164L	RC3H1_ENST00000258349.4_Missense_Mutation_p.R164L|RC3H1_ENST00000367694.2_Missense_Mutation_p.R164L			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	164					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						TGTAACTGTTCGTTCACCTAA	0.512																																							uc001gju.3		NA																	0				ovary(2)	2						c.(490-492)CGA>CTA		roquin							158.0	129.0	139.0					1																	173952657		2203	4300	6503	SO:0001583	missense	149041				cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:173952657C>A	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.491G>T	1.37:g.173952657C>A	ENSP00000356669:p.Arg164Leu		Somatic				RC3H1_uc010pms.1_Missense_Mutation_p.R164L|RC3H1_uc001gjv.2_Missense_Mutation_p.R164L|RC3H1_uc010pmt.1_Missense_Mutation_p.R164L	p.R164L	NM_172071	NP_742068	WXS	Illumina HiSeq	Unspecified	Q5TC82	RC3H1_HUMAN			3	578	-			164					B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	c.491G>T	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	C	33	5.263987	0.95399	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	D;D;D	0.95656	-3.77;-3.77;-3.77	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.97885	0.9305	M	0.83953	2.67	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.995;0.995;0.998;0.998	D	0.98516	1.0621	10	0.87932	D	0	-11.6664	19.2792	0.94046	0.0:1.0:0.0:0.0	.	164;164;164;164	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	L	164	ENSP00000356669:R164L;ENSP00000258349:R164L;ENSP00000356667:R164L	ENSP00000258349:R164L	R	-	2	0	RC3H1	172219280	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.445000	0.80570	2.630000	0.89119	0.557000	0.71058	CGA		0.512	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071		3	58	1	0	0.004672	0.004672	0.00534343	3	58				
PAPPA2	60676	broad.mit.edu	37	1	176563950	176563950	+	Missense_Mutation	SNP	C	C	T	rs376921585		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:176563950C>T	ENST00000367662.3	+	3	2374	c.1210C>T	c.(1210-1212)Cgc>Tgc	p.R404C	PAPPA2_ENST00000367661.3_Missense_Mutation_p.R404C	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	404					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGCATCTTGCCGCTCTTTGCT	0.587																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(1210-1212)CGC>TGC		pappalysin 2 isoform 1		C	CYS/ARG,CYS/ARG	0,4092		0,0,2046	94.0	95.0	95.0		1210,1210	5.4	1.0	1		95	1,8381		0,1,4190	no	missense,missense	PAPPA2	NM_020318.2,NM_021936.2	180,180	0,1,6236	TT,TC,CC		0.0119,0.0,0.0080	probably-damaging,probably-damaging	404/1792,404/828	176563950	1,12473	2046	4191	6237	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176563950C>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1210C>T	1.37:g.176563950C>T	ENSP00000356634:p.Arg404Cys		Somatic				PAPPA2_uc001gky.1_Missense_Mutation_p.R404C|PAPPA2_uc009www.2_RNA	p.R404C	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			3	2374	+			404					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.1210C>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481559	0.63849	0.0	1.19E-4	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.74002	-0.8;-0.8	5.45	5.45	0.79879	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, subdomain 2 (1);	0.110120	0.64402	D	0.000017	D	0.84624	0.5513	M	0.70275	2.135	0.53005	D	0.99996	D;D	0.89917	1.0;1.0	D;D	0.83275	0.99;0.996	D	0.85328	0.1088	10	0.56958	D	0.05	-25.2794	13.8224	0.63331	0.1532:0.8468:0.0:0.0	.	404;404	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	C	404	ENSP00000356634:R404C;ENSP00000356633:R404C	ENSP00000356633:R404C	R	+	1	0	PAPPA2	174830573	1.000000	0.71417	0.962000	0.40283	0.941000	0.58515	2.931000	0.48932	2.555000	0.86185	0.650000	0.86243	CGC		0.587	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			4	145	0	0	0	0.000602	0	4	145				
NPHS2	7827	broad.mit.edu	37	1	179530487	179530487	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:179530487C>A	ENST00000367615.4	-	3	456	c.388G>T	c.(388-390)Gag>Tag	p.E130*	NPHS2_ENST00000367616.4_Nonsense_Mutation_p.E130*	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	130					actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						CTTTCATACTCTTGTACAACC	0.368																																							uc001gmq.3		NA																	0					0						c.(388-390)GAG>TAG		podocin							105.0	117.0	113.0					1																	179530487		2203	4299	6502	SO:0001587	stop_gained	7827				excretion	integral to plasma membrane	protein binding	g.chr1:179530487C>A	AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.388G>T	1.37:g.179530487C>A	ENSP00000356587:p.Glu130*		Somatic				NPHS2_uc009wxi.2_Nonsense_Mutation_p.E130*	p.E130*	NM_014625	NP_055440	WXS	Illumina HiSeq	Unspecified	Q9NP85	PODO_HUMAN			3	473	-			130			Cytoplasmic (Potential).		B1AM32|B1AM33|Q8N6Q5	Nonsense_Mutation	SNP	ENST00000367615.4	37	c.388G>T	CCDS1331.1	.	.	.	.	.	.	.	.	.	.	C	37	6.009919	0.97200	.	.	ENSG00000116218	ENST00000367615;ENST00000367616	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.6224	18.6781	0.91535	0.0:1.0:0.0:0.0	.	.	.	.	X	130	.	ENSP00000356587:E130X	E	-	1	0	NPHS2	177797110	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.862000	0.69560	2.765000	0.95021	0.650000	0.86243	GAG		0.368	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085283.1			8	142	1	0	1.58986e-06	0.008291	1.97827e-06	8	142				
FAM163A	148753	broad.mit.edu	37	1	179783246	179783246	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:179783246C>T	ENST00000341785.4	+	5	822	c.426C>T	c.(424-426)ccC>ccT	p.P142P	RP11-12M5.3_ENST00000453051.1_RNA|RP11-12M5.3_ENST00000415218.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	142						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						TGGCAGCACCCCAGAGTTACC	0.602																																							uc009wxj.2		NA																	0				ovary(1)	1						c.(424-426)CCC>CCT		hypothetical protein LOC148753							62.0	71.0	68.0					1																	179783246		2203	4300	6503	SO:0001819	synonymous_variant	148753					integral to membrane		g.chr1:179783246C>T	BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.426C>T	1.37:g.179783246C>T			Somatic				FAM163A_uc001gnj.2_Silent_p.P142P|FAM163A_uc009wxk.2_Silent_p.P142P	p.P142P	NM_173509	NP_775780	WXS	Illumina HiSeq	Unspecified	Q96GL9	F163A_HUMAN			6	885	+			142					A8K8R7	Silent	SNP	ENST00000341785.4	37	c.426C>T	CCDS1333.1																																																																																				0.602	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085300.1	NM_173509		16	95	0	0	0	0.004007	0	16	95				
EIF2D	1939	broad.mit.edu	37	1	206767018	206767018	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:206767018T>C	ENST00000271764.2	-	14	1842	c.1634A>G	c.(1633-1635)cAg>cGg	p.Q545R	EIF2D_ENST00000472709.2_Intron|EIF2D_ENST00000367114.3_Missense_Mutation_p.Q421R	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	545	SUI1. {ECO:0000255|PROSITE- ProRule:PRU00200}.				formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GATCTGCACCTGAAGGCTGTC	0.592																																							uc001heh.2		NA																	0					0						c.(1633-1635)CAG>CGG		ligatin							99.0	82.0	88.0					1																	206767018		2203	4300	6503	SO:0001583	missense	1939				intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity	g.chr1:206767018T>C	BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.1634A>G	1.37:g.206767018T>C	ENSP00000271764:p.Gln545Arg		Somatic				LGTN_uc009xbw.2_Missense_Mutation_p.Q421R	p.Q545R	NM_006893	NP_008824	WXS	Illumina HiSeq	Unspecified	P41214	EIF2D_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.166)		14	1843	-	Breast(84;0.183)		545			SUI1.		Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	ENST00000271764.2	37	c.1634A>G	CCDS1465.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.075986	0.55646	.	.	ENSG00000143486	ENST00000367114;ENST00000271764	T;T	0.29917	1.55;1.55	5.68	5.68	0.88126	Translation initiation factor SUI1 (3);	0.186293	0.48767	D	0.000178	T	0.54727	0.1876	M	0.73217	2.22	0.48040	D	0.999574	P;D	0.63880	0.949;0.993	P;D	0.71184	0.498;0.972	T	0.57871	-0.7736	10	0.66056	D	0.02	-24.5372	15.1071	0.72329	0.0:0.0:0.0:1.0	.	421;545	P41214-2;P41214	.;EIF2D_HUMAN	R	421;545	ENSP00000356081:Q421R;ENSP00000271764:Q545R	ENSP00000271764:Q545R	Q	-	2	0	EIF2D	204833641	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.955000	0.56715	2.161000	0.67846	0.460000	0.39030	CAG		0.592	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1	NM_006893		9	92	0	0	0	0.004482	0	9	92				
C1orf74	148304	broad.mit.edu	37	1	209956173	209956173	+	Silent	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:209956173G>C	ENST00000294811.1	-	2	1063	c.807C>G	c.(805-807)ctC>ctG	p.L269L		NM_152485.2	NP_689698.1	Q96LT6	CA074_HUMAN	chromosome 1 open reading frame 74	269										endometrium(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	15				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		GTTAAAGTCAGAGGGCCACAG	0.468																																							uc001hhp.1		NA																	0				skin(1)	1						c.(805-807)CTC>CTG		hypothetical protein LOC148304							100.0	106.0	104.0					1																	209956173		2203	4300	6503	SO:0001819	synonymous_variant	148304							g.chr1:209956173G>C	AK057807	CCDS1491.1	1q32.2	2008-02-05			ENSG00000162757	ENSG00000162757			26319	protein-coding gene	gene with protein product						12477932	Standard	NM_152485		Approved	FLJ25078	uc001hhp.1	Q96LT6	OTTHUMG00000036483	ENST00000294811.1:c.807C>G	1.37:g.209956173G>C			Somatic					p.L269L	NM_152485	NP_689698	WXS	Illumina HiSeq	Unspecified	Q96LT6	CA074_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0328)	2	1050	-			269						Silent	SNP	ENST00000294811.1	37	c.807C>G	CCDS1491.1																																																																																				0.468	C1orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088745.1	NM_152485		10	153	0	0	0	0.001368	0	10	153				
RYR2	6262	broad.mit.edu	37	1	237777522	237777522	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:237777522G>A	ENST00000366574.2	+	37	5411	c.5094G>A	c.(5092-5094)ctG>ctA	p.L1698L	RYR2_ENST00000542537.1_Silent_p.L1682L|RYR2_ENST00000360064.6_Silent_p.L1696L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1698	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGGTTTGCTGCGTGCTGGCT	0.552																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(5092-5094)CTG>CTA		cardiac muscle ryanodine receptor							65.0	65.0	65.0					1																	237777522		2169	4265	6434	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237777522G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5094G>A	1.37:g.237777522G>A			Somatic					p.L1698L	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		37	5214	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1698			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.5094G>A	CCDS55691.1																																																																																				0.552	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		5	32	0	0	0	0.000602	0	5	32				
OR2AK2	391191	broad.mit.edu	37	1	248129579	248129579	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:248129579G>T	ENST00000366480.3	+	1	1045	c.946G>T	c.(946-948)Gtg>Ttg	p.V316L	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	316						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GACGGGGGCAGTGAGGAGACT	0.423																																					Melanoma(45;390 1181 23848 28461 41504)	Melanoma(45;390 1181 23848 28461 41504)	uc010pzd.1		NA																	0				ovary(1)|breast(1)	2						c.(946-948)GTG>TTG		olfactory receptor, family 2, subfamily AK,							102.0	98.0	100.0					1																	248129579		2203	4300	6503	SO:0001583	missense	391191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248129579G>T	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.946G>T	1.37:g.248129579G>T	ENSP00000355436:p.Val316Leu		Somatic				OR2L13_uc001ids.2_Intron	p.V316L	NM_001004491	NP_001004491	WXS	Illumina HiSeq	Unspecified	Q8NG84	O2AK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	946	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		316			Cytoplasmic (Potential).		B2RND1|Q6IF05	Missense_Mutation	SNP	ENST00000366480.3	37	c.946G>T	CCDS31102.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.624629	0.00117	.	.	ENSG00000187080	ENST00000366480	T	0.32515	1.45	3.04	-6.09	0.02145	.	.	.	.	.	T	0.08670	0.0215	N	0.05383	-0.06	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23084	-1.0198	9	0.02654	T	1	.	0.8119	0.01095	0.1448:0.2339:0.2583:0.363	.	316	Q8NG84	O2AK2_HUMAN	L	316	ENSP00000355436:V316L	ENSP00000355436:V316L	V	+	1	0	OR2AK2	246196202	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-11.408000	0.00003	-3.583000	0.00137	-1.516000	0.00938	GTG		0.423	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	NM_001004491		12	85	1	0	1.61879e-10	0.001368	2.13234e-10	12	85				
OR2M7	391196	broad.mit.edu	37	1	248487753	248487753	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:248487753T>A	ENST00000317965.2	-	1	146	c.118A>T	c.(118-120)Atg>Ttg	p.M40L		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAGTTTCCCATGAAGGCCACT	0.527																																							uc010pzk.1		NA																	0				skin(2)	2						c.(118-120)ATG>TTG		olfactory receptor, family 2, subfamily M,							266.0	259.0	262.0					1																	248487753		2203	4300	6503	SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248487753T>A	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.118A>T	1.37:g.248487753T>A	ENSP00000324557:p.Met40Leu		Somatic					p.M40L	NM_001004691	NP_001004691	WXS	Illumina HiSeq	Unspecified	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	118	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		40			Helical; Name=1; (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	c.118A>T	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.182150	0.00308	.	.	ENSG00000177186	ENST00000317965	T	0.00241	8.46	1.55	0.394	0.16299	.	1.173110	0.06729	N	0.776331	T	0.00073	0.0002	N	0.01446	-0.86	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.36040	-0.9764	10	0.05351	T	0.99	.	0.7357	0.00965	0.1925:0.1673:0.3676:0.2725	.	40	Q8NG81	OR2M7_HUMAN	L	40	ENSP00000324557:M40L	ENSP00000324557:M40L	M	-	1	0	OR2M7	246554376	0.000000	0.05858	0.057000	0.19452	0.327000	0.28475	-4.945000	0.00167	0.708000	0.31955	0.163000	0.16589	ATG		0.527	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		29	259	0	0	0	0.001786	0	29	259				
OR2T6	254879	broad.mit.edu	37	1	248551699	248551699	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:248551699T>C	ENST00000355728.2	+	1	790	c.790T>C	c.(790-792)Tct>Cct	p.S264P		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTTCCCCAATCTTACCACAC	0.478																																							uc001iei.1		NA																	0				ovary(2)|skin(1)	3						c.(790-792)TCT>CCT		olfactory receptor, family 2, subfamily T,							170.0	159.0	163.0					1																	248551699		2203	4300	6503	SO:0001583	missense	254879				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248551699T>C	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.790T>C	1.37:g.248551699T>C	ENSP00000347965:p.Ser264Pro		Somatic					p.S264P	NM_001005471	NP_001005471	WXS	Illumina HiSeq	Unspecified	Q8NHC8	OR2T6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	790	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		264			Extracellular (Potential).		A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	c.790T>C	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	T	3.722	-0.057427	0.07317	.	.	ENSG00000198104	ENST00000355728	T	0.00272	8.36	4.02	-0.0907	0.13664	GPCR, rhodopsin-like superfamily (1);	0.729526	0.11855	N	0.522912	T	0.00412	0.0013	M	0.86178	2.8	0.09310	N	1	B	0.28291	0.206	B	0.37387	0.248	T	0.16958	-1.0385	10	0.72032	D	0.01	.	11.4836	0.50339	0.0:0.0:0.4409:0.5591	.	264	Q8NHC8	OR2T6_HUMAN	P	264	ENSP00000347965:S264P	ENSP00000347965:S264P	S	+	1	0	OR2T6	246618322	0.000000	0.05858	0.035000	0.18076	0.004000	0.04260	-0.024000	0.12435	-0.110000	0.12022	-0.332000	0.08345	TCT		0.478	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471		6	70	0	0	0	0.001168	0	6	70				
OR2T1	26696	broad.mit.edu	37	1	248570332	248570332	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:248570332A>T	ENST00000366474.1	+	1	1037	c.1037A>T	c.(1036-1038)gAt>gTt	p.D346V		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	346						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGAAACAAGGATGTGACTGGA	0.512																																							uc010pzm.1		NA																	0				pancreas(1)	1						c.(1036-1038)GAT>GTT		olfactory receptor, family 2, subfamily T,							157.0	165.0	162.0					1																	248570332		2203	4300	6503	SO:0001583	missense	26696				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248570332A>T	U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.1037A>T	1.37:g.248570332A>T	ENSP00000355430:p.Asp346Val		Somatic					p.D346V	NM_030904	NP_112166	WXS	Illumina HiSeq	Unspecified	O43869	OR2T1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	1037	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		346			Cytoplasmic (Potential).		Q6IEZ9	Missense_Mutation	SNP	ENST00000366474.1	37	c.1037A>T	CCDS31115.1	.	.	.	.	.	.	.	.	.	.	a	15.41	2.824206	0.50739	.	.	ENSG00000175143	ENST00000366474	T	0.40476	1.03	5.19	4.05	0.47172	.	0.000000	0.38111	U	0.001813	T	0.56717	0.2004	L	0.54863	1.705	0.58432	D	0.999998	D	0.89917	1.0	D	0.79108	0.992	T	0.57300	-0.7835	10	0.87932	D	0	.	10.4976	0.44788	0.8542:0.0:0.0:0.1458	.	346	O43869	OR2T1_HUMAN	V	346	ENSP00000355430:D346V	ENSP00000355430:D346V	D	+	2	0	OR2T1	246636955	1.000000	0.71417	0.288000	0.24862	0.574000	0.36063	5.645000	0.67909	0.791000	0.33826	0.533000	0.62120	GAT		0.512	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097346.2			27	178	0	0	0	0.002096	0	27	178				
DIP2C	22982	broad.mit.edu	37	10	436259	436259	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:436259G>A	ENST00000280886.6	-	12	1526	c.1439C>T	c.(1438-1440)cCc>cTc	p.P480L	DIP2C_ENST00000381496.3_Missense_Mutation_p.P373L	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	480						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CCAGTCTCGGGGCGGTTTGGA	0.478																																							uc001ifp.2		NA																	0		p.P480P(1)		breast(4)|ovary(2)|large_intestine(1)	7						c.(1438-1440)CCC>CTC		DIP2 disco-interacting protein 2 homolog C							129.0	127.0	127.0					10																	436259		2203	4300	6503	SO:0001583	missense	22982					nucleus	catalytic activity|transcription factor binding	g.chr10:436259G>A	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.1439C>T	10.37:g.436259G>A	ENSP00000280886:p.Pro480Leu		Somatic				DIP2C_uc009xhj.1_Missense_Mutation_p.P176L	p.P480L	NM_014974	NP_055789	WXS	Illumina HiSeq	Unspecified	Q9Y2E4	DIP2C_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)	12	1529	-		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	480					B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	c.1439C>T	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	33	5.232038	0.95207	.	.	ENSG00000151240	ENST00000280886;ENST00000381496	T;T	0.44881	0.91;0.91	5.67	5.67	0.87782	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.62356	0.2421	M	0.65498	2.005	0.80722	D	1	D;P	0.56746	0.977;0.954	P;P	0.62560	0.904;0.847	T	0.58306	-0.7659	10	0.39692	T	0.17	-18.3496	19.7564	0.96294	0.0:0.0:1.0:0.0	.	373;480	E7EPU2;Q9Y2E4	.;DIP2C_HUMAN	L	480;373	ENSP00000280886:P480L;ENSP00000370907:P373L	ENSP00000280886:P480L	P	-	2	0	DIP2C	426259	1.000000	0.71417	0.999000	0.59377	0.771000	0.43674	9.813000	0.99286	2.677000	0.91161	0.467000	0.42956	CCC		0.478	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974		16	118	0	0	0	0.001882	0	16	118				
LARP4B	23185	broad.mit.edu	37	10	871703	871704	+	Splice_Site	DNP	CC	CC	AA			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:871703_871704CC>AA	ENST00000316157.3	-	11	1272_1273	c.1232_1233GG>TT	c.(1231-1233)aGG>aTT	p.R411I		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	411					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						CCGGAACTTGCCTGCTTCGAGG	0.515																																							uc001ifs.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.e11+1		La ribonucleoprotein domain family, member 4B																																				SO:0001630	splice_region_variant	23185						nucleotide binding|RNA binding	g.chr10:871703_871704CC>AA	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1232_1233delinsAA	10.37:g.871703_871704delinsAA			Somatic					p.R411_splice	NM_015155	NP_055970	WXS	Illumina HiSeq	Unspecified	Q92615	LAR4B_HUMAN			11	1273	-								A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Splice_Site	DNP	ENST00000316157.3	37	c.1232_splice	CCDS31131.1																																																																																				0.515	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155	Missense_Mutation	4	35	0	0	0	0.004672	0	4	35				
IL2RA	3559	broad.mit.edu	37	10	6066301	6066301	+	Silent	SNP	C	C	T	rs36065822|rs41290331		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:6066301C>T	ENST00000379959.3	-	3	446	c.273G>A	c.(271-273)acG>acA	p.T91T	IL2RA_ENST00000379954.1_Silent_p.T91T|IL2RA_ENST00000256876.6_Silent_p.T91T|RP11-536K7.5_ENST00000440436.1_RNA	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	91					activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)			endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	TCACTTGTTTCGTTGTGTTCC	0.413																																							uc001iiz.1		NA																	0				ovary(1)|skin(1)	2						c.(271-273)ACG>ACA		interleukin 2 receptor, alpha chain precursor	Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)						256.0	202.0	220.0					10																	6066301		2203	4300	6503	SO:0001819	synonymous_variant	3559				cell proliferation	integral to membrane	interleukin-2 receptor activity	g.chr10:6066301C>T	X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.273G>A	10.37:g.6066301C>T			Somatic				IL2RA_uc009xih.1_Silent_p.T91T|IL2RA_uc001ija.1_Silent_p.T53T	p.T91T	NM_000417	NP_000408	WXS	Illumina HiSeq	Unspecified	P01589	IL2RA_HUMAN			3	432	-			91			Extracellular (Potential).		Q5W007	Silent	SNP	ENST00000379959.3	37	c.273G>A	CCDS7076.1	.	.	.	.	.	.	.	.	.	.	c	2.203	-0.382586	0.04966	.	.	ENSG00000134460	ENST00000447847	.	.	.	3.68	-3.24	0.05094	.	.	.	.	.	T	0.21145	0.0509	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29366	-1.0014	4	.	.	.	-13.7209	4.3844	0.11309	0.1642:0.4024:0.0:0.4334	rs41290331	.	.	.	Q	62	.	.	R	-	2	0	IL2RA	6106307	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.098000	0.11024	-0.656000	0.05380	-0.993000	0.02533	CGA		0.413	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1	NM_000417		6	35	0	0	0	0.001168	0	6	35				
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	RNA	SNP	A	A	G	rs2257765		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:38654432A>G	ENST00000494540.1	+	0	599					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TCATCTCGCAATGCAAGGAAA	0.453																																							uc010qex.1		NA																	0					0						c.(523-525)AAT>AGT		SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);																																						158160							g.chr10:38654432A>G			10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38654432A>G			Somatic				HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Missense_Mutation_p.N173S	p.N175S			WXS	Illumina HiSeq	Unspecified					5	599	+									Missense_Mutation	SNP	ENST00000494540.1	37	c.524A>G																																																																																					0.453	HSD17B7P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000047631.2	NR_003086		3	54	0	0	0	0.004672	0	3	54				
FRMPD2	143162	broad.mit.edu	37	10	49450294	49450294	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:49450294C>T	ENST00000374201.3	-	5	779	c.477G>A	c.(475-477)cgG>cgA	p.R159R	FRMPD2_ENST00000305531.3_Silent_p.R135R|FRMPD2_ENST00000407470.4_Silent_p.R128R	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	159	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		TCTCATGAACCCGACAAGCTT	0.572																																							uc001jgi.2		NA																	0				large_intestine(1)	1						c.(475-477)CGG>CGA		FERM and PDZ domain containing 2 isoform 3							100.0	97.0	98.0					10																	49450294		2203	4300	6503	SO:0001819	synonymous_variant	143162				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding	g.chr10:49450294C>T	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.477G>A	10.37:g.49450294C>T			Somatic				FRMPD2_uc001jgh.2_Silent_p.R128R|FRMPD2_uc001jgj.2_Silent_p.R137R	p.R159R	NM_001018071	NP_001018081	WXS	Illumina HiSeq	Unspecified	Q68DX3	FRPD2_HUMAN		Kidney(211;0.201)	5	584	-			159			KIND.		B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	ENST00000374201.3	37	c.477G>A	CCDS31195.1																																																																																				0.572	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428		10	114	0	0	0	0.006214	0	10	114				
HK1	3098	broad.mit.edu	37	10	71158451	71158451	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:71158451G>C	ENST00000359426.6	+	17	2580	c.2476G>C	c.(2476-2478)Gtg>Ctg	p.V826L	HK1_ENST00000404387.2_Missense_Mutation_p.V830L|HK1_ENST00000360289.2_Missense_Mutation_p.V814L|HK1_ENST00000448642.2_Missense_Mutation_p.V861L|HK1_ENST00000298649.3_Missense_Mutation_p.V825L	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	826	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GTGCGGGGTGGTGTCCAGGAG	0.592																																							uc001jpl.3		NA																	0				ovary(1)	1						c.(2476-2478)GTG>CTG		hexokinase 1 isoform HKI							89.0	77.0	81.0					10																	71158451		2203	4300	6503	SO:0001583	missense	3098				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity	g.chr10:71158451G>C	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.2476G>C	10.37:g.71158451G>C	ENSP00000352398:p.Val826Leu		Somatic				HK1_uc001jpg.3_Missense_Mutation_p.V814L|HK1_uc001jph.3_Missense_Mutation_p.V830L|HK1_uc001jpi.3_Missense_Mutation_p.V830L|HK1_uc001jpj.3_Missense_Mutation_p.V861L|HK1_uc001jpk.3_Missense_Mutation_p.V825L	p.V826L	NM_000188	NP_000179	WXS	Illumina HiSeq	Unspecified	P19367	HXK1_HUMAN			17	2577	+			826			Catalytic.		E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	c.2476G>C	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.891109	0.91889	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.97620	-4.46;-4.46;-4.46;-4.46;-4.46	5.49	4.59	0.56863	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98689	0.9560	M	0.92555	3.32	0.80722	D	1	D;D;D;D;B	0.76494	0.991;0.999;0.999;0.999;0.011	P;D;D;D;B	0.85130	0.897;0.994;0.997;0.994;0.003	D	0.99474	1.0946	10	0.87932	D	0	-30.19	13.7759	0.63053	0.0746:0.0:0.9254:0.0	.	826;825;861;830;814	P19367;P19367-2;E7ENR4;P19367-3;P19367-4	HXK1_HUMAN;.;.;.;.	L	814;861;830;825;826;826	ENSP00000353433:V814L;ENSP00000402103:V861L;ENSP00000384774:V830L;ENSP00000298649:V825L;ENSP00000352398:V826L	ENSP00000298649:V825L	V	+	1	0	HK1	70828457	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	8.004000	0.88535	1.313000	0.45069	0.563000	0.77884	GTG		0.592	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188		7	38	0	0	0	0.001984	0	7	38				
NDST2	8509	broad.mit.edu	37	10	75565474	75565474	+	Silent	SNP	T	T	C	rs192145180	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:75565474T>C	ENST00000309979.6	-	8	2173	c.1617A>G	c.(1615-1617)ctA>ctG	p.L539L	RP11-574K11.31_ENST00000603027.1_Silent_p.L539L|NDST2_ENST00000299641.4_Silent_p.L416L			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	539	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					CAAAGGTGTATAGGCCCAGCC	0.517													T|||	3	0.000599042	0.0015	0.0014	5008	,	,		18837	0.0		0.0	False		,,,				2504	0.0						uc001jvk.2		NA																	0				ovary(1)	1						c.(1615-1617)CTA>CTG		heparan glucosaminyl							101.0	89.0	93.0					10																	75565474		2203	4300	6503	SO:0001819	synonymous_variant	8509					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr10:75565474T>C	U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.1617A>G	10.37:g.75565474T>C			Somatic				NDST2_uc010qks.1_Silent_p.L165L|NDST2_uc010qkt.1_Silent_p.L416L|NDST2_uc001jvl.1_5'Flank|NDST2_uc009xro.2_Silent_p.L165L|NDST2_uc010qku.1_Silent_p.L414L	p.L539L	NM_003635	NP_003626	WXS	Illumina HiSeq	Unspecified	P52849	NDST2_HUMAN			8	2421	-	Prostate(51;0.0112)		539			Lumenal (Potential).|Heparan sulfate N-deacetylase 2.		Q2TB32|Q59H89	Silent	SNP	ENST00000309979.6	37	c.1617A>G	CCDS7335.1																																																																																				0.517	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048710.1	NM_003635		5	50	0	0	0	0.001168	0	5	50				
DYDC1	143241	broad.mit.edu	37	10	82112230	82112230	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:82112230T>A	ENST00000372204.3	-	3	292	c.128A>T	c.(127-129)aAt>aTt	p.N43I	DYDC1_ENST00000421924.2_Missense_Mutation_p.N43I|DYDC2_ENST00000372197.1_Intron|DYDC2_ENST00000372199.1_5'UTR|DYDC2_ENST00000372198.1_Intron|DYDC1_ENST00000372202.1_Missense_Mutation_p.N43I	NM_138812.3	NP_620167.1	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	43										kidney(1)|large_intestine(3)|skin(1)	5			Colorectal(32;0.229)			CATGGTCACATTTTCCTTATA	0.378																																							uc001kbx.2		NA																	0					0						c.(127-129)AAT>ATT		DPY30 domain containing 1							73.0	67.0	69.0					10																	82112230		2203	4300	6503	SO:0001583	missense	143241							g.chr10:82112230T>A	BC019250	CCDS7366.1	10q22.3	2006-02-01			ENSG00000170788	ENSG00000170788			23460	protein-coding gene	gene with protein product		615154					Standard	NM_138812		Approved	bA36D19.5, DPY30D1	uc031pwj.1	Q8WWB3	OTTHUMG00000018609	ENST00000372204.3:c.128A>T	10.37:g.82112230T>A	ENSP00000361278:p.Asn43Ile		Somatic				DYDC1_uc001kby.1_Missense_Mutation_p.N43I|DYDC1_uc009xsr.1_Missense_Mutation_p.N43I|DYDC2_uc001kbz.1_RNA|DYDC2_uc001kca.1_Intron	p.N43I	NM_138812	NP_620167	WXS	Illumina HiSeq	Unspecified	Q8WWB3	DYDC1_HUMAN	Colorectal(32;0.229)		3	293	-			43					A8K927|Q5QP03|Q5QP04|Q6WNP4|Q6ZU87	Missense_Mutation	SNP	ENST00000372204.3	37	c.128A>T	CCDS7366.1	.	.	.	.	.	.	.	.	.	.	T	16.55	3.153667	0.57259	.	.	ENSG00000170788	ENST00000372204;ENST00000372202;ENST00000421924;ENST00000454362;ENST00000453477	.	.	.	5.97	5.97	0.96955	.	0.064307	0.64402	D	0.000006	T	0.69513	0.3119	L	0.48362	1.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.72093	-0.4394	9	0.87932	D	0	-16.7131	12.8526	0.57867	0.0:0.0:0.0:1.0	.	43;43	A8K927;Q8WWB3	.;DYDC1_HUMAN	I	43	.	ENSP00000361276:N43I	N	-	2	0	DYDC1	82102210	0.958000	0.32768	0.924000	0.36721	0.913000	0.54294	1.877000	0.39598	2.288000	0.76882	0.533000	0.62120	AAT		0.378	DYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049059.1	NM_138812		6	23	0	0	0	0.001984	0	6	23				
TNKS2	80351	broad.mit.edu	37	10	93586895	93586895	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:93586895T>C	ENST00000371627.4	+	8	1296	c.917T>C	c.(916-918)cTc>cCc	p.L306P		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	306					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				CCAACACTGCTCAATTGTCAC	0.393																																							uc001khp.2		NA																	0				kidney(3)|skin(3)|ovary(1)|lung(1)	8						c.(916-918)CTC>CCC		tankyrase, TRF1-interacting ankyrin-related							138.0	128.0	131.0					10																	93586895		2203	4300	6503	SO:0001583	missense	80351				positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding	g.chr10:93586895T>C	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.917T>C	10.37:g.93586895T>C	ENSP00000360689:p.Leu306Pro		Somatic					p.L306P	NM_025235	NP_079511	WXS	Illumina HiSeq	Unspecified	Q9H2K2	TNKS2_HUMAN			8	1214	+		Colorectal(252;0.162)	306			ANK 6.		B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	37	c.917T>C	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.346374	0.61073	.	.	ENSG00000107854	ENST00000371627	T	0.16457	2.34	5.77	5.77	0.91146	Ankyrin repeat-containing domain (3);	0.000000	0.47093	D	0.000254	T	0.19604	0.0471	L	0.49455	1.56	0.80722	D	1	B	0.09022	0.002	B	0.18561	0.022	T	0.02275	-1.1184	10	0.30078	T	0.28	.	16.3948	0.83586	0.0:0.0:0.0:1.0	.	306	Q9H2K2	TNKS2_HUMAN	P	306	ENSP00000360689:L306P	ENSP00000360689:L306P	L	+	2	0	TNKS2	93576875	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	7.970000	0.88000	2.326000	0.78906	0.533000	0.62120	CTC		0.393	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235		4	76	0	0	0	0.000248	0	4	76				
BTAF1	9044	broad.mit.edu	37	10	93695417	93695417	+	Silent	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:93695417A>G	ENST00000265990.6	+	2	326	c.18A>G	c.(16-18)ctA>ctG	p.L6L		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	6					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				ATTTCAGGCTAGATCGCCTTT	0.388																																							uc001khr.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(16-18)CTA>CTG		BTAF1 RNA polymerase II, B-TFIID transcription							167.0	143.0	151.0					10																	93695417		2203	4300	6503	SO:0001819	synonymous_variant	9044				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity	g.chr10:93695417A>G	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.18A>G	10.37:g.93695417A>G			Somatic				BTAF1_uc009xua.1_RNA	p.L6L	NM_003972	NP_003963	WXS	Illumina HiSeq	Unspecified	O14981	BTAF1_HUMAN			2	116	+		Colorectal(252;0.0846)	6					B4E0W6|O43578	Silent	SNP	ENST00000265990.6	37	c.18A>G	CCDS7419.1																																																																																				0.388	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972		13	53	0	0	0	0.00245	0	13	53				
NEURL1	9148	broad.mit.edu	37	10	105349997	105349997	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:105349997G>A	ENST00000369780.4	+	6	2002	c.1593G>A	c.(1591-1593)acG>acA	p.T531T	SH3PXD2A_ENST00000427662.2_Intron|NEURL_ENST00000369777.2_Silent_p.T514T	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		531					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CGGTGGACACGGTCATCTACA	0.637																																							uc001kxh.2		NA																	0					0						c.(1591-1593)ACG>ACA		neuralized-like							138.0	108.0	118.0					10																	105349997		2203	4300	6503	SO:0001819	synonymous_variant	9148				nervous system development	perinuclear region of cytoplasm	zinc ion binding	g.chr10:105349997G>A																												ENST00000369780.4:c.1593G>A	10.37:g.105349997G>A			Somatic				SH3PXD2A_uc010qqr.1_Intron	p.T531T	NM_004210	NP_004201	WXS	Illumina HiSeq	Unspecified	O76050	NEU1A_HUMAN		Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)	6	2003	+			531			RING-type.		Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Silent	SNP	ENST00000369780.4	37	c.1593G>A	CCDS7551.1																																																																																				0.637	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1			10	77	0	0	0	0.006214	0	10	77				
ATRNL1	26033	broad.mit.edu	37	10	117001358	117001358	+	Splice_Site	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:117001358A>G	ENST00000355044.3	+	10	1658		c.e10-1			NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1						G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TTTATTCTGTAGGACTATTTT	0.328																																							uc001lcg.2		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)	7						c.e10-2		attractin-like 1 precursor							65.0	64.0	64.0					10																	117001358		2203	4300	6503	SO:0001630	splice_region_variant	26033					integral to membrane	sugar binding	g.chr10:117001358A>G	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.1533-1A>G	10.37:g.117001358A>G			Somatic					p.W511_splice	NM_207303	NP_997186	WXS	Illumina HiSeq	Unspecified	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	10	1919	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)						O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Splice_Site	SNP	ENST00000355044.3	37	c.1533_splice	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.407640	0.83340	.	.	ENSG00000107518	ENST00000355044	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7884	0.78326	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATRNL1	116991348	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.176000	0.94839	2.198000	0.70561	0.533000	0.62120	.		0.328	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	Intron	5	51	0	0	0	0.001168	0	5	51				
KIAA1598	57698	broad.mit.edu	37	10	118699991	118699991	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:118699991G>A	ENST00000355371.4	-	9	1341	c.844C>T	c.(844-846)Cag>Tag	p.Q282*	KIAA1598_ENST00000392903.2_Nonsense_Mutation_p.Q282*|KIAA1598_ENST00000497044.1_5'UTR|KIAA1598_ENST00000260777.10_Nonsense_Mutation_p.Q282*|KIAA1598_ENST00000392901.4_Nonsense_Mutation_p.Q222*	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598	282					axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		TGTTGATGCTGAATTCTCTCT	0.423																																							uc009xyw.2		NA																	0					0						c.(844-846)CAG>TAG		shootin1 isoform a							216.0	204.0	208.0					10																	118699991		2203	4300	6503	SO:0001587	stop_gained	57698				axon guidance	axon		g.chr10:118699991G>A	BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.844C>T	10.37:g.118699991G>A	ENSP00000347532:p.Gln282*		Somatic				KIAA1598_uc001lcz.3_Nonsense_Mutation_p.Q282*|KIAA1598_uc010qso.1_Nonsense_Mutation_p.Q222*|KIAA1598_uc010qsp.1_Nonsense_Mutation_p.Q282*|KIAA1598_uc010qsq.1_Nonsense_Mutation_p.Q222*|KIAA1598_uc001lcy.3_Nonsense_Mutation_p.Q252*	p.Q282*	NM_001127211	NP_001120683	WXS	Illumina HiSeq	Unspecified	A0MZ66	SHOT1_HUMAN		all cancers(201;0.00494)	9	1342	-			282			Potential.		A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	Nonsense_Mutation	SNP	ENST00000355371.4	37	c.844C>T	CCDS44482.1	.	.	.	.	.	.	.	.	.	.	G	38	7.026232	0.98010	.	.	ENSG00000187164	ENST00000392903;ENST00000260777;ENST00000355371;ENST00000392901	.	.	.	5.08	4.17	0.49024	.	0.119800	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-3.7412	15.6526	0.77110	0.0:0.1377:0.8623:0.0	.	.	.	.	X	282;282;282;222	.	ENSP00000260777:Q282X	Q	-	1	0	KIAA1598	118689981	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.425000	0.52771	1.139000	0.42245	0.650000	0.86243	CAG		0.423	KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018330		8	116	0	0	0	0.006214	0	8	116				
ATE1	11101	broad.mit.edu	37	10	123661995	123661995	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:123661995A>G	ENST00000224652.6	-	6	809	c.724T>C	c.(724-726)Ttt>Ctt	p.F242L	ATE1_ENST00000543447.1_Missense_Mutation_p.F127L|ATE1_ENST00000369040.3_Missense_Mutation_p.F146L|ATE1_ENST00000481784.1_5'UTR|ATE1_ENST00000369043.3_Missense_Mutation_p.F242L|ATE1_ENST00000540606.1_Missense_Mutation_p.F235L|ATE1_ENST00000535655.1_Intron	NM_001001976.1	NP_001001976.1	O95260	ATE1_HUMAN	arginyltransferase 1	242					protein arginylation (GO:0016598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginyltransferase activity (GO:0004057)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				TTTGGTGGAAACAAAGATGGT	0.423																																							uc001lfp.2		NA																	0					0						c.(724-726)TTT>CTT		arginyltransferase 1 isoform 2							162.0	152.0	156.0					10																	123661995		2203	4300	6503	SO:0001583	missense	11101				protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity	g.chr10:123661995A>G	AF079098	CCDS31299.1, CCDS31300.1, CCDS73211.1, CCDS73212.1, CCDS73213.1	10q26	2013-05-08			ENSG00000107669	ENSG00000107669	2.3.2.8		782	protein-coding gene	gene with protein product		607103				16002466, 16943202	Standard	XM_005269458		Approved		uc001lfq.3	O95260	OTTHUMG00000019178	ENST00000224652.6:c.724T>C	10.37:g.123661995A>G	ENSP00000224652:p.Phe242Leu		Somatic				ATE1_uc001lfq.2_Missense_Mutation_p.F242L|ATE1_uc010qtr.1_Missense_Mutation_p.F127L|ATE1_uc010qts.1_Missense_Mutation_p.F146L|ATE1_uc010qtt.1_Missense_Mutation_p.F235L|ATE1_uc001lfr.2_Intron|ATE1_uc009xzu.2_Intron	p.F242L	NM_007041	NP_008972	WXS	Illumina HiSeq	Unspecified	O95260	ATE1_HUMAN			6	806	-		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)	242					O95261|Q5SQQ3|Q8WW04	Missense_Mutation	SNP	ENST00000224652.6	37	c.724T>C	CCDS31300.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.334|2.334	-0.352669|-0.352669	0.05173|0.05173	.|.	.|.	ENSG00000107669|ENSG00000107669	ENST00000369043;ENST00000224652;ENST00000369040;ENST00000540606;ENST00000543447|ENST00000423243	.|.	.|.	.|.	4.86|4.86	-0.292|-0.292	0.12839|0.12839	.|.	0.838539|.	0.10841|.	N|.	0.628181|.	T|T	0.10035|0.10035	0.0246|0.0246	N|N	0.04880|0.04880	-0.145|-0.145	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.04013|.	0.001;0.0;0.0;0.001|.	T|T	0.25363|0.25363	-1.0134|-1.0134	9|5	0.09590|.	T|.	0.72|.	-33.7433|-33.7433	0.323|0.323	0.00306|0.00306	0.305:0.2106:0.2794:0.205|0.305:0.2106:0.2794:0.205	.|.	235;146;242;242|.	F5GXE4;B4E107;O95260;O95260-2|.	.;.;ATE1_HUMAN;.|.	L|A	242;242;146;235;127|238	.|.	ENSP00000224652:F242L|.	F|V	-|-	1|2	0|0	ATE1|ATE1	123651985|123651985	0.008000|0.008000	0.16893|0.16893	0.009000|0.009000	0.14445|0.14445	0.889000|0.889000	0.51656|0.51656	1.680000|1.680000	0.37607|0.37607	0.031000|0.031000	0.15407|0.15407	0.455000|0.455000	0.32223|0.32223	TTT|GTT		0.423	ATE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001001976		16	98	0	0	0	0.006122	0	16	98				
C10orf90	118611	broad.mit.edu	37	10	128114584	128114584	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr10:128114584T>A	ENST00000284694.7	-	8	2157	c.2037A>T	c.(2035-2037)agA>agT	p.R679S	C10orf90_ENST00000454341.1_Missense_Mutation_p.R582S|C10orf90_ENST00000480379.1_Missense_Mutation_p.R83S|C10orf90_ENST00000544758.1_Missense_Mutation_p.R776S|C10orf90_ENST00000356858.3_Missense_Mutation_p.R632S	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	679	ALMS motif. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CGGCACGGAGTCTGTTACTTT	0.413																																							uc001ljq.2		NA																	0				ovary(1)|skin(1)	2						c.(2035-2037)AGA>AGT		hypothetical protein LOC118611							211.0	194.0	199.0					10																	128114584		2203	4300	6503	SO:0001583	missense	118611							g.chr10:128114584T>A	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.2037A>T	10.37:g.128114584T>A	ENSP00000284694:p.Arg679Ser		Somatic				C10orf90_uc001ljp.2_Missense_Mutation_p.R535S|C10orf90_uc010qum.1_Missense_Mutation_p.R776S|C10orf90_uc001ljo.2_RNA	p.R679S	NM_001004298	NP_001004298	WXS	Illumina HiSeq	Unspecified	Q96M02	CJ090_HUMAN		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)	8	2158	-		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)	679					B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	c.2037A>T	CCDS31310.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.5|22.5	4.298620|4.298620	0.81025|0.81025	.|.	.|.	ENSG00000154493|ENSG00000154493	ENST00000424927|ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758	.|T;T;T	.|0.34072	.|1.38;1.51;1.47	5.58|5.58	-1.0|-1.0	0.10196|0.10196	.|.	.|0.000000	.|0.46758	.|D	.|0.000272	T|T	0.50137|0.50137	0.1598|0.1598	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.992;0.999;0.992	.|P;D;P	.|0.69479	.|0.856;0.964;0.813	T|T	0.48980|0.48980	-0.8986|-0.8986	5|10	.|0.87932	.|D	.|0	-24.6262|-24.6262	11.0038|11.0038	0.47622|0.47622	0.0:0.4508:0.0:0.5492|0.0:0.4508:0.0:0.5492	.|.	.|776;679;582	.|F5GZL2;Q96M02;Q96M02-2	.|.;CJ090_HUMAN;.	V|S	222|632;679;582;776	.|ENSP00000284694:R679S;ENSP00000398786:R582S;ENSP00000444369:R776S	.|ENSP00000284694:R679S	D|R	-|-	2|3	0|2	C10orf90|C10orf90	128104574|128104574	0.982000|0.982000	0.34865|0.34865	0.991000|0.991000	0.47740|0.47740	0.998000|0.998000	0.95712|0.95712	-0.049000|-0.049000	0.11924|0.11924	-0.339000|-0.339000	0.08401|0.08401	0.533000|0.533000	0.62120|0.62120	GAC|AGA		0.413	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298		15	84	0	0	0	0.00499	0	15	84				
MUC6	4588	broad.mit.edu	37	11	1026473	1026473	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:1026473G>A	ENST00000421673.2	-	20	2450	c.2400C>T	c.(2398-2400)ccC>ccT	p.P800P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	800					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CACACTTGGTGGGCACCTGGA	0.692																																							uc001lsw.2		NA																	0				ovary(1)	1						c.(2398-2400)CCC>CCT		mucin 6, gastric							22.0	26.0	25.0					11																	1026473		2017	4173	6190	SO:0001819	synonymous_variant	4588				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent	g.chr11:1026473G>A	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2400C>T	11.37:g.1026473G>A			Somatic					p.P800P	NM_005961	NP_005952	WXS	Illumina HiSeq	Unspecified	Q6W4X9	MUC6_HUMAN		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	20	2451	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	800					O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	c.2400C>T	CCDS44513.1																																																																																				0.692	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		3	22	0	0	0	0.000602	0	3	22				
MUC5B	727897	broad.mit.edu	37	11	1264911	1264911	+	Silent	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:1264911T>C	ENST00000529681.1	+	31	6859	c.6801T>C	c.(6799-6801)tcT>tcC	p.S2267S	MUC5B_ENST00000447027.1_Silent_p.S2270S|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2267	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.S2267S(1)|p.S2270S(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CACCCCCTTCTCCAGGGACGA	0.677																																							uc009ycr.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(8713-8715)TCT>TCC		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							127.0	156.0	146.0					11																	1264911		2155	4230	6385	SO:0001819	synonymous_variant	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1264911T>C	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.6801T>C	11.37:g.1264911T>C			Somatic				MUC5B_uc001ltb.2_Silent_p.S2270S	p.S2905S	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	48	8841	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	2267			7 X Cys-rich subdomain repeats.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	c.8715T>C	CCDS44515.2																																																																																				0.677	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		3	98	0	0	0	0.004672	0	3	98				
KRTAP5-1	387264	broad.mit.edu	37	11	1605992	1605992	+	Missense_Mutation	SNP	G	G	T	rs60899198	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:1605992G>T	ENST00000382171.2	-	1	521	c.488C>A	c.(487-489)tCc>tAc	p.S163Y	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	163	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GGCCCCCTTGGAGCACCCACA	0.652																																							uc001ltu.1		NA																	0					0						c.(487-489)TCC>TAC		keratin associated protein 5-1							69.0	84.0	79.0					11																	1605992		2202	4299	6501	SO:0001583	missense	387264					keratin filament		g.chr11:1605992G>T	AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.488C>A	11.37:g.1605992G>T	ENSP00000371606:p.Ser163Tyr		Somatic				LOC338651_uc009ycx.1_Intron|LOC338651_uc001ltt.1_Intron	p.S163Y	NM_001005922	NP_001005922	WXS	Illumina HiSeq	Unspecified	Q6L8H4	KRA51_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	1	522	-		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	163			8 X 4 AA repeats of C-C-X-P.			Missense_Mutation	SNP	ENST00000382171.2	37	c.488C>A	CCDS31330.1	.	.	.	.	.	.	.	.	.	.	-	1.959	-0.439445	0.04636	.	.	ENSG00000205869	ENST00000382171	T	0.05081	3.5	3.69	-5.66	0.02451	.	.	.	.	.	T	0.11239	0.0274	M	0.76170	2.325	0.09310	N	1	P	0.43094	0.799	B	0.41813	0.367	T	0.09684	-1.0663	9	0.54805	T	0.06	.	17.1666	0.86818	0.0:0.7049:0.2951:0.0	.	163	Q6L8H4	KRA51_HUMAN	Y	163	ENSP00000371606:S163Y	ENSP00000371606:S163Y	S	-	2	0	KRTAP5-1	1562568	0.000000	0.05858	0.150000	0.22450	0.017000	0.09413	-1.717000	0.01876	-1.045000	0.03250	-0.974000	0.02594	TCC		0.652	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127922.1	NM_001005922		14	165	1	0	3.27435e-08	0.00245	4.18329e-08	14	165				
OR51Q1	390061	broad.mit.edu	37	11	5443585	5443585	+	Missense_Mutation	SNP	G	G	A	rs145294897		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:5443585G>A	ENST00000300778.4	+	1	245	c.155G>A	c.(154-156)cGc>cAc	p.R52H	HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTGTCATTCGCACAGAGCCA	0.562																																							uc010qzd.1		NA																	0				ovary(1)	1						c.(154-156)CGC>CAC		olfactory receptor, family 51, subfamily Q,		G	HIS/ARG	0,4402		0,0,2201	314.0	260.0	279.0		155	-0.5	0.0	11	dbSNP_134	279	1,8593	1.2+/-3.3	0,1,4296	no	missense	OR51Q1	NM_001004757.2	29	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign	52/318	5443585	1,12995	2201	4297	6498	SO:0001583	missense	390061				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5443585G>A	AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.155G>A	11.37:g.5443585G>A	ENSP00000300778:p.Arg52His		Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	p.R52H	NM_001004757	NP_001004757	WXS	Illumina HiSeq	Unspecified	Q8NH59	O51Q1_HUMAN		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	155	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	52			Cytoplasmic (Potential).		B2RNN1	Missense_Mutation	SNP	ENST00000300778.4	37	c.155G>A	CCDS31381.1	.	.	.	.	.	.	.	.	.	.	G	3.167	-0.170776	0.06421	0.0	1.16E-4	ENSG00000167360	ENST00000300778	T	0.03004	4.08	5.0	-0.475	0.12104	GPCR, rhodopsin-like superfamily (1);	1.412540	0.04542	N	0.388323	T	0.03739	0.0106	L	0.41961	1.31	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.47787	-0.9090	10	0.12103	T	0.63	.	5.2465	0.15500	0.4058:0.0:0.461:0.1332	.	52	Q8NH59	O51Q1_HUMAN	H	52	ENSP00000300778:R52H	ENSP00000300778:R52H	R	+	2	0	OR51Q1	5400161	0.000000	0.05858	0.001000	0.08648	0.132000	0.20833	-3.111000	0.00599	0.014000	0.14944	0.380000	0.24917	CGC		0.562	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143373.1	NM_001004757		7	228	0	0	0	0.001984	0	7	228				
OR52L1	338751	broad.mit.edu	37	11	6007675	6007675	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:6007675G>A	ENST00000332249.4	-	1	540	c.486C>T	c.(484-486)atC>atT	p.I162I		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I147I(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCACCATTCCGATGCACCCTA	0.517																																					Melanoma(121;653 1666 10547 22796 51255)	Melanoma(121;653 1666 10547 22796 51255)	uc001mcd.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)	central_nervous_system(1)|pancreas(1)	2						c.(484-486)ATC>ATT		olfactory receptor, family 52, subfamily L,							79.0	75.0	76.0					11																	6007675		2034	4191	6225	SO:0001819	synonymous_variant	338751				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6007675G>A	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.486C>T	11.37:g.6007675G>A			Somatic					p.I162I	NM_001005173	NP_001005173	WXS	Illumina HiSeq	Unspecified	Q8NGH7	O52L1_HUMAN		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	541	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	162			Helical; Name=4; (Potential).		B2RPA6|Q6IFK9	Silent	SNP	ENST00000332249.4	37	c.486C>T	CCDS44529.1																																																																																				0.517	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173		5	73	0	0	0	0.001984	0	5	73				
BTBD10	84280	broad.mit.edu	37	11	13427223	13427223	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:13427223C>A	ENST00000278174.5	-	7	1234	c.989G>T	c.(988-990)gGa>gTa	p.G330V	BTBD10_ENST00000528120.1_Missense_Mutation_p.G282V|BTBD10_ENST00000530907.1_Missense_Mutation_p.G338V	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	330	Interaction with AKT family members. {ECO:0000250|UniProtKB:Q80X66}.					nucleus (GO:0005634)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		ATATTCTTCTCCCATCTGTGG	0.418																																							uc001mkz.2		NA																	0					0						c.(988-990)GGA>GTA		K+ channel tetramerization protein							231.0	214.0	220.0					11																	13427223		2200	4294	6494	SO:0001583	missense	84280					nucleus		g.chr11:13427223C>A	AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.989G>T	11.37:g.13427223C>A	ENSP00000278174:p.Gly330Val		Somatic				BTBD10_uc010rcl.1_Missense_Mutation_p.G338V|BTBD10_uc001mla.2_Missense_Mutation_p.G314V|BTBD10_uc009ygn.2_RNA|BTBD10_uc010rcm.1_Missense_Mutation_p.G282V|BTBD10_uc010rcn.1_Missense_Mutation_p.G299V|BTBD10_uc009ygo.2_Missense_Mutation_p.G282V	p.G330V	NM_032320	NP_115696	WXS	Illumina HiSeq	Unspecified	Q9BSF8	BTBDA_HUMAN		Epithelial(150;0.0214)	7	1246	-			330					B7Z228|Q86WG1	Missense_Mutation	SNP	ENST00000278174.5	37	c.989G>T	CCDS7811.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.547586	0.86022	.	.	ENSG00000148925	ENST00000278174;ENST00000530907;ENST00000528120	D;D;D	0.81739	-1.53;-1.53;-1.53	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.89466	0.6723	M	0.70595	2.14	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.981;0.981;0.981	D	0.90399	0.4401	10	0.87932	D	0	-37.2958	18.6399	0.91392	0.0:1.0:0.0:0.0	.	299;338;330;330	B7Z2J1;B7Z228;D3DQW7;Q9BSF8	.;.;.;BTBDA_HUMAN	V	330;338;282	ENSP00000278174:G330V;ENSP00000431186:G338V;ENSP00000435257:G282V	ENSP00000278174:G330V	G	-	2	0	BTBD10	13383799	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.755000	0.85180	2.495000	0.84180	0.591000	0.81541	GGA		0.418	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386200.1	NM_032320		18	259	1	0	1.96292e-10	0.001523	2.57676e-10	18	259				
MPPED2	744	broad.mit.edu	37	11	30433117	30433117	+	Silent	SNP	G	G	A	rs142670850		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:30433117G>A	ENST00000358117.5	-	6	905	c.783C>T	c.(781-783)acC>acT	p.T261T	MPPED2_ENST00000524667.1_5'UTR|MPPED2_ENST00000448418.2_Intron	NM_001584.2	NP_001575.1	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2	261					nervous system development (GO:0007399)		hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(15)|skin(2)|upper_aerodigestive_tract(2)	33						TGTAACCGTCGGTCATGATGC	0.453																																							uc001msr.2		NA																	0				skin(1)	1						c.(781-783)ACC>ACT		metallophosphoesterase domain containing 2		G	,	0,4404		0,0,2202	111.0	88.0	96.0		,783	0.5	1.0	11	dbSNP_134	96	1,8597	1.2+/-3.3	0,1,4298	no	intron,coding-synonymous	MPPED2	NM_001145399.1,NM_001584.2	,	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	,	,261/295	30433117	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	744				nervous system development		hydrolase activity|metal ion binding	g.chr11:30433117G>A	U57911	CCDS7870.1, CCDS44560.1	11p13	2008-07-18	2005-10-10	2005-10-10	ENSG00000066382	ENSG00000066382			1180	protein-coding gene	gene with protein product		600911	"""chromosome 11 open reading frame 8"""	C11orf8		8666403, 9266672	Standard	NM_001584		Approved	239FB, D11S302E, Hs.46638, FAM1B, dJ873F21.1, dJ1024C24.1	uc001msr.3	Q15777	OTTHUMG00000166159	ENST00000358117.5:c.783C>T	11.37:g.30433117G>A			Somatic				MPPED2_uc001msq.3_Intron|MPPED2_uc009yji.2_Silent_p.T135T	p.T261T	NM_001584	NP_001575	WXS	Illumina HiSeq	Unspecified	Q15777	MPPD2_HUMAN			6	903	-			261					D3DQZ5|E9PB10|Q59GE6	Silent	SNP	ENST00000358117.5	37	c.783C>T	CCDS7870.1																																																																																				0.453	MPPED2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388155.2	NM_001584		5	49	0	0	0	0.001984	0	5	49				
OR5AS1	219447	broad.mit.edu	37	11	55798491	55798491	+	Silent	SNP	C	C	G	rs375389223		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:55798491C>G	ENST00000313555.1	+	1	597	c.597C>G	c.(595-597)ctC>ctG	p.L199L		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					AGCTTCTGCTCTTTGCTTTGT	0.418																																							uc010riw.1		NA																	0				ovary(3)|liver(1)|skin(1)	5						c.(595-597)CTC>CTG		olfactory receptor, family 5, subfamily AS,							310.0	308.0	309.0					11																	55798491		2201	4296	6497	SO:0001819	synonymous_variant	219447				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55798491C>G	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.597C>G	11.37:g.55798491C>G			Somatic					p.L199L	NM_001001921	NP_001001921	WXS	Illumina HiSeq	Unspecified	Q8N127	O5AS1_HUMAN			1	597	+	Esophageal squamous(21;0.00693)		199			Helical; Name=5; (Potential).		Q6IFB8	Silent	SNP	ENST00000313555.1	37	c.597C>G	CCDS31516.1																																																																																				0.418	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		24	304	0	0	0	0.00632	0	24	304				
PRG2	5553	broad.mit.edu	37	11	57156708	57156708	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:57156708C>A	ENST00000311862.5	-	3	214	c.141G>T	c.(139-141)gaG>gaT	p.E47D	RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.E152D|PRG2_ENST00000533605.1_Missense_Mutation_p.E47D|PRG2_ENST00000525955.1_Missense_Mutation_p.E47D	NM_001243245.1|NM_002728.4	NP_001230174.1|NP_002719.3	P13727	PRG2_HUMAN	proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)	47					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	AAGGGGTCTCCTCCATCTCCT	0.572																																							uc001njz.2		NA																	0				central_nervous_system(1)	1						c.(139-141)GAG>GAT		proteoglycan 2 preproprotein	Sargramostim(DB00020)						82.0	82.0	82.0					11																	57156708		2201	4296	6497	SO:0001583	missense	5553				defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding	g.chr11:57156708C>A	BC005929	CCDS7955.1, CCDS58133.1	11q12	2005-11-25				ENSG00000186652			9362	protein-coding gene	gene with protein product		605601				1565101	Standard	NM_001243245		Approved	MBP, BMPG		P13727		ENST00000311862.5:c.141G>T	11.37:g.57156708C>A	ENSP00000312134:p.Glu47Asp		Somatic				PRG2_uc001njw.1_RNA|PRG2_uc001njx.1_RNA|PRG2_uc001njy.1_RNA|PRG2_uc001nka.2_Missense_Mutation_p.E47D|PRG2_uc001nkb.2_Missense_Mutation_p.E47D|PRG2_uc001nkd.2_Missense_Mutation_p.E47D|PRG2_uc001nkc.2_Missense_Mutation_p.E47D|PRG2_uc001nke.2_Missense_Mutation_p.E327D	p.E47D	NM_002728	NP_002719	WXS	Illumina HiSeq	Unspecified	P13727	PRG2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	168	-			47					A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	ENST00000311862.5	37	c.141G>T	CCDS7955.1	.	.	.	.	.	.	.	.	.	.	C	11.18	1.562768	0.27915	.	.	ENSG00000186652;ENSG00000186652;ENSG00000186652;ENSG00000254979	ENST00000311862;ENST00000533605;ENST00000525955;ENST00000529411	T;T;T;T	0.36699	2.89;2.64;2.89;1.24	4.75	1.42	0.22433	.	0.957041	0.08530	N	0.932237	T	0.22399	0.0540	L	0.34521	1.04	0.09310	N	1	P;P	0.47762	0.9;0.9	B;B	0.39706	0.307;0.307	T	0.13469	-1.0508	10	0.30854	T	0.27	-13.6086	2.2789	0.04109	0.2002:0.4936:0.195:0.1113	.	47;47	A6XMW0;P13727	.;PRG2_HUMAN	D	47;47;47;152	ENSP00000312134:E47D;ENSP00000433231:E47D;ENSP00000433016:E47D;ENSP00000431536:E152D	ENSP00000312134:E47D	E	-	3	2	RP11-872D17.8;PRG2	56913284	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.186000	0.16978	0.600000	0.29862	0.655000	0.94253	GAG		0.572	PRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392468.1	NM_002728		5	80	1	0	8.12818e-05	0.001984	9.82584e-05	5	80				
OR9Q2	219957	broad.mit.edu	37	11	57958327	57958327	+	Missense_Mutation	SNP	G	G	A	rs560592347		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:57958327G>A	ENST00000311591.3	+	1	422	c.365G>A	c.(364-366)cGc>cAc	p.R122H		NM_001005283.2	NP_001005283.1	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(24)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41		Breast(21;0.0589)				GCCTATGACCGCTACACGGCC	0.567																																							uc010rka.1		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(364-366)CGC>CAC		olfactory receptor, family 9, subfamily Q,							138.0	116.0	123.0					11																	57958327		2201	4296	6497	SO:0001583	missense	219957				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57958327G>A	AB065859	CCDS31544.1	11q12.1	2012-08-09		2004-03-10	ENSG00000186513	ENSG00000186513		"""GPCR / Class A : Olfactory receptors"""	15328	protein-coding gene	gene with protein product				OR9Q2P			Standard	NM_001005283		Approved		uc010rka.2	Q8NGE9	OTTHUMG00000167414	ENST00000311591.3:c.365G>A	11.37:g.57958327G>A	ENSP00000308714:p.Arg122His		Somatic					p.R122H	NM_001005283	NP_001005283	WXS	Illumina HiSeq	Unspecified	Q8NGE9	OR9Q2_HUMAN			1	365	+		Breast(21;0.0589)	122			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000311591.3	37	c.365G>A	CCDS31544.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.229838	0.79688	.	.	ENSG00000186513	ENST00000311591	T	0.77489	-1.1	5.54	3.55	0.40652	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000164	D	0.86401	0.5924	M	0.86268	2.805	0.40752	D	0.982926	D	0.89917	1.0	D	0.63488	0.915	D	0.88018	0.2767	10	0.66056	D	0.02	-17.3383	10.3228	0.43775	0.0738:0.1353:0.7909:0.0	.	122	Q8NGE9	OR9Q2_HUMAN	H	122	ENSP00000308714:R122H	ENSP00000308714:R122H	R	+	2	0	OR9Q2	57714903	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	5.662000	0.68032	1.486000	0.48398	0.655000	0.94253	CGC		0.567	OR9Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394540.1	NM_001005283		10	123	0	0	0	0.008291	0	10	123				
MS4A5	64232	broad.mit.edu	37	11	60215196	60215196	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:60215196C>T	ENST00000300190.2	+	5	653	c.567C>T	c.(565-567)tgC>tgT	p.C189C		NM_023945.2	NP_076434.2	Q9H3V2	MS4A5_HUMAN	membrane-spanning 4-domains, subfamily A, member 5	189						integral component of membrane (GO:0016021)				large_intestine(7)|lung(7)|ovary(1)|skin(1)	16						TTTTGGGGTGCCACTCAGAGG	0.333																																							uc001npo.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(565-567)TGC>TGT		membrane-spanning 4-domains, subfamily A, member							174.0	176.0	175.0					11																	60215196		2203	4300	6503	SO:0001819	synonymous_variant	64232					integral to membrane	receptor activity	g.chr11:60215196C>T	AB013103	CCDS7987.1	11q12	2008-03-25			ENSG00000166930	ENSG00000166930			13374	protein-coding gene	gene with protein product		606499				11245982, 11401424	Standard	NM_023945		Approved	CD20L2	uc001npo.3	Q9H3V2	OTTHUMG00000167613	ENST00000300190.2:c.567C>T	11.37:g.60215196C>T			Somatic					p.C189C	NM_023945	NP_076434	WXS	Illumina HiSeq	Unspecified	Q9H3V2	MS4A5_HUMAN			5	653	+			189			Cytoplasmic (Potential).		Q9BZH1	Silent	SNP	ENST00000300190.2	37	c.567C>T	CCDS7987.1	.	.	.	.	.	.	.	.	.	.	C	1.917	-0.449274	0.04572	.	.	ENSG00000166930	ENST00000528905	.	.	.	4.22	1.13	0.20643	.	.	.	.	.	T	0.31670	0.0804	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25502	-1.0130	4	.	.	.	2.7918	6.5439	0.22394	0.2127:0.675:0.0:0.1123	.	.	.	.	S	112	.	.	P	+	1	0	MS4A5	59971772	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.115000	0.15540	0.111000	0.17947	0.467000	0.42956	CCA		0.333	MS4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395392.1			6	137	0	0	0	0.00308	0	6	137				
MS4A12	54860	broad.mit.edu	37	11	60269468	60269468	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:60269468G>T	ENST00000016913.4	+	4	484	c.427G>T	c.(427-429)Ggc>Tgc	p.G143C	MS4A12_ENST00000537076.1_Missense_Mutation_p.G97C	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12	143						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						TATTATCTCTGGCTCTCTCTC	0.373																																							uc001npr.2		NA																	0					0						c.(427-429)GGC>TGC		membrane-spanning 4-domains, subfamily A, member							225.0	215.0	219.0					11																	60269468		2203	4300	6503	SO:0001583	missense	54860					integral to membrane	receptor activity	g.chr11:60269468G>T	AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.427G>T	11.37:g.60269468G>T	ENSP00000016913:p.Gly143Cys		Somatic					p.G143C	NM_017716	NP_060186	WXS	Illumina HiSeq	Unspecified	Q9NXJ0	M4A12_HUMAN			4	484	+			143			Cytoplasmic (Potential).		F5GX98|Q8N6L4	Missense_Mutation	SNP	ENST00000016913.4	37	c.427G>T	CCDS7988.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.131634	0.56828	.	.	ENSG00000071203	ENST00000537076;ENST00000526784;ENST00000016913	T;T;T	0.21191	2.02;2.02;2.02	5.36	4.45	0.53987	.	0.059212	0.64402	D	0.000002	T	0.52980	0.1768	M	0.93016	3.37	0.32780	N	0.502582	D	0.89917	1.0	D	0.91635	0.999	T	0.71244	-0.4650	10	0.87932	D	0	.	10.2943	0.43613	0.0918:0.0:0.9082:0.0	.	143	Q9NXJ0	M4A12_HUMAN	C	97;97;143	ENSP00000440424:G97C;ENSP00000431959:G97C;ENSP00000016913:G143C	ENSP00000016913:G143C	G	+	1	0	MS4A12	60026044	0.998000	0.40836	0.304000	0.25085	0.077000	0.17291	2.689000	0.46993	1.378000	0.46305	0.655000	0.94253	GGC		0.373	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383627.1			18	157	1	0	5.35356e-11	0.00278	7.15056e-11	18	157				
SYT12	91683	broad.mit.edu	37	11	66807372	66807372	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:66807372A>G	ENST00000393946.2	+	7	1481	c.319A>G	c.(319-321)Atc>Gtc	p.I107V	SYT12_ENST00000527043.1_Missense_Mutation_p.I107V|SYT12_ENST00000526281.1_3'UTR|SYT12_ENST00000525457.1_Missense_Mutation_p.I107V			Q8IV01	SYT12_HUMAN	synaptotagmin XII	107						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						CTTTGAGAGCATCAGTGAACT	0.642																																					Ovarian(65;2862 3307)	Ovarian(65;2862 3307)	uc009yrl.2		NA																	0				ovary(1)	1						c.(319-321)ATC>GTC		synaptotagmin XII							76.0	79.0	78.0					11																	66807372		2200	4295	6495	SO:0001583	missense	91683					cell junction|integral to membrane|synaptic vesicle membrane		g.chr11:66807372A>G	AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.319A>G	11.37:g.66807372A>G	ENSP00000377520:p.Ile107Val		Somatic				SYT12_uc001oju.2_Missense_Mutation_p.I107V	p.I107V	NM_177963	NP_808878	WXS	Illumina HiSeq	Unspecified	Q8IV01	SYT12_HUMAN			4	549	+			107			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000393946.2	37	c.319A>G	CCDS8154.1	.	.	.	.	.	.	.	.	.	.	A	9.849	1.193046	0.21954	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043	T;T;T	0.12361	2.69;2.69;2.69	5.1	3.95	0.45737	.	0.120382	0.64402	D	0.000020	T	0.08935	0.0221	N	0.24115	0.695	0.37497	D	0.916595	B	0.02656	0.0	B	0.01281	0.0	T	0.20075	-1.0286	10	0.28530	T	0.3	.	9.2039	0.37278	0.913:0.0:0.087:0.0	.	107	Q8IV01	SYT12_HUMAN	V	107	ENSP00000377520:I107V;ENSP00000431400:I107V;ENSP00000435316:I107V	ENSP00000377520:I107V	I	+	1	0	SYT12	66563948	1.000000	0.71417	0.997000	0.53966	0.387000	0.30353	3.172000	0.50832	0.933000	0.37291	0.379000	0.24179	ATC		0.642	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393129.1	NM_177963		8	111	0	0	0	0.008291	0	8	111				
