#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
FAF1	11124	broad.mit.edu	37	1	51253830	51253830	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:51253830C>G	ENST00000396153.2	-	4	660	c.209G>C	c.(208-210)aGt>aCt	p.S70T	FAF1_ENST00000371778.4_Missense_Mutation_p.S70T	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	70					apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.0?(3)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		AGCTGGATGACTTGCTGGATT	0.423																																							uc009vyx.1		NA																	3	Whole gene deletion(3)		thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	ovary(1)|pancreas(1)	2						c.(208-210)AGT>ACT		FAS-associated factor 1							94.0	88.0	90.0					1																	51253830		2203	4300	6503	SO:0001583	missense	11124				apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity	g.chr1:51253830C>G	AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.209G>C	1.37:g.51253830C>G	ENSP00000379457:p.Ser70Thr		Somatic				FAF1_uc009vyw.1_RNA|FAF1_uc001cse.1_Missense_Mutation_p.S70T	p.S70T	NM_007051	NP_008982	WXS	Illumina HiSeq	Unspecified	Q9UNN5	FAF1_HUMAN		GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)	5	272	-			70					Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Missense_Mutation	SNP	ENST00000396153.2	37	c.209G>C	CCDS554.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525273	0.27299	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000371780;ENST00000543607	.	.	.	5.96	2.83	0.33086	.	0.232438	0.50627	D	0.000109	T	0.41096	0.1144	L	0.29908	0.895	0.80722	D	1	B	0.20368	0.044	B	0.19148	0.024	T	0.18023	-1.0350	9	0.32370	T	0.25	-17.0404	8.4159	0.32670	0.0:0.7291:0.1254:0.1455	.	70	Q9UNN5	FAF1_HUMAN	T	70;70;62;70	.	ENSP00000360843:S70T	S	-	2	0	FAF1	51026418	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	1.288000	0.33296	0.793000	0.33875	-0.345000	0.07892	AGT		0.423	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021807.1	NM_007051		10	35	0	0	0	0.010729	0	10	35				
USP33	23032	broad.mit.edu	37	1	78189060	78189060	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:78189060C>G	ENST00000370793.1	-	13	1784	c.1438G>C	c.(1438-1440)Gat>Cat	p.D480H	USP33_ENST00000370794.3_Missense_Mutation_p.D449H|USP33_ENST00000357428.1_Missense_Mutation_p.D480H|USP33_ENST00000370792.3_Missense_Mutation_p.D480H	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	480	USP.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						ATTGTTCCATCAAATATGTCT	0.323																																					Melanoma(152;72 1870 11110 26780 42647)	Melanoma(152;72 1870 11110 26780 42647)	uc001dht.2		NA																	0				lung(2)|ovary(1)	3						c.(1438-1440)GAT>CAT		ubiquitin specific protease 33 isoform 1							163.0	143.0	150.0					1																	78189060		2203	4299	6502	SO:0001583	missense	23032				axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr1:78189060C>G	AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.1438G>C	1.37:g.78189060C>G	ENSP00000359829:p.Asp480His		Somatic				USP33_uc001dhs.2_Missense_Mutation_p.D201H|USP33_uc001dhu.2_Missense_Mutation_p.D449H|USP33_uc001dhv.2_Missense_Mutation_p.D285H|USP33_uc001dhw.2_Missense_Mutation_p.D480H	p.D480H	NM_015017	NP_055832	WXS	Illumina HiSeq	Unspecified	Q8TEY7	UBP33_HUMAN			13	1785	-			480					Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	ENST00000370793.1	37	c.1438G>C	CCDS678.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.7|25.7	4.663262|4.663262	0.88251|0.88251	.|.	.|.	ENSG00000077254|ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428;ENST00000370792|ENST00000481579	T;T;T;T|.	0.31510|.	1.49;1.49;1.49;1.49|.	5.17|5.17	5.17|5.17	0.71159|0.71159	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.49098|0.49098	0.1537|0.1537	L|L	0.33189|0.33189	0.99|0.99	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.998;0.999|.	T|T	0.41840|0.41840	-0.9486|-0.9486	10|5	0.72032|.	D|.	0.01|.	.|.	19.0447|19.0447	0.93015|0.93015	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	480;449;480|.	Q8TEY7-3;Q8TEY7-2;Q8TEY7|.	.;.;UBP33_HUMAN|.	H|F	449;480;480;480|84	ENSP00000359830:D449H;ENSP00000359829:D480H;ENSP00000350009:D480H;ENSP00000359828:D480H|.	ENSP00000350009:D480H|.	D|L	-|-	1|3	0|2	USP33|USP33	77961648|77961648	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.487000|7.487000	0.81328|0.81328	2.582000|2.582000	0.87167|0.87167	0.655000|0.655000	0.94253|0.94253	GAT|TTG		0.323	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017		14	40	0	0	0	0.028581	0	14	40				
LRIG2	9860	broad.mit.edu	37	1	113637318	113637318	+	Silent	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:113637318G>C	ENST00000361127.5	+	6	942	c.744G>C	c.(742-744)cgG>cgC	p.R248R		NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	248					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		AAATGCAGCGGAATGGAATTA	0.358																																							uc001edf.1		NA																	0				ovary(3)	3						c.(742-744)CGG>CGC		leucine-rich repeats and immunoglobulin-like							131.0	136.0	134.0					1																	113637318		2203	4300	6503	SO:0001819	synonymous_variant	9860					cytoplasm|integral to membrane|plasma membrane		g.chr1:113637318G>C	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.744G>C	1.37:g.113637318G>C			Somatic				LRIG2_uc009wgn.1_Silent_p.R145R	p.R248R	NM_014813	NP_055628	WXS	Illumina HiSeq	Unspecified	O94898	LRIG2_HUMAN		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)	6	942	+	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)	248			LRR 8.|Extracellular (Potential).		Q9NSN2	Silent	SNP	ENST00000361127.5	37	c.744G>C	CCDS30808.1																																																																																				0.358	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813		15	92	0	0	0	0.024245	0	15	92				
SMG5	23381	broad.mit.edu	37	1	156235927	156235927	+	Silent	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:156235927A>G	ENST00000361813.5	-	12	1644	c.1500T>C	c.(1498-1500)agT>agC	p.S500S	SMG5_ENST00000489907.2_Intron|SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	500					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CACCTTCAAGACTCTTGTCAG	0.532																																							uc001foc.3		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(1498-1500)AGT>AGC		SMG5 homolog nonsense mediated mRNA decay							84.0	82.0	83.0					1																	156235927		2203	4300	6503	SO:0001819	synonymous_variant	23381				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding	g.chr1:156235927A>G	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.1500T>C	1.37:g.156235927A>G			Somatic				SMG5_uc009wrv.2_5'UTR	p.S500S	NM_015327	NP_056142	WXS	Illumina HiSeq	Unspecified	Q9UPR3	SMG5_HUMAN			12	1649	-	Hepatocellular(266;0.158)		500					D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Silent	SNP	ENST00000361813.5	37	c.1500T>C	CCDS1137.1																																																																																				0.532	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327		16	98	0	0	0	0.010504	0	16	98				
KLHL20	27252	broad.mit.edu	37	1	173720961	173720961	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:173720961C>G	ENST00000209884.4	+	4	792	c.656C>G	c.(655-657)tCc>tGc	p.S219C	KLHL20_ENST00000546011.1_Missense_Mutation_p.S30C	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	219	BACK.				cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						GATATAATATCCAGTGATGAG	0.403																																					GBM(159;862 2695 6559 23041)	GBM(159;862 2695 6559 23041)	uc001gjc.2		NA																	0				ovary(1)	1						c.(655-657)TCC>TGC		kelch-like 20							96.0	85.0	89.0					1																	173720961		2203	4300	6503	SO:0001583	missense	27252				cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity	g.chr1:173720961C>G	AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.656C>G	1.37:g.173720961C>G	ENSP00000209884:p.Ser219Cys		Somatic				KLHL20_uc010pmr.1_Missense_Mutation_p.S30C|KLHL20_uc009wwf.2_Missense_Mutation_p.S201C	p.S219C	NM_014458	NP_055273	WXS	Illumina HiSeq	Unspecified	Q9Y2M5	KLH20_HUMAN			4	835	+			219			BACK.		B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	ENST00000209884.4	37	c.656C>G	CCDS1310.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889756	0.52014	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	T;T	0.71817	-0.6;-0.6	5.38	5.38	0.77491	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.66848	0.2831	M	0.83774	2.66	0.80722	D	1	B;B	0.26708	0.076;0.157	B;B	0.28139	0.06;0.086	T	0.68591	-0.5368	10	0.42905	T	0.14	.	17.892	0.88875	0.0:1.0:0.0:0.0	.	30;219	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	C	30;219	ENSP00000443121:S30C;ENSP00000209884:S219C	ENSP00000209884:S219C	S	+	2	0	KLHL20	171987584	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.464000	0.80887	2.490000	0.84030	0.591000	0.81541	TCC		0.403	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458		8	31	0	0	0	0.006214	0	8	31				
HMCN1	83872	broad.mit.edu	37	1	186120395	186120395	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:186120395C>T	ENST00000271588.4	+	94	14901	c.14672C>T	c.(14671-14673)gCt>gTt	p.A4891V	HMCN1_ENST00000367492.2_Missense_Mutation_p.A4891V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4891	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTTGGAATTGCTTTCCTTAAT	0.398																																							uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(14671-14673)GCT>GTT		hemicentin 1 precursor							141.0	141.0	141.0					1																	186120395		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186120395C>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14672C>T	1.37:g.186120395C>T	ENSP00000271588:p.Ala4891Val		Somatic				HMCN1_uc001grs.1_Missense_Mutation_p.A460V	p.A4891V	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			94	14901	+			4891			Nidogen G2 beta-barrel.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.14672C>T	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	32	5.140427	0.94560	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.23754	1.89;1.89	5.13	5.13	0.70059	G2 nidogen/fibulin G2F (2);Green fluorescent protein-like (1);	0.051861	0.85682	D	0.000000	T	0.52549	0.1741	M	0.75777	2.31	0.58432	D	0.999997	D	0.71674	0.998	D	0.68943	0.961	T	0.57323	-0.7831	10	0.72032	D	0.01	.	18.5888	0.91200	0.0:1.0:0.0:0.0	.	4891	Q96RW7	HMCN1_HUMAN	V	4891	ENSP00000271588:A4891V;ENSP00000356462:A4891V	ENSP00000271588:A4891V	A	+	2	0	HMCN1	184387018	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.784000	0.68990	2.373000	0.80994	0.655000	0.94253	GCT		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		16	81	0	0	0	0.028581	0	16	81				
ADIPOR1	51094	broad.mit.edu	37	1	202912932	202912932	+	Silent	SNP	C	C	T	rs145759019	byFrequency	TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:202912932C>T	ENST00000340990.5	-	6	1057	c.759G>A	c.(757-759)gcG>gcA	p.A253A	ADIPOR1_ENST00000436244.1_Silent_p.A253A|ADIPOR1_ENST00000367254.3_Missense_Mutation_p.A164T	NM_015999.4	NP_057083.2	Q96A54	ADR1_HUMAN	adiponectin receptor 1	253					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|hormone-mediated signaling pathway (GO:0009755)|leptin-mediated signaling pathway (GO:0033210)|negative regulation of cell growth (GO:0030308)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of JAK-STAT cascade (GO:0046427)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(75;0.141)			GGTCCCACTGCGCCACAATGA	0.537													c|||	3	0.000599042	0.0	0.0	5008	,	,		18884	0.003		0.0	False		,,,				2504	0.0						uc001gyq.3		NA																	0					0						c.(757-759)GCG>GCA		adiponectin receptor 1		A	,	1,4405	2.1+/-5.4	0,1,2202	81.0	68.0	73.0		759,759	-4.7	1.0	1	dbSNP_134	73	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	ADIPOR1	NM_001127687.1,NM_015999.3	,	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	,	253/376,253/376	202912932	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	51094				fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane|plasma membrane	hormone binding|protein kinase binding|receptor activity	g.chr1:202912932C>T		CCDS1430.1	1q32.1	2012-08-22			ENSG00000159346	ENSG00000159346		"""GPCR / Unclassified : Adiponectin receptors"""	24040	protein-coding gene	gene with protein product		607945				12802337	Standard	XM_006711360		Approved	PAQR1, ACDCR1	uc001gyq.5	Q96A54	OTTHUMG00000041391	ENST00000340990.5:c.759G>A	1.37:g.202912932C>T			Somatic				ADIPOR1_uc010pqd.1_Silent_p.A177A|ADIPOR1_uc001gyr.3_Silent_p.A52A|ADIPOR1_uc001gys.3_Silent_p.A253A	p.A253A	NM_015999	NP_057083	WXS	Illumina HiSeq	Unspecified	Q96A54	ADR1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.141)		6	1026	-			253			Helical; Name=4; (Potential).		B3KMB0|Q53HS7|Q53YY6|Q9Y360	Silent	SNP	ENST00000340990.5	37	c.759G>A	CCDS1430.1	.	.	.	.	.	.	.	.	.	.	c	16.48	3.136319	0.56936	2.27E-4	2.33E-4	ENSG00000159346	ENST00000367254	T	0.43294	0.95	5.99	-4.66	0.03329	.	0.045225	0.85682	D	0.000000	T	0.26268	0.0641	.	.	.	0.21553	N	0.999644	.	.	.	.	.	.	T	0.18335	-1.0340	7	0.52906	T	0.07	.	0.0726	0.00024	0.262:0.1998:0.2256:0.3126	.	.	.	.	T	164	ENSP00000356223:A164T	ENSP00000356223:A164T	A	-	1	0	ADIPOR1	201179555	0.001000	0.12720	0.969000	0.41365	0.968000	0.65278	-1.558000	0.02164	-0.611000	0.05709	-1.096000	0.02151	GCA		0.537	ADIPOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099160.2	NM_015999		9	51	0	0	0	0.013537	0	9	51				
NFASC	23114	broad.mit.edu	37	1	204944417	204944417	+	Missense_Mutation	SNP	G	G	A	rs184503324	byFrequency	TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:204944417G>A	ENST00000401399.1	+	14	1776	c.1577G>A	c.(1576-1578)cGg>cAg	p.R526Q	NFASC_ENST00000339876.6_Missense_Mutation_p.R526Q|NFASC_ENST00000338586.6_Missense_Mutation_p.R526Q|NFASC_ENST00000338515.6_Missense_Mutation_p.R526Q|NFASC_ENST00000367170.4_Missense_Mutation_p.R526Q|NFASC_ENST00000367169.4_Missense_Mutation_p.R526Q|NFASC_ENST00000539706.1_Missense_Mutation_p.R537Q|NFASC_ENST00000404907.1_Missense_Mutation_p.R537Q|NFASC_ENST00000404076.1_Missense_Mutation_p.R520Q|NFASC_ENST00000513543.1_Missense_Mutation_p.R537Q|NFASC_ENST00000360049.4_Missense_Mutation_p.R537Q|NFASC_ENST00000367171.4_Missense_Mutation_p.R526Q|NFASC_ENST00000367172.4_Missense_Mutation_p.R526Q|NFASC_ENST00000403080.1_Missense_Mutation_p.R526Q			O94856	NFASC_HUMAN	neurofascin	526	Ig-like C2-type 6.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGGATCTACCGGATGCCCGAG	0.632											OREG0014142	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	3	0.000599042	0.0	0.0014	5008	,	,		16704	0.0		0.001	False		,,,				2504	0.001						uc001hbj.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(1576-1578)CGG>CAG		neurofascin isoform 1 precursor		G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	80.0	78.0	79.0		1577,1577,1610,1610,1559,1610	3.3	1.0	1		79	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense,missense,missense,missense	NFASC	NM_001005388.2,NM_001005389.1,NM_001160331.1,NM_001160332.1,NM_001160333.1,NM_015090.3	43,43,43,43,43,43	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	526/1241,526/620,537/1190,537/1175,520/614,537/1170	204944417	3,13003	2203	4300	6503	SO:0001583	missense	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204944417G>A	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1577G>A	1.37:g.204944417G>A	ENSP00000385637:p.Arg526Gln		Somatic	OREG0014142	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2148	NFASC_uc001hbh.2_Missense_Mutation_p.R526Q|NFASC_uc010pqz.1_Missense_Mutation_p.R520Q|NFASC_uc010pra.1_Missense_Mutation_p.R537Q|NFASC_uc001hbi.2_Missense_Mutation_p.R537Q|NFASC_uc010prb.1_Missense_Mutation_p.R537Q|NFASC_uc010prc.1_Missense_Mutation_p.R93Q|NFASC_uc001hbk.1_Missense_Mutation_p.R347Q	p.R526Q	NM_001005388	NP_001005388	WXS	Illumina HiSeq	Unspecified	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		15	1905	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		526			Extracellular (Potential).|Ig-like C2-type 6.		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	c.1577G>A	CCDS53460.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	1|1	0.0027624309392265192|0.0027624309392265192	0|0	0.0|0.0	0|0	0.0|0.0	G|G	15.28|15.28	2.785859|2.785859	0.49997|0.49997	0.0|0.0	3.49E-4|3.49E-4	ENSG00000163531|ENSG00000163531	ENST00000367173|ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.64260	.|-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.23|5.23	3.34|3.34	0.38264|0.38264	.|Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.137172	.|0.32161	.|N	.|0.006492	T|T	0.41789|0.41789	0.1174|0.1174	L|L	0.31664|0.31664	0.95|0.95	0.35940|0.35940	D|D	0.83317|0.83317	.|B;B;B;B;B;B;B	.|0.29115	.|0.022;0.001;0.059;0.049;0.233;0.059;0.085	.|B;B;B;B;B;B;B	.|0.21917	.|0.02;0.003;0.008;0.037;0.009;0.018;0.022	T|T	0.40079|0.40079	-0.9582|-0.9582	5|10	.|0.12766	.|T	.|0.61	.|.	8.0045|8.0045	0.30317|0.30317	0.2509:0.0:0.7491:0.0|0.2509:0.0:0.7491:0.0	.|.	.|526;537;537;526;526;537;526	.|O94856;O94856-11;O94856-8;F8W791;O94856-9;O94856-3;O94856-2	.|NFASC_HUMAN;.;.;.;.;.;.	R|Q	496|526;526;526;526;526;526;537;537;537;526;526;520;526;537;537;513	.|ENSP00000356140:R526Q;ENSP00000356139:R526Q;ENSP00000356138:R526Q;ENSP00000342128:R526Q;ENSP00000344786:R526Q;ENSP00000343509:R526Q;ENSP00000438614:R537Q;ENSP00000353154:R537Q;ENSP00000356137:R526Q;ENSP00000384875:R526Q;ENSP00000385676:R520Q;ENSP00000385637:R526Q;ENSP00000384061:R537Q;ENSP00000425908:R537Q;ENSP00000415031:R513Q	.|ENSP00000295776:R537Q	G|R	+|+	1|2	0|0	NFASC|NFASC	203211040|203211040	0.940000|0.940000	0.31905|0.31905	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	1.480000|1.480000	0.35464|0.35464	1.185000|1.185000	0.42971|0.42971	0.561000|0.561000	0.74099|0.74099	GGA|CGG		0.632	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		12	75	0	0	0	0.010729	0	12	75				
TARBP1	6894	broad.mit.edu	37	1	234566017	234566017	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:234566017C>G	ENST00000040877.1	-	15	2424	c.2425G>C	c.(2425-2427)Gta>Cta	p.V809L		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	809					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			ATGCTCACTACTCTCTGAATC	0.483																																							uc001hwd.2		NA																	0				ovary(2)|skin(1)	3						c.(2425-2427)GTA>CTA		TAR RNA binding protein 1							71.0	67.0	69.0					1																	234566017		2203	4300	6503	SO:0001583	missense	6894				regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity	g.chr1:234566017C>G		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.2425G>C	1.37:g.234566017C>G	ENSP00000040877:p.Val809Leu		Somatic					p.V809L	NM_005646	NP_005637	WXS	Illumina HiSeq	Unspecified	Q13395	TARB1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000263)		15	2425	-	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	809					Q9H581	Missense_Mutation	SNP	ENST00000040877.1	37	c.2425G>C	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.893055	0.33442	.	.	ENSG00000059588	ENST00000040877	T	0.06849	3.25	5.26	4.35	0.52113	.	0.222205	0.39759	N	0.001264	T	0.10121	0.0248	L	0.53249	1.67	0.34124	D	0.664478	B	0.24483	0.104	B	0.25140	0.058	T	0.10847	-1.0612	10	0.10636	T	0.68	-13.4894	15.8562	0.78979	0.0:0.8635:0.1365:0.0	.	809	Q13395	TARB1_HUMAN	L	809	ENSP00000040877:V809L	ENSP00000040877:V809L	V	-	1	0	TARBP1	232632640	0.866000	0.29940	0.177000	0.23020	0.807000	0.45602	4.407000	0.59754	1.331000	0.45412	0.655000	0.94253	GTA		0.483	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646		9	44	0	0	0	0.010729	0	9	44				
ANKRD30A	91074	broad.mit.edu	37	10	37431192	37431192	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr10:37431192A>T	ENST00000602533.1	+	7	1298	c.1199A>T	c.(1198-1200)gAa>gTa	p.E400V	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.E400V|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.E400V			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	456					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CCTACAAAAGAATCATCTACA	0.378																																							uc001iza.1		NA																	0				ovary(7)|breast(1)|skin(1)	9						c.(1198-1200)GAA>GTA		ankyrin repeat domain 30A							53.0	50.0	51.0					10																	37431192		1878	4118	5996	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37431192A>T	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1199A>T	10.37:g.37431192A>T	ENSP00000473551:p.Glu400Val		Somatic					p.E400V	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			7	1298	+			456					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.1199A>T		.	.	.	.	.	.	.	.	.	.	.	8.529	0.870471	0.17322	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.08807	3.05;3.05	0.509	-0.985	0.10256	.	.	.	.	.	T	0.16171	0.0389	L	0.46157	1.445	0.09310	N	1	D	0.57899	0.981	D	0.67231	0.95	T	0.13818	-1.0495	8	0.62326	D	0.03	.	.	.	.	.	456	Q9BXX3	AN30A_HUMAN	V	400	ENSP00000354432:E400V;ENSP00000363792:E400V	ENSP00000354432:E400V	E	+	2	0	ANKRD30A	37471198	0.001000	0.12720	0.002000	0.10522	0.004000	0.04260	0.248000	0.18198	-0.328000	0.08539	0.113000	0.15668	GAA		0.378	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		4	20	0	0	0	0.021553	0	4	20				
GFRA1	2674	broad.mit.edu	37	10	117884826	117884826	+	Nonsense_Mutation	SNP	G	G	A	rs191814086		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr10:117884826G>A	ENST00000355422.6	-	6	1226	c.676C>T	c.(676-678)Cga>Tga	p.R226*	GFRA1_ENST00000439649.3_Nonsense_Mutation_p.R221*|GFRA1_ENST00000369236.1_Nonsense_Mutation_p.R221*|GFRA1_ENST00000544592.1_Nonsense_Mutation_p.R105*	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	226					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		ATGGTCTGTCGCCTCCGCTCT	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19265	0.0		0.0	False		,,,				2504	0.0				Ovarian(128;329 1725 45498 46808 50759)	Ovarian(128;329 1725 45498 46808 50759)	uc001lcj.2		NA																	0				ovary(1)|pancreas(1)	2						c.(676-678)CGA>TGA		GDNF family receptor alpha 1 isoform a							80.0	68.0	72.0					10																	117884826		2203	4300	6503	SO:0001587	stop_gained	2674				axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity	g.chr10:117884826G>A	AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.676C>T	10.37:g.117884826G>A	ENSP00000347591:p.Arg226*		Somatic				GFRA1_uc001lci.2_Nonsense_Mutation_p.R221*|GFRA1_uc009xyr.2_Nonsense_Mutation_p.R221*	p.R226*	NM_005264	NP_005255	WXS	Illumina HiSeq	Unspecified	P56159	GFRA1_HUMAN		all cancers(201;0.0337)	6	1374	-		Lung NSC(174;0.21)	226			2.		A8KA21|O15507|O43912	Nonsense_Mutation	SNP	ENST00000355422.6	37	c.676C>T	CCDS44481.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	45	11.765170	0.99600	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.5798	19.9522	0.97203	0.0:0.0:1.0:0.0	.	.	.	.	X	226;221;221;105;221	.	ENSP00000347591:R221X	R	-	1	2	GFRA1	117874816	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.997000	0.88414	2.725000	0.93324	0.655000	0.94253	CGA		0.562	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793		9	44	0	0	0	0.004482	0	9	44				