IL18BP	10068	broad.mit.edu	37	11	71715288	71715288	+	IGR	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:71715288G>A	ENST00000393703.4	+	0	1788				NUMA1_ENST00000393695.3_Missense_Mutation_p.P2036S|NUMA1_ENST00000351960.6_Missense_Mutation_p.P900S|NUMA1_ENST00000358965.6_Missense_Mutation_p.P2022S	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein						cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						GTAGAAGCTGGAGCTGCTTTC	0.607																																							uc001orl.1		NA								T					RARA		APL		0				ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						c.(6106-6108)CCA>TCA		nuclear mitotic apparatus protein 1							112.0	104.0	107.0					11																	71715288		2200	4293	6493	SO:0001628	intergenic_variant	4926				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity	g.chr11:71715288G>A	AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713		11.37:g.71715288G>A			Somatic				IL18BP_uc009ysu.1_Intron|NUMA1_uc001orj.2_Missense_Mutation_p.P218S|NUMA1_uc009ysw.1_Missense_Mutation_p.P1603S|NUMA1_uc001ork.1_Missense_Mutation_p.P900S|NUMA1_uc001orm.1_Missense_Mutation_p.P2022S	p.P2036S	NM_006185	NP_006176	WXS	Illumina HiSeq	Unspecified	Q14980	NUMA1_HUMAN			25	6278	-			2036					B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Missense_Mutation	SNP	ENST00000393703.4	37	c.6106C>T	CCDS8206.2	.	.	.	.	.	.	.	.	.	.	G	9.002	0.980407	0.18812	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	T;T;T	0.17528	2.27;2.74;2.73	5.01	1.84	0.25277	.	0.510038	0.18255	N	0.146812	T	0.07413	0.0187	N	0.14661	0.345	0.33264	D	0.560154	B;B;B;P	0.35011	0.005;0.015;0.005;0.48	B;B;B;B	0.31442	0.009;0.014;0.009;0.13	T	0.33007	-0.9885	10	0.11485	T	0.65	.	7.8231	0.29298	0.0874:0.3091:0.6036:0.0	.	2042;2022;2036;900	Q4LE64;Q14980-2;Q14980;Q9BTE9	.;.;NUMA1_HUMAN;.	S	900;2022;2036;1585;1009	ENSP00000260051:P900S;ENSP00000351851:P2022S;ENSP00000377298:P2036S	ENSP00000260051:P900S	P	-	1	0	NUMA1	71392936	0.009000	0.17119	0.914000	0.36105	0.421000	0.31385	0.833000	0.27504	0.611000	0.30052	0.655000	0.94253	CCA		0.607	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258012.2	NM_173042		3	39	0	0	0	0.004672	0	3	39				
DNAJB13	374407	broad.mit.edu	37	11	73669405	73669405	+	Missense_Mutation	SNP	G	G	A	rs145187500	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:73669405G>A	ENST00000339764.1	+	2	863	c.112G>A	c.(112-114)Gag>Aag	p.E38K		NM_153614.2	NP_705842.2	P59910	DJB13_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 13	38	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				protein folding (GO:0006457)					large_intestine(3)|lung(2)	5	Breast(11;7.42e-05)					GAAGTCAAATGAGCCGTCTTC	0.527													g|||	7	0.00139776	0.0053	0.0	5008	,	,		18938	0.0		0.0	False		,,,				2504	0.0						uc001ouo.2		NA																	0					0						c.(112-114)GAG>AAG		testis spermatogenesis apoptosis-related protein			LYS/GLU	14,4386	21.2+/-45.6	0,14,2186	118.0	101.0	107.0		112	4.5	0.0	11	dbSNP_134	107	0,8586		0,0,4293	yes	missense	DNAJB13	NM_153614.2	56	0,14,6479	AA,AG,GG		0.0,0.3182,0.1078	benign	38/317	73669405	14,12972	2200	4293	6493	SO:0001583	missense	374407				apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding	g.chr11:73669405G>A	AF516185	CCDS8227.1	11q13.3	2011-09-02	2010-04-21		ENSG00000187726	ENSG00000187726		"""Heat shock proteins / DNAJ (HSP40)"""	30718	protein-coding gene	gene with protein product	"""radial spoke 16 homolog A (Chlamydomonas)"""	610263	"""DnaJ (Hsp40) related, subfamily B, member 13"""				Standard	NM_153614		Approved	TSARG6, RSPH16A	uc001ouo.3	P59910	OTTHUMG00000168093	ENST00000339764.1:c.112G>A	11.37:g.73669405G>A	ENSP00000344431:p.Glu38Lys		Somatic					p.E38K	NM_153614	NP_705842	WXS	Illumina HiSeq	Unspecified	P59910	DJB13_HUMAN			2	863	+	Breast(11;7.42e-05)		38			J.		B3LEP4|Q8IZW5	Missense_Mutation	SNP	ENST00000339764.1	37	c.112G>A	CCDS8227.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	g	12.50	1.956031	0.34471	0.003182	0.0	ENSG00000187726	ENST00000339764	T	0.73575	-0.76	5.4	4.49	0.54785	Heat shock protein DnaJ, N-terminal (5);	0.315689	0.37437	N	0.002084	T	0.49915	0.1585	L	0.28014	0.82	0.37928	D	0.931902	B	0.15473	0.013	B	0.16722	0.016	T	0.51317	-0.8721	10	0.07325	T	0.83	.	12.0776	0.53653	0.0839:0.0:0.9161:0.0	.	38	P59910	DJB13_HUMAN	K	38	ENSP00000344431:E38K	ENSP00000344431:E38K	E	+	1	0	DNAJB13	73347053	1.000000	0.71417	0.008000	0.14137	0.011000	0.07611	3.629000	0.54266	1.290000	0.44636	0.645000	0.84053	GAG		0.527	DNAJB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398100.1	NM_153614		5	66	0	0	0	0.001984	0	5	66				
PCF11	51585	broad.mit.edu	37	11	82868592	82868592	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:82868592C>T	ENST00000298281.4	+	1	563	c.111C>T	c.(109-111)atC>atT	p.I37I		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	37	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AGCCGCACATCAATATGCTGA	0.597																																							uc001ozx.3		NA																	0				ovary(1)	1						c.(109-111)ATC>ATT		pre-mRNA cleavage complex II protein Pcf11							90.0	99.0	96.0					11																	82868592		2035	4198	6233	SO:0001819	synonymous_variant	51585				mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex		g.chr11:82868592C>T	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.111C>T	11.37:g.82868592C>T			Somatic				PCF11_uc010rsu.1_Silent_p.I37I|PCF11_uc001ozy.2_Silent_p.I37I	p.I37I	NM_015885	NP_056969	WXS	Illumina HiSeq	Unspecified	O94913	PCF11_HUMAN			1	456	+			37			CID.		A6H8W7|O43671|Q6P0X8	Silent	SNP	ENST00000298281.4	37	c.111C>T	CCDS44689.1																																																																																				0.597	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885		6	127	0	0	0	0.001984	0	6	127				
NXPE4	54827	broad.mit.edu	37	11	114453682	114453682	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:114453682A>G	ENST00000375478.3	-	3	338	c.158T>C	c.(157-159)tTa>tCa	p.L53S	NXPE4_ENST00000424261.2_5'UTR	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	53						extracellular vesicular exosome (GO:0070062)											TTTAGGGAATAAGGACTTTGT	0.393																																							uc001ppc.2		NA																	0				ovary(2)|skin(2)	4						c.(157-159)TTA>TCA		hypothetical protein LOC54827 isoform 1							222.0	206.0	211.0					11																	114453682		1936	4140	6076	SO:0001583	missense	54827					extracellular region		g.chr11:114453682A>G	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.158T>C	11.37:g.114453682A>G	ENSP00000364627:p.Leu53Ser		Somatic				FAM55D_uc001ppd.2_5'UTR	p.L53S	NM_001077639	NP_001071107	WXS	Illumina HiSeq	Unspecified	Q6UWF7	FA55D_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)	3	339	-		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)	53					Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	c.158T>C	CCDS41718.1	.	.	.	.	.	.	.	.	.	.	A	0.351	-0.944828	0.02304	.	.	ENSG00000137634	ENST00000375478	T	0.10763	2.84	4.68	-2.21	0.06973	.	2.290010	0.01832	N	0.034784	T	0.09113	0.0225	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.35919	-0.9769	10	0.21540	T	0.41	.	9.681	0.40070	0.5562:0.0:0.4438:0.0	.	53	Q6UWF7	FA55D_HUMAN	S	53	ENSP00000364627:L53S	ENSP00000364627:L53S	L	-	2	0	FAM55D	113958892	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.586000	0.23894	-0.368000	0.08040	-0.472000	0.04984	TTA		0.393	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678		18	191	0	0	0	0.008871	0	18	191				
C3AR1	719	broad.mit.edu	37	12	8212099	8212099	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:8212099A>G	ENST00000307637.4	-	2	886	c.683T>C	c.(682-684)gTc>gCc	p.V228A		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	228					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		AGGTTGGAAGACAGTGGGGAC	0.408																																							uc001qtv.1		NA																	0				ovary(1)	1						c.(682-684)GTC>GCC		complement component 3a receptor 1							76.0	76.0	76.0					12																	8212099		2203	4299	6502	SO:0001583	missense	719				blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity	g.chr12:8212099A>G	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.683T>C	12.37:g.8212099A>G	ENSP00000302079:p.Val228Ala		Somatic					p.V228A	NM_004054	NP_004045	WXS	Illumina HiSeq	Unspecified	Q16581	C3AR_HUMAN		Kidney(36;0.0893)	2	775	-			228			Extracellular (Potential).		O43771|Q92868	Missense_Mutation	SNP	ENST00000307637.4	37	c.683T>C	CCDS8588.1	.	.	.	.	.	.	.	.	.	.	A	0.248	-1.008861	0.02112	.	.	ENSG00000171860	ENST00000307637	T	0.71341	-0.56	4.28	-8.57	0.00900	GPCR, rhodopsin-like superfamily (1);	3.452660	0.01003	N	0.003707	T	0.38453	0.1041	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37337	-0.9710	10	0.23302	T	0.38	.	1.9061	0.03278	0.2134:0.1935:0.3855:0.2076	.	228	Q16581	C3AR_HUMAN	A	228	ENSP00000302079:V228A	ENSP00000302079:V228A	V	-	2	0	C3AR1	8103366	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.090000	0.01356	-2.466000	0.00533	-1.139000	0.01908	GTC		0.408	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400254.1			9	104	0	0	0	0.004482	0	9	104				
TAS2R46	259292	broad.mit.edu	37	12	11214561	11214561	+	Silent	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:11214561G>T	ENST00000533467.1	-	1	332	c.333C>A	c.(331-333)gcC>gcA	p.A111A	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	111					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TGGAGAAATTGGCAATCTTGA	0.373																																							uc001qzp.1		NA																	0				ovary(1)	1						c.(331-333)GCC>GCA		taste receptor, type 2, member 46							88.0	94.0	92.0					12																	11214561		2070	4221	6291	SO:0001819	synonymous_variant	259292				sensory perception of taste	cilium membrane|integral to membrane	G-protein coupled receptor activity	g.chr12:11214561G>T	AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.333C>A	12.37:g.11214561G>T			Somatic				PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	p.A111A	NM_176887	NP_795368	WXS	Illumina HiSeq	Unspecified	P59540	T2R46_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)	1	333	-			111			Cytoplasmic (Potential).		P59548|Q645X6	Silent	SNP	ENST00000533467.1	37	c.333C>A	CCDS53748.1																																																																																				0.373	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383559.1	NM_176887		13	83	1	0	4.7546e-09	0.004007	6.17775e-09	13	83				
LRRK2	120892	broad.mit.edu	37	12	40688716	40688716	+	Splice_Site	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:40688716A>T	ENST00000298910.7	+	22	2936	c.2878A>T	c.(2878-2880)Agg>Tgg	p.R960W	LRRK2_ENST00000343742.2_Splice_Site_p.R960W	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	960					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGATTCACTCAGTAAGTATTT	0.289																																							uc001rmg.3		NA																	0				ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24						c.(2878-2880)AGG>TGG		leucine-rich repeat kinase 2							39.0	45.0	43.0					12																	40688716		2202	4278	6480	SO:0001630	splice_region_variant	120892				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding	g.chr12:40688716A>T	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2878+1A>T	12.37:g.40688716A>T			Somatic				LRRK2_uc001rmh.1_Missense_Mutation_p.R582W|LRRK2_uc009zjw.2_5'Flank	p.R960W	NM_198578	NP_940980	WXS	Illumina HiSeq	Unspecified	Q5S007	LRRK2_HUMAN			22	2999	+	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)	960					A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	c.2878A>T	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	A	14.82	2.650865	0.47362	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.28255	2.12;1.62	5.52	-0.613	0.11594	.	0.310103	0.32258	N	0.006341	T	0.19208	0.0461	L	0.32530	0.975	0.37730	D	0.925227	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.05533	-1.0879	10	0.62326	D	0.03	.	7.0662	0.25154	0.5467:0.127:0.0:0.3263	.	960;960	E9PC85;Q5S007	.;LRRK2_HUMAN	W	960	ENSP00000341930:R960W;ENSP00000298910:R960W	ENSP00000298910:R960W	R	+	1	2	LRRK2	38974983	0.850000	0.29656	0.993000	0.49108	0.996000	0.88848	1.497000	0.35649	0.012000	0.14892	0.482000	0.46254	AGG		0.289	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	Missense_Mutation	4	69	0	0	0	0.000602	0	4	69				
ASB8	140461	broad.mit.edu	37	12	48543756	48543756	+	Missense_Mutation	SNP	C	C	T	rs149438083		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:48543756C>T	ENST00000317697.3	-	4	429	c.260G>A	c.(259-261)cGa>cAa	p.R87Q	ASB8_ENST00000535055.1_3'UTR|ASB8_ENST00000536549.1_Missense_Mutation_p.R87Q|ASB8_ENST00000537754.1_5'UTR|ASB8_ENST00000536071.1_3'UTR|ASB8_ENST00000536953.1_3'UTR|ASB8_ENST00000539528.1_3'UTR	NM_024095.3	NP_077000.1	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box containing 8	87					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|kidney(2)|large_intestine(2)|lung(5)|soft_tissue(1)	11						GAGGGCTGTTCGGTTATACCC	0.483																																							uc001rrh.2		NA																	0				kidney(1)	1						c.(259-261)CGA>CAA		ankyrin repeat and SOCS box-containing 8		C	GLN/ARG	0,4406		0,0,2203	63.0	59.0	61.0		260	4.4	1.0	12	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	no	missense	ASB8	NM_024095.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	87/289	48543756	1,13005	2203	4300	6503	SO:0001583	missense	140461				intracellular signal transduction	cytoplasm|nucleus		g.chr12:48543756C>T	AK024908	CCDS8761.1	12q13.12	2013-01-10	2011-01-25			ENSG00000177981		"""Ankyrin repeat domain containing"""	17183	protein-coding gene	gene with protein product		615053	"""ankyrin repeat and SOCS box-containing 8"""			12076535	Standard	NM_024095		Approved	MGC5540, FLJ21255	uc001rrh.3	Q9H765		ENST00000317697.3:c.260G>A	12.37:g.48543756C>T	ENSP00000320893:p.Arg87Gln		Somatic				ASB8_uc010slr.1_Missense_Mutation_p.R83Q	p.R87Q	NM_024095	NP_077000	WXS	Illumina HiSeq	Unspecified	Q9H765	ASB8_HUMAN			4	429	-			87			ANK 2.		A8K1P2|Q547Q2	Missense_Mutation	SNP	ENST00000317697.3	37	c.260G>A	CCDS8761.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964206	0.74131	0.0	1.16E-4	ENSG00000177981	ENST00000317697;ENST00000536549;ENST00000446549;ENST00000539503;ENST00000545791;ENST00000540212	D;D;T;T;T	0.82081	-1.57;-1.57;-0.14;-0.18;-0.18	5.3	4.4	0.53042	Ankyrin repeat-containing domain (3);	0.058000	0.64402	D	0.000001	T	0.78534	0.4298	N	0.16903	0.455	0.80722	D	1	D	0.71674	0.998	P	0.51324	0.666	T	0.79040	-0.1966	10	0.36615	T	0.2	-5.8074	15.8618	0.79032	0.0:0.8637:0.1363:0.0	.	87	Q9H765	ASB8_HUMAN	Q	87	ENSP00000320893:R87Q;ENSP00000445622:R87Q;ENSP00000444093:R87Q;ENSP00000437769:R87Q;ENSP00000442639:R87Q	ENSP00000320893:R87Q	R	-	2	0	ASB8	46830023	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.227000	0.78070	1.353000	0.45828	0.563000	0.77884	CGA		0.483	ASB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396497.1			7	65	0	0	0	0.004482	0	7	65				
CCDC65	85478	broad.mit.edu	37	12	49312207	49312207	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:49312207G>A	ENST00000320516.4	+	5	947	c.759G>A	c.(757-759)aaG>aaA	p.K253K	RP11-302B13.5_ENST00000398092.4_Intron|CCDC65_ENST00000266984.5_Silent_p.K253K	NM_033124.4	NP_149115.2	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65	253										breast(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	15						AGGATGAGAAGAGCTCCAAAG	0.433																																							uc001rso.2		NA																	0				ovary(1)|skin(1)	2						c.(757-759)AAG>AAA		coiled-coil domain containing 65							84.0	83.0	83.0					12																	49312207		2203	4300	6503	SO:0001819	synonymous_variant	85478							g.chr12:49312207G>A		CCDS8772.1	12q13.12	2014-07-18			ENSG00000139537	ENSG00000139537			29937	protein-coding gene	gene with protein product		611088				17089017, 21700706	Standard	NM_033124		Approved	NYD-SP28, FLJ35732, FAP250, CILD27	uc001rso.3	Q8IXS2		ENST00000320516.4:c.759G>A	12.37:g.49312207G>A			Somatic					p.K253K	NM_033124	NP_149115	WXS	Illumina HiSeq	Unspecified	Q8IXS2	CCD65_HUMAN			5	986	+			253					A6NJG5|B2RBE2|Q8N7G4|Q8NA91|Q96JA0	Silent	SNP	ENST00000320516.4	37	c.759G>A	CCDS8772.1																																																																																				0.433	CCDC65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408922.1	NM_033124		5	65	0	0	0	0.001984	0	5	65				
KRT71	112802	broad.mit.edu	37	12	52946759	52946759	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:52946759C>T	ENST00000267119.5	-	1	172	c.103G>A	c.(103-105)Ggg>Agg	p.G35R		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	35	Gly-rich.|Head.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		CCTTTGCTCCCTGCCCGGAAG	0.667																																							uc001sao.2		NA																	0				ovary(1)|skin(1)	2						c.(103-105)GGG>AGG		keratin 71							57.0	68.0	64.0					12																	52946759		2203	4300	6503	SO:0001583	missense	112802						structural molecule activity	g.chr12:52946759C>T	AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.103G>A	12.37:g.52946759C>T	ENSP00000267119:p.Gly35Arg		Somatic					p.G35R	NM_033448	NP_258259	WXS	Illumina HiSeq	Unspecified	Q3SY84	K2C71_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.194)	1	173	-			35			Head.|Gly-rich.		B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	ENST00000267119.5	37	c.103G>A	CCDS8831.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244465	0.59103	.	.	ENSG00000139648	ENST00000267119	D	0.92495	-3.05	5.24	4.33	0.51752	.	0.000000	0.45867	D	0.000324	D	0.86859	0.6034	L	0.39514	1.22	0.34394	D	0.694504	B	0.10296	0.003	B	0.15870	0.014	D	0.83996	0.0340	10	0.16420	T	0.52	.	13.1559	0.59516	0.0:0.9212:0.0:0.0788	.	35	Q3SY84	K2C71_HUMAN	R	35	ENSP00000267119:G35R	ENSP00000267119:G35R	G	-	1	0	KRT71	51233026	0.001000	0.12720	1.000000	0.80357	0.928000	0.56348	1.053000	0.30442	2.609000	0.88269	0.655000	0.94253	GGG		0.667	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396487.1	NM_033448		12	147	0	0	0	0.00245	0	12	147				
ESPL1	9700	broad.mit.edu	37	12	53684209	53684209	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:53684209C>T	ENST00000257934.4	+	24	5411	c.5320C>T	c.(5320-5322)Cga>Tga	p.R1774*	ESPL1_ENST00000552462.1_Nonsense_Mutation_p.R1774*	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1774					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						TACTGACAAGCGAGAATGGTG	0.577																																					Colon(53;1069 1201 2587 5382)	Colon(53;1069 1201 2587 5382)	uc001sck.2		NA																	0				lung(1)|kidney(1)|skin(1)	3						c.(5320-5322)CGA>TGA		separase							118.0	107.0	111.0					12																	53684209		2203	4300	6503	SO:0001587	stop_gained	9700				apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding	g.chr12:53684209C>T	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5320C>T	12.37:g.53684209C>T	ENSP00000257934:p.Arg1774*		Somatic				ESPL1_uc001scj.2_Nonsense_Mutation_p.R1449*	p.R1774*	NM_012291	NP_036423	WXS	Illumina HiSeq	Unspecified	Q14674	ESPL1_HUMAN			24	5411	+			1774						Nonsense_Mutation	SNP	ENST00000257934.4	37	c.5320C>T	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	C	44	11.188962	0.99528	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	.	.	.	5.4	3.38	0.38709	.	0.613068	0.16292	N	0.220879	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.7416	0.05255	0.3325:0.4153:0.1604:0.0917	.	.	.	.	X	1774;1449;1774	.	ENSP00000257934:R1774X	R	+	1	2	ESPL1	51970476	0.961000	0.32948	0.989000	0.46669	0.993000	0.82548	0.448000	0.21726	1.459000	0.47892	0.650000	0.86243	CGA		0.577	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291		11	90	0	0	0	0.001368	0	11	90				
MON2	23041	broad.mit.edu	37	12	62918926	62918926	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:62918926A>G	ENST00000393632.2	+	10	1563	c.1172A>G	c.(1171-1173)aAt>aGt	p.N391S	MON2_ENST00000393629.2_Missense_Mutation_p.N391S|MON2_ENST00000280379.6_Missense_Mutation_p.N391S|MON2_ENST00000552738.1_Missense_Mutation_p.N391S|MON2_ENST00000552115.1_Missense_Mutation_p.N391S|MON2_ENST00000546600.1_Missense_Mutation_p.N391S|MON2_ENST00000393630.3_Missense_Mutation_p.N391S	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	391					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		GATATTGTAAATGCACTGGGA	0.338																																							uc001sre.2		NA																	0				central_nervous_system(2)	2						c.(1171-1173)AAT>AGT		MON2 homolog							110.0	104.0	106.0					12																	62918926		2203	4300	6503	SO:0001583	missense	23041				Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding	g.chr12:62918926A>G		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.1172A>G	12.37:g.62918926A>G	ENSP00000377252:p.Asn391Ser		Somatic				MON2_uc009zqj.2_Missense_Mutation_p.N391S|MON2_uc010ssl.1_Missense_Mutation_p.N319S|MON2_uc010ssm.1_Missense_Mutation_p.N391S|MON2_uc010ssn.1_Missense_Mutation_p.N391S|MON2_uc001srf.2_Missense_Mutation_p.N154S	p.N391S	NM_015026	NP_055841	WXS	Illumina HiSeq	Unspecified	Q7Z3U7	MON2_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)	10	1563	+			391					A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	c.1172A>G	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.761605	0.31228	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.64803	-0.09;-0.12;-0.12;-0.09;-0.09;-0.12;0.57	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.55000	0.1893	L	0.43152	1.355	0.80722	D	1	B;B;B;B	0.31435	0.217;0.104;0.067;0.323	B;B;B;B	0.30943	0.085;0.108;0.051;0.122	T	0.52313	-0.8592	9	.	.	.	-16.9649	15.9735	0.80040	1.0:0.0:0.0:0.0	.	391;391;391;391	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4	.;.;.;.	S	391;391;391;391;319;391;391;391	ENSP00000377252:N391S;ENSP00000377250:N391S;ENSP00000280379:N391S;ENSP00000447407:N391S;ENSP00000449215:N391S;ENSP00000377249:N391S;ENSP00000446635:N391S	.	N	+	2	0	MON2	61205193	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	8.910000	0.92685	2.234000	0.73211	0.528000	0.53228	AAT		0.338	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026		6	51	0	0	0	0.00308	0	6	51				
NAV3	89795	broad.mit.edu	37	12	78513397	78513398	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:78513397_78513398CC>AA	ENST00000397909.2	+	15	3594_3595	c.3421_3422CC>AA	c.(3421-3423)CCt>AAt	p.P1141N	NAV3_ENST00000266692.7_Missense_Mutation_p.P1141N|NAV3_ENST00000228327.6_Missense_Mutation_p.P1141N|NAV3_ENST00000536525.2_Missense_Mutation_p.P1141N			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1141	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CTTGCCCCGCCCTTCAAAATCC	0.53										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(3421-3423)CCT>AAT		neuron navigator 3																																				SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78513397_78513398CC>AA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	Exception_encountered	12.37:g.78513397_78513398delinsAA	ENSP00000381007:p.Pro1141Asn	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.P1141N|NAV3_uc010sub.1_Missense_Mutation_p.P641N|NAV3_uc009zsf.2_Missense_Mutation_p.P149N	p.P1141N	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			15	3594_3595	+			1141			Ser-rich.		Q8NFW7|Q9Y2E7	Missense_Mutation	DNP	ENST00000397909.2	37	c.3421_3422CC>AA																																																																																					0.530	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		8	72	0	0	0	0.004672	0	8	72				
UHRF1BP1L	23074	broad.mit.edu	37	12	100478282	100478282	+	Silent	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:100478282T>C	ENST00000279907.7	-	10	1472	c.1260A>G	c.(1258-1260)acA>acG	p.T420T	UHRF1BP1L_ENST00000545232.2_Silent_p.T70T|UHRF1BP1L_ENST00000356828.3_Silent_p.T420T	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	420										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GAGAGGCATGTGTTGGGGATT	0.423																																							uc001tgq.2		NA																	0				ovary(2)	2						c.(1258-1260)ACA>ACG		UHRF1 (ICBP90) binding protein 1-like isoform a							269.0	227.0	241.0					12																	100478282		2203	4300	6503	SO:0001819	synonymous_variant	23074							g.chr12:100478282T>C		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1260A>G	12.37:g.100478282T>C			Somatic				UHRF1BP1L_uc001tgr.2_Silent_p.T420T|UHRF1BP1L_uc001tgp.2_Silent_p.T70T	p.T420T	NM_015054	NP_055869	WXS	Illumina HiSeq	Unspecified	A0JNW5	UH1BL_HUMAN			10	1489	-			420					A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Silent	SNP	ENST00000279907.7	37	c.1260A>G	CCDS31882.1																																																																																				0.423	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947		19	162	0	0	0	0.00278	0	19	162				
HIP1R	9026	broad.mit.edu	37	12	123338594	123338594	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:123338594C>G	ENST00000253083.4	+	8	707	c.582C>G	c.(580-582)ttC>ttG	p.F194L		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	194					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		GCACAGTTTTCCGACAGCTCA	0.617																																							uc001udj.1		NA																	0				ovary(1)	1						c.(580-582)TTC>TTG		huntingtin interacting protein-1-related							142.0	131.0	135.0					12																	123338594		2203	4300	6503	SO:0001583	missense	9026				receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding	g.chr12:123338594C>G	AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.582C>G	12.37:g.123338594C>G	ENSP00000253083:p.Phe194Leu		Somatic				HIP1R_uc001udg.1_Missense_Mutation_p.F182L|HIP1R_uc001udi.1_Missense_Mutation_p.F194L	p.F194L	NM_003959	NP_003950	WXS	Illumina HiSeq	Unspecified	O75146	HIP1R_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)	8	641	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		194					A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	ENST00000253083.4	37	c.582C>G	CCDS31922.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.370513	0.42003	.	.	ENSG00000130787	ENST00000253083	T	0.32515	1.45	4.44	0.326	0.15908	ANTH (1);	0.151766	0.64402	D	0.000012	T	0.19327	0.0464	N	0.14661	0.345	0.49582	D	0.999808	B;B;B	0.31581	0.329;0.18;0.008	B;B;B	0.40375	0.327;0.174;0.01	T	0.05818	-1.0862	10	0.48119	T	0.1	-25.1736	6.5832	0.22607	0.1268:0.6507:0.0:0.2225	.	194;194;182	O75146;Q6NXG8;B3KQW8	HIP1R_HUMAN;.;.	L	194	ENSP00000253083:F194L	ENSP00000253083:F194L	F	+	3	2	HIP1R	121904547	0.997000	0.39634	0.999000	0.59377	0.718000	0.41266	0.576000	0.23744	0.095000	0.17434	0.462000	0.41574	TTC		0.617	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1	NM_003959		17	202	0	0	0	0.00333	0	17	202				
TMEM132B	114795	broad.mit.edu	37	12	125834688	125834688	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:125834688G>T	ENST00000299308.3	+	2	751	c.743G>T	c.(742-744)aGc>aTc	p.S248I		NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	248						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GGCCTGGAGAGCCCCCAGCAA	0.572																																							uc001uhe.1		NA																	0				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19						c.(742-744)AGC>ATC		transmembrane protein 132B							79.0	81.0	80.0					12																	125834688		1934	4131	6065	SO:0001583	missense	114795					integral to membrane		g.chr12:125834688G>T	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.743G>T	12.37:g.125834688G>T	ENSP00000299308:p.Ser248Ile		Somatic					p.S248I	NM_052907	NP_443139	WXS	Illumina HiSeq	Unspecified	Q14DG7	T132B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)	2	751	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		248			Extracellular (Potential).		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	c.743G>T	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	G	5.935	0.356541	0.11239	.	.	ENSG00000139364	ENST00000299308	T	0.11495	2.77	5.34	1.96	0.26148	.	.	.	.	.	T	0.07324	0.0185	N	0.24115	0.695	0.09310	N	1	B	0.32526	0.374	B	0.35470	0.203	T	0.36504	-0.9745	9	0.38643	T	0.18	.	4.7099	0.12867	0.2587:0.3354:0.4059:0.0	.	248	Q14DG7	T132B_HUMAN	I	248	ENSP00000299308:S248I	ENSP00000299308:S248I	S	+	2	0	TMEM132B	124400641	0.049000	0.20398	0.002000	0.10522	0.106000	0.19336	2.182000	0.42556	0.585000	0.29608	0.655000	0.94253	AGC		0.572	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		13	67	1	0	2.27111e-07	0.001368	2.86325e-07	13	67				
GPR133	283383	broad.mit.edu	37	12	131561418	131561418	+	Splice_Site	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:131561418A>T	ENST00000261654.5	+	14	2105	c.1546A>T	c.(1546-1548)Agc>Tgc	p.S516C	GPR133_ENST00000376682.4_Splice_Site_p.S202C|GPR133_ENST00000543617.1_Splice_Site_p.S35C|GPR133_ENST00000535015.1_Splice_Site_p.S548C	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	516	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCTGGACTTCAGGTACCCTCT	0.587																																							uc001uit.3		NA																	0				pancreas(5)|ovary(3)|skin(2)	10						c.(1546-1548)AGC>TGC		G protein-coupled receptor 133 precursor							165.0	130.0	142.0					12																	131561418		2203	4300	6503	SO:0001630	splice_region_variant	283383				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:131561418A>T	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1547+1A>T	12.37:g.131561418A>T			Somatic				GPR133_uc010tbm.1_Missense_Mutation_p.S548C|GPR133_uc009zyo.2_5'UTR|GPR133_uc001uiv.1_Missense_Mutation_p.S35C	p.S516C	NM_198827	NP_942122	WXS	Illumina HiSeq	Unspecified	Q6QNK2	GP133_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)	14	2105	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		516			GPS.|Extracellular (Potential).		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	c.1546A>T	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117090	0.77323	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	T;T;T;T	0.50548	0.74;0.75;0.75;0.8	3.78	3.78	0.43462	GPS domain (3);	0.000000	0.85682	D	0.000000	T	0.74481	0.3722	H	0.94183	3.505	0.52501	D	0.999953	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.997;0.973;0.995	T	0.80558	-0.1329	10	0.87932	D	0	.	10.743	0.46164	1.0:0.0:0.0:0.0	.	548;35;516	B7ZLF7;Q6QNK2-3;Q6QNK2	.;.;GP133_HUMAN	C	516;548;202;35	ENSP00000261654:S516C;ENSP00000444425:S548C;ENSP00000365872:S202C;ENSP00000438021:S35C	ENSP00000261654:S516C	S	+	1	0	GPR133	130127371	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	6.741000	0.74837	1.505000	0.48720	0.402000	0.26972	AGC		0.587	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	Missense_Mutation	4	88	0	0	0	0.000602	0	4	88				
GPR133	283383	broad.mit.edu	37	12	131616301	131616301	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr12:131616301G>C	ENST00000261654.5	+	21	2766	c.2207G>C	c.(2206-2208)aGa>aCa	p.R736T	GPR133_ENST00000376682.4_Missense_Mutation_p.R422T|GPR133_ENST00000540207.1_3'UTR|GPR133_ENST00000543617.1_Missense_Mutation_p.R255T|GPR133_ENST00000535015.1_Missense_Mutation_p.R768T	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	736					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GCTGTGACCAGAGTCATCTCA	0.587																																							uc001uit.3		NA																	0				pancreas(5)|ovary(3)|skin(2)	10						c.(2206-2208)AGA>ACA		G protein-coupled receptor 133 precursor							202.0	147.0	166.0					12																	131616301		2203	4300	6503	SO:0001583	missense	283383				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:131616301G>C	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.2207G>C	12.37:g.131616301G>C	ENSP00000261654:p.Arg736Thr		Somatic				GPR133_uc010tbm.1_Missense_Mutation_p.R768T|GPR133_uc009zyo.2_Missense_Mutation_p.R18T|GPR133_uc009zyp.2_RNA	p.R736T	NM_198827	NP_942122	WXS	Illumina HiSeq	Unspecified	Q6QNK2	GP133_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)	21	2766	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		736			Cytoplasmic (Potential).		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	c.2207G>C	CCDS9272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.4|23.4	4.410656|4.410656	0.83340|0.83340	.|.	.|.	ENSG00000111452|ENSG00000111452	ENST00000335486|ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	.|T;T;T;T	.|0.42513	.|1.3;1.29;0.97;0.97	4.48|4.48	4.48|4.48	0.54585|0.54585	.|GPCR, family 2-like (1);	.|0.000000	.|0.85682	.|U	.|0.000000	T|T	0.61887|0.61887	0.2383|0.2383	M|M	0.73598|0.73598	2.24|2.24	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;P	.|0.76494	.|0.992;0.999;0.563	.|D;D;P	.|0.77557	.|0.982;0.99;0.715	T|T	0.60490|0.60490	-0.7253|-0.7253	5|10	.|0.24483	.|T	.|0.36	.|.	14.6225|14.6225	0.68597|0.68597	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|768;89;736	.|B7ZLF7;Q9NSM3;Q6QNK2	.|.;.;GP133_HUMAN	Q|T	90|736;768;422;255	.|ENSP00000261654:R736T;ENSP00000444425:R768T;ENSP00000365872:R422T;ENSP00000438021:R255T	.|ENSP00000261654:R736T	E|R	+|+	1|2	0|0	GPR133|GPR133	130182254|130182254	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.940000|0.940000	0.58332|0.58332	8.150000|8.150000	0.89634|0.89634	2.004000|2.004000	0.58718|0.58718	0.491000|0.491000	0.48974|0.48974	GAG|AGA		0.587	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827		8	78	0	0	0	0.008291	0	8	78				
ATP12A	479	broad.mit.edu	37	13	25281307	25281307	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr13:25281307C>T	ENST00000381946.3	+	16	2483	c.2316C>T	c.(2314-2316)tcC>tcT	p.S772S	ATP12A_ENST00000218548.6_Silent_p.S778S			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	772				SI -> LH (in Ref. 7; CAA49478). {ECO:0000305}.	ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		ACTTCGCATCCATCGTCACAG	0.542																																					Pancreas(156;1582 1935 18898 22665 26498)	Pancreas(156;1582 1935 18898 22665 26498)	uc001upp.2		NA																	0				ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6						c.(2314-2316)TCC>TCT		hydrogen/potassium-exchanging ATPase 12A	Esomeprazole(DB00736)|Pantoprazole(DB00213)						94.0	82.0	86.0					13																	25281307		2203	4300	6503	SO:0001819	synonymous_variant	479				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding	g.chr13:25281307C>T	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2316C>T	13.37:g.25281307C>T			Somatic				ATP12A_uc010aaa.2_Silent_p.S778S	p.S772S	NM_001676	NP_001667	WXS	Illumina HiSeq	Unspecified	P54707	AT12A_HUMAN		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	16	2503	+		Lung SC(185;0.0225)|Breast(139;0.077)	772	SI -> LH (in Ref. 7; CAA49478).		Cytoplasmic (Potential).		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	ENST00000381946.3	37	c.2316C>T	CCDS31948.1																																																																																				0.542	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676		6	42	0	0	0	0.001168	0	6	42				
CENPJ	55835	broad.mit.edu	37	13	25479796	25479796	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr13:25479796C>A	ENST00000381884.4	-	7	2565	c.2380G>T	c.(2380-2382)Gat>Tat	p.D794Y	CENPJ_ENST00000545981.1_Missense_Mutation_p.D794Y	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	794					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		CTTTCATCATCAAAGTCCATT	0.418																																							uc001upt.3		NA																	0				ovary(2)	2						c.(2380-2382)GAT>TAT		centromere protein J							163.0	153.0	157.0					13																	25479796		2203	4300	6503	SO:0001583	missense	55835				cell division|centriole replication|G2/M transition of mitotic cell cycle|microtubule nucleation|microtubule polymerization	centriole|cytosol|gamma-tubulin small complex|microtubule	protein domain specific binding|tubulin binding	g.chr13:25479796C>A	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.2380G>T	13.37:g.25479796C>A	ENSP00000371308:p.Asp794Tyr		Somatic				CENPJ_uc010tdf.1_RNA|CENPJ_uc010aae.2_RNA|CENPJ_uc010aaf.2_RNA|CENPJ_uc001upu.2_5'Flank	p.D794Y	NM_018451	NP_060921	WXS	Illumina HiSeq	Unspecified	Q9HC77	CENPJ_HUMAN		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)	7	2633	-		Lung SC(185;0.0225)|Breast(139;0.0602)	794					Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	c.2380G>T	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.145176	0.57044	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.68181	-0.31;-0.31	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.82728	0.5100	M	0.78637	2.42	0.58432	D	0.999996	D	0.89917	1.0	D	0.80764	0.994	D	0.84445	0.0585	10	0.87932	D	0	.	18.4548	0.90715	0.0:1.0:0.0:0.0	.	794	Q9HC77	CENPJ_HUMAN	Y	794	ENSP00000371308:D794Y;ENSP00000441090:D794Y	ENSP00000371308:D794Y	D	-	1	0	CENPJ	24377796	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	6.177000	0.71961	2.639000	0.89480	0.551000	0.68910	GAT		0.418	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451		9	93	1	0	1.76689e-08	0.006214	2.27257e-08	9	93				
MTUS2	23281	broad.mit.edu	37	13	30077256	30077257	+	Missense_Mutation	DNP	GA	GA	CT	rs533395760	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr13:30077256_30077257GA>CT	ENST00000380808.2	+	9	1176_1177	c.960_961GA>CT	c.(958-963)ccGAtt>ccCTtt	p.I321F	MTUS2_ENST00000400542.3_3'UTR|MTUS2_ENST00000431530.3_Missense_Mutation_p.I1352F|MTUS2_ENST00000542829.1_Missense_Mutation_p.I231F	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1342						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CGACCAGTCCGATTAAACTCTC	0.569																																							uc001usl.3		NA																	0					0						c.(4051-4056)CCGATT>CCCTTT		hypothetical protein LOC23281 isoform a																																				SO:0001583	missense	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:30077256_30077257GA>CT	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	Exception_encountered	13.37:g.30077256_30077257delinsCT	ENSP00000370186:p.Ile321Phe		Somatic				MTUS2_uc001usm.3_Missense_Mutation_p.I321F|MTUS2_uc010aau.2_Missense_Mutation_p.I231F|MTUS2_uc010tdq.1_Missense_Mutation_p.I104F	p.I1352F	NM_001033602	NP_001028774	WXS	Illumina HiSeq	Unspecified	Q5JR59	MTUS2_HUMAN			14	4111_4112	+			1342					A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	DNP	ENST00000380808.2	37	c.4053_4054GA>CT	CCDS41874.1																																																																																				0.569	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044335.2	XM_166270		9	41	0	0	0	0.004672	0	9	41				
TRPC4	7223	broad.mit.edu	37	13	38266233	38266233	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr13:38266233C>T	ENST00000379705.3	-	4	1994	c.1137G>A	c.(1135-1137)ctG>ctA	p.L379L	TRPC4_ENST00000355779.2_Silent_p.L379L|TRPC4_ENST00000379681.3_Silent_p.L379L|TRPC4_ENST00000338947.5_Silent_p.L206L|TRPC4_ENST00000358477.2_Silent_p.L379L|TRPC4_ENST00000426868.2_Silent_p.L379L|TRPC4_ENST00000379679.1_Silent_p.L206L|TRPC4_ENST00000447043.1_Silent_p.L379L|TRPC4_ENST00000379673.2_Silent_p.L379L			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	379	Poly-Leu.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CAAGCAGCAGCAGGAACAAAA	0.498																																							uc001uws.2		NA																	0				ovary(3)|skin(2)|breast(1)	6						c.(1135-1137)CTG>CTA		transient receptor potential cation channel,							117.0	110.0	113.0					13																	38266233		2203	4300	6503	SO:0001819	synonymous_variant	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38266233C>T	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1137G>A	13.37:g.38266233C>T			Somatic				TRPC4_uc010abv.2_Intron|TRPC4_uc001uwt.2_Silent_p.L379L|TRPC4_uc010tey.1_Silent_p.L379L|TRPC4_uc010abw.2_Silent_p.L206L|TRPC4_uc010abx.2_Silent_p.L379L|TRPC4_uc010aby.2_Silent_p.L379L	p.L379L	NM_016179	NP_057263	WXS	Illumina HiSeq	Unspecified	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	4	1372	-			379			Poly-Leu.|Helical; (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	ENST00000379705.3	37	c.1137G>A	CCDS9365.1																																																																																				0.498	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		6	58	0	0	0	0.001168	0	6	58				
DACH1	1602	broad.mit.edu	37	13	72049967	72049967	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr13:72049967T>C	ENST00000359684.2	-	10	2046	c.2047A>G	c.(2047-2049)Agg>Ggg	p.R683G	DACH1_ENST00000354591.4_Missense_Mutation_p.R429G|DACH1_ENST00000305425.4_Missense_Mutation_p.R631G|DACH1_ENST00000313174.7_Missense_Mutation_p.R483G			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	683	DACHbox-C.|Interaction with SIN3A. {ECO:0000250}.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		TTCTTTAGCCTCTTTTGAACT	0.338																																							uc010thn.1		NA																	0				breast(1)	1						c.(1885-1887)AGG>GGG		dachshund homolog 1 isoform a							181.0	158.0	165.0					13																	72049967		1836	4082	5918	SO:0001583	missense	1602				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding	g.chr13:72049967T>C	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.2047A>G	13.37:g.72049967T>C	ENSP00000352712:p.Arg683Gly		Somatic				DACH1_uc010tho.1_Missense_Mutation_p.R481G|DACH1_uc010thp.1_Missense_Mutation_p.R427G	p.R629G	NM_080759	NP_542937	WXS	Illumina HiSeq	Unspecified	Q9UI36	DACH1_HUMAN		GBM - Glioblastoma multiforme(99;0.00032)	10	2308	-		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)	681			DACHbox-C.|Potential.|Interaction with SIN3A (By similarity).		D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37	c.1885A>G		.	.	.	.	.	.	.	.	.	.	T	19.46	3.831274	0.71258	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.58358	0.44;0.5;0.53;0.34	5.35	4.09	0.47781	.	0.000000	0.85682	D	0.000000	T	0.71962	0.3402	M	0.81802	2.56	0.28417	N	0.917911	D;D;D	0.89917	0.989;0.995;1.0	D;D;D	0.91635	0.985;0.988;0.999	T	0.67841	-0.5566	10	0.87932	D	0	-13.6373	12.8642	0.57930	0.0:0.0:0.1351:0.8649	.	427;481;629	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	G	631;483;429;683;683	ENSP00000304994:R631G;ENSP00000318506:R483G;ENSP00000346604:R429G;ENSP00000352712:R683G	ENSP00000304994:R631G	R	-	1	2	DACH1	70947968	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.195000	0.58400	2.150000	0.67090	0.533000	0.62120	AGG		0.338	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392		6	68	0	0	0	0.001168	0	6	68				
OR4L1	122742	broad.mit.edu	37	14	20528818	20528818	+	Silent	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:20528818G>C	ENST00000315683.1	+	1	615	c.615G>C	c.(613-615)ctG>ctC	p.L205L		NM_001004717.1	NP_001004717.1	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L, member 1	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(16)|ovary(2)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		ACAGCGGGCTGCTCTCTTTCA	0.428																																							uc001vwn.1		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(613-615)CTG>CTC		olfactory receptor, family 4, subfamily L,							249.0	228.0	235.0					14																	20528818		2203	4300	6503	SO:0001819	synonymous_variant	122742				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20528818G>C		CCDS32029.1	14q11.2	2013-09-23			ENSG00000176246	ENSG00000176246		"""GPCR / Class A : Olfactory receptors"""	15356	protein-coding gene	gene with protein product				OR4L2P			Standard	NM_001004717		Approved		uc001vwn.1	Q8NH43	OTTHUMG00000169492	ENST00000315683.1:c.615G>C	14.37:g.20528818G>C			Somatic					p.L205L	NM_001004717	NP_001004717	WXS	Illumina HiSeq	Unspecified	Q8NH43	OR4L1_HUMAN	Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)	1	615	+	all_cancers(95;0.00108)		205			Helical; Name=5; (Potential).		Q6IEZ5	Silent	SNP	ENST00000315683.1	37	c.615G>C	CCDS32029.1																																																																																				0.428	OR4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404381.1			10	147	0	0	0	0.008291	0	10	147				
TTC5	91875	broad.mit.edu	37	14	20766966	20766966	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:20766966T>C	ENST00000258821.3	-	5	685	c.629A>G	c.(628-630)tAt>tGt	p.Y210C		NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	210					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		TGCTTGGGCATAGGCACTGAG	0.453																																							uc001vwt.2		NA																	0				ovary(1)	1						c.(628-630)TAT>TGT		tetratricopeptide repeat domain 5							117.0	105.0	109.0					14																	20766966		2203	4300	6503	SO:0001583	missense	91875				DNA repair	cytoplasm|nucleus	binding	g.chr14:20766966T>C	BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.629A>G	14.37:g.20766966T>C	ENSP00000258821:p.Tyr210Cys		Somatic				TTC5_uc001vwu.2_Missense_Mutation_p.Y67C	p.Y210C	NM_138376	NP_612385	WXS	Illumina HiSeq	Unspecified	Q8N0Z6	TTC5_HUMAN	Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)	5	686	-	all_cancers(95;0.00092)		210			TPR 3.		A8MQ18|Q96HF9	Missense_Mutation	SNP	ENST00000258821.3	37	c.629A>G	CCDS9546.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.928025	0.73327	.	.	ENSG00000136319	ENST00000258821	T	0.74842	-0.88	4.65	4.65	0.58169	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.86260	0.5890	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88404	0.3017	10	0.87932	D	0	.	13.4803	0.61332	0.0:0.0:0.0:1.0	.	210	Q8N0Z6	TTC5_HUMAN	C	210	ENSP00000258821:Y210C	ENSP00000258821:Y210C	Y	-	2	0	TTC5	19836806	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.468000	0.73551	2.095000	0.63458	0.477000	0.44152	TAT		0.453	TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073529.4	NM_138376		6	45	0	0	0	0.001984	0	6	45				
SLC7A7	9056	broad.mit.edu	37	14	23282224	23282224	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:23282224C>A	ENST00000397532.3	-	2	909	c.384G>T	c.(382-384)gaG>gaT	p.E128D	SLC7A7_ENST00000555702.1_Missense_Mutation_p.E128D|SLC7A7_ENST00000397529.2_Missense_Mutation_p.E128D|SLC7A7_ENST00000285850.7_Missense_Mutation_p.E128D|SLC7A7_ENST00000397528.4_Missense_Mutation_p.E128D|SLC7A7_ENST00000554517.1_Intron			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	128					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		GGCTGGTGGGCTCAATGATGA	0.557																																							uc001wgr.3		NA																	0				ovary(1)|breast(1)	2						c.(382-384)GAG>GAT		solute carrier family 7 member 7							131.0	122.0	125.0					14																	23282224		2203	4300	6503	SO:0001583	missense	9056				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity	g.chr14:23282224C>A	AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.384G>T	14.37:g.23282224C>A	ENSP00000380666:p.Glu128Asp		Somatic				SLC7A7_uc001wgs.3_Missense_Mutation_p.E128D|SLC7A7_uc001wgt.3_Missense_Mutation_p.E128D|SLC7A7_uc001wgu.3_Missense_Mutation_p.E128D|SLC7A7_uc001wgv.3_Missense_Mutation_p.E128D	p.E128D	NM_003982	NP_003973	WXS	Illumina HiSeq	Unspecified	Q9UM01	YLAT1_HUMAN		GBM - Glioblastoma multiforme(265;0.00741)	2	522	-	all_cancers(95;8.44e-05)		128					B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Missense_Mutation	SNP	ENST00000397532.3	37	c.384G>T	CCDS9574.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341632	0.61073	.	.	ENSG00000155465	ENST00000285850;ENST00000555702;ENST00000397532;ENST00000404278;ENST00000397529;ENST00000397528;ENST00000554758;ENST00000488800	D;D;D;D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55;-2.55;-2.55;-2.55	5.5	3.54	0.40534	Amino acid permease domain (1);	0.048822	0.85682	D	0.000000	D	0.91161	0.7216	L	0.58583	1.82	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	D	0.89976	0.4097	10	0.59425	D	0.04	.	6.9357	0.24464	0.0:0.5758:0.0:0.4242	.	128	Q9UM01	YLAT1_HUMAN	D	128;128;128;101;128;128;128;128	ENSP00000285850:E128D;ENSP00000451881:E128D;ENSP00000380666:E128D;ENSP00000380663:E128D;ENSP00000380662:E128D;ENSP00000450671:E128D;ENSP00000421554:E128D	ENSP00000285850:E128D	E	-	3	2	SLC7A7	22352064	0.999000	0.42202	1.000000	0.80357	0.984000	0.73092	0.739000	0.26173	1.176000	0.42840	0.655000	0.94253	GAG		0.557	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3			8	134	1	0	2.17888e-05	0.006214	2.66773e-05	8	134				
NYNRIN	57523	broad.mit.edu	37	14	24886453	24886453	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:24886453T>G	ENST00000382554.3	+	9	5816	c.5498T>G	c.(5497-5499)cTt>cGt	p.L1833R		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1833					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GACCAGGTCCTTTTGCTGTCC	0.582																																							uc001wpf.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(5497-5499)CTT>CGT		hypothetical protein LOC57523							54.0	62.0	59.0					14																	24886453		2006	4182	6188	SO:0001583	missense	57523				DNA integration	integral to membrane	DNA binding	g.chr14:24886453T>G	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.5498T>G	14.37:g.24886453T>G	ENSP00000371994:p.Leu1833Arg		Somatic					p.L1833R	NM_025081	NP_079357	WXS	Illumina HiSeq	Unspecified	Q9P2P1	NYNRI_HUMAN			9	5816	+			1833					Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	c.5498T>G	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	T	14.18	2.459126	0.43634	.	.	ENSG00000205978	ENST00000382554	T	0.14893	2.47	4.65	4.65	0.58169	.	.	.	.	.	T	0.26304	0.0642	N	0.24115	0.695	0.31696	N	0.641294	D	0.76494	0.999	D	0.66716	0.946	T	0.14476	-1.0471	9	0.87932	D	0	.	12.3345	0.55058	0.0:0.0:0.0:1.0	.	1833	Q9P2P1	NYNRI_HUMAN	R	1833	ENSP00000371994:L1833R	ENSP00000371994:L1833R	L	+	2	0	NYNRIN	23956293	0.934000	0.31675	0.957000	0.39632	0.053000	0.15095	1.997000	0.40786	2.078000	0.62432	0.460000	0.39030	CTT		0.582	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1			5	42	0	0	0	0.000602	0	5	42				
CLEC14A	161198	broad.mit.edu	37	14	38724577	38724577	+	Silent	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:38724577C>A	ENST00000342213.2	-	1	997	c.651G>T	c.(649-651)cgG>cgT	p.R217R		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	217						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GGAGCTGTCCCCGGCAGAGCG	0.652																																							uc001wum.1		NA																	0				ovary(3)|skin(1)	4						c.(649-651)CGG>CGT		C-type lectin domain family 14, member A							78.0	84.0	82.0					14																	38724577		2203	4300	6503	SO:0001819	synonymous_variant	161198					integral to membrane	sugar binding	g.chr14:38724577C>A		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.651G>T	14.37:g.38724577C>A			Somatic					p.R217R	NM_175060	NP_778230	WXS	Illumina HiSeq	Unspecified	Q86T13	CLC14_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)	1	998	-	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		217			Extracellular (Potential).		Q695G9|Q6PWT6|Q8N5V5	Silent	SNP	ENST00000342213.2	37	c.651G>T	CCDS9667.1																																																																																				0.652	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060		27	188	1	0	1.16021e-09	0.007291	1.51781e-09	27	188				
MDGA2	161357	broad.mit.edu	37	14	47343340	47343340	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:47343340T>C	ENST00000399232.2	-	13	2658	c.2294A>G	c.(2293-2295)aAt>aGt	p.N765S	MDGA2_ENST00000426342.1_Missense_Mutation_p.N536S|MDGA2_ENST00000439988.3_Missense_Mutation_p.N834S|MDGA2_ENST00000357362.3_Missense_Mutation_p.N536S|MDGA2_ENST00000399222.3_5'UTR	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	765	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CCAGTCAAAATTATCTGTATC	0.318																																							uc001wwj.3		NA																	0				ovary(4)|large_intestine(1)|pancreas(1)	6						c.(2293-2295)AAT>AGT		MAM domain containing 1 isoform 1							144.0	135.0	138.0					14																	47343340		1829	4088	5917	SO:0001583	missense	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47343340T>C	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2294A>G	14.37:g.47343340T>C	ENSP00000382178:p.Asn765Ser		Somatic				MDGA2_uc001wwh.3_5'UTR|MDGA2_uc001wwi.3_Missense_Mutation_p.N536S|MDGA2_uc010ani.2_Missense_Mutation_p.N325S	p.N765S	NM_001113498	NP_001106970	WXS	Illumina HiSeq	Unspecified	Q7Z553	MDGA2_HUMAN			13	2490	-			765			MAM.		F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37	c.2294A>G		.	.	.	.	.	.	.	.	.	.	T	15.60	2.880351	0.51801	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.01998	4.51;4.51;4.51;4.51	5.68	5.68	0.88126	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.123600	0.33753	U	0.004587	T	0.02455	0.0075	N	0.11673	0.155	0.80722	D	1	B;B	0.32862	0.337;0.387	B;B	0.42959	0.149;0.403	T	0.63945	-0.6522	10	0.49607	T	0.09	.	10.066	0.42303	0.15:0.0:0.0:0.85	.	536;765	F6W3S7;Q7Z553	.;MDGA2_HUMAN	S	765;536;834;536	ENSP00000400011:N765S;ENSP00000405456:N536S;ENSP00000382178:N834S;ENSP00000349925:N536S	ENSP00000349925:N536S	N	-	2	0	MDGA2	46413090	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.829000	0.69316	2.155000	0.67459	0.460000	0.39030	AAT		0.318	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		12	83	0	0	0	0.001368	0	12	83				
AKAP5	9495	broad.mit.edu	37	14	64935446	64935446	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:64935446G>A	ENST00000394718.4	+	2	712	c.334G>A	c.(334-336)Gag>Aag	p.E112K	ZBTB25_ENST00000555424.1_Intron|AKAP5_ENST00000320636.5_Missense_Mutation_p.E112K|ZBTB25_ENST00000555220.1_Intron	NM_004857.3	NP_004848.3	P24588	AKAP5_HUMAN	A kinase (PRKA) anchor protein 5	112	Essential to the intracellular anchoring function. {ECO:0000250}.				energy reserve metabolic process (GO:0006112)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|stomach(1)	13				all cancers(60;0.00749)|OV - Ovarian serous cystadenocarcinoma(108;0.0095)|BRCA - Breast invasive adenocarcinoma(234;0.0449)		AATAAATGCTGAGGATGCTGA	0.413																																							uc001xhd.3		NA																	0					0						c.(334-336)GAG>AAG		A-kinase anchor protein 5							98.0	111.0	106.0					14																	64935446		2203	4300	6503	SO:0001583	missense	9495				energy reserve metabolic process|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting|regulation of insulin secretion|signal transduction|synaptic transmission	cytosol	adenylate cyclase binding|calmodulin binding	g.chr14:64935446G>A	M90359	CCDS9764.1	14q23.3	2012-05-16			ENSG00000179841	ENSG00000179841		"""A-kinase anchor proteins"""	375	protein-coding gene	gene with protein product		604688				1512224, 1618839	Standard	NM_004857		Approved	AKAP75, AKAP79	uc001xhd.4	P24588	OTTHUMG00000029634	ENST00000394718.4:c.334G>A	14.37:g.64935446G>A	ENSP00000378207:p.Glu112Lys		Somatic				ZBTB25_uc001xhc.2_Intron	p.E112K	NM_004857	NP_004848	WXS	Illumina HiSeq	Unspecified	P24588	AKAP5_HUMAN		all cancers(60;0.00749)|OV - Ovarian serous cystadenocarcinoma(108;0.0095)|BRCA - Breast invasive adenocarcinoma(234;0.0449)	2	712	+			112			Essential to the intracellular anchoring function (By similarity).		A2RRB8	Missense_Mutation	SNP	ENST00000394718.4	37	c.334G>A	CCDS9764.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.529478	0.44969	.	.	ENSG00000179841	ENST00000394718;ENST00000320636	T;T	0.31247	1.5;1.5	5.1	5.1	0.69264	.	0.100900	0.43260	D	0.000599	T	0.41534	0.1163	L	0.29908	0.895	0.39283	D	0.964606	D	0.69078	0.997	D	0.63597	0.916	T	0.28933	-1.0028	10	0.39692	T	0.17	-2.118	16.3033	0.82832	0.0:0.0:1.0:0.0	.	112	P24588	AKAP5_HUMAN	K	112	ENSP00000378207:E112K;ENSP00000315615:E112K	ENSP00000315615:E112K	E	+	1	0	AKAP5	64005199	0.998000	0.40836	0.914000	0.36105	0.582000	0.36321	3.227000	0.51262	2.389000	0.81357	0.655000	0.94253	GAG		0.413	AKAP5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268070.3			9	144	0	0	0	0.008291	0	9	144				
ZBTB25	7597	broad.mit.edu	37	14	64954637	64954637	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:64954637G>A	ENST00000608382.1	-	3	503	c.312C>T	c.(310-312)gcC>gcT	p.A104A	ZBTB25_ENST00000394715.1_Silent_p.A104A|ZBTB25_ENST00000555424.1_Intron|ZBTB25_ENST00000555220.1_Intron	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	104	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		AAAGGTAGTCGGCGTGAAGAA	0.418																																							uc001xhf.2		NA																	0				ovary(1)|skin(1)	2						c.(310-312)GCC>GCT		zinc finger protein 46							111.0	101.0	104.0					14																	64954637		2203	4300	6503	SO:0001819	synonymous_variant	7597					cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:64954637G>A	X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.312C>T	14.37:g.64954637G>A			Somatic				ZBTB25_uc001xhc.2_Intron|ZBTB25_uc001xhg.2_Silent_p.A104A	p.A104A	NM_006977	NP_008908	WXS	Illumina HiSeq	Unspecified	P24278	ZBT25_HUMAN		all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)	3	495	-			104			BTB.		B3KUX6|Q8IYH9	Silent	SNP	ENST00000608382.1	37	c.312C>T	CCDS9765.1																																																																																				0.418	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280649.2	NM_006977		4	91	0	0	0	0.000248	0	4	91				
MAP3K9	4293	broad.mit.edu	37	14	71209239	71209239	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:71209239G>A	ENST00000554752.2	-	6	1395	c.1396C>T	c.(1396-1398)Cgg>Tgg	p.R466W	MAP3K9_ENST00000555993.2_Missense_Mutation_p.R466W|MAP3K9_ENST00000554146.1_Missense_Mutation_p.R203W|MAP3K9_ENST00000381250.4_Missense_Mutation_p.R466W|MAP3K9_ENST00000553414.1_Missense_Mutation_p.R160W	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	466	Leucine-zipper 2.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		TCCCGACGCCGCAGCAGTTCC	0.612																																					GBM(114;411 1587 13539 28235 50070)	GBM(114;411 1587 13539 28235 50070)	uc001xmm.2		NA																	0				stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(1396-1398)CGG>TGG		mitogen-activated protein kinase kinase kinase							51.0	46.0	48.0					14																	71209239		2203	4300	6503	SO:0001583	missense	4293				activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity	g.chr14:71209239G>A	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1396C>T	14.37:g.71209239G>A	ENSP00000451612:p.Arg466Trp		Somatic				MAP3K9_uc010ttk.1_Missense_Mutation_p.R203W|MAP3K9_uc001xmk.2_Missense_Mutation_p.R160W|MAP3K9_uc001xml.2_Missense_Mutation_p.R466W	p.R466W	NM_033141	NP_149132	WXS	Illumina HiSeq	Unspecified	P80192	M3K9_HUMAN		all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)	6	1396	-			466			Leucine-zipper 2.		A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	37	c.1396C>T		.	.	.	.	.	.	.	.	.	.	G	20.5	3.999090	0.74818	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	6.06	4.02	0.46733	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.89577	0.6755	M	0.62723	1.935	0.47949	D	0.999555	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.76575	0.988;0.973;0.988;0.988	D	0.91172	0.4969	10	0.87932	D	0	.	16.7531	0.85492	0.0:0.0:0.7536:0.2464	.	203;466;466;160	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	W	466;466;160;466;203;194	ENSP00000451612:R466W;ENSP00000451038:R160W;ENSP00000370649:R466W;ENSP00000451921:R203W	ENSP00000005198:R466W	R	-	1	2	MAP3K9	70278992	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	2.094000	0.41719	1.533000	0.49186	0.655000	0.94253	CGG		0.612	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2			6	45	0	0	0	0.001984	0	6	45				
GALC	2581	broad.mit.edu	37	14	88416221	88416221	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:88416221T>A	ENST00000261304.2	-	12	1412	c.1306A>T	c.(1306-1308)Aga>Tga	p.R436*	GALC_ENST00000393568.4_Nonsense_Mutation_p.R413*|GALC_ENST00000393569.2_Nonsense_Mutation_p.R410*|GALC_ENST00000544807.2_Nonsense_Mutation_p.R380*	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	436					carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AAAAGAAATCTTTCGGATGTT	0.338																																							uc001xvt.2		NA																	0					0						c.(1306-1308)AGA>TGA		galactosylceramidase isoform a precursor							102.0	96.0	98.0					14																	88416221		1793	4065	5858	SO:0001587	stop_gained	2581				carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity	g.chr14:88416221T>A	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.1306A>T	14.37:g.88416221T>A	ENSP00000261304:p.Arg436*		Somatic				GALC_uc010tvw.1_RNA|GALC_uc010tvx.1_Nonsense_Mutation_p.R410*|GALC_uc010tvy.1_Nonsense_Mutation_p.R413*|GALC_uc010tvz.1_Nonsense_Mutation_p.R380*	p.R436*	NM_000153	NP_000144	WXS	Illumina HiSeq	Unspecified	P54803	GALC_HUMAN			12	1705	-			436					B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Nonsense_Mutation	SNP	ENST00000261304.2	37	c.1306A>T	CCDS9878.2	.	.	.	.	.	.	.	.	.	.	T	37	6.267839	0.97426	.	.	ENSG00000054983	ENST00000261304;ENST00000544807;ENST00000393569;ENST00000539620;ENST00000393568	.	.	.	5.57	4.41	0.53225	.	0.555823	0.21259	N	0.077519	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-11.7725	11.2014	0.48743	0.0:0.0:0.1539:0.8461	.	.	.	.	X	436;380;410;225;413	.	ENSP00000261304:R436X	R	-	1	2	GALC	87485974	0.071000	0.21146	0.109000	0.21407	0.687000	0.40016	1.891000	0.39738	0.922000	0.37019	-0.472000	0.04984	AGA		0.338	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071559.2			9	104	0	0	0	0.006214	0	9	104				
KCNK10	54207	broad.mit.edu	37	14	88729741	88729741	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:88729741C>A	ENST00000340700.5	-	2	643	c.192G>T	c.(190-192)caG>caT	p.Q64H	KCNK10_ENST00000319231.5_Missense_Mutation_p.Q69H|KCNK10_ENST00000312350.5_Missense_Mutation_p.Q69H	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	64					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TCATGACGGTCTGCAAGCCCC	0.607																																							uc001xwo.2		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(190-192)CAG>CAT		potassium channel, subfamily K, member 10							114.0	100.0	104.0					14																	88729741		2203	4300	6503	SO:0001583	missense	54207				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr14:88729741C>A	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.192G>T	14.37:g.88729741C>A	ENSP00000343104:p.Gln64His		Somatic				KCNK10_uc001xwm.2_Missense_Mutation_p.Q69H|KCNK10_uc001xwn.2_Missense_Mutation_p.Q69H	p.Q64H	NM_021161	NP_066984	WXS	Illumina HiSeq	Unspecified	P57789	KCNKA_HUMAN			2	649	-			64			Cytoplasmic (Potential).		B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	c.192G>T	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.907150	0.33628	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231;ENST00000556282	D;D;D;D	0.97303	-2.7;-2.71;-2.69;-4.33	5.87	3.02	0.34903	.	0.157820	0.64402	D	0.000016	D	0.89199	0.6647	N	0.10874	0.06	0.32922	D	0.515916	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.83070	-0.0143	10	0.12430	T	0.62	.	5.514	0.16896	0.1401:0.6412:0.0:0.2187	.	64;69;69	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	H	64;69;69;52	ENSP00000343104:Q64H;ENSP00000310568:Q69H;ENSP00000312811:Q69H;ENSP00000452587:Q52H	ENSP00000310568:Q69H	Q	-	3	2	KCNK10	87799494	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.807000	0.27140	0.911000	0.36747	0.655000	0.94253	CAG		0.607	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161		7	137	1	0	8.12818e-05	0.001984	9.82584e-05	7	137				