DMBT1	1755	broad.mit.edu	37	10	124402690	124402690	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr10:124402690G>T	ENST00000338354.3	+	53	7124	c.7018G>T	c.(7018-7020)Gcc>Tcc	p.A2340S	DMBT1_ENST00000330163.4_Missense_Mutation_p.A1712S|DMBT1_ENST00000368909.3_Missense_Mutation_p.A2340S|DMBT1_ENST00000368956.2_Missense_Mutation_p.A1712S|DMBT1_ENST00000359586.6_Missense_Mutation_p.A1060S|DMBT1_ENST00000344338.3_Missense_Mutation_p.A2330S|DMBT1_ENST00000368955.3_Missense_Mutation_p.A2330S			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2340	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCTTCGCATTGCCCGCTTCCG	0.577																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	0				central_nervous_system(7)	7						c.(7018-7020)GCC>TCC		deleted in malignant brain tumors 1 isoform b							121.0	132.0	128.0					10																	124402690		2088	4213	6301	SO:0001583	missense	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124402690G>T		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.7018G>T	10.37:g.124402690G>T	ENSP00000342210:p.Ala2340Ser		Somatic				DMBT1_uc001lgl.1_Missense_Mutation_p.A2330S|DMBT1_uc001lgm.1_Missense_Mutation_p.A1712S|DMBT1_uc009xzz.1_Missense_Mutation_p.A2339S|DMBT1_uc010qtx.1_Missense_Mutation_p.A1060S|DMBT1_uc009yab.1_Missense_Mutation_p.A1043S|DMBT1_uc009yac.1_Missense_Mutation_p.A634S	p.A2340S	NM_007329	NP_015568	WXS	Illumina HiSeq	Unspecified	Q9UGM3	DMBT1_HUMAN			53	7124	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	2340			ZP.		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.7018G>T		.	.	.	.	.	.	.	.	.	.	G	15.40	2.821795	0.50633	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	D;D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.28	-1.03	0.10102	Zona pellucida sperm-binding protein (3);	1.447470	0.05327	N	0.527629	T	0.75975	0.3923	L	0.53561	1.675	0.09310	N	1	B;P;B;B;B;B;B	0.46220	0.225;0.874;0.091;0.091;0.091;0.091;0.111	B;B;B;B;B;B;B	0.40375	0.07;0.327;0.07;0.07;0.07;0.07;0.116	T	0.64141	-0.6477	10	0.52906	T	0.07	.	1.9122	0.03290	0.2606:0.2211:0.4046:0.1136	.	1060;2320;1589;2469;1712;2330;2340	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	S	2340;2469;2340;2340;2340;2339;1712;2330;1712;1712;2340;2330;1712;486;1060	ENSP00000342210:A2340S;ENSP00000343175:A2330S;ENSP00000327747:A1712S;ENSP00000357905:A2340S;ENSP00000357951:A2330S;ENSP00000357952:A1712S;ENSP00000352593:A1060S	ENSP00000331522:A1712S	A	+	1	0	DMBT1	124392680	0.011000	0.17503	0.003000	0.11579	0.016000	0.09150	0.610000	0.24253	-0.238000	0.09724	0.655000	0.94253	GCC		0.577	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		21	71	1	0	1.96292e-10	0.010504	2.15166e-10	21	71				
NUP98	4928	broad.mit.edu	37	11	3800193	3800193	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:3800193T>C	ENST00000324932.7	-	4	685	c.265A>G	c.(265-267)Aat>Gat	p.N89D	RNU7-50P_ENST00000459175.1_RNA|NUP98_ENST00000397007.4_Missense_Mutation_p.N89D|NUP98_ENST00000355260.3_Missense_Mutation_p.N89D|NUP98_ENST00000397004.4_Missense_Mutation_p.N89D|NUP98_ENST00000359171.4_Missense_Mutation_p.N89D	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	89	FG repeats 1.|Gly/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AACAAGGTATTTGCTGTTCCT	0.478			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																		uc001lyh.2		NA		Dom	yes		11	11p15	4928	T	nucleoporin 98kDa			L	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11		AML		0				breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12						c.(265-267)AAT>GAT		nucleoporin 98kD isoform 1							163.0	147.0	152.0					11																	3800193		2201	4298	6499	SO:0001583	missense	4928				carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity	g.chr11:3800193T>C	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.265A>G	11.37:g.3800193T>C	ENSP00000316032:p.Asn89Asp		Somatic				NUP98_uc001lyi.2_Missense_Mutation_p.N89D|NUP98_uc001lyj.1_Missense_Mutation_p.N89D|NUP98_uc001lyk.1_Missense_Mutation_p.N89D|NUP98_uc010qxv.1_Intron	p.N89D	NM_016320	NP_057404	WXS	Illumina HiSeq	Unspecified	P52948	NUP98_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)	4	556	-		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)	89			Gly/Thr-rich.		Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	37	c.265A>G	CCDS7746.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.253059	0.80135	.	.	ENSG00000110713	ENST00000324932;ENST00000359171;ENST00000355260;ENST00000397004;ENST00000397007	.	.	.	5.73	5.73	0.89815	.	0.227351	0.44483	D	0.000448	T	0.63141	0.2486	M	0.62723	1.935	0.36696	D	0.879846	P;B;D;P	0.53745	0.763;0.403;0.962;0.9	B;B;P;B	0.49276	0.229;0.088;0.605;0.39	T	0.69917	-0.5015	9	0.39692	T	0.17	.	15.1425	0.72620	0.0:0.0:0.0:1.0	.	89;89;89;89	P52948-3;P52948-4;P52948-2;P52948-5	.;.;.;.	D	89	.	ENSP00000316032:N89D	N	-	1	0	NUP98	3756769	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.148000	0.71788	2.302000	0.77476	0.533000	0.62120	AAT		0.478	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320		6	70	0	0	0	0.00308	0	6	70				
CNGA4	1262	broad.mit.edu	37	11	6265487	6265487	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:6265487G>C	ENST00000379936.2	+	6	1691	c.1576G>C	c.(1576-1578)Gct>Cct	p.A526P		NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	526					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTTAAGATTGCTTACCGCAT	0.592																																							uc001mco.2		NA																	0				skin(1)	1						c.(1576-1578)GCT>CCT		cyclic nucleotide gated channel alpha 4							72.0	72.0	72.0					11																	6265487		2201	4296	6497	SO:0001583	missense	1262				response to stimulus|sensory perception of smell		cAMP binding	g.chr11:6265487G>C	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.1576G>C	11.37:g.6265487G>C	ENSP00000369268:p.Ala526Pro		Somatic				CNGA4_uc010raa.1_3'UTR|CNGA4_uc001mcn.2_3'UTR	p.A526P	NM_001037329	NP_001032406	WXS	Illumina HiSeq	Unspecified	Q8IV77	CNGA4_HUMAN		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	6	1683	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	526			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000379936.2	37	c.1576G>C	CCDS31408.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371294	0.42003	.	.	ENSG00000132259	ENST00000379936	D	0.97620	-4.46	5.28	4.38	0.52667	.	0.275438	0.38548	N	0.001660	D	0.93504	0.7927	L	0.36672	1.1	0.25479	N	0.987757	P	0.45902	0.868	B	0.40565	0.333	D	0.88885	0.3342	10	0.62326	D	0.03	.	9.1424	0.36912	0.165:0.0:0.835:0.0	.	526	Q8IV77	CNGA4_HUMAN	P	526	ENSP00000369268:A526P	ENSP00000369268:A526P	A	+	1	0	CNGA4	6222063	0.239000	0.23836	0.732000	0.30844	0.641000	0.38312	1.869000	0.39519	1.482000	0.48325	-0.160000	0.13428	GCT		0.592	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329		6	52	0	0	0	0.02938	0	6	52				
OR10A5	144124	broad.mit.edu	37	11	6867169	6867169	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:6867169C>G	ENST00000299454.4	+	1	287	c.256C>G	c.(256-258)Ctg>Gtg	p.L86V	OR10A5_ENST00000379831.2_Missense_Mutation_p.L90V			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	86					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GCTGGGGACCCTGCTTGCCCA	0.498																																					Pancreas(44;21 1072 25662 28041 45559)	Pancreas(44;21 1072 25662 28041 45559)	uc001met.1		NA																	0				skin(2)|ovary(1)	3						c.(256-258)CTG>GTG		olfactory receptor, family 10, subfamily A,							92.0	94.0	93.0					11																	6867169		2201	4292	6493	SO:0001583	missense	144124				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6867169C>G	AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.256C>G	11.37:g.6867169C>G	ENSP00000299454:p.Leu86Val		Somatic					p.L86V	NM_178168	NP_835462	WXS	Illumina HiSeq	Unspecified	Q9H207	O10A5_HUMAN		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	256	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	86			Extracellular (Potential).		O95223|Q52M66|Q96R21|Q96R22	Missense_Mutation	SNP	ENST00000299454.4	37	c.256C>G	CCDS7773.1	.	.	.	.	.	.	.	.	.	.	.	13.37	2.217654	0.39201	.	.	ENSG00000166363	ENST00000299454;ENST00000379831	T;T	0.00408	7.54;7.54	3.42	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.147655	0.31472	N	0.007599	T	0.00998	0.0033	M	0.89214	3.015	0.22762	N	0.998764	D	0.61080	0.989	D	0.63488	0.915	T	0.35895	-0.9770	10	0.87932	D	0	.	5.3667	0.16117	0.0:0.7439:0.0:0.2561	.	86	Q9H207	O10A5_HUMAN	V	86;90	ENSP00000299454:L86V;ENSP00000369159:L90V	ENSP00000299454:L86V	L	+	1	2	OR10A5	6823745	0.000000	0.05858	0.972000	0.41901	0.995000	0.86356	-0.144000	0.10280	0.984000	0.38629	0.591000	0.81541	CTG		0.498	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385983.1	NM_178168		4	45	0	0	0	0.009096	0	4	45				
CCDC73	493860	broad.mit.edu	37	11	32635535	32635535	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:32635535G>C	ENST00000335185.5	-	16	2372	c.2329C>G	c.(2329-2331)Ctt>Gtt	p.L777V	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	777										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					TTAAGATGAAGATGGGAAATG	0.328																																							uc001mtv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2329-2331)CTT>GTT		sarcoma antigen NY-SAR-79							101.0	87.0	91.0					11																	32635535		1831	4087	5918	SO:0001583	missense	493860							g.chr11:32635535G>C	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.2329C>G	11.37:g.32635535G>C	ENSP00000335325:p.Leu777Val		Somatic					p.L777V	NM_001008391	NP_001008392	WXS	Illumina HiSeq	Unspecified	Q6ZRK6	CCD73_HUMAN			16	2373	-	Breast(20;0.112)		777					Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	c.2329C>G	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999814	0.35320	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.64	2.18	0.27775	.	0.682067	0.13143	N	0.410471	T	0.33294	0.0858	L	0.50333	1.59	0.09310	N	0.999999	P	0.46064	0.872	P	0.45856	0.495	T	0.22243	-1.0222	9	0.72032	D	0.01	.	3.6851	0.08326	0.2883:0.0:0.5183:0.1934	.	777	Q6ZRK6	CCD73_HUMAN	V	777	.	ENSP00000335325:L777V	L	-	1	0	CCDC73	32592111	0.001000	0.12720	0.270000	0.24601	0.585000	0.36419	0.452000	0.21795	0.669000	0.31146	0.650000	0.86243	CTT		0.328	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391		9	38	0	0	0	0.004482	0	9	38				
API5	8539	broad.mit.edu	37	11	43333683	43333683	+	Silent	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:43333683G>C	ENST00000531273.1	+	1	145	c.6G>C	c.(4-6)ccG>ccC	p.P2P	API5_ENST00000534695.1_Silent_p.P2P|API5_ENST00000420461.2_Silent_p.P2P|API5_ENST00000534600.1_Silent_p.P2P|API5_ENST00000455725.2_5'UTR|API5_ENST00000378852.3_Silent_p.P2P			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	2	ARM-like and Heat-like helical repeats.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						TCACCATGCCGACAGTAGAGG	0.647											OREG0020900	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(1;98 122 5625 20895 49453)	Pancreas(1;98 122 5625 20895 49453)	uc010rfh.1		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(4-6)CCG>CCC		apoptosis inhibitor 5 isoform a							46.0	43.0	44.0					11																	43333683		2203	4300	6503	SO:0001819	synonymous_variant	8539				anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding	g.chr11:43333683G>C	U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.6G>C	11.37:g.43333683G>C			Somatic	OREG0020900	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	915	API5_uc010rfg.1_5'UTR|API5_uc001mxf.2_Silent_p.P2P|API5_uc010rfi.1_Silent_p.P2P	p.P2P	NM_001142930	NP_001136402	WXS	Illumina HiSeq	Unspecified	Q9BZZ5	API5_HUMAN			1	179	+			2				Not acetylated.	B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Silent	SNP	ENST00000531273.1	37	c.6G>C	CCDS44572.1																																																																																				0.647	API5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389545.1	NM_006595		6	25	0	0	0	0.004482	0	6	25				
OOSP2	219990	broad.mit.edu	37	11	59812153	59812153	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:59812153G>C	ENST00000278855.2	+	3	438	c.253G>C	c.(253-255)Gag>Cag	p.E85Q	PLAC1L_ENST00000532905.1_Missense_Mutation_p.E54Q	NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		85						extracellular region (GO:0005576)				breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						GGTAGTTTCTGAGGAAACTCT	0.398																																							uc001nol.2		NA																	0				ovary(2)|skin(1)	3						c.(253-255)GAG>CAG		placenta-specific 1-like precursor							97.0	88.0	91.0					11																	59812153		2201	4295	6496	SO:0001583	missense	219990					extracellular region		g.chr11:59812153G>C																												ENST00000278855.2:c.253G>C	11.37:g.59812153G>C	ENSP00000278855:p.Glu85Gln		Somatic					p.E85Q	NM_173801	NP_776162	WXS	Illumina HiSeq	Unspecified	Q86WS3	PLACL_HUMAN			3	438	+			85					E9PJA4|Q8N9U6	Missense_Mutation	SNP	ENST00000278855.2	37	c.253G>C	CCDS7979.1	.	.	.	.	.	.	.	.	.	.	G	4.133	0.023028	0.08006	.	.	ENSG00000149507	ENST00000278855;ENST00000532905	D;D	0.83335	-1.71;-1.71	2.9	-0.19	0.13256	.	.	.	.	.	T	0.75228	0.3821	N	0.17800	0.525	0.09310	N	1	D	0.65815	0.995	P	0.58721	0.844	T	0.64639	-0.6360	9	0.08179	T	0.78	-0.0262	5.6122	0.17412	0.397:0.0:0.603:0.0	.	85	Q86WS3	PLACL_HUMAN	Q	85;54	ENSP00000278855:E85Q;ENSP00000433831:E54Q	ENSP00000278855:E85Q	E	+	1	0	PLAC1L	59568729	0.000000	0.05858	0.000000	0.03702	0.127000	0.20565	0.234000	0.17930	-0.032000	0.13758	0.563000	0.77884	GAG		0.398	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394411.1			7	34	0	0	0	0.006214	0	7	34				
ARL2	402	broad.mit.edu	37	11	64787927	64787927	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:64787927A>G	ENST00000246747.4	+	4	471	c.376A>G	c.(376-378)Aag>Gag	p.K126E	RP11-399J13.3_ENST00000301886.3_Intron|ARL2_ENST00000529384.1_Missense_Mutation_p.K126E|ARL2_ENST00000533729.1_Intron	NM_001667.3	NP_001658.2	P36404	ARL2_HUMAN	ADP-ribosylation factor-like 2	126					cell cycle (GO:0007049)|centrosome organization (GO:0051297)|GTP catabolic process (GO:0006184)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of GTPase activity (GO:0034260)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of microtubule polymerization (GO:0031116)|regulation of microtubule polymerization (GO:0031113)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|tubulin complex assembly (GO:0007021)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|GTPase inhibitor activity (GO:0005095)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	5						CTTTGCTAATAAGCAGGACCT	0.587																																							uc001och.3		NA																	0					0						c.(376-378)AAG>GAG		ADP-ribosylation factor-like 2							51.0	44.0	46.0					11																	64787927		2201	4297	6498	SO:0001583	missense	402				cell cycle|centrosome organization|maintenance of protein location in nucleus|negative regulation of GTPase activity|positive regulation of cell-substrate adhesion|positive regulation of microtubule polymerization|small GTPase mediated signal transduction|tight junction assembly|tubulin complex assembly	centrosome|lateral plasma membrane|mitochondrial intermembrane space|nucleus	GTP binding|GTPase activity|GTPase inhibitor activity|protein binding	g.chr11:64787927A>G	AF493888	CCDS8088.1, CCDS55770.1	11q13	2014-05-09			ENSG00000213465	ENSG00000213465		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	693	protein-coding gene	gene with protein product		601175				8415637, 9253601	Standard	NM_001667		Approved	ARFL2	uc001och.4	P36404	OTTHUMG00000165728	ENST00000246747.4:c.376A>G	11.37:g.64787927A>G	ENSP00000246747:p.Lys126Glu		Somatic				SNX15_uc001oci.3_Intron	p.K126E	NM_001667	NP_001658	WXS	Illumina HiSeq	Unspecified	P36404	ARL2_HUMAN			4	470	+			126			GTP (By similarity).		G3V184|Q9BUK8	Missense_Mutation	SNP	ENST00000246747.4	37	c.376A>G	CCDS8088.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.631684	0.87660	.	.	ENSG00000213465	ENST00000246747;ENST00000529384	D;D	0.95980	-3.87;-3.87	5.38	4.25	0.50352	Small GTP-binding protein domain (1);	0.000000	0.85682	U	0.000000	D	0.98713	0.9568	H	0.99820	4.81	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.97371	0.9976	10	0.87932	D	0	-21.6764	9.16	0.37016	0.9131:0.0:0.0869:0.0	.	126	P36404	ARL2_HUMAN	E	126	ENSP00000246747:K126E;ENSP00000436021:K126E	ENSP00000246747:K126E	K	+	1	0	ARL2	64544503	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	8.215000	0.89762	0.893000	0.36288	0.402000	0.26972	AAG		0.587	ARL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385963.1	NM_001667		4	29	0	0	0	0.021553	0	4	29				
FAM89B	23625	broad.mit.edu	37	11	65341071	65341071	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:65341071C>T	ENST00000530349.1	+	2	671	c.529C>T	c.(529-531)Cgt>Tgt	p.R177C	FAM89B_ENST00000449319.2_3'UTR|FAM89B_ENST00000316409.2_Missense_Mutation_p.R164C|EHBP1L1_ENST00000309295.4_5'Flank			Q8N5H3	FA89B_HUMAN	family with sequence similarity 89, member B	177					negative regulation of SMAD protein import into nucleus (GO:0060392)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cytoplasm (GO:0005737)	transcription corepressor binding (GO:0001222)			large_intestine(1)|urinary_tract(2)	3						GCACAATGCCCGTGACCAGTG	0.662																																							uc001oem.2		NA																	0					0						c.(490-492)CGT>TGT		family with sequence similarity 89, member B							44.0	44.0	44.0					11																	65341071		2201	4296	6497	SO:0001583	missense	23625							g.chr11:65341071C>T	AF052151	CCDS8105.1, CCDS44648.1, CCDS53662.1	11q23	2007-12-04				ENSG00000176973			16708	protein-coding gene	gene with protein product						9525630, 10512749	Standard	NM_152832		Approved		uc001oel.2	Q8N5H3		ENST00000530349.1:c.529C>T	11.37:g.65341071C>T	ENSP00000431459:p.Arg177Cys		Somatic				FAM89B_uc001oen.2_3'UTR|FAM89B_uc001oel.2_Missense_Mutation_p.R177C|EHBP1L1_uc001oeo.3_5'Flank	p.R164C	NM_152832	NP_690045	WXS	Illumina HiSeq	Unspecified	Q8N5H3	FA89B_HUMAN			2	811	+			164					E9PB01|E9PL72|Q6PJ27	Missense_Mutation	SNP	ENST00000530349.1	37	c.490C>T	CCDS53662.1	.	.	.	.	.	.	.	.	.	.	C	19.49	3.837984	0.71373	.	.	ENSG00000176973	ENST00000316409;ENST00000530349;ENST00000377088	.	.	.	4.72	4.72	0.59763	.	0.000000	0.35903	N	0.002901	T	0.43144	0.1234	L	0.29908	0.895	0.51482	D	0.999925	B;B	0.32862	0.387;0.387	B;B	0.23852	0.049;0.049	T	0.50101	-0.8867	9	0.72032	D	0.01	-3.5411	13.0472	0.58933	0.0:1.0:0.0:0.0	.	164;177	Q8N5H3;E9PL72	FA89B_HUMAN;.	C	164;177;150	.	ENSP00000314829:R164C	R	+	1	0	FAM89B	65097647	0.998000	0.40836	1.000000	0.80357	0.985000	0.73830	1.683000	0.37638	2.454000	0.82982	0.561000	0.74099	CGT		0.662	FAM89B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390095.1	NM_152832		11	43	0	0	0	0.008291	0	11	43				
FAM86C2P	645332	broad.mit.edu	37	11	67570529	67570529	+	IGR	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:67570529C>T								FAM86C2P (5389 upstream) : RP11-119D9.1 (83437 downstream)																							AACTTTGCTTCTAAGCTCTGT	0.478																																							uc001omt.3		NA																	0					0						c.(103-105)GAA>AAA		SubName: Full=cDNA FLJ57700, weakly similar to Protein FAM86A;																																				SO:0001628	intergenic_variant	645332							g.chr11:67570529C>T																													11.37:g.67570529C>T			Somatic				LOC645332_uc001omu.3_Missense_Mutation_p.E35K	p.E35K	NR_024249		WXS	Illumina HiSeq	Unspecified					2	126	-									Missense_Mutation	SNP		37	c.103G>A																																																																																				0	0.478									4	56	0	0	0	0.02938	0	4	56				
SUV420H1	51111	broad.mit.edu	37	11	67925781	67925781	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:67925781C>G	ENST00000304363.4	-	11	2385	c.2032G>C	c.(2032-2034)Gtg>Ctg	p.V678L		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	678					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TCTGATGTCACAACTGAACAA	0.463																																							uc001onm.1		NA																	0				ovary(2)|kidney(1)	3						c.(2032-2034)GTG>CTG		suppressor of variegation 4-20 homolog 1 isoform							101.0	92.0	95.0					11																	67925781		2200	4294	6494	SO:0001583	missense	51111				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr11:67925781C>G	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.2032G>C	11.37:g.67925781C>G	ENSP00000305899:p.Val678Leu		Somatic				SUV420H1_uc009yse.1_Missense_Mutation_p.V264L|SUV420H1_uc001onn.1_Missense_Mutation_p.V506L|SUV420H1_uc009ysf.2_Missense_Mutation_p.V438L	p.V678L	NM_017635	NP_060105	WXS	Illumina HiSeq	Unspecified	Q4FZB7	SV421_HUMAN			11	2288	-			678					B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	37	c.2032G>C	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325657	0.81580	.	.	ENSG00000110066	ENST00000304363	T	0.44881	0.91	5.04	5.04	0.67666	.	0.208564	0.41294	D	0.000917	T	0.33000	0.0848	L	0.29908	0.895	0.80722	D	1	P	0.38677	0.642	B	0.36378	0.223	T	0.06516	-1.0822	10	0.23891	T	0.37	-20.2878	18.1611	0.89708	0.0:1.0:0.0:0.0	.	678	Q4FZB7	SV421_HUMAN	L	678	ENSP00000305899:V678L	ENSP00000305899:V678L	V	-	1	0	SUV420H1	67682357	0.039000	0.19947	0.065000	0.19835	0.691000	0.40173	1.763000	0.38461	2.623000	0.88846	0.491000	0.48974	GTG		0.463	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635		10	34	0	0	0	0.008291	0	10	34				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		19	16	1	0	7.88262e-20	0.01892	8.75278e-20	19	16				
ADAMTS20	80070	broad.mit.edu	37	12	43846118	43846118	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:43846118C>T	ENST00000389420.3	-	14	2037	c.2038G>A	c.(2038-2040)Gga>Aga	p.G680R	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.G680R	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	680	Cys-rich.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GTTTCAGTTCCACAAGGAGTA	0.343																																							uc010skx.1		NA																	0				central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(2038-2040)GGA>AGA		a disintegrin-like and metalloprotease with							94.0	87.0	89.0					12																	43846118		2203	4300	6503	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43846118C>T	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2038G>A	12.37:g.43846118C>T	ENSP00000374071:p.Gly680Arg		Somatic					p.G680R	NM_025003	NP_079279	WXS	Illumina HiSeq	Unspecified	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	14	2038	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	680			Cys-rich.		A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.2038G>A	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	17.48	3.401150	0.62288	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.59502	4.01;0.26	4.54	3.65	0.41850	.	0.125717	0.35495	N	0.003180	T	0.62233	0.2411	L	0.52905	1.665	0.80722	D	1	D	0.55385	0.971	P	0.52343	0.696	T	0.65265	-0.6210	10	0.54805	T	0.06	.	12.9429	0.58357	0.0:0.92:0.0:0.08	.	680	P59510	ATS20_HUMAN	R	680	ENSP00000374071:G680R;ENSP00000448341:G680R	ENSP00000374068:G680R	G	-	1	0	ADAMTS20	42132385	1.000000	0.71417	0.939000	0.37840	0.574000	0.36063	7.370000	0.79589	1.224000	0.43551	0.455000	0.32223	GGA		0.343	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		24	37	0	0	0	0.024334	0	24	37				