AKT1	207	broad.mit.edu	37	14	105246551	105246551	+	Missense_Mutation	SNP	C	C	T	rs34409589|rs121434592		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:105246551C>T	ENST00000554581.1	-	2	1529	c.49G>A	c.(49-51)Gag>Aag	p.E17K	AKT1_ENST00000554848.1_Missense_Mutation_p.E17K|AKT1_ENST00000407796.2_Missense_Mutation_p.E17K|AKT1_ENST00000555528.1_Missense_Mutation_p.E17K|AKT1_ENST00000402615.2_Missense_Mutation_p.E17K|AKT1_ENST00000544168.1_5'Flank|AKT1_ENST00000349310.3_Missense_Mutation_p.E17K			P31749	AKT1_HUMAN	v-akt murine thymoma viral oncogene homolog 1	17	Inositol-(1,3,4,5)-tetrakisphosphate binding.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.		E -> K (in PROTEUSS and breast cancer; also detected in colorectal and ovarian cancer; somatic mutation; results in increased phosphorylation at T-308 and higher basal ubiquitination; the mutant protein is more efficiently recruited to the plasma membrane; alters phosphatidylinositiol phosphates lipid specificity of the AKT1 PH domain; dbSNP:rs121434592). {ECO:0000269|PubMed:17611497, ECO:0000269|PubMed:21793738}.		activation-induced cell death of T cells (GO:0006924)|aging (GO:0007568)|anagen (GO:0042640)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell projection organization (GO:0030030)|cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to mechanical stimulus (GO:0071260)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|execution phase of apoptosis (GO:0097194)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycogen cell differentiation involved in embryonic placenta development (GO:0060709)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|labyrinthine layer blood vessel development (GO:0060716)|mammary gland epithelial cell differentiation (GO:0060644)|maternal placenta development (GO:0001893)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of proteolysis (GO:0045861)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|osteoblast differentiation (GO:0001649)|peptidyl-serine phosphorylation (GO:0018105)|peripheral nervous system myelin maintenance (GO:0032287)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell growth (GO:0030307)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle checkpoint (GO:1901976)|regulation of cell migration (GO:0030334)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of neuron projection development (GO:0010975)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of translation (GO:0006417)|response to fluid shear stress (GO:0034405)|response to food (GO:0032094)|response to heat (GO:0009408)|response to UV-A (GO:0070141)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|striated muscle cell differentiation (GO:0051146)|T cell costimulation (GO:0031295)|translation (GO:0006412)	cell-cell junction (GO:0005911)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|kinase activity (GO:0016301)|nitric-oxide synthase regulator activity (GO:0030235)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.E17K(102)		NS(3)|breast(97)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(7)|lung(10)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|thyroid(10)|urinary_tract(15)	176		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	TTGATGTACTCCCCTACAGAC	0.612	E17K(KU1919_URINARY_TRACT)	1	Mis		"""breast, colorectal, ovarian, NSCLC"""																																		uc001ypk.2	E17K(KU1919_URINARY_TRACT)	1		Dom	yes		14	14q32.32	207	Mis	v-akt murine thymoma viral oncogene homolog 1			E			breast|colorectal|ovarian|NSCLC		102	Substitution - Missense(102)	p.E17K(126)	breast(49)|urinary_tract(14)|thyroid(10)|endometrium(10)|lung(7)|large_intestine(4)|prostate(4)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|NS(1)	breast(86)|urinary_tract(12)|thyroid(10)|lung(7)|endometrium(5)|large_intestine(4)|skin(4)|prostate(3)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|NS(1)	134						c.(49-51)GAG>AAG		AKT1 kinase	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)						130.0	93.0	106.0					14																	105246551		2203	4300	6503	SO:0001583	missense	207				activation of pro-apoptotic gene products|activation-induced cell death of T cells|endocrine pancreas development|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen biosynthetic process|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|mRNA metabolic process|negative regulation of fatty acid beta-oxidation|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|nitric oxide biosynthetic process|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of blood vessel endothelial cell migration|positive regulation of cell growth|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of establishment of protein localization in plasma membrane|positive regulation of fat cell differentiation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|positive regulation of nitric oxide biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein autophosphorylation|protein import into nucleus, translocation|regulation of neuron projection development|regulation of translation|response to fluid shear stress|response to heat|response to UV-A|T cell costimulation	cytosol|nucleoplasm|plasma membrane	enzyme binding|identical protein binding|nitric-oxide synthase regulator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein serine/threonine kinase activity	g.chr14:105246551C>T	M63167	CCDS9994.1	14q32.33	2014-09-17			ENSG00000142208	ENSG00000142208	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	391	protein-coding gene	gene with protein product		164730					Standard	XM_005267401		Approved	RAC, PKB, PRKBA, AKT	uc001ypn.3	P31749	OTTHUMG00000170795	ENST00000554581.1:c.49G>A	14.37:g.105246551C>T	ENSP00000451828:p.Glu17Lys		Somatic				INF2_uc010tyi.1_Intron|AKT1_uc001ypl.2_Missense_Mutation_p.E17K|AKT1_uc010axa.2_Missense_Mutation_p.E17K|AKT1_uc001ypm.2_Missense_Mutation_p.E17K|AKT1_uc001ypn.2_Missense_Mutation_p.E17K|AKT1_uc010tyk.1_5'Flank	p.E17K	NM_005163	NP_005154	WXS	Illumina HiSeq	Unspecified	P31749	AKT1_HUMAN	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	3	603	-		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	17	E->K: Increase in basal ubiquitination, phosphorylation at T-308 and important increase in membrane recruitment. Decrease in ubiquitination, phosphorylation at T-308 as well as impaired association with the membrane; when associated with R-8.	E -> K (in breast cancer; also detected in colorectal and ovarian cancer; somatic mutation; alters the PH domain conformation; results in activation of the protein; alters the subcellular location of the protein to the plasma membrane).	PH.		B2RAM5|B7Z5R1|Q9BWB6	Missense_Mutation	SNP	ENST00000554581.1	37	c.49G>A	CCDS9994.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458989	0.84317	.	.	ENSG00000142208	ENST00000554581;ENST00000407796;ENST00000349310;ENST00000402615;ENST00000555528;ENST00000554848;ENST00000555926	T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17	4.61	4.61	0.57282	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.59838	0.2223	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64411	-0.6414	10	0.72032	D	0.01	.	16.1757	0.81847	0.0:1.0:0.0:0.0	.	17	P31749	AKT1_HUMAN	K	17	ENSP00000451828:E17K;ENSP00000384293:E17K;ENSP00000270202:E17K;ENSP00000385326:E17K;ENSP00000450688:E17K;ENSP00000451166:E17K;ENSP00000451824:E17K	ENSP00000270202:E17K	E	-	1	0	AKT1	104317596	1.000000	0.71417	0.639000	0.29394	0.296000	0.27459	7.347000	0.79356	2.395000	0.81488	0.462000	0.41574	GAG		0.612	AKT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410418.1	NM_005163		4	32	0	0	0	0.000602	0	4	32				
MTA1	9112	broad.mit.edu	37	14	105911820	105911820	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr14:105911820C>T	ENST00000331320.7	+	3	376	c.162C>T	c.(160-162)acC>acT	p.T54T	MTA1_ENST00000405646.1_Silent_p.T54T|MTA1_ENST00000406191.1_Silent_p.T54T	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	54	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		TCTCCAGCACCCTCATCGCCC	0.667																																							uc001yqx.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(160-162)ACC>ACT		metastasis associated protein							116.0	82.0	93.0					14																	105911820		2203	4300	6503	SO:0001819	synonymous_variant	9112				signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:105911820C>T	U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.162C>T	14.37:g.105911820C>T			Somatic				MTA1_uc001yqy.2_RNA|MTA1_uc001yqz.1_5'UTR|MTA1_uc001yra.1_5'UTR	p.T54T	NM_004689	NP_004680	WXS	Illumina HiSeq	Unspecified	Q13330	MTA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)	3	349	+		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	54			BAH.		A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Silent	SNP	ENST00000331320.7	37	c.162C>T	CCDS32169.1																																																																																				0.667	MTA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317849.15			7	66	0	0	0	0.00308	0	7	66				
OR4M2	390538	broad.mit.edu	37	15	22369371	22369372	+	Missense_Mutation	DNP	TC	TC	AG			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr15:22369371_22369372TC>AG	ENST00000332663.2	+	1	894_895	c.796_797TC>AG	c.(796-798)TCg>AGg	p.S266R	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CCCATTTGACTCGTTTTCCCTA	0.416																																							uc010tzu.1		NA																	0				ovary(1)	1						c.(796-798)TCG>AGG		olfactory receptor, family 4, subfamily M,																																				SO:0001583	missense	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22369371_22369372TC>AG	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	Exception_encountered	15.37:g.22369371_22369372delinsAG	ENSP00000329467:p.Ser266Arg		Somatic				LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.S266R	NM_001004719	NP_001004719	WXS	Illumina HiSeq	Unspecified	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	796_797	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	266			Extracellular (Potential).		B9EH16|Q6IEY2	Missense_Mutation	DNP	ENST00000332663.2	37	c.796_797TC>AG	CCDS32172.1																																																																																				0.416	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			6	83	0	0	0	0.004672	0	6	83				
SECISBP2L	9728	broad.mit.edu	37	15	49325180	49325180	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr15:49325180C>A	ENST00000559471.1	-	4	909	c.646G>T	c.(646-648)Gat>Tat	p.D216Y	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.D216Y	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	216							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TGTGAAGCATCTACCAGAAGC	0.398																																							uc001zxe.1		NA																	0				breast(1)|skin(1)	2						c.(646-648)GAT>TAT		SECIS binding protein 2-like							269.0	243.0	251.0					15																	49325180		2197	4295	6492	SO:0001583	missense	9728							g.chr15:49325180C>A	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.646G>T	15.37:g.49325180C>A	ENSP00000453854:p.Asp216Tyr		Somatic				SECISBP2L_uc001zxd.1_Missense_Mutation_p.D216Y|SECISBP2L_uc010bep.1_5'UTR|SECISBP2L_uc010beq.1_Intron	p.D216Y	NM_014701	NP_055516	WXS	Illumina HiSeq	Unspecified	Q93073	SBP2L_HUMAN			4	780	-			216					Q8N767	Missense_Mutation	SNP	ENST00000559471.1	37	c.646G>T	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.342501	0.81911	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	D	0.90004	-2.6	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.91968	0.7456	L	0.34521	1.04	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.92858	0.6303	10	0.87932	D	0	.	19.4188	0.94712	0.0:1.0:0.0:0.0	.	216;216	Q93073;Q93073-2	SBP2L_HUMAN;.	Y	216	ENSP00000261847:D216Y	ENSP00000261847:D216Y	D	-	1	0	SECISBP2L	47112472	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.658000	0.74407	2.582000	0.87167	0.591000	0.81541	GAT		0.398	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701		15	202	1	0	1.15919e-05	0.008871	1.42382e-05	15	202				
DAPK2	23604	broad.mit.edu	37	15	64263687	64263687	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr15:64263687T>C	ENST00000457488.1	-	4	418	c.388A>G	c.(388-390)Att>Gtt	p.I130V	DAPK2_ENST00000261891.3_Missense_Mutation_p.I130V|DAPK2_ENST00000558069.1_Missense_Mutation_p.I130V|DAPK2_ENST00000558482.1_5'UTR	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	130	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		ATCTGCTTAATGAAGCTGGTG	0.498																																							uc002amr.2		NA																	0				stomach(1)|central_nervous_system(1)	2						c.(388-390)ATT>GTT		death-associated kinase 2							135.0	125.0	128.0					15																	64263687		2203	4300	6503	SO:0001583	missense	23604				apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding	g.chr15:64263687T>C	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.388A>G	15.37:g.64263687T>C	ENSP00000408277:p.Ile130Val		Somatic				DAPK2_uc010uim.1_RNA|DAPK2_uc010bgu.1_Missense_Mutation_p.I120V	p.I130V	NM_014326	NP_055141	WXS	Illumina HiSeq	Unspecified	Q9UIK4	DAPK2_HUMAN		LUAD - Lung adenocarcinoma(2;0.215)	4	419	-			130			Protein kinase.		E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	ENST00000457488.1	37	c.388A>G	CCDS10188.1	.	.	.	.	.	.	.	.	.	.	T	15.20	2.763000	0.49574	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.64618	-0.11;-0.11	5.4	5.4	0.78164	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.066960	0.56097	D	0.000027	T	0.51193	0.1660	N	0.16201	0.385	0.80722	D	1	B;B	0.22604	0.072;0.026	B;B	0.34138	0.176;0.099	T	0.51450	-0.8704	10	0.45353	T	0.12	.	14.9034	0.70699	0.0:0.0:0.0:1.0	.	130;130	E9JGM7;Q9UIK4	.;DAPK2_HUMAN	V	130	ENSP00000261891:I130V;ENSP00000408277:I130V	ENSP00000261891:I130V	I	-	1	0	DAPK2	62050740	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.070000	0.57548	2.176000	0.68965	0.379000	0.24179	ATT		0.498	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256479.1	NM_014326		8	114	0	0	0	0.008291	0	8	114				
TMEM202	338949	broad.mit.edu	37	15	72690674	72690674	+	Nonsense_Mutation	SNP	C	C	T	rs143325433		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr15:72690674C>T	ENST00000341689.3	+	1	61	c.7C>T	c.(7-9)Cga>Tga	p.R3*	TMEM202_ENST00000567679.1_Nonsense_Mutation_p.R3*	NM_001080462.1	NP_001073931.1	A6NGA9	TM202_HUMAN	transmembrane protein 202	3						integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	18						CAAGATGGAGCGAAGGGAACA	0.473																																							uc002auq.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(7-9)CGA>TGA		transmembrane protein 202							48.0	48.0	48.0					15																	72690674		2199	4297	6496	SO:0001587	stop_gained	338949					integral to membrane		g.chr15:72690674C>T		CCDS32287.1	15q24.1	2007-12-18				ENSG00000187806			33733	protein-coding gene	gene with protein product							Standard	NM_001080462		Approved	FLJ27523	uc002auq.3	A6NGA9		ENST00000341689.3:c.7C>T	15.37:g.72690674C>T	ENSP00000340212:p.Arg3*		Somatic				TMEM202_uc002aur.2_RNA	p.R3*	NM_001080462	NP_001073931	WXS	Illumina HiSeq	Unspecified	A6NGA9	TM202_HUMAN			1	7	+			3						Nonsense_Mutation	SNP	ENST00000341689.3	37	c.7C>T	CCDS32287.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302490	0.60195	.	.	ENSG00000187806	ENST00000341689	.	.	.	3.92	-1.82	0.07857	.	2.623870	0.01159	N	0.006582	.	.	.	.	.	.	0.58432	A	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.4738	4.3876	0.11325	0.2948:0.391:0.0:0.3142	.	.	.	.	X	3	.	ENSP00000340212:R3X	R	+	1	2	TMEM202	70477728	0.183000	0.23186	0.081000	0.20488	0.048000	0.14542	0.288000	0.18939	-0.095000	0.12351	0.467000	0.42956	CGA		0.473	TMEM202-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435756.1	NM_001080462		3	17	0	0	0	0.004672	0	3	17				
TSPAN3	10099	broad.mit.edu	37	15	77348493	77348493	+	Silent	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr15:77348493C>A	ENST00000267970.4	-	2	441	c.168G>T	c.(166-168)gtG>gtT	p.V56V	TSPAN3_ENST00000558394.1_5'UTR|TSPAN3_ENST00000559494.1_Intron|TSPAN3_ENST00000424443.3_Intron|TSPAN3_ENST00000558745.1_5'UTR|TSPAN3_ENST00000346495.2_Silent_p.V56V|TSPAN3_ENST00000561277.1_5'UTR	NM_001168412.1|NM_005724.5|NM_198902.2	NP_001161884.1|NP_005715.1|NP_944492.1	O60637	TSN3_HUMAN	tetraspanin 3	56						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	10				all cancers(203;1.14e-19)		CAGCTATGATCACTACAGCAG	0.478																																							uc002bcj.2		NA																	0					0						c.(166-168)GTG>GTT		transmembrane 4 superfamily member 8 isoform 1							147.0	132.0	137.0					15																	77348493		2196	4294	6490	SO:0001819	synonymous_variant	10099					integral to membrane		g.chr15:77348493C>A		CCDS10292.1, CCDS10293.1, CCDS53963.1	15q23	2013-02-14	2005-03-21	2005-03-21	ENSG00000140391	ENSG00000140391		"""Tetraspanins"""	17752	protein-coding gene	gene with protein product		613134	"""transmembrane 4 superfamily member 8"""	TM4SF8			Standard	NM_005724		Approved	TM4-A, TSPAN-3	uc002bcj.3	O60637	OTTHUMG00000143728	ENST00000267970.4:c.168G>T	15.37:g.77348493C>A			Somatic				TSPAN3_uc002bck.2_Silent_p.V56V|TSPAN3_uc010ump.1_Intron|TSPAN3_uc010bkx.2_Intron	p.V56V	NM_005724	NP_005715	WXS	Illumina HiSeq	Unspecified	O60637	TSN3_HUMAN		all cancers(203;1.14e-19)	2	385	-			56			Helical; (Potential).		A6NEH4|B3KQQ2|B4DP19|Q9BW22|Q9NVX9	Silent	SNP	ENST00000267970.4	37	c.168G>T	CCDS10292.1																																																																																				0.478	TSPAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289792.3	NM_005724		32	98	1	0	9.04072e-19	0.003271	1.23783e-18	32	98				
SYNM	23336	broad.mit.edu	37	15	99669782	99669782	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr15:99669782C>T	ENST00000560674.1	+	4	828	c.359C>T	c.(358-360)tCg>tTg	p.S120L	SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000328642.7_Missense_Mutation_p.S405L|SYNM_ENST00000336292.6_Missense_Mutation_p.S405L|RP11-6O2.4_ENST00000566974.1_RNA			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	406	Coil 1B.|Interaction with DMD and UTRN.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						TATTCTTCCTCGGCCACTACC	0.502																																					Pancreas(125;1071 1762 21750 40003 40381)	Pancreas(125;1071 1762 21750 40003 40381)	uc002bup.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1216-1218)TCG>TTG		desmuslin isoform A							120.0	125.0	123.0					15																	99669782		1907	4127	6034	SO:0001583	missense	23336				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding	g.chr15:99669782C>T	AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.359C>T	15.37:g.99669782C>T	ENSP00000453040:p.Ser120Leu		Somatic				SYNM_uc002buo.2_Missense_Mutation_p.S406L|SYNM_uc002buq.2_Intron	p.S406L	NM_145728	NP_663780	WXS	Illumina HiSeq	Unspecified	O15061	SYNEM_HUMAN			6	1337	+			406			Tail.		A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000560674.1	37	c.1217C>T		.	.	.	.	.	.	.	.	.	.	C	5.008	0.187248	0.09547	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	D;D	0.84730	-1.89;-1.88	5.42	-7.09	0.01553	.	.	.	.	.	T	0.76278	0.3965	.	.	.	0.09310	N	1	B;B	0.18968	0.026;0.032	B;B	0.12156	0.001;0.007	T	0.58222	-0.7674	8	0.52906	T	0.07	.	13.8053	0.63227	0.0:0.7838:0.1041:0.112	.	406;405	O15061;C9JIE4	SYNEM_HUMAN;.	L	405	ENSP00000336775:S405L;ENSP00000330469:S405L	ENSP00000330469:S405L	S	+	2	0	SYNM	97487305	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.044000	0.12023	-1.750000	0.01328	-0.781000	0.03364	TCG		0.502	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000415698.2	NM_145728		11	249	0	0	0	0.001368	0	11	249				
OR4F15	390649	broad.mit.edu	37	15	102358549	102358549	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr15:102358549C>A	ENST00000332238.4	+	1	184	c.160C>A	c.(160-162)Cat>Aat	p.H54N		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CATGGATGCTCATCTGCACTC	0.403																																							uc010uts.1		NA																	0					0						c.(160-162)CAT>AAT		olfactory receptor, family 4, subfamily F,							282.0	241.0	255.0					15																	102358549		2203	4300	6503	SO:0001583	missense	390649				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:102358549C>A	BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.160C>A	15.37:g.102358549C>A	ENSP00000333184:p.His54Asn		Somatic					p.H54N	NM_001001674	NP_001001674	WXS	Illumina HiSeq	Unspecified	Q8NGB8	O4F15_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)		1	160	+	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		54			Cytoplasmic (Potential).		B2RNQ5|Q6IF57|Q96R70	Missense_Mutation	SNP	ENST00000332238.4	37	c.160C>A	CCDS32342.1	.	.	.	.	.	.	.	.	.	.	.	9.656	1.142956	0.21205	.	.	ENSG00000182854	ENST00000332238	T	0.00792	5.69	5.57	2.51	0.30379	GPCR, rhodopsin-like superfamily (1);	0.309970	0.27976	N	0.017094	T	0.01156	0.0038	M	0.71296	2.17	0.09310	N	1	B	0.10296	0.003	B	0.15484	0.013	T	0.41466	-0.9507	9	.	.	.	.	7.8026	0.29183	0.3412:0.5791:0.0:0.0797	.	54	Q8NGB8	O4F15_HUMAN	N	54	ENSP00000333184:H54N	.	H	+	1	0	OR4F15	100176072	0.000000	0.05858	0.028000	0.17463	0.808000	0.45660	-0.363000	0.07593	0.810000	0.34279	0.650000	0.86243	CAT		0.403	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417594.1	NM_001001674		156	190	1	0	4.04931e-71	0.00361	5.60448e-71	156	190				
WDR90	197335	broad.mit.edu	37	16	712698	712698	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr16:712698G>A	ENST00000293879.4	+	34	4165	c.4165G>A	c.(4165-4167)Gag>Aag	p.E1389K	WDR90_ENST00000549091.1_Missense_Mutation_p.E1391K|WDR90_ENST00000315764.4_5'Flank|WDR90_ENST00000547944.1_5'Flank			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1389										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CATGGAACACGAGCTGGTGCT	0.627																																							uc002cii.1		NA																	0				ovary(1)	1						c.(4165-4167)GAG>AAG		WD repeat domain 90							70.0	74.0	73.0					16																	712698		2136	4248	6384	SO:0001583	missense	197335							g.chr16:712698G>A	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.4165G>A	16.37:g.712698G>A	ENSP00000293879:p.Glu1389Lys		Somatic				WDR90_uc002cij.1_Intron|WDR90_uc002cik.1_Missense_Mutation_p.E916K|WDR90_uc002cil.1_Intron|WDR90_uc002cim.1_Missense_Mutation_p.E565K|WDR90_uc002cin.1_Missense_Mutation_p.E4K|WDR90_uc010uul.1_5'Flank|WDR90_uc002cio.1_5'Flank|WDR90_uc010bqx.1_5'Flank	p.E1389K	NM_145294	NP_660337	WXS	Illumina HiSeq	Unspecified	Q96KV7	WDR90_HUMAN			34	4219	+		Hepatocellular(780;0.0218)	1389					Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	c.4165G>A	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334525	0.60853	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.32515	1.51;1.45	4.9	3.92	0.45320	Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.64402	U	0.000001	T	0.53417	0.1795	M	0.81239	2.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.55528	-0.8127	10	0.13108	T	0.6	.	14.0319	0.64619	0.0:0.1525:0.8475:0.0	.	1391;1389	F8VUX9;Q96KV7	.;WDR90_HUMAN	K	1391;1389	ENSP00000448122:E1391K;ENSP00000293879:E1389K	ENSP00000293879:E1389K	E	+	1	0	WDR90	652699	1.000000	0.71417	0.114000	0.21550	0.013000	0.08279	7.270000	0.78493	1.013000	0.39391	0.491000	0.48974	GAG		0.627	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294		5	45	0	0	0	0.001984	0	5	45				
PTX4	390667	broad.mit.edu	37	16	1536429	1536429	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr16:1536429G>A	ENST00000447419.2	-	3	973	c.948C>T	c.(946-948)taC>taT	p.Y316Y	PTX4_ENST00000293922.1_Silent_p.Y311Y|PTX4_ENST00000440447.2_Missense_Mutation_p.T168M			Q96A99	PTX4_HUMAN	pentraxin 4, long	316	Pentaxin.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CCTCGGTGGCGTAGGACAGGA	0.667																																							uc010uvf.1		NA																	0					0						c.(931-933)TAC>TAT		neuronal pentraxin II-like							52.0	61.0	58.0					16																	1536429		2198	4300	6498	SO:0001819	synonymous_variant	390667					extracellular region	metal ion binding	g.chr16:1536429G>A		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.948C>T	16.37:g.1536429G>A			Somatic					p.Y311Y	NM_001013658	NP_001013680	WXS	Illumina HiSeq	Unspecified	Q96A99	PTX4_HUMAN			3	933	-			316			Pentaxin.			Silent	SNP	ENST00000447419.2	37	c.933C>T																																																																																					0.667	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658		6	51	0	0	0	0.00308	0	6	51				
CACNG3	10368	broad.mit.edu	37	16	24372717	24372717	+	Missense_Mutation	SNP	G	G	T	rs140935639	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr16:24372717G>T	ENST00000005284.3	+	4	1683	c.481G>T	c.(481-483)Gcc>Tcc	p.A161S		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	161					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		ATCAGCCAACGCCGGAGACCC	0.443																																							uc002dmf.2		NA																	0					0						c.(481-483)GCC>TCC		voltage-dependent calcium channel gamma-3							112.0	124.0	120.0					16																	24372717		2197	4300	6497	SO:0001583	missense	10368				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr16:24372717G>T	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.481G>T	16.37:g.24372717G>T	ENSP00000005284:p.Ala161Ser		Somatic					p.A161S	NM_006539	NP_006530	WXS	Illumina HiSeq	Unspecified	O60359	CCG3_HUMAN		GBM - Glioblastoma multiforme(48;0.0809)	4	1681	+			161						Missense_Mutation	SNP	ENST00000005284.3	37	c.481G>T	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	G	6.453	0.451670	0.12223	.	.	ENSG00000006116	ENST00000005284	D	0.89552	-2.53	4.96	4.96	0.65561	.	0.054811	0.64402	D	0.000001	D	0.86293	0.5898	L	0.58669	1.825	0.44834	D	0.997844	P	0.36354	0.549	B	0.37198	0.243	D	0.83927	0.0304	10	0.10636	T	0.68	-10.5168	16.81	0.85717	0.0:0.0:1.0:0.0	.	161	O60359	CCG3_HUMAN	S	161	ENSP00000005284:A161S	ENSP00000005284:A161S	A	+	1	0	CACNG3	24280218	1.000000	0.71417	0.842000	0.33263	0.392000	0.30506	4.886000	0.63149	2.274000	0.75844	0.655000	0.94253	GCC		0.443	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539		8	143	1	0	0.00621372	0.006214	0.00708549	8	143				
SETD1A	9739	broad.mit.edu	37	16	30990966	30990966	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr16:30990966G>C	ENST00000262519.8	+	14	4545	c.3859G>C	c.(3859-3861)Gag>Cag	p.E1287Q		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1287					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						GGACGAGGCCGAGCGCCCTAG	0.726																																							uc002ead.1		NA																	0				ovary(2)|skin(1)	3						c.(3859-3861)GAG>CAG		SET domain containing 1A							17.0	22.0	20.0					16																	30990966		2186	4269	6455	SO:0001583	missense	9739				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding	g.chr16:30990966G>C	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3859G>C	16.37:g.30990966G>C	ENSP00000262519:p.Glu1287Gln		Somatic					p.E1287Q	NM_014712	NP_055527	WXS	Illumina HiSeq	Unspecified	O15047	SET1A_HUMAN			14	4545	+			1287					A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	c.3859G>C	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	G	7.330	0.618649	0.14129	.	.	ENSG00000099381	ENST00000262519	D	0.95238	-3.65	4.96	3.99	0.46301	.	0.181153	0.46442	D	0.000299	D	0.90810	0.7114	L	0.29908	0.895	0.37243	D	0.906194	B	0.31193	0.312	B	0.37422	0.249	D	0.89690	0.3897	10	0.42905	T	0.14	.	11.8339	0.52312	0.0:0.0:0.8242:0.1758	.	1287	O15047	SET1A_HUMAN	Q	1287	ENSP00000262519:E1287Q	ENSP00000262519:E1287Q	E	+	1	0	SETD1A	30898467	1.000000	0.71417	0.156000	0.22583	0.010000	0.07245	8.395000	0.90188	1.056000	0.40484	0.563000	0.77884	GAG		0.726	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712		8	21	0	0	0	0.004482	0	8	21				
SALL1	6299	broad.mit.edu	37	16	51175080	51175080	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr16:51175080C>T	ENST00000251020.4	-	2	1086	c.1053G>A	c.(1051-1053)ccG>ccA	p.P351P	SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Silent_p.P254P|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	351					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P351P(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TTTCAGAGGACGGGGTGGTAA	0.507																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(5)|ovary(3)	8						c.(1051-1053)CCG>CCA		sal-like 1 isoform a							64.0	70.0	68.0					16																	51175080		2198	4300	6498	SO:0001819	synonymous_variant	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51175080C>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1053G>A	16.37:g.51175080C>T			Somatic				SALL1_uc010vgr.1_Silent_p.P254P|SALL1_uc010cbv.2_Intron	p.P351P	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	1084	-		all_cancers(37;0.0322)	351					Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	c.1053G>A	CCDS10747.1																																																																																				0.507	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		4	79	0	0	0	0.000248	0	4	79				
BBS2	583	broad.mit.edu	37	16	56535364	56535364	+	Missense_Mutation	SNP	T	T	C	rs62035990		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr16:56535364T>C	ENST00000245157.5	-	10	1546	c.1126A>G	c.(1126-1128)Ata>Gta	p.I376V	BBS2_ENST00000561951.1_5'Flank|BBS2_ENST00000568104.1_Missense_Mutation_p.I376V	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	376					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						GCTGGGATTATGCCCCGATGC	0.507									Bardet-Biedl syndrome																														uc002ejd.2		NA																	0				ovary(1)	1						c.(1126-1128)ATA>GTA		Bardet-Biedl syndrome 2 protein							202.0	176.0	185.0					16																	56535364		2198	4300	6498	SO:0001583	missense	583	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	adult behavior|brain morphogenesis|cerebral cortex development|cilium morphogenesis|fat cell differentiation|hippocampus development|melanosome transport|negative regulation of multicellular organism growth|photoreceptor cell maintenance|protein localization to organelle|regulation of cilium beat frequency involved in ciliary motility|sperm axoneme assembly|striatum development	BBSome|cilium membrane|microtubule basal body|motile cilium	protein binding	g.chr16:56535364T>C	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.1126A>G	16.37:g.56535364T>C	ENSP00000245157:p.Ile376Val		Somatic				BBS2_uc010ccg.2_3'UTR	p.I376V	NM_031885	NP_114091	WXS	Illumina HiSeq	Unspecified	Q9BXC9	BBS2_HUMAN			10	1360	-			376					Q96CM0|Q96SN9	Missense_Mutation	SNP	ENST00000245157.5	37	c.1126A>G	CCDS32451.1	.	.	.	.	.	.	.	.	.	.	T	1.497	-0.553186	0.03996	.	.	ENSG00000125124	ENST00000245157	D	0.90004	-2.6	5.38	-0.705	0.11252	.	0.242366	0.39544	N	0.001326	T	0.69305	0.3096	N	0.04805	-0.155	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57183	-0.7855	10	0.02654	T	1	-2.4807	9.83	0.40937	0.0:0.5499:0.1298:0.3203	rs62035990	376	Q9BXC9	BBS2_HUMAN	V	376	ENSP00000245157:I376V	ENSP00000245157:I376V	I	-	1	0	BBS2	55092865	0.000000	0.05858	0.060000	0.19600	0.985000	0.73830	-0.131000	0.10482	-0.434000	0.07275	0.528000	0.53228	ATA		0.507	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885		5	145	0	0	0	0.001168	0	5	145				
DPEP2	64174	broad.mit.edu	37	16	68021890	68021890	+	Splice_Site	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr16:68021890T>A	ENST00000572888.1	-	9	1721	c.1071A>T	c.(1069-1071)aaA>aaT	p.K357N	DPEP2_ENST00000412757.2_Splice_Site_p.K357N|DPEP2_ENST00000393847.1_Splice_Site_p.K357N			Q9H4A9	DPEP2_HUMAN	dipeptidase 2	357					arachidonic acid metabolic process (GO:0019369)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		CCTGAGGGAATCTGTGTGGCC	0.562																																							uc010cey.2		NA																	0				skin(1)	1						c.(1069-1071)AAA>AAT		dipeptidase 2 precursor							77.0	73.0	74.0					16																	68021890		2198	4300	6498	SO:0001630	splice_region_variant	64174				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|proteolysis	anchored to membrane|plasma membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity	g.chr16:68021890T>A	AJ295149	CCDS10857.1	16q22.1	2011-07-22			ENSG00000167261	ENSG00000167261	3.4.13.19		23028	protein-coding gene	gene with protein product		609925					Standard	NM_022355		Approved		uc002eve.4	Q9H4A9	OTTHUMG00000137542	ENST00000572888.1:c.1071-1A>T	16.37:g.68021890T>A			Somatic				DPEP2_uc002evd.3_Missense_Mutation_p.R362S|DPEP2_uc002eve.2_Missense_Mutation_p.K357N|DPEP2_uc002evf.2_RNA	p.K357N	NM_022355	NP_071750	WXS	Illumina HiSeq	Unspecified	Q9H4A9	DPEP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)	9	1235	-		Ovarian(137;0.192)	357					B2RCF8|Q6UX92|Q8TC95	Missense_Mutation	SNP	ENST00000572888.1	37	c.1071A>T	CCDS10857.1	.	.	.	.	.	.	.	.	.	.	T	14.74	2.624684	0.46840	.	.	ENSG00000167261	ENST00000393847;ENST00000412757;ENST00000322384	T;T	0.21734	1.99;1.99	5.84	-3.47	0.04753	.	1.041780	0.07593	N	0.922356	T	0.10852	0.0265	N	0.26042	0.785	0.80722	D	1	B	0.12630	0.006	B	0.22152	0.038	T	0.34129	-0.9841	10	0.23302	T	0.38	.	0.5674	0.00689	0.3417:0.2392:0.2148:0.2043	.	357	Q9H4A9	DPEP2_HUMAN	N	357;357;270	ENSP00000377430:K357N;ENSP00000412549:K357N	ENSP00000314702:K270N	K	-	3	2	DPEP2	66579391	0.000000	0.05858	0.882000	0.34594	0.867000	0.49689	-2.670000	0.00844	-0.983000	0.03511	-0.468000	0.05107	AAA		0.562	DPEP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437026.1	NM_022355	Missense_Mutation	4	83	0	0	0	0.000602	0	4	83				
AP1G1	164	broad.mit.edu	37	16	71823312	71823312	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr16:71823312C>T	ENST00000299980.4	-	2	512	c.71G>A	c.(70-72)cGa>cAa	p.R24Q	AP1G1_ENST00000570297.1_5'UTR|AP1G1_ENST00000423132.2_Missense_Mutation_p.R24Q|AP1G1_ENST00000569748.1_Missense_Mutation_p.R24Q|AP1G1_ENST00000393512.3_Missense_Mutation_p.R24Q|AP1G1_ENST00000433195.2_Missense_Mutation_p.R47Q	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	24					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				GATCATTTCTCGTTCTTCAGC	0.468																																							uc010cgg.2		NA																	0				ovary(2)	2						c.(70-72)CGA>CAA		adaptor-related protein complex 1, gamma 1							159.0	129.0	139.0					16																	71823312		2198	4300	6498	SO:0001583	missense	164				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity	g.chr16:71823312C>T	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.71G>A	16.37:g.71823312C>T	ENSP00000299980:p.Arg24Gln		Somatic				AP1G1_uc002fba.2_Missense_Mutation_p.R24Q|AP1G1_uc002fbb.2_Missense_Mutation_p.R47Q|AP1G1_uc010vmg.1_RNA|AP1G1_uc010vmh.1_Missense_Mutation_p.R106Q	p.R24Q	NM_001128	NP_001119	WXS	Illumina HiSeq	Unspecified	O43747	AP1G1_HUMAN			2	385	-		Ovarian(137;0.125)	24					O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	ENST00000299980.4	37	c.71G>A	CCDS32480.1	.	.	.	.	.	.	.	.	.	.	C	37	6.336836	0.97485	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195;ENST00000425422;ENST00000450149	T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78	5.47	5.47	0.80525	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60392	0.2265	M	0.89287	3.02	0.80722	D	1	D;D;D;D	0.89917	1.0;0.99;0.997;1.0	D;P;P;D	0.97110	1.0;0.804;0.885;1.0	T	0.67405	-0.5679	10	0.66056	D	0.02	-4.8471	19.3236	0.94252	0.0:1.0:0.0:0.0	.	106;24;47;24	B4DS96;O43747;B3KXW5;O43747-2	.;AP1G1_HUMAN;.;.	Q	24;24;24;47;106;24	ENSP00000299980:R24Q;ENSP00000377148:R24Q;ENSP00000409153:R24Q;ENSP00000403259:R47Q;ENSP00000405836:R24Q	ENSP00000299980:R24Q	R	-	2	0	AP1G1	70380813	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.484000	0.81180	2.560000	0.86352	0.467000	0.42956	CGA		0.468	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1			6	88	0	0	0	0.004482	0	6	88				
RP11-64J4.2	0	broad.mit.edu	37	17	3214548	3214548	+	RNA	SNP	G	G	T	rs371838570		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:3214548G>T	ENST00000573491.1	-	0	359																											GTGTCTCCAGGCCCACCAGTG	0.572																																							uc002fvi.2		NA																	0				ovary(1)	1						c.(943-945)GGC>GTC		RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;							158.0	133.0	141.0					17																	3214548		2203	4300	6503			390756							g.chr17:3214548G>T																													17.37:g.3214548G>T			Somatic					p.G315V	NR_024128		WXS	Illumina HiSeq	Unspecified					1	1010	+									Missense_Mutation	SNP	ENST00000573491.1	37	c.944G>T																																																																																					0.572	RP11-64J4.2-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000438371.1			14	70	1	0	7.93312e-07	0.00245	9.93591e-07	14	70				
GPS2	2874	broad.mit.edu	37	17	7216947	7216947	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:7216947G>A	ENST00000380728.2	-	7	874	c.574C>T	c.(574-576)Cag>Tag	p.Q192*	GPS2_ENST00000389167.5_Nonsense_Mutation_p.Q192*|RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000391950.3_Nonsense_Mutation_p.Q192*			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	192					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)	p.Q192*(1)		breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				GGTGGGGGCTGAGCAGTCCCA	0.577											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002gfv.1		NA																	1	Substitution - Nonsense(1)		haematopoietic_and_lymphoid_tissue(1)	ovary(2)|pancreas(1)	3						c.(574-576)CAG>TAG		G protein pathway suppressor 2							92.0	90.0	91.0					17																	7216947		2203	4300	6503	SO:0001587	stop_gained	2874				cell cycle|inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter	transcriptional repressor complex	GTPase inhibitor activity|protein binding|transcription corepressor activity	g.chr17:7216947G>A	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.574C>T	17.37:g.7216947G>A	ENSP00000370104:p.Gln192*		Somatic	OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	640	GPS2_uc002gfw.1_Nonsense_Mutation_p.Q154*|GPS2_uc002gfx.1_Nonsense_Mutation_p.Q192*|NEURL4_uc002gfy.1_RNA|GPS2_uc002gfz.1_Nonsense_Mutation_p.Q192*	p.Q192*	NM_004489	NP_004480	WXS	Illumina HiSeq	Unspecified	Q13227	GPS2_HUMAN			6	837	-		Prostate(122;0.157)	192					B4DXA1|Q6FHM8	Nonsense_Mutation	SNP	ENST00000380728.2	37	c.574C>T	CCDS11100.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216085	0.79352	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	.	.	.	4.84	4.84	0.62591	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-0.21	14.9843	0.71336	0.0:0.0:1.0:0.0	.	.	.	.	X	192	.	ENSP00000319371:Q192X	Q	-	1	0	GPS2	7157671	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.299000	0.72770	2.516000	0.84829	0.655000	0.94253	CAG		0.577	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489		10	76	0	0	0	0.000978	0	10	76				
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2	R273H(NCIH1793_LUNG)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PANC1_PANCREAS)|R273H(NCIH508_LARGE_INTESTINE)|R273H(NCIH1975_LUNG)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(NCIH2405_LUNG)|R273H(HEC59_ENDOMETRIUM)|R273H(NCIH1155_LUNG)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(EN_ENDOMETRIUM)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(MDAMB468_BREAST)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW620_LARGE_INTESTINE)|R273H(SUIT2_PANCREAS)|R273H(SW480_LARGE_INTESTINE)|R273H(SKMEL30_SKIN)|R273H(OC314_OVARY)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)	111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	p.R273H(469)|p.R273C(394)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576	c.(817-819)CGT>CAT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							67.0	58.0	61.0					17																	7577120		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577120C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141H|TP53_uc010cng.1_Missense_Mutation_p.R141H|TP53_uc002gii.1_Missense_Mutation_p.R141H|TP53_uc010cnh.1_Missense_Mutation_p.R273H|TP53_uc010cni.1_Missense_Mutation_p.R273H|TP53_uc002gij.2_Missense_Mutation_p.R273H	p.R273H	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1012	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	273		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.818G>A	CCDS11118.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		3	17	0	0	0	0.004672	0	3	17				
SUPT6H	6830	broad.mit.edu	37	17	27016385	27016385	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:27016385A>G	ENST00000314616.6	+	25	3431	c.3148A>G	c.(3148-3150)Att>Gtt	p.I1050V	SUPT6H_ENST00000347486.4_Missense_Mutation_p.I1050V	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1050	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TGACTCATATATTGAAGTCCT	0.473																																							uc002hby.2		NA																	0				ovary(2)|skin(1)	3						c.(3148-3150)ATT>GTT		suppressor of Ty 6 homolog							101.0	90.0	93.0					17																	27016385		2203	4300	6503	SO:0001583	missense	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27016385A>G	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3148A>G	17.37:g.27016385A>G	ENSP00000319104:p.Ile1050Val		Somatic				SUPT6H_uc010crt.2_Missense_Mutation_p.I1050V|SUPT6H_uc002hbz.1_Translation_Start_Site	p.I1050V	NM_003170	NP_003161	WXS	Illumina HiSeq	Unspecified	Q7KZ85	SPT6H_HUMAN			25	3238	+	Lung NSC(42;0.00431)		1050					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	c.3148A>G	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	A	3.700	-0.061820	0.07317	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.61	5.61	0.85477	Tex RuvX-like domain (1);	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	N	0.00841	-1.15	0.80722	D	1	B	0.19817	0.039	B	0.12156	0.007	T	0.36261	-0.9755	9	0.02654	T	1	-9.9817	15.8137	0.78583	1.0:0.0:0.0:0.0	.	1050	Q7KZ85	SPT6H_HUMAN	V	1050	.	ENSP00000319104:I1050V	I	+	1	0	SUPT6H	24040512	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	8.623000	0.90957	2.138000	0.66242	0.533000	0.62120	ATT		0.473	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		4	69	0	0	0	0.000602	0	4	69				
G6PC	2538	broad.mit.edu	37	17	41063209	41063209	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:41063209C>G	ENST00000253801.2	+	5	919	c.840C>G	c.(838-840)taC>taG	p.Y280*	G6PC_ENST00000585489.1_3'UTR|G6PC_ENST00000592383.1_3'UTR	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	280					carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CCAGCATGTACAGGGAGAGCT	0.572																																							uc002icb.1		NA																	0				ovary(1)|breast(1)|kidney(1)|skin(1)	4						c.(838-840)TAC>TAG		glucose-6-phosphatase, catalytic subunit							86.0	79.0	81.0					17																	41063209		2203	4300	6503	SO:0001587	stop_gained	2538	Glycogen_Storage_Disease_type_Ia			gluconeogenesis|glucose homeostasis|transmembrane transport	integral to endoplasmic reticulum membrane	glucose-6-phosphatase activity|phosphate binding	g.chr17:41063209C>G	U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.840C>G	17.37:g.41063209C>G	ENSP00000253801:p.Tyr280*		Somatic				G6PC_uc010whf.1_3'UTR	p.Y280*	NM_000151	NP_000142	WXS	Illumina HiSeq	Unspecified	P35575	G6PC_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.113)	5	919	+		Breast(137;0.000143)	280			Cytoplasmic (Potential).		A1L4C0|B4E1C3|K7EL82	Nonsense_Mutation	SNP	ENST00000253801.2	37	c.840C>G	CCDS11446.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.353102	0.61293	.	.	ENSG00000131482	ENST00000253801	.	.	.	4.94	1.81	0.25067	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.5402	0.45029	0.0:0.7842:0.0:0.2158	.	.	.	.	X	280	.	ENSP00000253801:Y280X	Y	+	3	2	G6PC	38316735	0.979000	0.34478	0.674000	0.29902	0.504000	0.33889	2.251000	0.43187	0.683000	0.31428	-0.277000	0.10078	TAC		0.572	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452451.1	NM_000151		4	39	0	0	0	0.000248	0	4	39				
IGF2BP1	10642	broad.mit.edu	37	17	47117317	47117317	+	Splice_Site	SNP	A	A	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:47117317A>C	ENST00000290341.3	+	7	1017		c.e7-1		IGF2BP1_ENST00000431824.2_Intron	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1						CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TGTGGCCCCCAGGATAGACGT	0.557																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)	Esophageal Squamous(198;1041 2123 8248 37119 38268)	uc002iom.2		NA																	0				kidney(1)	1						c.e7-2		insulin-like growth factor 2 mRNA binding							98.0	95.0	96.0					17																	47117317		2203	4300	6503	SO:0001630	splice_region_variant	10642				CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity	g.chr17:47117317A>C	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.684-1A>C	17.37:g.47117317A>C			Somatic				IGF2BP1_uc010dbj.2_Intron	p.K228_splice	NM_006546	NP_006537	WXS	Illumina HiSeq	Unspecified	Q9NZI8	IF2B1_HUMAN			7	1018	+								C9JT33	Splice_Site	SNP	ENST00000290341.3	37	c.684_splice	CCDS11543.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.649702	0.87958	.	.	ENSG00000159217	ENST00000290341	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8734	0.70478	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IGF2BP1	44472316	1.000000	0.71417	0.996000	0.52242	0.926000	0.56050	9.299000	0.96137	2.146000	0.66826	0.533000	0.62120	.		0.557	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364046.1	NM_006546	Intron	24	55	0	0	0	0.005443	0	24	55				
FAM117A	81558	broad.mit.edu	37	17	47799892	47799892	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:47799892G>A	ENST00000240364.2	-	3	510	c.431C>T	c.(430-432)gCa>gTa	p.A144V	FAM117A_ENST00000514018.1_5'UTR|RP11-613C6.2_ENST00000512720.1_RNA|FAM117A_ENST00000513602.1_5'UTR	NM_030802.3	NP_110429.1	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	144										haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	17						GCCCCAGGATGCTGAGCGCTT	0.572																																							uc002ipk.2		NA																	0				ovary(1)	1						c.(430-432)GCA>GTA		family with sequence similarity 117, member A							131.0	96.0	108.0					17																	47799892		2203	4300	6503	SO:0001583	missense	81558							g.chr17:47799892G>A	BC037572	CCDS11553.1	17q21.33	2006-04-26				ENSG00000121104			24179	protein-coding gene	gene with protein product	"""C/EBP induced protein"""					12477932	Standard	NM_030802		Approved		uc002ipk.3	Q9C073		ENST00000240364.2:c.431C>T	17.37:g.47799892G>A	ENSP00000240364:p.Ala144Val		Somatic				FAM117A_uc010wlz.1_5'UTR	p.A144V	NM_030802	NP_110429	WXS	Illumina HiSeq	Unspecified	Q9C073	F117A_HUMAN			3	500	-			144					B7Z7Q3	Missense_Mutation	SNP	ENST00000240364.2	37	c.431C>T	CCDS11553.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903264	0.52333	.	.	ENSG00000121104	ENST00000240364;ENST00000511743	.	.	.	5.22	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.60650	0.2285	M	0.67397	2.05	0.80722	D	1	B	0.33612	0.419	B	0.34652	0.187	T	0.65253	-0.6213	9	0.72032	D	0.01	-25.1413	11.8586	0.52453	0.0813:0.0:0.9187:0.0	.	144	Q9C073	F117A_HUMAN	V	144;34	.	ENSP00000240364:A144V	A	-	2	0	FAM117A	45154891	1.000000	0.71417	0.056000	0.19401	0.715000	0.41141	7.469000	0.80959	1.446000	0.47643	-0.136000	0.14681	GCA		0.572	FAM117A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365736.1	NM_030802		3	20	0	0	0	0.000248	0	3	20				
TRIM37	4591	broad.mit.edu	37	17	57057436	57057436	+	IGR	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:57057436T>A	ENST00000393066.3	-	0	3622				PPM1E_ENST00000308249.2_Missense_Mutation_p.Y438N	NM_001005207.2	NP_001005207.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TGATGGCTTCTATGACACCGT	0.493									Mulibrey Nanism																														uc002iwx.2		NA																	0				breast(3)|lung(1)|skin(1)	5						c.(1312-1314)TAT>AAT		protein phosphatase 1E							137.0	99.0	112.0					17																	57057436		2203	4300	6503	SO:0001628	intergenic_variant	22843		Familial Cancer Database	Perheentupa syndrome	protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity	g.chr17:57057436T>A	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972			17.37:g.57057436T>A			Somatic				PPM1E_uc010ddd.2_Missense_Mutation_p.Y201N	p.Y438N	NM_014906	NP_055721	WXS	Illumina HiSeq	Unspecified	Q8WY54	PPM1E_HUMAN	BRCA - Breast invasive adenocarcinoma(1;5.76e-11)		7	1439	+	Medulloblastoma(34;0.127)|all_neural(34;0.237)		447			PP2C-like.		Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000393066.3	37	c.1312T>A	CCDS45746.1	.	.	.	.	.	.	.	.	.	.	T	19.75	3.885106	0.72410	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.19105	2.17	5.52	5.52	0.82312	.	0.121015	0.64402	D	0.000010	T	0.34629	0.0904	L	0.29908	0.895	0.80722	D	1	D;D	0.69078	0.997;0.994	P;D	0.69479	0.879;0.964	T	0.12192	-1.0557	10	0.87932	D	0	-4.7069	15.6493	0.77078	0.0:0.0:0.0:1.0	.	447;438	Q8WY54-3;Q8WY54-2	.;.	N	438;289	ENSP00000312411:Y438N	ENSP00000312411:Y438N	Y	+	1	0	PPM1E	54412218	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.040000	0.89188	2.109000	0.64355	0.402000	0.26972	TAT		0.493	TRIM37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445928.1	NM_015294		8	43	0	0	0	0.00308	0	8	43				
CD300LD	100131439	broad.mit.edu	37	17	72588302	72588302	+	Splice_Site	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:72588302C>T	ENST00000375352.1	-	1	120	c.40G>A	c.(40-42)Ggt>Agt	p.G14S	C17orf77_ENST00000392620.1_Silent_p.T39T|C17orf77_ENST00000328023.2_Silent_p.T39T	NM_001115152.1	NP_001108624.1	Q6UXZ3	CLM4_HUMAN	CD300 molecule-like family member d	14					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(1)|lung(2)|prostate(1)|stomach(1)	5						CCACACTCACCTGGGAGGATG	0.552																																							uc002jkz.2		NA																	0					0						c.(40-42)GGT>AGT		CD300 molecule-like family member d precursor							81.0	81.0	81.0					17																	72588302		2203	4300	6503	SO:0001630	splice_region_variant	100131439					integral to membrane|plasma membrane	receptor activity	g.chr17:72588302C>T		CCDS42379.1	17q25.1	2014-05-15			ENSG00000204345	ENSG00000204345		"""Immunoglobulin superfamily / V-set domain containing"""	16848	protein-coding gene	gene with protein product						22291008	Standard	NM_001115152		Approved	CMRF35A4, CD300D	uc002jkz.2	Q6UXZ3	OTTHUMG00000067614	ENST00000375352.1:c.40+1G>A	17.37:g.72588302C>T			Somatic				C17orf77_uc002jla.1_Silent_p.T39T	p.G14S	NM_001115152	NP_001108624	WXS	Illumina HiSeq	Unspecified	Q6UXZ3	CLM4_HUMAN			1	69	-			14						Missense_Mutation	SNP	ENST00000375352.1	37	c.40G>A	CCDS42379.1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.176507	0.38413	.	.	ENSG00000204345	ENST00000375352	T	0.05580	3.42	4.18	4.18	0.49190	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.11196	0.0273	M	0.85099	2.735	0.80722	D	1	B	0.31968	0.349	B	0.25614	0.062	T	0.02588	-1.1137	8	.	.	.	.	12.727	0.57176	0.0:1.0:0.0:0.0	.	14	Q6UXZ3	CLM4_HUMAN	S	14	ENSP00000364501:G14S	.	G	-	1	0	CD300LD	70099897	1.000000	0.71417	0.958000	0.39756	0.023000	0.10783	3.428000	0.52792	2.289000	0.77006	0.609000	0.83330	GGT		0.552	CD300LD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145099.1	NM_001115152	Missense_Mutation	8	58	0	0	0	0.008291	0	8	58				
ZNF521	25925	broad.mit.edu	37	18	22805026	22805026	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr18:22805026G>A	ENST00000361524.3	-	4	3004	c.2856C>T	c.(2854-2856)caC>caT	p.H952H	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Silent_p.H732H|ZNF521_ENST00000538137.2_Silent_p.H952H	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	952					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CAGGGCCTAGGTGGGTCTGCA	0.468			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(2854-2856)CAC>CAT		zinc finger protein 521							115.0	107.0	109.0					18																	22805026		2203	4300	6503	SO:0001819	synonymous_variant	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22805026G>A	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2856C>T	18.37:g.22805026G>A			Somatic				ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.H952H|ZNF521_uc002kvl.2_Silent_p.H732H	p.H952H	NM_015461	NP_056276	WXS	Illumina HiSeq	Unspecified	Q96K83	ZN521_HUMAN			4	3103	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		952			C2H2-type 22.		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	ENST00000361524.3	37	c.2856C>T	CCDS32806.1																																																																																				0.468	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		4	88	0	0	0	0.000248	0	4	88				
CHST9	83539	broad.mit.edu	37	18	24497220	24497220	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr18:24497220C>T	ENST00000284224.8	-	6	612	c.335G>A	c.(334-336)aGt>aAt	p.S112N	AQP4-AS1_ENST00000582605.1_RNA|CHST9_ENST00000580774.1_3'UTR|CHST9_ENST00000581714.1_Missense_Mutation_p.S112N|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000578701.1_RNA|AQP4-AS1_ENST00000568797.1_RNA	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	112					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					TTGTGAATGACTGGTCTTTGT	0.403																																							uc002kwd.2		NA																	0				ovary(2)|skin(1)	3						c.(334-336)AGT>AAT		GalNAc-4-sulfotransferase 2							307.0	276.0	285.0					18																	24497220		1871	4101	5972	SO:0001583	missense	83539				carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity	g.chr18:24497220C>T	AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.335G>A	18.37:g.24497220C>T	ENSP00000284224:p.Ser112Asn		Somatic				C18orf16_uc002kwb.2_Intron|C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_Missense_Mutation_p.S27N|CHST9_uc002kwe.2_Missense_Mutation_p.S112N	p.S112N	NM_031422	NP_113610	WXS	Illumina HiSeq	Unspecified	Q7L1S5	CHST9_HUMAN			5	533	-	all_lung(6;0.0145)|Ovarian(20;0.124)		112			Lumenal (Potential).		Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	ENST00000284224.8	37	c.335G>A	CCDS42422.1	.	.	.	.	.	.	.	.	.	.	C	9.858	1.195524	0.22037	.	.	ENSG00000154080	ENST00000284224	T	0.70749	-0.51	5.36	3.21	0.36854	.	1.877750	0.01854	N	0.036100	T	0.56366	0.1980	N	0.17082	0.46	0.20307	N	0.999918	B	0.02656	0.0	B	0.06405	0.002	T	0.40850	-0.9541	10	0.14656	T	0.56	-5.8155	8.5647	0.33531	0.0:0.7893:0.0:0.2107	.	112	Q7L1S5	CHST9_HUMAN	N	112	ENSP00000284224:S112N	ENSP00000284224:S112N	S	-	2	0	CHST9	22751218	0.000000	0.05858	0.035000	0.18076	0.006000	0.05464	-0.544000	0.06077	0.553000	0.29044	0.655000	0.94253	AGT		0.403	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446549.1	NM_031422		4	228	0	0	0	0.001984	0	4	228				
DSC1	1823	broad.mit.edu	37	18	28710644	28710644	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr18:28710644G>C	ENST00000257198.5	-	16	2779	c.2518C>G	c.(2518-2520)Cat>Gat	p.H840D	RP11-408H20.3_ENST00000582307.1_RNA|RP11-408H20.2_ENST00000581836.1_RNA|DSC1_ENST00000257197.3_3'UTR	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	840					homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			CAATGTTTATGCTCCTCATCT	0.388																																							uc002kwn.2		NA																	0				ovary(3)|skin(1)	4						c.(2518-2520)CAT>GAT		desmocollin 1 isoform Dsc1a preproprotein							120.0	120.0	120.0					18																	28710644		2203	4300	6503	SO:0001583	missense	1823				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding	g.chr18:28710644G>C	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.2518C>G	18.37:g.28710644G>C	ENSP00000257198:p.His840Asp		Somatic				DSC1_uc002kwm.2_3'UTR|uc002kwo.1_5'Flank	p.H840D	NM_024421	NP_077739	WXS	Illumina HiSeq	Unspecified	Q08554	DSC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00778)		16	2780	-			840			Cytoplasmic (Potential).		Q9HB01	Missense_Mutation	SNP	ENST00000257198.5	37	c.2518C>G	CCDS11894.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565920	0.45694	.	.	ENSG00000134765	ENST00000257198	T	0.55588	0.51	6.17	5.3	0.74995	Cadherin, cytoplasmic domain (1);	0.111999	0.39615	N	0.001307	T	0.46946	0.1419	M	0.62723	1.935	0.26556	N	0.97383	P	0.39717	0.684	B	0.35182	0.197	T	0.44772	-0.9306	10	0.26408	T	0.33	.	11.9794	0.53111	0.0651:0.1217:0.8132:0.0	.	840	Q08554	DSC1_HUMAN	D	840	ENSP00000257198:H840D	ENSP00000257198:H840D	H	-	1	0	DSC1	26964642	0.728000	0.28080	0.968000	0.41197	0.994000	0.84299	2.591000	0.46163	1.626000	0.50381	0.655000	0.94253	CAT		0.388	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421		4	81	0	0	0	0.000248	0	4	81				
ASXL3	80816	broad.mit.edu	37	18	31319654	31319655	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr18:31319654_31319655GA>TG	ENST00000269197.5	+	11	2286_2287	c.2286_2287GA>TG	c.(2284-2289)gaGAga>gaTGga	p.762_763ER>DG		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	762	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CCATAAATGAGAGAATGGCACA	0.465																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(2284-2289)GAGAGA>GATGGA		additional sex combs like 3																																				SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31319654_31319655GA>TG	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		Exception_encountered	18.37:g.31319654_31319655delinsTG	ENSP00000269197:p.E762_R763delinsDG		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.469_470ER>DG	p.762_763ER>DG	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			11	2341_2342	+			762_763			Ser-rich.		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	DNP	ENST00000269197.5	37	c.2286_2287GA>TG	CCDS45847.1																																																																																				0.465	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			5	62	0	0	0	0.004672	0	5	62				
CNDP1	84735	broad.mit.edu	37	18	72247453	72247453	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr18:72247453A>T	ENST00000358821.3	+	10	1483	c.1255A>T	c.(1255-1257)Att>Ttt	p.I419F	CNDP1_ENST00000582365.1_Missense_Mutation_p.I376F	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	419						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		ACACCCGTGGATTGCAAATAT	0.448																																					Melanoma(32;1029 1042 25286 38395 44237)	Melanoma(32;1029 1042 25286 38395 44237)	uc002llq.2		NA																	0					0						c.(1255-1257)ATT>TTT		carnosinase 1 precursor							122.0	113.0	116.0					18																	72247453		2203	4300	6503	SO:0001583	missense	84735				proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity	g.chr18:72247453A>T		CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.1255A>T	18.37:g.72247453A>T	ENSP00000351682:p.Ile419Phe		Somatic				CNDP1_uc002lls.2_Missense_Mutation_p.I222F	p.I419F	NM_032649	NP_116038	WXS	Illumina HiSeq	Unspecified	Q96KN2	CNDP1_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.109)	10	1466	+		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)	419					Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Missense_Mutation	SNP	ENST00000358821.3	37	c.1255A>T	CCDS12007.1	.	.	.	.	.	.	.	.	.	.	A	8.815	0.936069	0.18206	.	.	ENSG00000150656	ENST00000358821	T	0.07567	3.18	5.04	-5.98	0.02220	.	0.580848	0.18377	N	0.143062	T	0.06554	0.0168	L	0.43923	1.385	0.22253	N	0.999254	B	0.28470	0.213	B	0.30105	0.111	T	0.17228	-1.0376	10	0.87932	D	0	-2.6377	9.0861	0.36581	0.2759:0.2305:0.4936:0.0	.	419	Q96KN2	CNDP1_HUMAN	F	419	ENSP00000351682:I419F	ENSP00000351682:I419F	I	+	1	0	CNDP1	70398433	0.060000	0.20803	0.007000	0.13788	0.009000	0.06853	-1.112000	0.03299	-1.102000	0.03023	0.460000	0.39030	ATT		0.448	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256326.1	NM_032649		4	43	0	0	0	0.000248	0	4	43				
GALR1	2587	broad.mit.edu	37	18	74968163	74968163	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr18:74968163A>C	ENST00000299727.3	+	2	716	c.716A>C	c.(715-717)gAa>gCa	p.E239A	GALR1_ENST00000582943.1_3'UTR	NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	239					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		AAGAAGTCTGAAGCATCCAAG	0.353																																							uc002lms.3		NA																	0				lung(1)	1						c.(715-717)GAA>GCA		galanin receptor 1							110.0	109.0	109.0					18																	74968163		2203	4300	6503	SO:0001583	missense	2587				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity	g.chr18:74968163A>C	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.716A>C	18.37:g.74968163A>C	ENSP00000299727:p.Glu239Ala		Somatic					p.E239A	NM_001480	NP_001471	WXS	Illumina HiSeq	Unspecified	P47211	GALR1_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)	2	1213	+		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)	239			Cytoplasmic (Potential).		Q4VBL7	Missense_Mutation	SNP	ENST00000299727.3	37	c.716A>C	CCDS12012.1	.	.	.	.	.	.	.	.	.	.	A	15.82	2.946889	0.53186	.	.	ENSG00000166573	ENST00000299727	T	0.36340	1.26	4.61	4.61	0.57282	GPCR, rhodopsin-like superfamily (1);	0.158570	0.56097	D	0.000038	T	0.25382	0.0617	N	0.20845	0.615	0.80722	D	1	P	0.36712	0.566	B	0.37731	0.257	T	0.07443	-1.0772	10	0.42905	T	0.14	.	11.6912	0.51516	1.0:0.0:0.0:0.0	.	239	P47211	GALR1_HUMAN	A	239	ENSP00000299727:E239A	ENSP00000299727:E239A	E	+	2	0	GALR1	73097151	1.000000	0.71417	0.982000	0.44146	0.970000	0.65996	8.531000	0.90610	1.852000	0.53769	0.460000	0.39030	GAA		0.353	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256362.1			8	70	0	0	0	0.006214	0	8	70				
ZNF57	126295	broad.mit.edu	37	19	2917901	2917901	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr19:2917901A>G	ENST00000306908.5	+	4	1430	c.1282A>G	c.(1282-1284)Acc>Gcc	p.T428A	AC006277.2_ENST00000520090.2_RNA|ZNF57_ENST00000523428.1_Missense_Mutation_p.T396A	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGTGGAAAAACCTTCACTTG	0.453																																					NSCLC(150;910 1964 4303 10464 26498)	NSCLC(150;910 1964 4303 10464 26498)	uc002lwr.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1282-1284)ACC>GCC		zinc finger protein 57							110.0	99.0	102.0					19																	2917901		2203	4300	6503	SO:0001583	missense	126295				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:2917901A>G	M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.1282A>G	19.37:g.2917901A>G	ENSP00000303696:p.Thr428Ala		Somatic				ZNF57_uc010xha.1_Missense_Mutation_p.T396A	p.T428A	NM_173480	NP_775751	WXS	Illumina HiSeq	Unspecified	Q68EA5	ZNF57_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)	4	1430	+			428			C2H2-type 10.		Q8N6R9	Missense_Mutation	SNP	ENST00000306908.5	37	c.1282A>G	CCDS12098.1	.	.	.	.	.	.	.	.	.	.	A	0.052	-1.247420	0.01481	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000523428	T;T	0.03745	3.82;3.82	2.02	-4.04	0.04010	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01029	0.0034	N	0.02391	-0.57	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.41998	-0.9477	9	0.02654	T	1	.	0.8254	0.01119	0.2672:0.3335:0.2313:0.168	.	428	Q68EA5	ZNF57_HUMAN	A	428;430;396	ENSP00000303696:T428A;ENSP00000430223:T396A	ENSP00000303696:T428A	T	+	1	0	ZNF57	2868901	0.000000	0.05858	0.004000	0.12327	0.015000	0.08874	-2.121000	0.01322	-1.413000	0.02027	-1.389000	0.01157	ACC		0.453	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1	NM_173480		3	87	0	0	0	0.004672	0	3	87				
CLEC4M	10332	broad.mit.edu	37	19	7830571	7830571	+	Missense_Mutation	SNP	G	G	A	rs142098305	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr19:7830571G>A	ENST00000327325.5	+	4	380	c.262G>A	c.(262-264)Gca>Aca	p.A88T	CLEC4M_ENST00000597522.1_Missense_Mutation_p.A88T|CLEC4M_ENST00000248228.4_Missense_Mutation_p.A88T|CLEC4M_ENST00000595496.1_Missense_Mutation_p.A67T|CLEC4M_ENST00000394122.2_Missense_Mutation_p.A76T|CLEC4M_ENST00000359059.5_Missense_Mutation_p.A67T|CLEC4M_ENST00000596707.1_Missense_Mutation_p.A67T|CLEC4M_ENST00000596363.1_Missense_Mutation_p.A60T|CLEC4M_ENST00000334806.5_Missense_Mutation_p.A60T|CLEC4M_ENST00000357361.2_Missense_Mutation_p.A88T	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	88					antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						CGAGCAAGACGCAATCTACCA	0.517													G|||	7	0.00139776	0.0053	0.0	5008	,	,		20283	0.0		0.0	False		,,,				2504	0.0						uc002mih.2		NA																	0				pancreas(1)	1						c.(262-264)GCA>ACA		C-type lectin domain family 4, member M isoform		A	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	5,4401	825.7+/-416.5	0,5,2198	145.0	144.0	144.0		178,259,199,199,262,262,262,178,262	-2.5	0.0	19	dbSNP_134	144	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense,missense,missense	CLEC4M	NM_001144904.1,NM_001144905.1,NM_001144906.1,NM_001144907.1,NM_001144908.1,NM_001144909.1,NM_001144910.1,NM_001144911.1,NM_014257.4	58,58,58,58,58,58,58,58,58	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	benign,benign,benign,benign,benign,benign,benign,benign,benign	60/349,87/376,67/264,67/333,88/233,88/354,88/377,60/297,88/400	7830571	5,13001	2203	4300	6503	SO:0001583	missense	10332				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding	g.chr19:7830571G>A	AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.262G>A	19.37:g.7830571G>A	ENSP00000316228:p.Ala88Thr		Somatic				CLEC4M_uc010xjv.1_Missense_Mutation_p.A60T|CLEC4M_uc002mhy.2_Missense_Mutation_p.A32T|CLEC4M_uc010xjw.1_Missense_Mutation_p.A67T|CLEC4M_uc010dvt.2_Missense_Mutation_p.A88T|CLEC4M_uc010dvs.2_Missense_Mutation_p.A87T|CLEC4M_uc010xjx.1_Missense_Mutation_p.A60T|CLEC4M_uc002mhz.2_Missense_Mutation_p.A88T|CLEC4M_uc002mic.2_Missense_Mutation_p.A60T|CLEC4M_uc002mia.2_Missense_Mutation_p.A67T	p.A88T	NM_001144910	NP_001138382	WXS	Illumina HiSeq	Unspecified	Q9H2X3	CLC4M_HUMAN			4	380	+			88			Extracellular (Probable).		A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Missense_Mutation	SNP	ENST00000327325.5	37	c.262G>A	CCDS12187.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	a	0.429	-0.904244	0.02453	0.001135	0.0	ENSG00000104938	ENST00000327325;ENST00000394122;ENST00000248228;ENST00000334806;ENST00000359059;ENST00000357361;ENST00000358690	T;T;T;T;T;T	0.22945	1.93;4.13;4.17;4.18;1.93;1.93	1.24	-2.48	0.06423	.	.	.	.	.	T	0.09862	0.0242	N	0.25647	0.755	0.09310	N	1	B;B;B;B;B;B;B;B;B;B	0.15141	0.003;0.002;0.001;0.003;0.006;0.001;0.012;0.01;0.007;0.001	B;B;B;B;B;B;B;B;B;B	0.10450	0.001;0.002;0.005;0.003;0.003;0.001;0.005;0.005;0.003;0.002	T	0.28681	-1.0036	9	0.26408	T	0.33	.	5.3769	0.16170	0.6551:0.0:0.3449:0.0	.	60;67;60;88;76;88;60;67;88;32	B4E2Z5;Q9H2X3-5;B4DNV9;Q9H2X3;E7ENS9;Q9H2X3-8;Q9H2X3-9;Q9H2X3-7;Q9H2X3-4;Q9H2X3-10	.;.;.;CLC4M_HUMAN;.;.;.;.;.;.	T	88;76;88;60;67;88;32	ENSP00000316228:A88T;ENSP00000377680:A76T;ENSP00000248228:A88T;ENSP00000335228:A60T;ENSP00000351954:A67T;ENSP00000349924:A88T	ENSP00000248228:A88T	A	+	1	0	CLEC4M	7736571	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.855000	0.04125	-2.183000	0.00315	GCA		0.517	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461161.1	NM_014257		4	104	0	0	0	0.000602	0	4	104				
CYP4F12	66002	broad.mit.edu	37	19	15789145	15789145	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr19:15789145G>A	ENST00000550308.1	+	3	653	c.273G>A	c.(271-273)tgG>tgA	p.W91*	CYP4F12_ENST00000324632.10_Nonsense_Mutation_p.W91*	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	91					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	TTACGATATGGCTGGGTCCCA	0.542																																							uc002nbl.2		NA																	0				skin(3)|ovary(2)|central_nervous_system(2)	7						c.(271-273)TGG>TGA		cytochrome P450, family 4, subfamily F,							141.0	140.0	141.0					19																	15789145		2187	4294	6481	SO:0001587	stop_gained	66002							g.chr19:15789145G>A	AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.273G>A	19.37:g.15789145G>A	ENSP00000448998:p.Trp91*		Somatic				CYP4F12_uc010xoo.1_Nonsense_Mutation_p.W91*|CYP4F12_uc010xop.1_Nonsense_Mutation_p.W91*	p.W91*	NM_023944	NP_076433	WXS	Illumina HiSeq	Unspecified					3	334	+	Acute lymphoblastic leukemia(2;0.0367)							E7ET51|O60389|Q5JPJ7|Q9HCS1	Nonsense_Mutation	SNP	ENST00000550308.1	37	c.273G>A	CCDS42517.1	.	.	.	.	.	.	.	.	.	.	.	21.4	4.145952	0.77888	.	.	ENSG00000186204	ENST00000550308;ENST00000551607;ENST00000324632	.	.	.	2.92	1.73	0.24493	.	0.180662	0.38005	U	0.001845	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4187	0.21732	0.0:0.0:0.7087:0.2912	.	.	.	.	X	91;44;91	.	ENSP00000321821:W91X	W	+	3	0	CYP4F12	15650145	0.985000	0.35326	0.037000	0.18230	0.005000	0.04900	2.389000	0.44407	1.625000	0.50366	0.491000	0.48974	TGG		0.542	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378938.9			7	137	0	0	0	0.008291	0	7	137				