ARID2	196528	broad.mit.edu	37	12	46298746	46298746	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:46298746C>G	ENST00000334344.6	+	21	5565	c.5393C>G	c.(5392-5394)tCa>tGa	p.S1798*	ARID2_ENST00000444670.1_Nonsense_Mutation_p.S1408*|ARID2_ENST00000457135.1_3'UTR|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1798					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AATAACTTATCAGTGCTAGCC	0.358			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					0				ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.(5392-5394)TCA>TGA		AT rich interactive domain 2 (ARID, RFX-like)							82.0	78.0	80.0					12																	46298746		2203	4300	6503	SO:0001587	stop_gained	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46298746C>G		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.5393C>G	12.37:g.46298746C>G	ENSP00000335044:p.Ser1798*		Somatic				ARID2_uc009zkg.1_Nonsense_Mutation_p.S1254*|ARID2_uc009zkh.1_Nonsense_Mutation_p.S1425*|ARID2_uc001rou.1_3'UTR	p.S1798*	NM_152641	NP_689854	WXS	Illumina HiSeq	Unspecified	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	21	5393	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	1798					Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	ENST00000334344.6	37	c.5393C>G	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	C	43	10.452630	0.99408	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000444670	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-13.565	19.5114	0.95142	0.0:1.0:0.0:0.0	.	.	.	.	X	1798;915;915;1408	.	ENSP00000335044:S1798X	S	+	2	0	ARID2	44585013	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.330000	0.79181	2.671000	0.90904	0.655000	0.94253	TCA		0.358	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		6	34	0	0	0	0.00308	0	6	34				
ACVRL1	94	broad.mit.edu	37	12	52309021	52309021	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:52309021C>G	ENST00000388922.4	+	7	1068	c.785C>G	c.(784-786)tCa>tGa	p.S262*	ACVRL1_ENST00000550683.1_Nonsense_Mutation_p.S276*|ACVRL1_ENST00000419526.2_Nonsense_Mutation_p.S88*	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	262	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	TTCATCGCCTCAGACATGACC	0.617																																							uc001rzj.2		NA																	0				lung(2)	2						c.(784-786)TCA>TGA		activin A receptor type II-like 1 precursor	Adenosine triphosphate(DB00171)						56.0	49.0	52.0					12																	52309021		2203	4300	6503	SO:0001587	stop_gained	94	Hereditary_Hemorrhagic_Telangiectasia			blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity	g.chr12:52309021C>G	L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.785C>G	12.37:g.52309021C>G	ENSP00000373574:p.Ser262*		Somatic				ACVRL1_uc001rzk.2_Nonsense_Mutation_p.S262*|ACVRL1_uc010snm.1_Nonsense_Mutation_p.S88*	p.S262*	NM_000020	NP_000011	WXS	Illumina HiSeq	Unspecified	P37023	ACVL1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0991)	7	1068	+			262			Cytoplasmic (Potential).|Protein kinase.		A6NGA8	Nonsense_Mutation	SNP	ENST00000388922.4	37	c.785C>G	CCDS31804.1	.	.	.	.	.	.	.	.	.	.	C	37	6.199302	0.97371	.	.	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683;ENST00000548659;ENST00000419526	.	.	.	5.44	5.44	0.79542	.	7739.210000	0.00166	N	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.055	0.93059	0.0:1.0:0.0:0.0	.	.	.	.	X	262;262;276;88;88	.	ENSP00000267008:S262X	S	+	2	0	ACVRL1	50595288	1.000000	0.71417	0.969000	0.41365	0.449000	0.32228	7.647000	0.83462	2.824000	0.97209	0.655000	0.94253	TCA		0.617	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2			17	50	0	0	0	0.007413	0	17	50				
RNF41	10193	broad.mit.edu	37	12	56600242	56600242	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:56600242C>G	ENST00000345093.4	-	7	1312	c.943G>C	c.(943-945)Gaa>Caa	p.E315Q	RNF41_ENST00000552656.1_Missense_Mutation_p.E315Q|RNF41_ENST00000394013.2_Missense_Mutation_p.E244Q	NM_005785.3|NM_194359.2	NP_005776.1|NP_919340.1	Q9H4P4	RNF41_HUMAN	ring finger protein 41, E3 ubiquitin protein ligase	315					extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|proteasomal protein catabolic process (GO:0010498)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|regulation of establishment of cell polarity (GO:2000114)|regulation of lymphocyte differentiation (GO:0045619)|regulation of MAPK cascade (GO:0043408)|regulation of myeloid cell differentiation (GO:0045637)|regulation of protein kinase B signaling (GO:0051896)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytosol (GO:0005829)	acid-amino acid ligase activity (GO:0016881)|protein tag (GO:0031386)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	11						TATATCTCTTCCACGCCATGC	0.512											OREG0021921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001skf.1		NA																	0				skin(1)	1						c.(943-945)GAA>CAA		ring finger protein 41 isoform 1							165.0	160.0	162.0					12																	56600242		2203	4300	6503	SO:0001583	missense	10193				apoptosis|induction of apoptosis|protein polyubiquitination|regulation of reactive oxygen species metabolic process		protein binding|protein tag|ubiquitin-protein ligase activity|zinc ion binding	g.chr12:56600242C>G	AF077599	CCDS8909.1, CCDS8910.1	12q13.13	2014-03-24	2014-03-24		ENSG00000181852	ENSG00000181852		"""RING-type (C3HC4) zinc fingers"""	18401	protein-coding gene	gene with protein product			"""ring finger protein 41"""				Standard	NM_005785		Approved	SBBI03, NRDP1	uc001skg.2	Q9H4P4	OTTHUMG00000170328	ENST00000345093.4:c.943G>C	12.37:g.56600242C>G	ENSP00000342755:p.Glu315Gln		Somatic	OREG0021921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1016	RNF41_uc001ske.1_Missense_Mutation_p.E244Q|RNF41_uc001skg.1_Missense_Mutation_p.E315Q|RNF41_uc010sqg.1_Missense_Mutation_p.E250Q|RNF41_uc010sqh.1_Missense_Mutation_p.E244Q	p.E315Q	NM_005785	NP_005776	WXS	Illumina HiSeq	Unspecified	Q9H4P4	RNF41_HUMAN			7	1312	-			315					A6NFW0|B2RBT8|O75598	Missense_Mutation	SNP	ENST00000345093.4	37	c.943G>C	CCDS8909.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720078	0.89205	.	.	ENSG00000181852	ENST00000345093;ENST00000394013;ENST00000448057;ENST00000552656	T;T	0.11821	2.74;2.74	5.21	5.21	0.72293	USP8 interacting (1);	0.048250	0.85682	D	0.000000	T	0.37237	0.0996	M	0.67397	2.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.97;0.983	T	0.06844	-1.0804	10	0.66056	D	0.02	-1.6574	17.9232	0.88973	0.0:1.0:0.0:0.0	.	302;315	B4E353;Q9H4P4	.;RNF41_HUMAN	Q	315;244;302;315	ENSP00000342755:E315Q;ENSP00000447303:E315Q	ENSP00000342755:E315Q	E	-	1	0	RNF41	54886509	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	6.003000	0.70701	2.606000	0.88127	0.655000	0.94253	GAA		0.512	RNF41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408525.1	NM_005785		34	144	0	0	0	0.010771	0	34	144				
B4GALNT1	2583	broad.mit.edu	37	12	58023955	58023955	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:58023955T>A	ENST00000341156.4	-	6	1276	c.692A>T	c.(691-693)cAg>cTg	p.Q231L	B4GALNT1_ENST00000550764.1_Missense_Mutation_p.Q231L|B4GALNT1_ENST00000550943.1_5'Flank|B4GALNT1_ENST00000449184.3_Missense_Mutation_p.Q231L|B4GALNT1_ENST00000418555.2_Missense_Mutation_p.Q176L|B4GALNT1_ENST00000552350.1_Missense_Mutation_p.Q231L	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	231					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TGTGTTGGTCTGGTAGCTTCG	0.577																																							uc001spg.1		NA																	0					0						c.(691-693)CAG>CTG		beta-1,4-N-acetyl-galactosaminyl transferase 1							108.0	81.0	90.0					12																	58023955		2203	4300	6503	SO:0001583	missense	2583				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity	g.chr12:58023955T>A	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.692A>T	12.37:g.58023955T>A	ENSP00000341562:p.Gln231Leu		Somatic				B4GALNT1_uc010sru.1_Missense_Mutation_p.Q176L|B4GALNT1_uc010srv.1_Missense_Mutation_p.Q231L|B4GALNT1_uc001sph.2_Missense_Mutation_p.Q231L|B4GALNT1_uc001spi.2_Missense_Mutation_p.Q231L	p.Q231L	NM_001478	NP_001469	WXS	Illumina HiSeq	Unspecified	Q00973	B4GN1_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.109)		6	1124	-	Melanoma(17;0.122)		231			Lumenal (Potential).		B4DE26|Q8N636	Missense_Mutation	SNP	ENST00000341156.4	37	c.692A>T	CCDS8950.1	.	.	.	.	.	.	.	.	.	.	.	16.14	3.039343	0.55003	.	.	ENSG00000135454	ENST00000341156;ENST00000418555;ENST00000550764;ENST00000552350;ENST00000548888	T;T;T;T;T	0.32753	2.22;2.23;1.44;1.44;1.48	4.72	4.72	0.59763	.	0.251528	0.40064	N	0.001187	T	0.26846	0.0657	L	0.31926	0.97	0.40044	D	0.975686	B;B;B;B	0.30973	0.302;0.118;0.005;0.002	B;B;B;B	0.35971	0.215;0.049;0.004;0.001	T	0.08994	-1.0695	10	0.31617	T	0.26	.	13.5974	0.61998	0.0:0.0:0.0:1.0	.	231;176;231;231	B4DSP5;B4DE26;Q8N636;Q00973	.;.;.;B4GN1_HUMAN	L	231;176;231;231;231	ENSP00000341562:Q231L;ENSP00000401601:Q176L;ENSP00000450303:Q231L;ENSP00000448500:Q231L;ENSP00000447945:Q231L	ENSP00000341562:Q231L	Q	-	2	0	B4GALNT1	56310222	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	5.247000	0.65416	2.116000	0.64780	0.379000	0.24179	CAG		0.577	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407853.1	NM_001478		7	86	0	0	0	0.004482	0	7	86				
PHLDA1	22822	broad.mit.edu	37	12	76424317	76424317	+	Nonstop_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:76424317C>G	ENST00000266671.5	-	1	3395	c.1205G>C	c.(1204-1206)tGa>tCa	p.*402S	RP11-290L1.3_ENST00000552367.1_RNA|RP11-290L1.2_ENST00000547721.1_RNA|PHLDA1_ENST00000602540.1_Nonstop_Mutation_p.*261S			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	0					apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				CTGCCCCTTTCAGGCAGAGTT	0.662																																							uc001sxu.2		NA																	0					0						c.(1204-1206)TGA>TCA		pleckstrin homology-like domain, family A,							55.0	54.0	55.0					12																	76424317		2203	4300	6503	SO:0001578	stop_lost	22822				apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding	g.chr12:76424317C>G	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.1205G>C	12.37:g.76424317C>G			Somatic					p.*402S	NM_007350	NP_031376	WXS	Illumina HiSeq	Unspecified	Q8WV24	PHLA1_HUMAN			1	1240	-		Colorectal(145;0.09)	402					A1A4G9|Q15184|Q2TAN2|Q9NZ17	Nonstop_Mutation	SNP	ENST00000266671.5	37	c.1205G>C	CCDS31861.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586722	0.46110	.	.	ENSG00000139289	ENST00000266671;ENST00000421361	.	.	.	4.92	4.03	0.46877	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7994	0.34898	0.0:0.8986:0.0:0.1014	.	.	.	.	S	402;220	.	.	X	-	2	2	PHLDA1	74710584	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	1.858000	0.39408	1.305000	0.44909	0.561000	0.74099	TGA		0.662	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350		9	61	0	0	0	0.016723	0	9	61				
PHLDA1	22822	broad.mit.edu	37	12	76424750	76424750	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:76424750C>G	ENST00000266671.5	-	1	2962	c.772G>C	c.(772-774)Gag>Cag	p.E258Q	RP11-290L1.3_ENST00000552367.1_RNA|RP11-290L1.2_ENST00000547721.1_RNA|PHLDA1_ENST00000602540.1_Missense_Mutation_p.E117Q			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	258	PH.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				TCCTTGCCCTCTGCCATCACC	0.577																																							uc001sxu.2		NA																	0					0						c.(772-774)GAG>CAG		pleckstrin homology-like domain, family A,							109.0	80.0	90.0					12																	76424750		2203	4300	6503	SO:0001583	missense	22822				apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding	g.chr12:76424750C>G	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.772G>C	12.37:g.76424750C>G	ENSP00000266671:p.Glu258Gln		Somatic					p.E258Q	NM_007350	NP_031376	WXS	Illumina HiSeq	Unspecified	Q8WV24	PHLA1_HUMAN			1	807	-		Colorectal(145;0.09)	258			PH.		A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	ENST00000266671.5	37	c.772G>C	CCDS31861.1	.	.	.	.	.	.	.	.	.	.	C	34	5.348038	0.95807	.	.	ENSG00000139289	ENST00000266671;ENST00000421361	T	0.49139	0.79	4.75	4.75	0.60458	Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.62344	0.2420	L	0.42245	1.32	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	T	0.65911	-0.6053	10	0.87932	D	0	-28.0068	17.5457	0.87860	0.0:1.0:0.0:0.0	.	258	Q8WV24	PHLA1_HUMAN	Q	258;117	ENSP00000266671:E258Q	ENSP00000266671:E258Q	E	-	1	0	PHLDA1	74711017	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.420000	0.80191	2.464000	0.83262	0.561000	0.74099	GAG		0.577	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350		8	33	0	0	0	0.006214	0	8	33				
PHLDA1	22822	broad.mit.edu	37	12	76425191	76425191	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:76425191C>G	ENST00000266671.5	-	1	2521	c.331G>C	c.(331-333)Gag>Cag	p.E111Q	RP11-290L1.3_ENST00000552367.1_RNA|RP11-290L1.2_ENST00000547721.1_RNA|PHLDA1_ENST00000602540.1_5'UTR			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	111					apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				GCGCCGTCCTCGCCCCAGCGG	0.756																																							uc001sxu.2		NA																	0					0						c.(331-333)GAG>CAG		pleckstrin homology-like domain, family A,							4.0	5.0	4.0					12																	76425191		1911	3794	5705	SO:0001583	missense	22822				apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding	g.chr12:76425191C>G	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.331G>C	12.37:g.76425191C>G	ENSP00000266671:p.Glu111Gln		Somatic					p.E111Q	NM_007350	NP_031376	WXS	Illumina HiSeq	Unspecified	Q8WV24	PHLA1_HUMAN			1	366	-		Colorectal(145;0.09)	111					A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	ENST00000266671.5	37	c.331G>C	CCDS31861.1	.	.	.	.	.	.	.	.	.	.	C	32	5.169960	0.94768	.	.	ENSG00000139289	ENST00000266671	T	0.57273	0.41	4.46	4.46	0.54185	.	.	.	.	.	T	0.61788	0.2375	L	0.29908	0.895	0.30250	N	0.794175	D	0.89917	1.0	D	0.85130	0.997	T	0.61869	-0.6974	9	0.87932	D	0	-8.3891	14.1332	0.65268	0.0:1.0:0.0:0.0	.	111	Q8WV24	PHLA1_HUMAN	Q	111	ENSP00000266671:E111Q	ENSP00000266671:E111Q	E	-	1	0	PHLDA1	74711458	0.014000	0.17966	1.000000	0.80357	0.991000	0.79684	0.138000	0.16016	2.299000	0.77371	0.555000	0.69702	GAG		0.756	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350		4	4	0	0	0	0.009096	0	4	4				
BTG1	694	broad.mit.edu	37	12	92538099	92538099	+	Silent	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:92538099A>G	ENST00000256015.3	-	2	634	c.273T>C	c.(271-273)agT>agC	p.S91S	C12orf79_ENST00000551843.1_5'Flank|C12orf79_ENST00000549802.1_5'Flank|C12orf79_ENST00000546975.1_5'Flank|C12orf79_ENST00000551563.2_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA|RP11-796E2.4_ENST00000501008.2_RNA	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	91					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				ACAGCTCCTGACTGCTCAGTC	0.507			T	MYC	BCLL						OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001tby.3		NA		Dom	yes		12	12q22	694	T	"""B-cell translocation gene 1, anti-proliferative"""			L	MYC		BCLL		0					0						c.(271-273)AGT>AGC		B-cell translocation protein 1							124.0	124.0	124.0					12																	92538099		2203	4300	6503	SO:0001819	synonymous_variant	694				cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity	g.chr12:92538099A>G		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.273T>C	12.37:g.92538099A>G			Somatic	OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1291	BTG1_uc001tbv.1_5'Flank|BTG1_uc001tbw.1_5'Flank|BTG1_uc001tbx.1_5'Flank|BTG1_uc009zss.1_5'Flank|uc001tca.2_5'Flank	p.S91S	NM_001731	NP_001722	WXS	Illumina HiSeq	Unspecified	P62324	BTG1_HUMAN			2	635	-		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)	91					P31607	Silent	SNP	ENST00000256015.3	37	c.273T>C	CCDS9043.1																																																																																				0.507	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1			20	86	0	0	0	0.016522	0	20	86				
CCDC64	92558	broad.mit.edu	37	12	120510394	120510394	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:120510394C>T	ENST00000397558.2	+	6	1169	c.1169C>T	c.(1168-1170)tCa>tTa	p.S390L	CCDC64_ENST00000446727.2_Intron|CCDC64_ENST00000257583.4_Missense_Mutation_p.S39L	NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	390					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGTGCTGACTCAGCCGTCTCC	0.567																																							uc001txl.1		NA																	0				ovary(2)	2						c.(1168-1170)TCA>TTA		coiled-coil domain containing 64							68.0	70.0	69.0					12																	120510394		2110	4244	6354	SO:0001583	missense	92558				Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding	g.chr12:120510394C>T	U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.1169C>T	12.37:g.120510394C>T	ENSP00000380690:p.Ser390Leu		Somatic				CCDC64_uc001txk.2_Missense_Mutation_p.S390L|CCDC64_uc009zwv.1_Intron|CCDC64_uc010sze.1_Intron|CCDC64_uc010szf.1_Missense_Mutation_p.S39L	p.S390L	NM_207311	NP_997194	WXS	Illumina HiSeq	Unspecified	Q6ZP65	BICR1_HUMAN			6	1194	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		390					A8MUC8|B4DWL0|B5MDJ0|O95000	Missense_Mutation	SNP	ENST00000397558.2	37	c.1169C>T	CCDS41845.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403260	0.83230	.	.	ENSG00000135127	ENST00000357093;ENST00000397558;ENST00000548673;ENST00000257583	T;T	0.04706	3.57;3.57	5.67	5.67	0.87782	.	0.154304	0.44902	D	0.000420	T	0.16171	0.0389	L	0.41573	1.285	0.80722	D	1	P;D	0.89917	0.663;1.0	B;D	0.83275	0.323;0.996	T	0.01074	-1.1460	10	0.36615	T	0.2	-3.0173	19.7706	0.96363	0.0:1.0:0.0:0.0	.	39;390	B4DWL0;Q6ZP65	.;BICR1_HUMAN	L	371;390;60;39	ENSP00000380690:S390L;ENSP00000447477:S60L	ENSP00000257583:S39L	S	+	2	0	CCDC64	118994777	1.000000	0.71417	0.995000	0.50966	0.740000	0.42216	7.487000	0.81328	2.697000	0.92050	0.655000	0.94253	TCA		0.567	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403390.2	NM_207311		27	78	0	0	0	0.034045	0	27	78				
CCDC64	92558	broad.mit.edu	37	12	120510439	120510439	+	Missense_Mutation	SNP	C	C	T	rs374769468		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:120510439C>T	ENST00000397558.2	+	6	1214	c.1214C>T	c.(1213-1215)tCg>tTg	p.S405L	CCDC64_ENST00000446727.2_Intron|CCDC64_ENST00000257583.4_Missense_Mutation_p.S54L	NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	405					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCAGAAACCTCGTCCGCCAAG	0.567																																							uc001txl.1		NA																	0				ovary(2)	2						c.(1213-1215)TCG>TTG		coiled-coil domain containing 64		C	LEU/SER	1,4205		0,1,2102	55.0	58.0	57.0		1214	5.7	0.9	12		57	0,8456		0,0,4228	no	missense	CCDC64	NM_207311.2	145	0,1,6330	TT,TC,CC		0.0,0.0238,0.0079	benign	405/574	120510439	1,12661	2103	4228	6331	SO:0001583	missense	92558				Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding	g.chr12:120510439C>T	U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.1214C>T	12.37:g.120510439C>T	ENSP00000380690:p.Ser405Leu		Somatic				CCDC64_uc001txk.2_Missense_Mutation_p.S405L|CCDC64_uc009zwv.1_Intron|CCDC64_uc010sze.1_Intron|CCDC64_uc010szf.1_Missense_Mutation_p.S54L	p.S405L	NM_207311	NP_997194	WXS	Illumina HiSeq	Unspecified	Q6ZP65	BICR1_HUMAN			6	1239	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		405					A8MUC8|B4DWL0|B5MDJ0|O95000	Missense_Mutation	SNP	ENST00000397558.2	37	c.1214C>T	CCDS41845.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463021	0.63513	2.38E-4	0.0	ENSG00000135127	ENST00000357093;ENST00000397558;ENST00000548673;ENST00000257583	T;T	0.04603	3.59;3.59	5.67	5.67	0.87782	.	0.271761	0.37095	N	0.002244	T	0.05273	0.0140	N	0.25647	0.755	0.49915	D	0.999837	P;P	0.36483	0.47;0.555	B;B	0.31390	0.041;0.129	T	0.47005	-0.9150	10	0.46703	T	0.11	-3.0787	19.7706	0.96363	0.0:1.0:0.0:0.0	.	54;405	B4DWL0;Q6ZP65	.;BICR1_HUMAN	L	386;405;75;54	ENSP00000380690:S405L;ENSP00000447477:S75L	ENSP00000257583:S54L	S	+	2	0	CCDC64	118994822	1.000000	0.71417	0.947000	0.38551	0.910000	0.53928	5.659000	0.68010	2.697000	0.92050	0.655000	0.94253	TCG		0.567	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403390.2	NM_207311		15	54	0	0	0	0.0333	0	15	54				
GCN1L1	10985	broad.mit.edu	37	12	120613633	120613633	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:120613633G>C	ENST00000300648.6	-	11	970	c.958C>G	c.(958-960)Ctg>Gtg	p.L320V		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	320					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGCAGTGCCAGCACAGCTTCA	0.552																																							uc001txo.2		NA																	0				ovary(4)	4						c.(958-960)CTG>GTG		GCN1 general control of amino-acid synthesis							48.0	50.0	50.0					12																	120613633		2067	4212	6279	SO:0001583	missense	10985				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding	g.chr12:120613633G>C	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.958C>G	12.37:g.120613633G>C	ENSP00000300648:p.Leu320Val		Somatic					p.L320V	NM_006836	NP_006827	WXS	Illumina HiSeq	Unspecified	Q92616	GCN1L_HUMAN			11	971	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		320			HEAT 2.		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	c.958C>G	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	G	9.920	1.211796	0.22289	.	.	ENSG00000089154	ENST00000300648	T	0.05786	3.39	5.66	1.43	0.22495	Armadillo-like helical (1);Armadillo-type fold (1);	0.424518	0.23660	N	0.045823	T	0.02455	0.0075	N	0.05199	-0.095	0.30181	N	0.800425	B	0.02656	0.0	B	0.04013	0.001	T	0.30909	-0.9962	10	0.30078	T	0.28	-3.0954	2.9055	0.05720	0.174:0.3353:0.3829:0.1078	.	320	Q92616	GCN1L_HUMAN	V	320	ENSP00000300648:L320V	ENSP00000300648:L320V	L	-	1	2	GCN1L1	119098016	0.996000	0.38824	1.000000	0.80357	0.847000	0.48162	1.466000	0.35310	0.755000	0.32990	0.563000	0.77884	CTG		0.552	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			7	30	0	0	0	0.02938	0	7	30				
DIS3	22894	broad.mit.edu	37	13	73346337	73346337	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr13:73346337T>G	ENST00000377767.4	-	10	1563	c.1463A>C	c.(1462-1464)gAt>gCt	p.D488A	DIS3_ENST00000545453.1_Missense_Mutation_p.D326A|DIS3_ENST00000377780.4_Missense_Mutation_p.D458A	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	488					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		ATGTAGAGCATCGTCTATATC	0.363										Multiple Myeloma(4;0.011)																													uc001vix.3		NA																	0				central_nervous_system(1)	1						c.(1462-1464)GAT>GCT		DIS3 mitotic control isoform a							113.0	113.0	113.0					13																	73346337		2203	4300	6503	SO:0001583	missense	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73346337T>G	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1463A>C	13.37:g.73346337T>G	ENSP00000366997:p.Asp488Ala	Multiple Myeloma(4;0.011)	Somatic				DIS3_uc001viy.3_Missense_Mutation_p.D458A|DIS3_uc001viz.2_RNA	p.D488A	NM_014953	NP_055768	WXS	Illumina HiSeq	Unspecified	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	10	1837	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	488					A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	c.1463A>C	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.565192	0.86439	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.66099	-0.19;-0.19;-0.19	5.48	5.48	0.80851	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	D	0.88793	0.6533	H	0.99740	4.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93747	0.7055	10	0.87932	D	0	.	15.533	0.75980	0.0:0.0:0.0:1.0	.	458;488	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	A	488;458;326	ENSP00000366997:D488A;ENSP00000367011:D458A;ENSP00000440058:D326A	ENSP00000366997:D488A	D	-	2	0	DIS3	72244338	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	6.217000	0.72218	2.198000	0.70561	0.460000	0.39030	GAT		0.363	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		8	32	0	0	0	0.00308	0	8	32				