ZNF536	9745	broad.mit.edu	37	19	31040325	31040325	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr19:31040325G>A	ENST00000355537.3	+	4	3946	c.3799G>A	c.(3799-3801)Gtc>Atc	p.V1267I		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1267					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CATGCTGTCGGTCCTCAGGGC	0.582																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(3799-3801)GTC>ATC		zinc finger protein 536							34.0	33.0	34.0					19																	31040325		2194	4277	6471	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31040325G>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3799G>A	19.37:g.31040325G>A	ENSP00000347730:p.Val1267Ile		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.V1267I	p.V1267I	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	3937	+	Esophageal squamous(110;0.0834)		1267					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.3799G>A	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.756643	0.69648	.	.	ENSG00000198597	ENST00000355537	T	0.13778	2.56	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.28863	0.0716	L	0.34521	1.04	0.53688	D	0.999971	D;D	0.64830	0.994;0.994	D;D	0.72625	0.978;0.978	T	0.03852	-1.0998	10	0.87932	D	0	-37.2602	18.3218	0.90241	0.0:0.0:1.0:0.0	.	1267;1267	A7E228;O15090	.;ZN536_HUMAN	I	1267	ENSP00000347730:V1267I	ENSP00000347730:V1267I	V	+	1	0	ZNF536	35732165	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.272000	0.95707	2.292000	0.77174	0.650000	0.86243	GTC		0.582	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		3	22	0	0	0	0.004672	0	3	22				
HPN	3249	broad.mit.edu	37	19	35556931	35556931	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr19:35556931A>G	ENST00000262626.2	+	12	2035	c.1210A>G	c.(1210-1212)Ata>Gta	p.I404V	HPN_ENST00000392226.1_Missense_Mutation_p.I404V|HPN_ENST00000597419.1_Missense_Mutation_p.I246V|HPN-AS1_ENST00000392227.2_RNA	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	404	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	CTTCCAGGCCATAAAGGTGAA	0.562																																							uc002nxq.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1210-1212)ATA>GTA		hepsin	Coagulation factor VIIa(DB00036)						89.0	98.0	95.0					19																	35556931		2203	4300	6503	SO:0001583	missense	3249				cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr19:35556931A>G		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.1210A>G	19.37:g.35556931A>G	ENSP00000262626:p.Ile404Val		Somatic				HPN_uc002nxr.1_Missense_Mutation_p.I404V|HPN_uc002nxs.1_Missense_Mutation_p.I246V|HPN_uc010xsh.1_Missense_Mutation_p.I373V|HPN_uc002nxt.1_Missense_Mutation_p.I288V|LOC100128675_uc010xsi.1_Intron	p.I404V	NM_002151	NP_002142	WXS	Illumina HiSeq	Unspecified	P05981	HEPS_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0849)		13	1455	+	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		404			Extracellular (Potential).|Peptidase S1.		B2RDS4	Missense_Mutation	SNP	ENST00000262626.2	37	c.1210A>G	CCDS32993.1	.	.	.	.	.	.	.	.	.	.	A	12.64	1.997617	0.35226	.	.	ENSG00000105707	ENST00000262626;ENST00000392226;ENST00000541345	D;D	0.89810	-2.57;-2.57	4.86	4.86	0.63082	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.086607	0.85682	D	0.000000	T	0.79770	0.4503	N	0.13003	0.285	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.75551	-0.3278	10	0.44086	T	0.13	.	12.4419	0.55629	1.0:0.0:0.0:0.0	.	376;404	B7Z1L4;P05981	.;HEPS_HUMAN	V	404;404;376	ENSP00000262626:I404V;ENSP00000376060:I404V	ENSP00000262626:I404V	I	+	1	0	HPN	40248771	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	4.388000	0.59633	2.048000	0.60808	0.374000	0.22700	ATA		0.562	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151		9	115	0	0	0	0.006214	0	9	115				
ARHGAP35	2909	broad.mit.edu	37	19	47422272	47422272	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr19:47422272C>T	ENST00000404338.3	+	1	340	c.340C>T	c.(340-342)Cag>Tag	p.Q114*		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	114					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										CACGGCCCTGCAGCCCTATAT	0.498																																							uc010ekv.2		NA																	0				central_nervous_system(1)	1						c.(340-342)CAG>TAG		glucocorticoid receptor DNA binding factor 1							83.0	82.0	82.0					19																	47422272		1939	4143	6082	SO:0001587	stop_gained	2909				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity	g.chr19:47422272C>T	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.340C>T	19.37:g.47422272C>T	ENSP00000385720:p.Gln114*		Somatic					p.Q114*	NM_004491	NP_004482	WXS	Illumina HiSeq	Unspecified	Q9NRY4	RHG35_HUMAN		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)	1	340	+		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)	114					A7E2A4|Q14452|Q9C0E1	Nonsense_Mutation	SNP	ENST00000404338.3	37	c.340C>T	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	C	35	5.561793	0.96527	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-33.307	19.1078	0.93303	0.0:1.0:0.0:0.0	.	.	.	.	X	114	.	ENSP00000324820:Q114X	Q	+	1	0	ARHGAP35	52114112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.814000	0.96858	0.563000	0.77884	CAG		0.498	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		14	99	0	0	0	0.001855	0	14	99				
CEACAM18	729767	broad.mit.edu	37	19	51983917	51983917	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr19:51983917G>T	ENST00000396477.4	+	2	404	c.383G>T	c.(382-384)gGc>gTc	p.G128V	CEACAM18_ENST00000451626.1_Missense_Mutation_p.G189V	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	128										breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		AGAGCAACCGGCTGGCTGGAG	0.512																																							uc002pwv.1		NA																	0				skin(1)	1						c.(565-567)GGC>GTC		carcinoembryonic antigen-related cell adhesion							67.0	67.0	67.0					19																	51983917		1958	4138	6096	SO:0001583	missense	729767					integral to membrane		g.chr19:51983917G>T			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.383G>T	19.37:g.51983917G>T	ENSP00000379738:p.Gly128Val		Somatic					p.G189V	NM_001080405	NP_001073874	WXS	Illumina HiSeq	Unspecified	A8MTB9	CEA18_HUMAN		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)	3	566	+		all_neural(266;0.0529)	189					C9JN24	Missense_Mutation	SNP	ENST00000396477.4	37	c.566G>T		.	.	.	.	.	.	.	.	.	.	.	10.46	1.357679	0.24598	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.01279	5.06	2.82	1.67	0.24075	Immunoglobulin-like fold (1);	.	.	.	.	T	0.02119	0.0066	M	0.67517	2.055	0.43703	D	0.996161	B	0.20052	0.041	B	0.31290	0.127	T	0.39722	-0.9600	9	0.11182	T	0.66	-16.8061	7.5815	0.27967	0.0:0.3756:0.6244:0.0	.	189	A8MTB9	CEA18_HUMAN	V	189;128;128	ENSP00000402203:G189V	ENSP00000379738:G128V	G	+	2	0	CEACAM18	56675729	0.100000	0.21855	0.711000	0.30485	0.074000	0.17049	0.445000	0.21677	0.677000	0.31305	0.650000	0.86243	GGC		0.512	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000323114.2			5	68	1	0	5.18039e-06	0.00308	6.40424e-06	5	68				
ZNF154	7710	broad.mit.edu	37	19	58214004	58214004	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr19:58214004G>A	ENST00000512439.2	-	3	509	c.313C>T	c.(313-315)Ctc>Ttc	p.L105F	AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000596085.1_Intron|ZNF154_ENST00000426889.1_Missense_Mutation_p.L105F			Q13106	ZN154_HUMAN	zinc finger protein 154	105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(7)|lung(3)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGTTGATGGAGAAATCCCAAC	0.517																																							uc010euf.2		NA																	0					0						c.(313-315)CTC>TTC		zinc finger protein 154							93.0	91.0	92.0					19																	58214004		1935	4141	6076	SO:0001583	missense	7710					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58214004G>A	U20648	CCDS42639.1	19q13.4	2013-01-08	2006-08-22		ENSG00000179909	ENSG00000179909		"""Zinc fingers, C2H2-type"", ""-"""	12939	protein-coding gene	gene with protein product		604085	"""zinc finger protein 154 (pHZ-92)"""			7557990	Standard	XR_243957		Approved	pHZ-92	uc010euf.3	Q13106	OTTHUMG00000140375	ENST00000512439.2:c.313C>T	19.37:g.58214004G>A	ENSP00000421258:p.Leu105Phe		Somatic				ZNF776_uc002qpx.2_Intron|ZNF154_uc002qpy.2_RNA	p.L105F	NM_001085384	NP_001078853	WXS	Illumina HiSeq	Unspecified	Q13106	ZN154_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	3	553	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	105			C2H2-type 1; degenerate.		A7MCY3|Q8IVG7|Q8NAR0	Missense_Mutation	SNP	ENST00000512439.2	37	c.313C>T	CCDS42639.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.847478	0.51164	.	.	ENSG00000179909	ENST00000512439;ENST00000426889	T;T	0.08370	3.1;3.1	2.94	-0.607	0.11615	.	.	.	.	.	T	0.07458	0.0188	L	0.60012	1.86	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.41484	-0.9506	9	0.48119	T	0.1	.	0.5527	0.00665	0.2496:0.2161:0.3463:0.188	.	105	Q13106	ZN154_HUMAN	F	105	ENSP00000421258:L105F;ENSP00000442370:L105F	ENSP00000442370:L105F	L	-	1	0	ZNF154	62905816	0.000000	0.05858	0.003000	0.11579	0.918000	0.54935	-1.836000	0.01690	-0.007000	0.14345	-0.321000	0.08615	CTC		0.517	ZNF154-002	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277102.2			5	59	0	0	0	0.000602	0	5	59				
APOB	338	broad.mit.edu	37	2	21245798	21245798	+	Silent	SNP	G	G	A	rs72653068		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:21245798G>A	ENST00000233242.1	-	18	2848	c.2721C>T	c.(2719-2721)caC>caT	p.H907H		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	907	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACCCGACTCGTGGAAGAAGT	0.507																																							uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(2719-2721)CAC>CAT		apolipoprotein B precursor	Atorvastatin(DB01076)						89.0	83.0	85.0					2																	21245798		2203	4300	6503	SO:0001819	synonymous_variant	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21245798G>A	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2721C>T	2.37:g.21245798G>A			Somatic					p.H907H	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			18	2849	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		907			Heparin-binding.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	c.2721C>T	CCDS1703.1																																																																																				0.507	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			9	68	0	0	0	0.008291	0	9	68				
CGREF1	10669	broad.mit.edu	37	2	27324340	27324340	+	Intron	SNP	G	G	A	rs11893427	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:27324340G>A	ENST00000260595.5	-	6	1028				CGREF1_ENST00000405600.1_Silent_p.P253P|CGREF1_ENST00000404694.3_Silent_p.P375P|CGREF1_ENST00000312734.4_Silent_p.P253P|CGREF1_ENST00000402394.1_Silent_p.P253P|CGREF1_ENST00000402550.1_Intron|CGREF1_ENST00000452318.2_Intron			Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1						cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			kidney(1)|lung(4)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCTGGGCCCGGGGGCATCTC	0.706																																							uc010eys.1		NA																	0				ovary(1)	1						c.(757-759)CCC>CCT		cell growth regulator with EF-hand domain 1							39.0	47.0	44.0					2																	27324340		1674	3351	5025	SO:0001627	intron_variant	10669				cell adhesion|cell cycle arrest|negative regulation of cell proliferation|response to stress	extracellular region	calcium ion binding	g.chr2:27324340G>A	BC034764	CCDS33162.1, CCDS33162.2, CCDS54339.1	2p23.3	2013-01-10			ENSG00000138028	ENSG00000138028		"""EF-hand domain containing"""	16962	protein-coding gene	gene with protein product		606137				8968090	Standard	NM_006569		Approved	CGR11	uc002riq.3	Q99674	OTTHUMG00000152009	ENST00000260595.5:c.735+23C>T	2.37:g.27324340G>A			Somatic				CGREF1_uc010ylf.1_Intron|CGREF1_uc002rip.1_Intron|CGREF1_uc002riq.2_Silent_p.P253P|CGREF1_uc010eyr.1_Silent_p.P375P|CGREF1_uc002rir.1_Silent_p.P253P|CGREF1_uc002ris.2_Missense_Mutation_p.P237L	p.P253P	NM_006569	NP_006560	WXS	Illumina HiSeq	Unspecified	Q99674	CGRE1_HUMAN			6	901	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		253					A6NHV7|B4DXY8|B5MCB7|B5MCC9|B5MCP5|E7EU99|Q8N4B7	Silent	SNP	ENST00000260595.5	37	c.759C>T																																																																																					0.706	CGREF1-201	KNOWN	basic	protein_coding	protein_coding		NM_006569		3	78	0	0	0	0.000602	0	3	78				
SLC8A1	6546	broad.mit.edu	37	2	40657346	40657346	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:40657346G>A	ENST00000403092.1	-	2	108	c.75C>T	c.(73-75)ctC>ctT	p.L25L	SLC8A1_ENST00000542756.1_Silent_p.L25L|SLC8A1_ENST00000406391.2_Silent_p.L25L|SLC8A1_ENST00000332839.4_Silent_p.L25L|SLC8A1_ENST00000402441.1_Silent_p.L25L|SLC8A1_ENST00000406785.2_Silent_p.L25L|SLC8A1_ENST00000408028.2_Silent_p.L25L|SLC8A1_ENST00000542024.1_Silent_p.L25L|SLC8A1_ENST00000405269.1_Silent_p.L25L|SLC8A1_ENST00000405901.3_Silent_p.L25L			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	25					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GGGAAAATAAGAGACTCACAG	0.408																																							uc002rrx.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(73-75)CTC>CTT		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						103.0	101.0	101.0					2																	40657346		2203	4300	6503	SO:0001819	synonymous_variant	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40657346G>A		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.75C>T	2.37:g.40657346G>A			Somatic				SLC8A1_uc002rry.2_Silent_p.L25L|SLC8A1_uc002rrz.2_Silent_p.L25L|SLC8A1_uc002rsa.2_Silent_p.L25L|SLC8A1_uc002rsd.3_Silent_p.L25L|SLC8A1_uc002rsb.1_Silent_p.L25L|SLC8A1_uc010fan.1_Silent_p.L25L|SLC8A1_uc002rsc.1_Silent_p.L25L	p.L25L	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			1	99	-			25					A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	ENST00000403092.1	37	c.75C>T	CCDS1806.1																																																																																				0.408	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		8	102	0	0	0	0.004482	0	8	102				
PLEK	5341	broad.mit.edu	37	2	68608012	68608012	+	Missense_Mutation	SNP	G	G	C	rs144599110		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:68608012G>C	ENST00000234313.7	+	3	535	c.356G>C	c.(355-357)cGa>cCa	p.R119P		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	119					actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		AGGTCCATTCGACTGCCAGAA	0.458																																							uc002sen.3		NA																	0				ovary(1)	1						c.(355-357)CGA>CCA		pleckstrin							138.0	130.0	133.0					2																	68608012		2203	4300	6503	SO:0001583	missense	5341				actin cytoskeleton reorganization|cortical actin cytoskeleton organization|hemopoietic progenitor cell differentiation|inhibition of phospholipase C activity involved in G-protein coupled receptor signaling pathway|integrin-mediated signaling pathway|negative regulation of calcium-mediated signaling|negative regulation of inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|platelet aggregation|positive regulation of actin filament bundle assembly|positive regulation of actin filament depolymerization|positive regulation of inositol-polyphosphate 5-phosphatase activity|positive regulation of integrin activation|positive regulation of platelet activation|protein kinase C signaling cascade|protein secretion by platelet|regulation of cell diameter|ruffle organization|thrombin receptor signaling pathway|vesicle docking involved in exocytosis	cytosol|extracellular region|membrane fraction|ruffle membrane|soluble fraction	phosphatidylinositol-3,4-bisphosphate binding|protein homodimerization activity|protein kinase C binding	g.chr2:68608012G>C	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.356G>C	2.37:g.68608012G>C	ENSP00000234313:p.Arg119Pro		Somatic				PLEK_uc010fde.2_Missense_Mutation_p.R119P	p.R119P	NM_002664	NP_002655	WXS	Illumina HiSeq	Unspecified	P08567	PLEK_HUMAN		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)	3	518	+		Ovarian(717;0.0129)	119					B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	c.356G>C	CCDS1887.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713685	0.89112	.	.	ENSG00000115956	ENST00000234313	T	0.22134	1.97	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.39279	0.1072	L	0.59436	1.845	0.80722	D	1	D;D	0.57257	0.979;0.979	P;P	0.60886	0.88;0.88	T	0.03630	-1.1018	10	0.52906	T	0.07	.	14.2444	0.65978	0.071:0.0:0.929:0.0	.	137;119	Q59GZ2;P08567	.;PLEK_HUMAN	P	119	ENSP00000234313:R119P	ENSP00000234313:R119P	R	+	2	0	PLEK	68461516	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.462000	0.66707	2.750000	0.94351	0.655000	0.94253	CGA		0.458	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664		7	214	0	0	0	0.006214	0	7	214				
DYSF	8291	broad.mit.edu	37	2	71795372	71795372	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:71795372C>T	ENST00000258104.3	+	26	2991	c.2714C>T	c.(2713-2715)tCt>tTt	p.S905F	DYSF_ENST00000409366.1_Missense_Mutation_p.S906F|DYSF_ENST00000413539.2_Missense_Mutation_p.S936F|DYSF_ENST00000410020.3_Missense_Mutation_p.S923F|DYSF_ENST00000429174.2_Missense_Mutation_p.S905F|DYSF_ENST00000409744.1_Missense_Mutation_p.S892F|DYSF_ENST00000409582.3_Missense_Mutation_p.S922F|DYSF_ENST00000409762.1_Missense_Mutation_p.S922F|DYSF_ENST00000410041.1_Missense_Mutation_p.S923F|DYSF_ENST00000394120.2_Missense_Mutation_p.S906F|DYSF_ENST00000409651.1_Missense_Mutation_p.S937F	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	905					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CCCAAGTTTTCTGACGTCACG	0.592																																							uc002sie.2		NA																	0				ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(2713-2715)TCT>TTT		dysferlin isoform 8							186.0	191.0	189.0					2																	71795372		2203	4300	6503	SO:0001583	missense	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71795372C>T	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2714C>T	2.37:g.71795372C>T	ENSP00000258104:p.Ser905Phe		Somatic				DYSF_uc010feg.2_Missense_Mutation_p.S936F|DYSF_uc010feh.2_Missense_Mutation_p.S891F|DYSF_uc002sig.3_Missense_Mutation_p.S891F|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.S905F|DYSF_uc010fef.2_Missense_Mutation_p.S922F|DYSF_uc010fei.2_Missense_Mutation_p.S922F|DYSF_uc010fek.2_Missense_Mutation_p.S923F|DYSF_uc010fej.2_Missense_Mutation_p.S892F|DYSF_uc010fel.2_Missense_Mutation_p.S892F|DYSF_uc010feo.2_Missense_Mutation_p.S937F|DYSF_uc010fem.2_Missense_Mutation_p.S906F|DYSF_uc010fen.2_Missense_Mutation_p.S923F|DYSF_uc002sif.2_Missense_Mutation_p.S906F	p.S905F	NM_003494	NP_003485	WXS	Illumina HiSeq	Unspecified	O75923	DYSF_HUMAN			26	3090	+			905			Cytoplasmic (Potential).		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	c.2714C>T	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532772	0.64972	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.85013	-1.91;-1.92;-1.92;-1.92;-1.92;-1.91;-1.92;-1.93;-1.92;-1.92;-1.92	4.94	4.94	0.65067	Ferlin/Peroxisome membrane (1);	0.127530	0.53938	D	0.000052	D	0.93064	0.7792	M	0.86343	2.81	0.50171	D	0.999858	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.998;0.998;1.0;1.0;1.0;1.0;0.999;1.0;0.999;0.998;0.998;0.999	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.85130	0.97;0.983;0.97;0.97;0.997;0.994;0.997;0.997;0.983;0.997;0.992;0.97;0.97;0.934	D	0.94263	0.7504	10	0.87932	D	0	-21.1778	15.669	0.77258	0.0:1.0:0.0:0.0	.	937;923;906;892;923;892;922;891;936;922;905;891;906;905	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	F	936;922;922;905;905;937;906;892;906;923;923	ENSP00000407046:S936F;ENSP00000387137:S922F;ENSP00000386547:S922F;ENSP00000398305:S905F;ENSP00000258104:S905F;ENSP00000386683:S937F;ENSP00000377678:S906F;ENSP00000386285:S892F;ENSP00000386512:S906F;ENSP00000386881:S923F;ENSP00000386617:S923F	ENSP00000258104:S905F	S	+	2	0	DYSF	71648880	1.000000	0.71417	0.997000	0.53966	0.688000	0.40055	3.861000	0.56002	2.288000	0.76882	0.448000	0.29417	TCT		0.592	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		9	337	0	0	0	0.008291	0	9	337				
GCFC2	6936	broad.mit.edu	37	2	75928338	75928338	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:75928338C>T	ENST00000321027.3	-	4	828	c.695G>A	c.(694-696)aGg>aAg	p.R232K	GCFC2_ENST00000409857.3_Missense_Mutation_p.R194K|GCFC2_ENST00000541687.1_Missense_Mutation_p.R232K	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	232					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)										AACTGCTTTCCTCATTTGCTG	0.358																																						Esophageal Squamous(141;1502 1784 15043 37622 47064)	uc002sno.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(694-696)AGG>AAG		hypothetical protein LOC6936							217.0	179.0	192.0					2																	75928338		2203	4299	6502	SO:0001583	missense	6936				negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr2:75928338C>T	AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.695G>A	2.37:g.75928338C>T	ENSP00000318690:p.Arg232Lys		Somatic				C2orf3_uc010ffs.2_5'UTR|C2orf3_uc002snn.2_Missense_Mutation_p.R63K|C2orf3_uc010fft.2_5'UTR	p.R232K	NM_003203	NP_003194	WXS	Illumina HiSeq	Unspecified	P16383	GCF_HUMAN			4	825	-			232					A4UHQ8|O95032|Q53TY0|Q6P2F2	Missense_Mutation	SNP	ENST00000321027.3	37	c.695G>A	CCDS1961.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.844212	0.32606	.	.	ENSG00000005436	ENST00000321027;ENST00000541687;ENST00000409857;ENST00000442309	T;T;T;T	0.37058	1.99;1.22;2.52;1.34	4.85	3.92	0.45320	.	0.218583	0.46145	N	0.000314	T	0.29882	0.0747	L	0.55213	1.73	0.41330	D	0.987238	B	0.32918	0.39	B	0.27076	0.076	T	0.08513	-1.0718	10	0.30078	T	0.28	-9.1673	10.725	0.46064	0.0:0.8962:0.0:0.1038	.	232	P16383	GCF_HUMAN	K	232;232;194;157	ENSP00000318690:R232K;ENSP00000437767:R232K;ENSP00000386552:R194K;ENSP00000415831:R157K	ENSP00000318690:R232K	R	-	2	0	C2orf3	75781846	1.000000	0.71417	1.000000	0.80357	0.374000	0.29953	1.537000	0.36083	1.263000	0.44181	-0.345000	0.07892	AGG		0.358	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252255.2	NM_003203		3	40	0	0	0	0.000248	0	3	40				
FABP1	2168	broad.mit.edu	37	2	88424034	88424034	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:88424034G>A	ENST00000295834.3	-	3	410	c.312C>T	c.(310-312)ctC>ctT	p.L104L	FABP1_ENST00000393750.3_Silent_p.L104L|FABP1_ENST00000495375.1_5'UTR	NM_001443.2	NP_001434.1	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver	104					cellular lipid metabolic process (GO:0044255)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|intestinal absorption (GO:0050892)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of hydrolase activity (GO:0051345)|small molecule metabolic process (GO:0044281)	apical cortex (GO:0045179)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|peroxisomal matrix (GO:0005782)	antioxidant activity (GO:0016209)|bile acid binding (GO:0032052)|chromatin binding (GO:0003682)|drug binding (GO:0008144)|fatty acid binding (GO:0005504)|long-chain fatty acid transporter activity (GO:0005324)|phospholipid binding (GO:0005543)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|stomach(1)	6						TGTCGCCGTTGAGTTCGGTCA	0.522																																							uc002sst.1		NA																	0					0						c.(310-312)CTC>CTT		fatty acid binding protein 1, liver							191.0	144.0	160.0					2																	88424034		2203	4300	6503	SO:0001819	synonymous_variant	2168				organ morphogenesis			g.chr2:88424034G>A	M10617	CCDS2001.1	2p11	2013-03-01			ENSG00000163586	ENSG00000163586		"""Fatty acid binding protein family"""	3555	protein-coding gene	gene with protein product		134650				3012800, 17698986	Standard	NM_001443		Approved	L-FABP	uc002sst.2	P07148	OTTHUMG00000130312	ENST00000295834.3:c.312C>T	2.37:g.88424034G>A			Somatic				FABP1_uc002ssu.2_Silent_p.L104L	p.L104L	NM_001443	NP_001434	WXS	Illumina HiSeq	Unspecified	P07148	FABPL_HUMAN			3	354	-			104						Silent	SNP	ENST00000295834.3	37	c.312C>T	CCDS2001.1																																																																																				0.522	FABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252660.1	NM_001443		4	85	0	0	0	0.000602	0	4	85				
IL36RN	26525	broad.mit.edu	37	2	113820196	113820196	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:113820196C>T	ENST00000393200.2	+	5	571	c.410C>T	c.(409-411)cCc>cTc	p.P137L	IL36RN_ENST00000346807.3_Missense_Mutation_p.P137L	NM_012275.2	NP_036407.1	Q9UBH0	I36RA_HUMAN	interleukin 36 receptor antagonist	137					antifungal humoral response (GO:0019732)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of interferon-gamma secretion (GO:1902714)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)	extracellular space (GO:0005615)	interleukin-1 receptor antagonist activity (GO:0005152)			large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						ACCCAGCTTCCCGAGAATGGT	0.627																																							uc002tis.2		NA																	0					0						c.(409-411)CCC>CTC		interleukin 1 family, member 5							48.0	46.0	47.0					2																	113820196		2203	4300	6503	SO:0001583	missense	26525					extracellular space	cytokine activity|interleukin-1 receptor antagonist activity	g.chr2:113820196C>T	AF201830	CCDS2111.1	2q14	2014-09-17	2011-06-06	2011-06-06	ENSG00000136695	ENSG00000136695		"""Interleukins and interleukin receptors"""	15561	protein-coding gene	gene with protein product	"""family of interleukin 1-delta"", ""interleukin-1 receptor antagonist homolog 1"", ""interleukin-1 HY1"", ""IL-1 related protein 3"""	605507	"""interleukin 1 family, member 5 (delta)"""	IL1F5		10625660, 10512743, 11574262	Standard	NM_012275		Approved	FIL1, FIL1(DELTA), FIL1D, IL1HY1, IL1RP3, IL1L1, IL-1F5, IL36RA, MGC29840	uc002tit.3	Q9UBH0	OTTHUMG00000131337	ENST00000393200.2:c.410C>T	2.37:g.113820196C>T	ENSP00000376896:p.Pro137Leu		Somatic				IL1F5_uc002tit.2_Missense_Mutation_p.P137L	p.P137L	NM_173170	NP_775262	WXS	Illumina HiSeq	Unspecified	Q9UBH0	I36RA_HUMAN			5	543	+			137					A8K2I4|Q56AT9|Q7RTZ6	Missense_Mutation	SNP	ENST00000393200.2	37	c.410C>T	CCDS2111.1	.	.	.	.	.	.	.	.	.	.	C	9.166	1.020014	0.19433	.	.	ENSG00000136695	ENST00000346807;ENST00000393200	T;T	0.78924	-1.22;-1.22	5.24	2.49	0.30216	.	0.523268	0.22500	N	0.059260	T	0.65903	0.2736	L	0.37561	1.115	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.57825	-0.7744	10	0.62326	D	0.03	-1.9936	7.819	0.29276	0.0:0.736:0.0:0.264	.	137	Q9UBH0	I36RA_HUMAN	L	137	ENSP00000259212:P137L;ENSP00000376896:P137L	ENSP00000259212:P137L	P	+	2	0	IL36RN	113536667	0.001000	0.12720	0.016000	0.15963	0.054000	0.15201	1.043000	0.30316	0.312000	0.23038	-0.137000	0.14449	CCC		0.627	IL36RN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330729.1	NM_173170		3	67	0	0	0	0.000248	0	3	67				
SAP130	79595	broad.mit.edu	37	2	128747338	128747338	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:128747338G>A	ENST00000259235.3	-	13	1787	c.1658C>T	c.(1657-1659)tCg>tTg	p.S553L	SAP130_ENST00000259234.6_Missense_Mutation_p.S527L|SAP130_ENST00000357702.5_Missense_Mutation_p.S553L	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	553					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		TCGAGCATGCGATGCATCCAC	0.572																																							uc002tpp.2		NA																	0				ovary(2)|skin(2)	4						c.(1657-1659)TCG>TTG		Sin3A-associated protein, 130kDa isoform b							118.0	98.0	104.0					2																	128747338		2203	4300	6503	SO:0001583	missense	79595				histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity	g.chr2:128747338G>A	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1658C>T	2.37:g.128747338G>A	ENSP00000259235:p.Ser553Leu		Somatic				SAP130_uc002tpn.2_Missense_Mutation_p.S314L|SAP130_uc002tpo.2_Missense_Mutation_p.S298L|SAP130_uc010fmd.2_Missense_Mutation_p.S553L|SAP130_uc002tpq.1_Missense_Mutation_p.S526L	p.S553L	NM_024545	NP_078821	WXS	Illumina HiSeq	Unspecified	Q9H0E3	SP130_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0771)	13	1790	-	Colorectal(110;0.1)		553					B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	ENST00000259235.3	37	c.1658C>T	CCDS2153.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850985	0.71719	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.46	5.46	0.80206	.	0.116910	0.64402	D	0.000011	T	0.66257	0.2771	L	0.27053	0.805	0.54753	D	0.999981	D;D;D;D;D	0.76494	0.999;0.997;0.997;0.998;0.997	D;D;D;D;D	0.77557	0.99;0.964;0.964;0.929;0.947	T	0.64846	-0.6311	9	0.36615	T	0.2	-16.603	19.3023	0.94148	0.0:0.0:1.0:0.0	.	553;526;553;83;191	B7ZLM3;Q96DP1;Q9H0E3;Q9H0E3-2;B3KRT9	.;.;SP130_HUMAN;.;.	L	553;553;527	.	ENSP00000259234:S527L	S	-	2	0	SAP130	128463808	1.000000	0.71417	0.755000	0.31263	0.950000	0.60333	6.603000	0.74145	2.543000	0.85770	0.655000	0.94253	TCG		0.572	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545		6	63	0	0	0	0.001984	0	6	63				
POTEE	445582	broad.mit.edu	37	2	132021858	132021858	+	Missense_Mutation	SNP	G	G	A	rs371012932		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:132021858G>A	ENST00000356920.5	+	15	2924	c.2830G>A	c.(2830-2832)Gat>Aat	p.D944N	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	944	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CGAGCTGCCCGATGGCCAGGT	0.602																																							uc002tsn.2		NA																	0					0						c.(2830-2832)GAT>AAT		protein expressed in prostate, ovary, testis,		G	ASN/ASP	1,4273		0,1,2136	53.0	63.0	59.0		2830		0.3	2		59	0,8354		0,0,4177	no	missense	POTEE	NM_001083538.1	23	0,1,6313	AA,AG,GG		0.0,0.0234,0.0079	probably-damaging	944/1076	132021858	1,12627	2137	4177	6314	SO:0001583	missense	445582						ATP binding	g.chr2:132021858G>A	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2830G>A	2.37:g.132021858G>A	ENSP00000439189:p.Asp944Asn		Somatic				PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.D544N|POTEE_uc002tsl.2_Missense_Mutation_p.D526N|POTEE_uc010fmy.1_Missense_Mutation_p.D408N	p.D944N	NM_001083538	NP_001077007	WXS	Illumina HiSeq	Unspecified	Q6S8J3	POTEE_HUMAN			15	2882	+			944			Actin-like.		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	c.2830G>A	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	18.54	3.646929	0.67358	2.34E-4	0.0	ENSG00000188219	ENST00000356920	D	0.97772	-4.53	.	.	.	.	.	.	.	.	D	0.98611	0.9535	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	D	0.97312	0.9938	8	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	944	Q6S8J3	POTEE_HUMAN	N	944	ENSP00000439189:D944N	ENSP00000439189:D944N	D	+	1	0	AC131180.1	131738328	1.000000	0.71417	0.269000	0.24586	0.273000	0.26683	6.504000	0.73704	0.119000	0.18210	0.121000	0.15741	GAT		0.602	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538		4	148	0	0	0	0.000602	0	4	148				
LCT	3938	broad.mit.edu	37	2	136575248	136575248	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:136575248C>G	ENST00000264162.2	-	6	1380	c.1370G>C	c.(1369-1371)tGg>tCg	p.W457S	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	457	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GATCCGGGACCAGGAGATGGA	0.627																																							uc002tuu.1		NA																	0				ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(1369-1371)TGG>TCG		lactase-phlorizin hydrolase preproprotein							58.0	55.0	56.0					2																	136575248		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136575248C>G	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1370G>C	2.37:g.136575248C>G	ENSP00000264162:p.Trp457Ser		Somatic					p.W457S	NM_002299	NP_002290	WXS	Illumina HiSeq	Unspecified	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	6	1381	-			457			Extracellular (Potential).|4 X approximate repeats.|2.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.1370G>C	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742299	0.89573	.	.	ENSG00000115850	ENST00000264162	D	0.89485	-2.52	5.77	5.77	0.91146	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.119289	0.64402	D	0.000009	D	0.97318	0.9123	H	0.99197	4.465	0.80722	D	1	D	0.71674	0.998	D	0.74674	0.984	D	0.98270	1.0503	10	0.87932	D	0	-11.3811	20.3627	0.98863	0.0:1.0:0.0:0.0	.	457	P09848	LPH_HUMAN	S	457	ENSP00000264162:W457S	ENSP00000264162:W457S	W	-	2	0	LCT	136291718	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.776000	0.85560	2.885000	0.99019	0.655000	0.94253	TGG		0.627	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		9	57	0	0	0	0.008291	0	9	57				
TNFAIP6	7130	broad.mit.edu	37	2	152222726	152222726	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:152222726C>A	ENST00000243347.3	+	3	464	c.389C>A	c.(388-390)cCa>cAa	p.P130Q	MIR4773-1_ENST00000585225.1_RNA	NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	130					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)	p.P130Q(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	TGCTACAACCCACACGGTGTG	0.373																																							uc002txk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(388-390)CCA>CAA		tumor necrosis factor, alpha-induced protein 6							85.0	83.0	84.0					2																	152222726		2203	4300	6503	SO:0001583	missense	7130				cell adhesion|cell-cell signaling|inflammatory response|signal transduction		hyaluronic acid binding	g.chr2:152222726C>A		CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.389C>A	2.37:g.152222726C>A	ENSP00000243347:p.Pro130Gln		Somatic					p.P130Q	NM_007115	NP_009046	WXS	Illumina HiSeq	Unspecified	P98066	TSG6_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.131)	3	465	+			130					Q53TI7|Q8WWI9	Missense_Mutation	SNP	ENST00000243347.3	37	c.389C>A	CCDS2193.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924649	0.52653	.	.	ENSG00000123610	ENST00000243347	T	0.29397	1.57	5.15	5.15	0.70609	C-type lectin fold (1);Link (1);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.43634	0.1256	M	0.68317	2.08	0.80722	D	1	D	0.57899	0.981	P	0.51193	0.662	T	0.23655	-1.0182	10	0.17832	T	0.49	.	18.9653	0.92694	0.0:1.0:0.0:0.0	.	130	P98066	TSG6_HUMAN	Q	130	ENSP00000243347:P130Q	ENSP00000243347:P130Q	P	+	2	0	TNFAIP6	151930972	1.000000	0.71417	1.000000	0.80357	0.458000	0.32498	4.605000	0.61119	2.526000	0.85167	0.563000	0.77884	CCA		0.373	TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254834.2	NM_007115		4	50	1	0	0.00024832	0.000248	0.000297361	4	50				
GALNT13	114805	broad.mit.edu	37	2	155252568	155252568	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:155252568A>G	ENST00000392825.3	+	10	1789	c.1222A>G	c.(1222-1224)Aag>Gag	p.K408E	GALNT13_ENST00000487047.1_3'UTR|GALNT13_ENST00000409237.1_Missense_Mutation_p.K408E	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	408					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						TCTGAAGTGTAAGCCCTTTTC	0.373																																							uc002tyr.3		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						c.(1222-1224)AAG>GAG		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							96.0	94.0	95.0					2																	155252568		2203	4300	6503	SO:0001583	missense	114805					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:155252568A>G	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1222A>G	2.37:g.155252568A>G	ENSP00000376570:p.Lys408Glu		Somatic				GALNT13_uc002tyt.3_Missense_Mutation_p.K408E|GALNT13_uc010foc.1_Missense_Mutation_p.K227E|GALNT13_uc010fod.2_Missense_Mutation_p.K161E	p.K408E	NM_052917	NP_443149	WXS	Illumina HiSeq	Unspecified	Q8IUC8	GLT13_HUMAN			10	1789	+			408			Lumenal (Potential).		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	c.1222A>G	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	A	18.40	3.615728	0.66672	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.55588	0.51;0.51	5.02	5.02	0.67125	.	0.095855	0.64402	D	0.000001	T	0.75236	0.3822	H	0.96489	3.83	0.80722	D	1	P;B;B;B	0.44776	0.843;0.008;0.276;0.008	P;B;B;B	0.51355	0.667;0.036;0.076;0.036	D	0.83408	0.0026	10	0.87932	D	0	.	13.8582	0.63542	1.0:0.0:0.0:0.0	.	408;408;408;408	Q8IUC8-2;B3KY85;Q08ER7;Q8IUC8	.;.;.;GLT13_HUMAN	E	408	ENSP00000376570:K408E;ENSP00000387239:K408E	ENSP00000376570:K408E	K	+	1	0	GALNT13	154960814	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.112000	0.94314	2.016000	0.59253	0.528000	0.53228	AAG		0.373	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917		5	30	0	0	0	0.001984	0	5	30				
KCNJ3	3760	broad.mit.edu	37	2	155566211	155566211	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:155566211C>A	ENST00000295101.2	+	2	1276	c.799C>A	c.(799-801)Ccc>Acc	p.P267T	KCNJ3_ENST00000493505.1_3'UTR|KCNJ3_ENST00000544049.1_Intron	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	267					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	TCTTGTGTCCCCCCTCACAAT	0.488																																							uc002tyv.1		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(799-801)CCC>ACC		potassium inwardly-rectifying channel J3	Halothane(DB01159)						118.0	107.0	110.0					2																	155566211		2203	4300	6503	SO:0001583	missense	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155566211C>A	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.799C>A	2.37:g.155566211C>A	ENSP00000295101:p.Pro267Thr		Somatic				KCNJ3_uc010zce.1_Intron	p.P267T	NM_002239	NP_002230	WXS	Illumina HiSeq	Unspecified	P48549	IRK3_HUMAN			2	994	+			267			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	c.799C>A	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955089	0.73902	.	.	ENSG00000162989	ENST00000295101	D	0.97710	-4.5	5.57	4.68	0.58851	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.049512	0.85682	N	0.000000	D	0.98912	0.9631	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99624	1.0984	10	0.87932	D	0	.	15.1602	0.72778	0.1423:0.8577:0.0:0.0	.	267	P48549	IRK3_HUMAN	T	267	ENSP00000295101:P267T	ENSP00000295101:P267T	P	+	1	0	KCNJ3	155274457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.772000	0.85439	1.459000	0.47892	0.650000	0.86243	CCC		0.488	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		8	65	1	0	1.06961e-07	0.00308	1.35745e-07	8	65				
ERMN	57471	broad.mit.edu	37	2	158182024	158182024	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:158182024C>T	ENST00000410096.1	-	1	422	c.131G>A	c.(130-132)aGg>aAg	p.R44K	ERMN_ENST00000409216.1_Missense_Mutation_p.R44K|ERMN_ENST00000409925.1_Missense_Mutation_p.R44K|ERMN_ENST00000420719.2_Missense_Mutation_p.R44K|ERMN_ENST00000535935.1_5'Flank|ERMN_ENST00000397283.2_Missense_Mutation_p.R57K	NM_020711.1	NP_065762.1	Q8TAM6	ERMIN_HUMAN	ermin, ERM-like protein	44					actin filament organization (GO:0007015)|morphogenesis of a branching structure (GO:0001763)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|internode region of axon (GO:0033269)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|paranode region of axon (GO:0033270)				endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12						GGGTTCTACCCTGTAGTGTGG	0.468																																							uc002tzh.2		NA																	0				ovary(1)|skin(1)	2						c.(130-132)AGG>AAG		ermin, ERM-like protein isoform b							185.0	173.0	177.0					2																	158182024		1914	4130	6044	SO:0001583	missense	57471					cytoplasm|cytoskeleton		g.chr2:158182024C>T	AB033015	CCDS42764.1, CCDS46431.1	2q24	2008-02-05	2008-01-15	2008-01-15	ENSG00000136541	ENSG00000136541			29208	protein-coding gene	gene with protein product	"""juxtanodin"", ""ermin"""	610072	"""KIAA1189"""	KIAA1189		16051705, 16421295	Standard	NM_020711		Approved	JN, ERMIN	uc002tzi.3	Q8TAM6	OTTHUMG00000153843	ENST00000410096.1:c.131G>A	2.37:g.158182024C>T	ENSP00000387047:p.Arg44Lys		Somatic				ERMN_uc010zcj.1_5'Flank|ERMN_uc010zck.1_Missense_Mutation_p.R44K|ERMN_uc002tzi.2_Missense_Mutation_p.R57K	p.R44K	NM_020711	NP_065762	WXS	Illumina HiSeq	Unspecified	Q8TAM6	ERMIN_HUMAN			1	393	-			44					B4DKA6|Q9ULN1	Missense_Mutation	SNP	ENST00000410096.1	37	c.131G>A	CCDS46431.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071984	0.36566	.	.	ENSG00000136541	ENST00000410096;ENST00000397283;ENST00000420719;ENST00000420317;ENST00000411762;ENST00000409216;ENST00000409925;ENST00000419116	T;T	0.44482	0.92;0.92	5.64	1.26	0.21427	.	1.013940	0.07875	N	0.968575	T	0.21387	0.0515	N	0.14661	0.345	0.09310	N	1	B;B;B	0.16396	0.017;0.017;0.017	B;B;B	0.12156	0.007;0.007;0.007	T	0.28138	-1.0053	10	0.11794	T	0.64	2.4738	4.4112	0.11434	0.0:0.4563:0.2537:0.2899	.	44;57;44	B4DIZ1;Q8TAM6-2;Q8TAM6	.;.;ERMIN_HUMAN	K	44;57;44;44;44;44;44;44	ENSP00000387049:R44K;ENSP00000387325:R44K	ENSP00000380453:R57K	R	-	2	0	ERMN	157890270	0.000000	0.05858	0.001000	0.08648	0.206000	0.24218	0.392000	0.20801	0.703000	0.31848	0.557000	0.71058	AGG		0.468	ERMN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332659.1	NM_001009959		8	104	0	0	0	0.008291	0	8	104				
WDSUB1	151525	broad.mit.edu	37	2	160139448	160139448	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:160139448G>A	ENST00000409990.3	-	2	389	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	WDSUB1_ENST00000392796.3_Silent_p.L45L|WDSUB1_ENST00000409124.1_Silent_p.L45L|WDSUB1_ENST00000358147.4_Silent_p.L45L|WDSUB1_ENST00000359774.4_Silent_p.L45L	NM_001128213.1	NP_001121685	Q8N9V3	WSDU1_HUMAN	WD repeat, sterile alpha motif and U-box domain containing 1	45							ubiquitin-protein transferase activity (GO:0004842)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|stomach(3)	16						GAATGTGGCAGTTCAGTAAAG	0.468																																							uc002uaj.3		NA																	0					0						c.(133-135)CTG>TTG		WD repeat, sterile alpha motif and U-box domain							143.0	138.0	140.0					2																	160139448		2203	4300	6503	SO:0001819	synonymous_variant	151525					ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr2:160139448G>A	AK093494	CCDS2208.1	2q24.2	2013-01-28	2006-02-17	2005-03-25	ENSG00000196151	ENSG00000196151		"""WD repeat domain containing"", ""Sterile alpha motif (SAM) domain containing"", ""U-box domain containing"""	26697	protein-coding gene	gene with protein product			"""WD repeat and SAM domain containing 1"", ""WD repeat, SAM and U-box domain containing 1"""	WDSAM1		12477932	Standard	NM_152528		Approved	UBOX6, FLJ36175	uc002ual.4	Q8N9V3	OTTHUMG00000132028	ENST00000409990.3:c.133C>T	2.37:g.160139448G>A			Somatic				WDSUB1_uc002uak.3_Silent_p.L45L|WDSUB1_uc002ual.3_Silent_p.L45L|WDSUB1_uc002uam.3_Silent_p.L45L|WDSUB1_uc010foo.2_Silent_p.L45L	p.L45L	NM_152528	NP_689741	WXS	Illumina HiSeq	Unspecified	Q8N9V3	WSDU1_HUMAN			2	282	-			45			WD 1.		Q53TI9|Q8N6N8	Silent	SNP	ENST00000409990.3	37	c.133C>T	CCDS2208.1																																																																																				0.468	WDSUB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333339.1	NM_152528		3	86	0	0	0	0.004672	0	3	86				
BAZ2B	29994	broad.mit.edu	37	2	160268905	160268906	+	Missense_Mutation	DNP	CC	CC	AA	rs534666282		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:160268905_160268906CC>AA	ENST00000392783.2	-	14	3112_3113	c.2617_2618GG>TT	c.(2617-2619)GGc>TTc	p.G873F	BAZ2B_ENST00000343439.5_Missense_Mutation_p.G773F|BAZ2B_ENST00000355831.2_Missense_Mutation_p.G839F|BAZ2B_ENST00000392782.1_Missense_Mutation_p.G837F	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	873					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TTCAGCATTGCCAACATTTGGA	0.431																																							uc002uao.2		NA																	0				ovary(3)|skin(1)	4						c.(2617-2619)GGC>TTC		bromodomain adjacent to zinc finger domain, 2B																																				SO:0001583	missense	29994				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr2:160268905_160268906CC>AA	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.2617_2618delinsAA	2.37:g.160268905_160268906delinsAA	ENSP00000376534:p.Gly873Phe		Somatic				BAZ2B_uc002uap.2_Missense_Mutation_p.G837F|BAZ2B_uc002uaq.1_Missense_Mutation_p.G703F|BAZ2B_uc002uar.1_Missense_Mutation_p.G446F	p.G873F	NM_013450	NP_038478	WXS	Illumina HiSeq	Unspecified	Q9UIF8	BAZ2B_HUMAN			14	2969_2970	-			873					D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	DNP	ENST00000392783.2	37	c.2617_2618GG>TT	CCDS2209.2																																																																																				0.431	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			4	67	0	0	0	0.004672	0	4	67				
ITGB6	3694	broad.mit.edu	37	2	161056565	161056565	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:161056565C>T	ENST00000283249.2	-	1	247	c.10G>A	c.(10-12)Gaa>Aaa	p.E4K	ITGB6_ENST00000485635.1_Intron|ITGB6_ENST00000409872.1_Missense_Mutation_p.E4K|ITGB6_ENST00000409967.2_Missense_Mutation_p.E4K|ITGB6_ENST00000428609.2_5'UTR	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	4					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						CAAAGCAGTTCAATCCCCATT	0.388																																							uc002ubh.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(10-12)GAA>AAA		integrin, beta 6 precursor							125.0	112.0	116.0					2																	161056565		2203	4300	6503	SO:0001583	missense	3694				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity	g.chr2:161056565C>T		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.10G>A	2.37:g.161056565C>T	ENSP00000283249:p.Glu4Lys		Somatic				ITGB6_uc010fow.1_Intron|ITGB6_uc010fou.2_Missense_Mutation_p.E4K|ITGB6_uc010zcq.1_5'UTR|ITGB6_uc010fov.1_Missense_Mutation_p.E4K	p.E4K	NM_000888	NP_000879	WXS	Illumina HiSeq	Unspecified	P18564	ITB6_HUMAN			1	26	-			4					B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	c.10G>A	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.869778	0.91587	.	.	ENSG00000115221	ENST00000283249;ENST00000409967;ENST00000409872	D;D;D	0.90069	-2.49;-2.61;-2.49	5.83	5.83	0.93111	.	0.307883	0.35235	N	0.003354	D	0.84804	0.5553	L	0.41236	1.265	0.35592	D	0.80715	B	0.25719	0.132	B	0.17098	0.017	T	0.82315	-0.0518	10	0.16420	T	0.52	.	20.1175	0.97942	0.0:1.0:0.0:0.0	.	4	P18564	ITB6_HUMAN	K	4	ENSP00000283249:E4K;ENSP00000386828:E4K;ENSP00000386367:E4K	ENSP00000283249:E4K	E	-	1	0	ITGB6	160764811	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.005000	0.57075	2.771000	0.95319	0.591000	0.81541	GAA		0.388	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888		12	85	0	0	0	0.003163	0	12	85				
EVX2	344191	broad.mit.edu	37	2	176948209	176948209	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:176948209C>A	ENST00000308618.4	-	1	432	c.296G>T	c.(295-297)cGc>cTc	p.R99L		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	99					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		CGGCTTCTTGCGGCTCTCGGC	0.652																																							uc010zeu.1		NA																	0				ovary(2)	2						c.(295-297)CGC>CTC		even-skipped homeobox 2							28.0	35.0	33.0					2																	176948209		2201	4299	6500	SO:0001583	missense	344191					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176948209C>A		CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.296G>T	2.37:g.176948209C>A	ENSP00000312385:p.Arg99Leu		Somatic					p.R99L	NM_001080458	NP_001073927	WXS	Illumina HiSeq	Unspecified	Q03828	EVX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)	1	482	-			99						Missense_Mutation	SNP	ENST00000308618.4	37	c.296G>T	CCDS33333.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.166859	0.38217	.	.	ENSG00000174279	ENST00000308618	D	0.91068	-2.78	5.84	5.84	0.93424	.	0.103806	0.64402	D	0.000010	D	0.86669	0.5988	L	0.47190	1.495	0.58432	D	0.999998	B	0.26672	0.156	B	0.16722	0.016	T	0.82694	-0.0330	10	0.07175	T	0.84	-21.135	20.1278	0.97990	0.0:1.0:0.0:0.0	.	99	Q03828	EVX2_HUMAN	L	99	ENSP00000312385:R99L	ENSP00000312385:R99L	R	-	2	0	EVX2	176656455	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	7.487000	0.81328	2.768000	0.95171	0.561000	0.74099	CGC		0.652	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1			3	54	1	0	0.004672	0.004672	0.00534343	3	54				
ITGA4	3676	broad.mit.edu	37	2	182389982	182389982	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:182389982T>C	ENST00000397033.2	+	21	2733	c.2303T>C	c.(2302-2304)aTa>aCa	p.I768T		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	768					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	ACTGTAGCAATACCTTTAAAA	0.358																																							uc002unu.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(2302-2304)ATA>ACA		integrin alpha 4 precursor	Natalizumab(DB00108)						114.0	108.0	110.0					2																	182389982		1859	4108	5967	SO:0001583	missense	3676				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity	g.chr2:182389982T>C		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.2303T>C	2.37:g.182389982T>C	ENSP00000380227:p.Ile768Thr		Somatic				ITGA4_uc010frj.1_Missense_Mutation_p.I250T|ITGA4_uc002unv.2_Missense_Mutation_p.I13T	p.I768T	NM_000885	NP_000876	WXS	Illumina HiSeq	Unspecified	P13612	ITA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0593)		21	3066	+			768			Extracellular (Potential).		D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	c.2303T>C	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	T	12.45	1.941752	0.34283	.	.	ENSG00000115232	ENST00000397033	T	0.49720	0.77	6.16	6.16	0.99307	Integrin alpha-2 (1);	0.254499	0.47852	D	0.000208	T	0.45397	0.1340	L	0.44542	1.39	0.41162	D	0.986108	B;B	0.32653	0.379;0.379	B;B	0.33846	0.171;0.171	T	0.45293	-0.9271	10	0.66056	D	0.02	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	590;768	Q59H74;P13612	.;ITA4_HUMAN	T	768	ENSP00000380227:I768T	ENSP00000380227:I768T	I	+	2	0	ITGA4	182098227	0.998000	0.40836	0.687000	0.30102	0.092000	0.18411	5.833000	0.69349	2.367000	0.80283	0.528000	0.53228	ATA		0.358	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1			6	46	0	0	0	0.001984	0	6	46				
FN1	2335	broad.mit.edu	37	2	216262528	216262528	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:216262528A>C	ENST00000359671.1	-	22	3657	c.3392T>G	c.(3391-3393)gTg>gGg	p.V1131G	FN1_ENST00000421182.1_Missense_Mutation_p.V1131G|FN1_ENST00000345488.5_Missense_Mutation_p.V1131G|FN1_ENST00000357867.4_Missense_Mutation_p.V1131G|FN1_ENST00000446046.1_Missense_Mutation_p.V1131G|FN1_ENST00000443816.1_Missense_Mutation_p.V1131G|FN1_ENST00000356005.4_Missense_Mutation_p.V1131G|FN1_ENST00000354785.4_Missense_Mutation_p.V1131G|FN1_ENST00000323926.6_Missense_Mutation_p.V1131G|FN1_ENST00000336916.4_Missense_Mutation_p.V1131G|FN1_ENST00000432072.2_Missense_Mutation_p.V1131G|FN1_ENST00000346544.3_Missense_Mutation_p.V1131G|FN1_ENST00000357009.2_Missense_Mutation_p.V1131G			P02751	FINC_HUMAN	fibronectin 1	1131	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GTCTGAAGTCACTTCTCGTGG	0.502																																							uc002vfa.2		NA																	0				central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13						c.(3391-3393)GTG>GGG		fibronectin 1 isoform 1 preproprotein	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						163.0	133.0	143.0					2																	216262528		2203	4300	6503	SO:0001583	missense	2335				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding	g.chr2:216262528A>C		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3392T>G	2.37:g.216262528A>C	ENSP00000352696:p.Val1131Gly		Somatic				FN1_uc002vfb.2_Missense_Mutation_p.V1131G|FN1_uc002vfc.2_Missense_Mutation_p.V1131G|FN1_uc002vfd.2_Missense_Mutation_p.V1131G|FN1_uc002vfe.2_Missense_Mutation_p.V1131G|FN1_uc002vff.2_Missense_Mutation_p.V1131G|FN1_uc002vfg.2_Missense_Mutation_p.V1131G|FN1_uc002vfh.2_Missense_Mutation_p.V1131G|FN1_uc002vfi.2_Missense_Mutation_p.V1131G|FN1_uc002vfj.2_Missense_Mutation_p.V1131G	p.V1131G	NM_212482	NP_997647	WXS	Illumina HiSeq	Unspecified	P02751	FINC_HUMAN		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	22	3658	-		Renal(323;0.127)	1131			|Fibronectin type-III 6.		B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37	c.3392T>G		.	.	.	.	.	.	.	.	.	.	A	21.6	4.173547	0.78452	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12	5.36	5.36	0.76844	.	0.102638	0.42548	D	0.000693	T	0.72170	0.3427	L	0.55481	1.735	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.995;0.967;0.989;0.995;0.993;0.967;1.0;0.991;0.995;0.99	D;D;D;D;D;D;D;D;D;D	0.91635	0.995;0.917;0.961;0.995;0.997;0.917;0.999;0.995;0.995;0.995	T	0.75169	-0.3412	10	0.87932	D	0	.	15.6454	0.77046	1.0:0.0:0.0:0.0	.	1131;1131;1131;1131;1131;1131;1131;1131;1131;1131	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	G	1131	ENSP00000394423:V1131G;ENSP00000323534:V1131G;ENSP00000338200:V1131G;ENSP00000350534:V1131G;ENSP00000346839:V1131G;ENSP00000352696:V1131G;ENSP00000265312:V1131G;ENSP00000273049:V1131G;ENSP00000349509:V1131G;ENSP00000410422:V1131G;ENSP00000415018:V1131G;ENSP00000399538:V1131G;ENSP00000348285:V1131G	ENSP00000265313:V1131G	V	-	2	0	FN1	215970773	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.437000	0.59955	2.158000	0.67659	0.482000	0.46254	GTG		0.502	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476		5	87	0	0	0	0.001168	0	5	87				
NYAP2	57624	broad.mit.edu	37	2	226446843	226446843	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:226446843A>G	ENST00000272907.6	+	4	1123	c.710A>G	c.(709-711)gAc>gGc	p.D237G	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	237					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CCCGCGGGAGACCCCGAGGAA	0.597																																							uc002voe.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(709-711)GAC>GGC		hypothetical protein LOC57624							100.0	107.0	105.0					2																	226446843		1906	4106	6012	SO:0001583	missense	57624							g.chr2:226446843A>G	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.710A>G	2.37:g.226446843A>G	ENSP00000272907:p.Asp237Gly		Somatic				KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Missense_Mutation_p.D7G	p.D237G	NM_020864	NP_065915	WXS	Illumina HiSeq	Unspecified	Q9P242	K1486_HUMAN		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)	4	885	+		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)	237					A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	c.710A>G	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	A	17.19	3.325288	0.60743	.	.	ENSG00000144460	ENST00000272907	T	0.42513	0.97	5.9	2.21	0.28008	.	0.409242	0.28635	N	0.014643	T	0.49932	0.1586	L	0.39633	1.23	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.27502	-1.0072	10	0.31617	T	0.26	-13.6875	9.8705	0.41170	0.8064:0.0:0.1936:0.0	.	237	Q9P242	K1486_HUMAN	G	237	ENSP00000272907:D237G	ENSP00000272907:D237G	D	+	2	0	KIAA1486	226155087	1.000000	0.71417	0.978000	0.43139	0.940000	0.58332	3.904000	0.56325	0.149000	0.19098	0.524000	0.50904	GAC		0.597	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		9	91	0	0	0	0.006214	0	9	91				
GPR35	2859	broad.mit.edu	37	2	241570285	241570285	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:241570285G>A	ENST00000319838.5	+	6	1858	c.916G>A	c.(916-918)Gtg>Atg	p.V306M	GPR35_ENST00000403859.1_Missense_Mutation_p.V306M|GPR35_ENST00000407714.1_Missense_Mutation_p.V306M|GPR35_ENST00000430267.1_Missense_Mutation_p.V306M|GPR35_ENST00000438013.2_Missense_Mutation_p.V337M	NM_001195381.1	NP_001182310.1	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	306					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|cervix(1)|endometrium(1)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	17		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		CTCTCTGTGCGTGACCCTCGC	0.642																																							uc002vzs.1		NA																	0				skin(2)|pancreas(1)	3						c.(916-918)GTG>ATG		G protein-coupled receptor 35							82.0	83.0	83.0					2																	241570285		2203	4300	6503	SO:0001583	missense	2859					integral to plasma membrane	G-protein coupled receptor activity	g.chr2:241570285G>A		CCDS2541.1, CCDS56174.1	2q37.3	2012-08-21			ENSG00000178623	ENSG00000178623		"""GPCR / Class A : Orphans"""	4492	protein-coding gene	gene with protein product		602646				9479505	Standard	NM_005301		Approved		uc021vze.1	Q9HC97	OTTHUMG00000133356	ENST00000319838.5:c.916G>A	2.37:g.241570285G>A	ENSP00000322731:p.Val306Met		Somatic				GPR35_uc010fzh.1_Missense_Mutation_p.V337M|GPR35_uc010fzi.1_Missense_Mutation_p.V337M	p.V306M	NM_005301	NP_005292	WXS	Illumina HiSeq	Unspecified	Q9HC97	GPR35_HUMAN		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)	1	1491	+		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)	306			Cytoplasmic (Potential).		J3KR30|O43495|Q17R58|Q4VBN5|Q4ZFV2|Q6FHI8|Q86UH4	Missense_Mutation	SNP	ENST00000319838.5	37	c.916G>A	CCDS2541.1	.	.	.	.	.	.	.	.	.	.	G	7.611	0.674896	0.14841	.	.	ENSG00000178623	ENST00000319838;ENST00000403859;ENST00000438013;ENST00000407714;ENST00000430267	T;T;T;T;T	0.61859	0.07;0.07;0.1;0.07;0.07	2.62	-1.15	0.09709	.	1.106060	0.07013	N	0.825491	T	0.27454	0.0674	N	0.08118	0	0.09310	N	1	B;B;P	0.34587	0.27;0.27;0.458	B;B;B	0.21546	0.01;0.01;0.035	T	0.09552	-1.0669	10	0.28530	T	0.3	-7.7642	3.4975	0.07661	0.3011:0.357:0.3419:0.0	.	391;337;306	Q6ZMP9;A8K2J1;Q9HC97	.;.;GPR35_HUMAN	M	306;306;337;306;306	ENSP00000322731:V306M;ENSP00000385140:V306M;ENSP00000415890:V337M;ENSP00000384263:V306M;ENSP00000411788:V306M	ENSP00000322731:V306M	V	+	1	0	GPR35	241218958	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.877000	0.04197	-0.256000	0.09473	0.455000	0.32223	GTG		0.642	GPR35-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325631.1	NM_001195382		11	67	0	0	0	0.001368	0	11	67				
SEL1L2	80343	broad.mit.edu	37	20	13850153	13850153	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr20:13850153G>C	ENST00000284951.5	-	14	1325	c.1251C>G	c.(1249-1251)taC>taG	p.Y417*	SEL1L2_ENST00000378072.5_Nonsense_Mutation_p.Y417*|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	417						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						ACTTACAGTAGTACATGAAGC	0.393																																							uc010gcf.2		NA																	0				ovary(2)	2						c.(1249-1251)TAC>TAG		sel-1 suppressor of lin-12-like 2 precursor							99.0	93.0	95.0					20																	13850153		1877	4110	5987	SO:0001587	stop_gained	80343					integral to membrane	binding	g.chr20:13850153G>C	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.1251C>G	20.37:g.13850153G>C	ENSP00000284951:p.Tyr417*		Somatic				SEL1L2_uc002woq.3_Nonsense_Mutation_p.Y278*|SEL1L2_uc010zrl.1_Nonsense_Mutation_p.Y417*|SEL1L2_uc002wor.2_RNA	p.Y417*	NM_025229	NP_079505	WXS	Illumina HiSeq	Unspecified	Q5TEA6	SE1L2_HUMAN			14	1333	-			417			Extracellular (Potential).|Sel1-like 8.		B4DXX5	Nonsense_Mutation	SNP	ENST00000284951.5	37	c.1251C>G		.	.	.	.	.	.	.	.	.	.	G	38	6.704081	0.97776	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	.	.	.	5.52	4.35	0.52113	.	0.000000	0.52532	D	0.000069	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.2555	5.8036	0.18428	0.2251:0.0:0.7749:0.0	.	.	.	.	X	417	.	ENSP00000284951:Y417X	Y	-	3	2	SEL1L2	13798153	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.358000	0.44134	2.754000	0.94517	0.557000	0.71058	TAC		0.393	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	NM_025229		9	48	0	0	0	0.008291	0	9	48				
MACROD2	140733	broad.mit.edu	37	20	13983012	13983012	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr20:13983012C>G	ENST00000310348.4	+	2	125	c.125C>G	c.(124-126)tCa>tGa	p.S42*	MACROD2_ENST00000217246.4_Nonsense_Mutation_p.S42*			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	42					brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AGCATTCTATCATGGAAGGAG	0.378																																							uc002wou.2		NA																	0					0						c.(124-126)TCA>TGA		MACRO domain containing 2 isoform 1							134.0	133.0	133.0					20																	13983012		2203	4300	6503	SO:0001587	stop_gained	140733							g.chr20:13983012C>G	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.125C>G	20.37:g.13983012C>G	ENSP00000309809:p.Ser42*		Somatic				MACROD2_uc002wot.2_Nonsense_Mutation_p.S42*|MACROD2_uc002wos.2_RNA	p.S42*	NM_080676	NP_542407	WXS	Illumina HiSeq	Unspecified	A1Z1Q3	MACD2_HUMAN			2	389	+		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)	42					A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Nonsense_Mutation	SNP	ENST00000310348.4	37	c.125C>G	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	C	40	8.142203	0.98675	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	.	.	.	6.02	6.02	0.97574	.	0.495932	0.18648	N	0.135094	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	1.1299	19.1153	0.93336	0.0:1.0:0.0:0.0	.	.	.	.	X	42	.	ENSP00000217246:S42X	S	+	2	0	MACROD2	13931012	0.501000	0.26099	0.015000	0.15790	0.966000	0.64601	3.426000	0.52778	2.857000	0.98124	0.650000	0.86243	TCA		0.378	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676		6	117	0	0	0	0.001984	0	6	117				
CSRP2BP	57325	broad.mit.edu	37	20	18123402	18123402	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr20:18123402A>T	ENST00000435364.3	+	1	439	c.98A>T	c.(97-99)gAg>gTg	p.E33V	PET117_ENST00000432901.3_3'UTR|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.E33V|CSRP2BP_ENST00000489634.2_5'Flank	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	33					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						GGTGAAGTGGAGGGAGAGACG	0.542																																							uc002wqj.2		NA																	0				lung(3)|ovary(2)|skin(1)	6						c.(97-99)GAG>GTG		CSRP2 binding protein							171.0	123.0	139.0					20																	18123402		2203	4300	6503	SO:0001583	missense	57325				histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity	g.chr20:18123402A>T	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.98A>T	20.37:g.18123402A>T	ENSP00000392318:p.Glu33Val		Somatic				CSRP2BP_uc002wqk.2_5'Flank	p.E33V	NM_020536	NP_065397	WXS	Illumina HiSeq	Unspecified	Q9H8E8	CSR2B_HUMAN			2	720	+			33					A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	c.98A>T	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.129562	0.77549	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000464792;ENST00000435364	T;T;T	0.24538	1.85;1.85;1.85	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.44095	0.1277	L	0.43152	1.355	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.33727	-0.9857	10	0.62326	D	0.03	-13.1656	15.7946	0.78401	1.0:0.0:0.0:0.0	.	33	Q9H8E8	CSR2B_HUMAN	V	33	ENSP00000278816:E33V;ENSP00000366909:E33V;ENSP00000392318:E33V	ENSP00000278816:E33V	E	+	2	0	CSRP2BP	18071402	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	8.664000	0.91139	2.199000	0.70637	0.460000	0.39030	GAG		0.542	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536		9	71	0	0	0	0.008291	0	9	71				
CST8	10047	broad.mit.edu	37	20	23472354	23472354	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr20:23472354C>A	ENST00000246012.1	+	2	407	c.50C>A	c.(49-51)gCc>gAc	p.A17D		NM_005492.2	NP_005483.1	O60676	CST8_HUMAN	cystatin 8 (cystatin-related epididymal specific)	17					negative regulation of endopeptidase activity (GO:0010951)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(9)|skin(2)	16	Colorectal(13;0.0431)|Lung NSC(19;0.235)					ATTCCCCTGGCCCTGGTGGCC	0.572																																							uc002wth.1		NA																	0					0						c.(49-51)GCC>GAC		cystatin 8 precursor							106.0	105.0	106.0					20																	23472354		2203	4300	6503	SO:0001583	missense	10047					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23472354C>A	AF059244	CCDS13156.1	20p11.21	2012-08-14			ENSG00000125815	ENSG00000125815			2480	protein-coding gene	gene with protein product		608683				7619504, 20565543	Standard	NM_005492		Approved	CRES, CTES5	uc002wth.1	O60676	OTTHUMG00000032071	ENST00000246012.1:c.50C>A	20.37:g.23472354C>A	ENSP00000246012:p.Ala17Asp		Somatic					p.A17D	NM_005492	NP_005483	WXS	Illumina HiSeq	Unspecified	O60676	CST8_HUMAN			2	407	+	Colorectal(13;0.0431)|Lung NSC(19;0.235)		17					Q2M2X6	Missense_Mutation	SNP	ENST00000246012.1	37	c.50C>A	CCDS13156.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.367119	0.24771	.	.	ENSG00000125815	ENST00000449810;ENST00000246012	T;T	0.12465	2.68;2.96	4.05	-0.703	0.11261	.	0.499396	0.20822	N	0.085042	T	0.15003	0.0362	L	0.58101	1.795	0.09310	N	1	P	0.52316	0.952	P	0.49752	0.621	T	0.10823	-1.0613	10	0.35671	T	0.21	-1.503	3.7449	0.08544	0.0:0.4314:0.1849:0.3836	.	17	O60676	CST8_HUMAN	D	17	ENSP00000399144:A17D;ENSP00000246012:A17D	ENSP00000246012:A17D	A	+	2	0	CST8	23420354	0.106000	0.21978	0.002000	0.10522	0.014000	0.08584	0.127000	0.15790	-0.085000	0.12573	-0.165000	0.13383	GCC		0.572	CST8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078336.1			7	95	1	0	0.00307968	0.00308	0.0035758	7	95				
ACTR5	79913	broad.mit.edu	37	20	37394929	37394929	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr20:37394929A>G	ENST00000243903.4	+	7	1379	c.1342A>G	c.(1342-1344)Aga>Gga	p.R448G		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	448					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				TGGGACAGAAAGAATTCGAGC	0.413																																							uc002xjd.2		NA																	0					0						c.(1342-1344)AGA>GGA		ARP5 actin-related protein 5 homolog							102.0	105.0	104.0					20																	37394929		2203	4300	6503	SO:0001583	missense	79913				DNA recombination|double-strand break repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent|UV-damage excision repair	cytoplasm|Ino80 complex	ATP binding|protein binding	g.chr20:37394929A>G	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.1342A>G	20.37:g.37394929A>G	ENSP00000243903:p.Arg448Gly		Somatic					p.R448G	NM_024855	NP_079131	WXS	Illumina HiSeq	Unspecified	Q9H9F9	ARP5_HUMAN			7	1367	+		Myeloproliferative disorder(115;0.00878)	448					Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	ENST00000243903.4	37	c.1342A>G	CCDS13308.1	.	.	.	.	.	.	.	.	.	.	A	19.23	3.787620	0.70337	.	.	ENSG00000101442	ENST00000243903	D	0.97209	-4.29	5.37	2.97	0.34412	.	0.000000	0.85682	D	0.000000	D	0.98732	0.9574	H	0.95470	3.675	0.58432	D	0.999993	D	0.69078	0.997	D	0.77004	0.989	D	0.98745	1.0718	10	0.87932	D	0	-17.5436	12.129	0.53932	0.7284:0.2716:0.0:0.0	.	448	Q9H9F9	ARP5_HUMAN	G	448	ENSP00000243903:R448G	ENSP00000243903:R448G	R	+	1	2	ACTR5	36828343	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.119000	0.57891	0.365000	0.24400	0.460000	0.39030	AGA		0.413	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855		10	102	0	0	0	0.008291	0	10	102				