ATP11A	23250	broad.mit.edu	37	13	113510301	113510301	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr13:113510301G>C	ENST00000487903.1	+	20	2408	c.2320G>C	c.(2320-2322)Gac>Cac	p.D774H	ATP11A_ENST00000283558.8_Missense_Mutation_p.D774H|ATP11A_ENST00000375645.3_Missense_Mutation_p.D774H|ATP11A_ENST00000375630.2_Missense_Mutation_p.D774H			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	774					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				GCCTCGAGAAGACGGGAGTTC	0.542																																							uc001vsi.3		NA																	0				large_intestine(2)|ovary(2)	4						c.(2320-2322)GAC>CAC		ATPase, class VI, type 11A isoform a							107.0	115.0	113.0					13																	113510301		2203	4300	6503	SO:0001583	missense	23250				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:113510301G>C	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.2320G>C	13.37:g.113510301G>C	ENSP00000420387:p.Asp774His		Somatic				ATP11A_uc001vsj.3_Missense_Mutation_p.D774H|ATP11A_uc001vsm.1_Missense_Mutation_p.D650H|ATP11A_uc010ago.2_RNA	p.D774H	NM_015205	NP_056020	WXS	Illumina HiSeq	Unspecified	P98196	AT11A_HUMAN			20	2408	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)	774			Cytoplasmic (Potential).		Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	37	c.2320G>C	CCDS32011.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.92|14.92	2.678496|2.678496	0.47886|0.47886	.|.	.|.	ENSG00000068650|ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558;ENST00000432166|ENST00000418678	T;T;T;T|.	0.64260|.	-0.09;-0.09;-0.09;-0.09|.	5.06|5.06	4.2|4.2	0.49525|0.49525	HAD-like domain (1);|.	0.628566|.	0.16360|.	N|.	0.217828|.	T|T	0.73806|0.73806	0.3634|0.3634	M|M	0.76170|0.76170	2.325|2.325	0.46521|0.46521	D|D	0.999084|0.999084	P;D;P|.	0.53619|.	0.933;0.961;0.845|.	P;D;P|.	0.64877|.	0.89;0.93;0.89|.	T|T	0.74734|0.74734	-0.3565|-0.3565	10|5	0.87932|.	D|.	0|.	.|.	14.5071|14.5071	0.67761|0.67761	0.0751:0.0:0.9249:0.0|0.0751:0.0:0.9249:0.0	.|.	774;774;774|.	E9PCW5;E9PEJ6;P98196|.	.;.;AT11A_HUMAN|.	H|N	774;774;774;774;215|748	ENSP00000420387:D774H;ENSP00000364781:D774H;ENSP00000364796:D774H;ENSP00000283558:D774H|.	ENSP00000283558:D774H|.	D|K	+|+	1|3	0|2	ATP11A|ATP11A	112558302|112558302	1.000000|1.000000	0.71417|0.71417	0.021000|0.021000	0.16686|0.16686	0.026000|0.026000	0.11368|0.11368	5.634000|5.634000	0.67833|0.67833	2.517000|2.517000	0.84864|0.84864	0.561000|0.561000	0.74099|0.74099	GAC|AAG		0.542	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205		27	100	0	0	0	0.034045	0	27	100				
OR4N5	390437	broad.mit.edu	37	14	20612192	20612192	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr14:20612192C>G	ENST00000333629.1	+	1	298	c.298C>G	c.(298-300)Cag>Gag	p.Q100E	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		CTGCATCACTCAGCTCTTTTT	0.493																																							uc010tla.1		NA																	0				ovary(1)	1						c.(298-300)CAG>GAG		olfactory receptor, family 4, subfamily N,							127.0	129.0	128.0					14																	20612192		2203	4300	6503	SO:0001583	missense	390437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20612192C>G		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.298C>G	14.37:g.20612192C>G	ENSP00000332110:p.Gln100Glu		Somatic					p.Q100E	NM_001004724	NP_001004724	WXS	Illumina HiSeq	Unspecified	Q8IXE1	OR4N5_HUMAN	Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)	1	298	+	all_cancers(95;0.00108)		100			Extracellular (Potential).		Q6IF11	Missense_Mutation	SNP	ENST00000333629.1	37	c.298C>G	CCDS32031.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046187	0.75846	.	.	ENSG00000184394	ENST00000333629	T	0.00456	7.3	4.0	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	D	0.000865	T	0.01976	0.0062	H	0.96365	3.81	0.39409	D	0.96672	D	0.61080	0.989	D	0.72338	0.977	T	0.17653	-1.0362	10	0.87932	D	0	.	13.9851	0.64328	0.0:1.0:0.0:0.0	.	100	Q8IXE1	OR4N5_HUMAN	E	100	ENSP00000332110:Q100E	ENSP00000332110:Q100E	Q	+	1	0	OR4N5	19682032	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.899000	0.63245	2.219000	0.72066	0.655000	0.94253	CAG		0.493	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1			9	75	0	0	0	0.004482	0	9	75				
ZC3H14	79882	broad.mit.edu	37	14	89077222	89077222	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr14:89077222C>G	ENST00000251038.5	+	16	2367	c.2142C>G	c.(2140-2142)ttC>ttG	p.F714L	ZC3H14_ENST00000406216.3_Missense_Mutation_p.F260L|ZC3H14_ENST00000318308.6_Missense_Mutation_p.F284L|ZC3H14_ENST00000555900.1_Missense_Mutation_p.F416L|ZC3H14_ENST00000302216.8_Missense_Mutation_p.F557L|ZC3H14_ENST00000336693.4_Missense_Mutation_p.F549L|ZC3H14_ENST00000557607.1_Missense_Mutation_p.F398L|ZC3H14_ENST00000555755.1_Missense_Mutation_p.F708L|ZC3H14_ENST00000359301.3_Missense_Mutation_p.F549L|ZC3H14_ENST00000393514.5_Missense_Mutation_p.F689L|ZC3H14_ENST00000556945.1_Missense_Mutation_p.F583L	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	714						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						ACTGCACATTCTACCATCCCA	0.393																																							uc001xww.2		NA																	0				ovary(2)|skin(1)	3						c.(2140-2142)TTC>TTG		zinc finger CCCH-type containing 14 isoform 1							216.0	182.0	193.0					14																	89077222		2203	4300	6503	SO:0001583	missense	79882					cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding	g.chr14:89077222C>G	AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.2142C>G	14.37:g.89077222C>G	ENSP00000251038:p.Phe714Leu		Somatic				ZC3H14_uc010twd.1_Missense_Mutation_p.F713L|ZC3H14_uc010twe.1_Missense_Mutation_p.F708L|ZC3H14_uc001xwx.2_Missense_Mutation_p.F557L|ZC3H14_uc010twf.1_Missense_Mutation_p.F427L|ZC3H14_uc001xwy.2_Missense_Mutation_p.F549L|ZC3H14_uc010twg.1_Missense_Mutation_p.F403L|ZC3H14_uc001xxa.2_Missense_Mutation_p.F259L|ZC3H14_uc001xxc.2_Missense_Mutation_p.F258L|ZC3H14_uc001xxb.2_Missense_Mutation_p.F284L	p.F714L	NM_024824	NP_079100	WXS	Illumina HiSeq	Unspecified	Q6PJT7	ZC3HE_HUMAN			16	2367	+			714			C3H1-type 5.		A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	ENST00000251038.5	37	c.2142C>G	CCDS32133.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.9|21.9	4.213554|4.213554	0.79352|0.79352	.|.	.|.	ENSG00000100722|ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000380684;ENST00000556945;ENST00000557607;ENST00000555755;ENST00000393514;ENST00000336693;ENST00000318308;ENST00000555900;ENST00000406216;ENST00000555792|ENST00000556000	D;D;D;D|.	0.84944|.	-1.92;-1.92;-1.92;-1.92|.	5.97|5.97	-6.18|-6.18	0.02085|0.02085	Zinc finger, CCCH-type (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67776|0.67776	0.2929|0.2929	M|M	0.78637|0.78637	2.42|2.42	0.32311|0.32311	N|N	0.563728|0.563728	D;D;D;D;D;D;D;D|.	0.76494|.	0.999;0.999;0.996;0.999;0.998;0.998;0.999;0.999|.	D;D;D;D;D;D;D;D|.	0.85130|.	0.996;0.995;0.99;0.997;0.974;0.987;0.993;0.997|.	T|T	0.72007|0.72007	-0.4420|-0.4420	10|5	0.54805|.	T|.	0.06|.	-16.5662|-16.5662	18.3447|18.3447	0.90317|0.90317	0.0:0.6281:0.0:0.3719|0.0:0.6281:0.0:0.3719	.|.	583;563;708;713;260;284;557;714|.	G3V256;F8W848;G3V5R4;Q6PJT7-2;Q6PJT7-8;Q6PJT7-6;Q6PJT7-3;Q6PJT7|.	.;.;.;.;.;.;.;ZC3HE_HUMAN|.	L|C	714;689;651;549;557;563;583;398;708;689;549;284;416;260;129|629	ENSP00000327176:F284L;ENSP00000451530:F416L;ENSP00000384682:F260L;ENSP00000450823:F129L|.	ENSP00000251038:F714L|.	F|S	+|+	3|2	2|0	ZC3H14|ZC3H14	88146975|88146975	0.791000|0.791000	0.28800|0.28800	0.343000|0.343000	0.25615|0.25615	0.943000|0.943000	0.58893|0.58893	-0.096000|-0.096000	0.11059|0.11059	-1.492000|-1.492000	0.01838|0.01838	-0.218000|-0.218000	0.12543|0.12543	TTC|TCT		0.393	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824		20	84	0	0	0	0.027356	0	20	84				
TTC7B	145567	broad.mit.edu	37	14	91161916	91161916	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr14:91161916C>G	ENST00000328459.6	-	6	826	c.705G>C	c.(703-705)ttG>ttC	p.L235F	TTC7B_ENST00000357056.2_Missense_Mutation_p.L235F|RP11-661G16.2_ENST00000553712.1_RNA	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	235										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				CTCCTCTTGTCAAGTTCCTGT	0.383																																							uc001xyp.2		NA																	0				ovary(2)	2						c.(703-705)TTG>TTC		tetratricopeptide repeat domain 7B							123.0	101.0	108.0					14																	91161916		2203	4300	6503	SO:0001583	missense	145567						binding	g.chr14:91161916C>G	BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.705G>C	14.37:g.91161916C>G	ENSP00000336127:p.Leu235Phe		Somatic				uc001xyr.1_5'Flank	p.L235F	NM_001010854	NP_001010854	WXS	Illumina HiSeq	Unspecified	Q86TV6	TTC7B_HUMAN			6	827	-		Melanoma(154;0.222)	235			TPR 2.		Q86U24|Q86VT3	Missense_Mutation	SNP	ENST00000328459.6	37	c.705G>C	CCDS32140.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912125	0.52439	.	.	ENSG00000165914	ENST00000555768;ENST00000357056;ENST00000328459;ENST00000557766	T;T	0.40476	1.71;1.03	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.60117	0.2244	M	0.74881	2.28	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.55642	-0.8109	10	0.16420	T	0.52	-10.1719	12.5214	0.56060	0.0:0.9231:0.0:0.0769	.	235	Q86TV6	TTC7B_HUMAN	F	133;235;235;155	ENSP00000349564:L235F;ENSP00000336127:L235F	ENSP00000336127:L235F	L	-	3	2	TTC7B	90231669	1.000000	0.71417	1.000000	0.80357	0.218000	0.24690	4.423000	0.59861	2.620000	0.88729	0.491000	0.48974	TTG		0.383	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2			6	34	0	0	0	0.021553	0	6	34				
USP8	9101	broad.mit.edu	37	15	50769116	50769116	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr15:50769116G>T	ENST00000396444.3	+	9	1258	c.920G>T	c.(919-921)tGt>tTt	p.C307F	USP8_ENST00000433963.1_Missense_Mutation_p.C307F|USP8_ENST00000307179.4_Missense_Mutation_p.C307F|USP8_ENST00000425032.3_Missense_Mutation_p.C230F	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	307	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TGGCTCCTTTGTTATCCCCAG	0.388																																							uc001zym.3		NA																	0				lung(1)|central_nervous_system(1)	2						c.(919-921)TGT>TTT		ubiquitin specific peptidase 8							113.0	101.0	105.0					15																	50769116		2196	4294	6490	SO:0001583	missense	9101				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr15:50769116G>T	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.920G>T	15.37:g.50769116G>T	ENSP00000379721:p.Cys307Phe		Somatic				USP8_uc001zyk.1_Missense_Mutation_p.V7F|USP8_uc001zyl.3_Missense_Mutation_p.C307F|USP8_uc001zyn.3_Missense_Mutation_p.C307F|USP8_uc010ufh.1_Missense_Mutation_p.C230F|USP8_uc010bev.1_Intron	p.C307F	NM_001128611	NP_001122083	WXS	Illumina HiSeq	Unspecified	P40818	UBP8_HUMAN		all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)	10	1420	+			307			Rhodanese.		B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	ENST00000396444.3	37	c.920G>T	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	G	8.987	0.976697	0.18812	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	4.95	4.03	0.46877	Rhodanese-like (4);	0.048411	0.85682	D	0.000000	T	0.28699	0.0711	N	0.25890	0.77	0.53688	D	0.999973	B;B	0.12013	0.003;0.005	B;B	0.21708	0.014;0.036	T	0.05784	-1.0864	10	0.08599	T	0.76	-3.2059	13.7596	0.62956	0.0754:0.0:0.9246:0.0	.	230;307	B4DKA8;P40818	.;UBP8_HUMAN	F	307;307;307;230	ENSP00000379721:C307F;ENSP00000405537:C307F;ENSP00000302239:C307F;ENSP00000412682:C230F	ENSP00000302239:C307F	C	+	2	0	USP8	48556408	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	6.600000	0.74132	1.203000	0.43233	0.460000	0.39030	TGT		0.388	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154		16	63	1	0	1.33834e-09	0.007413	1.45768e-09	16	63				
MYO5A	4644	broad.mit.edu	37	15	52622589	52622589	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr15:52622589T>A	ENST00000399231.3	-	34	4684	c.4441A>T	c.(4441-4443)Aag>Tag	p.K1481*	MYO5A_ENST00000399233.2_Nonsense_Mutation_p.K1478*|MYO5A_ENST00000553916.1_Nonsense_Mutation_p.K1479*|MYO5A_ENST00000356338.6_Nonsense_Mutation_p.K1454*|MYO5A_ENST00000358212.6_Nonsense_Mutation_p.K1506*	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1481					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TCATCCTCCTTCTTGTATTCC	0.428																																							uc002aby.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(4441-4443)AAG>TAG		myosin VA isoform 1							218.0	205.0	209.0					15																	52622589		1840	4084	5924	SO:0001587	stop_gained	4644				actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr15:52622589T>A		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.4441A>T	15.37:g.52622589T>A	ENSP00000382177:p.Lys1481*		Somatic				MYO5A_uc002abx.3_Nonsense_Mutation_p.K1454*|MYO5A_uc010ugd.1_Nonsense_Mutation_p.K203*|MYO5A_uc002abz.1_RNA	p.K1481*	NM_000259	NP_000250	WXS	Illumina HiSeq	Unspecified	Q9Y4I1	MYO5A_HUMAN		all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)	34	4685	-			1481					A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Nonsense_Mutation	SNP	ENST00000399231.3	37	c.4441A>T	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	T	43	10.497940	0.99416	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	.	.	.	5.46	4.31	0.51392	.	0.102713	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7376	0.57234	0.0:0.0:0.1371:0.8629	.	.	.	.	X	1481;988;1478;1454;1506;1084;1479	.	ENSP00000348693:K1454X	K	-	1	0	MYO5A	50409881	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.825000	0.48096	0.872000	0.35775	0.460000	0.39030	AAG		0.428	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259		28	141	0	0	0	0.015359	0	28	141				
VPS13C	54832	broad.mit.edu	37	15	62169209	62169209	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr15:62169209T>G	ENST00000261517.5	-	75	10260	c.10187A>C	c.(10186-10188)cAg>cCg	p.Q3396P	VPS13C_ENST00000395896.4_Missense_Mutation_p.Q3396P|VPS13C_ENST00000249837.3_Missense_Mutation_p.Q3353P|VPS13C_ENST00000395898.3_Missense_Mutation_p.Q3353P|VPS13C_ENST00000558919.1_5'UTR	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						CCATATAAGCTGATCTCTCTT	0.294																																							uc002agz.2		NA																	0				ovary(2)	2						c.(10186-10188)CAG>CCG		vacuolar protein sorting 13C protein isoform 2A							107.0	116.0	113.0					15																	62169209		2203	4294	6497	SO:0001583	missense	54832				protein localization			g.chr15:62169209T>G	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.10187A>C	15.37:g.62169209T>G	ENSP00000261517:p.Gln3396Pro		Somatic				VPS13C_uc002aha.2_Missense_Mutation_p.Q3353P|VPS13C_uc002ahb.1_Missense_Mutation_p.Q3396P|VPS13C_uc002ahc.1_Missense_Mutation_p.Q3353P	p.Q3396P	NM_020821	NP_065872	WXS	Illumina HiSeq	Unspecified	Q709C8	VP13C_HUMAN			75	10261	-			3396						Missense_Mutation	SNP	ENST00000261517.5	37	c.10187A>C	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	T	19.00	3.742826	0.69418	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.78707	-1.2;-1.2;-1.2	5.06	5.06	0.68205	.	0.112630	0.64402	D	0.000009	D	0.87382	0.6163	M	0.80982	2.52	0.58432	D	0.999999	D;D;D;P	0.65815	0.991;0.987;0.995;0.955	D;D;D;P	0.68192	0.936;0.921;0.956;0.786	D	0.88933	0.3374	10	0.66056	D	0.02	.	13.6621	0.62374	0.0:0.0:0.0:1.0	.	3353;3396;3353;3396	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	P	3353;3396;3396;3396	ENSP00000249837:Q3353P;ENSP00000261517:Q3396P;ENSP00000379233:Q3396P	ENSP00000249837:Q3353P	Q	-	2	0	VPS13C	59956501	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	6.901000	0.75693	2.031000	0.59945	0.477000	0.44152	CAG		0.294	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		10	97	0	0	0	0.010729	0	10	97				
CRAMP1L	57585	broad.mit.edu	37	16	1705274	1705274	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:1705274G>C	ENST00000397412.3	+	9	1191	c.1092G>C	c.(1090-1092)caG>caC	p.Q364H	CRAMP1L_ENST00000293925.5_Missense_Mutation_p.Q364H|CRAMP1L_ENST00000436138.3_Missense_Mutation_p.Q361H|CRAMP1L_ENST00000262317.4_5'Flank|LA16c-431H6.6_ENST00000454337.1_3'UTR			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	364						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						TCTTGAAGCAGAAGTGGGCGC	0.552																																							uc010uvh.1		NA																	0					0						c.(1090-1092)CAG>CAC		Crm, cramped-like							110.0	113.0	112.0					16																	1705274		2058	4192	6250	SO:0001583	missense	57585					nucleus	DNA binding	g.chr16:1705274G>C	AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.1092G>C	16.37:g.1705274G>C	ENSP00000380559:p.Gln364His		Somatic				CRAMP1L_uc002cmf.2_RNA	p.Q364H	NM_020825	NP_065876	WXS	Illumina HiSeq	Unspecified	Q96RY5	CRML_HUMAN			8	1092	+			364					A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Missense_Mutation	SNP	ENST00000397412.3	37	c.1092G>C	CCDS10440.2	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739486	0.89573	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.72732	0.3497	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.68606	-0.5364	9	0.34782	T	0.22	-29.5872	20.0893	0.97812	0.0:0.0:1.0:0.0	.	364	Q96RY5	CRML_HUMAN	H	364;364;361	.	ENSP00000293925:Q364H	Q	+	3	2	CRAMP1L	1645275	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.545000	0.67237	2.761000	0.94854	0.655000	0.94253	CAG		0.552	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4			32	32	0	0	0	0.023175	0	32	32				
CLUAP1	23059	broad.mit.edu	37	16	3562389	3562389	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:3562389G>A	ENST00000576634.1	+	5	550	c.406G>A	c.(406-408)Gat>Aat	p.D136N	CLUAP1_ENST00000417763.2_5'UTR|CLUAP1_ENST00000571025.1_Missense_Mutation_p.D136N|CLUAP1_ENST00000572600.1_Intron|CLUAP1_ENST00000341633.5_Missense_Mutation_p.D136N|LA16c-306E5.3_ENST00000574423.2_RNA	NM_015041.2	NP_055856.1	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1	136					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cilium (GO:0005929)|intracellular membrane-bounded organelle (GO:0043231)|intraciliary transport particle B (GO:0030992)|nucleus (GO:0005634)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(2)	16						CCAGATTGCAGATTTGAAGGC	0.453																																							uc002cvk.1		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(406-408)GAT>AAT		clusterin associated protein 1 isoform 1							101.0	98.0	99.0					16																	3562389		2197	4300	6497	SO:0001583	missense	23059					nucleus	protein binding	g.chr16:3562389G>A	BC017070	CCDS32381.1, CCDS45398.1	16p13.3	2014-07-18				ENSG00000103351		"""Intraflagellar transport homologs"""	19009	protein-coding gene	gene with protein product	"""flagellar associated protein 22, qilin-like protein, homolog (Chlamydomonas)"", ""cilia and flagella associated protein 22"""					15480429, 9734811, 19253336	Standard	NM_015041		Approved	FLJ13297, KIAA0643, FAP22, CFAP22	uc002cvk.2	Q96AJ1		ENST00000576634.1:c.406G>A	16.37:g.3562389G>A	ENSP00000460850:p.Asp136Asn		Somatic				CLUAP1_uc002cvj.1_Missense_Mutation_p.D136N|CLUAP1_uc002cvl.1_Missense_Mutation_p.D136N|CLUAP1_uc002cvm.1_Intron	p.D136N	NM_015041	NP_055856	WXS	Illumina HiSeq	Unspecified	Q96AJ1	CLUA1_HUMAN			5	511	+			136					O75138|Q65ZA3|Q9H8R4|Q9H8T1	Missense_Mutation	SNP	ENST00000576634.1	37	c.406G>A	CCDS32381.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.479848	0.63849	.	.	ENSG00000103351	ENST00000341633	T	0.49432	0.78	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.65933	0.2739	L	0.60012	1.86	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.66972	-0.5788	10	0.62326	D	0.03	-32.686	16.8993	0.86109	0.0:0.0:1.0:0.0	.	136	Q96AJ1	CLUA1_HUMAN	N	136	ENSP00000344392:D136N	ENSP00000344392:D136N	D	+	1	0	CLUAP1	3502390	1.000000	0.71417	0.998000	0.56505	0.177000	0.22998	9.231000	0.95317	2.580000	0.87095	0.655000	0.94253	GAT		0.453	CLUAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437883.2	NM_024793		3	55	0	0	0	0.009096	0	3	55				
CREBBP	1387	broad.mit.edu	37	16	3781195	3781195	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:3781195C>T	ENST00000262367.5	-	30	5979	c.5170G>A	c.(5170-5172)Gag>Aag	p.E1724K	CREBBP_ENST00000382070.3_Missense_Mutation_p.E1686K	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1724	Interaction with TRERF1.			ED -> VV (in Ref. 2; AAC51340). {ECO:0000305}.	cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGGCCTACCTCGCACACAGTG	0.652			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																uc002cvv.2		NA		Dom/Rec	yes		16	16p13.3	1387	T|N|F|Mis|O	CREB binding protein (CBP)	yes	Rubinstein-Taybi syndrome	L	MLL|MORF|RUNXBP2		ALL|AML|DLBCL|B-NHL 		0				haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127						c.(5170-5172)GAG>AAG		CREB binding protein isoform a							61.0	60.0	60.0					16																	3781195		2197	4300	6497	SO:0001583	missense	1387	Rubinstein-Taybsyndrome			cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	g.chr16:3781195C>T	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.5170G>A	16.37:g.3781195C>T	ENSP00000262367:p.Glu1724Lys		Somatic				CREBBP_uc002cvw.2_Missense_Mutation_p.E1686K	p.E1724K	NM_004380	NP_004371	WXS	Illumina HiSeq	Unspecified	Q92793	CBP_HUMAN		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)	30	5374	-		Ovarian(90;0.0266)	1724	ED -> VV (in Ref. 2; AAC51340).		Interaction with TRERF1.|ZZ-type.		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	c.5170G>A	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	c	20.9	4.065703	0.76187	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.91577	-2.87;-2.87	5.87	5.87	0.94306	Zinc finger, ZZ-type (4);	0.000000	0.85682	D	0.000000	D	0.95345	0.8489	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	D	0.94233	0.7478	10	0.45353	T	0.12	-31.3166	20.2192	0.98319	0.0:1.0:0.0:0.0	.	1754;1724	Q4LE28;Q92793	.;CBP_HUMAN	K	1724;1754;1686;259	ENSP00000262367:E1724K;ENSP00000371502:E1686K	ENSP00000262367:E1724K	E	-	1	0	CREBBP	3721196	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	7.818000	0.86416	2.780000	0.95670	0.655000	0.94253	GAG		0.652	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		30	124	0	0	0	0.010818	0	30	124				
CREBBP	1387	broad.mit.edu	37	16	3789613	3789613	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:3789613C>G	ENST00000262367.5	-	25	5055	c.4246G>C	c.(4246-4248)Gaa>Caa	p.E1416Q	CREBBP_ENST00000382070.3_Missense_Mutation_p.E1378Q	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1416	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GAGCCGTATTCTTGGACGTGC	0.493			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																uc002cvv.2		NA		Dom/Rec	yes		16	16p13.3	1387	T|N|F|Mis|O	CREB binding protein (CBP)	yes	Rubinstein-Taybi syndrome	L	MLL|MORF|RUNXBP2		ALL|AML|DLBCL|B-NHL 		0				haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127						c.(4246-4248)GAA>CAA		CREB binding protein isoform a							85.0	78.0	81.0					16																	3789613		2197	4300	6497	SO:0001583	missense	1387	Rubinstein-Taybsyndrome			cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	g.chr16:3789613C>G	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4246G>C	16.37:g.3789613C>G	ENSP00000262367:p.Glu1416Gln		Somatic				CREBBP_uc002cvw.2_Missense_Mutation_p.E1378Q	p.E1416Q	NM_004380	NP_004371	WXS	Illumina HiSeq	Unspecified	Q92793	CBP_HUMAN		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)	25	4450	-		Ovarian(90;0.0266)	1416			Cys/His-rich.		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	c.4246G>C	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	c	17.99	3.522796	0.64747	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.94232	-3.38;-3.38	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.97983	0.9336	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.98816	1.0745	10	0.72032	D	0.01	-25.9242	19.4402	0.94817	0.0:1.0:0.0:0.0	.	1446;1416	Q4LE28;Q92793	.;CBP_HUMAN	Q	1416;1446;1378;5	ENSP00000262367:E1416Q;ENSP00000371502:E1378Q	ENSP00000262367:E1416Q	E	-	1	0	CREBBP	3729614	1.000000	0.71417	0.190000	0.23270	0.499000	0.33736	7.713000	0.84693	2.665000	0.90641	0.561000	0.74099	GAA		0.493	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		11	42	0	0	0	0.028581	0	11	42				
ITGAL	3683	broad.mit.edu	37	16	30490717	30490717	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:30490717G>A	ENST00000356798.6	+	6	691	c.511G>A	c.(511-513)Gaa>Aaa	p.E171K	ITGAL_ENST00000454514.2_Intron|RP11-297C4.3_ENST00000562525.1_RNA|RP11-297C4.2_ENST00000569459.1_RNA|ITGAL_ENST00000358164.5_Intron|ITGAL_ENST00000433423.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	171	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GCAGCCAGATGAATTTCAGAA	0.438																																					NSCLC(110;1462 1641 3311 33990 49495)	NSCLC(110;1462 1641 3311 33990 49495)	uc002dyi.3		NA																	0				ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10						c.(511-513)GAA>AAA		integrin alpha L isoform a precursor	Efalizumab(DB00095)						94.0	86.0	89.0					16																	30490717		2197	4300	6497	SO:0001583	missense	3683				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity	g.chr16:30490717G>A		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.511G>A	16.37:g.30490717G>A	ENSP00000349252:p.Glu171Lys		Somatic				ITGAL_uc010veu.1_Intron|ITGAL_uc002dyj.3_Intron|ITGAL_uc010vev.1_Intron	p.E171K	NM_002209	NP_002200	WXS	Illumina HiSeq	Unspecified	P20701	ITAL_HUMAN			6	687	+			171			VWFA.|Extracellular (Potential).		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	c.511G>A	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002362	0.93227	.	.	ENSG00000005844	ENST00000356798	D	0.82526	-1.62	5.85	4.89	0.63831	von Willebrand factor, type A (3);	0.348662	0.24720	N	0.036153	D	0.90167	0.6927	M	0.82517	2.595	0.80722	D	1	D	0.69078	0.997	D	0.66716	0.946	D	0.90715	0.4630	10	0.87932	D	0	.	11.5309	0.50610	0.0832:0.0:0.9168:0.0	.	171	P20701	ITAL_HUMAN	K	171	ENSP00000349252:E171K	ENSP00000349252:E171K	E	+	1	0	ITGAL	30398218	0.998000	0.40836	0.983000	0.44433	0.960000	0.62799	3.427000	0.52785	2.775000	0.95449	0.411000	0.27672	GAA		0.438	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2			5	41	0	0	0	0.02938	0	5	41				
SRCAP	10847	broad.mit.edu	37	16	30732535	30732535	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:30732535G>A	ENST00000262518.4	+	21	3664	c.3279G>A	c.(3277-3279)ctG>ctA	p.L1093L	SRCAP_ENST00000395059.2_Silent_p.L1093L|SRCAP_ENST00000344771.4_Intron	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1093	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TGGGGGTCCTGAGTGGGACCT	0.602																																							uc002dze.1		NA																	0				ovary(3)|skin(1)	4						c.(3277-3279)CTG>CTA		Snf2-related CBP activator protein							98.0	106.0	103.0					16																	30732535		2197	4300	6497	SO:0001819	synonymous_variant	10847				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity	g.chr16:30732535G>A	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3279G>A	16.37:g.30732535G>A			Somatic				SRCAP_uc002dzf.2_Intron|SRCAP_uc002dzg.1_Silent_p.L950L|SRCAP_uc010bzz.1_Silent_p.L663L	p.L1093L	NM_006662	NP_006653	WXS	Illumina HiSeq	Unspecified	Q6ZRS2	SRCAP_HUMAN	Colorectal(24;0.198)		21	3664	+			1093			Pro-rich.		B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	c.3279G>A	CCDS10689.2																																																																																				0.602	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662		21	107	0	0	0	0.030593	0	21	107				
ZNF267	10308	broad.mit.edu	37	16	31927690	31927690	+	Missense_Mutation	SNP	G	G	A	rs146914846	byFrequency	TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:31927690G>A	ENST00000300870.10	+	4	2329	c.2120G>A	c.(2119-2121)cGg>cAg	p.R707Q		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	707					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						ACTACACATCGGAGAAGTCAT	0.433													.|||	4	0.000798722	0.0	0.0	5008	,	,		22027	0.0		0.002	False		,,,				2504	0.002						uc002ecs.3		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(2119-2121)CGG>CAG		zinc finger protein 267		G	GLN/ARG	0,4394		0,0,2197	96.0	88.0	90.0		2120	-0.9	0.0	16	dbSNP_134	90	18,8582		0,18,4282	no	missense	ZNF267	NM_003414.4	43	0,18,6479	AA,AG,GG		0.2093,0.0,0.1385	benign	707/744	31927690	18,12976	2197	4300	6497	SO:0001583	missense	10308				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:31927690G>A	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.2120G>A	16.37:g.31927690G>A	ENSP00000300870:p.Arg707Gln		Somatic					p.R707Q	NM_003414	NP_003405	WXS	Illumina HiSeq	Unspecified	Q14586	ZN267_HUMAN			4	2329	+			707			C2H2-type 14.		A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	37	c.2120G>A	CCDS32440.1	.	.	.	.	.	.	.	.	.	.	.	0.695	-0.792953	0.02862	0.0	0.002093	ENSG00000185947	ENST00000300870	T	0.17691	2.26	0.468	-0.935	0.10423	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03348	0.0097	N	0.00972	-1.085	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.46219	-0.9207	9	0.02654	T	1	.	4.1884	0.10409	0.7045:0.0:0.2955:0.0	.	707	Q14586	ZN267_HUMAN	Q	707	ENSP00000300870:R707Q	ENSP00000300870:R707Q	R	+	2	0	ZNF267	31835191	0.000000	0.05858	0.012000	0.15200	0.010000	0.07245	0.210000	0.17455	-0.643000	0.05473	-0.658000	0.03865	CGG		0.433	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414		3	77	0	0	0	0.014758	0	3	77				
RPGRIP1L	23322	broad.mit.edu	37	16	53636079	53636079	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:53636079C>T	ENST00000379925.3	-	27	3907	c.3857G>A	c.(3856-3858)gGt>gAt	p.G1286D	RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.G1252D|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.G1206D	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	1286					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				AATACCTTCACCATCTGCTCG	0.443																																							uc002ehp.2		NA																	0				ovary(1)	1						c.(3856-3858)GGT>GAT		RPGRIP1-like isoform a							107.0	85.0	93.0					16																	53636079		2198	4300	6498	SO:0001583	missense	23322				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding	g.chr16:53636079C>T		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.3857G>A	16.37:g.53636079C>T	ENSP00000369257:p.Gly1286Asp		Somatic				RPGRIP1L_uc002eho.3_Missense_Mutation_p.G1206D|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.G1240D|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.G1252D	p.G1286D	NM_015272	NP_056087	WXS	Illumina HiSeq	Unspecified	Q68CZ1	FTM_HUMAN			27	3921	-		all_cancers(37;0.0973)	1286					A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	c.3857G>A	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.348042	0.61183	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.69435	-0.4;-0.4	5.86	5.86	0.93980	.	0.123532	0.56097	D	0.000040	T	0.64571	0.2610	L	0.54323	1.7	0.80722	D	1	B;B;B	0.22746	0.034;0.074;0.056	B;B;B	0.19946	0.012;0.025;0.027	T	0.58429	-0.7638	10	0.34782	T	0.22	-16.9078	18.3801	0.90448	0.0:1.0:0.0:0.0	.	1240;1286;1206	B7ZKJ9;Q68CZ1;Q68CZ1-2	.;FTM_HUMAN;.	D	1286;1206	ENSP00000369257:G1286D;ENSP00000262135:G1206D	ENSP00000262135:G1206D	G	-	2	0	RPGRIP1L	52193580	0.693000	0.27728	0.869000	0.34112	0.974000	0.67602	3.729000	0.54999	2.776000	0.95493	0.650000	0.86243	GGT		0.443	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272		14	38	0	0	0	0.007413	0	14	38				
FHOD1	29109	broad.mit.edu	37	16	67267932	67267932	+	Silent	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:67267932C>T	ENST00000258201.4	-	13	1921	c.1674G>A	c.(1672-1674)ctG>ctA	p.L558L		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	558	FH1.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		ACTCTACATTCAGCATGTCCT	0.617																																							uc002esl.2		NA																	0				breast(2)|ovary(1)	3						c.(1672-1674)CTG>CTA		formin homology 2 domain containing 1							66.0	67.0	67.0					16																	67267932		2198	4300	6498	SO:0001819	synonymous_variant	29109				actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding	g.chr16:67267932C>T	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.1674G>A	16.37:g.67267932C>T			Somatic				FHOD1_uc010ced.2_Silent_p.L365L|FHOD1_uc010vjh.1_Silent_p.L218L	p.L558L	NM_013241	NP_037373	WXS	Illumina HiSeq	Unspecified	Q9Y613	FHOD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)	13	1786	-		Ovarian(137;0.0563)	558			FH1.		Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	ENST00000258201.4	37	c.1674G>A	CCDS10834.1																																																																																				0.617	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2			8	67	0	0	0	0.00308	0	8	67				
FANCA	2175	broad.mit.edu	37	16	89815072	89815072	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:89815072C>T	ENST00000389301.3	-	33	3373	c.3343G>A	c.(3343-3345)Gag>Aag	p.E1115K	FANCA_ENST00000568369.1_Missense_Mutation_p.E1115K	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1115					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CCTACCATCTCAGAGTTGACC	0.602			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc002fou.1		NA	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	D|Mis|N|F|S	"""Fanconi anemia, complementation group A"""			L		AML|leukemia			0				ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						c.(3343-3345)GAG>AAG	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group A isoform							108.0	73.0	85.0					16																	89815072		2198	4300	6498	SO:0001583	missense	2175	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding	g.chr16:89815072C>T	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3343G>A	16.37:g.89815072C>T	ENSP00000373952:p.Glu1115Lys		Somatic				FANCA_uc010vpn.1_Missense_Mutation_p.E1115K|FANCA_uc010vpo.1_Missense_Mutation_p.E201K	p.E1115K	NM_000135	NP_000126	WXS	Illumina HiSeq	Unspecified	O15360	FANCA_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.028)	33	3385	-		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)	1115					A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	c.3343G>A	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199056	0.79015	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	D	0.85484	-1.99	4.76	3.8	0.43715	.	0.191121	0.36200	N	0.002724	D	0.88695	0.6506	M	0.71581	2.175	0.47949	D	0.999555	D;D;D	0.65815	0.983;0.995;0.995	P;P;P	0.57425	0.537;0.82;0.82	D	0.89118	0.3501	10	0.72032	D	0.01	-13.0806	10.4765	0.44667	0.194:0.806:0.0:0.0	.	92;1115;1115	B7Z6Y4;B4DRI7;O15360	.;.;FANCA_HUMAN	K	1115;92	ENSP00000373952:E1115K	ENSP00000306281:E92K	E	-	1	0	FANCA	88342573	0.981000	0.34729	0.717000	0.30585	0.815000	0.46073	3.492000	0.53259	1.363000	0.46019	0.561000	0.74099	GAG		0.602	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1			3	27	0	0	0	0.004672	0	3	27				
VPS53	55275	broad.mit.edu	37	17	556535	556535	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:556535C>T	ENST00000571805.1	-	7	740	c.604G>A	c.(604-606)Gaa>Aaa	p.E202K	VPS53_ENST00000401468.3_Intron|VPS53_ENST00000446250.2_5'UTR|VPS53_ENST00000437048.2_Missense_Mutation_p.E202K|VPS53_ENST00000576149.1_Intron|VPS53_ENST00000291074.5_Missense_Mutation_p.E173K|VPS53_ENST00000574029.1_Intron			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	202					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		GTTTACCTTTCGGAAAGCTGC	0.483																																							uc002frn.2		NA																	0					0						c.(604-606)GAA>AAA		vacuolar protein sorting 53 isoform 2							80.0	80.0	80.0					17																	556535		2203	4299	6502	SO:0001583	missense	55275				protein transport	endosome membrane|Golgi apparatus		g.chr17:556535C>T		CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.604G>A	17.37:g.556535C>T	ENSP00000459312:p.Glu202Lys		Somatic				VPS53_uc002frk.2_Intron|VPS53_uc010cjo.1_Missense_Mutation_p.E202K|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Missense_Mutation_p.E173K|VPS53_uc002fro.2_5'UTR|VPS53_uc010cjp.1_Intron	p.E202K	NM_018289	NP_060759	WXS	Illumina HiSeq	Unspecified	Q5VIR6	VPS53_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)	7	751	-			202					A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	ENST00000571805.1	37	c.604G>A		.	.	.	.	.	.	.	.	.	.	C	16.90	3.248797	0.59103	.	.	ENSG00000141252	ENST00000437048;ENST00000291074;ENST00000389040	T;T;T	0.31510	1.49;1.49;1.49	5.6	5.6	0.85130	Vps53-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.22244	0.0536	N	0.16201	0.385	0.80722	D	1	B;B;P	0.37038	0.209;0.211;0.579	B;B;B	0.35727	0.029;0.103;0.209	T	0.03695	-1.1012	10	0.40728	T	0.16	.	18.5315	0.90993	0.0:1.0:0.0:0.0	.	202;202;173	Q5VIR6-4;Q5VIR6;Q5VIR6-2	.;VPS53_HUMAN;.	K	202;173;202	ENSP00000401435:E202K;ENSP00000291074:E173K;ENSP00000373692:E202K	ENSP00000291074:E173K	E	-	1	0	VPS53	503285	1.000000	0.71417	0.997000	0.53966	0.261000	0.26267	7.176000	0.77643	2.800000	0.96347	0.543000	0.68304	GAA		0.483	VPS53-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000436940.2	NM_018289		4	110	0	0	0	0.009096	0	4	110				
GEMIN4	50628	broad.mit.edu	37	17	650277	650277	+	Missense_Mutation	SNP	G	G	A	rs186893279		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:650277G>A	ENST00000319004.5	-	2	1124	c.1006C>T	c.(1006-1008)Cgc>Tgc	p.R336C	GEMIN4_ENST00000437269.1_3'UTR|GEMIN4_ENST00000576778.1_Missense_Mutation_p.R325C	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	336					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TGGCTGCTGCGGAGCACGGCC	0.632																																							uc002frs.1		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(1006-1008)CGC>TGC		gemin 4		G	CYS/ARG	1,4259		0,1,2129	51.0	57.0	55.0		1006	-0.4	0.8	17		55	4,8458		0,4,4227	yes	missense	GEMIN4	NM_015721.2	180	0,5,6356	AA,AG,GG		0.0473,0.0235,0.0393	benign	336/1059	650277	5,12717	2130	4231	6361	SO:0001583	missense	50628				rRNA processing|spliceosomal snRNP assembly	Cajal body|cytosol|nucleolus|small nuclear ribonucleoprotein complex|spliceosomal complex	protein binding	g.chr17:650277G>A	AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.1006C>T	17.37:g.650277G>A	ENSP00000321706:p.Arg336Cys		Somatic				GEMIN4_uc010vqa.1_3'UTR	p.R336C	NM_015721	NP_056536	WXS	Illumina HiSeq	Unspecified	P57678	GEMI4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)	2	1125	-		Myeloproliferative disorder(207;0.204)	336					Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	ENST00000319004.5	37	c.1006C>T	CCDS45559.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	4.504	0.093570	0.08632	2.35E-4	4.73E-4	ENSG00000179409	ENST00000319004	T	0.14893	2.47	5.74	-0.44	0.12261	.	0.819129	0.11405	N	0.567349	T	0.06690	0.0171	N	0.08118	0	0.09310	N	0.999999	B	0.09022	0.002	B	0.04013	0.001	T	0.33266	-0.9875	10	0.54805	T	0.06	-2.6492	0.6932	0.00894	0.2338:0.1351:0.2499:0.3812	.	336	P57678	GEMI4_HUMAN	C	336	ENSP00000321706:R336C	ENSP00000321706:R336C	R	-	1	0	GEMIN4	597027	0.236000	0.23804	0.763000	0.31416	0.060000	0.15804	1.233000	0.32648	-0.383000	0.07858	-1.461000	0.01025	CGC		0.632	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721		7	41	0	0	0	0.02938	0	7	41				
SERPINF2	5345	broad.mit.edu	37	17	1657465	1657465	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:1657465G>C	ENST00000324015.3	+	10	1190	c.1113G>C	c.(1111-1113)caG>caC	p.Q371H	SERPINF2_ENST00000450523.2_Missense_Mutation_p.Q307H|SERPINF2_ENST00000382061.4_Missense_Mutation_p.Q371H	NM_000934.3	NP_000925.2	P08697	A2AP_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2	371					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of proteolysis (GO:0030162)|response to organic substance (GO:0010033)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Ocriplasmin(DB08888)	TCTCCGAGCAGAGCCTGGTGG	0.677																																							uc002ftk.1		NA																	0					0						c.(1111-1113)CAG>CAC		alpha-2-antiplasmin isoform a precursor	Streptokinase(DB00086)						69.0	71.0	70.0					17																	1657465		2203	4300	6503	SO:0001583	missense	5345				acute-phase response|fibrinolysis|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity	g.chr17:1657465G>C	D00174	CCDS11011.1, CCDS54064.1	17p13.3	2014-02-18	2005-08-18		ENSG00000167711	ENSG00000167711		"""Serine (or cysteine) peptidase inhibitors"""	9075	protein-coding gene	gene with protein product	"""alpha-2-plasmin inhibitor"", ""alpha-2-antiplasmin"""	613168	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2"""	PLI		3416655, 24172014	Standard	NM_000934		Approved	API, ALPHA-2-PI, A2AP, AAP	uc002ftk.1	P08697	OTTHUMG00000090552	ENST00000324015.3:c.1113G>C	17.37:g.1657465G>C	ENSP00000321853:p.Gln371His		Somatic				SERPINF2_uc010vqr.1_Missense_Mutation_p.Q307H	p.Q371H	NM_000934	NP_000925	WXS	Illumina HiSeq	Unspecified	P08697	A2AP_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	10	1190	+			371					B4E1B7|Q8N5U7|Q9UCG2|Q9UCG3	Missense_Mutation	SNP	ENST00000324015.3	37	c.1113G>C	CCDS11011.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.824351	0.32237	.	.	ENSG00000167711	ENST00000324015;ENST00000450523;ENST00000453723;ENST00000382061	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.63	3.63	0.41609	Serpin domain (3);	0.878115	0.10144	N	0.710468	T	0.32793	0.0841	L	0.47716	1.5	0.09310	N	1	B;B	0.25441	0.126;0.126	B;B	0.15484	0.013;0.013	T	0.14868	-1.0457	10	0.66056	D	0.02	.	11.8008	0.52126	0.1289:0.0:0.8711:0.0	.	307;371	B4E1B7;P08697	.;A2AP_HUMAN	H	371;307;255;371	ENSP00000321853:Q371H;ENSP00000403877:Q307H;ENSP00000402056:Q255H;ENSP00000371493:Q371H	ENSP00000321853:Q371H	Q	+	3	2	SERPINF2	1604215	0.922000	0.31269	0.128000	0.21923	0.567000	0.35839	1.751000	0.38339	2.654000	0.90174	0.655000	0.94253	CAG		0.677	SERPINF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207078.3	NM_000934		11	75	0	0	0	0.013537	0	11	75				
TP53	7157	broad.mit.edu	37	17	7578507	7578507	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:7578507G>T	ENST00000269305.4	-	5	612	c.423C>A	c.(421-423)tgC>tgA	p.C141*	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.C141*|TP53_ENST00000420246.2_Nonsense_Mutation_p.C141*|TP53_ENST00000445888.2_Nonsense_Mutation_p.C141*|TP53_ENST00000413465.2_Nonsense_Mutation_p.C141*|TP53_ENST00000359597.4_Nonsense_Mutation_p.C141*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	141	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141W(13)|p.C141*(11)|p.0?(8)|p.A138_P142delAKTCP(4)|p.C141C(4)|p.N131fs*27(2)|p.P142fs*7(1)|p.L137_W146del10(1)|p.C141A(1)|p.C9W(1)|p.A6_P10delAKTCP(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.T140fs*28(1)|p.A138_V143delAKTCPV(1)|p.C141fs*5(1)|p.P142del(1)|p.C48W(1)|p.C141_P142insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTGCACAGGGCAGGTCTTGG	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		55	Substitution - Missense(16)|Substitution - Nonsense(11)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(5)|Substitution - coding silent(4)|Insertion - Frameshift(1)|Insertion - In frame(1)	p.C141Y(61)|p.C141*(11)|p.C141R(10)|p.C141W(10)|p.0?(7)|p.C141C(4)|p.C141F(4)|p.C141fs*29(3)|p.N131fs*27(2)|p.C141S(2)|p.C141fs*8(2)|p.L137_W146del10(1)|p.K139fs*4(1)|p.C141fs*34(1)|p.C141fs*30(1)|p.A138_V143delAKTCPV(1)|p.A138_P142delAKTCP(1)|p.C141A(1)|p.C141G(1)|p.C141_P142insXX(1)|p.K139_C141>N(1)|p.C141fs*5(1)|p.P142del(1)|p.P142fs*7(1)	ovary(13)|lung(9)|breast(6)|oesophagus(5)|large_intestine(4)|bone(4)|stomach(3)|central_nervous_system(3)|upper_aerodigestive_tract(2)|haematopoietic_and_lymphoid_tissue(2)|liver(2)|kidney(1)|urinary_tract(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(421-423)TGC>TGA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							57.0	56.0	56.0					17																	7578507		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578507G>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.423C>A	17.37:g.7578507G>T	ENSP00000269305:p.Cys141*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Nonsense_Mutation_p.C141*|TP53_uc002gih.2_Nonsense_Mutation_p.C141*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.C9*|TP53_uc010cng.1_Nonsense_Mutation_p.C9*|TP53_uc002gii.1_Nonsense_Mutation_p.C9*|TP53_uc010cnh.1_Nonsense_Mutation_p.C141*|TP53_uc010cni.1_Nonsense_Mutation_p.C141*|TP53_uc002gij.2_Nonsense_Mutation_p.C141*|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Nonsense_Mutation_p.C48*|TP53_uc002gio.2_Nonsense_Mutation_p.C9*|TP53_uc010vug.1_Nonsense_Mutation_p.C102*	p.C141*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	617	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	141		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.423C>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551985	0.45487	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	.	.	.	5.48	2.07	0.26955	.	0.046412	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.1094	8.3736	0.32430	0.2952:0.0:0.7048:0.0	.	.	.	.	X	141;141;141;141;141;141;130;48;9;48;9;141	.	ENSP00000269305:C141X	C	-	3	2	TP53	7519232	1.000000	0.71417	0.987000	0.45799	0.022000	0.10575	1.115000	0.31209	0.236000	0.21180	0.655000	0.94253	TGC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		10	39	1	0	2.27111e-07	0.013537	2.42725e-07	10	39				
MYH13	8735	broad.mit.edu	37	17	10248849	10248849	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:10248849C>A	ENST00000418404.3	-	13	1511	c.1348G>T	c.(1348-1350)Gac>Tac	p.D450Y	MYH13_ENST00000252172.4_Missense_Mutation_p.D450Y			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	450	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TGCTTGGTGTCCAGCTGCTGG	0.512																																							uc002gmk.1		NA																	0				ovary(4)|skin(2)	6						c.(1348-1350)GAC>TAC		myosin, heavy polypeptide 13, skeletal muscle							177.0	168.0	171.0					17																	10248849		2203	4297	6500	SO:0001583	missense	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10248849C>A	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.1348G>T	17.37:g.10248849C>A	ENSP00000404570:p.Asp450Tyr		Somatic				MYH13_uc010vvf.1_Missense_Mutation_p.D125Y	p.D450Y	NM_003802	NP_003793	WXS	Illumina HiSeq	Unspecified	Q9UKX3	MYH13_HUMAN			14	1438	-			450			Myosin head-like.		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	c.1348G>T	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276994	0.80580	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	D	0.87887	-2.31	4.33	4.33	0.51752	Myosin head, motor domain (2);	.	.	.	.	D	0.92948	0.7756	M	0.75264	2.295	0.53688	D	0.999971	D	0.57571	0.98	D	0.75020	0.985	D	0.93743	0.7052	9	0.66056	D	0.02	.	17.3699	0.87373	0.0:1.0:0.0:0.0	.	450	Q9UKX3	MYH13_HUMAN	Y	450;125	ENSP00000252172:D450Y	ENSP00000252172:D450Y	D	-	1	0	MYH13	10189574	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.492000	0.81482	2.402000	0.81655	0.561000	0.74099	GAC		0.512	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		45	93	1	0	5.39261e-20	0.01441	6.02704e-20	45	93				