TP53TG5	27296	broad.mit.edu	37	20	44003715	44003715	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr20:44003715G>A	ENST00000372726.3	-	4	888	c.732C>T	c.(730-732)tcC>tcT	p.S244S	SYS1_ENST00000426004.1_3'UTR|SYS1-DBNDD2_ENST00000452133.1_Intron|TP53TG5_ENST00000494455.1_5'Flank|TP53TG5_ENST00000537995.1_Silent_p.S228S|SYS1-DBNDD2_ENST00000475242.1_Intron	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	244					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						CAAGTGATGCGGAGCAGAAGC	0.612																																							uc002xny.2		NA																	0				central_nervous_system(1)	1						c.(730-732)TCC>TCT		TP53-target gene 5 protein							65.0	64.0	65.0					20																	44003715		2203	4300	6503	SO:0001819	synonymous_variant	27296				intracellular signal transduction|negative regulation of cell growth	cytoplasm|nucleus		g.chr20:44003715G>A	AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.732C>T	20.37:g.44003715G>A			Somatic				SYS1_uc002xnw.1_3'UTR|SYS1-DBNDD2_uc002xnx.2_Intron	p.S244S	NM_014477	NP_055292	WXS	Illumina HiSeq	Unspecified	Q9Y2B4	T53G5_HUMAN			4	813	-			244						Silent	SNP	ENST00000372726.3	37	c.732C>T	CCDS13352.1																																																																																				0.612	TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079460.1	NM_014477		11	93	0	0	0	0.000978	0	11	93				
PREX1	57580	broad.mit.edu	37	20	47262425	47262425	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr20:47262425G>C	ENST00000371941.3	-	26	3498	c.3476C>G	c.(3475-3477)tCa>tGa	p.S1159*	PREX1_ENST00000396220.1_Nonsense_Mutation_p.S1159*	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1159					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GTCGTGGCCTGAGTCCTCCTG	0.607																																							uc002xtw.1		NA																	0				lung(3)|ovary(2)|pancreas(1)	6						c.(3475-3477)TCA>TGA		phosphatidylinositol-3,4,							144.0	99.0	114.0					20																	47262425		2203	4300	6503	SO:0001587	stop_gained	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47262425G>C	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3476C>G	20.37:g.47262425G>C	ENSP00000361009:p.Ser1159*		Somatic				PREX1_uc002xtv.1_Nonsense_Mutation_p.S456*	p.S1159*	NM_020820	NP_065871	WXS	Illumina HiSeq	Unspecified	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		26	3499	-			1159					E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Nonsense_Mutation	SNP	ENST00000371941.3	37	c.3476C>G	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	43	10.072890	0.99330	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	.	.	.	4.8	4.8	0.61643	.	0.000000	0.48767	U	0.000172	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.2325	0.89938	0.0:0.0:1.0:0.0	.	.	.	.	X	1159	.	ENSP00000361009:S1159X	S	-	2	0	PREX1	46695832	1.000000	0.71417	0.991000	0.47740	0.934000	0.57294	9.354000	0.97083	2.370000	0.80446	0.655000	0.94253	TCA		0.607	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		2	41	0	0	0	0.004672	0	2	41				
DPM1	8813	broad.mit.edu	37	20	49575502	49575502	+	5'Flank	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr20:49575502A>T	ENST00000371588.5	-	0	0				DPM1_ENST00000371583.5_5'Flank|DPM1_ENST00000371582.4_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.E41D|DPM1_ENST00000466152.1_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						CGCAGCCAGAACGGCTGGTTC	0.617																																							uc002xvy.1		NA																	0				skin(2)|ovary(1)	3						c.(121-123)GAA>GAT		molybdenum cofactor synthesis 3							39.0	45.0	43.0					20																	49575502		2161	4212	6373	SO:0001631	upstream_gene_variant	27304				enzyme active site formation via L-cysteine persulfide|Mo-molybdopterin cofactor biosynthetic process|tRNA thio-modification|tRNA wobble uridine modification|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|nucleotidyltransferase activity|protein binding|thiosulfate sulfurtransferase activity|URM1 activating enzyme activity	g.chr20:49575502A>T	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575502A>T	Exception_encountered		Somatic				DPM1_uc002xvw.1_5'Flank|DPM1_uc002xvx.1_5'Flank	p.E41D	NM_014484	NP_055299	WXS	Illumina HiSeq	Unspecified	O95396	MOCS3_HUMAN			1	140	+			41					O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	c.123A>T	CCDS13434.1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.824299	0.32237	.	.	ENSG00000124217	ENST00000244051	T	0.72394	-0.65	4.35	-0.799	0.10901	.	1.877210	0.03296	U	0.188225	T	0.50205	0.1602	N	0.08118	0	0.09310	N	1	B	0.27498	0.18	B	0.23574	0.047	T	0.35450	-0.9788	9	.	.	.	-12.862	10.165	0.42875	0.3257:0.0:0.6743:0.0	.	41	O95396	MOCS3_HUMAN	D	41	ENSP00000244051:E41D	.	E	+	3	2	MOCS3	49008909	0.000000	0.05858	0.007000	0.13788	0.005000	0.04900	0.103000	0.15292	-0.095000	0.12351	-0.290000	0.09829	GAA		0.617	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859		9	79	0	0	0	0.008291	0	9	79				
C22orf42	150297	broad.mit.edu	37	22	32555049	32555049	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr22:32555049C>A	ENST00000382097.3	-	1	226	c.154G>T	c.(154-156)Gat>Tat	p.D52Y	RP1-90G24.8_ENST00000426354.1_lincRNA	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	52										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						GCTTTCAAATCCAATTTGGCA	0.542																																							uc003amd.2		NA																	0				ovary(1)|skin(1)	2						c.(154-156)GAT>TAT		chromosome 22 open reading frame 42							171.0	152.0	159.0					22																	32555049		2203	4300	6503	SO:0001583	missense	150297							g.chr22:32555049C>A	BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.154G>T	22.37:g.32555049C>A	ENSP00000371529:p.Asp52Tyr		Somatic					p.D52Y	NM_001010859	NP_001010859	WXS	Illumina HiSeq	Unspecified	Q6IC83	CV042_HUMAN			1	195	-			52					A4QPH5	Missense_Mutation	SNP	ENST00000382097.3	37	c.154G>T	CCDS33639.1	.	.	.	.	.	.	.	.	.	.	C	1.435	-0.569223	0.03910	.	.	ENSG00000205856	ENST00000382097	T	0.38240	1.15	0.461	-0.922	0.10468	.	.	.	.	.	T	0.30479	0.0766	N	0.08118	0	0.09310	N	1	D	0.58970	0.984	D	0.65323	0.934	T	0.20140	-1.0284	8	0.87932	D	0	.	.	.	.	.	52	Q6IC83	CV042_HUMAN	Y	52	ENSP00000371529:D52Y	ENSP00000371529:D52Y	D	-	1	0	C22orf42	30885049	0.001000	0.12720	0.057000	0.19452	0.069000	0.16628	-1.069000	0.03444	-0.773000	0.04596	-1.326000	0.01283	GAT		0.542	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859		9	161	1	0	4.3838e-07	0.001855	5.50859e-07	9	161				
APOL4	80832	broad.mit.edu	37	22	36587493	36587493	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr22:36587493A>G	ENST00000352371.1	-	6	907	c.683T>C	c.(682-684)gTg>gCg	p.V228A	APOL4_ENST00000332987.1_Missense_Mutation_p.V225A|APOL4_ENST00000405511.1_3'UTR|APOL4_ENST00000479929.1_5'UTR|APOL4_ENST00000404685.3_3'UTR|APOL4_ENST00000429038.2_3'UTR			Q9BPW4	APOL4_HUMAN	apolipoprotein L, 4	229					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	extracellular space (GO:0005615)	lipid binding (GO:0008289)			lung(1)	1						AAAAGAAAGCACATTGGGTGT	0.468																																							uc003aox.2		NA																	0					0						c.(685-687)GTG>GCG		apolipoprotein L4 isoform 2 precursor							107.0	100.0	103.0					22																	36587493		2193	4293	6486	SO:0001583	missense	80832				lipid metabolic process|lipid transport|lipoprotein metabolic process	extracellular region	lipid binding	g.chr22:36587493A>G	AF305226	CCDS74851.1, CCDS74852.1	22q11.2-q13.2	2013-01-24			ENSG00000100336	ENSG00000100336		"""Apolipoproteins"""	14867	protein-coding gene	gene with protein product		607254				11374903	Standard	NM_030643		Approved	APOLIV	uc003aox.3	Q9BPW4	OTTHUMG00000150630	ENST00000352371.1:c.683T>C	22.37:g.36587493A>G	ENSP00000338260:p.Val228Ala		Somatic				APOL4_uc003aow.2_Missense_Mutation_p.V226A|APOL4_uc010gww.2_Missense_Mutation_p.V71A	p.V229A	NM_145660	NP_663693	WXS	Illumina HiSeq	Unspecified	Q9BPW4	APOL4_HUMAN			6	911	-			229					Q9BQ37|Q9BXQ8	Missense_Mutation	SNP	ENST00000352371.1	37	c.686T>C		.	.	.	.	.	.	.	.	.	.	a	9.217	1.032524	0.19590	.	.	ENSG00000100336	ENST00000352371;ENST00000332987	T;T	0.03358	3.96;3.96	2.38	2.38	0.29361	.	1.979650	0.02710	N	0.112752	T	0.04861	0.0131	L	0.36672	1.1	0.23056	N	0.99836	B;B	0.24043	0.096;0.021	B;B	0.28139	0.086;0.028	T	0.40327	-0.9569	10	0.26408	T	0.33	.	6.6786	0.23108	1.0:0.0:0.0:0.0	.	229;225	Q9BPW4;Q9BPW4-3	APOL4_HUMAN;.	A	228;225	ENSP00000338260:V228A;ENSP00000333229:V225A	ENSP00000333229:V225A	V	-	2	0	APOL4	34917439	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	0.116000	0.15561	1.349000	0.45751	0.330000	0.21533	GTG		0.468	APOL4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_145660		4	57	0	0	0	0.000602	0	4	57				
EIF3L	51386	broad.mit.edu	37	22	38274119	38274119	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr22:38274119A>G	ENST00000412331.2	+	11	2098	c.1516A>G	c.(1516-1518)Atc>Gtc	p.I506V	EIF3L_ENST00000381683.6_Missense_Mutation_p.I458V|EIF3L_ENST00000406934.1_Missense_Mutation_p.I408V	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L											kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GACCAGCGGTATCTCAGCCCT	0.517																																							uc003auf.2		NA																	0				ovary(1)	1						c.(1516-1518)ATC>GTC		eukaryotic translation initiation factor 3							66.0	63.0	64.0					22																	38274119		2178	4233	6411	SO:0001583	missense	51386					eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity	g.chr22:38274119A>G	AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.1516A>G	22.37:g.38274119A>G	ENSP00000416892:p.Ile506Val		Somatic				EIF3L_uc003aue.1_Missense_Mutation_p.I506V|EIF3L_uc011ann.1_Missense_Mutation_p.I458V|EIF3L_uc003aug.2_Missense_Mutation_p.I398V|EIF3L_uc003auh.2_Missense_Mutation_p.I239V	p.I506V	NM_016091	NP_057175	WXS	Illumina HiSeq	Unspecified	Q9Y262	EIF3L_HUMAN			11	1603	+			506						Missense_Mutation	SNP	ENST00000412331.2	37	c.1516A>G	CCDS13960.1	.	.	.	.	.	.	.	.	.	.	a	4.823	0.152948	0.09185	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934;ENST00000450376	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.07	4.04	0.47022	.	0.094804	0.64402	N	0.000001	T	0.28001	0.0690	N	0.22421	0.69	0.52501	D	0.999955	B;B;B;B	0.15141	0.0;0.012;0.0;0.0	B;B;B;B	0.15484	0.002;0.013;0.002;0.003	T	0.04454	-1.0950	10	0.30854	T	0.27	-23.7178	10.6054	0.45392	0.9242:0.0:0.0758:0.0	.	458;408;506;549	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	V	506;549;458;473;408;18	ENSP00000416892:I506V;ENSP00000371099:I458V;ENSP00000384634:I408V;ENSP00000412349:I18V	ENSP00000262832:I473V	I	+	1	0	EIF3L	36604065	1.000000	0.71417	1.000000	0.80357	0.211000	0.24417	6.285000	0.72658	0.883000	0.36040	0.364000	0.22116	ATC		0.517	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319551.2	NM_016091		3	95	0	0	0	0.000602	0	3	95				
SCN11A	11280	broad.mit.edu	37	3	38936043	38936043	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:38936043T>C	ENST00000302328.3	-	15	3014	c.2816A>G	c.(2815-2817)cAa>cGa	p.Q939R	SCN11A_ENST00000456224.3_Missense_Mutation_p.Q939R|SCN11A_ENST00000450244.1_Missense_Mutation_p.Q939R|SCN11A_ENST00000444237.2_Missense_Mutation_p.Q939R	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	939					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGGCTCAGGTTGTGTGATGCG	0.493																																							uc011ays.1		NA																	0				skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(2815-2817)CAA>CGA		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						233.0	235.0	234.0					3																	38936043		2203	4300	6503	SO:0001583	missense	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38936043T>C	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.2816A>G	3.37:g.38936043T>C	ENSP00000307599:p.Gln939Arg		Somatic				SCN11A_uc010hhn.1_Missense_Mutation_p.Q55R	p.Q939R	NM_014139	NP_054858	WXS	Illumina HiSeq	Unspecified	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	15	3015	-			939					A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	c.2816A>G	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	T	10.75	1.437721	0.25900	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	5.2	1.5	0.22942	Sodium ion transport-associated (1);	17.794200	0.00166	N	0.000000	T	0.80171	0.4574	M	0.62723	1.935	0.09310	N	1	B	0.17667	0.023	B	0.17433	0.018	T	0.52902	-0.8513	10	0.27785	T	0.31	.	4.4944	0.11830	0.0:0.1721:0.1682:0.6597	.	939	Q9UI33	SCNBA_HUMAN	R	939	ENSP00000307599:Q939R;ENSP00000400945:Q939R;ENSP00000416757:Q939R;ENSP00000408028:Q939R	ENSP00000307599:Q939R	Q	-	2	0	SCN11A	38911047	0.482000	0.25948	0.001000	0.08648	0.007000	0.05969	1.217000	0.32455	0.293000	0.22520	0.528000	0.53228	CAA		0.493	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		21	211	0	0	0	0.003954	0	21	211				
LIMD1	8994	broad.mit.edu	37	3	45715878	45715878	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:45715878A>G	ENST00000273317.4	+	7	1889	c.1868A>G	c.(1867-1869)tAc>tGc	p.Y623C		NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	623	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.|Necessary for nuclear localization.				cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		GACAGAGACTACCACGTGGAG	0.577																																							uc003coq.2		NA																	0				ovary(1)	1						c.(1867-1869)TAC>TGC		LIM domains containing 1							96.0	85.0	89.0					3																	45715878		2203	4300	6503	SO:0001583	missense	8994				cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding	g.chr3:45715878A>G	AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.1868A>G	3.37:g.45715878A>G	ENSP00000273317:p.Tyr623Cys		Somatic					p.Y623C	NM_014240	NP_055055	WXS	Illumina HiSeq	Unspecified	Q9UGP4	LIMD1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)	7	1917	+			623			LIM zinc-binding 3.|Necessary for nuclear localization.		Q17RQ1|Q9BQQ9|Q9NQ47	Missense_Mutation	SNP	ENST00000273317.4	37	c.1868A>G	CCDS2729.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.160971	0.78226	.	.	ENSG00000144791	ENST00000273317	D	0.91843	-2.92	5.71	1.8	0.24995	Zinc finger, LIM-type (4);	0.142736	0.48767	D	0.000162	D	0.96172	0.8752	M	0.90922	3.16	0.54753	D	0.999983	D	0.89917	1.0	D	0.87578	0.998	D	0.95097	0.8227	10	0.87932	D	0	.	10.8374	0.46696	0.6387:0.0:0.0:0.3612	.	623	Q9UGP4	LIMD1_HUMAN	C	623	ENSP00000273317:Y623C	ENSP00000273317:Y623C	Y	+	2	0	LIMD1	45690882	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	4.901000	0.63259	0.060000	0.16281	0.533000	0.62120	TAC		0.577	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257327.1	NM_014240		8	43	0	0	0	0.000978	0	8	43				
IP6K1	9807	broad.mit.edu	37	3	49765625	49765625	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:49765625C>T	ENST00000321599.4	-	5	1004	c.703G>A	c.(703-705)Gac>Aac	p.D235N	IP6K1_ENST00000395238.1_Missense_Mutation_p.D70N|IP6K1_ENST00000460540.1_Missense_Mutation_p.D70N|IP6K1_ENST00000468463.1_Missense_Mutation_p.D235N	NM_001242829.1|NM_153273.3	NP_001229758.1|NP_695005.1	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1	235					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	15						GCTGACGCGTCATCGCCATGC	0.617																																							uc003cxm.1		NA																	0					0						c.(703-705)GAC>AAC		inositol hexakisphosphate kinase 1 isoform 1							115.0	97.0	103.0					3																	49765625		2203	4300	6503	SO:0001583	missense	9807				phosphatidylinositol phosphorylation	cytoplasm|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity	g.chr3:49765625C>T	D87452	CCDS33760.1, CCDS43092.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000176095	ENSG00000176095			18360	protein-coding gene	gene with protein product		606991	"""inositol hexaphosphate kinase 1"""	IHPK1			Standard	NM_001242829		Approved	KIAA0263	uc003cxm.1	Q92551	OTTHUMG00000158197	ENST00000321599.4:c.703G>A	3.37:g.49765625C>T	ENSP00000323780:p.Asp235Asn		Somatic				IP6K1_uc003cxn.1_Missense_Mutation_p.D70N|IP6K1_uc011bcv.1_Missense_Mutation_p.D70N|IP6K1_uc003cxo.2_Missense_Mutation_p.D235N	p.D235N	NM_153273	NP_695005	WXS	Illumina HiSeq	Unspecified	Q92551	IP6K1_HUMAN			5	1018	-			235					A8K157|A8MUX4|Q7L3I7|Q96E38	Missense_Mutation	SNP	ENST00000321599.4	37	c.703G>A	CCDS33760.1	.	.	.	.	.	.	.	.	.	.	C	36	5.904849	0.97087	.	.	ENSG00000176095	ENST00000321599;ENST00000395238;ENST00000468463;ENST00000460540	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.50394	0.1613	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.996;0.999	T	0.45483	-0.9258	10	0.44086	T	0.13	-19.4465	19.4967	0.95075	0.0:1.0:0.0:0.0	.	235;235	C9JNA8;Q92551	.;IP6K1_HUMAN	N	235;70;235;70	ENSP00000323780:D235N;ENSP00000378659:D70N;ENSP00000420467:D235N;ENSP00000420762:D70N	ENSP00000323780:D235N	D	-	1	0	IP6K1	49740629	1.000000	0.71417	0.885000	0.34714	0.939000	0.58152	7.818000	0.86416	2.610000	0.88304	0.655000	0.94253	GAC		0.617	IP6K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350380.1	NM_153273		13	64	0	0	0	0.001855	0	13	64				
OR5K1	26339	broad.mit.edu	37	3	98188893	98188893	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:98188893T>A	ENST00000332650.5	+	1	570	c.473T>A	c.(472-474)aTt>aAt	p.I158N		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CATTCCATGATTCATGTAGGG	0.428																																							uc003dsm.2		NA																	0				large_intestine(1)	1						c.(472-474)ATT>AAT		olfactory receptor, family 5, subfamily K,							200.0	202.0	202.0					3																	98188893		2203	4300	6503	SO:0001583	missense	26339				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:98188893T>A	X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.473T>A	3.37:g.98188893T>A	ENSP00000373193:p.Ile158Asn		Somatic					p.I158N	NM_001004736	NP_001004736	WXS	Illumina HiSeq	Unspecified	Q8NHB7	OR5K1_HUMAN			1	473	+			158			Helical; Name=4; (Potential).		B9EGY5|Q6IF46	Missense_Mutation	SNP	ENST00000332650.5	37	c.473T>A	CCDS43115.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.102784	0.56183	.	.	ENSG00000232382	ENST00000332650	T	0.38722	1.12	5.33	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.335977	0.21541	N	0.072890	T	0.64983	0.2648	M	0.90019	3.08	0.23361	N	0.99784	D	0.53885	0.963	D	0.66979	0.948	T	0.59616	-0.7421	10	0.87932	D	0	-14.8636	5.8048	0.18434	0.0:0.0874:0.1673:0.7453	.	158	Q8NHB7	OR5K1_HUMAN	N	158	ENSP00000373193:I158N	ENSP00000373193:I158N	I	+	2	0	OR5K1	99671583	0.002000	0.14202	0.988000	0.46212	0.851000	0.48451	0.759000	0.26461	0.849000	0.35215	0.460000	0.39030	ATT		0.428	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359019.1			18	176	0	0	0	0.008871	0	18	176				
ZBTB11	27107	broad.mit.edu	37	3	101390835	101390835	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:101390835T>C	ENST00000312938.4	-	2	1113	c.533A>G	c.(532-534)cAt>cGt	p.H178R	ZBTB11_ENST00000461821.1_Missense_Mutation_p.H178R	NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	178					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CACAAGTTCATGTTTGGATAC	0.393																																							uc003dve.3		NA																	0				skin(1)	1						c.(532-534)CAT>CGT		zinc finger protein ZNF-U69274							108.0	115.0	113.0					3																	101390835		2203	4300	6503	SO:0001583	missense	27107				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:101390835T>C	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.533A>G	3.37:g.101390835T>C	ENSP00000326200:p.His178Arg		Somatic				ZBTB11_uc003dvf.2_Missense_Mutation_p.H178R	p.H178R	NM_014415	NP_055230	WXS	Illumina HiSeq	Unspecified	O95625	ZBT11_HUMAN			2	763	-			178					Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	37	c.533A>G	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.797328	0.90538	.	.	ENSG00000066422	ENST00000312938;ENST00000461821	T;T	0.37235	2.79;1.21	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.57140	0.2033	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.58967	-0.7542	10	0.87932	D	0	-16.2384	16.4277	0.83824	0.0:0.0:0.0:1.0	.	178;178	C9J2L2;O95625	.;ZBT11_HUMAN	R	178	ENSP00000326200:H178R;ENSP00000417369:H178R	ENSP00000326200:H178R	H	-	2	0	ZBTB11	102873525	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.838000	0.75359	2.279000	0.76181	0.533000	0.62120	CAT		0.393	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415		8	61	0	0	0	0.000978	0	8	61				
KIAA2018	205717	broad.mit.edu	37	3	113378654	113378654	+	Silent	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:113378654T>C	ENST00000478658.1	-	5	1892	c.1875A>G	c.(1873-1875)ccA>ccG	p.P625P	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.P625P			Q68DE3	K2018_HUMAN	KIAA2018	625						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CAAAAGTCTGTGGTGTTGGAA	0.433																																							uc003eam.2		NA																	0				skin(2)|ovary(1)	3						c.(1873-1875)CCA>CCG		hypothetical protein LOC205717							154.0	148.0	150.0					3																	113378654		1908	4125	6033	SO:0001819	synonymous_variant	205717				regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr3:113378654T>C	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.1875A>G	3.37:g.113378654T>C			Somatic				KIAA2018_uc003eal.2_Silent_p.P569P	p.P625P	NM_001009899	NP_001009899	WXS	Illumina HiSeq	Unspecified	Q68DE3	K2018_HUMAN			7	2286	-			625					Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	c.1875A>G	CCDS43133.1																																																																																				0.433	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		15	95	0	0	0	0.00499	0	15	95				
IQCB1	9657	broad.mit.edu	37	3	121547451	121547451	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:121547451G>A	ENST00000310864.6	-	4	343	c.129C>T	c.(127-129)agC>agT	p.S43S	IQCB1_ENST00000349820.6_Silent_p.S43S	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	43					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)			NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		TCAACTCTGAGCTTCCTAAAG	0.308																																							uc010hre.1		NA																	0					0						c.(127-129)AGC>AGT		IQ motif containing B1 isoform a							54.0	51.0	52.0					3																	121547451		2203	4299	6502	SO:0001819	synonymous_variant	9657				cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding	g.chr3:121547451G>A	D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.129C>T	3.37:g.121547451G>A			Somatic				IQCB1_uc003eek.2_Silent_p.S43S|IQCB1_uc010hrf.1_RNA	p.S43S	NM_001023570	NP_001018864	WXS	Illumina HiSeq	Unspecified	Q15051	IQCB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0983)	4	344	-			43					Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Silent	SNP	ENST00000310864.6	37	c.129C>T	CCDS33837.1																																																																																				0.308	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	NM_014642		5	29	0	0	0	0.001168	0	5	29				
RPN1	6184	broad.mit.edu	37	3	128345617	128345617	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:128345617T>C	ENST00000296255.3	-	6	1143	c.1095A>G	c.(1093-1095)atA>atG	p.I365M	RPN1_ENST00000497289.1_Missense_Mutation_p.I193M|RPN1_ENST00000490166.1_5'UTR	NM_002950.3	NP_002941.1	P04843	RPN1_HUMAN	ribophorin I	365					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|stomach(2)	13				GBM - Glioblastoma multiforme(114;0.189)		TCAGAGAATCTATCACTTGTT	0.463			T	EVI1	AML																																		uc003ekr.1		NA		Dom	yes		3	3q21.3-q25.2	6184	T	ribophorin I			L	EVI1		AML		0				ovary(2)|central_nervous_system(1)	3						c.(1093-1095)ATA>ATG		ribophorin I precursor							244.0	186.0	206.0					3																	128345617		2203	4300	6503	SO:0001583	missense	6184				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|melanosome|oligosaccharyltransferase complex|rough microsome	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding	g.chr3:128345617T>C		CCDS3051.1	3q21.3	2013-03-06			ENSG00000163902	ENSG00000163902			10381	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 1 homolog (S. cerevisiae)"", ""oligosaccharyltransferase complex subunit (non-catalytic)"""	180470					Standard	NM_002950		Approved	OST1	uc003ekr.1	P04843	OTTHUMG00000159691	ENST00000296255.3:c.1095A>G	3.37:g.128345617T>C	ENSP00000296255:p.Ile365Met		Somatic				RPN1_uc011bkq.1_Missense_Mutation_p.I193M	p.I365M	NM_002950	NP_002941	WXS	Illumina HiSeq	Unspecified	P04843	RPN1_HUMAN		GBM - Glioblastoma multiforme(114;0.189)	6	1171	-			365			Lumenal (Potential).		B2R5Z0|D3DNB6|Q68DT1	Missense_Mutation	SNP	ENST00000296255.3	37	c.1095A>G	CCDS3051.1	.	.	.	.	.	.	.	.	.	.	T	17.86	3.491789	0.64074	.	.	ENSG00000163902	ENST00000296255;ENST00000497289;ENST00000537139;ENST00000545956	.	.	.	5.28	-0.556	0.11803	.	0.158753	0.64402	D	0.000012	T	0.68686	0.3028	M	0.84326	2.69	0.50313	D	0.999862	D	0.62365	0.991	D	0.68943	0.961	T	0.65203	-0.6225	9	0.62326	D	0.03	-9.8444	3.89	0.09114	0.128:0.0702:0.3989:0.403	.	365	P04843	RPN1_HUMAN	M	365;193;136;339	.	ENSP00000296255:I365M	I	-	3	3	RPN1	129828307	0.449000	0.25689	0.999000	0.59377	0.988000	0.76386	-0.333000	0.07894	-0.019000	0.14055	-0.435000	0.05868	ATA		0.463	RPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356934.2	NM_002950		22	84	0	0	0	0.00333	0	22	84				
EFCAB12	90288	broad.mit.edu	37	3	129140646	129140646	+	Splice_Site	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:129140646C>A	ENST00000505956.1	-	2	212	c.50G>T	c.(49-51)gGa>gTa	p.G17V	EFCAB12_ENST00000326085.3_Splice_Site_p.G17V	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	17							calcium ion binding (GO:0005509)										CGGGCAGAGTCCTTGGGGTAA	0.507																																							uc003emg.2		NA																	0					NA						c.(49-51)GGA>GTA		hypothetical protein LOC90288							25.0	24.0	24.0					3																	129140646		1877	4106	5983	SO:0001630	splice_region_variant	0							g.chr3:129140646C>A	AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.50-1G>T	3.37:g.129140646C>A			Somatic					p.G17V	NM_207307	NP_997190	WXS	Illumina HiSeq	Unspecified					2	213	-								Q69YX4	Missense_Mutation	SNP	ENST00000505956.1	37	c.50G>T	CCDS54638.1	.	.	.	.	.	.	.	.	.	.	C	8.224	0.803199	0.16397	.	.	ENSG00000172771	ENST00000505956;ENST00000326085	T;T	0.15487	2.42;2.42	3.41	1.54	0.23209	.	1.291170	0.05574	N	0.571633	T	0.10465	0.0256	N	0.14661	0.345	0.22803	N	0.998711	P	0.36909	0.573	B	0.36092	0.217	T	0.27673	-1.0067	10	0.56958	D	0.05	.	3.9617	0.09413	0.2343:0.6391:0.0:0.1266	.	17	Q6NXP0	CC025_HUMAN	V	17	ENSP00000420854:G17V;ENSP00000324241:G17V	ENSP00000324241:G17V	G	-	2	0	C3orf25	130623336	0.389000	0.25205	0.092000	0.20876	0.530000	0.34684	0.413000	0.21148	0.401000	0.25424	0.655000	0.94253	GGA		0.507	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355530.1	NM_207307	Missense_Mutation	4	24	1	0	0.000602214	0.000602	0.000712216	4	24				
ZIC4	84107	broad.mit.edu	37	3	147108886	147108886	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:147108886C>G	ENST00000383075.3	-	4	1348	c.836G>C	c.(835-837)aGc>aCc	p.S279T	ZIC4_ENST00000484399.1_Missense_Mutation_p.S279T|ZIC4_ENST00000491672.1_Missense_Mutation_p.S73T|ZIC4_ENST00000525172.2_Missense_Mutation_p.S329T|ZIC4_ENST00000425731.3_Missense_Mutation_p.S317T|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000473123.1_Missense_Mutation_p.S279T	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	279						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						ACGCAGCGAGCTGGGGTGCGT	0.642																																							uc003ewd.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(835-837)AGC>ACC		zinc finger protein of the cerebellum 4							40.0	46.0	44.0					3																	147108886		2203	4300	6503	SO:0001583	missense	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147108886C>G	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.836G>C	3.37:g.147108886C>G	ENSP00000372553:p.Ser279Thr		Somatic				ZIC4_uc003ewc.1_Missense_Mutation_p.S209T|ZIC4_uc011bno.1_Missense_Mutation_p.S329T	p.S279T	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			4	1109	-			279			C2H2-type 5.		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	c.836G>C	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	C	33	5.219696	0.95139	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672	T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;1.27	5.05	5.05	0.67936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000037	T	0.68100	0.2964	L	0.48642	1.525	0.45594	D	0.998537	D;D	0.76494	0.975;0.999	P;D	0.85130	0.897;0.997	T	0.71431	-0.4595	9	0.87932	D	0	.	18.4032	0.90525	0.0:1.0:0.0:0.0	.	329;279	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	T	279;317;329;279;279;73	ENSP00000372553:S279T;ENSP00000397695:S317T;ENSP00000435509:S329T;ENSP00000417855:S279T;ENSP00000420775:S279T;ENSP00000418277:S73T	ENSP00000372553:S279T	S	-	2	0	ZIC4	148591576	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.734000	0.84928	2.337000	0.79520	0.462000	0.41574	AGC		0.642	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			6	34	0	0	0	0.001984	0	6	34				
KCNAB1	7881	broad.mit.edu	37	3	156249199	156249199	+	Splice_Site	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:156249199G>A	ENST00000490337.1	+	13	1147	c.1083G>A	c.(1081-1083)gcG>gcA	p.A361A	KCNAB1_ENST00000302490.8_Splice_Site_p.A343A|KCNAB1_ENST00000471742.1_Splice_Site_p.A350A|KCNAB1_ENST00000389636.5_Splice_Site_p.A332A|KCNAB1_ENST00000389634.5_Splice_Site_p.A314A|KCNAB1_ENST00000497291.1_3'UTR	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	361					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TCCTCCCAGCGTGGTGCCTGA	0.463																																							uc003far.2		NA																	0				ovary(3)|skin(1)	4						c.(1081-1083)GCG>GCA		potassium voltage-gated channel, shaker-related							234.0	205.0	215.0					3																	156249199		2203	4300	6503	SO:0001630	splice_region_variant	7881					cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity	g.chr3:156249199G>A	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.1082-1G>A	3.37:g.156249199G>A			Somatic				KCNAB1_uc011bon.1_Silent_p.A332A|KCNAB1_uc003fas.2_Silent_p.A350A|KCNAB1_uc003fat.2_Silent_p.A343A|KCNAB1_uc010hvt.1_Silent_p.A314A|KCNAB1_uc011boo.1_Silent_p.A237A	p.A361A	NM_172160	NP_751892	WXS	Illumina HiSeq	Unspecified	Q14722	KCAB1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)		13	1147	+			361					A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Silent	SNP	ENST00000490337.1	37	c.1083G>A	CCDS3174.1																																																																																				0.463	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	Silent	6	211	0	0	0	0.00308	0	6	211				
SI	6476	broad.mit.edu	37	3	164725752	164725752	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:164725752G>T	ENST00000264382.3	-	36	4276	c.4214C>A	c.(4213-4215)aCa>aAa	p.T1405K		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1405	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATTAGTAGTTGTTCCATTTAC	0.279										HNSCC(35;0.089)																													uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(4213-4215)ACA>AAA		sucrase-isomaltase	Acarbose(DB00284)						147.0	151.0	149.0					3																	164725752		2202	4293	6495	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164725752G>T	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4214C>A	3.37:g.164725752G>T	ENSP00000264382:p.Thr1405Lys	HNSCC(35;0.089)	Somatic					p.T1405K	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			36	4276	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1405			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.4214C>A	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611708	0.46631	.	.	ENSG00000090402	ENST00000264382	D	0.88586	-2.4	5.06	4.18	0.49190	Glycoside hydrolase, superfamily (1);	0.279202	0.34879	N	0.003607	D	0.85496	0.5710	L	0.52126	1.63	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.76629	-0.2889	10	0.48119	T	0.1	.	13.0331	0.58854	0.0:0.0:0.8387:0.1613	.	1405	P14410	SUIS_HUMAN	K	1405	ENSP00000264382:T1405K	ENSP00000264382:T1405K	T	-	2	0	SI	166208446	0.827000	0.29292	0.015000	0.15790	0.687000	0.40016	4.174000	0.58256	1.343000	0.45638	0.585000	0.79938	ACA		0.279	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		27	82	1	0	5.8336e-16	0.003271	7.93038e-16	27	82				
BCHE	590	broad.mit.edu	37	3	165547467	165547467	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:165547467C>A	ENST00000264381.3	-	2	1521	c.1355G>T	c.(1354-1356)cGa>cTa	p.R452L	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	452					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	TTTGGAGGATCGGTGTTCAAA	0.403																																							uc003fem.3		NA																	0				ovary(3)|pancreas(1)	4						c.(1354-1356)CGA>CTA		butyrylcholinesterase precursor	Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)						103.0	106.0	105.0					3																	165547467		2203	4300	6503	SO:0001583	missense	590				choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding	g.chr3:165547467C>A	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1355G>T	3.37:g.165547467C>A	ENSP00000264381:p.Arg452Leu		Somatic				BCHE_uc003fen.3_Intron	p.R452L	NM_000055	NP_000046	WXS	Illumina HiSeq	Unspecified	P06276	CHLE_HUMAN			2	1515	-			452					A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	37	c.1355G>T	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018696	0.54576	.	.	ENSG00000114200	ENST00000264381	T	0.69040	-0.37	5.52	4.65	0.58169	Carboxylesterase, type B (1);	0.068246	0.64402	D	0.000013	T	0.74566	0.3733	M	0.82716	2.605	0.80722	D	1	B	0.22541	0.071	B	0.37346	0.247	T	0.75554	-0.3277	10	0.87932	D	0	.	13.2064	0.59798	0.0:0.9234:0.0:0.0766	.	452	P06276	CHLE_HUMAN	L	452	ENSP00000264381:R452L	ENSP00000264381:R452L	R	-	2	0	BCHE	167030161	0.731000	0.28111	1.000000	0.80357	0.996000	0.88848	1.412000	0.34714	1.339000	0.45563	0.591000	0.81541	CGA		0.403	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1			13	129	1	0	1.67942e-08	0.006122	2.16735e-08	13	129				
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		555	Substitution - Missense(555)	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1624-1626)GAA>AAA		phosphoinositide-3-kinase, catalytic, alpha							56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178936082G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.E542K	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		10	1781	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		542		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).	PI3K helical.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1624G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			6	54	0	0	0	0.004482	0	6	54				
ACTL6A	86	broad.mit.edu	37	3	179287926	179287926	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:179287926C>T	ENST00000429709.2	+	3	387	c.174C>T	c.(172-174)ggC>ggT	p.G58G	ACTL6A_ENST00000392662.1_Silent_p.G16G|ACTL6A_ENST00000450518.2_Silent_p.G16G	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	58					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			AAATAGATGGCGATAAAGGCA	0.433																																							uc003fjw.2		NA																	0				ovary(1)	1						c.(172-174)GGC>GGT		actin-like 6A isoform 1							196.0	178.0	184.0					3																	179287926		2203	4300	6503	SO:0001819	synonymous_variant	86				chromatin remodeling|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|nervous system development|regulation of growth|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	Ino80 complex|npBAF complex|NuA4 histone acetyltransferase complex|plasma membrane|SWI/SNF complex	ATP binding|chromatin binding	g.chr3:179287926C>T	AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.174C>T	3.37:g.179287926C>T			Somatic				ACTL6A_uc003fjx.2_Silent_p.G16G|ACTL6A_uc003fjy.2_Silent_p.G16G	p.G58G	NM_004301	NP_004292	WXS	Illumina HiSeq	Unspecified	O96019	ACL6A_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)		3	347	+	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		58					B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Silent	SNP	ENST00000429709.2	37	c.174C>T	CCDS3231.1																																																																																				0.433	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349599.1	NM_004301		12	105	0	0	0	0.001368	0	12	105				
LAMP3	27074	broad.mit.edu	37	3	182872155	182872155	+	Missense_Mutation	SNP	A	A	G	rs531808500		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:182872155A>G	ENST00000265598.3	-	2	329	c.74T>C	c.(73-75)aTg>aCg	p.M25T	LAMP3_ENST00000466939.1_Start_Codon_SNP_p.M1T	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	25					cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			TTTTGCTCTCATTTGACTGCC	0.398																																							uc003flh.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(73-75)ATG>ACG		lysosomal-associated membrane protein 3							117.0	109.0	111.0					3																	182872155		2203	4300	6503	SO:0001583	missense	27074				cell proliferation	integral to membrane|lysosomal membrane		g.chr3:182872155A>G	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.74T>C	3.37:g.182872155A>G	ENSP00000265598:p.Met25Thr		Somatic					p.M25T	NM_014398	NP_055213	WXS	Illumina HiSeq	Unspecified	Q9UQV4	LAMP3_HUMAN	all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)		2	298	-	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		25					D3DNS4|O94781|Q8NEC8	Missense_Mutation	SNP	ENST00000265598.3	37	c.74T>C	CCDS3242.1	.	.	.	.	.	.	.	.	.	.	A	9.932	1.215100	0.22373	.	.	ENSG00000078081	ENST00000265598;ENST00000466939;ENST00000476015;ENST00000470251	T;T;T;T	0.52057	1.47;1.41;0.82;0.68	5.71	3.31	0.37934	.	1.264140	0.05353	N	0.532182	T	0.34745	0.0908	N	0.24115	0.695	0.40046	D	0.975711	B	0.10296	0.003	B	0.09377	0.004	T	0.18335	-1.0340	10	0.37606	T	0.19	-1.2467	6.2496	0.20837	0.7932:0.0:0.2068:0.0	.	25	Q9UQV4	LAMP3_HUMAN	T	25;1;25;1	ENSP00000265598:M25T;ENSP00000418912:M1T;ENSP00000419059:M25T;ENSP00000420589:M1T	ENSP00000265598:M25T	M	-	2	0	LAMP3	184354849	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	0.365000	0.20348	0.950000	0.37743	-0.408000	0.06270	ATG		0.398	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1			8	85	0	0	0	0.006214	0	8	85				
ABCF3	55324	broad.mit.edu	37	3	183905460	183905460	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:183905460T>A	ENST00000429586.2	+	5	542	c.357T>A	c.(355-357)aaT>aaA	p.N119K	ABCF3_ENST00000292808.5_Missense_Mutation_p.N113K|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	119					defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGACAGTGAATGCAAAGAAGT	0.512																																							uc003fmz.2		NA																	0				ovary(3)|lung(1)	4						c.(355-357)AAT>AAA		ATP-binding cassette, sub-family F (GCN20),							79.0	73.0	75.0					3																	183905460		2203	4300	6503	SO:0001583	missense	55324						ATP binding|ATPase activity	g.chr3:183905460T>A	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.357T>A	3.37:g.183905460T>A	ENSP00000411471:p.Asn119Lys		Somatic				ABCF3_uc003fna.2_Missense_Mutation_p.N113K|ABCF3_uc003fnb.2_5'Flank	p.N119K	NM_018358	NP_060828	WXS	Illumina HiSeq	Unspecified	Q9NUQ8	ABCF3_HUMAN	Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		5	490	+	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		119					A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	ENST00000429586.2	37	c.357T>A	CCDS3254.1	.	.	.	.	.	.	.	.	.	.	T	16.86	3.240161	0.58995	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.91792	-2.89;-2.91	4.57	-3.5	0.04710	.	0.188943	0.45867	D	0.000338	D	0.86268	0.5892	L	0.29908	0.895	0.43412	D	0.99555	P;P	0.39862	0.692;0.565	B;B	0.42522	0.39;0.108	T	0.81066	-0.1101	10	0.87932	D	0	-9.6759	12.7884	0.57520	0.0:0.5053:0.0:0.4947	.	113;119	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	K	119;113	ENSP00000411471:N119K;ENSP00000292808:N113K	ENSP00000292808:N113K	N	+	3	2	ABCF3	185388154	0.993000	0.37304	0.986000	0.45419	0.875000	0.50365	0.227000	0.17795	-0.417000	0.07461	0.379000	0.24179	AAT		0.512	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	NM_018358		3	87	0	0	0	0.000248	0	3	87				
POLR2H	5437	broad.mit.edu	37	3	184086079	184086079	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr3:184086079C>G	ENST00000456318.1	+	6	1499	c.450C>G	c.(448-450)ttC>ttG	p.F150L	POLR2H_ENST00000452961.1_Missense_Mutation_p.F114L|POLR2H_ENST00000296223.3_Missense_Mutation_p.F150L|POLR2H_ENST00000429568.1_Missense_Mutation_p.L172V|POLR2H_ENST00000438240.1_Missense_Mutation_p.F114L|EIF2B5_ENST00000444495.1_Intron|POLR2H_ENST00000443489.1_Missense_Mutation_p.F86L|POLR2H_ENST00000430783.1_Missense_Mutation_p.F122L	NM_001278699.1	NP_001265628.1	P52434	RPAB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide H	150					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGCTAGCCTTCTGAACCTCGC	0.567																																							uc003fok.1		NA																	0					0						c.(448-450)TTC>TTG		RNA polymerase II, polypeptide H							97.0	93.0	94.0					3																	184086079		2203	4300	6503	SO:0001583	missense	5437				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex|nucleolus	DNA-directed RNA polymerase activity|protein binding|zinc ion binding	g.chr3:184086079C>G		CCDS3264.1, CCDS63861.1, CCDS63862.1, CCDS63859.1, CCDS63860.1	3q28	2013-01-21			ENSG00000163882	ENSG00000163882		"""RNA polymerase subunits"""	9195	protein-coding gene	gene with protein product		606023					Standard	NM_001278698		Approved	RPB8	uc003fok.2	P52434	OTTHUMG00000156746	ENST00000456318.1:c.450C>G	3.37:g.184086079C>G	ENSP00000392913:p.Phe150Leu		Somatic				POLR2H_uc003foj.1_RNA	p.F150L	NM_006232	NP_006223	WXS	Illumina HiSeq	Unspecified	P52434	RPAB3_HUMAN	Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		5	537	+	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		150					C9J413|C9JBJ6|C9JCU7|C9JUA8|P53802|Q969R0	Missense_Mutation	SNP	ENST00000456318.1	37	c.450C>G	CCDS3264.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.320914|4.320914	0.81580|0.81580	.|.	.|.	ENSG00000163882|ENSG00000163882	ENST00000456318;ENST00000438240;ENST00000430783;ENST00000443489;ENST00000452961;ENST00000296223|ENST00000429568	.|.	.|.	.|.	5.74|5.74	3.97|3.97	0.46021|0.46021	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74015|0.74015	0.3661|0.3661	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	P|.	0.37636|.	0.603|.	B|.	0.36845|.	0.234|.	T|T	0.75825|0.75825	-0.3181|-0.3181	9|6	0.72032|0.87932	D|D	0.01|0	.|.	10.6177|10.6177	0.45460|0.45460	0.0:0.8436:0.0:0.1564|0.0:0.8436:0.0:0.1564	.|.	150|.	P52434|.	RPAB3_HUMAN|.	L|V	150;114;122;86;114;150|172	.|.	ENSP00000296223:F150L|ENSP00000415536:L172V	F|L	+|+	3|1	2|2	POLR2H|POLR2H	185568773|185568773	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	2.919000|2.919000	0.48836|0.48836	0.792000|0.792000	0.33850|0.33850	0.650000|0.650000	0.86243|0.86243	TTC|CTG		0.567	POLR2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345558.1	NM_006232		7	129	0	0	0	0.008291	0	7	129				
WHSC1	7468	broad.mit.edu	37	4	1902635	1902635	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr4:1902635G>T	ENST00000382895.3	+	4	685	c.254G>T	c.(253-255)cGg>cTg	p.R85L	WHSC1_ENST00000420906.2_Missense_Mutation_p.R85L|WHSC1_ENST00000398261.1_Missense_Mutation_p.R85L|WHSC1_ENST00000436793.1_Missense_Mutation_p.R85L|WHSC1_ENST00000503128.1_Missense_Mutation_p.R85L|WHSC1_ENST00000514045.1_Missense_Mutation_p.R85L|WHSC1_ENST00000382891.5_Missense_Mutation_p.R85L|WHSC1_ENST00000508803.1_Missense_Mutation_p.R85L|WHSC1_ENST00000382892.2_Missense_Mutation_p.R85L	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	85					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		CTTACTTCCCGGGTGTTTAAT	0.537			T	IGH@	MM																																		uc003gdz.3		NA		Dom	yes		4	4p16.3	7468	T	Wolf-Hirschhorn syndrome candidate 1(MMSET)			L	IGH@		MM		0				ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.(253-255)CGG>CTG		Wolf-Hirschhorn syndrome candidate 1 protein							58.0	60.0	59.0					4																	1902635		2203	4300	6503	SO:0001583	missense	7468				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr4:1902635G>T	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.254G>T	4.37:g.1902635G>T	ENSP00000372351:p.Arg85Leu		Somatic				WHSC1_uc003geb.3_Missense_Mutation_p.R85L|WHSC1_uc003gec.3_Missense_Mutation_p.R85L|WHSC1_uc003ged.3_Missense_Mutation_p.R85L|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gdx.2_Missense_Mutation_p.R85L|WHSC1_uc003gdy.1_Missense_Mutation_p.R85L|WHSC1_uc010icd.1_Missense_Mutation_p.R85L|WHSC1_uc003gea.1_Missense_Mutation_p.R85L|WHSC1_uc010ice.1_Missense_Mutation_p.R85L|WHSC1_uc003geg.1_Missense_Mutation_p.R85L|WHSC1_uc003geh.1_Missense_Mutation_p.R85L	p.R85L	NM_001042424	NP_001035889	WXS	Illumina HiSeq	Unspecified	O96028	NSD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)	2	430	+		all_epithelial(65;1.34e-05)	85					A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	c.254G>T	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475914	0.63737	.	.	ENSG00000109685	ENST00000508803;ENST00000514045;ENST00000515806;ENST00000382891;ENST00000382892;ENST00000436793;ENST00000420906;ENST00000382895;ENST00000503128;ENST00000509115;ENST00000398261	D;T;T;D;D;T;T;D;T;T;T	0.95377	-3.69;1.0;0.45;-3.69;-3.69;0.77;1.0;-3.69;0.98;1.06;0.98	5.59	5.59	0.84812	.	0.110120	0.41500	D	0.000865	D	0.93575	0.7949	L	0.36672	1.1	0.40147	D	0.976906	P;P;B;P;P	0.45396	0.857;0.771;0.02;0.857;0.857	P;B;B;P;P	0.48840	0.468;0.32;0.011;0.468;0.592	D	0.90895	0.4764	10	0.02654	T	1	.	19.5874	0.95495	0.0:0.0:1.0:0.0	.	85;85;85;85;85	O96028-3;O96028-7;O96028;O96028-5;O96028-6	.;.;NSD2_HUMAN;.;.	L	85	ENSP00000423972:R85L;ENSP00000421681:R85L;ENSP00000427434:R85L;ENSP00000372347:R85L;ENSP00000372348:R85L;ENSP00000416725:R85L;ENSP00000399251:R85L;ENSP00000372351:R85L;ENSP00000425761:R85L;ENSP00000422878:R85L;ENSP00000381311:R85L	ENSP00000308780:R85L	R	+	2	0	WHSC1	1872433	0.994000	0.37717	0.975000	0.42487	0.985000	0.73830	5.528000	0.67129	2.622000	0.88805	0.655000	0.94253	CGG		0.537	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330		16	45	1	0	2.35188e-11	0.006122	3.15235e-11	16	45				
SHROOM3	57619	broad.mit.edu	37	4	77661790	77661790	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr4:77661790G>C	ENST00000296043.6	+	5	3417	c.2464G>C	c.(2464-2466)Ggg>Cgg	p.G822R		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	822					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)		p.G821W(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CAGTACTTCTGGGAATGACTT	0.547																																							uc011cbx.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(2464-2466)GGG>CGG		shroom family member 3 protein							71.0	80.0	77.0					4																	77661790		2203	4300	6503	SO:0001583	missense	57619				apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding	g.chr4:77661790G>C	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2464G>C	4.37:g.77661790G>C	ENSP00000296043:p.Gly822Arg		Somatic				SHROOM3_uc011cbz.1_Missense_Mutation_p.G646R|SHROOM3_uc003hkf.1_Missense_Mutation_p.G697R|SHROOM3_uc003hkg.2_Missense_Mutation_p.G600R	p.G822R	NM_020859	NP_065910	WXS	Illumina HiSeq	Unspecified	Q8TF72	SHRM3_HUMAN	Lung(101;0.0903)		5	3417	+			822					Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	c.2464G>C	CCDS3579.2	.	.	.	.	.	.	.	.	.	.	g	11.41	1.630159	0.28978	.	.	ENSG00000138771	ENST00000296043	T	0.35973	1.28	5.55	2.4	0.29515	.	3.092850	0.00819	N	0.001571	T	0.35856	0.0946	L	0.54323	1.7	0.09310	N	1	B;B;B	0.18741	0.03;0.03;0.03	B;B;B	0.17098	0.017;0.017;0.017	T	0.14896	-1.0456	10	0.23302	T	0.38	-11.8263	7.0345	0.24985	0.2532:0.1845:0.5624:0.0	.	646;822;600	B4E244;Q8TF72;B3KY47	.;SHRM3_HUMAN;.	R	822	ENSP00000296043:G822R	ENSP00000296043:G822R	G	+	1	0	SHROOM3	77880814	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-0.367000	0.07553	0.684000	0.31448	0.558000	0.71614	GGG		0.547	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859		4	89	0	0	0	0.000602	0	4	89				
FRAS1	80144	broad.mit.edu	37	4	79440630	79440630	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr4:79440630G>A	ENST00000264895.6	+	67	10975	c.10535G>A	c.(10534-10536)aGa>aAa	p.R3512K		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3508					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GTTCTCTGGAGAACAGGTATG	0.468																																							uc003hlb.2		NA																	0				large_intestine(5)	5						c.(10534-10536)AGA>AAA		Fraser syndrome 1							193.0	187.0	189.0					4																	79440630		1890	4115	6005	SO:0001583	missense	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79440630G>A	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.10535G>A	4.37:g.79440630G>A	ENSP00000264895:p.Arg3512Lys		Somatic					p.R3512K	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			67	10975	+			3507			Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	c.10535G>A	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466543	0.84425	.	.	ENSG00000138759	ENST00000264895	T	0.11821	2.74	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.26122	0.0637	N	0.20807	0.61	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.04347	-1.0958	10	0.51188	T	0.08	.	19.5023	0.95100	0.0:0.0:1.0:0.0	.	3512	E9PHH6	.	K	3512	ENSP00000264895:R3512K	ENSP00000264895:R3512K	R	+	2	0	FRAS1	79659654	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	9.334000	0.96470	2.605000	0.88082	0.591000	0.81541	AGA		0.468	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				11	162	0	0	0	0.001368	0	11	162				
TET2	54790	broad.mit.edu	37	4	106156588	106156588	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr4:106156588A>T	ENST00000540549.1	+	3	2349	c.1489A>T	c.(1489-1491)Act>Tct	p.T497S	TET2_ENST00000305737.2_Missense_Mutation_p.T497S|TET2_ENST00000413648.2_Missense_Mutation_p.T497S|TET2_ENST00000394764.1_Missense_Mutation_p.T497S|TET2_ENST00000380013.4_Missense_Mutation_p.T497S|TET2_ENST00000545826.1_Missense_Mutation_p.T497S|TET2_ENST00000513237.1_Missense_Mutation_p.T518S			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	497					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.T497S(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		AGGGACAATGACTGTTCCATT	0.443			"""Mis N, F"""		MDS																																		uc003hxk.2		NA		Rec	yes		4	4q24	54790	Mis N|F	tet oncogene family member 2			L			MDS		1	Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(1)	haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733						c.(1489-1491)ACT>TCT		tet oncogene family member 2 isoform a							97.0	92.0	94.0					4																	106156588		2203	4300	6503	SO:0001583	missense	54790				cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr4:106156588A>T	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.1489A>T	4.37:g.106156588A>T	ENSP00000442788:p.Thr497Ser		Somatic				TET2_uc011cez.1_Missense_Mutation_p.T518S|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Missense_Mutation_p.T497S|TET2_uc003hxi.1_Missense_Mutation_p.T497S	p.T497S	NM_001127208	NP_001120680	WXS	Illumina HiSeq	Unspecified	Q6N021	TET2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)	3	1875	+		Myeloproliferative disorder(5;0.0393)	497					B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	ENST00000540549.1	37	c.1489A>T	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	A	8.602	0.887071	0.17540	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648;ENST00000535110	T;T;T;T;T;T;T	0.03717	3.83;4.48;3.83;4.48;4.48;3.83;3.84	4.43	0.859	0.19036	.	.	.	.	.	T	0.02418	0.0074	L	0.29908	0.895	0.09310	N	1	B;B;B	0.14805	0.001;0.001;0.011	B;B;B	0.13407	0.004;0.004;0.009	T	0.49303	-0.8954	9	0.08179	T	0.78	.	3.8845	0.09093	0.3817:0.0:0.4348:0.1835	.	518;497;497	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	S	497;497;497;518;497;497;497;497	ENSP00000306705:T497S;ENSP00000442788:T497S;ENSP00000442867:T497S;ENSP00000425443:T518S;ENSP00000369351:T497S;ENSP00000378245:T497S;ENSP00000391448:T497S	ENSP00000265149:T497S	T	+	1	0	TET2	106376037	0.000000	0.05858	0.070000	0.20053	0.899000	0.52679	0.235000	0.17948	0.108000	0.17862	0.377000	0.23210	ACT		0.443	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628		18	72	0	0	0	0.002299	0	18	72				
GLRA3	8001	broad.mit.edu	37	4	175565021	175565021	+	Silent	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr4:175565021T>C	ENST00000274093.3	-	10	1813	c.1311A>G	c.(1309-1311)ccA>ccG	p.P437P	GLRA3_ENST00000340217.5_Silent_p.P422P	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	437					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	AAAAAGCTAATGGGAAGCAGG	0.423																																							uc003ity.1		NA																	0				ovary(3)	3						c.(1309-1311)CCA>CCG		glycine receptor, alpha 3 isoform a	Glycine(DB00145)						100.0	100.0	100.0					4																	175565021		2203	4300	6503	SO:0001819	synonymous_variant	8001				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chr4:175565021T>C	AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.1311A>G	4.37:g.175565021T>C			Somatic				GLRA3_uc003itz.1_Silent_p.P422P	p.P437P	NM_006529	NP_006520	WXS	Illumina HiSeq	Unspecified	O75311	GLRA3_HUMAN		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	10	1814	-		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)	437			Helical; (Probable).		D3DP44|O75816|Q5D0E3	Silent	SNP	ENST00000274093.3	37	c.1311A>G	CCDS3822.1																																																																																				0.423	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1			3	57	0	0	0	0.004672	0	3	57				
GLRA3	8001	broad.mit.edu	37	4	175749923	175749923	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr4:175749923A>G	ENST00000274093.3	-	1	542	c.40T>C	c.(40-42)Ttt>Ctt	p.F14L	GLRA3_ENST00000340217.5_Missense_Mutation_p.F14L	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	14					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	CAGAAGTAAAATCCCGAAACT	0.448																																							uc003ity.1		NA																	0				ovary(3)	3						c.(40-42)TTT>CTT		glycine receptor, alpha 3 isoform a	Glycine(DB00145)						122.0	111.0	115.0					4																	175749923		2203	4300	6503	SO:0001583	missense	8001				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chr4:175749923A>G	AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.40T>C	4.37:g.175749923A>G	ENSP00000274093:p.Phe14Leu		Somatic				GLRA3_uc003itz.1_Missense_Mutation_p.F14L|uc003iua.1_5'Flank|uc003iub.1_5'Flank	p.F14L	NM_006529	NP_006520	WXS	Illumina HiSeq	Unspecified	O75311	GLRA3_HUMAN		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	1	543	-		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)	14					D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	ENST00000274093.3	37	c.40T>C	CCDS3822.1	.	.	.	.	.	.	.	.	.	.	A	11.72	1.722035	0.30503	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	T;T	0.66638	-0.1;-0.22	5.23	5.23	0.72850	.	0.099812	0.45126	D	0.000383	T	0.42426	0.1202	N	0.08118	0	0.31733	N	0.636755	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41858	-0.9485	10	0.10636	T	0.68	.	11.4289	0.50027	1.0:0.0:0.0:0.0	.	14;14	O75311-2;O75311	.;GLRA3_HUMAN	L	14	ENSP00000274093:F14L;ENSP00000345284:F14L	ENSP00000274093:F14L	F	-	1	0	GLRA3	175986498	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.417000	0.59822	2.187000	0.69744	0.533000	0.62120	TTT		0.448	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1			3	67	0	0	0	0.004672	0	3	67				
DNAH5	1767	broad.mit.edu	37	5	13786444	13786444	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr5:13786444C>T	ENST00000265104.4	-	52	8768	c.8664G>A	c.(8662-8664)gaG>gaA	p.E2888E		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2888					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CAGCATCAGCCTCTTCAGATG	0.363									Kartagener syndrome																														uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(8662-8664)GAG>GAA		dynein, axonemal, heavy chain 5							76.0	77.0	77.0					5																	13786444		2203	4300	6503	SO:0001819	synonymous_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13786444C>T	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8664G>A	5.37:g.13786444C>T			Somatic					p.E2888E	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			52	8706	-	Lung NSC(4;0.00476)		2888					Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	c.8664G>A	CCDS3882.1																																																																																				0.363	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		5	38	0	0	0	0.001168	0	5	38				
PRDM9	56979	broad.mit.edu	37	5	23527643	23527643	+	Nonsense_Mutation	SNP	A	A	T	rs199802267	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr5:23527643A>T	ENST00000296682.3	+	11	2628	c.2446A>T	c.(2446-2448)Aag>Tag	p.K816*		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	816					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CTTTAGCAATAAGTCACACCT	0.567										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(2446-2448)AAG>TAG		PR domain containing 9							31.0	44.0	40.0					5																	23527643		2116	4260	6376	SO:0001587	stop_gained	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23527643A>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2446A>T	5.37:g.23527643A>T	ENSP00000296682:p.Lys816*	HNSCC(3;0.000094)	Somatic					p.K816*	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			11	2628	+			816			C2H2-type 12.		B4DX22|Q27Q50	Nonsense_Mutation	SNP	ENST00000296682.3	37	c.2446A>T	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.390998	0.82902	.	.	ENSG00000164256	ENST00000296682	.	.	.	3.02	1.79	0.24919	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.3392	7.7292	0.28777	0.7859:0.214:0.0:0.0	.	.	.	.	X	816	.	ENSP00000296682:K816X	K	+	1	0	PRDM9	23563400	0.000000	0.05858	0.087000	0.20705	0.005000	0.04900	-0.164000	0.09983	0.542000	0.28846	0.386000	0.25728	AAG		0.567	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		12	166	0	0	0	0.001855	0	12	166				
PARP8	79668	broad.mit.edu	37	5	50091199	50091199	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr5:50091199C>G	ENST00000281631.5	+	12	1534	c.1376C>G	c.(1375-1377)tCa>tGa	p.S459*	PARP8_ENST00000503750.2_Nonsense_Mutation_p.S459*|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000505697.2_Nonsense_Mutation_p.S459*|PARP8_ENST00000514342.2_Nonsense_Mutation_p.S212*|PARP8_ENST00000505554.1_Nonsense_Mutation_p.S438*|PARP8_ENST00000514067.2_Nonsense_Mutation_p.S459*	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	459						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				TCTCTTACCTCAGGGCTTATT	0.448																																							uc003jon.3		NA																	0				lung(3)|large_intestine(1)|ovary(1)	5						c.(1375-1377)TCA>TGA		poly (ADP-ribose) polymerase family, member 8							72.0	76.0	75.0					5																	50091199		2203	4300	6503	SO:0001587	stop_gained	79668					intracellular	NAD+ ADP-ribosyltransferase activity	g.chr5:50091199C>G	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.1376C>G	5.37:g.50091199C>G	ENSP00000281631:p.Ser459*		Somatic				PARP8_uc011cpz.1_Nonsense_Mutation_p.S351*|PARP8_uc003joo.2_Nonsense_Mutation_p.S459*|PARP8_uc003jop.2_Nonsense_Mutation_p.S459*	p.S459*	NM_024615	NP_078891	WXS	Illumina HiSeq	Unspecified	Q8N3A8	PARP8_HUMAN			13	1558	+		Lung NSC(810;0.0305)|Breast(144;0.222)	459					Q3KRB7|Q6DHZ1|Q9H754	Nonsense_Mutation	SNP	ENST00000281631.5	37	c.1376C>G	CCDS3954.1	.	.	.	.	.	.	.	.	.	.	C	38	7.263155	0.98171	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000514342;ENST00000281631;ENST00000514067;ENST00000505554;ENST00000503561;ENST00000423185	.	.	.	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.7719	19.29	0.94095	0.0:1.0:0.0:0.0	.	.	.	.	X	459;459;212;459;459;438;212;212	.	.	S	+	2	0	PARP8	50126956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.371000	0.73119	2.601000	0.87937	0.655000	0.94253	TCA		0.448	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615		5	57	0	0	0	0.000602	0	5	57				
FAM169A	26049	broad.mit.edu	37	5	74137430	74137430	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr5:74137430C>T	ENST00000389156.4	-	2	162	c.72G>A	c.(70-72)atG>atA	p.M24I	FAM169A_ENST00000380515.3_Missense_Mutation_p.M24I|FAM169A_ENST00000510496.1_Missense_Mutation_p.M24I	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	24						membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						TTAAATCTGACATGTAATCTT	0.393																																							uc003kdm.2		NA																	0					0						c.(70-72)ATG>ATA		hypothetical protein LOC26049							111.0	102.0	105.0					5																	74137430		1840	4091	5931	SO:0001583	missense	26049							g.chr5:74137430C>T		CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.72G>A	5.37:g.74137430C>T	ENSP00000373808:p.Met24Ile		Somatic				FAM169A_uc010izm.2_Missense_Mutation_p.M24I|FAM169A_uc003kdl.2_5'UTR	p.M24I	NM_015566	NP_056381	WXS	Illumina HiSeq	Unspecified	Q9Y6X4	F169A_HUMAN			2	115	-			24					A8K1T9|Q6MZT0|Q9H989	Missense_Mutation	SNP	ENST00000389156.4	37	c.72G>A	CCDS43330.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596604	0.46318	.	.	ENSG00000198780	ENST00000389156;ENST00000510496;ENST00000380515;ENST00000513277;ENST00000514200;ENST00000506954	T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45	5.61	4.72	0.59763	.	0.284054	0.29021	N	0.013388	T	0.21103	0.0508	N	0.24115	0.695	0.31553	N	0.658455	B;B	0.26081	0.141;0.141	B;B	0.26693	0.072;0.054	T	0.15578	-1.0432	10	0.28530	T	0.3	-15.4652	11.7494	0.51839	0.1237:0.6235:0.2528:0.0	.	24;24	D6RB01;Q9Y6X4	.;F169A_HUMAN	I	24	ENSP00000373808:M24I;ENSP00000424578:M24I;ENSP00000369886:M24I;ENSP00000423631:M24I;ENSP00000423883:M24I;ENSP00000421451:M24I	ENSP00000369886:M24I	M	-	3	0	FAM169A	74173186	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.751000	0.47508	1.325000	0.45301	0.585000	0.79938	ATG		0.393	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371092.2			16	55	0	0	0	0.006122	0	16	55				
RASA1	5921	broad.mit.edu	37	5	86642487	86642487	+	Splice_Site	SNP	A	A	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr5:86642487A>C	ENST00000274376.6	+	7	1613		c.e7-1		RASA1_ENST00000512763.1_Splice_Site|RASA1_ENST00000506290.1_Splice_Site|RASA1_ENST00000456692.2_Splice_Site	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1						blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		TCTCTTTTTAAGATGGTTCCA	0.254																																							uc003kiw.2		NA																	0				upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5						c.e7-2		RAS p21 protein activator 1 isoform 1							39.0	44.0	42.0					5																	86642487		2193	4279	6472	SO:0001630	splice_region_variant	5921				cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding	g.chr5:86642487A>C		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1050-1A>C	5.37:g.86642487A>C			Somatic				RASA1_uc010jav.2_Splice_Site|RASA1_uc003kix.2_Splice_Site_p.I173_splice|RASA1_uc011ctv.1_Splice_Site_p.I183_splice|RASA1_uc011ctw.1_Splice_Site_p.I184_splice|RASA1_uc010jaw.2_Splice_Site_p.I172_splice	p.I350_splice	NM_002890	NP_002881	WXS	Illumina HiSeq	Unspecified	P20936	RASA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)	7	1168	+		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)						B2R6W3|Q9UDI1	Splice_Site	SNP	ENST00000274376.6	37	c.1050_splice	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.135630	0.77662	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0693	0.72024	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RASA1	86678243	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.957000	0.93082	2.077000	0.62373	0.472000	0.43445	.		0.254	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	Intron	4	49	0	0	0	0.000602	0	4	49				
SLCO6A1	133482	broad.mit.edu	37	5	101834232	101834232	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr5:101834232C>A	ENST00000506729.1	-	1	488	c.317G>T	c.(316-318)cGc>cTc	p.R106L	SLCO6A1_ENST00000513675.1_Missense_Mutation_p.R106L|SLCO6A1_ENST00000379810.1_Missense_Mutation_p.R106L|SLCO6A1_ENST00000514551.1_5'UTR|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.R106L|RP11-58B2.1_ENST00000502494.1_RNA|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.R106L			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	106	Cys-rich.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CATGAAGCAGCGAATGTTATT	0.547																																							uc003knn.2		NA																	0				ovary(3)|skin(3)|central_nervous_system(1)	7						c.(316-318)CGC>CTC		solute carrier organic anion transporter family,							84.0	84.0	84.0					5																	101834232		2203	4300	6503	SO:0001583	missense	133482					integral to membrane|plasma membrane	transporter activity	g.chr5:101834232C>A	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.317G>T	5.37:g.101834232C>A	ENSP00000421339:p.Arg106Leu		Somatic				SLCO6A1_uc003kno.2_Missense_Mutation_p.R106L|SLCO6A1_uc003knp.2_Missense_Mutation_p.R106L|SLCO6A1_uc003knq.2_Missense_Mutation_p.R106L	p.R106L	NM_173488	NP_775759	WXS	Illumina HiSeq	Unspecified	Q86UG4	SO6A1_HUMAN		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)	1	489	-		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)	106			Cytoplasmic (Potential).|Cys-rich.		A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	c.317G>T	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	C	7.258	0.604660	0.14002	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16	3.52	1.5	0.22942	.	1.288320	0.05194	N	0.503625	T	0.35008	0.0917	L	0.61218	1.895	0.09310	N	1	B;P;P	0.37864	0.27;0.518;0.61	B;B;B	0.36335	0.132;0.222;0.145	T	0.29243	-1.0018	10	0.49607	T	0.09	.	4.7206	0.12917	0.0:0.6497:0.0:0.3503	.	106;106;106	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	L	106	ENSP00000421339:R106L;ENSP00000369135:R106L;ENSP00000373671:R106L;ENSP00000421990:R106L;ENSP00000369138:R106L	ENSP00000369135:R106L	R	-	2	0	SLCO6A1	101862131	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-1.112000	0.03299	0.360000	0.24265	0.484000	0.47621	CGC		0.547	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488		9	30	1	0	0.000442599	0.006214	0.000528353	9	30				
PCDHA7	56141	broad.mit.edu	37	5	140216204	140216204	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr5:140216204G>A	ENST00000525929.1	+	1	2236	c.2236G>A	c.(2236-2238)Ggg>Agg	p.G746R	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.G746R|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	746					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCGCGGTGGGGAGCTGGTC	0.642																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	0				ovary(2)|skin(2)	4						c.(2236-2238)GGG>AGG		protocadherin alpha 7 isoform 1 precursor							57.0	55.0	56.0					5																	140216204		2203	4300	6503	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140216204G>A	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2236G>A	5.37:g.140216204G>A	ENSP00000436426:p.Gly746Arg		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.G746R	p.G746R	NM_018910	NP_061733	WXS	Illumina HiSeq	Unspecified	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2236	+			746			Cytoplasmic (Potential).		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.2236G>A	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.014082	0.54468	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.26518	1.73;1.73	3.57	2.68	0.31781	.	0.000000	0.31949	U	0.006809	T	0.51787	0.1695	H	0.96365	3.81	0.20703	N	0.999863	P;P	0.51537	0.681;0.946	P;P	0.51974	0.573;0.686	T	0.56117	-0.8032	10	0.72032	D	0.01	.	11.6462	0.51263	0.0944:0.0:0.9056:0.0	.	746;746	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	R	746	ENSP00000436426:G746R;ENSP00000367365:G746R	ENSP00000367365:G746R	G	+	1	0	PCDHA7	140196388	0.994000	0.37717	0.998000	0.56505	0.755000	0.42902	2.562000	0.45914	1.968000	0.57251	0.462000	0.41574	GGG		0.642	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		3	41	0	0	0	0.004672	0	3	41				
KCTD16	57528	broad.mit.edu	37	5	143853425	143853425	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr5:143853425C>T	ENST00000507359.3	+	3	2126	c.1035C>T	c.(1033-1035)ccC>ccT	p.P345P	KCTD16_ENST00000512467.1_Silent_p.P345P	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	345					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			TGGACCGTCCCATCAAGAAGG	0.582																																							uc003lnm.1		NA																	0				large_intestine(2)|ovary(1)|skin(1)	4						c.(1033-1035)CCC>CCT		potassium channel tetramerisation domain							74.0	73.0	73.0					5																	143853425		2203	4300	6503	SO:0001819	synonymous_variant	57528					cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr5:143853425C>T	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1035C>T	5.37:g.143853425C>T			Somatic				KCTD16_uc003lnn.1_Silent_p.P345P	p.P345P	NM_020768	NP_065819	WXS	Illumina HiSeq	Unspecified	Q68DU8	KCD16_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		4	1664	+		all_hematologic(541;0.118)	345					Q9P2M9	Silent	SNP	ENST00000507359.3	37	c.1035C>T	CCDS34260.1																																																																																				0.582	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368		12	58	0	0	0	0.00245	0	12	58				
PRELID2	153768	broad.mit.edu	37	5	145202687	145202687	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr5:145202687G>C	ENST00000334744.4	-	2	138	c.86C>G	c.(85-87)cCc>cGc	p.P29R	PRELID2_ENST00000358004.2_Missense_Mutation_p.P29R|PRELID2_ENST00000505416.1_Missense_Mutation_p.P29R|PRELID2_ENST00000511435.1_Missense_Mutation_p.P29R|PRELID2_ENST00000394450.2_5'UTR	NM_182960.2	NP_892005.1	Q8N945	PRLD2_HUMAN	PRELI domain containing 2	29	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTATCCATGGGGTTGGGGTA	0.318																																							uc003lnp.1		NA																	0					0						c.(85-87)CCC>CGC		PRELI domain containing 2 isoform a							48.0	51.0	50.0					5																	145202687		2201	4297	6498	SO:0001583	missense	153768							g.chr5:145202687G>C	AK095695	CCDS34261.1, CCDS34262.1, CCDS43377.1	5q32	2012-04-23			ENSG00000186314	ENSG00000186314			28306	protein-coding gene	gene with protein product						12477932	Standard	NM_182960		Approved	MGC21644, FLJ38376	uc003lnq.1	Q8N945	OTTHUMG00000163384	ENST00000334744.4:c.86C>G	5.37:g.145202687G>C	ENSP00000335675:p.Pro29Arg		Somatic				PRELID2_uc003lnq.1_Missense_Mutation_p.P29R|PRELID2_uc003lno.1_5'UTR|PRELID2_uc003lnr.1_Missense_Mutation_p.P29R	p.P29R	NM_182960	NP_892005	WXS	Illumina HiSeq	Unspecified	Q8N945	PRLD2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		2	139	-			29			PRELI/MSF1.		G5EA01|Q96EQ3	Missense_Mutation	SNP	ENST00000334744.4	37	c.86C>G	CCDS34262.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063942	0.55432	.	.	ENSG00000186314	ENST00000358004;ENST00000334744;ENST00000505416;ENST00000511435	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	5.42	5.42	0.78866	PRELI/MSF1 (2);	0.082094	0.51477	D	0.000100	T	0.39118	0.1066	M	0.64997	1.995	0.42398	D	0.992557	P;P;P	0.52577	0.81;0.773;0.954	P;B;P	0.55577	0.549;0.3;0.779	T	0.14896	-1.0456	10	0.87932	D	0	-7.8485	16.4812	0.84158	0.0:0.0:1.0:0.0	.	29;29;29	D6RAB6;G5EA01;Q8N945	.;.;PRLD2_HUMAN	R	29	ENSP00000350694:P29R;ENSP00000335675:P29R;ENSP00000424730:P29R;ENSP00000422789:P29R	ENSP00000335675:P29R	P	-	2	0	PRELID2	145182880	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.413000	0.66399	2.685000	0.91497	0.655000	0.94253	CCC		0.318	PRELID2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000372970.1	NM_182960		5	33	0	0	0	0.000602	0	5	33				
DSP	1832	broad.mit.edu	37	6	7571787	7571787	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:7571787C>T	ENST00000379802.3	+	14	2214	c.1873C>T	c.(1873-1875)Cag>Tag	p.Q625*	DSP_ENST00000418664.2_Nonsense_Mutation_p.Q625*	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	625	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CCTGGTCATTCAGCTCCCTGG	0.468																																							uc003mxp.1		NA																	0				central_nervous_system(6)|ovary(2)|skin(1)	9						c.(1873-1875)CAG>TAG		desmoplakin isoform I							128.0	117.0	121.0					6																	7571787		2203	4300	6503	SO:0001587	stop_gained	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7571787C>T	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1873C>T	6.37:g.7571787C>T	ENSP00000369129:p.Gln625*		Somatic				DSP_uc003mxq.1_Nonsense_Mutation_p.Q625*	p.Q625*	NM_004415	NP_004406	WXS	Illumina HiSeq	Unspecified	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	14	2152	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	625			Globular 1.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Nonsense_Mutation	SNP	ENST00000379802.3	37	c.1873C>T	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	C	43	10.444993	0.99406	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	.	.	.	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	20.2983	0.98569	0.0:1.0:0.0:0.0	.	.	.	.	X	625;625;430	.	ENSP00000369129:Q625X	Q	+	1	0	DSP	7516786	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	4.422000	0.59854	2.802000	0.96397	0.655000	0.94253	CAG		0.468	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		11	76	0	0	0	0.00245	0	11	76				
OR12D2	26529	broad.mit.edu	37	6	29364823	29364823	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:29364823T>C	ENST00000383555.2	+	1	408	c.347T>C	c.(346-348)aTg>aCg	p.M116T	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						TTCGCCGTGATGGCATTTGAC	0.493																																							uc003nmf.3		NA																	0				ovary(1)	1						c.(346-348)ATG>ACG		olfactory receptor, family 12, subfamily D,							92.0	92.0	92.0					6																	29364823		1510	2708	4218	SO:0001583	missense	26529				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29364823T>C		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.347T>C	6.37:g.29364823T>C	ENSP00000373047:p.Met116Thr		Somatic					p.M116T	NM_013936	NP_039224	WXS	Illumina HiSeq	Unspecified	P58182	O12D2_HUMAN			1	408	+			116			Helical; Name=3; (Potential).		B0S862|Q5SUN9|Q6IET9	Missense_Mutation	SNP	ENST00000383555.2	37	c.347T>C	CCDS4659.1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.077660	0.36662	.	.	ENSG00000168787	ENST00000383555	T	0.00462	7.26	3.94	3.94	0.45596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.01189	0.0039	H	0.94542	3.55	0.45554	D	0.998509	D	0.89917	1.0	D	0.91635	0.999	T	0.31420	-0.9944	10	0.87932	D	0	.	12.6292	0.56646	0.0:0.0:0.0:1.0	.	116	P58182	O12D2_HUMAN	T	116	ENSP00000373047:M116T	ENSP00000373047:M116T	M	+	2	0	OR12D2	29472802	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	7.170000	0.77587	1.643000	0.50594	0.172000	0.16884	ATG		0.493	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2			6	46	0	0	0	0.001984	0	6	46				
MSH5	4439	broad.mit.edu	37	6	31709022	31709022	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:31709022C>T	ENST00000375755.3	+	3	516	c.230C>T	c.(229-231)cCa>cTa	p.P77L	MSH5_ENST00000534153.4_Missense_Mutation_p.P77L|MSH5_ENST00000375740.3_Missense_Mutation_p.P77L|MSH5_ENST00000375703.3_Missense_Mutation_p.P77L|MSH5_ENST00000375750.3_Missense_Mutation_p.P77L|MSH5_ENST00000482280.1_3'UTR|MSH5-SAPCD1_ENST00000493662.2_Missense_Mutation_p.P77L|MSH5_ENST00000375742.3_Missense_Mutation_p.P77L|CLIC1_ENST00000395892.1_5'Flank	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	77					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						CACTTCATGCCAGATGCCCCA	0.498								Direct reversal of damage;Mismatch excision repair (MMR)																															uc003nwv.1		NA																	0				ovary(2)|breast(1)	3						c.(229-231)CCA>CTA	Direct_reversal_of_damage|MMR	mutS homolog 5 isoform c							283.0	256.0	266.0					6																	31709022		1511	2709	4220	SO:0001583	missense	4439				chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding	g.chr6:31709022C>T	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.230C>T	6.37:g.31709022C>T	ENSP00000364908:p.Pro77Leu		Somatic				MSH5_uc003nwt.1_Missense_Mutation_p.P77L|MSH5_uc003nwu.1_Missense_Mutation_p.P77L|MSH5_uc003nww.1_Missense_Mutation_p.P77L|MSH5_uc003nwx.1_Missense_Mutation_p.P77L	p.P77L	NM_172166	NP_751898	WXS	Illumina HiSeq	Unspecified	O43196	MSH5_HUMAN			3	309	+			77					B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Missense_Mutation	SNP	ENST00000375755.3	37	c.230C>T	CCDS4720.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.993524	0.54041	.	.	ENSG00000204410	ENST00000375755;ENST00000375742;ENST00000375750;ENST00000425703;ENST00000534153;ENST00000375703;ENST00000375740	T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.19	5.19	0.71726	.	0.552333	0.18689	N	0.133932	T	0.18002	0.0432	L	0.36672	1.1	0.41782	D	0.989824	B;B;B;B	0.09022	0.002;0.001;0.0;0.002	B;B;B;B	0.10450	0.004;0.001;0.001;0.005	T	0.03514	-1.1029	9	0.34782	T	0.22	-23.3493	16.2003	0.82067	0.0:1.0:0.0:0.0	.	77;77;77;77	O43196-4;O43196;O43196-2;O43196-3	.;MSH5_HUMAN;.;.	L	77	ENSP00000364908:P77L;ENSP00000364894:P77L;ENSP00000364903:P77L;ENSP00000402842:P77L;ENSP00000431693:P77L;ENSP00000364855:P77L;ENSP00000364892:P77L	ENSP00000364855:P77L	P	+	2	0	MSH5	31817001	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.623000	0.67757	2.426000	0.82243	0.650000	0.86243	CCA		0.498	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4			15	171	0	0	0	0.00245	0	15	171				
HCRTR2	3062	broad.mit.edu	37	6	55145140	55145140	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:55145140C>A	ENST00000370862.3	+	6	1339	c.1003C>A	c.(1003-1005)Cat>Aat	p.H335N		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	335					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GATGTTTGCCCATACTGAAGA	0.373																																							uc003pcl.2		NA																	0				ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6						c.(1003-1005)CAT>AAT		orexin receptor 2							216.0	208.0	211.0					6																	55145140		2203	4300	6503	SO:0001583	missense	3062				feeding behavior	integral to plasma membrane	neuropeptide receptor activity	g.chr6:55145140C>A	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.1003C>A	6.37:g.55145140C>A	ENSP00000359899:p.His335Asn		Somatic				HCRTR2_uc010jzv.2_RNA	p.H335N	NM_001526	NP_001517	WXS	Illumina HiSeq	Unspecified	O43614	OX2R_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		6	1318	+	Lung NSC(77;0.107)|Renal(3;0.122)		335			Extracellular (Potential).		Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	37	c.1003C>A	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	C	0.335	-0.953968	0.02285	.	.	ENSG00000137252	ENST00000370862	T	0.60797	0.16	5.62	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.203363	0.50627	D	0.000119	T	0.20333	0.0489	N	0.05280	-0.08	0.47819	D	0.999526	B	0.02656	0.0	B	0.06405	0.002	T	0.05869	-1.0859	10	0.19147	T	0.46	.	15.4098	0.74908	0.0:0.9221:0.0:0.0779	.	335	O43614	OX2R_HUMAN	N	335	ENSP00000359899:H335N	ENSP00000359899:H335N	H	+	1	0	HCRTR2	55253099	0.956000	0.32656	0.752000	0.31206	0.080000	0.17528	2.141000	0.42168	2.659000	0.90383	0.585000	0.79938	CAT		0.373	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1			11	131	1	0	3.07112e-06	0.000978	3.80898e-06	11	131				
MMS22L	253714	broad.mit.edu	37	6	97616094	97616094	+	Silent	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:97616094T>C	ENST00000275053.4	-	20	3127	c.2862A>G	c.(2860-2862)gcA>gcG	p.A954A	MMS22L_ENST00000369251.2_Silent_p.A914A	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	954					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CAAAGATTTGTGCCCATGATT	0.368																																							uc003ppb.2		NA																	0					0						c.(2860-2862)GCA>GCG		hypothetical protein LOC253714							120.0	119.0	119.0					6																	97616094		2203	4300	6503	SO:0001819	synonymous_variant	253714				double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding	g.chr6:97616094T>C		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.2862A>G	6.37:g.97616094T>C			Somatic				C6orf167_uc011eaf.1_Silent_p.A914A	p.A954A	NM_198468	NP_940870	WXS	Illumina HiSeq	Unspecified	Q6ZRQ5	MMS22_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0457)	20	3128	-		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)	954					D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Silent	SNP	ENST00000275053.4	37	c.2862A>G	CCDS5039.1																																																																																				0.368	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468		12	67	0	0	0	0.000978	0	12	67				
SLC22A16	85413	broad.mit.edu	37	6	110768092	110768092	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:110768092C>G	ENST00000368919.3	-	3	701	c.635G>C	c.(634-636)cGc>cCc	p.R212P	SLC22A16_ENST00000456137.2_3'UTR|SLC22A16_ENST00000330550.4_Missense_Mutation_p.R178P|SLC22A16_ENST00000439654.1_Missense_Mutation_p.R212P	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	212					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	AAGAAAAAAGCGAGCAGCCAT	0.423																																							uc003puf.2		NA																	0				ovary(1)	1						c.(634-636)CGC>CCC		solute carrier family 22, member 16							75.0	74.0	74.0					6																	110768092		2203	4300	6503	SO:0001583	missense	85413				acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity	g.chr6:110768092C>G		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.635G>C	6.37:g.110768092C>G	ENSP00000357915:p.Arg212Pro		Somatic				SLC22A16_uc003pue.2_Missense_Mutation_p.R193P	p.R212P	NM_033125	NP_149116	WXS	Illumina HiSeq	Unspecified	Q86VW1	S22AG_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	3	702	-		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)	212					O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	ENST00000368919.3	37	c.635G>C	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920386	0.52653	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654;ENST00000434949;ENST00000437378;ENST00000424139	D;D;D;D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63	5.14	4.27	0.50696	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.110721	0.64402	D	0.000005	D	0.96002	0.8698	H	0.96080	3.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96655	0.9484	10	0.72032	D	0.01	.	12.3031	0.54887	0.0:0.9158:0.0:0.0842	.	212;178	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	P	212;129;178;212;42;169;169	ENSP00000357915:R212P;ENSP00000395642:R129P;ENSP00000328583:R178P;ENSP00000408799:R212P;ENSP00000409306:R42P;ENSP00000416310:R169P;ENSP00000401007:R169P	ENSP00000328583:R178P	R	-	2	0	SLC22A16	110874785	1.000000	0.71417	0.966000	0.40874	0.580000	0.36256	3.654000	0.54453	1.159000	0.42565	0.561000	0.74099	CGC		0.423	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125		5	58	0	0	0	0.001168	0	5	58				
SOGA3	387104	broad.mit.edu	37	6	127796879	127796879	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:127796879G>A	ENST00000525778.1	-	6	3037	c.2292C>T	c.(2290-2292)gaC>gaT	p.D764D	SOGA3_ENST00000368268.2_Silent_p.D764D|SOGA3_ENST00000556132.1_Silent_p.D764D|SOGA3_ENST00000465909.2_Silent_p.D764D|SOGA3_ENST00000474293.2_5'Flank|SOGA3_ENST00000481848.2_Silent_p.D764D			Q5TF21	SOGA3_HUMAN	SOGA family member 3	764					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GCCGCGAGTCGTCGTCGCTCT	0.716																																							uc003qbd.2		NA																	0				breast(3)|ovary(2)|skin(1)	6						c.(2290-2292)GAC>GAT		hypothetical protein LOC387104 precursor							32.0	40.0	38.0					6																	127796879		2134	4219	6353	SO:0001819	synonymous_variant	387104					integral to membrane		g.chr6:127796879G>A	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2292C>T	6.37:g.127796879G>A			Somatic				C6orf174_uc003qbc.2_5'Flank	p.D764D	NM_001012279	NP_001012279	WXS	Illumina HiSeq	Unspecified	Q5TF21	CF174_HUMAN		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)	6	3157	-			764						Silent	SNP	ENST00000525778.1	37	c.2292C>T	CCDS43505.1																																																																																				0.716	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279		7	33	0	0	0	0.00308	0	7	33				
SLC35D3	340146	broad.mit.edu	37	6	137245321	137245321	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:137245321C>A	ENST00000331858.4	+	2	903	c.738C>A	c.(736-738)tgC>tgA	p.C246*		NM_001008783.1	NP_001008783.1	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	246					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	13	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		CGCTGCACTGCACCTACATCA	0.627																																							uc003qhe.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(736-738)TGC>TGA		solute carrier family 35, member D3							73.0	58.0	63.0					6																	137245321		2203	4300	6503	SO:0001587	stop_gained	340146				carbohydrate transport	integral to membrane		g.chr6:137245321C>A		CCDS34544.1	6q23.2	2013-05-22			ENSG00000182747	ENSG00000182747		"""Solute carriers"""	15621	protein-coding gene	gene with protein product		612519		FRCL1			Standard	NM_001008783		Approved		uc003qhe.3	Q5M8T2	OTTHUMG00000015651	ENST00000331858.4:c.738C>A	6.37:g.137245321C>A	ENSP00000333591:p.Cys246*		Somatic					p.C246*	NM_001008783	NP_001008783	WXS	Illumina HiSeq	Unspecified	Q5M8T2	S35D3_HUMAN		GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)	2	903	+	Colorectal(23;0.24)		246					B4DI58|Q5QNZ6|Q6NX71	Nonsense_Mutation	SNP	ENST00000331858.4	37	c.738C>A	CCDS34544.1	.	.	.	.	.	.	.	.	.	.	C	37	6.093309	0.97276	.	.	ENSG00000182747	ENST00000331858	.	.	.	5.68	3.43	0.39272	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.4214	8.6319	0.33924	0.0:0.688:0.0:0.312	.	.	.	.	X	246	.	ENSP00000333591:C246X	C	+	3	2	SLC35D3	137287014	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.709000	0.37909	1.288000	0.44600	0.561000	0.74099	TGC		0.627	SLC35D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042389.2	XM_294017		5	39	1	0	0.00198382	0.001984	0.00231749	5	39				
SYNE1	23345	broad.mit.edu	37	6	152650896	152650896	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:152650896C>G	ENST00000367255.5	-	78	15525	c.14924G>C	c.(14923-14925)gGa>gCa	p.G4975A	SYNE1_ENST00000341594.5_Missense_Mutation_p.G4722A|SYNE1_ENST00000423061.1_Missense_Mutation_p.G4904A|SYNE1_ENST00000265368.4_Missense_Mutation_p.G4975A|SYNE1_ENST00000448038.1_Missense_Mutation_p.G4904A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4975					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.G4975A(2)|p.G4904A(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGGATGTCTCCATCCAGCTC	0.463										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - Missense(3)		urinary_tract(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(14923-14925)GGA>GCA		spectrin repeat containing, nuclear envelope 1							134.0	138.0	137.0					6																	152650896		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152650896C>G	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.14924G>C	6.37:g.152650896C>G	ENSP00000356224:p.Gly4975Ala	HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Missense_Mutation_p.G4904A|SYNE1_uc003qou.3_Missense_Mutation_p.G4975A|SYNE1_uc010kiz.2_Missense_Mutation_p.G730A	p.G4975A	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	78	15526	-		Ovarian(120;0.0955)	4975			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.14924G>C	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	10.88	1.475769	0.26511	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	6.03	4.01	0.46588	.	0.321619	0.26499	N	0.024028	T	0.12646	0.0307	N	0.24115	0.695	0.41384	D	0.987574	B;B;B;B	0.12013	0.005;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.001;0.001;0.001	T	0.12426	-1.0548	10	0.09843	T	0.71	.	6.3816	0.21538	0.0:0.6556:0.1644:0.1801	.	4975;4975;4975;4904	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	A	4975;4904;4975;4904;4722	ENSP00000356224:G4975A;ENSP00000396024:G4904A;ENSP00000265368:G4975A;ENSP00000390975:G4904A;ENSP00000341887:G4722A	ENSP00000265368:G4975A	G	-	2	0	SYNE1	152692589	0.000000	0.05858	0.349000	0.25694	0.980000	0.70556	0.855000	0.27805	2.861000	0.98227	0.655000	0.94253	GGA		0.463	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		10	65	0	0	0	0.000978	0	10	65				
SYNE1	23345	broad.mit.edu	37	6	152771825	152771825	+	Silent	SNP	A	A	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:152771825A>C	ENST00000367255.5	-	27	3931	c.3330T>G	c.(3328-3330)gcT>gcG	p.A1110A	SYNE1_ENST00000341594.5_Silent_p.A1176A|SYNE1_ENST00000367248.3_Silent_p.A1100A|SYNE1_ENST00000423061.1_Silent_p.A1117A|SYNE1_ENST00000265368.4_Silent_p.A1110A|SYNE1_ENST00000413186.2_Silent_p.A1110A|SYNE1_ENST00000448038.1_Silent_p.A1117A|SYNE1_ENST00000367253.4_Silent_p.A1110A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1110					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGTCAATGGCAGCTCTGAGCT	0.542										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(3328-3330)GCT>GCG		spectrin repeat containing, nuclear envelope 1							180.0	173.0	175.0					6																	152771825		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152771825A>C	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3330T>G	6.37:g.152771825A>C		HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Silent_p.A1117A|SYNE1_uc003qou.3_Silent_p.A1110A|SYNE1_uc010kjb.1_Silent_p.A1093A|SYNE1_uc003qow.2_Silent_p.A405A|SYNE1_uc003qox.1_Silent_p.A626A	p.A1110A	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	27	3932	-		Ovarian(120;0.0955)	1110			HAT 2.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.3330T>G	CCDS5236.2																																																																																				0.542	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		12	151	0	0	0	0.001855	0	12	151				
PDE10A	10846	broad.mit.edu	37	6	165746519	165746519	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr6:165746519C>T	ENST00000366882.1	-	23	2489	c.2335G>A	c.(2335-2337)Gat>Aat	p.D779N	PDE10A_ENST00000539869.2_Missense_Mutation_p.D789N|PDE10A_ENST00000354448.4_Missense_Mutation_p.D779N			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	779					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	AGTGCTCAATCTTCAGATGCA	0.527																																					Esophageal Squamous(22;308 615 5753 12038 40624)	Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2		NA																	0				ovary(3)|skin(2)	5						c.(2335-2337)GAT>AAT		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						148.0	134.0	138.0					6																	165746519		2203	4300	6503	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165746519C>T	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.2335G>A	6.37:g.165746519C>T	ENSP00000355847:p.Asp779Asn		Somatic				PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.D709N|PDE10A_uc003quo.2_Missense_Mutation_p.D789N	p.D779N	NM_006661	NP_006652	WXS	Illumina HiSeq	Unspecified	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	23	2576	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	779					Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.2335G>A		.	.	.	.	.	.	.	.	.	.	C	15.63	2.891184	0.52014	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.71222	-0.55;-0.55	4.51	4.51	0.55191	.	9.287050	0.00166	N	0.000002	T	0.50240	0.1604	N	0.19112	0.55	0.35437	D	0.794512	B;B	0.23650	0.037;0.089	B;B	0.14578	0.011;0.011	T	0.06499	-1.0823	10	0.72032	D	0.01	.	17.5849	0.87978	0.0:1.0:0.0:0.0	.	789;779	Q9ULW9;Q9Y233	.;PDE10_HUMAN	N	779;807;789;779;778	ENSP00000355847:D779N;ENSP00000346435:D779N	ENSP00000341187:D789N	D	-	1	0	PDE10A	165666509	1.000000	0.71417	0.467000	0.27180	0.013000	0.08279	3.146000	0.50631	2.200000	0.70718	0.655000	0.94253	GAT		0.527	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			16	144	0	0	0	0.008871	0	16	144				
SNX13	23161	broad.mit.edu	37	7	17879517	17879517	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:17879517C>G	ENST00000409389.1	-	13	1444	c.1272G>C	c.(1270-1272)caG>caC	p.Q424H	SNX13_ENST00000428135.3_Missense_Mutation_p.Q424H			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	424	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TTCCATCTCTCTGACGACTTA	0.418																																							uc003stw.1		NA																	0				central_nervous_system(2)|kidney(1)	3						c.(1270-1272)CAG>CAC		SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;							163.0	147.0	152.0					7																	17879517		1878	4107	5985	SO:0001583	missense	23161				cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity	g.chr7:17879517C>G	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.1272G>C	7.37:g.17879517C>G	ENSP00000386705:p.Gln424His		Somatic				SNX13_uc003stv.2_Missense_Mutation_p.Q424H|SNX13_uc010kuc.2_Missense_Mutation_p.Q221H	p.Q424H			WXS	Illumina HiSeq	Unspecified	Q9Y5W8	SNX13_HUMAN			13	1485	-	Lung NSC(10;0.0261)|all_lung(11;0.0521)		424			RGS.		B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	ENST00000409389.1	37	c.1272G>C		.	.	.	.	.	.	.	.	.	.	C	17.35	3.366373	0.61513	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	T;T	0.19105	2.17;2.43	5.25	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.36880	0.0983	L	0.59436	1.845	0.80722	D	1	D;D;D	0.71674	0.996;0.997;0.998	D;D;D	0.65443	0.915;0.935;0.93	T	0.07009	-1.0795	10	0.44086	T	0.13	-4.9061	9.505	0.39042	0.0:0.7778:0.0:0.2222	.	221;424;424	B3KN60;B8ZZT9;Q9Y5W8-2	.;.;.	H	424;424;472	ENSP00000386705:Q424H;ENSP00000398789:Q424H	ENSP00000242044:Q472H	Q	-	3	2	SNX13	17846042	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.421000	0.44688	1.336000	0.45506	0.557000	0.71058	CAG		0.418	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132		5	37	0	0	0	0.000602	0	5	37				
TRGC1	6966	broad.mit.edu	37	7	38305263	38305263	+	RNA	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:38305263T>C	ENST00000443402.2	-	0	16					NM_001003799.1|NM_001003806.1	NP_001003799.1|NP_001003806.1	P0CF51	TRGC1_HUMAN	T cell receptor gamma constant 1							integral component of membrane (GO:0016021)											GGGAAACATCTGCATCAAGTT	0.383																																							uc003tge.1		NA																	0					0						c.(442-444)GCA>GCG		Homo sapiens TCRgamma alternate reading frame protein (TCRg) mRNA, complete cds.							131.0	141.0	138.0					7																	38305263		1795	4075	5870			445347							g.chr7:38305263T>C	M14996		7p14	2012-02-07			ENSG00000211689	ENSG00000211689		"""T cell receptors / TRG locus"""	12275	other	T cell receptor gene	"""T-cell receptor, gamma, constant region C1"""	186970		TCRGC1		2879283	Standard	NG_001336		Approved	C1		P0CF51	OTTHUMG00000155219		7.37:g.38305263T>C			Somatic				uc003tfz.1_Intron|TARP_uc003tgb.2_5'UTR|TARP_uc003tgc.1_5'UTR|TARP_uc003tgd.1_5'UTR|TARP_uc010kxi.1_RNA|TARP_uc003tgf.1_RNA|TARP_uc003tgj.1_RNA|TARP_uc003tgh.1_RNA|TARP_uc003tgi.1_RNA|TARP_uc003tgg.1_RNA	p.A148A			WXS	Illumina HiSeq	Unspecified	A2JGV3	A2JGV3_HUMAN			5	821	-			Error:Variant_position_missing_in_A2JGV3_after_alignment						Silent	SNP	ENST00000443402.2	37	c.444A>G																																																																																					0.383	TRGC1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TR_C_gene	OTTHUMT00000338825.3	NG_001336		27	207	0	0	0	0.003755	0	27	207				
VWC2	375567	broad.mit.edu	37	7	49842409	49842409	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:49842409G>T	ENST00000340652.4	+	3	1355	c.799G>T	c.(799-801)Gat>Tat	p.D267Y		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	267	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						GTACGAGCCTGATCAGTGCTG	0.572																																							uc003tot.1		NA																	0					0						c.(799-801)GAT>TAT		von Willebrand factor C domain containing 2							263.0	173.0	203.0					7																	49842409		2203	4300	6503	SO:0001583	missense	375567				negative regulation of BMP signaling pathway|positive regulation of neuron differentiation	basement membrane|extracellular space		g.chr7:49842409G>T	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.799G>T	7.37:g.49842409G>T	ENSP00000341819:p.Asp267Tyr		Somatic					p.D267Y	NM_198570	NP_940972	WXS	Illumina HiSeq	Unspecified	Q2TAL6	VWC2_HUMAN			3	1355	+			267			VWFC 2.		Q6UXE2	Missense_Mutation	SNP	ENST00000340652.4	37	c.799G>T	CCDS5508.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.929928	0.73327	.	.	ENSG00000188730	ENST00000340652	T	0.74526	-0.85	5.32	5.32	0.75619	von Willebrand factor, type C (4);	0.064303	0.64402	D	0.000014	D	0.82728	0.5100	L	0.47190	1.495	0.49051	D	0.999741	D	0.64830	0.994	D	0.67103	0.949	D	0.84356	0.0535	10	0.87932	D	0	.	19.0139	0.92886	0.0:0.0:1.0:0.0	.	267	Q2TAL6	VWC2_HUMAN	Y	267	ENSP00000341819:D267Y	ENSP00000341819:D267Y	D	+	1	0	VWC2	49812955	1.000000	0.71417	0.956000	0.39512	0.947000	0.59692	5.764000	0.68826	2.484000	0.83849	0.650000	0.86243	GAT		0.572	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570		6	65	1	0	3.59834e-05	0.001168	4.37759e-05	6	65				
POM121L12	285877	broad.mit.edu	37	7	53104220	53104220	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:53104220G>A	ENST00000408890.4	+	1	872	c.856G>A	c.(856-858)Gag>Aag	p.E286K		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	286										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CTTCGCCCTCGAGGTCACCCA	0.622																																							uc003tpz.2		NA																	0					0						c.(856-858)GAG>AAG		POM121 membrane glycoprotein-like 12							41.0	46.0	45.0					7																	53104220		1997	4169	6166	SO:0001583	missense	285877							g.chr7:53104220G>A		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.856G>A	7.37:g.53104220G>A	ENSP00000386133:p.Glu286Lys		Somatic					p.E286K	NM_182595	NP_872401	WXS	Illumina HiSeq	Unspecified	Q8N7R1	P1L12_HUMAN			1	872	+			286					Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	c.856G>A	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	G	6.300	0.423482	0.11928	.	.	ENSG00000221900	ENST00000408890	T	0.23147	1.92	1.97	-3.93	0.04143	.	.	.	.	.	T	0.11281	0.0275	N	0.08118	0	0.09310	N	1	B	0.17465	0.022	B	0.11329	0.006	T	0.22173	-1.0224	9	0.62326	D	0.03	.	6.5751	0.22562	0.1911:0.3771:0.4319:0.0	.	286	Q8N7R1	P1L12_HUMAN	K	286	ENSP00000386133:E286K	ENSP00000386133:E286K	E	+	1	0	POM121L12	53071714	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.312000	0.00516	-2.116000	0.00830	-1.229000	0.01577	GAG		0.622	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		8	62	0	0	0	0.004482	0	8	62				
ZNF479	90827	broad.mit.edu	37	7	57187809	57187809	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:57187809T>G	ENST00000331162.4	-	5	1583	c.1313A>C	c.(1312-1314)aAa>aCa	p.K438T		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TTCTTCACATTTGTAGGGTCT	0.453																																							uc010kzo.2		NA																	0				ovary(3)|skin(1)	4						c.(1312-1314)AAA>ACA		zinc finger protein 479							15.0	13.0	14.0					7																	57187809		1651	3694	5345	SO:0001583	missense	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57187809T>G	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1313A>C	7.37:g.57187809T>G	ENSP00000333776:p.Lys438Thr		Somatic					p.K438T	NM_033273	NP_150376	WXS	Illumina HiSeq	Unspecified	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	1584	-			438			C2H2-type 10.			Missense_Mutation	SNP	ENST00000331162.4	37	c.1313A>C	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	N	0.007	-1.944203	0.00479	.	.	ENSG00000185177	ENST00000331162	T	0.58060	0.36	0.955	-1.91	0.07641	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32133	0.0819	N	0.20574	0.59	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10497	-1.0627	9	0.59425	D	0.04	.	4.2411	0.10648	0.1773:0.0:0.4807:0.342	.	438	Q96JC4	ZN479_HUMAN	T	438	ENSP00000333776:K438T	ENSP00000333776:K438T	K	-	2	0	ZNF479	57191751	0.000000	0.05858	0.013000	0.15412	0.012000	0.07955	-1.673000	0.01951	-4.325000	0.00056	-4.471000	0.00005	AAA		0.453	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		4	88	0	0	0	0.000602	0	4	88				
PCLO	27445	broad.mit.edu	37	7	82583230	82583230	+	Missense_Mutation	SNP	C	C	A	rs373232753		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:82583230C>A	ENST00000333891.9	-	5	7376	c.7039G>T	c.(7039-7041)Gta>Tta	p.V2347L	PCLO_ENST00000423517.2_Missense_Mutation_p.V2347L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGGGCTATTACAGAAGAAGGT	0.433																																							uc003uhx.2		NA																	0				ovary(7)	7						c.(7039-7041)GTA>TTA		piccolo isoform 1							79.0	81.0	80.0					7																	82583230		1873	4102	5975	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82583230C>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7039G>T	7.37:g.82583230C>A	ENSP00000334319:p.Val2347Leu		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.V2347L|PCLO_uc010lec.2_5'Flank	p.V2347L	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			5	7328	-			2278						Missense_Mutation	SNP	ENST00000333891.9	37	c.7039G>T	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	7.543	0.661021	0.14645	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16597	2.33;2.33	4.17	-3.01	0.05463	.	.	.	.	.	T	0.10680	0.0261	L	0.36672	1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.35699	-0.9778	9	0.87932	D	0	.	2.2406	0.04018	0.1202:0.3303:0.1206:0.4288	.	2347;2347	Q9Y6V0-5;Q9Y6V0-6	.;.	L	2278;2347;2347	ENSP00000334319:V2347L;ENSP00000388393:V2347L	ENSP00000334319:V2347L	V	-	1	0	PCLO	82421166	0.000000	0.05858	0.000000	0.03702	0.715000	0.41141	-1.831000	0.01698	-0.627000	0.05589	0.505000	0.49811	GTA		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		6	56	1	0	0.00198382	0.001984	0.00231749	6	56				
ABCB4	5244	broad.mit.edu	37	7	87031509	87031509	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:87031509C>G	ENST00000265723.4	-	28	3875	c.3764G>C	c.(3763-3765)gGg>gCg	p.G1255A	ABCB4_ENST00000359206.3_Missense_Mutation_p.G1248A|ABCB4_ENST00000545634.1_Missense_Mutation_p.G1248A|ABCB4_ENST00000453593.1_Missense_Mutation_p.G1201A|ABCB4_ENST00000358400.3_Missense_Mutation_p.G1201A	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1255	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CTTGACTCTCCCATTCTGAAA	0.512																																							uc003uiv.1		NA																	0				ovary(4)|skin(1)|pancreas(1)	6						c.(3763-3765)GGG>GCG		ATP-binding cassette, subfamily B, member 4							160.0	145.0	150.0					7																	87031509		2203	4300	6503	SO:0001583	missense	5244				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity	g.chr7:87031509C>G	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.3764G>C	7.37:g.87031509C>G	ENSP00000265723:p.Gly1255Ala		Somatic				ABCB4_uc003uiw.1_Missense_Mutation_p.G1248A|ABCB4_uc003uix.1_Missense_Mutation_p.G1201A	p.G1255A	NM_018849	NP_061337	WXS	Illumina HiSeq	Unspecified	P21439	MDR3_HUMAN			28	3840	-	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		1255			ABC transporter 2.|Cytoplasmic (By similarity).		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	c.3764G>C	CCDS5606.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.09|19.09	3.760601|3.760601	0.69763|0.69763	.|.	.|.	ENSG00000005471|ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634|ENST00000440025	D;D;D;D;D|.	0.91407|.	-2.84;-2.84;-2.84;-2.84;-2.84|.	5.3|5.3	4.42|4.42	0.53409|0.53409	ATPase, AAA+ type, core (1);ABC transporter-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80221|0.80221	0.4583|0.4583	M|M	0.90759|0.90759	3.145|3.145	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;0.999|.	D|D	0.84200|0.84200	0.0450|0.0450	10|5	0.87932|.	D|.	0|.	-12.4935|-12.4935	13.6957|13.6957	0.62578|0.62578	0.0:0.9245:0.0:0.0755|0.0:0.9245:0.0:0.0755	.|.	1201;1248;1255|.	A4D1D5;P21439-2;P21439|.	.;.;MDR3_HUMAN|.	A|C	1248;1201;1255;1201;1248|59	ENSP00000352135:G1248A;ENSP00000351172:G1201A;ENSP00000265723:G1255A;ENSP00000392983:G1201A;ENSP00000437465:G1248A|.	ENSP00000265723:G1255A|.	G|W	-|-	2|3	0|0	ABCB4|ABCB4	86869445|86869445	1.000000|1.000000	0.71417|0.71417	0.055000|0.055000	0.19348|0.19348	0.725000|0.725000	0.41563|0.41563	4.768000|4.768000	0.62293|0.62293	1.360000|1.360000	0.45960|0.45960	0.655000|0.655000	0.94253|0.94253	GGG|TGG		0.512	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443		10	144	0	0	0	0.000978	0	10	144				
ADAM22	53616	broad.mit.edu	37	7	87607717	87607717	+	Missense_Mutation	SNP	G	G	T	rs181573756		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:87607717G>T	ENST00000265727.7	+	3	392	c.313G>T	c.(313-315)Gtg>Ttg	p.V105L	ADAM22_ENST00000439864.1_Missense_Mutation_p.V105L|ADAM22_ENST00000315984.7_Missense_Mutation_p.V105L|ADAM22_ENST00000398201.4_Missense_Mutation_p.V105L|ADAM22_ENST00000398204.4_Missense_Mutation_p.V105L|ADAM22_ENST00000398209.3_Missense_Mutation_p.V105L			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	105					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TCTCGATGTCGTGCTAAATCA	0.333																																							uc003ujn.2		NA																	0				ovary(4)|skin(2)|lung(1)|kidney(1)	8						c.(313-315)GTG>TTG		ADAM metallopeptidase domain 22 isoform 1							178.0	162.0	167.0					7																	87607717		1906	4123	6029	SO:0001583	missense	53616				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding	g.chr7:87607717G>T	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.313G>T	7.37:g.87607717G>T	ENSP00000265727:p.Val105Leu		Somatic				ADAM22_uc003uji.1_Missense_Mutation_p.V104L|ADAM22_uc003ujj.1_Missense_Mutation_p.V105L|ADAM22_uc003ujk.1_Missense_Mutation_p.V105L|ADAM22_uc003ujl.1_Missense_Mutation_p.V105L|ADAM22_uc003ujm.2_Missense_Mutation_p.V105L|ADAM22_uc003ujo.2_Missense_Mutation_p.V105L|ADAM22_uc003ujp.1_Missense_Mutation_p.V157L	p.V105L	NM_021723	NP_068369	WXS	Illumina HiSeq	Unspecified	Q9P0K1	ADA22_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		3	392	+	Esophageal squamous(14;0.00202)		105					O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	ENST00000265727.7	37	c.313G>T	CCDS47637.1	.	.	.	.	.	.	.	.	.	.	G	4.444	0.082115	0.08533	.	.	ENSG00000008277	ENST00000398204;ENST00000439864;ENST00000412441;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	T;T;T;T;T;T;T;T	0.05717	3.4;3.4;3.4;3.4;3.4;3.4;3.4;3.4	5.43	-8.39	0.00969	Peptidase M12B, propeptide (1);	1.308460	0.05440	N	0.547527	T	0.02494	0.0076	N	0.03050	-0.425	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.12156	0.007;0.001;0.003;0.001;0.004;0.004	T	0.47262	-0.9131	10	0.33940	T	0.23	.	8.8575	0.35236	0.5306:0.2429:0.2265:0.0	.	157;105;105;105;105;105	E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2;E7EPF1;D6W5P7	.;.;ADA22_HUMAN;.;.;.	L	105;105;122;105;105;105;105;72	ENSP00000381262:V105L;ENSP00000391334:V105L;ENSP00000413899:V122L;ENSP00000381260:V105L;ENSP00000265727:V105L;ENSP00000315900:V105L;ENSP00000381267:V105L;ENSP00000381261:V72L	ENSP00000265727:V105L	V	+	1	0	ADAM22	87445653	0.000000	0.05858	0.030000	0.17652	0.144000	0.21451	-0.865000	0.04250	-2.141000	0.00805	-0.378000	0.06908	GTG		0.333	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723		13	70	1	0	6.72482e-11	0.003163	8.95081e-11	13	70				
SAMD9L	219285	broad.mit.edu	37	7	92762765	92762765	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:92762765C>T	ENST00000318238.4	-	5	3736	c.2520G>A	c.(2518-2520)atG>atA	p.M840I	SAMD9L_ENST00000437805.1_Missense_Mutation_p.M840I|SAMD9L_ENST00000411955.1_Missense_Mutation_p.M840I	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	840					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TCCGGGATCTCATGCAGTTTA	0.363																																							uc003umh.1		NA																	0				ovary(4)	4						c.(2518-2520)ATG>ATA		sterile alpha motif domain containing 9-like							92.0	97.0	95.0					7																	92762765		2203	4299	6502	SO:0001583	missense	219285							g.chr7:92762765C>T	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.2520G>A	7.37:g.92762765C>T	ENSP00000326247:p.Met840Ile		Somatic				SAMD9L_uc003umj.1_Missense_Mutation_p.M840I|SAMD9L_uc003umi.1_Missense_Mutation_p.M840I|SAMD9L_uc010lfb.1_Missense_Mutation_p.M840I|SAMD9L_uc003umk.1_Missense_Mutation_p.M840I|SAMD9L_uc010lfc.1_Missense_Mutation_p.M840I|SAMD9L_uc010lfd.1_Missense_Mutation_p.M840I|SAMD9L_uc011khx.1_Intron	p.M840I	NM_152703	NP_689916	WXS	Illumina HiSeq	Unspecified	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		5	3736	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		840					A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	c.2520G>A	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783178	0.49891	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.23147	1.92;1.92;1.92	4.67	4.67	0.58626	.	0.119507	0.52532	D	0.000063	T	0.29620	0.0739	L	0.46614	1.455	0.34533	D	0.709468	P	0.48294	0.908	B	0.43916	0.436	T	0.47837	-0.9086	10	0.62326	D	0.03	-17.6241	17.3551	0.87333	0.0:1.0:0.0:0.0	.	840	Q8IVG5	SAM9L_HUMAN	I	840	ENSP00000326247:M840I;ENSP00000405760:M840I;ENSP00000408796:M840I	ENSP00000326247:M840I	M	-	3	0	SAMD9L	92600701	0.890000	0.30428	1.000000	0.80357	0.811000	0.45836	0.531000	0.23052	2.433000	0.82419	0.467000	0.42956	ATG		0.363	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		11	121	0	0	0	0.001368	0	11	121				
CALCR	799	broad.mit.edu	37	7	93072950	93072950	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:93072950C>A	ENST00000394441.1	-	8	1083	c.768G>T	c.(766-768)aaG>aaT	p.K256N	CALCR_ENST00000426151.1_Missense_Mutation_p.K256N|CALCR_ENST00000360249.4_Missense_Mutation_p.K272N|CALCR_ENST00000359558.2_Missense_Mutation_p.K290N|CALCR_ENST00000421592.1_Missense_Mutation_p.K272N	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	290					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	GCAAGCGTTGCTTCTCAGTAA	0.433																																							uc003umv.1		NA																	0				ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.(868-870)AAG>AAT		calcitonin receptor isoform 2 precursor	Salmon Calcitonin(DB00017)						137.0	126.0	130.0					7																	93072950		2203	4300	6503	SO:0001583	missense	799				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding	g.chr7:93072950C>A	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.768G>T	7.37:g.93072950C>A	ENSP00000377959:p.Lys256Asn		Somatic				CALCR_uc011kia.1_Missense_Mutation_p.K70N|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.K256N|CALCR_uc003umw.2_Missense_Mutation_p.K256N	p.K290N	NM_001742	NP_001733	WXS	Illumina HiSeq	Unspecified	P30988	CALCR_HUMAN	STAD - Stomach adenocarcinoma(171;0.000244)		10	1131	-	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		272			Cytoplasmic (Potential).		A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	37	c.870G>T	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535701	0.45176	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	4.94	-7.9	0.01169	.	.	.	.	.	T	0.35998	0.0951	L	0.48642	1.525	0.20563	N	0.999882	B;B	0.34147	0.438;0.014	B;B	0.41571	0.36;0.043	T	0.50701	-0.8797	9	0.59425	D	0.04	.	9.073	0.36504	0.131:0.6456:0.0:0.2234	.	290;256	F5H605;A4D1G6	.;.	N	290;272;272;256;256	ENSP00000352561:K290N;ENSP00000353385:K272N;ENSP00000399552:K272N;ENSP00000377959:K256N;ENSP00000389295:K256N	ENSP00000352561:K290N	K	-	3	2	CALCR	92910886	0.174000	0.23070	0.000000	0.03702	0.004000	0.04260	-0.288000	0.08377	-1.904000	0.01092	0.557000	0.71058	AAG		0.433	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742		6	92	1	0	3.59834e-05	0.001168	4.37759e-05	6	92				
CASD1	64921	broad.mit.edu	37	7	94157528	94157528	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:94157528G>T	ENST00000297273.4	+	5	712	c.425G>T	c.(424-426)gGt>gTt	p.G142V		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	142						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GAAGTTAATGGTTCTATGAAA	0.284																																							uc003uni.3		NA																	0				ovary(2)	2						c.(424-426)GGT>GTT		CAS1 domain containing 1 precursor							150.0	155.0	153.0					7																	94157528		2203	4299	6502	SO:0001583	missense	64921					integral to membrane		g.chr7:94157528G>T	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.425G>T	7.37:g.94157528G>T	ENSP00000297273:p.Gly142Val		Somatic				CASD1_uc003unh.2_Missense_Mutation_p.G142V|CASD1_uc003unj.3_Missense_Mutation_p.G142V	p.G142V	NM_022900	NP_075051	WXS	Illumina HiSeq	Unspecified	Q96PB1	CASD1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		5	652	+	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		142					B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	ENST00000297273.4	37	c.425G>T	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.445415	0.25987	.	.	ENSG00000127995	ENST00000447923;ENST00000297273	T;T	0.17854	2.25;2.25	4.83	2.88	0.33553	Cyclin-like (1);	0.185148	0.49305	D	0.000145	T	0.15696	0.0378	L	0.29908	0.895	0.58432	D	0.999997	B;P;P	0.45283	0.411;0.76;0.855	B;B;P	0.47299	0.321;0.446;0.543	T	0.02560	-1.1141	10	0.41790	T	0.15	.	9.3235	0.37980	0.0756:0.274:0.6504:0.0	.	142;142;142	Q8WZ77;Q96PB1;B2RAS9	.;CASD1_HUMAN;.	V	73;142	ENSP00000396261:G73V;ENSP00000297273:G142V	ENSP00000297273:G142V	G	+	2	0	CASD1	93995464	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.119000	0.64679	1.137000	0.42214	-0.165000	0.13383	GGT		0.284	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1	NM_022900		7	56	1	0	0.00307968	0.00308	0.0035758	7	56				
ASNS	440	broad.mit.edu	37	7	97481672	97481672	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:97481672G>A	ENST00000394309.3	-	13	2056	c.1585C>T	c.(1585-1587)Cgg>Tgg	p.R529W	ASNS_ENST00000394308.3_Missense_Mutation_p.R529W|ASNS_ENST00000437628.1_Missense_Mutation_p.R446W|ASNS_ENST00000175506.4_Missense_Mutation_p.R529W|ASNS_ENST00000422745.1_Missense_Mutation_p.R508W|ASNS_ENST00000455086.1_Missense_Mutation_p.R446W|ASNS_ENST00000444334.1_Missense_Mutation_p.R508W	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	529	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CAGTCAGCCCGGCCTGGGTAA	0.498																																					Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	uc003uot.3		NA																	0				ovary(1)	1						c.(1585-1587)CGG>TGG		asparagine synthetase	Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						120.0	114.0	116.0					7																	97481672		2203	4300	6503	SO:0001583	missense	440				cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding	g.chr7:97481672G>A	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1585C>T	7.37:g.97481672G>A	ENSP00000377846:p.Arg529Trp		Somatic				ASNS_uc011kin.1_Missense_Mutation_p.R446W|ASNS_uc003uou.3_Missense_Mutation_p.R529W|ASNS_uc003uov.3_Missense_Mutation_p.R529W|ASNS_uc011kio.1_Missense_Mutation_p.R508W|ASNS_uc003uow.3_Missense_Mutation_p.R508W|ASNS_uc003uox.3_Missense_Mutation_p.R446W	p.R529W	NM_133436	NP_597680	WXS	Illumina HiSeq	Unspecified	P08243	ASNS_HUMAN			13	2091	-	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)		529			Asparagine synthetase.		A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	ENST00000394309.3	37	c.1585C>T	CCDS5652.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737653	0.69304	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334	T;T;T;T;T;T;T	0.46063	0.89;0.89;0.88;0.89;0.88;0.88;0.88	5.23	5.23	0.72850	.	0.276969	0.37623	N	0.002019	T	0.36580	0.0972	L	0.43152	1.355	0.48975	D	0.99973	P	0.52463	0.953	B	0.38712	0.28	T	0.39251	-0.9623	10	0.66056	D	0.02	-11.6126	16.6738	0.85273	0.0:0.0:1.0:0.0	.	529	P08243	ASNS_HUMAN	W	529;529;446;529;508;446;508	ENSP00000175506:R529W;ENSP00000377846:R529W;ENSP00000414379:R446W;ENSP00000377845:R529W;ENSP00000414901:R508W;ENSP00000408472:R446W;ENSP00000406994:R508W	ENSP00000175506:R529W	R	-	1	2	ASNS	97319608	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.397000	0.52572	2.609000	0.88269	0.561000	0.74099	CGG		0.498	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356		6	127	0	0	0	0.001168	0	6	127				
ASNS	440	broad.mit.edu	37	7	97483918	97483918	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:97483918G>A	ENST00000394309.3	-	10	1683	c.1212C>T	c.(1210-1212)cgC>cgT	p.R404R	ASNS_ENST00000394308.3_Silent_p.R404R|ASNS_ENST00000437628.1_Silent_p.R321R|ASNS_ENST00000175506.4_Silent_p.R404R|ASNS_ENST00000422745.1_Silent_p.R383R|ASNS_ENST00000455086.1_Silent_p.R321R|ASNS_ENST00000444334.1_Silent_p.R383R	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	404	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	TTCGATCTGCGCGGAGAACAT	0.388																																					Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	uc003uot.3		NA																	0				ovary(1)	1						c.(1210-1212)CGC>CGT		asparagine synthetase	Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						79.0	83.0	82.0					7																	97483918		2203	4300	6503	SO:0001819	synonymous_variant	440				cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding	g.chr7:97483918G>A	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1212C>T	7.37:g.97483918G>A			Somatic				ASNS_uc011kin.1_Silent_p.R321R|ASNS_uc003uou.3_Silent_p.R404R|ASNS_uc003uov.3_Silent_p.R404R|ASNS_uc011kio.1_Silent_p.R383R|ASNS_uc003uow.3_Silent_p.R383R|ASNS_uc003uox.3_Silent_p.R321R	p.R404R	NM_133436	NP_597680	WXS	Illumina HiSeq	Unspecified	P08243	ASNS_HUMAN			10	1718	-	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)		404			Asparagine synthetase.		A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Silent	SNP	ENST00000394309.3	37	c.1212C>T	CCDS5652.1																																																																																				0.388	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356		9	66	0	0	0	0.008291	0	9	66				
SERPINE1	5054	broad.mit.edu	37	7	100771931	100771931	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:100771931G>C	ENST00000223095.4	+	2	414	c.257G>C	c.(256-258)gGa>gCa	p.G86A	SERPINE1_ENST00000445463.2_Missense_Mutation_p.G71A	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	86					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.G86V(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	GCAGCTATGGGATTCAAGATT	0.572																																							uc003uxt.2		NA																	1	Substitution - Missense(1)		prostate(1)	ovary(1)|lung(1)|central_nervous_system(1)	3						c.(256-258)GGA>GCA		plasminogen activator inhibitor-1 isoform 1	Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)						46.0	44.0	44.0					7																	100771931		2203	4300	6503	SO:0001583	missense	5054				angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity	g.chr7:100771931G>C	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.257G>C	7.37:g.100771931G>C	ENSP00000223095:p.Gly86Ala		Somatic				SERPINE1_uc011kkj.1_Missense_Mutation_p.G71A|SERPINE1_uc003uxu.1_5'Flank	p.G86A	NM_000602	NP_000593	WXS	Illumina HiSeq	Unspecified	P05121	PAI1_HUMAN			2	405	+	Lung NSC(181;0.136)|all_lung(186;0.182)		86					B7Z4S0|F8WD53	Missense_Mutation	SNP	ENST00000223095.4	37	c.257G>C	CCDS5711.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695945	0.30052	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000441467	D;D	0.85484	-1.99;-1.99	5.71	2.51	0.30379	Serpin domain (3);	0.513801	0.21121	N	0.079807	T	0.78444	0.4284	M	0.67569	2.06	0.37000	D	0.895234	B;P	0.38978	0.356;0.652	B;B	0.32465	0.033;0.146	T	0.74904	-0.3505	10	0.34782	T	0.22	.	6.4298	0.21790	0.4403:0.0:0.5597:0.0	.	71;86	F8WD53;P05121	.;PAI1_HUMAN	A	86;71;71	ENSP00000223095:G86A;ENSP00000396766:G71A	ENSP00000223095:G86A	G	+	2	0	SERPINE1	100558651	0.193000	0.23313	0.982000	0.44146	0.484000	0.33280	0.990000	0.29642	0.606000	0.29965	0.655000	0.94253	GGA		0.572	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602		6	72	0	0	0	0.00308	0	6	72				
RELN	5649	broad.mit.edu	37	7	103191710	103191710	+	Missense_Mutation	SNP	C	C	T	rs371614773		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:103191710C>T	ENST00000428762.1	-	41	6265	c.6106G>A	c.(6106-6108)Gcg>Acg	p.A2036T	RELN_ENST00000343529.5_Missense_Mutation_p.A2036T|RELN_ENST00000424685.2_Missense_Mutation_p.A2036T	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2036					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACTGGATCCGCGGATGAGCTA	0.498																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(6106-6108)GCG>ACG		reelin isoform a		C	THR/ALA,THR/ALA	0,4406		0,0,2203	55.0	47.0	50.0		6106,6106	4.2	1.0	7		50	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RELN	NM_005045.3,NM_173054.2	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	2036/3461,2036/3459	103191710	1,13005	2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103191710C>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6106G>A	7.37:g.103191710C>T	ENSP00000392423:p.Ala2036Thr		Somatic				RELN_uc010liz.2_Missense_Mutation_p.A2036T	p.A2036T	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	41	6266	-			2036					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.6106G>A	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	5.517	0.280267	0.10458	0.0	1.16E-4	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.22539	1.95;1.95;1.95	5.96	4.18	0.49190	Neuraminidase (1);	0.265034	0.43416	N	0.000570	T	0.11922	0.0290	N	0.24115	0.695	0.35661	D	0.812554	B;B	0.21225	0.051;0.053	B;B	0.09377	0.004;0.002	T	0.14448	-1.0472	10	0.02654	T	1	.	12.8294	0.57738	0.0:0.8683:0.0:0.1317	.	2036;2036	P78509-2;P78509	.;RELN_HUMAN	T	2036	ENSP00000392423:A2036T;ENSP00000345694:A2036T;ENSP00000388446:A2036T	ENSP00000345694:A2036T	A	-	1	0	RELN	102978946	0.995000	0.38212	0.995000	0.50966	0.212000	0.24457	1.205000	0.32308	0.871000	0.35750	0.650000	0.86243	GCG		0.498	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		6	29	0	0	0	0.001168	0	6	29				
KMT2E	55904	broad.mit.edu	37	7	104681417	104681417	+	Silent	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:104681417A>T	ENST00000311117.3	+	3	563	c.18A>T	c.(16-18)ccA>ccT	p.P6P	KMT2E_ENST00000257745.4_Silent_p.P6P|KMT2E_ENST00000476671.1_Silent_p.P6P|KMT2E_ENST00000334877.4_Silent_p.P6P|KMT2E_ENST00000334914.7_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	6					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TAGTGATCCCATTGGGGGTTG	0.423																																							uc003vcm.2		NA																	0				ovary(2)|pancreas(1)	3						c.(16-18)CCA>CCT		myeloid/lymphoid or mixed-lineage leukemia 5							115.0	106.0	109.0					7																	104681417		2203	4300	6503	SO:0001819	synonymous_variant	55904				cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding	g.chr7:104681417A>T	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.18A>T	7.37:g.104681417A>T			Somatic				MLL5_uc010lja.1_5'UTR|MLL5_uc010ljb.1_Silent_p.P6P|MLL5_uc003vcl.2_Silent_p.P6P|MLL5_uc010ljc.2_Silent_p.P6P	p.P6P	NM_182931	NP_891847	WXS	Illumina HiSeq	Unspecified	Q8IZD2	MLL5_HUMAN			3	552	+			6					B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Silent	SNP	ENST00000311117.3	37	c.18A>T	CCDS34723.1																																																																																				0.423	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1			4	97	0	0	0	0.000602	0	4	97				
CBLL1	79872	broad.mit.edu	37	7	107398785	107398785	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:107398785C>T	ENST00000440859.3	+	6	1105	c.638C>T	c.(637-639)cCa>cTa	p.P213L	CBLL1_ENST00000222597.2_Missense_Mutation_p.P212L|CBLL1_ENST00000415884.2_3'UTR	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	213	Pro-rich.				negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						GCCCCACCACCAACTGAAATC	0.473																																							uc003veq.2		NA																	0				ovary(2)|skin(2)|lung(1)	5						c.(637-639)CCA>CTA		Cas-Br-M (murine) ecotropic retroviral							183.0	173.0	177.0					7																	107398785		2203	4300	6503	SO:0001583	missense	79872				cell-cell adhesion|negative regulation of cell adhesion|positive regulation of cell migration|positive regulation of endocytosis		protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr7:107398785C>T	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.638C>T	7.37:g.107398785C>T	ENSP00000401277:p.Pro213Leu		Somatic				CBLL1_uc011kme.1_Missense_Mutation_p.P92L|CBLL1_uc011kmf.1_Missense_Mutation_p.P212L	p.P213L	NM_024814	NP_079090	WXS	Illumina HiSeq	Unspecified	Q75N03	HAKAI_HUMAN			6	968	+			213			Pro-rich.		B7ZM03|Q8TAJ4|Q9H5S6	Missense_Mutation	SNP	ENST00000440859.3	37	c.638C>T	CCDS5747.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786050	0.31593	.	.	ENSG00000105879	ENST00000440859;ENST00000535365;ENST00000222597;ENST00000420796;ENST00000417616	T;T;T	0.32272	1.47;1.46;1.55	5.14	5.14	0.70334	.	0.075697	0.53938	D	0.000054	T	0.27419	0.0673	L	0.56769	1.78	0.58432	D	0.999999	P;P	0.37330	0.557;0.59	B;B	0.34824	0.086;0.19	T	0.04242	-1.0966	10	0.09590	T	0.72	-1.0795	13.8877	0.63719	0.1525:0.8475:0.0:0.0	.	212;213	B7ZM03;Q75N03	.;HAKAI_HUMAN	L	213;92;212;163;159	ENSP00000401277:P213L;ENSP00000222597:P212L;ENSP00000410615:P163L	ENSP00000222597:P212L	P	+	2	0	CBLL1	107186021	0.995000	0.38212	1.000000	0.80357	0.996000	0.88848	3.553000	0.53713	2.558000	0.86282	0.655000	0.94253	CCA		0.473	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814		14	206	0	0	0	0.004007	0	14	206				
WNT16	51384	broad.mit.edu	37	7	120979309	120979309	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:120979309C>A	ENST00000222462.2	+	4	1298	c.1008C>A	c.(1006-1008)caC>caA	p.H336Q	WNT16_ENST00000361301.2_Missense_Mutation_p.H326Q	NM_057168.1	NP_476509.1	Q9UBV4	WNT16_HUMAN	wingless-type MMTV integration site family, member 16	336					bone remodeling (GO:0046849)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|optic cup formation involved in camera-type eye development (GO:0003408)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|replicative senescence (GO:0090399)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)	18	all_neural(327;0.117)					TGGTCAGGCACGTGGAGAGGT	0.537																																							uc003vjw.2		NA																	0				lung(2)|ovary(2)|large_intestine(1)	5						c.(1006-1008)CAC>CAA		wingless-type MMTV integration site family,							172.0	111.0	132.0					7																	120979309		2203	4300	6503	SO:0001583	missense	51384				anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|keratinocyte differentiation|keratinocyte proliferation|negative regulation of cell death|optic cup formation involved in camera-type eye development|oxidative stress-induced premature senescence|positive regulation of gene expression|positive regulation of JNK cascade|positive regulation of phosphatidylinositol 3-kinase cascade|replicative senescence|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity	g.chr7:120979309C>A	AF152584	CCDS5780.1, CCDS5781.1	7q31	2008-07-18			ENSG00000002745	ENSG00000002745		"""Wingless-type MMTV integration sites"""	16267	protein-coding gene	gene with protein product		606267				10500199	Standard	NM_016087		Approved		uc003vjw.3	Q9UBV4	OTTHUMG00000156963	ENST00000222462.2:c.1008C>A	7.37:g.120979309C>A	ENSP00000222462:p.His336Gln		Somatic				WNT16_uc003vjv.2_Missense_Mutation_p.H326Q|WNT16_uc010lkl.2_Missense_Mutation_p.H120Q	p.H336Q	NM_057168	NP_476509	WXS	Illumina HiSeq	Unspecified	Q9UBV4	WNT16_HUMAN			4	1265	+	all_neural(327;0.117)		336					Q2M3G1|Q9Y5C0	Missense_Mutation	SNP	ENST00000222462.2	37	c.1008C>A	CCDS5781.1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.953904	0.34471	.	.	ENSG00000002745	ENST00000361301;ENST00000222462	T;T	0.74842	-0.88;-0.88	5.81	1.0	0.19881	.	0.000000	0.85682	D	0.000000	T	0.61887	0.2383	L	0.31752	0.955	0.58432	D	0.999993	P;P	0.45902	0.868;0.868	B;P	0.44673	0.343;0.457	T	0.53294	-0.8459	10	0.27082	T	0.32	.	9.7711	0.40589	0.0:0.5217:0.0:0.4783	.	336;326	Q9UBV4;E9PH60	WNT16_HUMAN;.	Q	326;336	ENSP00000355065:H326Q;ENSP00000222462:H336Q	ENSP00000222462:H336Q	H	+	3	2	WNT16	120766545	0.008000	0.16893	0.996000	0.52242	0.988000	0.76386	-0.823000	0.04443	-0.082000	0.12640	-0.136000	0.14681	CAC		0.537	WNT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346843.1	NM_057168		15	59	1	0	1.5739e-10	0.004007	2.08038e-10	15	59				
GRM8	2918	broad.mit.edu	37	7	126746621	126746621	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:126746621G>A	ENST00000339582.2	-	3	1464	c.656C>T	c.(655-657)tCg>tTg	p.S219L	GRM8_ENST00000405249.1_Missense_Mutation_p.S219L|GRM8_ENST00000358373.3_Missense_Mutation_p.S219L|GRM8_ENST00000444921.2_Missense_Mutation_p.S219L|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	219					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.S219L(2)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				AGCCAGTGTCGAAACATAATT	0.493										HNSCC(24;0.065)																													uc003vlr.2		NA																	2	Substitution - Missense(2)	p.S219S(1)	endometrium(2)	lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.(655-657)TCG>TTG		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)						141.0	122.0	129.0					7																	126746621		2203	4300	6503	SO:0001583	missense	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126746621G>A		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.656C>T	7.37:g.126746621G>A	ENSP00000344173:p.Ser219Leu	HNSCC(24;0.065)	Somatic				GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.S219L|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_5'UTR	p.S219L	NM_000845	NP_000836	WXS	Illumina HiSeq	Unspecified	O00222	GRM8_HUMAN			2	967	-		Prostate(267;0.186)	219			Extracellular (Potential).		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	c.656C>T	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384331	0.82792	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249;ENST00000457830;ENST00000465844	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.11	5.11	0.69529	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000001	D	0.93861	0.8036	H	0.95079	3.62	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.75484	0.986;0.956	D	0.95641	0.8698	10	0.87932	D	0	.	17.5651	0.87917	0.0:0.0:1.0:0.0	.	219;219	O00222-2;O00222	.;GRM8_HUMAN	L	219;219;219;219;219;29	ENSP00000344173:S219L;ENSP00000409790:S219L;ENSP00000351142:S219L;ENSP00000385731:S219L;ENSP00000415522:S219L;ENSP00000418255:S29L	ENSP00000344173:S219L	S	-	2	0	GRM8	126533857	1.000000	0.71417	0.946000	0.38457	0.542000	0.35054	8.018000	0.88722	2.386000	0.81285	0.563000	0.77884	TCG		0.493	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			6	54	0	0	0	0.001984	0	6	54				
RBM28	55131	broad.mit.edu	37	7	127964664	127964664	+	Silent	SNP	C	C	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:127964664C>A	ENST00000223073.2	-	12	1401	c.1287G>T	c.(1285-1287)acG>acT	p.T429T	RBM28_ENST00000415472.2_Silent_p.T288T	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	429					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						TCTTCACCTTCGTCGTCTGAA	0.562																																							uc003vmp.2		NA																	0				ovary(2)	2						c.(1285-1287)ACG>ACT		RNA binding motif protein 28							164.0	163.0	164.0					7																	127964664		2203	4300	6503	SO:0001819	synonymous_variant	55131				mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding	g.chr7:127964664C>A	AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.1287G>T	7.37:g.127964664C>A			Somatic				RBM28_uc003vmo.2_Silent_p.T46T|RBM28_uc011koj.1_Silent_p.T288T|RBM28_uc011kok.1_Silent_p.T376T	p.T429T	NM_018077	NP_060547	WXS	Illumina HiSeq	Unspecified	Q9NW13	RBM28_HUMAN			12	1402	-			429					A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Silent	SNP	ENST00000223073.2	37	c.1287G>T	CCDS5801.1																																																																																				0.562	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2	NM_018077		22	254	1	0	1.85244e-09	0.00333	2.41513e-09	22	254				
TNPO3	23534	broad.mit.edu	37	7	128633922	128633922	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:128633922C>G	ENST00000265388.5	-	9	1348	c.1205G>C	c.(1204-1206)aGg>aCg	p.R402T	TNPO3_ENST00000393245.1_Missense_Mutation_p.R402T|TNPO3_ENST00000471166.1_Missense_Mutation_p.R402T|TNPO3_ENST00000471234.1_Missense_Mutation_p.R402T|TNPO3_ENST00000482320.1_Missense_Mutation_p.R336T			Q9Y5L0	TNPO3_HUMAN	transportin 3	402					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						GTCTGATACCCTCATGCGAAA	0.418																																					Pancreas(147;583 2585 39696 52331)	Pancreas(147;583 2585 39696 52331)	uc003vol.1		NA																	0				ovary(2)|skin(2)|lung(1)	5						c.(1204-1206)AGG>ACG		transportin 3							117.0	109.0	112.0					7																	128633922		2203	4300	6503	SO:0001583	missense	23534				splicing factor protein import into nucleus	cytoplasm|nucleus	protein binding|receptor activity	g.chr7:128633922C>G	AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.1205G>C	7.37:g.128633922C>G	ENSP00000265388:p.Arg402Thr		Somatic				TNPO3_uc003vom.1_Missense_Mutation_p.R336T|TNPO3_uc010lly.1_Missense_Mutation_p.R402T|TNPO3_uc010llz.1_Missense_Mutation_p.R402T	p.R402T	NM_012470	NP_036602	WXS	Illumina HiSeq	Unspecified	Q9Y5L0	TNPO3_HUMAN			9	1579	-			402					A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	ENST00000265388.5	37	c.1205G>C	CCDS5809.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266221	0.80358	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.77	5.77	0.91146	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67173	0.2865	N	0.24115	0.695	0.58432	D	0.999994	B;D;B	0.76494	0.03;0.999;0.038	B;D;B	0.65987	0.031;0.94;0.075	T	0.66031	-0.6024	10	0.38643	T	0.18	.	17.4798	0.87670	0.0:1.0:0.0:0.0	.	402;402;402	C9IZM0;C9J7E5;Q9Y5L0	.;.;TNPO3_HUMAN	T	402;402;336;402;402	ENSP00000376936:R402T;ENSP00000265388:R402T;ENSP00000420089:R336T;ENSP00000418646:R402T;ENSP00000418267:R402T	ENSP00000265388:R402T	R	-	2	0	TNPO3	128421158	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.787000	0.85759	2.729000	0.93468	0.655000	0.94253	AGG		0.418	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350929.1	NM_012470		3	92	0	0	0	0.000602	0	3	92				