KRTAP4-4	84616	broad.mit.edu	37	17	39316759	39316759	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:39316759T>C	ENST00000390661.3	-	1	224	c.185A>G	c.(184-186)cAc>cGc	p.H62R		NM_032524.1	NP_115913.1	Q9BYR3	KRA44_HUMAN	keratin associated protein 4-4	62	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].		Missing (in allele KAP4.13). {ECO:0000269|PubMed:11279113}.|Missing (in allele KAP4.4-v1).			keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(5)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGCTGGGGTGGCAGCAGGT	0.662																																							uc002hwc.2		NA																	0					0						c.(184-186)CAC>CGC		keratin associated protein 4.4							39.0	48.0	45.0					17																	39316759		2200	4294	6494	SO:0001583	missense	84616					keratin filament		g.chr17:39316759T>C	AJ406936	CCDS11383.1	17q21.2	2013-06-25			ENSG00000171396	ENSG00000171396		"""Keratin associated proteins"""	16928	protein-coding gene	gene with protein product			"""keratin associated protein 4-13"""	KRTAP4-13		11279113	Standard	NM_032524		Approved	KAP4.4, KAP4.13	uc002hwc.3	Q9BYR3	OTTHUMG00000133428	ENST00000390661.3:c.185A>G	17.37:g.39316759T>C	ENSP00000375076:p.His62Arg		Somatic					p.H62R	NM_032524	NP_115913	WXS	Illumina HiSeq	Unspecified	Q9BYR3	KRA44_HUMAN	STAD - Stomach adenocarcinoma(17;0.000449)		1	225	-		Breast(137;0.000496)	62		Missing (in allele KAP4.13).|Missing (in allele KAP4.4-v1).	9.|26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].		Q9BYU7	Missense_Mutation	SNP	ENST00000390661.3	37	c.185A>G	CCDS11383.1	.	.	.	.	.	.	.	.	.	.	.	3.774	-0.047123	0.07407	.	.	ENSG00000171396	ENST00000390661	T	0.01203	5.18	5.19	-0.262	0.12958	.	0.000000	0.30101	N	0.010409	T	0.00210	0.0006	N	0.00010	-3.015	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46978	-0.9152	10	0.13108	T	0.6	.	4.2837	0.10844	0.153:0.4186:0.0:0.4284	.	62	Q9BYR3	KRA44_HUMAN	R	62	ENSP00000375076:H62R	ENSP00000375076:H62R	H	-	2	0	KRTAP4-4	36570285	0.000000	0.05858	0.243000	0.24186	0.582000	0.36321	-0.494000	0.06451	0.042000	0.15717	-0.142000	0.14014	CAC		0.662	KRTAP4-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257291.1			4	112	0	0	0	0.02938	0	4	112				
TMEM106A	113277	broad.mit.edu	37	17	41365217	41365217	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:41365217G>A	ENST00000331615.3	+	3	394	c.157G>A	c.(157-159)Gat>Aat	p.D53N	TMEM106A_ENST00000541594.1_Missense_Mutation_p.D5N|TMEM106A_ENST00000536052.1_Missense_Mutation_p.D53N|TMEM106A_ENST00000592564.1_3'UTR|TMEM106A_ENST00000588659.1_Missense_Mutation_p.D53N	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	53						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.D53N(1)		NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		AGGAACTGCTGATGCCAGCTT	0.552																																							uc002idn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(157-159)GAT>AAT		transmembrane protein 106A							144.0	129.0	134.0					17																	41365217		2203	4296	6499	SO:0001583	missense	113277					integral to membrane		g.chr17:41365217G>A	AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.157G>A	17.37:g.41365217G>A	ENSP00000330774:p.Asp53Asn		Somatic				TMEM106A_uc010why.1_Missense_Mutation_p.D5N|TMEM106A_uc010cze.1_Missense_Mutation_p.D53N|TMEM106A_uc010whz.1_Missense_Mutation_p.D53N	p.D53N	NM_145041	NP_659478	WXS	Illumina HiSeq	Unspecified	Q96A25	T106A_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0917)	3	394	+		Breast(137;0.0164)	53					A8K2X2|B7Z698	Missense_Mutation	SNP	ENST00000331615.3	37	c.157G>A	CCDS11462.1	.	.	.	.	.	.	.	.	.	.	G	9.255	1.041642	0.19748	.	.	ENSG00000184988	ENST00000331615;ENST00000536052;ENST00000541594	T;T;T	0.22336	1.99;1.99;1.96	4.64	1.25	0.21368	.	0.612744	0.16845	N	0.197179	T	0.09730	0.0239	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.24083	-1.0170	10	0.62326	D	0.03	-6.6814	6.6562	0.22988	0.506:0.0:0.494:0.0	.	53;5;53	B7Z779;B7Z698;Q96A25	.;.;T106A_HUMAN	N	53;53;5	ENSP00000330774:D53N;ENSP00000439835:D53N;ENSP00000439844:D5N	ENSP00000330774:D53N	D	+	1	0	TMEM106A	38720743	0.000000	0.05858	0.001000	0.08648	0.653000	0.38743	-0.244000	0.08903	0.168000	0.19655	0.591000	0.81541	GAT		0.552	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453470.2	NM_145041		12	116	0	0	0	0.006122	0	12	116				
MSI2	124540	broad.mit.edu	37	17	55478817	55478817	+	Silent	SNP	C	C	T	rs201726045		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:55478817C>T	ENST00000284073.2	+	6	599	c.390C>T	c.(388-390)ttC>ttT	p.F130F	MSI2_ENST00000322684.3_Silent_p.F126F|MSI2_ENST00000442934.2_Silent_p.F69F|MSI2_ENST00000416426.2_Silent_p.F108F|MSI2_ENST00000579180.1_Silent_p.F26F	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	130	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		AGCAATATTTCGAGCAGTTTG	0.488			T	HOXA9	CML								C|||	1	0.000199681	0.0008	0.0	5008	,	,		19569	0.0		0.0	False		,,,				2504	0.0						uc002iuz.1		NA		Dom	yes		17	17q23.2	124540	T	musashi homolog 2 (Drosophila)			L	HOXA9		CML		0				central_nervous_system(1)|pancreas(1)	2						c.(388-390)TTC>TTT		musashi 2 isoform a							137.0	127.0	130.0					17																	55478817		2203	4300	6503	SO:0001819	synonymous_variant	124540					cytoplasm	nucleotide binding|RNA binding	g.chr17:55478817C>T	BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.390C>T	17.37:g.55478817C>T			Somatic				MSI2_uc010wnm.1_Silent_p.F108F|MSI2_uc002iva.2_Silent_p.F126F	p.F130F	NM_138962	NP_620412	WXS	Illumina HiSeq	Unspecified	Q96DH6	MSI2H_HUMAN		GBM - Glioblastoma multiforme(1;0.0025)	6	563	+	Breast(9;1.78e-08)		130			RRM 2.		Q7Z6M7|Q8N9T4	Silent	SNP	ENST00000284073.2	37	c.390C>T	CCDS11596.1																																																																																				0.488	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441813.1			20	61	0	0	0	0.027356	0	20	61				
STRADA	92335	broad.mit.edu	37	17	61781922	61781922	+	Silent	SNP	G	G	A	rs147552949		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:61781922G>A	ENST00000336174.6	-	11	991	c.879C>T	c.(877-879)aaC>aaT	p.N293N	STRADA_ENST00000582137.1_Silent_p.N264N|STRADA_ENST00000447001.3_Silent_p.N249N|RP11-51F16.8_ENST00000580553.1_3'UTR|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000579340.1_3'UTR|STRADA_ENST00000392950.4_Silent_p.N256N|STRADA_ENST00000245865.5_3'UTR|STRADA_ENST00000375840.4_Silent_p.N235N	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	293	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						GCACTGTGCCGTTCAGTTTCT	0.632																																							uc002jbm.2		NA																	0				ovary(1)	1						c.(877-879)AAC>AAT		STE20-related kinase adaptor alpha isoform 1		G	,,,,,	0,4406		0,0,2203	48.0	51.0	50.0		768,879,705,792,747,768	-7.8	0.8	17	dbSNP_134	50	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	STRADA	NM_001003786.2,NM_001003787.2,NM_001003788.2,NM_001165969.1,NM_001165970.1,NM_153335.5	,,,,,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,,,,,	256/395,293/432,235/374,264/315,249/300,256/349	61781922	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	92335				activation of protein kinase activity|cell cycle arrest|insulin receptor signaling pathway|protein export from nucleus|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|kinase binding|protein kinase activity	g.chr17:61781922G>A	AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.879C>T	17.37:g.61781922G>A			Somatic				STRADA_uc002jbn.2_Silent_p.N235N|STRADA_uc002jbo.2_Silent_p.N256N|STRADA_uc002jbp.2_Silent_p.N256N|STRADA_uc002jbq.2_Silent_p.N235N|STRADA_uc010wpq.1_Silent_p.N249N|STRADA_uc010wpr.1_Silent_p.N264N|STRADA_uc010ddw.2_Silent_p.N264N|STRADA_uc002jbr.2_3'UTR	p.N293N	NM_001003787	NP_001003787	WXS	Illumina HiSeq	Unspecified	Q7RTN6	STRAA_HUMAN			11	1038	-			293			Protein kinase.		B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Silent	SNP	ENST00000336174.6	37	c.879C>T	CCDS32703.1																																																																																				0.632	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1			21	74	0	0	0	0.021523	0	21	74				
SLC9A3R1	9368	broad.mit.edu	37	17	72759559	72759559	+	Silent	SNP	C	C	T	rs147104235	byFrequency	TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:72759559C>T	ENST00000262613.5	+	3	852	c.657C>T	c.(655-657)atC>atT	p.I219I	SLC9A3R1_ENST00000413388.2_Silent_p.I63I	NM_004252.4	NP_004243.1	O14745	NHRF1_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1	219	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|bile acid secretion (GO:0032782)|cellular phosphate ion homeostasis (GO:0030643)|cellular protein localization (GO:0034613)|glutathione transport (GO:0034635)|microvillus assembly (GO:0030033)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of sodium:proton antiporter activity (GO:0032416)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein complex assembly (GO:0006461)|regulation of excretion (GO:0044062)|regulation of protein kinase activity (GO:0045859)|regulation of sodium:proton antiporter activity (GO:0032415)|renal absorption (GO:0070293)|renal phosphate ion absorption (GO:0097291)|renal sodium ion transport (GO:0003096)|Wnt signaling pathway (GO:0016055)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|membrane raft (GO:0045121)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle (GO:0031982)	beta-2 adrenergic receptor binding (GO:0031698)|beta-catenin binding (GO:0008013)|chloride channel regulator activity (GO:0017081)|growth factor receptor binding (GO:0070851)|PDZ domain binding (GO:0030165)|phosphatase binding (GO:0019902)|protein self-association (GO:0043621)|receptor binding (GO:0005102)			large_intestine(4)	4						TGTCCGCCATCAGGGCTGGCG	0.607																																							uc002jlo.2		NA																	0					0						c.(655-657)ATC>ATT		sodium/hydrogen exchanger regulatory factor 1							59.0	54.0	56.0					17																	72759559		2201	4300	6501	SO:0001819	synonymous_variant	9368				apoptosis|bile acid secretion|glutathione transport|microvillus assembly|negative regulation of cell proliferation|negative regulation of ERK1 and ERK2 cascade|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|protein complex assembly|regulation of protein kinase activity|regulation of sodium:hydrogen antiporter activity|renal absorption|Wnt receptor signaling pathway	actin cytoskeleton|apical plasma membrane|centrosome|endomembrane system|filopodium|intracellular membrane-bounded organelle|microvillus membrane|ruffle	beta-2 adrenergic receptor binding|beta-catenin binding|chloride channel regulator activity|growth factor receptor binding|PDZ domain binding|phosphatase binding|protein self-association	g.chr17:72759559C>T	AF015926	CCDS11705.1	17q25.1	2014-09-04	2012-03-22		ENSG00000109062	ENSG00000109062			11075	protein-coding gene	gene with protein product		604990	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1"""			9314537, 9430655	Standard	NM_004252		Approved	NHERF, EBP50	uc002jlo.4	O14745	OTTHUMG00000178863	ENST00000262613.5:c.657C>T	17.37:g.72759559C>T			Somatic				SLC9A3R1_uc002jln.1_RNA|SLC9A3R1_uc002jlp.2_Silent_p.I63I	p.I219I	NM_004252	NP_004243	WXS	Illumina HiSeq	Unspecified	O14745	NHRF1_HUMAN			3	880	+			219			PDZ 2.		B3KY21|O43552|Q86WQ5	Silent	SNP	ENST00000262613.5	37	c.657C>T	CCDS11705.1																																																																																				0.607	SLC9A3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443671.1			8	23	0	0	0	0.008291	0	8	23				
ROCK1	6093	broad.mit.edu	37	18	18586533	18586533	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr18:18586533C>G	ENST00000399799.2	-	16	2604	c.1664G>C	c.(1663-1665)aGg>aCg	p.R555T		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	555	Interaction with FHOD1.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					CGATTCTGTCCTAAGTAAGTC	0.348																																							uc002kte.2		NA																	0				lung(2)|breast(2)|central_nervous_system(1)	5						c.(1663-1665)AGG>ACG		Rho-associated, coiled-coil containing protein							103.0	90.0	94.0					18																	18586533		2203	4300	6503	SO:0001583	missense	6093				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity	g.chr18:18586533C>G		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.1664G>C	18.37:g.18586533C>G	ENSP00000382697:p.Arg555Thr		Somatic					p.R555T	NM_005406	NP_005397	WXS	Illumina HiSeq	Unspecified	Q13464	ROCK1_HUMAN			16	2605	-	Melanoma(1;0.165)		555			Interaction with FHOD1.|Potential.		B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	c.1664G>C	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782363	0.90282	.	.	ENSG00000067900	ENST00000399799	T	0.65732	-0.17	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.73481	0.3592	M	0.75447	2.3	0.80722	D	1	P	0.51449	0.945	P	0.50860	0.652	T	0.77000	-0.2750	10	0.87932	D	0	.	19.4568	0.94895	0.0:1.0:0.0:0.0	.	555	Q13464	ROCK1_HUMAN	T	555	ENSP00000382697:R555T	ENSP00000382697:R555T	R	-	2	0	ROCK1	16840531	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.320000	0.79064	2.832000	0.97577	0.655000	0.94253	AGG		0.348	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406		12	45	0	0	0	0.010729	0	12	45				
SLC14A2	8170	broad.mit.edu	37	18	43216966	43216966	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr18:43216966C>A	ENST00000255226.6	+	6	1478	c.662C>A	c.(661-663)tCt>tAt	p.S221Y	SLC14A2_ENST00000586448.1_Missense_Mutation_p.S221Y	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	221					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CCAGTTCTTTCTAGTGCCTTG	0.517																																							uc010dnj.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(661-663)TCT>TAT		solute carrier family 14 (urea transporter),							256.0	253.0	254.0					18																	43216966		2203	4300	6503	SO:0001583	missense	8170					apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity	g.chr18:43216966C>A	X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.662C>A	18.37:g.43216966C>A	ENSP00000255226:p.Ser221Tyr		Somatic				SLC14A2_uc002lbb.2_Missense_Mutation_p.S221Y|SLC14A2_uc002lbe.2_Missense_Mutation_p.S221Y	p.S221Y	NM_007163	NP_009094	WXS	Illumina HiSeq	Unspecified	Q15849	UT2_HUMAN			7	983	+			221			Helical; (Potential).		A8K8Q7|Q2TBD6|Q96PH5	Missense_Mutation	SNP	ENST00000255226.6	37	c.662C>A	CCDS11924.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413378	0.83449	.	.	ENSG00000132874	ENST00000255226	T	0.52526	0.66	5.15	4.28	0.50868	.	0.059858	0.64402	D	0.000001	T	0.60117	0.2244	M	0.84511	2.7	0.80722	D	1	P	0.47106	0.89	P	0.50490	0.642	T	0.62263	-0.6891	10	0.20519	T	0.43	-8.1969	13.6206	0.62134	0.0:0.926:0.0:0.074	.	221	Q15849	UT2_HUMAN	Y	221	ENSP00000255226:S221Y	ENSP00000255226:S221Y	S	+	2	0	SLC14A2	41470964	1.000000	0.71417	0.186000	0.23195	0.616000	0.37450	5.335000	0.65929	1.409000	0.46915	0.655000	0.94253	TCT		0.517	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1			42	154	1	0	6.4308e-24	0.01441	7.23465e-24	42	154				
LINGO3	645191	broad.mit.edu	37	19	2290251	2290251	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:2290251C>G	ENST00000585527.1	-	1	1772	c.1525G>C	c.(1525-1527)Gag>Cag	p.E509Q	LINGO3_ENST00000404279.1_Missense_Mutation_p.E509Q			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	509						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						TTGTGGGCCTCGCCCGGGGTC	0.726																																							uc010dsx.1		NA																	0					0						c.(1525-1527)GAG>CAG		leucine rich repeat and Ig domain containing 3							14.0	17.0	16.0					19																	2290251		1931	4081	6012	SO:0001583	missense	645191					integral to membrane		g.chr19:2290251C>G	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.1525G>C	19.37:g.2290251C>G	ENSP00000467753:p.Glu509Gln		Somatic				SPPL2B_uc010dsw.1_Intron|uc002lvo.1_5'UTR	p.E509Q	NM_001101391	NP_001094861	WXS	Illumina HiSeq	Unspecified	P0C6S8	LIGO3_HUMAN			2	1653	-			509			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000585527.1	37	c.1525G>C	CCDS45905.1	.	.	.	.	.	.	.	.	.	.	c	9.391	1.075460	0.20227	.	.	ENSG00000220008	ENST00000404279	T	0.57273	0.41	4.24	3.2	0.36748	.	.	.	.	.	T	0.34193	0.0889	N	0.14661	0.345	0.22305	N	0.999212	B	0.20261	0.043	B	0.25140	0.058	T	0.23833	-1.0177	9	0.35671	T	0.21	.	7.5138	0.27590	0.0:0.8033:0.0:0.1967	.	509	P0C6S8	LIGO3_HUMAN	Q	509	ENSP00000384979:E509Q	ENSP00000384979:E509Q	E	-	1	0	LINGO3	2241251	0.957000	0.32711	0.933000	0.37362	0.735000	0.41995	2.306000	0.43673	0.784000	0.33661	0.555000	0.69702	GAG		0.726	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451291.2	NM_001101391		4	26	0	0	0	0.021553	0	4	26				
MRPL4	51073	broad.mit.edu	37	19	10369342	10369342	+	Silent	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:10369342C>T	ENST00000253099.6	+	8	1007	c.720C>T	c.(718-720)ttC>ttT	p.F240F	CTD-2369P2.4_ENST00000587088.1_RNA|CTD-2369P2.5_ENST00000592893.1_RNA|MRPL4_ENST00000307422.5_Silent_p.F240F|MRPL4_ENST00000393733.2_Silent_p.F240F|MRPL4_ENST00000590669.1_Silent_p.F240F	NM_015956.2|NM_146388.1	NP_057040.2|NP_666500.1	Q9BYD3	RM04_HUMAN	mitochondrial ribosomal protein L4	240					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11		Renal(1328;0.0112)	OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;1.99e-06)|all cancers(31;4.81e-06)	Lung(535;0.00705)		TTAAGACCTTCAACTTGATCC	0.567																																							uc002mnm.2		NA																	0				ovary(1)	1						c.(718-720)TTC>TTT		mitochondrial ribosomal protein L4 isoform a							120.0	118.0	119.0					19																	10369342		2203	4300	6503	SO:0001819	synonymous_variant	51073				translation	mitochondrion|ribosome	structural constituent of ribosome	g.chr19:10369342C>T	AB049635	CCDS12230.1, CCDS42499.1	19p13.2	2012-11-14			ENSG00000105364	ENSG00000105364		"""Mitochondrial ribosomal proteins / large subunits"""	14276	protein-coding gene	gene with protein product		611823					Standard	NM_015956		Approved	CGI-28	uc002mnn.3	Q9BYD3	OTTHUMG00000180400	ENST00000253099.6:c.720C>T	19.37:g.10369342C>T			Somatic				MRPL4_uc002mnn.2_Silent_p.F240F|MRPL4_uc002mno.2_Silent_p.F240F	p.F240F	NM_146387	NP_666499	WXS	Illumina HiSeq	Unspecified	Q9BYD3	RM04_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;1.99e-06)|all cancers(31;4.81e-06)	Lung(535;0.00705)	9	874	+		Renal(1328;0.0112)	240					A6NNV7|Q9BW07|Q9H4N2|Q9Y317	Silent	SNP	ENST00000253099.6	37	c.720C>T	CCDS12230.1																																																																																				0.567	MRPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451197.1			10	82	0	0	0	0.010729	0	10	82				
QTRT1	81890	broad.mit.edu	37	19	10823678	10823678	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:10823678G>A	ENST00000250237.5	+	9	1031	c.1021G>A	c.(1021-1023)Gcg>Acg	p.A341T		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	341					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CAACACGGCCGCGCTGCACCA	0.682																																							uc002mpr.2		NA																	0				skin(1)	1						c.(1021-1023)GCG>ACG		queuine tRNA-ribosyltransferase 1							43.0	36.0	38.0					19																	10823678		2203	4299	6502	SO:0001583	missense	81890				queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity	g.chr19:10823678G>A	AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.1021G>A	19.37:g.10823678G>A	ENSP00000250237:p.Ala341Thr		Somatic				DNM2_uc010dxk.2_5'Flank	p.A341T	NM_031209	NP_112486	WXS	Illumina HiSeq	Unspecified	Q9BXR0	TGT_HUMAN	Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)		9	1046	+			341					B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	37	c.1021G>A	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125339	0.77436	.	.	ENSG00000213339	ENST00000250237	.	.	.	4.33	4.33	0.51752	.	0.000000	0.64402	U	0.000001	D	0.83732	0.5318	H	0.95504	3.68	0.80722	D	1	P	0.52316	0.952	P	0.54590	0.756	D	0.89509	0.3770	9	0.87932	D	0	-15.6001	15.5854	0.76479	0.0:0.0:1.0:0.0	.	341	Q9BXR0	TGT_HUMAN	T	341	.	ENSP00000250237:A341T	A	+	1	0	QTRT1	10684678	1.000000	0.71417	0.426000	0.26672	0.322000	0.28314	8.423000	0.90264	1.967000	0.57214	0.491000	0.48974	GCG		0.682	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209		7	23	0	0	0	0.008291	0	7	23				
DCAF15	90379	broad.mit.edu	37	19	14070103	14070103	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:14070103C>A	ENST00000254337.6	+	7	1052	c.1031C>A	c.(1030-1032)cCt>cAt	p.P344H		NM_138353.2	NP_612362.2	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	344					protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)	11						GAAGCCCGGCCTGCCCTGTGC	0.701																																							uc002mxt.2		NA																	0				central_nervous_system(1)	1						c.(1030-1032)CCT>CAT		DDB1 and CUL4 associated factor 15							20.0	26.0	24.0					19																	14070103		2200	4300	6500	SO:0001583	missense	90379							g.chr19:14070103C>A	BC002926	CCDS32926.1	19p13.12	2009-07-17	2009-07-17	2009-07-17	ENSG00000132017	ENSG00000132017		"""DDB1 and CUL4 associated factors"""	25095	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 72"""	C19orf72			Standard	NM_138353		Approved	MGC99481	uc002mxt.3	Q66K64		ENST00000254337.6:c.1031C>A	19.37:g.14070103C>A	ENSP00000254337:p.Pro344His		Somatic				DCAF15_uc002mxu.2_5'Flank	p.P344H	NM_138353	NP_612362	WXS	Illumina HiSeq	Unspecified	Q66K64	DCA15_HUMAN			7	1037	+			344					B3KS86|Q96DW0|Q9BU31	Missense_Mutation	SNP	ENST00000254337.6	37	c.1031C>A	CCDS32926.1	.	.	.	.	.	.	.	.	.	.	c	4.411	0.076053	0.08485	.	.	ENSG00000132017	ENST00000254337	.	.	.	4.46	0.488	0.16848	.	0.406771	0.20233	N	0.096442	T	0.16557	0.0398	N	0.14661	0.345	0.09310	N	1	B	0.31351	0.32	B	0.31946	0.138	T	0.09773	-1.0659	9	0.45353	T	0.12	-0.6389	2.0597	0.03589	0.1371:0.4377:0.2218:0.2034	.	344	Q66K64	DCA15_HUMAN	H	344	.	ENSP00000254337:P344H	P	+	2	0	DCAF15	13931103	0.000000	0.05858	0.118000	0.21660	0.008000	0.06430	-0.867000	0.04241	0.315000	0.23110	0.491000	0.48974	CCT		0.701	DCAF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458099.1	NM_138353		3	25	1	0	0.00909568	0.009096	0.00936965	3	25				