PLXNA4	91584	broad.mit.edu	37	7	131878879	131878879	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:131878879C>T	ENST00000359827.3	-	14	3760	c.2798G>A	c.(2797-2799)tGc>tAc	p.C933Y	PLXNA4_ENST00000321063.4_Missense_Mutation_p.C933Y			Q9HCM2	PLXA4_HUMAN	plexin A4	933	IPT/TIG 1.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CACAGCCACGCAGATCTCCAC	0.582																																							uc003vra.3		NA																	0				ovary(1)	1						c.(2797-2799)TGC>TAC		plexin A4 isoform 1							82.0	84.0	84.0					7																	131878879		2067	4210	6277	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131878879C>T	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2798G>A	7.37:g.131878879C>T	ENSP00000352882:p.Cys933Tyr		Somatic					p.C933Y	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			14	3027	-			933			IPT/TIG 1.|Extracellular (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.2798G>A	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466961	0.84425	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.76186	-1.0;-1.0	4.48	4.48	0.54585	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86686	0.5992	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.88577	0.3134	10	0.62326	D	0.03	.	17.3305	0.87262	0.0:1.0:0.0:0.0	.	933	Q9HCM2	PLXA4_HUMAN	Y	933	ENSP00000323194:C933Y;ENSP00000352882:C933Y	ENSP00000323194:C933Y	C	-	2	0	PLXNA4	131529419	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.538000	0.82048	2.317000	0.78254	0.484000	0.47621	TGC		0.582	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		11	135	0	0	0	0.001855	0	11	135				
AKR1D1	6718	broad.mit.edu	37	7	137792186	137792186	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:137792186T>G	ENST00000242375.3	+	7	757	c.715T>G	c.(715-717)Tta>Gta	p.L239V	AKR1D1_ENST00000432161.1_Missense_Mutation_p.L239V|AKR1D1_ENST00000468877.2_3'UTR|AKR1D1_ENST00000411726.2_Missense_Mutation_p.L198V	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	239					androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)			endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	TCCACCTTTGTTAAAGGATGC	0.383																																							uc003vtz.2		NA																	0				skin(1)	1						c.(715-717)TTA>GTA		aldo-keto reductase family 1, member D1							165.0	152.0	156.0					7																	137792186		2203	4300	6503	SO:0001583	missense	6718				androgen metabolic process|bile acid biosynthetic process|bile acid catabolic process|C21-steroid hormone metabolic process|cholesterol catabolic process|digestion	cytosol	aldo-keto reductase (NADP) activity|delta4-3-oxosteroid 5beta-reductase activity|steroid binding	g.chr7:137792186T>G	Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.715T>G	7.37:g.137792186T>G	ENSP00000242375:p.Leu239Val		Somatic				AKR1D1_uc011kqe.1_Missense_Mutation_p.L239V|AKR1D1_uc011kqf.1_Missense_Mutation_p.L198V|AKR1D1_uc010lmy.1_RNA	p.L239V	NM_005989	NP_005980	WXS	Illumina HiSeq	Unspecified	P51857	AK1D1_HUMAN			7	784	+			239					A1L4P6|A8K060|B4DPN3|B4DPN8	Missense_Mutation	SNP	ENST00000242375.3	37	c.715T>G	CCDS5846.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.801061	0.70567	.	.	ENSG00000122787	ENST00000432161;ENST00000411726;ENST00000242375	T;T;T	0.26223	1.75;1.75;1.75	5.55	-7.25	0.01470	NADP-dependent oxidoreductase domain (3);	0.000000	0.64402	D	0.000001	T	0.46308	0.1386	M	0.80028	2.48	0.40358	D	0.979212	D;P;D	0.69078	0.997;0.918;0.995	D;P;D	0.70487	0.969;0.715;0.969	T	0.63897	-0.6533	10	0.87932	D	0	.	17.6352	0.88120	0.0:0.6533:0.0:0.3467	.	198;239;239	B4DPN8;B4DPN3;P51857	.;.;AK1D1_HUMAN	V	239;198;239	ENSP00000389197:L239V;ENSP00000402374:L198V;ENSP00000242375:L239V	ENSP00000242375:L239V	L	+	1	2	AKR1D1	137442726	0.775000	0.28604	0.022000	0.16811	0.337000	0.28794	-0.260000	0.08708	-1.314000	0.02300	-0.326000	0.08463	TTA		0.383	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341637.1	NM_005989		7	109	0	0	0	0.006214	0	7	109				
SSPO	23145	broad.mit.edu	37	7	149521590	149521590	+	RNA	SNP	C	C	T	rs375602468	byFrequency	TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr7:149521590C>T	ENST00000378016.2	+	0	13669							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCACTGGCTCCGAGACCCAAC	0.706													C|||	3	0.000599042	0.0023	0.0	5008	,	,		15591	0.0		0.0	False		,,,				2504	0.0						uc010lpk.2		NA																	0					0						c.(13669-13671)CGA>TGA		SCO-spondin precursor		C		8,4044		0,8,2018	26.0	31.0	29.0		13683	1.2	0.0	7		29	0,8322		0,0,4161	no	coding-notMod3	SSPO	NM_198455.2		0,8,6179	TT,TC,CC		0.0,0.1974,0.0647			149521590	8,12366	2026	4161	6187			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149521590C>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149521590C>T			Somatic				SSPO_uc010lpm.1_RNA|SSPO_uc003wgg.2_Intron|SSPO_uc003wgh.2_RNA|SSPO_uc003wgi.1_Intron	p.R4557*	NM_198455	NP_940857	WXS	Illumina HiSeq	Unspecified	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		96	13669	+	Melanoma(164;0.165)|Ovarian(565;0.177)		4557					Q76B61	Nonsense_Mutation	SNP	ENST00000378016.2	37	c.13669C>T																																																																																					0.706	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				3	46	0	0	0	0.004672	0	3	46				
DLGAP2	9228	broad.mit.edu	37	8	1497614	1497614	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:1497614A>G	ENST00000421627.2	+	2	889	c.755A>G	c.(754-756)cAg>cGg	p.Q252R		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	331					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GACGCGCTGCAGAGCCCCTTC	0.667																																							uc003wpl.2		NA																	0					0						c.(754-756)CAG>CGG		discs large-associated protein 2							55.0	63.0	61.0					8																	1497614		2093	4235	6328	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1497614A>G	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.755A>G	8.37:g.1497614A>G	ENSP00000400258:p.Gln252Arg		Somatic				DLGAP2_uc003wpm.2_Missense_Mutation_p.Q252R	p.Q252R	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	2	852	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	331					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.755A>G	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.00|11.00	1.508891|1.508891	0.27036|0.27036	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.14391|.	2.51|.	5.3|5.3	0.319|0.319	0.15873|0.15873	.|.	0.203475|.	0.52532|.	N|.	0.000064|.	T|T	0.48059|0.48059	0.1479|0.1479	L|L	0.57536|0.57536	1.79|1.79	0.30745|0.30745	N|N	0.745709|0.745709	B;B|.	0.26902|.	0.163;0.102|.	B;B|.	0.29440|.	0.102;0.047|.	T|T	0.50988|0.50988	-0.8762|-0.8762	10|5	0.48119|.	T|.	0.1|.	-16.1326|-16.1326	8.9822|8.9822	0.35972|0.35972	0.6461:0.2818:0.0721:0.0|0.6461:0.2818:0.0721:0.0	.|.	331;331|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	R|G	297;252|269	ENSP00000400258:Q252R|.	ENSP00000348366:Q297R|.	Q|R	+|+	2|1	0|2	DLGAP2|DLGAP2	1485021|1485021	1.000000|1.000000	0.71417|0.71417	0.158000|0.158000	0.22627|0.22627	0.756000|0.756000	0.42949|0.42949	2.949000|2.949000	0.49074|0.49074	-0.169000|-0.169000	0.10834|0.10834	0.533000|0.533000	0.62120|0.62120	CAG|AGA		0.667	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		16	88	0	0	0	0.007413	0	16	88				
LPL	4023	broad.mit.edu	37	8	19805713	19805713	+	Silent	SNP	C	C	A	rs374067507		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:19805713C>A	ENST00000311322.8	+	2	581	c.111C>A	c.(109-111)atC>atA	p.I37I	LPL_ENST00000521994.1_3'UTR	NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	37					chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	TTATCGACATCGAAAGTAAAT	0.423																																							uc003wzk.3		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(109-111)ATC>ATA		lipoprotein lipase precursor	Clofibrate(DB00636)|Gemfibrozil(DB01241)|Orlistat(DB01083)						117.0	113.0	114.0					8																	19805713		2203	4300	6503	SO:0001819	synonymous_variant	4023				fatty acid biosynthetic process|lipoprotein metabolic process|phospholipid metabolic process|positive regulation of cholesterol storage|positive regulation of sequestering of triglyceride|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	anchored to membrane|chylomicron|plasma membrane|very-low-density lipoprotein particle	heparin binding|lipoprotein lipase activity|phospholipase activity|receptor binding|triglyceride lipase activity	g.chr8:19805713C>A		CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.111C>A	8.37:g.19805713C>A			Somatic					p.I37I	NM_000237	NP_000228	WXS	Illumina HiSeq	Unspecified	P06858	LIPL_HUMAN		Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	2	481	+			37					B2R5T9|Q16282|Q16283|Q96FC4	Silent	SNP	ENST00000311322.8	37	c.111C>A	CCDS6012.1																																																																																				0.423	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089113.3			7	131	1	0	5.4927e-09	0.004482	7.11259e-09	7	131				
EGR3	1960	broad.mit.edu	37	8	22548112	22548112	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:22548112G>C	ENST00000317216.2	-	2	1395	c.1038C>G	c.(1036-1038)gaC>gaG	p.D346E	EGR3_ENST00000522910.1_Missense_Mutation_p.D308E|EGR3_ENST00000524088.1_5'UTR|RP11-459E5.1_ENST00000523627.1_RNA|EGR3_ENST00000519492.1_3'UTR	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	Q06889	EGR3_HUMAN	early growth response 3	346					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|circadian rhythm (GO:0007623)|endothelial cell chemotaxis (GO:0035767)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		GCTTGCGCTCGTCGCTGCGCG	0.652																																							uc003xcm.1		NA																	0					0						c.(1036-1038)GAC>GAG		early growth response 3							58.0	50.0	53.0					8																	22548112		2201	4297	6498	SO:0001583	missense	1960				circadian rhythm|muscle organ development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:22548112G>C	X63741	CCDS6033.1, CCDS56528.1	8p23-p21	2013-01-08			ENSG00000179388	ENSG00000179388		"""Zinc fingers, C2H2-type"""	3240	protein-coding gene	gene with protein product	"""zinc finger protein pilot"""	602419				1906159, 11909874	Standard	NM_004430		Approved	PILOT	uc003xcm.1	Q06889	OTTHUMG00000097825	ENST00000317216.2:c.1038C>G	8.37:g.22548112G>C	ENSP00000318057:p.Asp346Glu		Somatic				EGR3_uc011kzn.1_Missense_Mutation_p.D308E|EGR3_uc011kzo.1_Missense_Mutation_p.D292E	p.D346E	NM_004430	NP_004421	WXS	Illumina HiSeq	Unspecified	Q06889	EGR3_HUMAN		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)	2	1396	-		Prostate(55;0.0421)|Breast(100;0.102)	346			C2H2-type 3.		A8K8U9|B4DHJ5|E7EW38|Q2M3W2	Missense_Mutation	SNP	ENST00000317216.2	37	c.1038C>G	CCDS6033.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068499	0.55539	.	.	ENSG00000179388	ENST00000317216;ENST00000522910;ENST00000435199	T;T	0.06933	3.24;3.24	5.62	4.75	0.60458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.110869	0.64402	D	0.000016	T	0.16854	0.0405	L	0.34521	1.04	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.83275	0.996;0.996	T	0.01290	-1.1394	10	0.87932	D	0	-22.4575	8.6156	0.33829	0.172:0.0:0.828:0.0	.	308;346	E7EW38;Q06889	.;EGR3_HUMAN	E	346;308;187	ENSP00000318057:D346E;ENSP00000430310:D308E	ENSP00000318057:D346E	D	-	3	2	EGR3	22604057	0.996000	0.38824	1.000000	0.80357	0.999000	0.98932	0.379000	0.20585	1.380000	0.46344	0.655000	0.94253	GAC		0.652	EGR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215098.1	NM_004430		10	48	0	0	0	0.001855	0	10	48				
DUSP26	78986	broad.mit.edu	37	8	33451115	33451115	+	Silent	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:33451115A>G	ENST00000256261.4	-	3	889	c.372T>C	c.(370-372)ttT>ttC	p.F124F	DUSP26_ENST00000523956.1_Silent_p.F124F	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	124	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		TGCTCATGTCAAAGGCTGGCG	0.642																																							uc003xjp.2		NA																	0					0						c.(370-372)TTT>TTC		dual specificity phosphatase 26							60.0	51.0	54.0					8																	33451115		2203	4300	6503	SO:0001819	synonymous_variant	78986					Golgi apparatus|nucleus	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr8:33451115A>G	AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.372T>C	8.37:g.33451115A>G			Somatic				DUSP26_uc003xjq.2_Silent_p.F124F	p.F124F	NM_024025	NP_076930	WXS	Illumina HiSeq	Unspecified	Q9BV47	DUS26_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)	3	705	-			124			Tyrosine-protein phosphatase.		D3DSV8|Q9BTW0	Silent	SNP	ENST00000256261.4	37	c.372T>C	CCDS6092.1																																																																																				0.642	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376564.1	NM_024025		7	71	0	0	0	0.008291	0	7	71				
CHRNA6	8973	broad.mit.edu	37	8	42612091	42612091	+	Silent	SNP	G	G	A	rs201576802		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:42612091G>A	ENST00000276410.2	-	4	709	c.354C>T	c.(352-354)ccC>ccT	p.P118P	CHRNA6_ENST00000534622.1_Silent_p.P103P|CHRNA6_ENST00000530869.1_5'UTR	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	118					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	GAACAATGTCGGGCTTCCAAA	0.423																																							uc003xpj.2		NA																	0					0						c.(352-354)CCC>CCT		cholinergic receptor, nicotinic, alpha 6							103.0	104.0	104.0					8																	42612091		2203	4300	6503	SO:0001819	synonymous_variant	8973					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr8:42612091G>A	U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.354C>T	8.37:g.42612091G>A			Somatic				CHRNA6_uc011lcw.1_Silent_p.P103P	p.P118P	NM_004198	NP_004189	WXS	Illumina HiSeq	Unspecified	Q15825	ACHA6_HUMAN	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		4	400	-	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	118			Extracellular.		B2R8V4|B4DQH1	Silent	SNP	ENST00000276410.2	37	c.354C>T	CCDS6135.1																																																																																				0.423	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383156.1			5	99	0	0	0	0.001168	0	5	99				
IL7	3574	broad.mit.edu	37	8	79652271	79652271	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:79652271T>A	ENST00000263851.4	-	3	794	c.194A>T	c.(193-195)aAc>aTc	p.N65I	IL7_ENST00000541183.1_Missense_Mutation_p.N14I|IL7_ENST00000520269.1_Missense_Mutation_p.N65I|IL7_ENST00000519833.1_5'UTR	NM_000880.3|NM_001199886.1|NM_001199887.1	NP_000871.1|NP_001186815.1|NP_001186816.1	P13232	IL7_HUMAN	interleukin 7	65					bone resorption (GO:0045453)|cell-cell signaling (GO:0007267)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|organ morphogenesis (GO:0009887)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell differentiation (GO:0045582)|regulation of gene expression (GO:0010468)|T cell lineage commitment (GO:0002360)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-7 receptor binding (GO:0005139)			endometrium(2)|large_intestine(2)|lung(1)	5						TTTAAAAAAGTTAAATTCATT	0.269																																							uc003ybg.2		NA																	0					0						c.(193-195)AAC>ATC		interleukin 7 precursor							44.0	46.0	45.0					8																	79652271		2196	4275	6471	SO:0001583	missense	3574				bone resorption|cell-cell signaling|humoral immune response|organ morphogenesis|positive regulation of B cell proliferation|positive regulation of T cell differentiation	extracellular space	cytokine activity|growth factor activity|interleukin-7 receptor binding	g.chr8:79652271T>A	J04156	CCDS6224.1, CCDS56541.1, CCDS75755.1, CCDS75756.1	8q12-q13	2008-07-03				ENSG00000104432		"""Interleukins and interleukin receptors"""	6023	protein-coding gene	gene with protein product		146660					Standard	NM_000880		Approved	IL-7	uc003ybg.3	P13232		ENST00000263851.4:c.194A>T	8.37:g.79652271T>A	ENSP00000263851:p.Asn65Ile		Somatic				IL7_uc003ybe.2_Missense_Mutation_p.N24I|IL7_uc011lfm.1_RNA|IL7_uc003ybh.2_RNA|IL7_uc003ybi.3_RNA	p.N65I	NM_000880	NP_000871	WXS	Illumina HiSeq	Unspecified	P13232	IL7_HUMAN			3	795	-			65					A0N0L3|Q5FBY5|Q5FBY9	Missense_Mutation	SNP	ENST00000263851.4	37	c.194A>T	CCDS6224.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.677114	0.47886	.	.	ENSG00000104432	ENST00000263851;ENST00000520269;ENST00000379114;ENST00000541183	T;T;T	0.52295	0.67;0.67;0.67	5.02	3.88	0.44766	.	0.107751	0.40818	N	0.001002	T	0.50922	0.1644	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.989;0.995	T	0.45338	-0.9268	9	.	.	.	.	6.8765	0.24149	0.0:0.1004:0.0:0.8996	.	65;65	P13232;Q5FBY9	IL7_HUMAN;.	I	65;65;62;14	ENSP00000263851:N65I;ENSP00000427750:N65I;ENSP00000438922:N14I	.	N	-	2	0	IL7	79814826	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	1.900000	0.39828	2.234000	0.73211	0.460000	0.39030	AAC		0.269	IL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379429.1			4	40	0	0	0	0.001168	0	4	40				
SNX16	64089	broad.mit.edu	37	8	82736126	82736126	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:82736126C>G	ENST00000345957.4	-	4	790	c.512G>C	c.(511-513)tGg>tCg	p.W171S	SNX16_ENST00000396330.2_Missense_Mutation_p.W171S|SNX16_ENST00000353788.4_Missense_Mutation_p.W142S	NM_152836.2	NP_690049.1	P57768	SNX16_HUMAN	sorting nexin 16	171	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				early endosome to late endosome transport (GO:0045022)|endosome to lysosome transport (GO:0008333)|protein targeting to lysosome (GO:0006622)	early endosome (GO:0005769)|extrinsic component of endosome membrane (GO:0031313)|late endosome (GO:0005770)|lysosome (GO:0005764)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			large_intestine(1)|ovary(1)|pancreas(1)|skin(2)	5						ATCTTTAAACCAGCGTTTTGG	0.343																																							uc011lft.1		NA																	0				ovary(1)|pancreas(1)	2						c.(511-513)TGG>TCG		sorting nexin 16 isoform a							94.0	92.0	93.0					8																	82736126		2203	4300	6503	SO:0001583	missense	64089				cell communication|early endosome to late endosome transport|endosome to lysosome transport|protein targeting to lysosome	early endosome membrane|extrinsic to endosome membrane|late endosome membrane|lysosome	identical protein binding|phosphatidylinositol binding	g.chr8:82736126C>G	AF305779	CCDS6234.1, CCDS6235.1	8q21.13	2011-05-03			ENSG00000104497	ENSG00000104497		"""Sorting nexins"""	14980	protein-coding gene	gene with protein product		614903				12461558, 12813048	Standard	NM_152837		Approved		uc003ycn.3	P57768	OTTHUMG00000164727	ENST00000345957.4:c.512G>C	8.37:g.82736126C>G	ENSP00000322652:p.Trp171Ser		Somatic				SNX16_uc003ycn.2_Missense_Mutation_p.W171S|SNX16_uc003yco.2_Missense_Mutation_p.W142S	p.W171S	NM_022133	NP_071416	WXS	Illumina HiSeq	Unspecified	P57768	SNX16_HUMAN			5	1019	-			171			PX.		A8K4D8|Q658L0|Q8N4U3	Missense_Mutation	SNP	ENST00000345957.4	37	c.512G>C	CCDS6234.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722222	0.89298	.	.	ENSG00000104497	ENST00000353788;ENST00000396330;ENST00000345957;ENST00000523757;ENST00000521810	T;T;T;T;T	0.34275	1.37;1.55;1.55;1.55;1.55	5.87	5.87	0.94306	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.59142	0.2172	M	0.63169	1.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.47222	-0.9134	10	0.25106	T	0.35	-20.5148	20.2192	0.98319	0.0:1.0:0.0:0.0	.	142;171	Q658L0;P57768	.;SNX16_HUMAN	S	142;171;171;142;171	ENSP00000322631:W142S;ENSP00000379621:W171S;ENSP00000322652:W171S;ENSP00000430038:W142S;ENSP00000428734:W171S	ENSP00000322652:W171S	W	-	2	0	SNX16	82898681	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.780000	0.95670	0.655000	0.94253	TGG		0.343	SNX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379929.1	NM_022133		4	39	0	0	0	0.000602	0	4	39				
POP1	10940	broad.mit.edu	37	8	99168473	99168473	+	Silent	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:99168473A>G	ENST00000401707.2	+	15	2334	c.2253A>G	c.(2251-2253)aaA>aaG	p.K751K	POP1_ENST00000349693.3_Silent_p.K751K	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	751					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			TGCCTAAAAAAACTCATCAGC	0.512																																							uc003yij.3		NA																	0				ovary(1)|breast(1)	2						c.(2251-2253)AAA>AAG		processing of precursor 1							112.0	106.0	108.0					8																	99168473		2203	4300	6503	SO:0001819	synonymous_variant	10940				tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity	g.chr8:99168473A>G	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.2253A>G	8.37:g.99168473A>G			Somatic				POP1_uc011lgv.1_Silent_p.K751K|POP1_uc003yik.2_Silent_p.K751K	p.K751K	NM_001145860	NP_001139332	WXS	Illumina HiSeq	Unspecified	Q99575	POP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.145)		15	2353	+	Breast(36;1.78e-06)		751					A8K5W9|Q15037	Silent	SNP	ENST00000401707.2	37	c.2253A>G	CCDS6277.1																																																																																				0.512	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029		17	74	0	0	0	0.007413	0	17	74				
RSPO2	340419	broad.mit.edu	37	8	109001377	109001377	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:109001377G>A	ENST00000276659.5	-	3	810	c.190C>T	c.(190-192)Cga>Tga	p.R64*	RSPO2_ENST00000378439.2_Intron|RSPO2_ENST00000517781.1_Intron|RSPO2_ENST00000517939.1_5'UTR	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	64					bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			CCTTCTCTTCGAAGGAAGAAG	0.478																																							uc003yms.2		NA																	0				skin(3)|ovary(2)|pancreas(1)|lung(1)	7						c.(190-192)CGA>TGA		R-spondin family, member 2 precursor							118.0	97.0	104.0					8																	109001377		2203	4300	6503	SO:0001587	stop_gained	340419				Wnt receptor signaling pathway	extracellular region	heparin binding	g.chr8:109001377G>A	AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.190C>T	8.37:g.109001377G>A	ENSP00000276659:p.Arg64*		Somatic				RSPO2_uc003ymq.2_5'UTR|RSPO2_uc003ymr.2_Intron	p.R64*	NM_178565	NP_848660	WXS	Illumina HiSeq	Unspecified	Q6UXX9	RSPO2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)		3	848	-			64					B3KVP0|Q4G0U4|Q8N6X6	Nonsense_Mutation	SNP	ENST00000276659.5	37	c.190C>T	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	G	38	6.994934	0.97990	.	.	ENSG00000147655	ENST00000276659;ENST00000521956;ENST00000520026;ENST00000522333	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-0.8501	18.7527	0.91821	0.0:0.0:1.0:0.0	.	.	.	.	X	64;64;36;64	.	ENSP00000276659:R64X	R	-	1	2	RSPO2	109070553	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.108000	0.77055	2.506000	0.84524	0.557000	0.71058	CGA		0.478	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565		5	72	0	0	0	0.000602	0	5	72				
MYC	4609	broad.mit.edu	37	8	128752935	128752935	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:128752935G>C	ENST00000377970.2	+	3	1606	c.1096G>C	c.(1096-1098)Gag>Cag	p.E366Q	MYC_ENST00000524013.1_Missense_Mutation_p.E365Q	NM_002467.4	NP_002458	P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	351	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	CTCGGACACCGAGGAGAATGT	0.552		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""																																		uc003ysi.2		3		Dom	yes		8	8q24.12-q24.13	4609	A|T	v-myc myelocytomatosis viral oncogene homolog (avian)			"""L, E"""	IGK@|BCL5|BCL7A |BTG1|TRA@|IGH@		Burkitt lymphoma| amplified in other cancers|B-CLL		0				lung(3)|ovary(1)|central_nervous_system(1)|pancreas(1)	6						c.(1096-1098)GAG>CAG		myc proto-oncogene protein							98.0	101.0	100.0					8																	128752935		2203	4300	6503	SO:0001583	missense	4609				branching involved in ureteric bud morphogenesis|cell cycle arrest|cell proliferation|cellular iron ion homeostasis|positive regulation of metanephric cap mesenchymal cell proliferation|positive regulation of transcription, DNA-dependent|regulation of telomere maintenance|regulation of transcription from RNA polymerase II promoter|response to drug	nucleolus|nucleoplasm	E-box binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr8:128752935G>C		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000377970.2:c.1096G>C	8.37:g.128752935G>C	ENSP00000367207:p.Glu366Gln		Somatic					p.E366Q	NM_002467	NP_002458	WXS	Illumina HiSeq	Unspecified	P01106	MYC_HUMAN	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	3	1621	+	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	351					A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000377970.2	37	c.1096G>C	CCDS6359.2	.	.	.	.	.	.	.	.	.	.	G	29.9	5.046162	0.93740	.	.	ENSG00000136997	ENST00000377970;ENST00000524013;ENST00000454617	D;D	0.83837	-1.77;-1.77	5.39	5.39	0.77823	Helix-loop-helix DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.92159	0.7514	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93185	0.6578	10	0.87932	D	0	-25.8378	18.133	0.89608	0.0:0.0:1.0:0.0	.	351	P01106	MYC_HUMAN	Q	366;365;332	ENSP00000367207:E366Q;ENSP00000430235:E365Q	ENSP00000367207:E366Q	E	+	1	0	MYC	128822117	1.000000	0.71417	0.967000	0.41034	0.984000	0.73092	9.864000	0.99589	2.519000	0.84933	0.650000	0.86243	GAG		0.552	MYC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250277.3			4	91	0	0	0	0.001168	0	4	91				
ZFAT	57623	broad.mit.edu	37	8	135615100	135615101	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:135615100_135615101CC>AG	ENST00000377838.3	-	6	1035_1036	c.861_862GG>CT	c.(859-864)caGGcc>caCTcc	p.287_288QA>HS	ZFAT_ENST00000520727.1_Missense_Mutation_p.275_276QA>HS|ZFAT_ENST00000429442.2_Missense_Mutation_p.275_276QA>HS|ZFAT_ENST00000520214.1_Missense_Mutation_p.275_276QA>HS|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000520356.1_Missense_Mutation_p.275_276QA>HS|ZFAT_ENST00000523399.1_Missense_Mutation_p.225_226QA>HS	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	287					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CTCAGGTGGGCCTGCAGCGAGT	0.51																																							uc003yup.2		NA																	0				central_nervous_system(1)	1						c.(859-864)CAGGCC>CACTCC		zinc finger protein 406 isoform ZFAT-1																																				SO:0001583	missense	57623				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding	g.chr8:135615100_135615101CC>AG	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.861_862delinsAG	8.37:g.135615100_135615101delinsAG	ENSP00000367069:p.Q287_A288delinsHS		Somatic				ZFAT_uc003yun.2_Missense_Mutation_p.275_276QA>HS|ZFAT_uc003yuo.2_Missense_Mutation_p.275_276QA>HS|ZFAT_uc010meh.2_Missense_Mutation_p.275_276QA>HS|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Missense_Mutation_p.275_276QA>HS|ZFAT_uc010mej.2_Missense_Mutation_p.225_226QA>HS|ZFAT_uc003yur.2_Missense_Mutation_p.275_276QA>HS	p.287_288QA>HS	NM_020863	NP_065914	WXS	Illumina HiSeq	Unspecified	Q9P243	ZFAT_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0432)		6	1036_1037	-	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		287_288			C2H2-type 3.		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	DNP	ENST00000377838.3	37	c.861_862GG>CT	CCDS47924.1																																																																																				0.510	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939		7	70	0	0	0	0.004672	0	7	70				
PGM5	5239	broad.mit.edu	37	9	70993145	70993145	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:70993145A>G	ENST00000396396.1	+	2	521	c.292A>G	c.(292-294)Atc>Gtc	p.I98V	PGM5_ENST00000396392.1_Missense_Mutation_p.I98V|PGM5_ENST00000604870.2_3'UTR	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	98					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)	p.I98V(3)		endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						ACAGAATGGCATCTTGTCGAC	0.478																																							uc004agr.2		NA																	3	Substitution - Missense(3)		endometrium(3)	ovary(1)|pancreas(1)	2						c.(292-294)ATC>GTC		phosphoglucomutase 5							35.0	38.0	37.0					9																	70993145		2198	4289	6487	SO:0001583	missense	5239				cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity	g.chr9:70993145A>G	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.292A>G	9.37:g.70993145A>G	ENSP00000379678:p.Ile98Val		Somatic					p.I98V	NM_021965	NP_068800	WXS	Illumina HiSeq	Unspecified	Q15124	PGM5_HUMAN			2	521	+			98					B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	ENST00000396396.1	37	c.292A>G	CCDS6622.2	.	.	.	.	.	.	.	.	.	.	.	14.68	2.608357	0.46527	.	.	ENSG00000154330	ENST00000396396;ENST00000396392;ENST00000377314;ENST00000431583	T;T;T	0.62498	0.02;0.02;0.02	4.37	4.37	0.52481	Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (1);Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.137251	0.48286	U	0.000197	T	0.73853	0.3640	M	0.88310	2.945	0.45502	D	0.998467	B	0.31227	0.314	P	0.45167	0.472	T	0.76953	-0.2768	10	0.72032	D	0.01	.	8.4592	0.32917	0.8259:0.0:0.0:0.1741	.	98	Q15124	PGM5_HUMAN	V	98;98;98;64	ENSP00000379678:I98V;ENSP00000379674:I98V;ENSP00000394864:I64V	ENSP00000366531:I98V	I	+	1	0	PGM5	70182965	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.606000	0.61126	1.730000	0.51580	0.445000	0.29226	ATC		0.478	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052548.2	NM_021965		3	68	0	0	0	0.000248	0	3	68				
PIP5K1B	8395	broad.mit.edu	37	9	71503923	71503923	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:71503923A>G	ENST00000265382.3	+	7	650	c.345A>G	c.(343-345)atA>atG	p.I115M	PIP5K1B_ENST00000541509.1_Missense_Mutation_p.I115M	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta	115	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		AACCTCTAATAGAACTGTCTA	0.383																																							uc004agu.2		NA																	0				stomach(1)	1						c.(343-345)ATA>ATG		phosphatidylinositol-4-phosphate 5-kinase, type							213.0	206.0	209.0					9																	71503923		2203	4300	6503	SO:0001583	missense	8395					endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding	g.chr9:71503923A>G	U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.345A>G	9.37:g.71503923A>G	ENSP00000265382:p.Ile115Met		Somatic				PIP5K1B_uc011lrq.1_Missense_Mutation_p.I115M|PIP5K1B_uc004agv.2_RNA	p.I115M	NM_003558	NP_003549	WXS	Illumina HiSeq	Unspecified	O14986	PI51B_HUMAN		Lung(182;0.133)	7	650	+			115			PIPK.		A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Missense_Mutation	SNP	ENST00000265382.3	37	c.345A>G	CCDS6624.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.357584	0.61293	.	.	ENSG00000107242	ENST00000541509;ENST00000377290;ENST00000265382;ENST00000419747;ENST00000437200;ENST00000440050	T;T;T;T	0.35421	1.31;1.31;1.31;1.31	5.44	3.06	0.35304	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.043502	0.85682	D	0.000000	T	0.51839	0.1698	M	0.88775	2.98	0.40605	D	0.981617	P	0.52170	0.951	P	0.53490	0.727	T	0.51764	-0.8664	10	0.48119	T	0.1	-12.5168	5.9363	0.19167	0.6273:0.0:0.0745:0.2982	.	115	O14986	PI51B_HUMAN	M	115;115;115;62;115;115	ENSP00000438082:I115M;ENSP00000265382:I115M;ENSP00000398587:I115M;ENSP00000411477:I115M	ENSP00000265382:I115M	I	+	3	3	PIP5K1B	70693743	0.970000	0.33590	0.985000	0.45067	0.992000	0.81027	0.188000	0.17018	0.340000	0.23745	0.533000	0.62120	ATA		0.383	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052561.2	NM_003558		5	137	0	0	0	0.000602	0	5	137				
SPATA31D1	389763	broad.mit.edu	37	9	84605739	84605740	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:84605739_84605740CC>AA	ENST00000344803.2	+	4	401_402	c.354_355CC>AA	c.(352-357)aaCCac>aaAAac	p.118_119NH>KN		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	118					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ATGATACCAACCACTTTCGTCG	0.54																																							uc004amn.2		NA																	0					0						c.(352-357)AACCAC>AAAAAC		hypothetical protein LOC389763																																				SO:0001583	missense	389763					integral to membrane		g.chr9:84605739_84605740CC>AA		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	Exception_encountered	9.37:g.84605739_84605740delinsAA	ENSP00000341988:p.N118_H119delinsKN		Somatic					p.118_119NH>KN	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	401_402	+			118_119						Missense_Mutation	DNP	ENST00000344803.2	37	c.354_355CC>AA	CCDS47986.1																																																																																				0.540	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		3	16	0	0	0	0.004672	0	3	16				
SPATA31D1	389763	broad.mit.edu	37	9	84605839	84605839	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:84605839G>A	ENST00000344803.2	+	4	501	c.454G>A	c.(454-456)Gct>Act	p.A152T		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	152					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCTGAAAGATGCTGCTCCCTC	0.552																																							uc004amn.2		NA																	0					0						c.(454-456)GCT>ACT		hypothetical protein LOC389763							126.0	125.0	125.0					9																	84605839		2002	4168	6170	SO:0001583	missense	389763					integral to membrane		g.chr9:84605839G>A		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.454G>A	9.37:g.84605839G>A	ENSP00000341988:p.Ala152Thr		Somatic					p.A152T	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	501	+			152						Missense_Mutation	SNP	ENST00000344803.2	37	c.454G>A	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.581963	0.46006	.	.	ENSG00000214929	ENST00000344803	T	0.09445	2.98	3.03	-0.106	0.13596	.	1.999540	0.02345	N	0.075286	T	0.16938	0.0407	L	0.46885	1.475	0.09310	N	1	D	0.60160	0.987	P	0.53689	0.732	T	0.12091	-1.0561	10	0.35671	T	0.21	-0.4263	3.6343	0.08143	0.1298:0.0:0.435:0.4352	.	152	Q6ZQQ2	F75D1_HUMAN	T	152	ENSP00000341988:A152T	ENSP00000341988:A152T	A	+	1	0	FAM75D1	83795659	0.737000	0.28175	0.000000	0.03702	0.010000	0.07245	0.148000	0.16224	-0.004000	0.14419	0.597000	0.82753	GCT		0.552	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		5	48	0	0	0	0.001168	0	5	48				
NTRK2	4915	broad.mit.edu	37	9	87549173	87549173	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:87549173G>C	ENST00000323115.4	+	13	2035	c.1682G>C	c.(1681-1683)tGt>tCt	p.C561S	NTRK2_ENST00000376213.1_Missense_Mutation_p.C561S|NTRK2_ENST00000277120.3_Missense_Mutation_p.C577S|NTRK2_ENST00000376214.1_Missense_Mutation_p.C577S			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	561	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	TATAACCTCTGTCCTGAGCAG	0.433										TSP Lung(25;0.17)																													uc004aoa.1		NA																	0				lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16						c.(1681-1683)TGT>TCT		neurotrophic tyrosine kinase, receptor, type 2							94.0	78.0	83.0					9																	87549173		2203	4300	6503	SO:0001583	missense	4915				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity	g.chr9:87549173G>C	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1682G>C	9.37:g.87549173G>C	ENSP00000314586:p.Cys561Ser	TSP Lung(25;0.17)	Somatic				NTRK2_uc004any.1_Missense_Mutation_p.C561S|NTRK2_uc004anz.1_Missense_Mutation_p.C577S	p.C561S	NM_001018064	NP_001018074	WXS	Illumina HiSeq	Unspecified	Q16620	NTRK2_HUMAN			16	2620	+			561			Protein kinase.|Cytoplasmic (Potential).		B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	37	c.1682G>C	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	G	4.785	0.146047	0.09134	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000277120;ENST00000323115	T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47	5.55	5.55	0.83447	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.098827	0.64402	D	0.000001	T	0.56321	0.1977	N	0.02830	-0.485	0.80722	D	1	B;B;B	0.22909	0.005;0.004;0.077	B;B;B	0.25759	0.013;0.008;0.063	T	0.57780	-0.7752	10	0.05525	T	0.97	.	12.9405	0.58340	0.0733:0.0:0.9267:0.0	.	561;577;607	Q16620;Q16620-4;Q59GJ1	NTRK2_HUMAN;.;.	S	577;561;577;561	ENSP00000365387:C577S;ENSP00000365386:C561S;ENSP00000277120:C577S;ENSP00000314586:C561S	ENSP00000277120:C577S	C	+	2	0	NTRK2	86738993	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.236000	0.43052	2.894000	0.99253	0.655000	0.94253	TGT		0.433	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1			4	50	0	0	0	0.000602	0	4	50				
HSD17B3	3293	broad.mit.edu	37	9	99015147	99015147	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:99015147G>C	ENST00000375263.3	-	4	370	c.323C>G	c.(322-324)aCa>aGa	p.T108R	RP11-240L7.4_ENST00000448857.1_RNA|HSD17B3_ENST00000464104.1_5'Flank|HSD17B3_ENST00000375262.2_Missense_Mutation_p.T108R	NM_000197.1	NP_000188.1	P37058	DHB3_HUMAN	hydroxysteroid (17-beta) dehydrogenase 3	108					androgen biosynthetic process (GO:0006702)|male genitalia development (GO:0030539)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			breast(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)				GTCATCTTTTGTAAAATCTGC	0.393																																							uc004awa.1		NA																	0					0						c.(322-324)ACA>AGA		estradiol 17 beta-dehydrogenase 3	NADH(DB00157)						181.0	179.0	180.0					9																	99015147		2203	4300	6503	SO:0001583	missense	3293				androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity	g.chr9:99015147G>C		CCDS6716.1	9q22	2011-09-20			ENSG00000130948	ENSG00000130948	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5212	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 2"""	605573				8075637, 19027726	Standard	NM_000197		Approved	SDR12C2	uc004awa.1	P37058	OTTHUMG00000020292	ENST00000375263.3:c.323C>G	9.37:g.99015147G>C	ENSP00000364412:p.Thr108Arg		Somatic				HSD17B3_uc010msc.1_Missense_Mutation_p.T108R	p.T108R	NM_000197	NP_000188	WXS	Illumina HiSeq	Unspecified	P37058	DHB3_HUMAN			4	371	-		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)	108					Q5U0Q6	Missense_Mutation	SNP	ENST00000375263.3	37	c.323C>G	CCDS6716.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700495	0.48307	.	.	ENSG00000130948	ENST00000375263;ENST00000375262	D;D	0.94000	-3.33;-2.41	4.31	4.31	0.51392	NAD(P)-binding domain (1);	0.433352	0.23023	N	0.052829	D	0.95182	0.8438	M	0.62209	1.925	0.46927	D	0.999257	P;D	0.53151	0.454;0.958	B;P	0.60789	0.291;0.879	D	0.95195	0.8311	10	0.72032	D	0.01	-19.1057	14.7353	0.69412	0.0:0.0:1.0:0.0	.	108;108	Q5U0Q6;P37058	.;DHB3_HUMAN	R	108	ENSP00000364412:T108R;ENSP00000364411:T108R	ENSP00000364411:T108R	T	-	2	0	HSD17B3	98054968	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	6.245000	0.72398	2.676000	0.91093	0.655000	0.94253	ACA		0.393	HSD17B3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053259.1	NM_000197		6	161	0	0	0	0.001984	0	6	161				
TBC1D2	55357	broad.mit.edu	37	9	100995710	100995710	+	Missense_Mutation	SNP	C	C	A	rs548342801		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:100995710C>A	ENST00000375064.1	-	4	807	c.769G>T	c.(769-771)Gcc>Tcc	p.A257S	TBC1D2_ENST00000342112.5_Missense_Mutation_p.A39S|TBC1D2_ENST00000375066.5_Missense_Mutation_p.A257S	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	257					positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		GGGGTGCTGGCGTCAGAGGCC	0.627																																							uc011lvb.1		NA																	0				ovary(3)	3						c.(769-771)GCC>TCC		TBC1 domain family, member 2							83.0	77.0	79.0					9																	100995710		2203	4300	6503	SO:0001583	missense	55357					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity	g.chr9:100995710C>A	AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.769G>T	9.37:g.100995710C>A	ENSP00000364205:p.Ala257Ser		Somatic				TBC1D2_uc004ayq.2_Missense_Mutation_p.A257S|TBC1D2_uc004ayr.2_Missense_Mutation_p.A39S|TBC1D2_uc004ayo.3_Missense_Mutation_p.A257S	p.A257S	NM_018421	NP_060891	WXS	Illumina HiSeq	Unspecified	Q9BYX2	TBD2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)	4	949	-		Myeloproliferative disorder(762;0.0255)	257					B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Missense_Mutation	SNP	ENST00000375064.1	37	c.769G>T		.	.	.	.	.	.	.	.	.	.	C	0.004	-2.382004	0.00205	.	.	ENSG00000095383	ENST00000375064;ENST00000375066;ENST00000342112	T;T;T	0.14516	2.5;3.17;2.5	4.52	-0.754	0.11065	.	0.506229	0.19441	N	0.114171	T	0.05364	0.0142	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.12630	0.001;0.006	B;B	0.06405	0.001;0.002	T	0.41106	-0.9527	10	0.12430	T	0.62	.	4.6369	0.12528	0.0863:0.4374:0.3292:0.1471	.	257;257	Q9BYX2;Q9BYX2-2	TBD2A_HUMAN;.	S	257;257;39	ENSP00000364205:A257S;ENSP00000364207:A257S;ENSP00000341567:A39S	ENSP00000341567:A39S	A	-	1	0	TBC1D2	100035531	0.001000	0.12720	0.003000	0.11579	0.022000	0.10575	0.215000	0.17562	-0.228000	0.09869	-2.641000	0.00151	GCC		0.627	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053366.1	NM_018421		3	31	1	0	0.004672	0.004672	0.00534343	3	31				
ASTN2	23245	broad.mit.edu	37	9	119977009	119977009	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:119977009C>T	ENST00000313400.4	-	3	743	c.643G>A	c.(643-645)Gcg>Acg	p.A215T	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.A215T|ASTN2_ENST00000361209.2_Missense_Mutation_p.A215T			O75129	ASTN2_HUMAN	astrotactin 2	215					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.A215P(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						AGCAGCAGCGCGATGAGGCCA	0.612																																							uc004bjs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(643-645)GCG>ACG		astrotactin 2 isoform c							29.0	30.0	30.0					9																	119977009		2203	4298	6501	SO:0001583	missense	23245					integral to membrane		g.chr9:119977009C>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.643G>A	9.37:g.119977009C>T	ENSP00000314038:p.Ala215Thr		Somatic				ASTN2_uc004bjr.1_Missense_Mutation_p.A215T|ASTN2_uc004bjt.1_Missense_Mutation_p.A215T	p.A215T	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			3	744	-			215			Helical; (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.643G>A		.	.	.	.	.	.	.	.	.	.	C	34	5.332394	0.95733	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.21932	2.13;2.12;1.98	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000001	T	0.34687	0.0906	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	0.995;1.0;0.999	P;D;P	0.77557	0.843;0.99;0.868	T	0.03761	-1.1006	9	.	.	.	-17.8813	18.8043	0.92030	0.0:1.0:0.0:0.0	.	215;215;215	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	T	215	ENSP00000314038:A215T;ENSP00000363108:A215T;ENSP00000354504:A215T	.	A	-	1	0	ASTN2	119016830	1.000000	0.71417	0.461000	0.27105	0.991000	0.79684	7.783000	0.85696	2.541000	0.85698	0.655000	0.94253	GCG		0.612	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		10	31	0	0	0	0.001368	0	10	31				
LMX1B	4010	broad.mit.edu	37	9	129458702	129458702	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:129458702C>T	ENST00000373474.4	+	8	1188	c.1181C>T	c.(1180-1182)tCc>tTc	p.S394F	LMX1B_ENST00000526117.1_Missense_Mutation_p.S387F|LMX1B_ENST00000561065.1_Missense_Mutation_p.S375F|LMX1B_ENST00000355497.5_Missense_Mutation_p.S398F|LMX1B_ENST00000425646.2_Missense_Mutation_p.S364F			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	394					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						CGGCTCTACTCCATGCAGAGT	0.682									Nail-Patella Syndrome																												Pancreas(110;1796 2278 18357 20466)	Pancreas(110;1796 2278 18357 20466)	uc004bqj.2		NA																	0					0						c.(1111-1113)TCC>TTC		LIM homeobox transcription factor 1, beta							86.0	94.0	91.0					9																	129458702		2203	4300	6503	SO:0001583	missense	4010	Nail-Patella_Syndrome	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:129458702C>T	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.1181C>T	9.37:g.129458702C>T	ENSP00000362573:p.Ser394Phe		Somatic				LMX1B_uc004bqi.2_Missense_Mutation_p.S364F|LMX1B_uc011maa.1_Missense_Mutation_p.S375F	p.S371F	NM_002316	NP_002307	WXS	Illumina HiSeq	Unspecified	O60663	LMX1B_HUMAN			8	1162	+			371					F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	37	c.1112C>T	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479360	0.84747	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.86961	0.6059	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.87673	0.2542	10	0.54805	T	0.06	.	17.2947	0.87167	0.0:1.0:0.0:0.0	.	375;371;387	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	F	387;394;398;364	ENSP00000436930:S387F;ENSP00000362573:S394F;ENSP00000347684:S398F;ENSP00000390923:S364F	ENSP00000347684:S398F	S	+	2	0	LMX1B	128498523	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.405000	0.80007	2.317000	0.78254	0.561000	0.74099	TCC		0.682	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2			10	135	0	0	0	0.00245	0	10	135				
NDOR1	27158	broad.mit.edu	37	9	140110130	140110130	+	Silent	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr9:140110130C>G	ENST00000344894.5	+	11	1391	c.1308C>G	c.(1306-1308)ctC>ctG	p.L436L	NDOR1_ENST00000371521.4_Silent_p.L436L|NDOR1_ENST00000427047.2_Silent_p.L402L|NDOR1_ENST00000458322.2_Silent_p.L429L	NM_001144028.1|NM_014434.2	NP_001137500.1|NP_055249.1			NADPH dependent diflavin oxidoreductase 1											breast(1)|endometrium(5)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GGGTGCCCCTCTGGGTGCGGC	0.622																																							uc004clw.2		NA																	0					0						c.(1306-1308)CTC>CTG		NADPH dependent diflavin oxidoreductase 1							48.0	53.0	52.0					9																	140110130		2203	4300	6503	SO:0001819	synonymous_variant	27158				cell death	cytosol|intermediate filament cytoskeleton|nucleus|perinuclear region of cytoplasm	flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding|oxidoreductase activity|protein binding	g.chr9:140110130C>G	BC015735	CCDS7036.1, CCDS48061.1, CCDS48062.1, CCDS48063.1	9q34.3	2008-02-05			ENSG00000188566	ENSG00000188566			29838	protein-coding gene	gene with protein product	"""NADPH dependent FMN and FAD containing oxidoreductase"""	606073				10625700, 12631275	Standard	XM_005266066		Approved	NR1, bA350O14.9	uc004clx.3	Q9UHB4	OTTHUMG00000020986	ENST00000344894.5:c.1308C>G	9.37:g.140110130C>G			Somatic				NDOR1_uc004clx.2_Silent_p.L436L|NDOR1_uc011mes.1_Silent_p.L429L|NDOR1_uc004cly.2_Silent_p.L402L	p.L436L	NM_014434	NP_055249	WXS	Illumina HiSeq	Unspecified	Q9UHB4	NDOR1_HUMAN	STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)	11	1419	+	all_cancers(76;0.0926)		436			FAD-binding FR-type.			Silent	SNP	ENST00000344894.5	37	c.1308C>G	CCDS7036.1																																																																																				0.622	NDOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254704.1	NM_014434		3	61	0	0	0	0.004672	0	3	61				
NLGN4X	57502	broad.mit.edu	37	X	5810994	5810994	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:5810994G>T	ENST00000381095.3	-	6	2942	c.2315C>A	c.(2314-2316)cCa>cAa	p.P772Q	NLGN4X_ENST00000275857.6_Missense_Mutation_p.P772Q|NLGN4X_ENST00000381093.2_Missense_Mutation_p.P792Q|NLGN4X_ENST00000538097.1_Missense_Mutation_p.P772Q|NLGN4X_ENST00000381092.1_Missense_Mutation_p.P772Q	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	772					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CGTCATAAGTGGGATGTCATC	0.552																																							uc010ndh.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(2314-2316)CCA>CAA		X-linked neuroligin 4 precursor							287.0	236.0	253.0					X																	5810994		2203	4300	6503	SO:0001583	missense	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5810994G>T	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.2315C>A	X.37:g.5810994G>T	ENSP00000370485:p.Pro772Gln		Somatic				NLGN4X_uc004crp.2_Missense_Mutation_p.P792Q|NLGN4X_uc004crq.2_Missense_Mutation_p.P772Q|NLGN4X_uc010ndi.2_Missense_Mutation_p.P809Q|NLGN4X_uc004crr.2_Missense_Mutation_p.P772Q|NLGN4X_uc010ndj.2_Missense_Mutation_p.P772Q	p.P772Q	NM_181332	NP_851849	WXS	Illumina HiSeq	Unspecified	Q8N0W4	NLGNX_HUMAN			6	2816	-			772			Cytoplasmic (Potential).		Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	c.2315C>A	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569268	0.45798	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14	3.82	3.82	0.43975	.	0.000000	0.34460	N	0.003956	T	0.46814	0.1412	M	0.79123	2.44	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.984;0.984;0.995	T	0.54364	-0.8305	10	0.87932	D	0	.	14.222	0.65833	0.0:0.0:1.0:0.0	.	829;772;792	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	Q	772;792;772;772;772	ENSP00000370485:P772Q;ENSP00000370483:P792Q;ENSP00000275857:P772Q;ENSP00000370482:P772Q;ENSP00000439203:P772Q	ENSP00000275857:P772Q	P	-	2	0	NLGN4X	5820994	1.000000	0.71417	0.663000	0.29738	0.081000	0.17604	8.436000	0.90300	1.508000	0.48769	0.513000	0.50165	CCA		0.552	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		14	140	1	0	6.31663e-08	0.003163	8.04317e-08	14	140				
BMX	660	broad.mit.edu	37	X	15574209	15574209	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:15574209G>A	ENST00000357607.2	+	19	2155	c.1967G>A	c.(1966-1968)cGt>cAt	p.R656H	BMX_ENST00000348343.6_Missense_Mutation_p.R656H|BMX_ENST00000342014.6_Missense_Mutation_p.R656H			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	656	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					CCAGAAAAGCGTCCCACATTT	0.333																																							uc004cww.2		NA																	0				lung(3)|ovary(2)	5						c.(1966-1968)CGT>CAT		BMX non-receptor tyrosine kinase							197.0	192.0	194.0					X																	15574209		2203	4300	6503	SO:0001583	missense	660				cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity	g.chrX:15574209G>A	AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.1967G>A	X.37:g.15574209G>A	ENSP00000350224:p.Arg656His		Somatic				BMX_uc004cwx.3_Missense_Mutation_p.R656H|BMX_uc004cwy.3_Missense_Mutation_p.R656H	p.R656H	NM_203281	NP_975010	WXS	Illumina HiSeq	Unspecified	P51813	BMX_HUMAN			19	2155	+	Hepatocellular(33;0.183)		656			Protein kinase.		A6NIH9|O60564|Q12871	Missense_Mutation	SNP	ENST00000357607.2	37	c.1967G>A	CCDS14168.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520697	0.85495	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	D;D;D	0.98362	-4.89;-4.89;-4.89	5.98	5.98	0.97165	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000017	D	0.99492	0.9819	H	0.99689	4.705	0.37363	D	0.911318	D	0.89917	1.0	D	0.81914	0.995	D	0.98839	1.0754	10	0.87932	D	0	.	14.5243	0.67875	0.0:0.0:1.0:0.0	.	656	P51813	BMX_HUMAN	H	656	ENSP00000350224:R656H;ENSP00000308774:R656H;ENSP00000340082:R656H	ENSP00000340082:R656H	R	+	2	0	BMX	15484130	0.999000	0.42202	0.999000	0.59377	0.992000	0.81027	3.051000	0.49885	2.508000	0.84585	0.600000	0.82982	CGT		0.333	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055877.1	NM_001721		7	218	0	0	0	0.004482	0	7	218				
CA5B	11238	broad.mit.edu	37	X	15768256	15768256	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:15768256A>T	ENST00000318636.3	+	2	246	c.110A>T	c.(109-111)tAt>tTt	p.Y37F	CA5B_ENST00000454127.2_Missense_Mutation_p.Y37F|CA5B_ENST00000380313.1_3'UTR	NM_007220.3	NP_009151.1	Q8WTZ4	CA5BL_HUMAN	carbonic anhydrase VB, mitochondrial	0						mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|lung(3)|prostate(1)|stomach(2)	9	Hepatocellular(33;0.183)					TGCAGCCTCTATACTTGTACT	0.493																																							uc004cxe.2		NA																	0					0						c.(109-111)TAT>TTT		carbonic anhydrase VB, mitochondrial precursor							92.0	94.0	94.0					X																	15768256		2203	4300	6503	SO:0001583	missense	11238				one-carbon metabolic process	mitochondrion	carbonate dehydratase activity|zinc ion binding	g.chrX:15768256A>T	AB021660	CCDS14171.1	Xp22.1	2008-08-13			ENSG00000169239	ENSG00000169239		"""Carbonic anhydrases"""	1378	protein-coding gene	gene with protein product		300230				10409679	Standard	XM_005274442		Approved		uc004cxe.3	Q9Y2D0	OTTHUMG00000021183	ENST00000318636.3:c.110A>T	X.37:g.15768256A>T	ENSP00000314099:p.Tyr37Phe		Somatic					p.Y37F	NM_007220	NP_009151	WXS	Illumina HiSeq	Unspecified	Q9Y2D0	CAH5B_HUMAN			2	227	+	Hepatocellular(33;0.183)		37					A6NEZ4	Missense_Mutation	SNP	ENST00000318636.3	37	c.110A>T	CCDS14171.1	.	.	.	.	.	.	.	.	.	.	A	11.67	1.708199	0.30322	.	.	ENSG00000169239	ENST00000498004;ENST00000318636;ENST00000479740;ENST00000454127	T;T;T	0.69040	-0.37;0.14;-0.37	5.37	5.37	0.77165	Carbonic anhydrase, alpha-class, catalytic domain (1);	0.398622	0.25932	N	0.027379	T	0.52175	0.1718	L	0.32530	0.975	0.27871	N	0.940044	B	0.31519	0.327	B	0.26202	0.067	T	0.49579	-0.8925	10	0.33940	T	0.23	-10.8275	10.7169	0.46017	1.0:0.0:0.0:0.0	.	37	Q9Y2D0	CAH5B_HUMAN	F	37	ENSP00000314099:Y37F;ENSP00000417553:Y37F;ENSP00000417021:Y37F	ENSP00000314099:Y37F	Y	+	2	0	CA5B	15678177	0.996000	0.38824	0.996000	0.52242	0.713000	0.41058	2.813000	0.48002	1.800000	0.52685	0.417000	0.27973	TAT		0.493	CA5B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354933.1	NM_007220		26	142	0	0	0	0.002096	0	26	142				
PHKA2	5256	broad.mit.edu	37	X	18944628	18944628	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:18944628T>G	ENST00000379942.4	-	14	2067	c.1402A>C	c.(1402-1404)Att>Ctt	p.I468L		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	468					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					ATTGGATGAATGTCCGCGATA	0.463																																							uc004cyv.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1402-1404)ATT>CTT		phosphorylase kinase, alpha 2 (liver)							171.0	138.0	149.0					X																	18944628		2203	4300	6503	SO:0001583	missense	5256				glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:18944628T>G		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.1402A>C	X.37:g.18944628T>G	ENSP00000369274:p.Ile468Leu		Somatic				PHKA2_uc010nfg.1_RNA	p.I468L	NM_000292	NP_000283	WXS	Illumina HiSeq	Unspecified	P46019	KPB2_HUMAN			14	1832	-	Hepatocellular(33;0.183)		468					A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	c.1402A>C	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	T	13.71	2.317148	0.40996	.	.	ENSG00000044446	ENST00000379942	D	0.91180	-2.8	5.38	1.74	0.24563	Glycoside hydrolase 15-related (1);	0.285110	0.41294	D	0.000912	D	0.85492	0.5709	L	0.51422	1.61	0.35862	D	0.827553	B	0.14438	0.01	B	0.15484	0.013	T	0.80763	-0.1237	10	0.56958	D	0.05	-6.8029	7.8107	0.29230	0.0:0.3435:0.0:0.6565	.	468	P46019	KPB2_HUMAN	L	468	ENSP00000369274:I468L	ENSP00000369274:I468L	I	-	1	0	PHKA2	18854549	1.000000	0.71417	0.927000	0.36925	0.675000	0.39556	0.617000	0.24359	0.292000	0.22492	0.486000	0.48141	ATT		0.463	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		9	171	0	0	0	0.008291	0	9	171				
PDHA1	5160	broad.mit.edu	37	X	19369444	19369444	+	Missense_Mutation	SNP	C	C	A	rs11554111		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:19369444C>A	ENST00000422285.2	+	4	442	c.337C>A	c.(337-339)Cat>Aat	p.H113N	PDHA1_ENST00000379805.3_Missense_Mutation_p.H113N|PDHA1_ENST00000540249.1_Missense_Mutation_p.H113N|PDHA1_ENST00000379806.5_Missense_Mutation_p.H151N|PDHA1_ENST00000545074.1_Missense_Mutation_p.H120N			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	113			H -> D (in PDHAD). {ECO:0000269|PubMed:8664900}.		acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					CCCCACAGACCATCTCATCAC	0.498																																							uc004czg.3		NA																	0				ovary(1)	1	GRCh37	CM961095	PDHA1	M	rs11554111	c.(337-339)CAT>AAT		pyruvate dehydrogenase E1 alpha 1 precursor	NADH(DB00157)						110.0	101.0	104.0					X																	19369444		2203	4300	6503	SO:0001583	missense	5160				glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity	g.chrX:19369444C>A		CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.337C>A	X.37:g.19369444C>A	ENSP00000394382:p.His113Asn		Somatic				PDHA1_uc004czh.3_Missense_Mutation_p.H148N|PDHA1_uc011mjc.1_Missense_Mutation_p.H117N|PDHA1_uc011mjd.1_Missense_Mutation_p.H110N|PDHA1_uc010nfk.2_Missense_Mutation_p.H110N	p.H113N	NM_000284	NP_000275	WXS	Illumina HiSeq	Unspecified	P08559	ODPA_HUMAN			4	482	+	Hepatocellular(33;0.183)		113		H -> D (in PDHE1 deficiency).			A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Missense_Mutation	SNP	ENST00000422285.2	37	c.337C>A	CCDS14192.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555055	0.65425	.	.	ENSG00000131828	ENST00000379806;ENST00000545074;ENST00000540249;ENST00000423505;ENST00000422285;ENST00000355808;ENST00000379805	D;D;D;D;D;D;D	0.97066	-3.77;-3.77;-4.23;-3.77;-3.77;-3.77;-3.77	5.54	5.54	0.83059	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.96703	0.8924	N	0.25890	0.77	0.80722	D	1	P;D;P;B;P	0.54772	0.627;0.968;0.935;0.051;0.935	B;D;D;B;P	0.64877	0.296;0.93;0.91;0.071;0.877	D	0.95547	0.8617	10	0.21540	T	0.41	-3.6966	18.8124	0.92063	0.0:1.0:0.0:0.0	.	113;120;113;151;113	B7Z3X5;B7Z3T7;B2R5P7;A5YVE9;P08559	.;.;.;.;ODPA_HUMAN	N	151;120;113;151;113;120;113	ENSP00000369134:H151N;ENSP00000438550:H120N;ENSP00000440761:H113N;ENSP00000406473:H151N;ENSP00000394382:H113N;ENSP00000348062:H120N;ENSP00000369133:H113N	ENSP00000348062:H120N	H	+	1	0	PDHA1	19279365	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.445000	0.80570	2.475000	0.83589	0.529000	0.55759	CAT		0.498	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055977.1			18	142	1	0	8.34094e-07	0.008871	1.04125e-06	18	142				
FAM47C	442444	broad.mit.edu	37	X	37028863	37028863	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:37028863C>G	ENST00000358047.3	+	1	2432	c.2380C>G	c.(2380-2382)Cgt>Ggt	p.R794G		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	794										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TCCCAAGACTCGTCGAGTGTC	0.617																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(2380-2382)CGT>GGT		hypothetical protein LOC442444							38.0	39.0	39.0					X																	37028863		2201	4300	6501	SO:0001583	missense	442444							g.chrX:37028863C>G	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2380C>G	X.37:g.37028863C>G	ENSP00000367913:p.Arg794Gly		Somatic					p.R794G	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	2394	+			794					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.2380C>G	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978864	0.34942	.	.	ENSG00000198173	ENST00000358047	T	0.14391	2.51	0.217	0.217	0.15264	.	.	.	.	.	T	0.23572	0.0570	M	0.68317	2.08	0.09310	N	0.999998	D	0.60575	0.988	P	0.57679	0.825	T	0.11251	-1.0595	9	0.35671	T	0.21	.	6.1626	0.20372	0.0:0.9996:0.0:4.0E-4	.	794	Q5HY64	FA47C_HUMAN	G	794	ENSP00000367913:R794G	ENSP00000367913:R794G	R	+	1	0	FAM47C	36938784	0.002000	0.14202	0.003000	0.11579	0.003000	0.03518	-0.513000	0.06305	0.273000	0.22049	0.277000	0.19347	CGT		0.617	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		3	43	0	0	0	0.001168	0	3	43				
EFHC2	80258	broad.mit.edu	37	X	44109460	44109460	+	Missense_Mutation	SNP	G	G	A	rs199652921		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:44109460G>A	ENST00000420999.1	-	5	921	c.838C>T	c.(838-840)Cgg>Tgg	p.R280W		NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	280	DM10 2. {ECO:0000255|PROSITE- ProRule:PRU00665}.						calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						TTACTCCTCCGGAGGAACATT	0.423																																							uc004dgb.3		NA																	0				breast(3)|ovary(2)|central_nervous_system(1)	6						c.(838-840)CGG>TGG		EF-hand domain (C-terminal) containing 2		G	TRP/ARG	1,3267		0,1,1348,570	61.0	52.0	55.0		838	4.3	1.0	X		55	0,6462		0,0,2337,1788	yes	missense	EFHC2	NM_025184.3	101	0,1,3685,2358	AA,AG,GG,G		0.0,0.0306,0.0103	probably-damaging	280/750	44109460	1,9729	1919	4125	6044	SO:0001583	missense	80258						calcium ion binding	g.chrX:44109460G>A	AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.838C>T	X.37:g.44109460G>A	ENSP00000404232:p.Arg280Trp		Somatic					p.R280W	NM_025184	NP_079460	WXS	Illumina HiSeq	Unspecified	Q5JST6	EFHC2_HUMAN			6	928	-			280			DM10 2.		Q5JST8|Q68DK4|Q8NEI0|Q9H653	Missense_Mutation	SNP	ENST00000420999.1	37	c.838C>T	CCDS55405.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.22|17.22	3.334212|3.334212	0.60853|0.60853	3.06E-4|3.06E-4	0.0|0.0	ENSG00000183690|ENSG00000183690	ENST00000441230|ENST00000333807;ENST00000420999;ENST00000378056	.|T;T	.|0.52295	.|0.67;0.67	5.26|5.26	4.31|4.31	0.51392|0.51392	.|Uncharacterised domain DM10 (2);	.|0.693799	.|0.14253	.|N	.|0.331287	T|T	0.69833|0.69833	0.3155|0.3155	M|M	0.86097|0.86097	2.795|2.795	0.38522|0.38522	D|D	0.948759|0.948759	.|D	.|0.89917	.|1.0	.|D	.|0.70716	.|0.97	T|T	0.74954|0.74954	-0.3488|-0.3488	5|10	.|0.87932	.|D	.|0	-1.4307|-1.4307	11.4968|11.4968	0.50413|0.50413	0.0:0.0:0.7036:0.2964|0.0:0.0:0.7036:0.2964	.|.	.|280	.|Q5JST6	.|EFHC2_HUMAN	L|W	260|280;308;84	.|ENSP00000333823:R280W;ENSP00000404232:R308W	.|ENSP00000333823:R280W	P|R	-|-	2|1	0|2	EFHC2|EFHC2	43994404|43994404	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.604000|0.604000	0.37047|0.37047	2.595000|2.595000	0.46197|0.46197	2.177000|2.177000	0.69029|0.69029	0.513000|0.513000	0.50165|0.50165	CCG|CGG		0.423	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184		5	37	0	0	0	0.001168	0	5	37				
PAGE4	9506	broad.mit.edu	37	X	49597217	49597217	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:49597217C>G	ENST00000218068.6	+	4	335	c.256C>G	c.(256-258)Cca>Gca	p.P86A	PAGE4_ENST00000376141.1_Missense_Mutation_p.P86A	NM_007003.2	NP_008934.1	O60829	PAGE4_HUMAN	P antigen family, member 4 (prostate associated)	86												Ovarian(276;0.236)					AGAGAAGACTCCACCTAATCC	0.383																																							uc004don.1		NA																	0					0						c.(256-258)CCA>GCA		G antigen, family C, 1							107.0	85.0	93.0					X																	49597217		2203	4300	6503	SO:0001583	missense	9506							g.chrX:49597217C>G	AF275258	CCDS35274.1	Xp11.23	2009-06-17	2005-01-26	2005-01-27	ENSG00000101951	ENSG00000101951			4108	protein-coding gene	gene with protein product		300287	"""G antigen, family C, 1"""	GAGEC1		9724777	Standard	NM_007003		Approved	PAGE-4, CT16.7	uc004don.1	O60829	OTTHUMG00000024155	ENST00000218068.6:c.256C>G	X.37:g.49597217C>G	ENSP00000218068:p.Pro86Ala		Somatic					p.P86A	NM_007003	NP_008934	WXS	Illumina HiSeq	Unspecified	O60829	GAGC1_HUMAN			4	335	+	Ovarian(276;0.236)		86					B2R529|D3DX68|Q6IBI1	Missense_Mutation	SNP	ENST00000218068.6	37	c.256C>G	CCDS35274.1	.	.	.	.	.	.	.	.	.	.	C	8.367	0.834511	0.16820	.	.	ENSG00000101951	ENST00000376141;ENST00000218068	T;T	0.09630	2.96;2.96	2.9	1.98	0.26296	.	.	.	.	.	T	0.20577	0.0495	L	0.47716	1.5	0.09310	N	1	D	0.65815	0.995	D	0.69307	0.963	T	0.07290	-1.0780	9	0.41790	T	0.15	.	6.8844	0.24191	0.0:0.716:0.284:0.0	.	86	O60829	GAGC1_HUMAN	A	86	ENSP00000365311:P86A;ENSP00000218068:P86A	ENSP00000218068:P86A	P	+	1	0	PAGE4	49483955	0.001000	0.12720	0.012000	0.15200	0.070000	0.16714	0.563000	0.23547	0.606000	0.29965	0.544000	0.68410	CCA		0.383	PAGE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060839.1			7	61	0	0	0	0.004482	0	7	61				
CCNB3	85417	broad.mit.edu	37	X	50053715	50053715	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:50053715G>A	ENST00000376042.1	+	6	2844	c.2546G>A	c.(2545-2547)aGt>aAt	p.S849N	CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.S849N			Q8WWL7	CCNB3_HUMAN	cyclin B3	849					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					AAGGAGCCCAGTGTTGACACA	0.532																																							uc004dox.3		NA																	0				ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9						c.(2545-2547)AGT>AAT		cyclin B3 isoform 3							42.0	34.0	37.0					X																	50053715		2203	4300	6503	SO:0001583	missense	85417				cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding	g.chrX:50053715G>A	AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2546G>A	X.37:g.50053715G>A	ENSP00000365210:p.Ser849Asn		Somatic				CCNB3_uc004doy.2_Missense_Mutation_p.S849N|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	p.S849N	NM_033031	NP_149020	WXS	Illumina HiSeq	Unspecified	Q8WWL7	CCNB3_HUMAN			6	2844	+	Ovarian(276;0.236)		849					B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	37	c.2546G>A	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	C	4.753	0.139939	0.09083	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.36157	1.27;1.27	0.886	-0.0305	0.13914	.	23.709600	0.00481	N	0.000121	T	0.27098	0.0664	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.08391	-1.0724	9	.	.	.	.	4.6244	0.12470	0.0:0.5903:0.4097:0.0	.	849	Q8WWL7	CCNB3_HUMAN	N	849	ENSP00000365210:S849N;ENSP00000276014:S849N	.	S	+	2	0	CCNB3	50070455	0.000000	0.05858	0.001000	0.08648	0.085000	0.17905	-1.106000	0.03319	-0.059000	0.13154	-0.731000	0.03576	AGT		0.532	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1			4	20	0	0	0	0.000248	0	4	20				
SMC1A	8243	broad.mit.edu	37	X	53432207	53432207	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:53432207C>G	ENST00000322213.4	-	12	2155	c.2028G>C	c.(2026-2028)gaG>gaC	p.E676D	SMC1A_ENST00000375340.6_Missense_Mutation_p.E442D	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	676					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						GCTCCTTCTTCTCTTTCAACT	0.537																																							uc004dsg.2		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(2026-2028)GAG>GAC		structural maintenance of chromosomes 1A							120.0	96.0	104.0					X																	53432207		2203	4300	6503	SO:0001583	missense	8243				cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity	g.chrX:53432207C>G	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.2028G>C	X.37:g.53432207C>G	ENSP00000323421:p.Glu676Asp		Somatic				SMC1A_uc011moe.1_Missense_Mutation_p.E654D|SMC1A_uc011mof.1_Missense_Mutation_p.E442D	p.E676D	NM_006306	NP_006297	WXS	Illumina HiSeq	Unspecified	Q14683	SMC1A_HUMAN			12	2097	-			676			Potential.		O14995|Q16351|Q2M228	Missense_Mutation	SNP	ENST00000322213.4	37	c.2028G>C	CCDS14352.1	.	.	.	.	.	.	.	.	.	.	C	8.496	0.863106	0.17250	.	.	ENSG00000072501	ENST00000322213;ENST00000375340	D;D	0.86694	-2.16;-2.16	4.6	1.83	0.25207	SMCs flexible hinge (1);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.83608	0.5291	N	0.20445	0.575	0.51012	D	0.999907	P;B;B	0.52842	0.956;0.003;0.001	P;B;B	0.62184	0.899;0.005;0.016	T	0.76865	-0.2801	10	0.16896	T	0.51	.	8.8408	0.35140	0.0:0.7129:0.0:0.2871	.	442;654;676	B7Z709;Q6MZR8;Q14683	.;.;SMC1A_HUMAN	D	676;442	ENSP00000323421:E676D;ENSP00000364489:E442D	ENSP00000323421:E676D	E	-	3	2	SMC1A	53448932	0.970000	0.33590	1.000000	0.80357	0.995000	0.86356	0.174000	0.16743	0.489000	0.27749	0.600000	0.82982	GAG		0.537	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306		9	35	0	0	0	0.008291	0	9	35				
TSR2	90121	broad.mit.edu	37	X	54469901	54469901	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:54469901G>T	ENST00000375151.4	+	3	262	c.241G>T	c.(241-243)Gtg>Ttg	p.V81L		NM_058163.1	NP_477511.1	Q969E8	TSR2_HUMAN	TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)	81					rRNA processing (GO:0006364)					breast(1)|endometrium(3)|lung(2)	6						TGATACAGTTGTGGAAGACGG	0.522																																							uc004dte.2		NA																	0					0						c.(241-243)GTG>TTG		TSR2, 20S rRNA accumulation, homolog							133.0	117.0	123.0					X																	54469901		2203	4300	6503	SO:0001583	missense	90121				rRNA processing		protein binding	g.chrX:54469901G>T	BC007699	CCDS14358.1	Xp11.22	2008-10-01			ENSG00000158526	ENSG00000158526			25455	protein-coding gene	gene with protein product	"""WGG motif containing 1"""					9417904	Standard	NM_058163		Approved	DT1P1A10, RP1-112K5.2, WGG1	uc004dte.3	Q969E8	OTTHUMG00000021628	ENST00000375151.4:c.241G>T	X.37:g.54469901G>T	ENSP00000364293:p.Val81Leu		Somatic				TSR2_uc004dtf.2_5'UTR	p.V81L	NM_058163	NP_477511	WXS	Illumina HiSeq	Unspecified	Q969E8	TSR2_HUMAN			3	243	+			81						Missense_Mutation	SNP	ENST00000375151.4	37	c.241G>T	CCDS14358.1	.	.	.	.	.	.	.	.	.	.	g	22.5	4.304104	0.81136	.	.	ENSG00000158526	ENST00000375151	.	.	.	5.7	5.7	0.88788	.	0.123875	0.53938	N	0.000046	T	0.65154	0.2664	M	0.65498	2.005	0.54753	D	0.999988	P	0.50819	0.939	P	0.50860	0.652	T	0.61312	-0.7088	9	0.17369	T	0.5	-21.5138	17.5467	0.87864	0.0:0.0:1.0:0.0	.	81	Q969E8	TSR2_HUMAN	L	81	.	ENSP00000364293:V81L	V	+	1	0	TSR2	54486626	1.000000	0.71417	0.876000	0.34364	0.533000	0.34776	3.164000	0.50770	2.414000	0.81942	0.591000	0.81541	GTG		0.522	TSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056802.1	NM_058163		9	73	1	0	1.33987e-11	0.008291	1.80222e-11	9	73				
SPIN2B	474343	broad.mit.edu	37	X	57146385	57146385	+	Silent	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:57146385G>C	ENST00000333933.3	-	2	988	c.678C>G	c.(676-678)ggC>ggG	p.G226G	SPIN2B_ENST00000374912.5_Silent_p.G226G|SPIN2B_ENST00000460948.1_Intron|SPIN2B_ENST00000275988.5_Silent_p.G226G|SPIN2B_ENST00000374910.3_Silent_p.G125G|RP3-323P24.3_ENST00000439622.1_RNA	NM_001006681.1	NP_001006682.1	Q9BPZ2	SPI2B_HUMAN	spindlin family, member 2B	226					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				endometrium(3)|large_intestine(1)|skin(1)	5						GAATGACCATGCCGATCCTTT	0.438																																							uc004duy.2		NA																	0					0						c.(676-678)GGC>GGG		spindlin-like protein 2							132.0	109.0	117.0					X																	57146385		2203	4298	6501	SO:0001819	synonymous_variant	474343				apoptosis|cell cycle|gamete generation	nucleus		g.chrX:57146385G>C	AF356353	CCDS35311.1, CCDS65274.1	Xp11.1	2014-02-12	2006-12-05		ENSG00000186787	ENSG00000186787			33147	protein-coding gene	gene with protein product		300517				12145692	Standard	XM_005262010		Approved	SPIN-2	uc004dva.3	Q9BPZ2	OTTHUMG00000021680	ENST00000333933.3:c.678C>G	X.37:g.57146385G>C			Somatic				SPIN2B_uc004duz.2_Silent_p.G226G|SPIN2B_uc004dva.2_Silent_p.G226G|uc011mor.1_RNA	p.G226G	NM_001006682	NP_001006683	WXS	Illumina HiSeq	Unspecified	Q9BPZ2	SPI2B_HUMAN			2	937	-			226					Q7Z2M0	Silent	SNP	ENST00000333933.3	37	c.678C>G	CCDS35311.1																																																																																				0.438	SPIN2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056912.1	NM_001006681		15	117	0	0	0	0.006122	0	15	117				
HEPH	9843	broad.mit.edu	37	X	65475992	65475992	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:65475992G>T	ENST00000343002.2	+	16	3380	c.2716G>T	c.(2716-2718)Ggc>Tgc	p.G906C	HEPH_ENST00000419594.1_Missense_Mutation_p.G717C|HEPH_ENST00000441993.2_Missense_Mutation_p.G909C|HEPH_ENST00000374727.3_Missense_Mutation_p.G909C|HEPH_ENST00000336279.5_Missense_Mutation_p.G639C|HEPH_ENST00000519389.1_Missense_Mutation_p.G960C			Q9BQS7	HEPH_HUMAN	hephaestin	906					cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CTGCCAAAAGGGCATCCTGGA	0.483																																							uc011moz.1		NA																	0		p.E909V(1)		lung(5)|ovary(4)	9						c.(2725-2727)GGC>TGC		hephaestin isoform a							110.0	102.0	105.0					X																	65475992		2203	4300	6503	SO:0001583	missense	9843				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity	g.chrX:65475992G>T	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.2716G>T	X.37:g.65475992G>T	ENSP00000343939:p.Gly906Cys		Somatic				HEPH_uc004dwn.2_Missense_Mutation_p.G909C|HEPH_uc004dwo.2_Missense_Mutation_p.G639C|HEPH_uc010nkr.2_Missense_Mutation_p.G717C|HEPH_uc011mpa.1_Missense_Mutation_p.G909C|HEPH_uc010nks.2_Missense_Mutation_p.G198C	p.G909C	NM_138737	NP_620074	WXS	Illumina HiSeq	Unspecified	Q9BQS7	HEPH_HUMAN			17	2785	+			906			Extracellular (Potential).		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37	c.2725G>T		.	.	.	.	.	.	.	.	.	.	G	15.70	2.912361	0.52439	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002	D;D;D;D;D;D	0.98889	-5.21;-5.21;-5.21;-5.21;-5.21;-5.21	4.52	4.52	0.55395	Cupredoxin (2);	0.410909	0.26210	N	0.025693	D	0.99345	0.9770	H	0.94183	3.505	0.38617	D	0.951047	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.85130	0.971;0.989;0.997;0.995	D	0.99560	1.0968	10	0.72032	D	0.01	.	15.2764	0.73745	0.0:0.0:1.0:0.0	.	960;306;717;906	E9PHN8;B4DFV3;E7ES21;Q9BQS7	.;.;.;HEPH_HUMAN	C	960;909;639;909;717;906	ENSP00000430620:G960C;ENSP00000363859:G909C;ENSP00000337418:G639C;ENSP00000411687:G909C;ENSP00000413211:G717C;ENSP00000343939:G906C	ENSP00000337418:G639C	G	+	1	0	HEPH	65392717	1.000000	0.71417	0.345000	0.25642	0.532000	0.34746	6.182000	0.71995	2.255000	0.74692	0.600000	0.82982	GGC		0.483	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737		6	86	1	0	0.00448238	0.004482	0.00517302	6	86				
GDPD2	54857	broad.mit.edu	37	X	69649556	69649556	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:69649556C>T	ENST00000374382.3	+	11	1401	c.1150C>T	c.(1150-1152)Caa>Taa	p.Q384*	GDPD2_ENST00000538649.1_Nonsense_Mutation_p.Q305*|GDPD2_ENST00000472623.1_3'UTR|GDPD2_ENST00000536730.1_Nonsense_Mutation_p.Q305*|GDPD2_ENST00000453994.2_Nonsense_Mutation_p.Q384*	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	384	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					AAGGGTGCCCCAAGCCATGGT	0.562																																							uc004dyh.2		NA																	0				ovary(2)	2						c.(1150-1152)CAA>TAA		osteoblast differentiation promoting factor							61.0	46.0	51.0					X																	69649556		2203	4300	6503	SO:0001587	stop_gained	54857				glycerol metabolic process|lipid metabolic process	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol inositolphosphodiesterase activity|metal ion binding	g.chrX:69649556C>T	AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.1150C>T	X.37:g.69649556C>T	ENSP00000363503:p.Gln384*		Somatic				GDPD2_uc010nkx.1_3'UTR|GDPD2_uc010nky.1_Nonsense_Mutation_p.Q170*|GDPD2_uc011mpk.1_Nonsense_Mutation_p.Q384*|GDPD2_uc011mpl.1_Nonsense_Mutation_p.Q305*|GDPD2_uc011mpm.1_Nonsense_Mutation_p.Q305*	p.Q384*	NM_017711	NP_060181	WXS	Illumina HiSeq	Unspecified	Q9HCC8	GDPD2_HUMAN			11	1401	+	Renal(35;0.156)		384			GDPD.|Extracellular (Potential).		B4DRH4|B4DVC9|Q9NXJ6	Nonsense_Mutation	SNP	ENST00000374382.3	37	c.1150C>T	CCDS14402.1	.	.	.	.	.	.	.	.	.	.	C	39	7.664614	0.98419	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	.	.	.	4.62	4.62	0.57501	.	0.150025	0.45606	D	0.000358	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.431	13.8798	0.63676	0.0:1.0:0.0:0.0	.	.	.	.	X	384;305;305;384	.	.	Q	+	1	0	GDPD2	69566281	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	5.164000	0.64954	2.143000	0.66587	0.292000	0.19580	CAA		0.562	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057070.1	NM_017711		3	23	0	0	0	0.004672	0	3	23				
ATRX	546	broad.mit.edu	37	X	76939375	76939375	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:76939375G>C	ENST00000373344.5	-	9	1587	c.1373C>G	c.(1372-1374)tCa>tGa	p.S458*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.S420*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	458					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTCTGACTTTGAAATATCCTT	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		1	Unknown(1)		bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(1372-1374)TCA>TGA		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						168.0	164.0	165.0					X																	76939375		2203	4296	6499	SO:0001587	stop_gained	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76939375G>C	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1373C>G	X.37:g.76939375G>C	ENSP00000362441:p.Ser458*		Somatic				ATRX_uc004ecq.3_Nonsense_Mutation_p.S420*|ATRX_uc004eco.3_Nonsense_Mutation_p.S243*|ATRX_uc004ecr.2_Nonsense_Mutation_p.S419*|ATRX_uc010nlx.1_Nonsense_Mutation_p.S458*|ATRX_uc010nly.1_Nonsense_Mutation_p.S403*	p.S458*	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			9	1605	-			458					D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	ENST00000373344.5	37	c.1373C>G	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	g	37	6.196463	0.97367	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	4.89	4.01	0.46588	.	1.207700	0.05811	N	0.613982	.	.	.	.	.	.	0.19575	N	0.999963	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-0.0647	8.8294	0.35074	0.1898:0.0:0.8102:0.0	.	.	.	.	X	458;420;414	.	ENSP00000362441:S458X	S	-	2	0	ATRX	76826031	0.818000	0.29161	0.998000	0.56505	0.983000	0.72400	1.633000	0.37113	0.831000	0.34780	0.509000	0.49947	TCA		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		11	171	0	0	0	0.008291	0	11	171				
CYSLTR1	10800	broad.mit.edu	37	X	77528786	77528786	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:77528786A>T	ENST00000373304.3	-	3	750	c.458T>A	c.(457-459)tTg>tAg	p.L153*		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	153					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	AGAACTGGTCAAAATCACAAA	0.363																																							uc004edb.2		NA																	0				ovary(1)	1						c.(457-459)TTG>TAG		cysteinyl leukotriene receptor 1	Amlexanox(DB01025)|Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)						62.0	56.0	58.0					X																	77528786		2201	4300	6501	SO:0001587	stop_gained	10800				elevation of cytosolic calcium ion concentration|respiratory gaseous exchange	integral to plasma membrane|membrane fraction	leukotriene receptor activity	g.chrX:77528786A>T	AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.458T>A	X.37:g.77528786A>T	ENSP00000362401:p.Leu153*		Somatic				CYSLTR1_uc010nma.2_Nonsense_Mutation_p.L153*|CYSLTR1_uc010nmb.2_Nonsense_Mutation_p.L153*	p.L153*	NM_006639	NP_006630	WXS	Illumina HiSeq	Unspecified	Q9Y271	CLTR1_HUMAN			3	858	-			153			Helical; Name=4; (Potential).		B2R954|D3DTE4|Q5JS94|Q8IV19	Nonsense_Mutation	SNP	ENST00000373304.3	37	c.458T>A	CCDS14439.1	.	.	.	.	.	.	.	.	.	.	a	36	5.948368	0.97134	.	.	ENSG00000173198	ENST00000373304	.	.	.	4.44	4.44	0.53790	.	0.248309	0.34178	N	0.004200	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.7762	0.46350	1.0:0.0:0.0:0.0	.	.	.	.	X	153	.	ENSP00000362401:L153X	L	-	2	0	CYSLTR1	77415442	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.019000	0.64060	1.435000	0.47434	0.368000	0.22195	TTG		0.363	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057315.1			3	26	0	0	0	0.000248	0	3	26				
HDX	139324	broad.mit.edu	37	X	83723856	83723856	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:83723856T>A	ENST00000297977.5	-	3	986	c.875A>T	c.(874-876)aAt>aTt	p.N292I	HDX_ENST00000506585.2_Missense_Mutation_p.N234I|HDX_ENST00000373177.2_Missense_Mutation_p.N292I	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	292						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GGACAAACAATTTCCTTCTGC	0.473																																					Pancreas(53;231 1169 36156 43751 51139)	Pancreas(53;231 1169 36156 43751 51139)	uc004eek.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(874-876)AAT>ATT		highly divergent homeobox							118.0	104.0	108.0					X																	83723856		2203	4300	6503	SO:0001583	missense	139324					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:83723856T>A	BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.875A>T	X.37:g.83723856T>A	ENSP00000297977:p.Asn292Ile		Somatic				HDX_uc011mqv.1_Missense_Mutation_p.N292I|HDX_uc004eel.1_Missense_Mutation_p.N234I	p.N292I	NM_144657	NP_653258	WXS	Illumina HiSeq	Unspecified	Q7Z353	HDX_HUMAN			3	984	-			292					A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	ENST00000297977.5	37	c.875A>T	CCDS35342.1	.	.	.	.	.	.	.	.	.	.	T	9.431	1.085518	0.20390	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585	T;T;T	0.31510	1.5;1.49;1.5	4.94	0.825	0.18824	.	0.435902	0.25866	N	0.027788	T	0.15652	0.0377	N	0.22421	0.69	0.25448	N	0.988032	B	0.02656	0.0	B	0.01281	0.0	T	0.14282	-1.0478	10	0.72032	D	0.01	-39.6606	2.2101	0.03945	0.1037:0.365:0.2843:0.247	.	292	Q7Z353	HDX_HUMAN	I	292;234;292	ENSP00000297977:N292I;ENSP00000362272:N234I;ENSP00000423670:N292I	ENSP00000297977:N292I	N	-	2	0	HDX	83610512	0.999000	0.42202	1.000000	0.80357	0.695000	0.40330	1.155000	0.31700	0.411000	0.25702	-0.716000	0.03619	AAT		0.473	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657		12	126	0	0	0	0.003163	0	12	126				
GPRASP2	114928	broad.mit.edu	37	X	101971406	101971406	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:101971406G>A	ENST00000535209.1	+	4	2440	c.1609G>A	c.(1609-1611)Gga>Aga	p.G537R	GPRASP2_ENST00000543253.1_Missense_Mutation_p.G537R|GPRASP2_ENST00000332262.5_Missense_Mutation_p.G537R			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	537						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						TAGCCCAGAAGGAGAAGAGCA	0.507																																							uc004ejk.2		NA																	0				ovary(1)	1						c.(1609-1611)GGA>AGA		G protein-coupled receptor associated sorting							90.0	81.0	84.0					X																	101971406		2203	4300	6503	SO:0001583	missense	114928					cytoplasm	protein binding	g.chrX:101971406G>A	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1609G>A	X.37:g.101971406G>A	ENSP00000437394:p.Gly537Arg		Somatic				GPRASP2_uc004ejl.2_Missense_Mutation_p.G537R|GPRASP2_uc004ejm.2_Missense_Mutation_p.G537R|GPRASP2_uc011mrp.1_5'Flank	p.G537R	NM_138437	NP_612446	WXS	Illumina HiSeq	Unspecified	Q96D09	GASP2_HUMAN			4	2943	+			537					D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	c.1609G>A	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	G	5.081	0.200579	0.09652	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.07021	3.23;3.23;3.23	4.44	2.68	0.31781	.	0.310096	0.23793	N	0.044512	T	0.07908	0.0198	M	0.65498	2.005	0.31694	N	0.641585	B	0.25390	0.125	B	0.19666	0.026	T	0.22765	-1.0207	10	0.09590	T	0.72	-8.4295	6.0004	0.19517	0.2341:0.0:0.7659:0.0	.	537	Q96D09	GASP2_HUMAN	R	537	ENSP00000437872:G537R;ENSP00000437394:G537R;ENSP00000339057:G537R	ENSP00000339057:G537R	G	+	1	0	GPRASP2	101858062	1.000000	0.71417	1.000000	0.80357	0.533000	0.34776	1.779000	0.38624	0.624000	0.30286	-0.191000	0.12829	GGA		0.507	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437		4	106	0	0	0	0.000602	0	4	106				
CXorf57	55086	broad.mit.edu	37	X	105868456	105868456	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:105868456C>G	ENST00000372548.4	+	3	1032	c.923C>G	c.(922-924)cCa>cGa	p.P308R	CXorf57_ENST00000372544.2_Missense_Mutation_p.P308R	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	308							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						AAGAGTTATCCATTCAGAATA	0.383																																							uc004emi.3		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(922-924)CCA>CGA		hypothetical protein LOC55086							152.0	130.0	138.0					X																	105868456		2203	4300	6503	SO:0001583	missense	55086							g.chrX:105868456C>G	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.923C>G	X.37:g.105868456C>G	ENSP00000361628:p.Pro308Arg		Somatic				CXorf57_uc004emj.3_Missense_Mutation_p.P308R|CXorf57_uc004emh.2_Missense_Mutation_p.P308R	p.P308R	NM_018015	NP_060485	WXS	Illumina HiSeq	Unspecified	Q6NSI4	CX057_HUMAN			3	1074	+			308					H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	ENST00000372548.4	37	c.923C>G	CCDS14519.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121784	0.37436	.	.	ENSG00000147231	ENST00000372544;ENST00000372548;ENST00000421550	T;T;T	0.43688	0.95;0.94;0.97	3.89	2.99	0.34606	Nucleic acid-binding, OB-fold-like (1);	0.363322	0.28171	N	0.016335	T	0.41073	0.1143	L	0.47716	1.5	0.34544	D	0.710626	D;P;P	0.53312	0.959;0.926;0.825	P;P;B	0.48654	0.585;0.585;0.408	T	0.55101	-0.8193	10	0.51188	T	0.08	-3.9473	9.6466	0.39872	0.3754:0.6246:0.0:0.0	.	308;308;308	A8K6R5;Q6NSI4;Q6NSI4-2	.;CX057_HUMAN;.	R	308;308;116	ENSP00000361623:P308R;ENSP00000361628:P308R;ENSP00000405866:P116R	ENSP00000361623:P308R	P	+	2	0	CXorf57	105755112	0.163000	0.22920	0.731000	0.30826	0.918000	0.54935	1.267000	0.33050	0.722000	0.32252	0.600000	0.82982	CCA		0.383	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057800.2	NM_018015		6	109	0	0	0	0.001984	0	6	109				
AMMECR1	9949	broad.mit.edu	37	X	109561258	109561258	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:109561258G>A	ENST00000262844.5	-	1	209	c.42C>T	c.(40-42)tcC>tcT	p.S14S	AMMECR1_ENST00000496695.1_5'Flank|AMMECR1_ENST00000372059.2_Silent_p.S14S|AMMECR1_ENST00000372057.1_Intron	NM_015365.2	NP_056180.1	Q9Y4X0	AMMR1_HUMAN	Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1	14										large_intestine(1)|lung(4)|ovary(1)|stomach(1)	7						GGGGCGAACTGGACAGTTTCT	0.672																																							uc004eoo.2		NA																	0					0						c.(40-42)TCC>TCT		AMMECR1 protein isoform 1							13.0	10.0	11.0					X																	109561258		1964	3852	5816	SO:0001819	synonymous_variant	9949							g.chrX:109561258G>A	AJ007014	CCDS14551.1, CCDS35368.1, CCDS55476.1	Xq22.3	2014-06-17	2008-09-12		ENSG00000101935	ENSG00000101935			467	protein-coding gene	gene with protein product		300195				10049589, 9480748	Standard	NM_001171689		Approved		uc004eoo.3	Q9Y4X0	OTTHUMG00000022197	ENST00000262844.5:c.42C>T	X.37:g.109561258G>A			Somatic				AMMECR1_uc004eop.2_Silent_p.S14S|AMMECR1_uc004eoq.2_Intron	p.S14S	NM_015365	NP_056180	WXS	Illumina HiSeq	Unspecified	Q9Y4X0	AMER1_HUMAN			1	123	-			14					Q5JYV9|Q6P9D8|Q8WX22|Q9UIQ8	Silent	SNP	ENST00000262844.5	37	c.42C>T	CCDS14551.1																																																																																				0.672	AMMECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057907.1			5	34	0	0	0	0.00308	0	5	34				
RGAG1	57529	broad.mit.edu	37	X	109694746	109694746	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:109694746G>T	ENST00000465301.2	+	3	1147	c.901G>T	c.(901-903)Gat>Tat	p.D301Y	RGAG1_ENST00000540313.1_Missense_Mutation_p.D301Y	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	301										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GCTCATGTCAGATCTAGACTC	0.478																																							uc004eor.1		NA																	0				lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(901-903)GAT>TAT		retrotransposon gag domain containing 1							199.0	171.0	181.0					X																	109694746		2203	4300	6503	SO:0001583	missense	57529							g.chrX:109694746G>T	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.901G>T	X.37:g.109694746G>T	ENSP00000419786:p.Asp301Tyr		Somatic				RGAG1_uc011msr.1_Missense_Mutation_p.D301Y	p.D301Y	NM_020769	NP_065820	WXS	Illumina HiSeq	Unspecified	Q8NET4	RGAG1_HUMAN			3	1147	+			301					Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	c.901G>T	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	10.22	1.290329	0.23478	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.47177	0.85;0.85	3.91	2.13	0.27403	.	0.951952	0.08572	N	0.925942	T	0.38268	0.1034	N	0.14661	0.345	0.09310	N	0.999994	D	0.54964	0.969	P	0.50970	0.655	T	0.21245	-1.0251	9	.	.	.	0.0409	7.4688	0.27336	0.2281:0.0:0.7719:0.0	.	301	Q8NET4	RGAG1_HUMAN	Y	301	ENSP00000419786:D301Y;ENSP00000441452:D301Y	.	D	+	1	0	RGAG1	109581402	0.553000	0.26513	0.182000	0.23118	0.177000	0.22998	2.355000	0.44107	0.441000	0.26529	0.600000	0.82982	GAT		0.478	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		18	191	1	0	9.7654e-05	0.007413	0.000117678	18	191				
DOCK11	139818	broad.mit.edu	37	X	117676931	117676931	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:117676931G>C	ENST00000276202.7	+	3	325	c.262G>C	c.(262-264)Gta>Cta	p.V88L	DOCK11_ENST00000276204.6_Missense_Mutation_p.V88L	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	88	Interaction with activated CDC42. {ECO:0000250}.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						GCAGTCTACTGTACCAGAAGA	0.378																																							uc004eqp.2		NA																	0				ovary(3)	3						c.(262-264)GTA>CTA		dedicator of cytokinesis 11							93.0	87.0	89.0					X																	117676931		2203	4299	6502	SO:0001583	missense	139818				blood coagulation	cytosol	GTP binding	g.chrX:117676931G>C	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.262G>C	X.37:g.117676931G>C	ENSP00000276202:p.Val88Leu		Somatic					p.V88L	NM_144658	NP_653259	WXS	Illumina HiSeq	Unspecified	Q5JSL3	DOC11_HUMAN			3	325	+			88			Interaction with activated CDC42 (By similarity).		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	c.262G>C	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015902	0.75161	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.54479	0.57;0.57	5.03	5.03	0.67393	.	0.064536	0.64402	D	0.000008	T	0.62588	0.2440	M	0.85859	2.78	0.50039	D	0.999842	B	0.31893	0.345	B	0.37943	0.261	T	0.65121	-0.6245	10	0.39692	T	0.17	-4.2333	16.0713	0.80936	0.0:0.0:1.0:0.0	.	88	Q5JSL3	DOC11_HUMAN	L	88	ENSP00000276204:V88L;ENSP00000276202:V88L	ENSP00000276202:V88L	V	+	1	0	DOCK11	117560959	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.538000	0.90634	2.310000	0.77875	0.538000	0.68166	GTA		0.378	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		8	91	0	0	0	0.00308	0	8	91				
KIAA1210	57481	broad.mit.edu	37	X	118220818	118220818	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:118220818T>C	ENST00000402510.2	-	11	4374	c.4375A>G	c.(4375-4377)Aat>Gat	p.N1459D		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1459										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TGGTTATTATTACCATCACCA	0.443																																							uc004era.3		NA																	0				ovary(4)|skin(1)	5						c.(4375-4377)AAT>GAT		hypothetical protein LOC57481							80.0	74.0	76.0					X																	118220818		1872	4091	5963	SO:0001583	missense	57481							g.chrX:118220818T>C	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4375A>G	X.37:g.118220818T>C	ENSP00000384670:p.Asn1459Asp		Somatic					p.N1459D	NM_020721	NP_065772	WXS	Illumina HiSeq	Unspecified	Q9ULL0	K1210_HUMAN			11	4375	-			1459					B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	c.4375A>G	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.423654	0.43020	.	.	ENSG00000250423	ENST00000402510	T	0.11385	2.78	5.0	1.1	0.20463	.	.	.	.	.	T	0.10165	0.0249	L	0.57536	1.79	0.09310	N	1	B	0.31227	0.314	B	0.35550	0.205	T	0.39961	-0.9588	9	0.12430	T	0.62	.	4.1416	0.10196	0.0:0.1961:0.1741:0.6298	.	1459	Q9ULL0	K1210_HUMAN	D	1459	ENSP00000384670:N1459D	ENSP00000384670:N1459D	N	-	1	0	RP13-347D8.6	118104846	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.384000	0.07389	-0.004000	0.14419	0.356000	0.21956	AAT		0.443	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721		6	65	0	0	0	0.001168	0	6	65				
GLUD2	2747	broad.mit.edu	37	X	120181571	120181571	+	Silent	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:120181571G>T	ENST00000328078.1	+	1	110	c.33G>T	c.(31-33)ccG>ccT	p.P11P		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	11					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CGCTGCTGCCGTCCCGGGCCG	0.766																																							uc004eto.2		NA																	0				pancreas(1)	1						c.(31-33)CCG>CCT		glutamate dehydrogenase 2 precursor	L-Glutamic Acid(DB00142)|NADH(DB00157)						19.0	23.0	21.0					X																	120181571		1595	3081	4676	SO:0001819	synonymous_variant	2747				glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding	g.chrX:120181571G>T	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.33G>T	X.37:g.120181571G>T			Somatic					p.P11P	NM_012084	NP_036216	WXS	Illumina HiSeq	Unspecified	P49448	DHE4_HUMAN			1	110	+			11					B2R8G0|Q9UDQ4	Silent	SNP	ENST00000328078.1	37	c.33G>T	CCDS14603.1																																																																																				0.766	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084		18	58	1	0	1.10513e-12	0.002299	1.49173e-12	18	58				
XIAP	331	broad.mit.edu	37	X	123040864	123040864	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:123040864C>G	ENST00000371199.3	+	7	1626	c.1327C>G	c.(1327-1329)Cgc>Ggc	p.R443G	XIAP_ENST00000468691.1_3'UTR|XIAP_ENST00000434753.3_Missense_Mutation_p.R443G|XIAP_ENST00000355640.3_Missense_Mutation_p.R443G	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	443					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						GCAGCTAAGGCGCCTGCAAGA	0.343									X-linked Lymphoproliferative syndrome																														uc010nqu.2		NA																	0				ovary(1)|lung(1)	2						c.(1327-1329)CGC>GGC		baculoviral IAP repeat-containing protein 4							74.0	72.0	73.0					X																	123040864		2203	4300	6503	SO:0001583	missense	331	X-linked_Lymphoproliferative_syndrome	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding	g.chrX:123040864C>G	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.1327C>G	X.37:g.123040864C>G	ENSP00000360242:p.Arg443Gly		Somatic				XIAP_uc004etx.2_Missense_Mutation_p.R443G|XIAP_uc010nqv.2_Missense_Mutation_p.R69G	p.R443G	NM_001167	NP_001158	WXS	Illumina HiSeq	Unspecified	P98170	XIAP_HUMAN			7	1453	+			443					D3DTF2|Q9NQ14	Missense_Mutation	SNP	ENST00000371199.3	37	c.1327C>G	CCDS14606.1	.	.	.	.	.	.	.	.	.	.	c	13.52	2.261916	0.39995	.	.	ENSG00000101966	ENST00000434753;ENST00000371199;ENST00000355640	T;T;T	0.03860	3.78;3.78;3.78	5.27	5.27	0.74061	Baculoviral inhibition of apoptosis protein repeat (1);	0.298987	0.29438	N	0.012151	T	0.08088	0.0202	L	0.50333	1.59	0.41481	D	0.988163	P	0.38642	0.641	B	0.37480	0.251	T	0.09487	-1.0672	10	0.62326	D	0.03	-4.2028	17.6164	0.88068	0.0:1.0:0.0:0.0	.	443	P98170	XIAP_HUMAN	G	443	ENSP00000395230:R443G;ENSP00000360242:R443G;ENSP00000347858:R443G	ENSP00000347858:R443G	R	+	1	0	XIAP	122868545	1.000000	0.71417	0.998000	0.56505	0.893000	0.52053	3.557000	0.53741	2.190000	0.69967	0.594000	0.82650	CGC		0.343	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058165.5	NM_001167		6	81	0	0	0	0.00308	0	6	81				
TENM1	10178	broad.mit.edu	37	X	123587250	123587250	+	Silent	SNP	G	G	A	rs371157889		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:123587250G>A	ENST00000371130.3	-	22	4083	c.4020C>T	c.(4018-4020)atC>atT	p.I1340I	TENM1_ENST00000461429.1_5'Flank|TENM1_ENST00000422452.2_Silent_p.I1347I	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1340					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CATTTGAGCCGATTACAGTTG	0.423																																							uc004euj.2		NA																	0				ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(4018-4020)ATC>ATT		odz, odd Oz/ten-m homolog 1 isoform 3		A	,,	1,3834		0,0,1,1632,570	304.0	210.0	242.0		4041,4038,4020	-1.7	1.0	X		242	0,6728		0,0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	ODZ1	NM_001163278.1,NM_001163279.1,NM_014253.3	,,	0,0,1,4060,2442	AA,AG,A,GG,G		0.0,0.0261,0.0095	,,	1347/2733,1346/2732,1340/2726	123587250	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123587250G>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4020C>T	X.37:g.123587250G>A			Somatic				ODZ1_uc011muj.1_Silent_p.I1346I|ODZ1_uc010nqy.2_Silent_p.I1347I	p.I1340I	NM_014253	NP_055068	WXS	Illumina HiSeq	Unspecified	Q9UKZ4	TEN1_HUMAN			22	4084	-			1340			Extracellular (Potential).		B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	c.4020C>T	CCDS14609.1																																																																																				0.423	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		10	143	0	0	0	0.000978	0	10	143				
TENM1	10178	broad.mit.edu	37	X	123654532	123654532	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:123654532G>T	ENST00000371130.3	-	18	3199	c.3136C>A	c.(3136-3138)Cat>Aat	p.H1046N	TENM1_ENST00000422452.2_Missense_Mutation_p.H1046N	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1046					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATCGTTGAATGTGTCAGAAGG	0.498																																							uc004euj.2		NA																	0				ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(3136-3138)CAT>AAT		odz, odd Oz/ten-m homolog 1 isoform 3							113.0	99.0	104.0					X																	123654532		2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123654532G>T	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3136C>A	X.37:g.123654532G>T	ENSP00000360171:p.His1046Asn		Somatic				ODZ1_uc011muj.1_Missense_Mutation_p.H1045N|ODZ1_uc010nqy.2_Missense_Mutation_p.H1046N	p.H1046N	NM_014253	NP_055068	WXS	Illumina HiSeq	Unspecified	Q9UKZ4	TEN1_HUMAN			18	3200	-			1046			Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.3136C>A	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	9.543	1.113808	0.20795	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.85088	-1.94;-1.91	5.58	5.58	0.84498	.	0.057423	0.64402	D	0.000001	T	0.77658	0.4163	L	0.45228	1.405	0.80722	D	1	D;B;B	0.55385	0.971;0.037;0.126	B;B;B	0.39217	0.294;0.004;0.013	T	0.78001	-0.2375	10	0.02654	T	1	.	18.5439	0.91039	0.0:0.0:1.0:0.0	.	1045;1046;1046	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	N	1046	ENSP00000360171:H1046N;ENSP00000403954:H1046N	ENSP00000360171:H1046N	H	-	1	0	ODZ1	123482213	1.000000	0.71417	1.000000	0.80357	0.301000	0.27625	9.813000	0.99286	2.321000	0.78463	0.600000	0.82982	CAT		0.498	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		22	136	1	0	9.95505e-16	0.002299	1.34852e-15	22	136				
ACTRT1	139741	broad.mit.edu	37	X	127185978	127185978	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:127185978A>T	ENST00000371124.3	-	1	404	c.208T>A	c.(208-210)Ttg>Atg	p.L70M		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	70						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						GGGTAGTGCAAATGTAGGGCC	0.478																																							uc004eum.2		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(208-210)TTG>ATG		actin-related protein T1							149.0	137.0	141.0					X																	127185978		2203	4300	6503	SO:0001583	missense	139741					cytoplasm|cytoskeleton		g.chrX:127185978A>T	AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.208T>A	X.37:g.127185978A>T	ENSP00000360165:p.Leu70Met		Somatic					p.L70M	NM_138289	NP_612146	WXS	Illumina HiSeq	Unspecified	Q8TDG2	ACTT1_HUMAN			1	405	-			70					Q6X7C1|Q96L10	Missense_Mutation	SNP	ENST00000371124.3	37	c.208T>A	CCDS14611.1	.	.	.	.	.	.	.	.	.	.	A	10.70	1.424688	0.25639	.	.	ENSG00000123165	ENST00000371124	D	0.95069	-3.6	3.76	0.117	0.14652	.	0.000000	0.47455	D	0.000224	D	0.94706	0.8292	M	0.84773	2.715	0.31948	N	0.609991	D	0.54047	0.964	P	0.50314	0.637	D	0.92987	0.6411	10	0.87932	D	0	.	7.8343	0.29362	0.3729:0.0:0.6271:0.0	.	70	Q8TDG2	ACTT1_HUMAN	M	70	ENSP00000360165:L70M	ENSP00000360165:L70M	L	-	1	2	ACTRT1	127013659	0.487000	0.25988	0.002000	0.10522	0.053000	0.15095	0.953000	0.29162	-0.076000	0.12775	0.441000	0.28932	TTG		0.478	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058192.1	NM_138289		14	179	0	0	0	0.001855	0	14	179				
SMARCA1	6594	broad.mit.edu	37	X	128582330	128582330	+	Silent	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:128582330G>T	ENST00000371122.4	-	24	3250	c.3121C>A	c.(3121-3123)Cgg>Agg	p.R1041R	SMARCA1_ENST00000371121.3_Silent_p.R1029R|SMARCA1_ENST00000371123.1_Silent_p.R1029R	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	1041					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						TTAGTTGCCCGTTTCTTCTTT	0.318																																							uc004eun.3		NA																	0				ovary(3)|skin(1)	4						c.(3121-3123)CGG>AGG		SWI/SNF-related matrix-associated							149.0	137.0	141.0					X																	128582330		2203	4296	6499	SO:0001819	synonymous_variant	6594				ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding	g.chrX:128582330G>T	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.3121C>A	X.37:g.128582330G>T			Somatic				SMARCA1_uc004eup.3_Silent_p.R1029R|SMARCA1_uc011muk.1_Silent_p.R1041R|SMARCA1_uc011mul.1_Silent_p.R1029R	p.R1041R	NM_003069	NP_003060	WXS	Illumina HiSeq	Unspecified	P28370	SMCA1_HUMAN			24	3234	-			1041					Q5JV41|Q5JV42	Silent	SNP	ENST00000371122.4	37	c.3121C>A	CCDS14612.1																																																																																				0.318	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069		9	70	1	0	0.00448238	0.004482	0.00517302	9	70				
SMARCA1	6594	broad.mit.edu	37	X	128599500	128599500	+	Silent	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:128599500G>T	ENST00000371122.4	-	23	3156	c.3027C>A	c.(3025-3027)gcC>gcA	p.A1009A	SMARCA1_ENST00000371123.1_Silent_p.A997A|SMARCA1_ENST00000371121.3_Silent_p.A997A	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	1009	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						TACATACCATGGCAGTCCTAG	0.343																																							uc004eun.3		NA																	0				ovary(3)|skin(1)	4						c.(3025-3027)GCC>GCA		SWI/SNF-related matrix-associated							153.0	137.0	143.0					X																	128599500		2203	4300	6503	SO:0001819	synonymous_variant	6594				ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding	g.chrX:128599500G>T	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.3027C>A	X.37:g.128599500G>T			Somatic				SMARCA1_uc004eup.3_Silent_p.A997A|SMARCA1_uc011muk.1_Silent_p.A1009A|SMARCA1_uc011mul.1_Silent_p.A997A	p.A1009A	NM_003069	NP_003060	WXS	Illumina HiSeq	Unspecified	P28370	SMCA1_HUMAN			23	3140	-			1009			SANT 2.		Q5JV41|Q5JV42	Silent	SNP	ENST00000371122.4	37	c.3027C>A	CCDS14612.1																																																																																				0.343	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069		11	161	1	0	0.000151284	0.001855	0.000181732	11	161				
SAGE1	55511	broad.mit.edu	37	X	134989508	134989508	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:134989508T>C	ENST00000370709.3	+	8	914	c.914T>C	c.(913-915)aTg>aCg	p.M305T	SAGE1_ENST00000535938.1_Missense_Mutation_p.M305T|SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000324447.3_Missense_Mutation_p.M305T			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	305						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					GAAGAGAAGATGGAAAATGAC	0.433																																							uc004ezh.2		NA																	0				ovary(2)|skin(1)	3						c.(913-915)ATG>ACG		sarcoma antigen 1							141.0	114.0	123.0					X																	134989508		2203	4300	6503	SO:0001583	missense	55511							g.chrX:134989508T>C	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.914T>C	X.37:g.134989508T>C	ENSP00000359743:p.Met305Thr		Somatic				SAGE1_uc010nry.1_Missense_Mutation_p.M274T|SAGE1_uc011mvv.1_Intron	p.M305T	NM_018666	NP_061136	WXS	Illumina HiSeq	Unspecified	Q9NXZ1	SAGE1_HUMAN			9	1081	+	Acute lymphoblastic leukemia(192;0.000127)		305					Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	37	c.914T>C	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	T	0.073	-1.197853	0.01594	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000370709	T;T;T	0.37584	1.19;1.19;1.19	1.56	0.274	0.15654	.	0.095117	0.43579	U	0.000551	T	0.16896	0.0406	N	0.17082	0.46	0.09310	N	1	B	0.17667	0.023	B	0.18561	0.022	T	0.09930	-1.0652	10	0.33940	T	0.23	.	3.2506	0.06812	0.0:0.2591:0.0:0.7409	.	305	Q9NXZ1	SAGE1_HUMAN	T	305	ENSP00000323191:M305T;ENSP00000445959:M305T;ENSP00000359743:M305T	ENSP00000323191:M305T	M	+	2	0	SAGE1	134817174	0.997000	0.39634	0.011000	0.14972	0.001000	0.01503	0.148000	0.16224	0.010000	0.14839	0.151000	0.16131	ATG		0.433	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666		20	104	0	0	0	0.002299	0	20	104				
ARHGEF6	9459	broad.mit.edu	37	X	135764989	135764989	+	Silent	SNP	C	C	G	rs199956578		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:135764989C>G	ENST00000250617.6	-	13	2612	c.1407G>C	c.(1405-1407)cgG>cgC	p.R469R	ARHGEF6_ENST00000535227.1_Silent_p.R342R|ARHGEF6_ENST00000370620.1_Silent_p.R315R|ARHGEF6_ENST00000370622.1_Silent_p.R315R	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	469	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					ACATAAGGTACCGCTCCTCTT	0.343																																							uc004fab.2		NA																	0					0						c.(1405-1407)CGG>CGC		Rac/Cdc42 guanine nucleotide exchange factor 6							102.0	88.0	93.0					X																	135764989		2203	4300	6503	SO:0001819	synonymous_variant	9459				apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chrX:135764989C>G	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1407G>C	X.37:g.135764989C>G			Somatic				ARHGEF6_uc011mwd.1_Silent_p.R342R|ARHGEF6_uc011mwe.1_Silent_p.R315R	p.R469R	NM_004840	NP_004831	WXS	Illumina HiSeq	Unspecified	Q15052	ARHG6_HUMAN			13	1869	-	Acute lymphoblastic leukemia(192;0.000127)		469			PH.		A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Silent	SNP	ENST00000250617.6	37	c.1407G>C	CCDS14660.1																																																																																				0.343	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840		6	88	0	0	0	0.001984	0	6	88				
GPR101	83550	broad.mit.edu	37	X	136113001	136113001	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:136113001T>G	ENST00000298110.1	-	1	832	c.833A>C	c.(832-834)gAa>gCa	p.E278A		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					GTCCTTGGCTTCCATTCTGCC	0.592																																							uc011mwh.1		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(832-834)GAA>GCA		G protein-coupled receptor 101							182.0	124.0	144.0					X																	136113001		2203	4300	6503	SO:0001583	missense	83550					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:136113001T>G	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.833A>C	X.37:g.136113001T>G	ENSP00000298110:p.Glu278Ala		Somatic					p.E278A	NM_054021	NP_473362	WXS	Illumina HiSeq	Unspecified	Q96P66	GP101_HUMAN			1	833	-	Acute lymphoblastic leukemia(192;0.000127)		278			Cytoplasmic (Potential).		Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	c.833A>C	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	T	0.528	-0.859115	0.02610	.	.	ENSG00000165370	ENST00000298110	T	0.64260	-0.09	4.04	0.188	0.15114	GPCR, rhodopsin-like superfamily (1);	1.152350	0.06826	N	0.793106	T	0.39253	0.1071	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.17471	-1.0368	10	0.09338	T	0.73	-0.0067	1.4612	0.02396	0.1785:0.1052:0.1716:0.5447	.	278	Q96P66	GP101_HUMAN	A	278	ENSP00000298110:E278A	ENSP00000298110:E278A	E	-	2	0	GPR101	135940667	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.415000	0.07106	-0.059000	0.13154	0.430000	0.28490	GAA		0.592	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1			4	168	0	0	0	0.000248	0	4	168				
MCF2	4168	broad.mit.edu	37	X	138714570	138714571	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:138714570_138714571GG>TT	ENST00000370576.4	-	2	303_304	c.94_95CC>AA	c.(94-96)CCt>AAt	p.P32N	MCF2_ENST00000520602.1_Missense_Mutation_p.P92N|MCF2_ENST00000338585.6_Missense_Mutation_p.P32N|MCF2_ENST00000519895.1_Missense_Mutation_p.P92N|MCF2_ENST00000414978.1_Missense_Mutation_p.P92N|MCF2_ENST00000370578.4_Missense_Mutation_p.P177N|MCF2_ENST00000536274.1_Missense_Mutation_p.P32N|MCF2_ENST00000370573.4_Missense_Mutation_p.P32N	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	32	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P32R(2)|p.P92R(1)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					AAAGCTGGTAGGACGTAAAACC	0.356																																							uc004fau.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(1)|pleura(1)	2						c.(94-96)CCT>AAT		MCF.2 cell line derived transforming sequence																																				SO:0001583	missense	4168				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chrX:138714570_138714571GG>TT		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.94_95delinsTT	X.37:g.138714570_138714571delinsTT	ENSP00000359608:p.Pro32Asn		Somatic				MCF2_uc004fav.2_Missense_Mutation_p.P32N|MCF2_uc011mwl.1_Missense_Mutation_p.P32N|MCF2_uc010nsh.1_Missense_Mutation_p.P32N|MCF2_uc011mwm.1_Missense_Mutation_p.P32N|MCF2_uc011mwn.1_Missense_Mutation_p.P177N|MCF2_uc004faw.2_Missense_Mutation_p.P92N|MCF2_uc011mwo.1_Missense_Mutation_p.P92N	p.P32N	NM_005369	NP_005360	WXS	Illumina HiSeq	Unspecified	P10911	MCF2_HUMAN			2	388_389	-	Acute lymphoblastic leukemia(192;0.000127)		32			CRAL-TRIO.		B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	DNP	ENST00000370576.4	37	c.94_95CC>AA	CCDS14667.1																																																																																				0.356	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369		6	78	0	0	0	0.004672	0	6	78				
SLITRK2	84631	broad.mit.edu	37	X	144904003	144904003	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:144904003G>T	ENST00000370490.1	+	1	4315	c.60G>T	c.(58-60)gaG>gaT	p.E20D	SLITRK2_ENST00000428560.2_Missense_Mutation_p.E20D|SLITRK2_ENST00000434188.2_Missense_Mutation_p.E20D|SLITRK2_ENST00000447897.2_Missense_Mutation_p.E20D|SLITRK2_ENST00000413937.2_Missense_Mutation_p.E20D			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	20					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TACAGACAGAGAGTCGCAAAA	0.473																																							uc004fcd.2		NA																	0				ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(58-60)GAG>GAT		SLIT and NTRK-like family, member 2 precursor							73.0	65.0	68.0					X																	144904003		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144904003G>T	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.60G>T	X.37:g.144904003G>T	ENSP00000359521:p.Glu20Asp		Somatic				SLITRK2_uc010nsp.2_Missense_Mutation_p.E20D|SLITRK2_uc010nso.2_Missense_Mutation_p.E20D|SLITRK2_uc011mwq.1_Missense_Mutation_p.E20D|SLITRK2_uc011mwr.1_Missense_Mutation_p.E20D|SLITRK2_uc011mws.1_Missense_Mutation_p.E20D|SLITRK2_uc004fcg.2_Missense_Mutation_p.E20D|SLITRK2_uc011mwt.1_Missense_Mutation_p.E20D	p.E20D	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	1050	+	Acute lymphoblastic leukemia(192;6.56e-05)		20					A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.60G>T	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575850	0.45902	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.53423	0.67;0.62;0.62;0.62;0.62;0.62	4.56	3.69	0.42338	.	0.219506	0.37261	U	0.002176	T	0.27241	0.0668	N	0.13098	0.295	0.30254	N	0.793784	B	0.26318	0.146	B	0.25291	0.059	T	0.19418	-1.0306	10	0.18276	T	0.48	-8.3205	9.5903	0.39541	0.1072:0.0:0.8928:0.0	.	20	Q9H156	SLIK2_HUMAN	D	20	ENSP00000334374:E20D;ENSP00000411681:E20D;ENSP00000359521:E20D;ENSP00000397015:E20D;ENSP00000407347:E20D;ENSP00000412010:E20D	ENSP00000334374:E20D	E	+	3	2	SLITRK2	144711695	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	1.011000	0.29911	0.720000	0.32209	0.436000	0.28706	GAG		0.473	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		7	46	1	0	0.00198382	0.001984	0.00231749	7	46				
GABRQ	55879	broad.mit.edu	37	X	151821537	151821537	+	Silent	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:151821537G>A	ENST00000370306.2	+	9	1712	c.1692G>A	c.(1690-1692)gaG>gaA	p.E564E		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	564					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATGATGATGAGCTCATGGCCC	0.517																																							uc004ffp.1		NA																	0				ovary(2)|pancreas(1)	3						c.(1690-1692)GAG>GAA		gamma-aminobutyric acid (GABA) receptor, theta							110.0	86.0	94.0					X																	151821537		2203	4300	6503	SO:0001819	synonymous_variant	55879					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity	g.chrX:151821537G>A	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1692G>A	X.37:g.151821537G>A			Somatic					p.E564E	NM_018558	NP_061028	WXS	Illumina HiSeq	Unspecified	Q9UN88	GBRT_HUMAN			9	1712	+	Acute lymphoblastic leukemia(192;6.56e-05)		564					A6NFN1|Q32MB4|Q9NZK8	Silent	SNP	ENST00000370306.2	37	c.1692G>A	CCDS14707.1																																																																																				0.517	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558		10	57	0	0	0	0.008291	0	10	57				
PDZD4	57595	broad.mit.edu	37	X	153069120	153069120	+	Silent	SNP	C	C	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:153069120C>T	ENST00000164640.4	-	8	2189	c.1998G>A	c.(1996-1998)gcG>gcA	p.A666A	PDZD4_ENST00000475140.1_5'Flank|PDZD4_ENST00000393758.2_Silent_p.A591A|PDZD4_ENST00000544474.1_Silent_p.A557A	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	666						cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCTCGCTCACCGCGTCGTCGT	0.667																																							uc004fiz.1		NA																	0				breast(1)	1						c.(1996-1998)GCG>GCA		PDZ domain containing 4							62.0	57.0	59.0					X																	153069120		2203	4299	6502	SO:0001819	synonymous_variant	57595					cell cortex		g.chrX:153069120C>T	AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.1998G>A	X.37:g.153069120C>T			Somatic				PDZD4_uc004fiy.1_Silent_p.A591A|PDZD4_uc004fix.2_Silent_p.A570A|PDZD4_uc004fja.1_Silent_p.A672A|PDZD4_uc011mze.1_Silent_p.A557A	p.A666A	NM_032512	NP_115901	WXS	Illumina HiSeq	Unspecified	Q76G19	PDZD4_HUMAN			8	2248	-	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		666					B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Silent	SNP	ENST00000164640.4	37	c.1998G>A	CCDS14732.1																																																																																				0.667	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061013.3	NM_032512		5	101	0	0	0	0.001984	0	5	101				
ARHGAP4	393	broad.mit.edu	37	X	153184609	153184609	+	Splice_Site	SNP	G	G	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:153184609G>A	ENST00000350060.5	-	6	851	c.810C>T	c.(808-810)gaC>gaT	p.D270D	ARHGAP4_ENST00000370028.3_Splice_Site_p.D310D|ARHGAP4_ENST00000393721.1_Intron|ARHGAP4_ENST00000370016.1_Splice_Site_p.D249D|ARHGAP4_ENST00000537206.1_Splice_Site_p.D247D	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	270					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AAGGACTCACGTCCATGAGGT	0.572																																							uc004fjk.1		NA																	0				central_nervous_system(1)	1						c.(808-810)GAC>GAT		Rho GTPase activating protein 4 isoform 2							179.0	117.0	138.0					X																	153184609		2203	4300	6503	SO:0001630	splice_region_variant	393				apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity	g.chrX:153184609G>A	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.810+1C>T	X.37:g.153184609G>A			Somatic				ARHGAP4_uc011mzf.1_Silent_p.D247D|ARHGAP4_uc004fjl.1_Silent_p.D310D|ARHGAP4_uc010nup.1_RNA	p.D270D	NM_001666	NP_001657	WXS	Illumina HiSeq	Unspecified	P98171	RHG04_HUMAN			6	852	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		270					Q14144|Q86UY3	Silent	SNP	ENST00000350060.5	37	c.810C>T	CCDS14736.1																																																																																				0.572	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666	Silent	4	114	0	0	0	0.001984	0	4	114				
HCFC1	3054	broad.mit.edu	37	X	153236139	153236139	+	Silent	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:153236139G>T	ENST00000310441.7	-	1	1119	c.153C>A	c.(151-153)ggC>ggA	p.G51G	HCFC1_ENST00000354233.3_Silent_p.G51G|HCFC1_ENST00000369984.4_Silent_p.G51G|TMEM187_ENST00000369982.4_5'Flank|HCFC1-AS1_ENST00000438219.1_RNA	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	51					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TTCCCTCGTTGCCGCCGCCAA	0.662																																							uc004fjp.2		NA																	0				ovary(2)	2						c.(151-153)GGC>GGA		host cell factor 1							76.0	77.0	76.0					X																	153236139		2113	4182	6295	SO:0001819	synonymous_variant	3054				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chrX:153236139G>T		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.153C>A	X.37:g.153236139G>T			Somatic				TMEM187_uc004fjq.2_5'Flank	p.G51G	NM_005334	NP_005325	WXS	Illumina HiSeq	Unspecified	P51610	HCFC1_HUMAN			1	681	-	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		51			Kelch 1.		Q6P4G5	Silent	SNP	ENST00000310441.7	37	c.153C>A	CCDS44020.1																																																																																				0.662	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334		10	36	1	0	2.27111e-07	0.001368	2.86325e-07	10	36				
RPL10	6134	broad.mit.edu	37	X	153626816	153626816	+	Intron	SNP	G	G	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:153626816G>T	ENST00000369817.2	+	3	553				RPL10_ENST00000479366.1_Intron|RPL10_ENST00000406022.2_5'Flank|SNORA70_ENST00000384436.1_RNA|RPL10_ENST00000424325.2_Intron			P27635	RL10_HUMAN	ribosomal protein L10						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTTCCGTTCCGACTCTCTCTT	0.567																																							uc010nuv.1		NA																	0					NA						c.(46-48)TCG>TAG		Homo sapiens cDNA, FLJ97181.							187.0	193.0	191.0					X																	153626816		2203	4300	6503	SO:0001627	intron_variant	0							g.chrX:153626816G>T	AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.-23-22G>T	X.37:g.153626816G>T			Somatic				RPL10_uc004fkm.2_Intron|RPL10_uc004fko.2_Intron|RPL10_uc004fkn.1_5'UTR|RPL10_uc004fkp.1_5'Flank|RPL10_uc004fkq.1_5'Flank|RPL10_uc004fkr.1_5'Flank|SNORA70_uc010nux.1_5'Flank	p.S16*			WXS	Illumina HiSeq	Unspecified					1	363	-								A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Nonsense_Mutation	SNP	ENST00000369817.2	37	c.47C>A	CCDS14746.1																																																																																				0.567	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127774.5	NM_006013		50	317	1	0	9.72345e-25	0.00361	1.3361e-24	50	317				
F8	2157	broad.mit.edu	37	X	154157498	154157498	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chrX:154157498C>G	ENST00000360256.4	-	14	4767	c.4567G>C	c.(4567-4569)Gac>Cac	p.D1523H		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1523	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GGGAATAGGTCCTTCTGATAA	0.463																																							uc004fmt.2		NA																	0				ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(4567-4569)GAC>CAC		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						103.0	98.0	100.0					X																	154157498		2203	4299	6502	SO:0001583	missense	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154157498C>G	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4567G>C	X.37:g.154157498C>G	ENSP00000353393:p.Asp1523His		Somatic					p.D1523H	NM_000132	NP_000123	WXS	Illumina HiSeq	Unspecified	P00451	FA8_HUMAN			14	4738	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		1523			B.		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	c.4567G>C	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	c	6.802	0.516978	0.13005	.	.	ENSG00000185010	ENST00000360256	D	0.99270	-5.66	5.32	1.35	0.21983	.	0.673314	0.14162	N	0.337267	D	0.97321	0.9124	M	0.67953	2.075	0.09310	N	1	P	0.45283	0.855	B	0.39027	0.288	D	0.93709	0.7022	10	0.30078	T	0.28	-1.5523	3.4076	0.07347	0.1807:0.5226:0.0:0.2966	.	1523	P00451	FA8_HUMAN	H	1523	ENSP00000353393:D1523H	ENSP00000353393:D1523H	D	-	1	0	F8	153810692	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.148000	0.16224	0.130000	0.18549	-0.507000	0.04495	GAC		0.463	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			8	133	0	0	0	0.000978	0	8	133				
GNG12	55970	broad.mit.edu	37	1	68171150	68171151	+	Frame_Shift_Ins	INS	-	-	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:68171150_68171151insT	ENST00000370982.3	-	4	401_402	c.202_203insA	c.(202-204)actfs	p.T68fs		NM_018841.5	NP_061329.3	Q9UBI6	GBG12_HUMAN	guanine nucleotide binding protein (G protein), gamma 12	68					cellular response to glucagon stimulus (GO:0071377)|cerebral cortex development (GO:0021987)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			lung(3)	3						GATGATGCAAGTTTTTTTATCC	0.436																																							uc001dea.1		NA																	0					0						c.(202-204)ACTfs		G-protein gamma-12 subunit precursor																																				SO:0001589	frameshift_variant	55970				cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity	g.chr1:68171150_68171151insT	AF119663	CCDS30749.1	1p31.2	2008-02-05			ENSG00000172380	ENSG00000172380			19663	protein-coding gene	gene with protein product		615405				10819326	Standard	NM_018841		Approved		uc001dea.2	Q9UBI6	OTTHUMG00000009545	ENST00000370982.3:c.203dupA	1.37:g.68171157_68171157dupT	ENSP00000360021:p.Thr68fs		Somatic					p.T68fs	NM_018841	NP_061329	WXS	Illumina HiSeq	Unspecified	Q9UBI6	GBG12_HUMAN			4	394_395	-			68					Q69YP5|Q9BRV5	Frame_Shift_Ins	INS	ENST00000370982.3	37	c.202_203insA	CCDS30749.1																																																																																				0.436	GNG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026355.2			9	116	NA	NA	NA	NA	NA	9	116	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158617388	158617389	+	Frame_Shift_Ins	INS	-	-	T			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr1:158617388_158617389insT	ENST00000368147.4	-	27	4016_4017	c.3836_3837insA	c.(3835-3837)aagfs	p.K1279fs		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1279					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCTTACGATCCTTTGTACGCCC	0.55																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(3835-3837)AAGfs		spectrin, alpha, erythrocytic 1																																				SO:0001589	frameshift_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158617388_158617389insT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3837dupA	1.37:g.158617391_158617391dupT	ENSP00000357129:p.Lys1279fs		Somatic					p.K1279fs	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			27	4035_4036	-	all_hematologic(112;0.0378)		1279			Spectrin 12.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Frame_Shift_Ins	INS	ENST00000368147.4	37	c.3836_3837insA	CCDS41423.1																																																																																				0.550	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		10	125	NA	NA	NA	NA	NA	10	125	---	---	---	---
TRIM51	84767	broad.mit.edu	37	11	55658790	55658790	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr11:55658790delG	ENST00000449290.2	+	7	1133	c.1041delG	c.(1039-1041)atgfs	p.M347fs	TRIM51_ENST00000244891.3_Frame_Shift_Del_p.M204fs	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	347	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										AGGTTCATATGGGGGACTCTT	0.428																																							uc010rip.1		NA																	0					0						c.(1039-1041)ATGfs		SPRY domain containing 5							75.0	80.0	78.0					11																	55658790		2110	4067	6177	SO:0001589	frameshift_variant	84767					intracellular	zinc ion binding	g.chr11:55658790delG	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.1041delG	11.37:g.55658790delG	ENSP00000395086:p.Met347fs		Somatic				SPRYD5_uc010riq.1_Frame_Shift_Del_p.M204fs	p.M347fs	NM_032681	NP_116070	WXS	Illumina HiSeq	Unspecified	Q9BSJ1	SPRY5_HUMAN			7	1133	+		all_epithelial(135;0.226)	347			B30.2/SPRY.		A6NMG2	Frame_Shift_Del	DEL	ENST00000449290.2	37	c.1041delG																																																																																					0.428	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681		13	71	NA	NA	NA	NA	NA	13	71	---	---	---	---
TAOK1	57551	broad.mit.edu	37	17	27829728	27829728	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:27829728delG	ENST00000261716.3	+	13	1844	c.1325delG	c.(1324-1326)cggfs	p.R442fs	TAOK1_ENST00000536202.1_Frame_Shift_Del_p.R442fs	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	442					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			GCTACTATACGGACAGCATCA	0.388																																							uc002hdz.1		NA																	0				upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(1324-1326)CGGfs		TAO kinase 1							181.0	147.0	158.0					17																	27829728		2203	4300	6503	SO:0001589	frameshift_variant	57551				mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity	g.chr17:27829728delG	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.1325delG	17.37:g.27829728delG	ENSP00000261716:p.Arg442fs		Somatic				TAOK1_uc010wbe.1_Frame_Shift_Del_p.R442fs|TAOK1_uc010wbf.1_Frame_Shift_Del_p.R442fs|TAOK1_uc002heb.1_Frame_Shift_Del_p.R268fs	p.R442fs	NM_020791	NP_065842	WXS	Illumina HiSeq	Unspecified	Q7L7X3	TAOK1_HUMAN	Colorectal(6;0.198)		13	1519	+			442					A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Frame_Shift_Del	DEL	ENST00000261716.3	37	c.1325delG	CCDS32601.1																																																																																				0.388	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791		7	169	NA	NA	NA	NA	NA	7	169	---	---	---	---
NF1	4763	broad.mit.edu	37	17	29527502	29527503	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr17:29527502_29527503delAG	ENST00000358273.4	+	9	1334_1335	c.951_952delAG	c.(949-954)acagaafs	p.E318fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.E318fs|NF1_ENST00000431387.4_Frame_Shift_Del_p.E318fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	318					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GGCAGCTGACAGAAAGTGCTGC	0.396			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		14	Whole gene deletion(8)|Unknown(6)	p.?(2)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(949-954)ACAGAAfs		neurofibromin isoform 1																																				SO:0001589	frameshift_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29527502_29527503delAG		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.951_952delAG	17.37:g.29527502_29527503delAG	ENSP00000351015:p.Glu318fs	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hge.1_Frame_Shift_Del_p.T317fs|NF1_uc002hgf.1_Frame_Shift_Del_p.T317fs|NF1_uc002hgh.2_Frame_Shift_Del_p.T317fs|NF1_uc010csn.1_Frame_Shift_Del_p.T177fs	p.T317fs	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	9	1284_1285	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	317_318					O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	c.951_952delAG	CCDS42292.1																																																																																				0.396	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		7	100	NA	NA	NA	NA	NA	7	100	---	---	---	---
HAMP	57817	broad.mit.edu	37	19	35773520	35773522	+	In_Frame_Del	DEL	CTC	CTC	-	rs373178250		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	CTC	CTC	-	-	CTC	CTC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr19:35773520_35773522delCTC	ENST00000598398.1	+	2	336_338	c.40_42delCTC	c.(40-42)ctcdel	p.L18del	HAMP_ENST00000222304.3_In_Frame_Del_p.L18del	NM_021175.2	NP_066998.1	P81172	HEPC_HUMAN	hepcidin antimicrobial peptide	18					cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|immune response (GO:0006955)|killing of cells of other organism (GO:0031640)	apical cortex (GO:0045179)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TTGCCTCCTGCTCCTCCTCCTCC	0.64																																							uc002nyw.2		NA																	0				central_nervous_system(1)	1						c.(40-42)CTCdel		hepcidin antimicrobial peptide preproprotein																																				SO:0001651	inframe_deletion	57817				defense response to bacterium|defense response to fungus|immune response|killing of cells of other organism	extracellular region	hormone activity	g.chr19:35773520_35773522delCTC	AF309489	CCDS12454.1	19q13.1	2014-09-17				ENSG00000105697			15598	protein-coding gene	gene with protein product		606464				11034317, 11113132	Standard	NM_021175		Approved	LEAP-1, HEPC, HFE2B, LEAP1	uc002nyw.3	P81172		ENST00000598398.1:c.40_42delCTC	19.37:g.35773529_35773531delCTC	ENSP00000471894:p.Leu18del		Somatic					p.L18del	NM_021175	NP_066998	WXS	Illumina HiSeq	Unspecified	P81172	HEPC_HUMAN	Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)		1	111_113	+	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		18					Q1HE14|Q9BY68	In_Frame_Del	DEL	ENST00000598398.1	37	c.40_42delCTC	CCDS12454.1																																																																																				0.640	HAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466067.1	NM_021175		10	223	NA	NA	NA	NA	NA	10	223	---	---	---	---
RGPD3	653489	broad.mit.edu	37	2	107049632	107049633	+	Frame_Shift_Ins	INS	-	-	A			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:107049632_107049633insA	ENST00000409886.3	-	16	2401_2402	c.2314_2315insT	c.(2314-2316)gcgfs	p.A772fs	RGPD3_ENST00000304514.7_Frame_Shift_Ins_p.A772fs	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	772					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTCTGAATCCGCATTTCGCAAA	0.376																																							uc010ywi.1		NA																	0				ovary(1)	1						c.(2314-2316)GCGfs		RANBP2-like and GRIP domain containing 3																																				SO:0001589	frameshift_variant	653489				intracellular transport		binding	g.chr2:107049632_107049633insA		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2314_2315insT	2.37:g.107049632_107049633insA	ENSP00000386588:p.Ala772fs		Somatic					p.A772fs	NM_001144013	NP_001137485	WXS	Illumina HiSeq	Unspecified	A6NKT7	RGPD3_HUMAN			16	2371_2372	-			772					B8ZZM4	Frame_Shift_Ins	INS	ENST00000409886.3	37	c.2314_2315insT	CCDS46379.1																																																																																				0.376	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931		9	146	NA	NA	NA	NA	NA	9	146	---	---	---	---
SCN2A	6326	broad.mit.edu	37	2	166245178	166245178	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr2:166245178delC	ENST00000375437.2	+	27	5152	c.4862delC	c.(4861-4863)tccfs	p.S1621fs	SCN2A_ENST00000375427.2_Frame_Shift_Del_p.S1621fs|SCN2A_ENST00000357398.3_Frame_Shift_Del_p.S1621fs|SCN2A_ENST00000283256.6_Frame_Shift_Del_p.S1621fs	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1621					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TATTTTGTGTCCCCTACCCTG	0.408																																							uc002udc.2		NA																	0				ovary(6)|breast(1)|pancreas(1)	8						c.(4861-4863)TCCfs		sodium channel, voltage-gated, type II, alpha	Lamotrigine(DB00555)						98.0	100.0	100.0					2																	166245178		2203	4300	6503	SO:0001589	frameshift_variant	6326				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166245178delC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4862delC	2.37:g.166245178delC	ENSP00000364586:p.Ser1621fs		Somatic				SCN2A_uc002udd.2_Frame_Shift_Del_p.S1621fs|SCN2A_uc002ude.2_Frame_Shift_Del_p.S1621fs	p.S1621fs	NM_001040142	NP_001035232	WXS	Illumina HiSeq	Unspecified	Q99250	SCN2A_HUMAN			27	5152	+			1621			IV.		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Frame_Shift_Del	DEL	ENST00000375437.2	37	c.4862delC	CCDS33314.1																																																																																				0.408	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007		14	173	NA	NA	NA	NA	NA	14	173	---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69000005	69000006	+	Frame_Shift_Ins	INS	-	-	A	rs561299451		TCGA-55-7724-01A-11D-2167-08	TCGA-55-7724-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7bf4a4b3-afb8-4494-b749-7138b223fc6f	b725ffd9-431b-4d0b-8752-5f2a7bb9e8b2	g.chr8:69000005_69000006insA	ENST00000288368.4	+	19	2351_2352	c.2074_2075insA	c.(2074-2076)cggfs	p.R692fs	RP11-403D15.2_ENST00000526901.1_RNA|PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	692	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.R692L(2)|p.R692Q(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CTTCCAGATCCGGGGATTTGGC	0.455																																							uc003xxv.1		NA																	4	Substitution - Missense(4)		lung(2)|endometrium(2)	skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.(2074-2076)CGGfs		DEP domain containing 2 isoform a																																				SO:0001589	frameshift_variant	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:69000005_69000006insA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	Exception_encountered	8.37:g.69000005_69000006insA	ENSP00000288368:p.Arg692fs		Somatic				PREX2_uc003xxu.1_Frame_Shift_Ins_p.R692fs|PREX2_uc011lez.1_Frame_Shift_Ins_p.R627fs	p.R692fs	NM_024870	NP_079146	WXS	Illumina HiSeq	Unspecified	Q70Z35	PREX2_HUMAN			19	2101_2102	+			692			PDZ 2.		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Frame_Shift_Ins	INS	ENST00000288368.4	37	c.2074_2075insA	CCDS6201.1																																																																																				0.455	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170		20	256	NA	NA	NA	NA	NA	20	256	---	---	---	---