TSHZ3	57616	broad.mit.edu	37	19	31770038	31770038	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:31770038C>T	ENST00000240587.4	-	2	988	c.661G>A	c.(661-663)Gct>Act	p.A221T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	221					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TCGTAGGCAGCGCTGCAGTCC	0.602																																							uc002nsy.3		NA																	0				ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(661-663)GCT>ACT		zinc finger protein 537							140.0	127.0	132.0					19																	31770038		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31770038C>T	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.661G>A	19.37:g.31770038C>T	ENSP00000240587:p.Ala221Thr		Somatic					p.A221T	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	726	-	Esophageal squamous(110;0.226)		221			C2H2-type 1.		Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.661G>A	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787726	0.70337	.	.	ENSG00000121297	ENST00000240587	T	0.13538	2.58	5.42	5.42	0.78866	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.058961	0.64402	D	0.000003	T	0.29749	0.0743	M	0.73962	2.25	0.80722	D	1	P	0.49253	0.921	P	0.49140	0.601	T	0.03981	-1.0987	10	0.66056	D	0.02	-26.043	19.2151	0.93774	0.0:1.0:0.0:0.0	.	221	Q63HK5	TSH3_HUMAN	T	221	ENSP00000240587:A221T	ENSP00000240587:A221T	A	-	1	0	TSHZ3	36461878	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	5.754000	0.68743	2.509000	0.84616	0.655000	0.94253	GCT		0.602	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		14	146	0	0	0	0.007413	0	14	146				
MAP4K1	11184	broad.mit.edu	37	19	39103253	39103253	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:39103253G>A	ENST00000591517.1	-	9	691	c.663C>T	c.(661-663)ctC>ctT	p.L221L	MAP4K1_ENST00000423454.2_5'UTR|MAP4K1_ENST00000589130.1_Silent_p.L217L|MAP4K1_ENST00000589002.1_5'UTR|MAP4K1_ENST00000396857.2_Silent_p.L221L|MAP4K1_ENST00000586296.1_Silent_p.L221L	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	221	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CTGCCTACCTGAGAGGGTGCA	0.607																																							uc002oix.1		NA																	0				skin(4)|lung(3)|ovary(1)	8						c.(661-663)CTC>CTT		mitogen-activated protein kinase kinase kinase							37.0	42.0	40.0					19																	39103253		2092	4234	6326	SO:0001819	synonymous_variant	11184				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity	g.chr19:39103253G>A	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.663C>T	19.37:g.39103253G>A			Somatic				MAP4K1_uc002oiy.1_Silent_p.L221L|MAP4K1_uc010xug.1_5'UTR	p.L221L	NM_007181	NP_009112	WXS	Illumina HiSeq	Unspecified	Q92918	M4K1_HUMAN	Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)		9	771	-	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		221			Protein kinase.			Silent	SNP	ENST00000591517.1	37	c.663C>T	CCDS59385.1																																																																																				0.607	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600		13	29	0	0	0	0.028581	0	13	29				
PRX	57716	broad.mit.edu	37	19	40902612	40902612	+	Silent	SNP	C	C	G	rs202113722		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:40902612C>G	ENST00000324001.7	-	7	1917	c.1647G>C	c.(1645-1647)ccG>ccC	p.P549P	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	549	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P549P(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGACACTTTCGGCAGCTGTA	0.577																																							uc002onr.2		NA																	1	Substitution - coding silent(1)	p.P549P(1)	ovary(1)	ovary(2)	2						c.(1645-1647)CCG>CCC		periaxin isoform 2							89.0	102.0	97.0					19																	40902612		2202	4297	6499	SO:0001819	synonymous_variant	57716				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding	g.chr19:40902612C>G	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1647G>C	19.37:g.40902612C>G			Somatic				PRX_uc002onq.2_Silent_p.P410P|PRX_uc002ons.2_3'UTR	p.P549P	NM_181882	NP_870998	WXS	Illumina HiSeq	Unspecified	Q9BXM0	PRAX_HUMAN	Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		7	1916	-			549			55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].|18.		Q9BXL9|Q9HCF2	Silent	SNP	ENST00000324001.7	37	c.1647G>C	CCDS33028.1																																																																																				0.577	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956		3	172	0	0	0	0.014758	0	3	172				
ZNF649	65251	broad.mit.edu	37	19	52394652	52394652	+	Missense_Mutation	SNP	C	C	T	rs200081147		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:52394652C>T	ENST00000354957.3	-	5	1021	c.737G>A	c.(736-738)aGg>aAg	p.R246K	CTC-429C10.2_ENST00000600329.1_RNA|ZNF649_ENST00000600738.1_Splice_Site	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	246					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GAGCCTGTACCTCTTGTAGAA	0.502																																							uc002pxy.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(736-738)AGG>AAG		zinc finger protein 649							126.0	123.0	124.0					19																	52394652		2203	4300	6503	SO:0001583	missense	65251				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52394652C>T	BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.737G>A	19.37:g.52394652C>T	ENSP00000347043:p.Arg246Lys		Somatic				ZNF577_uc010ydf.1_5'Flank	p.R246K	NM_023074	NP_075562	WXS	Illumina HiSeq	Unspecified	Q9BS31	ZN649_HUMAN		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)	5	1005	-		all_neural(266;0.0602)	246			C2H2-type 3.		A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	ENST00000354957.3	37	c.737G>A	CCDS12843.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	0.012	-1.651653	0.00785	.	.	ENSG00000198093	ENST00000354957	T	0.03951	3.75	2.35	-2.86	0.05717	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01661	0.0053	N	0.02708	-0.52	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45862	-0.9232	9	0.02654	T	1	.	8.4533	0.32884	0.0:0.4449:0.0:0.5551	.	246	Q9BS31	ZN649_HUMAN	K	246	ENSP00000347043:R246K	ENSP00000347043:R246K	R	-	2	0	ZNF649	57086464	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.392000	0.02523	-0.839000	0.04212	-1.750000	0.00680	AGG		0.502	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074		3	104	0	0	0	0.004672	0	3	104				
KIR3DL1	3811	broad.mit.edu	37	19	55340825	55340825	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:55340825G>T	ENST00000391728.4	+	7	1043	c.1010G>T	c.(1009-1011)aGa>aTa	p.R337I	KIR3DL1_ENST00000538269.1_Missense_Mutation_p.R337I|KIR3DL1_ENST00000541392.1_Missense_Mutation_p.R320I|KIR3DL1_ENST00000402254.2_Intron|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.R320I|KIR3DL1_ENST00000358178.4_Missense_Mutation_p.R242I	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	337					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		GGTAACCCCAGACACCTGCAC	0.433																																							uc002qhk.3		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5						c.(1009-1011)AGA>ATA		killer cell immunoglobulin-like receptor, three							270.0	207.0	229.0					19																	55340825		2175	4153	6328	SO:0001583	missense	3811				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity	g.chr19:55340825G>T	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.1010G>T	19.37:g.55340825G>T	ENSP00000375608:p.Arg337Ile		Somatic				KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.R262I|KIR3DL1_uc010esf.2_Missense_Mutation_p.R242I|KIR3DL1_uc010yfo.1_Missense_Mutation_p.R279I|KIR3DL1_uc002qhl.3_Intron	p.R337I	NM_013289	NP_037421	WXS	Illumina HiSeq	Unspecified	P43629	KI3L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	7	1073	+			337			Extracellular (Potential).		O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000391728.4	37	c.1010G>T	CCDS42621.1	.	.	.	.	.	.	.	.	.	.	-	9.790	1.177752	0.21787	.	.	ENSG00000167633	ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	T;T;T;T;T	0.00502	6.95;7.04;6.95;7.04;6.98	0.743	-1.28	0.09318	.	.	.	.	.	T	0.01287	0.0042	M	0.84219	2.685	0.09310	N	1	D;D;D	0.64830	0.994;0.994;0.967	D;D;P	0.68943	0.921;0.961;0.897	T	0.43310	-0.9399	9	0.87932	D	0	.	3.4985	0.07664	0.4576:0.0:0.5424:0.0	.	320;242;337	Q15702;Q14946;P43629	.;.;KI3L1_HUMAN	I	337;320;315;337;320;242	ENSP00000443350:R337I;ENSP00000442355:R320I;ENSP00000375608:R337I;ENSP00000326868:R320I;ENSP00000350901:R242I	ENSP00000326868:R320I	R	+	2	0	KIR3DL1	60032637	0.001000	0.12720	0.003000	0.11579	0.039000	0.13416	-0.043000	0.12043	-0.436000	0.07254	0.184000	0.17185	AGA		0.433	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141238.1	NM_013289		10	80	1	0	0.00010058	0.013537	0.000106168	10	80				
NLRP8	126205	broad.mit.edu	37	19	56466501	56466501	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:56466501G>A	ENST00000291971.3	+	3	1148	c.1077G>A	c.(1075-1077)acG>acA	p.T359T	NLRP8_ENST00000590542.1_Silent_p.T359T	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	359	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GGTTTAATACGATGGAAAAAA	0.453																																							uc002qmh.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13						c.(1075-1077)ACG>ACA		NLR family, pyrin domain containing 8							74.0	73.0	73.0					19																	56466501		2203	4300	6503	SO:0001819	synonymous_variant	126205					cytoplasm	ATP binding	g.chr19:56466501G>A	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1077G>A	19.37:g.56466501G>A			Somatic				NLRP8_uc010etg.2_Silent_p.T359T	p.T359T	NM_176811	NP_789781	WXS	Illumina HiSeq	Unspecified	Q86W28	NALP8_HUMAN		GBM - Glioblastoma multiforme(193;0.0695)	3	1148	+		Colorectal(82;0.000147)|Ovarian(87;0.17)	359			NACHT.		Q7RTR4	Silent	SNP	ENST00000291971.3	37	c.1077G>A	CCDS12937.1																																																																																				0.453	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811		28	60	0	0	0	0.015359	0	28	60				
USP34	9736	broad.mit.edu	37	2	61484020	61484020	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:61484020C>T	ENST00000398571.2	-	47	6190	c.6114G>A	c.(6112-6114)atG>atA	p.M2038I		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2038	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			AAATGTTCTTCATATCAGCCA	0.299																																							uc002sbe.2		NA																	0				ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19						c.(6112-6114)ATG>ATA		ubiquitin specific protease 34							31.0	29.0	29.0					2																	61484020		1827	4074	5901	SO:0001583	missense	9736				positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr2:61484020C>T	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6114G>A	2.37:g.61484020C>T	ENSP00000381577:p.Met2038Ile		Somatic				USP34_uc002sbf.2_Missense_Mutation_p.M188I	p.M2038I	NM_014709	NP_055524	WXS	Illumina HiSeq	Unspecified	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)		47	6136	-			2038					A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	c.6114G>A	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785179	0.90282	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.05139	3.49;3.49	5.63	5.63	0.86233	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.11367	0.0277	L	0.46670	1.46	0.80722	D	1	B	0.25486	0.127	B	0.32980	0.156	T	0.08994	-1.0695	10	0.46703	T	0.11	.	20.0344	0.97551	0.0:1.0:0.0:0.0	.	2038	Q70CQ2	UBP34_HUMAN	I	1886;1886;2038;316	ENSP00000381577:M2038I;ENSP00000410559:M316I	ENSP00000263989:M1886I	M	-	3	0	USP34	61337524	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.969000	0.70422	2.803000	0.96430	0.650000	0.86243	ATG		0.299	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			5	48	0	0	0	0.014758	0	5	48				
FBXO41	150726	broad.mit.edu	37	2	73493698	73493698	+	Missense_Mutation	SNP	C	C	T	rs369510771		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:73493698C>T	ENST00000521871.1	-	3	1433	c.1018G>A	c.(1018-1020)Gag>Aag	p.E340K	FBXO41_ENST00000520530.2_Missense_Mutation_p.E340K|FBXO41_ENST00000295133.5_Missense_Mutation_p.E401K			Q8TF61	FBX41_HUMAN	F-box protein 41	340										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						AGCTGCCGCTCGGCACGGTCA	0.701																																							uc002sjb.1		NA																	0				breast(2)|pancreas(1)	3						c.(1201-1203)GAG>AAG		F-box protein 41							15.0	18.0	17.0					2																	73493698		1993	4133	6126	SO:0001583	missense	150726					intracellular	protein binding|zinc ion binding	g.chr2:73493698C>T	AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.1018G>A	2.37:g.73493698C>T	ENSP00000428646:p.Glu340Lys		Somatic					p.E401K	NM_001080410	NP_001073879	WXS	Illumina HiSeq	Unspecified	Q8TF61	FBX41_HUMAN			3	1201	-			340			Potential.		G3V0Z7|Q2M1V8	Missense_Mutation	SNP	ENST00000521871.1	37	c.1201G>A	CCDS46337.2	.	.	.	.	.	.	.	.	.	.	C	35	5.424588	0.96111	.	.	ENSG00000163013	ENST00000295133;ENST00000521871;ENST00000520530	T;T	0.34667	1.35;1.35	5.17	5.17	0.71159	.	0.105655	0.64402	D	0.000006	T	0.58308	0.2113	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.61332	-0.7084	10	0.72032	D	0.01	.	17.2116	0.86931	0.0:1.0:0.0:0.0	.	340	Q8TF61	FBX41_HUMAN	K	401;340;401	ENSP00000295133:E401K;ENSP00000428646:E340K	ENSP00000295133:E401K	E	-	1	0	FBXO41	73347206	1.000000	0.71417	0.946000	0.38457	0.944000	0.59088	7.522000	0.81844	2.408000	0.81797	0.453000	0.30009	GAG		0.701	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377381.1			4	26	0	0	0	0.009096	0	4	26				
SNRNP200	23020	broad.mit.edu	37	2	96964614	96964614	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:96964614C>T	ENST00000323853.5	-	7	898	c.821G>A	c.(820-822)cGt>cAt	p.R274H	SNRNP200_ENST00000349783.5_Missense_Mutation_p.R274H	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	274					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						ATCATAGAAACGACTGAGCTG	0.438																																							uc002svu.2		NA																	0				ovary(5)|skin(4)|large_intestine(1)	10						c.(820-822)CGT>CAT		activating signal cointegrator 1 complex subunit							100.0	102.0	101.0					2																	96964614		2203	4300	6503	SO:0001583	missense	23020					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr2:96964614C>T	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.821G>A	2.37:g.96964614C>T	ENSP00000317123:p.Arg274His		Somatic					p.R274H	NM_014014	NP_054733	WXS	Illumina HiSeq	Unspecified	O75643	U520_HUMAN			7	907	-			274					O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	c.821G>A	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070404	0.76301	.	.	ENSG00000144028	ENST00000323853;ENST00000349783	T;T	0.68181	-0.31;1.52	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.59487	0.2197	L	0.33485	1.01	0.80722	D	1	B	0.10296	0.003	B	0.04013	0.001	T	0.54801	-0.8239	10	0.52906	T	0.07	-9.6731	18.3483	0.90329	0.0:1.0:0.0:0.0	.	274	O75643	U520_HUMAN	H	274	ENSP00000317123:R274H;ENSP00000326937:R274H	ENSP00000317123:R274H	R	-	2	0	SNRNP200	96328341	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.408000	0.80041	2.627000	0.88993	0.555000	0.69702	CGT		0.438	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		35	78	0	0	0	0.015359	0	35	78				
UGGT1	56886	broad.mit.edu	37	2	128870740	128870740	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:128870740A>T	ENST00000259253.6	+	6	651	c.604A>T	c.(604-606)Att>Ttt	p.I202F	UGGT1_ENST00000375990.3_Missense_Mutation_p.I178F	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	202					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CTACTCTGAGATTGGCTCTGA	0.343																																							uc002tps.2		NA																	0				ovary(1)	1						c.(604-606)ATT>TTT		UDP-glucose ceramide glucosyltransferase-like 1							89.0	96.0	94.0					2																	128870740		2203	4300	6503	SO:0001583	missense	56886				'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding	g.chr2:128870740A>T	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.604A>T	2.37:g.128870740A>T	ENSP00000259253:p.Ile202Phe		Somatic				UGGT1_uc010fme.1_Missense_Mutation_p.I77F|UGGT1_uc002tpr.2_Missense_Mutation_p.I178F	p.I202F	NM_020120	NP_064505	WXS	Illumina HiSeq	Unspecified	Q9NYU2	UGGG1_HUMAN			6	782	+			202					Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	c.604A>T	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	A	15.70	2.909977	0.52439	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.09538	2.97;2.97	5.58	4.4	0.53042	.	0.169358	0.51477	D	0.000091	T	0.17577	0.0422	M	0.79011	2.435	0.50039	D	0.999847	B;B	0.26602	0.154;0.036	B;B	0.31547	0.132;0.03	T	0.01345	-1.1379	10	0.36615	T	0.2	.	12.6101	0.56546	0.8613:0.1387:0.0:0.0	.	178;202	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	F	178;202	ENSP00000365158:I178F;ENSP00000259253:I202F	ENSP00000259253:I202F	I	+	1	0	UGGT1	128587210	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.537000	0.45702	0.911000	0.36747	0.477000	0.44152	ATT		0.343	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120		27	63	0	0	0	0.027356	0	27	63				
LOC401010	401010	broad.mit.edu	37	2	132200935	132200935	+	IGR	SNP	C	C	T	rs71345556		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:132200935C>T								AC073869.19 (34313 upstream) : RP11-109E12.1 (18458 downstream)																							CAGGTTGACACTGGACAGCTT	0.597																																							uc002tst.2		NA																	0					0						c.(1066-1068)AGT>AAT		SubName: Full=cDNA FLJ12694 fis, clone NT2RP1000358, highly similar to Homo sapiens mRNA; cDNA DKFZp564C186 (from clone DKFZp564C186);																																				SO:0001628	intergenic_variant	401010							g.chr2:132200935C>T																													2.37:g.132200935C>T			Somatic					p.S356N	NR_002826		WXS	Illumina HiSeq	Unspecified					1	1533	-									Missense_Mutation	SNP		37	c.1067G>A																																																																																				0	0.597									3	16	0	0	0	0.004672	0	3	16				
NCKAP5	344148	broad.mit.edu	37	2	133541671	133541671	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:133541671C>T	ENST00000409261.1	-	14	3086	c.2713G>A	c.(2713-2715)Gac>Aac	p.D905N	NCKAP5_ENST00000317721.6_Missense_Mutation_p.D905N|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	905										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TCTCCACTGTCACTAGACTCA	0.647																																							uc002ttp.2		NA																	0					0						c.(2713-2715)GAC>AAC		Nck-associated protein 5 isoform 1							41.0	43.0	42.0					2																	133541671		1951	4139	6090	SO:0001583	missense	344148						protein binding	g.chr2:133541671C>T	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2713G>A	2.37:g.133541671C>T	ENSP00000387128:p.Asp905Asn		Somatic				NCKAP5_uc002ttq.2_Intron	p.D905N	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			14	3087	-			905					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.2713G>A	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	c	2.895	-0.228713	0.06022	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.12465	2.68;2.68	4.95	3.08	0.35506	.	0.172467	0.26609	N	0.023433	T	0.08758	0.0217	N	0.20986	0.625	0.09310	N	0.999997	B	0.12013	0.005	B	0.13407	0.009	T	0.28138	-1.0053	10	0.35671	T	0.21	.	8.2468	0.31693	0.0:0.7318:0.0:0.2682	.	905	O14513	NCKP5_HUMAN	N	905	ENSP00000387128:D905N;ENSP00000380603:D905N	ENSP00000380603:D905N	D	-	1	0	NCKAP5	133258141	0.002000	0.14202	0.001000	0.08648	0.028000	0.11728	0.382000	0.20635	0.640000	0.30582	0.645000	0.84053	GAC		0.647	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		26	53	0	0	0	0.009535	0	26	53				
XIRP2	129446	broad.mit.edu	37	2	168105622	168105622	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:168105622C>G	ENST00000409195.1	+	9	7809	c.7720C>G	c.(7720-7722)Caa>Gaa	p.Q2574E	XIRP2_ENST00000295237.9_Missense_Mutation_p.Q2574E|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.Q2352E|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2399					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGTTAAAACTCAAAGCCAAAA	0.333																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(7720-7722)CAA>GAA		xin actin-binding repeat containing 2 isoform 1							95.0	89.0	91.0					2																	168105622		1831	4080	5911	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168105622C>G	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7720C>G	2.37:g.168105622C>G	ENSP00000386840:p.Gln2574Glu		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.Q2399E|XIRP2_uc010fpq.2_Missense_Mutation_p.Q2352E|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	p.Q2574E	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	7738	+			2399					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.7720C>G	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.592905	0.00126	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02050	4.48;4.48;4.48	6.07	4.29	0.51040	.	0.286633	0.32231	N	0.006387	T	0.00695	0.0023	N	0.00170	-1.935	0.21105	N	0.99978	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.48714	-0.9011	10	0.02654	T	1	-12.2981	15.726	0.77761	0.0:0.3929:0.6071:0.0	.	2399;2399;2352	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	E	2574;2574;2352	ENSP00000386840:Q2574E;ENSP00000295237:Q2574E;ENSP00000387255:Q2352E	ENSP00000295237:Q2574E	Q	+	1	0	XIRP2	167813868	0.972000	0.33761	0.109000	0.21407	0.061000	0.15899	3.033000	0.49743	0.900000	0.36469	-0.840000	0.03056	CAA		0.333	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		15	54	0	0	0	0.0333	0	15	54				
HDLBP	3069	broad.mit.edu	37	2	242187753	242187753	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:242187753C>A	ENST00000391975.1	-	13	1750	c.1523G>T	c.(1522-1524)cGt>cTt	p.R508L	HDLBP_ENST00000391976.2_Missense_Mutation_p.R508L|HDLBP_ENST00000310931.4_Missense_Mutation_p.R508L|HDLBP_ENST00000427183.2_Missense_Mutation_p.R475L|HDLBP_ENST00000476807.1_5'UTR	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	508	KH 5. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)	p.R508H(1)		breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		ATCCTTGGTACGCTCATTTTC	0.458																																							uc002waz.2		NA																	1	Substitution - Missense(1)		endometrium(1)	breast(3)|skin(1)	4						c.(1522-1524)CGT>CTT		high density lipoprotein binding protein							121.0	116.0	118.0					2																	242187753		2203	4300	6503	SO:0001583	missense	3069				cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding	g.chr2:242187753C>A		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1523G>T	2.37:g.242187753C>A	ENSP00000375836:p.Arg508Leu		Somatic				HDLBP_uc002wba.2_Missense_Mutation_p.R508L|HDLBP_uc002wbb.2_Missense_Mutation_p.R460L	p.R508L	NM_203346	NP_976221	WXS	Illumina HiSeq	Unspecified	Q00341	VIGLN_HUMAN		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)	13	1751	-		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)	508			KH 5.		B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	37	c.1523G>T	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921031	0.73213	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000452931	T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;2.0	6.17	3.46	0.39613	K Homology (1);K Homology, type 1 (1);	0.044585	0.85682	D	0.000000	T	0.53738	0.1815	M	0.76002	2.32	0.80722	D	1	P;D	0.61080	0.572;0.989	B;P	0.53809	0.363;0.735	T	0.54728	-0.8250	10	0.49607	T	0.09	-7.9844	11.7143	0.51643	0.0:0.8105:0.0:0.1895	.	475;508	E7EM71;Q00341	.;VIGLN_HUMAN	L	508;508;508;475;17	ENSP00000375836:R508L;ENSP00000375837:R508L;ENSP00000312042:R508L;ENSP00000399139:R475L;ENSP00000388876:R17L	ENSP00000312042:R508L	R	-	2	0	HDLBP	241836426	1.000000	0.71417	0.492000	0.27490	0.990000	0.78478	7.755000	0.85180	0.502000	0.28037	0.655000	0.94253	CGT		0.458	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346		24	72	1	0	2.44723e-14	0.024334	2.69985e-14	24	72				
GAL3ST2	64090	broad.mit.edu	37	2	242741340	242741340	+	Silent	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:242741340A>G	ENST00000192314.6	+	3	395	c.264A>G	c.(262-264)tcA>tcG	p.S88S	AC114730.5_ENST00000437438.1_RNA	NM_022134.2	NP_071417.2	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	88					biosynthetic process (GO:0009058)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|skin(1)	14		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CCGCCGGCTCACGCGTCCACC	0.642																																							uc002wcj.1		NA																	0					0						c.(262-264)TCA>TCG		galactose-3-O-sulfotransferase 2							58.0	52.0	54.0					2																	242741340		2203	4299	6502	SO:0001819	synonymous_variant	64090				biosynthetic process	Golgi cisterna membrane|integral to membrane	galactosylceramide sulfotransferase activity	g.chr2:242741340A>G	AB040610	CCDS33427.1	2q37.2	2014-05-19			ENSG00000154252	ENSG00000154252		"""Sulfotransferases, membrane-bound"""	24869	protein-coding gene	gene with protein product		608237				11029462	Standard	NM_022134		Approved	GP3ST	uc002wcj.1	Q9H3Q3	OTTHUMG00000151473	ENST00000192314.6:c.264A>G	2.37:g.242741340A>G			Somatic					p.S88S	NM_022134	NP_071417	WXS	Illumina HiSeq	Unspecified	Q9H3Q3	G3ST2_HUMAN		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)	3	395	+		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)	88			Lumenal (Potential).		Q17RK0|Q57Z52	Silent	SNP	ENST00000192314.6	37	c.264A>G	CCDS33427.1																																																																																				0.642	GAL3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322792.1	NM_022134		7	78	0	0	0	0.006214	0	7	78				
SLC4A11	83959	broad.mit.edu	37	20	3211402	3211402	+	Missense_Mutation	SNP	C	C	T	rs376120280		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:3211402C>T	ENST00000380056.3	-	10	1353	c.1306G>A	c.(1306-1308)Gcg>Acg	p.A436T	SLC4A11_ENST00000488544.1_5'Flank|SLC4A11_ENST00000380059.3_Missense_Mutation_p.A463T|SLC4A11_ENST00000539553.2_Missense_Mutation_p.A420T	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	436	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						GCCAGGGGCGCGGTGGTCAGC	0.682																																					NSCLC(190;922 2139 10266 10292 38692)	NSCLC(190;922 2139 10266 10292 38692)	uc002wig.2		NA																	0				ovary(1)	1						c.(1306-1308)GCG>ACG		solute carrier family 4 member 11		C	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	39.0	47.0	44.0		1258,1387,1306	4.2	0.9	20		44	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	SLC4A11	NM_001174089.1,NM_001174090.1,NM_032034.3	58,58,58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	420/876,463/919,436/892	3211402	2,13004	2203	4300	6503	SO:0001583	missense	83959				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity	g.chr20:3211402C>T	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1306G>A	20.37:g.3211402C>T	ENSP00000369396:p.Ala436Thr		Somatic				SLC4A11_uc010zqe.1_Missense_Mutation_p.A463T|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.A420T	p.A436T	NM_032034	NP_114423	WXS	Illumina HiSeq	Unspecified	Q8NBS3	S4A11_HUMAN			10	1354	-			436			Helical; (Potential).|Membrane (bicarbonate transporter).		B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	c.1306G>A	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.108371	0.77096	0.0	2.33E-4	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	T;T;T	0.78816	-1.21;-1.21;-1.21	5.12	4.17	0.49024	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79516	0.4459	M	0.85373	2.75	0.80722	D	1	P;P;P	0.48016	0.883;0.904;0.904	B;B;B	0.42112	0.258;0.376;0.376	D	0.83901	0.0290	10	0.72032	D	0.01	.	11.9396	0.52892	0.0:0.9141:0.0:0.0859	.	420;463;436	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	T	463;436;420	ENSP00000369399:A463T;ENSP00000369396:A436T;ENSP00000441370:A420T	ENSP00000369396:A436T	A	-	1	0	SLC4A11	3159402	1.000000	0.71417	0.895000	0.35142	0.986000	0.74619	4.612000	0.61169	2.384000	0.81235	0.563000	0.77884	GCG		0.682	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1			3	38	0	0	0	0.004672	0	3	38				
ANKEF1	63926	broad.mit.edu	37	20	10030698	10030698	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:10030698C>G	ENST00000378380.3	+	6	1810	c.1481C>G	c.(1480-1482)tCa>tGa	p.S494*	SNAP25-AS1_ENST00000421143.2_RNA|ANKEF1_ENST00000488991.1_3'UTR|SNAP25-AS1_ENST00000603542.1_RNA|ANKEF1_ENST00000378392.1_Nonsense_Mutation_p.S494*	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	494							calcium ion binding (GO:0005509)										AAGGTATTTTCAAACATTAAT	0.383																																							uc002wno.2		NA																	0				ovary(1)|breast(1)	2						c.(1480-1482)TCA>TGA		ankyrin repeat domain protein 5							99.0	97.0	98.0					20																	10030698		2203	4300	6503	SO:0001587	stop_gained	63926						calcium ion binding	g.chr20:10030698C>G	AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.1481C>G	20.37:g.10030698C>G	ENSP00000367631:p.Ser494*		Somatic				uc002wnn.1_Intron|ANKRD5_uc002wnp.2_Nonsense_Mutation_p.S494*|ANKRD5_uc010gbz.2_Nonsense_Mutation_p.S305*	p.S494*	NM_022096	NP_071379	WXS	Illumina HiSeq	Unspecified	Q9NU02	ANKR5_HUMAN			7	1874	+			494					B3KUQ0|Q9H6Y9	Nonsense_Mutation	SNP	ENST00000378380.3	37	c.1481C>G	CCDS13108.1	.	.	.	.	.	.	.	.	.	.	C	32	5.184678	0.94885	.	.	ENSG00000132623	ENST00000378392;ENST00000378380	.	.	.	5.77	3.84	0.44239	.	1.013580	0.07865	N	0.966931	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-17.8724	7.2008	0.25879	0.129:0.6748:0.1247:0.0715	.	.	.	.	X	494	.	ENSP00000367631:S494X	S	+	2	0	ANKRD5	9978698	0.032000	0.19561	0.430000	0.26722	0.029000	0.11900	1.485000	0.35519	0.901000	0.36495	-0.868000	0.02995	TCA		0.383	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077968.2	NM_022096		10	100	0	0	0	0.008291	0	10	100				
CSRP2BP	57325	broad.mit.edu	37	20	18142502	18142502	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:18142502G>C	ENST00000435364.3	+	5	1062	c.721G>C	c.(721-723)Gag>Cag	p.E241Q	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.E113Q|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.E240Q	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	241					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						CATTACTGTTGAGGGACTTAG	0.418																																							uc002wqj.2		NA																	0				lung(3)|ovary(2)|skin(1)	6						c.(721-723)GAG>CAG		CSRP2 binding protein							72.0	81.0	78.0					20																	18142502		2202	4300	6502	SO:0001583	missense	57325				histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity	g.chr20:18142502G>C	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.721G>C	20.37:g.18142502G>C	ENSP00000392318:p.Glu241Gln		Somatic				CSRP2BP_uc002wqk.2_Missense_Mutation_p.E113Q|CSRP2BP_uc010zru.1_Missense_Mutation_p.E112Q	p.E241Q	NM_020536	NP_065397	WXS	Illumina HiSeq	Unspecified	Q9H8E8	CSR2B_HUMAN			6	1343	+			241					A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	c.721G>C	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475544	0.63737	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.16457	2.35;2.36;2.35;2.34	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.27697	0.0681	N	0.24115	0.695	0.80722	D	1	D;D	0.61697	0.982;0.99	P;P	0.60345	0.873;0.815	T	0.00862	-1.1536	10	0.41790	T	0.15	-20.7082	20.2307	0.98348	0.0:0.0:1.0:0.0	.	113;241	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	Q	241;240;241;113	ENSP00000278816:E241Q;ENSP00000366909:E240Q;ENSP00000392318:E241Q;ENSP00000425909:E113Q	ENSP00000278816:E241Q	E	+	1	0	CSRP2BP	18090502	1.000000	0.71417	0.979000	0.43373	0.996000	0.88848	9.071000	0.93980	2.846000	0.97976	0.644000	0.83932	GAG		0.418	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536		20	85	0	0	0	0.014323	0	20	85				
SALL4	57167	broad.mit.edu	37	20	50407635	50407635	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:50407635C>G	ENST00000217086.4	-	2	1498	c.1387G>C	c.(1387-1389)Gac>Cac	p.D463H	SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000395997.3_Intron|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	463					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCTATGGGGTCAGGTACAGAG	0.532																																							uc002xwh.3		NA																	0				ovary(2)	2						c.(1387-1389)GAC>CAC		sal-like 4							77.0	82.0	80.0					20																	50407635		2203	4300	6503	SO:0001583	missense	57167				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:50407635C>G	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.1387G>C	20.37:g.50407635C>G	ENSP00000217086:p.Asp463His		Somatic				SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	p.D463H	NM_020436	NP_065169	WXS	Illumina HiSeq	Unspecified	Q9UJQ4	SALL4_HUMAN			2	1488	-			463					A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	c.1387G>C	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	C	3.993	-0.004069	0.07773	.	.	ENSG00000101115	ENST00000217086	T	0.08984	3.03	5.4	2.4	0.29515	.	0.183260	0.26590	N	0.023530	T	0.04543	0.0124	N	0.08118	0	0.19575	N	0.999964	B	0.18610	0.029	B	0.09377	0.004	T	0.36648	-0.9739	10	0.54805	T	0.06	-8.2543	10.7647	0.46286	0.0:0.7908:0.0:0.2092	.	463	Q9UJQ4	SALL4_HUMAN	H	463	ENSP00000217086:D463H	ENSP00000217086:D463H	D	-	1	0	SALL4	49841042	0.992000	0.36948	0.015000	0.15790	0.229000	0.25112	1.613000	0.36900	0.658000	0.30925	0.650000	0.86243	GAC		0.532	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3			23	127	0	0	0	0.01892	0	23	127				
LAMA5	3911	broad.mit.edu	37	20	60907449	60907449	+	Silent	SNP	G	G	A	rs142357165		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:60907449G>A	ENST00000252999.3	-	28	3597	c.3531C>T	c.(3529-3531)gcC>gcT	p.A1177A	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1177	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GTGCCTGTTCGGCTGTGAGCC	0.627																																							uc002ycq.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(3529-3531)GCC>GCT		laminin alpha 5 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						53.0	56.0	55.0					20																	60907449		2203	4300	6503	SO:0001819	synonymous_variant	3911				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding	g.chr20:60907449G>A	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.3531C>T	20.37:g.60907449G>A			Somatic					p.A1177A	NM_005560	NP_005551	WXS	Illumina HiSeq	Unspecified	O15230	LAMA5_HUMAN	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		28	3598	-	Breast(26;1.57e-08)		1177			Domain IV 1 (domain IV B).		Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	c.3531C>T	CCDS33502.1																																																																																				0.627	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560		9	109	0	0	0	0.006214	0	9	109				
KCNJ15	3772	broad.mit.edu	37	21	39671975	39671975	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr21:39671975G>A	ENST00000328656.4	+	4	1095	c.792G>A	c.(790-792)ctG>ctA	p.L264L	KCNJ15_ENST00000398934.1_Silent_p.L264L|KCNJ15_ENST00000398938.2_Silent_p.L264L|KCNJ15_ENST00000398930.1_Silent_p.L264L|KCNJ15_ENST00000398932.1_Silent_p.L264L	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	264					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	CGAGCCCCCTGAGAGACCTCA	0.547																																							uc002ywv.2		NA																	0				ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6						c.(790-792)CTG>CTA		potassium inwardly-rectifying channel J15							65.0	66.0	66.0					21																	39671975		2203	4300	6503	SO:0001819	synonymous_variant	3772				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity	g.chr21:39671975G>A	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.792G>A	21.37:g.39671975G>A			Somatic				KCNJ15_uc002yww.2_Silent_p.L264L|KCNJ15_uc002ywx.2_Silent_p.L264L	p.L264L	NM_002243	NP_002234	WXS	Illumina HiSeq	Unspecified	Q99712	IRK15_HUMAN			4	1094	+			264			Cytoplasmic (By similarity).		D3DSH5|O00564|Q96L28|Q99446	Silent	SNP	ENST00000328656.4	37	c.792G>A	CCDS13656.1																																																																																				0.547	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243		12	30	0	0	0	0.016723	0	12	30				
SEPT5	5413	broad.mit.edu	37	22	19709227	19709227	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:19709227G>A	ENST00000455784.2	+	9	907	c.782G>A	c.(781-783)cGg>cAg	p.R261Q	SEPT5_ENST00000406395.1_Missense_Mutation_p.R261Q|SEPT5_ENST00000383045.3_Missense_Mutation_p.R270Q|SEPT5_ENST00000438754.2_Missense_Mutation_p.R270Q|GP1BB_ENST00000366425.3_5'Flank	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	261	Septin-type G.				cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					CAGCGGGTCCGGGGCCGACTG	0.677																																							uc002zpv.1		NA																	0				lung(1)	1						c.(781-783)CGG>CAG		septin 5							41.0	53.0	49.0					22																	19709227		2203	4299	6502	SO:0001583	missense	5413				cell cycle|cytokinesis|regulation of exocytosis|synaptic vesicle targeting	plasma membrane|septin complex|synaptic vesicle	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr22:19709227G>A	Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.782G>A	22.37:g.19709227G>A	ENSP00000391311:p.Arg261Gln		Somatic				SEPT5_uc002zpw.1_RNA|SEPT5_uc002zpx.1_RNA|SEPT5_uc002zpy.1_5'UTR|SEPT5_uc002zpz.1_5'Flank	p.R261Q	NM_002688	NP_002679	WXS	Illumina HiSeq	Unspecified	Q99719	SEPT5_HUMAN			9	907	+	Colorectal(54;0.0993)		261					O15251|Q96MY5	Missense_Mutation	SNP	ENST00000455784.2	37	c.782G>A	CCDS13764.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006435	0.93287	.	.	ENSG00000184702	ENST00000455784;ENST00000406395;ENST00000412544;ENST00000431124;ENST00000383045;ENST00000438754	T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4	3.92	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.78400	0.4277	H	0.94771	3.58	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.84310	0.0510	10	0.87932	D	0	.	12.6461	0.56735	0.0:0.0:0.8233:0.1767	.	261	Q99719	SEPT5_HUMAN	Q	261;261;214;299;270;270	ENSP00000391311:R261Q;ENSP00000384535:R261Q;ENSP00000408678:R214Q;ENSP00000414488:R299Q;ENSP00000372515:R270Q;ENSP00000394541:R270Q	ENSP00000372515:R270Q	R	+	2	0	SEPT5	18089227	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	3.873000	0.56093	2.203000	0.70933	0.478000	0.44815	CGG		0.677	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317937.1	NM_002688		27	82	0	0	0	0.012213	0	27	82				
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	G	A	rs146546850	byFrequency	TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:29091841G>A	ENST00000405598.1	-	12	1307	c.1116C>T	c.(1114-1116)tcC>tcT	p.S372S	CHEK2_ENST00000382578.1_Silent_p.S281S|CHEK2_ENST00000403642.1_Silent_p.S281S|CHEK2_ENST00000402731.1_Silent_p.S343S|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000464581.1_5'Flank|CHEK2_ENST00000328354.6_Silent_p.S372S|CHEK2_ENST00000382580.2_Silent_p.S415S|CHEK2_ENST00000544772.1_Silent_p.S151S|CHEK2_ENST00000348295.3_Silent_p.S343S|CHEK2_ENST00000404276.1_Silent_p.S372S|CHEK2_ENST00000382565.1_Intron			O96017	CHK2_HUMAN	checkpoint kinase 2	372	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.S372S(8)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																															uc003adu.1		NA	yes	Rec		familial breast cancer	22	22q12.1	11200	F	CHK2 checkpoint homolog (S. pombe)			E		breast 			8	Substitution - coding silent(8)	p.S372S(1)	kidney(4)|prostate(2)|endometrium(1)|central_nervous_system(1)	central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						c.(1114-1116)TCC>TCT	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	protein kinase CHK2 isoform a							43.0	44.0	44.0					22																	29091841		2203	4300	6503	SO:0001819	synonymous_variant	11200	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer			cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr22:29091841G>A	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1116C>T	22.37:g.29091841G>A			Somatic				CHEK2_uc003ads.1_Silent_p.S151S|CHEK2_uc010gvh.1_Silent_p.S281S|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.S415S|CHEK2_uc003adv.1_Silent_p.S343S|CHEK2_uc003adw.1_Silent_p.S372S|CHEK2_uc003adx.1_Silent_p.S151S|CHEK2_uc003ady.1_Silent_p.S372S|CHEK2_uc003adz.1_Silent_p.S176S	p.S372S	NM_007194	NP_009125	WXS	Illumina HiSeq	Unspecified	O96017	CHK2_HUMAN			11	1188	-			372			Protein kinase.		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	SNP	ENST00000405598.1	37	c.1116C>T	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	G	5.792	0.330417	0.10956	.	.	ENSG00000183765	ENST00000434810	.	.	.	5.89	-2.11	0.07187	.	.	.	.	.	T	0.42154	0.1190	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33854	-0.9852	4	.	.	.	-7.6356	3.2532	0.06822	0.327:0.1103:0.4613:0.1014	.	.	.	.	L	116	.	.	P	-	2	0	CHEK2	27421841	0.997000	0.39634	0.996000	0.52242	0.470000	0.32858	0.318000	0.19504	-0.075000	0.12798	-0.907000	0.02831	CCA		0.413	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735		3	37	0	0	0	0.004482	0	3	37				
TIMP3	7078	broad.mit.edu	37	22	33255201	33255201	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:33255201C>T	ENST00000266085.6	+	5	774	c.473C>T	c.(472-474)aCt>aTt	p.T158I	SYN3_ENST00000332840.5_Intron|SYN3_ENST00000358763.2_Intron	NM_000362.4	NP_000353.1	P35625	TIMP3_HUMAN	TIMP metallopeptidase inhibitor 3	158	Mediates interaction with EFEMP1.				cellular response to organic substance (GO:0071310)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(2)|large_intestine(3)|lung(1)|urinary_tract(1)	7						TGCTTTGTGACTTCCAAGAAC	0.542																																							uc003anb.2		NA																	0				lung(1)	1						c.(472-474)ACT>ATT		tissue inhibitor of metalloproteinase 3							142.0	124.0	130.0					22																	33255201		2203	4300	6503	SO:0001583	missense	7078				negative regulation of membrane protein ectodomain proteolysis|visual perception		metal ion binding|metalloendopeptidase inhibitor activity|protein binding	g.chr22:33255201C>T		CCDS13911.1	22q12.3	2013-01-08	2008-07-31		ENSG00000100234	ENSG00000100234			11822	protein-coding gene	gene with protein product		188826	"""tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)"""	SFD		8188246, 12652295	Standard	NM_000362		Approved		uc003anb.3	P35625	OTTHUMG00000030784	ENST00000266085.6:c.473C>T	22.37:g.33255201C>T	ENSP00000266085:p.Thr158Ile		Somatic				SYN3_uc003amx.2_Intron|SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	p.T158I	NM_000362	NP_000353	WXS	Illumina HiSeq	Unspecified	P35625	TIMP3_HUMAN			5	1659	+			158			Mediates interaction with EFEMP1.		B2RBY9|Q5THV4|Q9UC74|Q9UGS2	Missense_Mutation	SNP	ENST00000266085.6	37	c.473C>T	CCDS13911.1	.	.	.	.	.	.	.	.	.	.	C	9.780	1.175151	0.21704	.	.	ENSG00000100234	ENST00000266085;ENST00000538671	D	0.94457	-3.43	5.36	3.21	0.36854	Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.255877	0.44688	D	0.000421	D	0.94676	0.8283	M	0.77103	2.36	0.80722	D	1	P	0.40332	0.713	B	0.43251	0.413	D	0.93754	0.7061	10	0.62326	D	0.03	.	15.7606	0.78076	0.0:0.7171:0.2829:0.0	.	158	P35625	TIMP3_HUMAN	I	158;92	ENSP00000266085:T158I	ENSP00000266085:T158I	T	+	2	0	TIMP3	31585201	1.000000	0.71417	0.993000	0.49108	0.007000	0.05969	6.092000	0.71414	0.607000	0.29982	-0.304000	0.09214	ACT		0.542	TIMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075672.2	NM_000362		72	61	0	0	0	0.01441	0	72	61				
MCM5	4174	broad.mit.edu	37	22	35817407	35817407	+	Silent	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:35817407C>T	ENST00000216122.4	+	15	2083	c.1929C>T	c.(1927-1929)ctC>ctT	p.L643L	MCM5_ENST00000382011.5_Silent_p.L600L	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	643					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						CCCTGCGGCTCTTCCAAGTGT	0.612																																							uc003anu.3		NA																	0				ovary(1)	1						c.(1927-1929)CTC>CTT		minichromosome maintenance complex component 5							106.0	106.0	106.0					22																	35817407		2203	4300	6503	SO:0001819	synonymous_variant	4174				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding	g.chr22:35817407C>T		CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.1929C>T	22.37:g.35817407C>T			Somatic				MCM5_uc010gwr.2_Silent_p.L452L|MCM5_uc003anv.3_Silent_p.L600L|MCM5_uc003anw.1_Silent_p.L427L	p.L643L	NM_006739	NP_006730	WXS	Illumina HiSeq	Unspecified	P33992	MCM5_HUMAN			15	2023	+			643					O60785|Q14578|Q9BTJ4|Q9BWL8	Silent	SNP	ENST00000216122.4	37	c.1929C>T	CCDS13915.1																																																																																				0.612	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3			46	121	0	0	0	0.01441	0	46	121				
TRIOBP	11078	broad.mit.edu	37	22	38154137	38154137	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:38154137G>C	ENST00000406386.3	+	16	6460	c.6205G>C	c.(6205-6207)Gag>Cag	p.E2069Q	TRIOBP_ENST00000407319.2_Missense_Mutation_p.E356Q|TRIOBP_ENST00000403663.2_Missense_Mutation_p.E356Q	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	2069					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CGAGGCACTGGAGAAGGAGGT	0.662																																							uc003atr.2		NA																	0				central_nervous_system(1)	1						c.(6205-6207)GAG>CAG		TRIO and F-actin binding protein isoform 6							15.0	20.0	19.0					22																	38154137		2171	4251	6422	SO:0001583	missense	11078				actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding	g.chr22:38154137G>C	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.6205G>C	22.37:g.38154137G>C	ENSP00000384312:p.Glu2069Gln		Somatic				TRIOBP_uc003atu.2_Missense_Mutation_p.E1897Q|TRIOBP_uc003atv.2_Missense_Mutation_p.E356Q|TRIOBP_uc003atw.2_Missense_Mutation_p.E356Q|TRIOBP_uc003atx.1_5'UTR|TRIOBP_uc010gxh.2_5'UTR	p.E2069Q	NM_001039141	NP_001034230	WXS	Illumina HiSeq	Unspecified	Q9H2D6	TARA_HUMAN			16	6476	+	Melanoma(58;0.0574)		2069			Potential.		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	c.6205G>C	CCDS43015.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.11|19.11	3.764854|3.764854	0.69878|0.69878	.|.	.|.	ENSG00000100106|ENSG00000100106	ENST00000406386;ENST00000407319;ENST00000403663|ENST00000428075	T|.	0.22945|.	1.93|.	5.66|5.66	4.63|4.63	0.57726|0.57726	.|.	.|.	.|.	.|.	.|.	T|T	0.58623|0.58623	0.2135|0.2135	L|L	0.43923|0.43923	1.385|1.385	0.41565|0.41565	D|D	0.988654|0.988654	P;P;P|.	0.49253|.	0.921;0.872;0.894|.	P;B;B|.	0.49999|.	0.628;0.397;0.404|.	T|T	0.54503|0.54503	-0.8284|-0.8284	9|5	0.32370|.	T|.	0.25|.	.|.	12.3972|12.3972	0.55391|0.55391	0.1333:0.0:0.8667:0.0|0.1333:0.0:0.8667:0.0	.|.	356;356;2069|.	F8W6V6;F2Z2W0;Q9H2D6|.	.;.;TARA_HUMAN|.	Q|A	2069;356;356|309	ENSP00000384312:E2069Q|.	ENSP00000386026:E356Q|.	E|G	+|+	1|2	0|0	TRIOBP|TRIOBP	36484083|36484083	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.802000|0.802000	0.45316|0.45316	3.267000|3.267000	0.51577|0.51577	2.665000|2.665000	0.90641|0.90641	0.561000|0.561000	0.74099|0.74099	GAG|GGA		0.662	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			7	26	0	0	0	0.006214	0	7	26				
APOBEC3A	200315	broad.mit.edu	37	22	39357577	39357577	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:39357577G>A	ENST00000402255.1	+	4	564	c.360G>A	c.(358-360)gtG>gtA	p.V120V	APOBEC3A_ENST00000249116.2_Silent_p.V120V			P31941	ABC3A_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A	120					cellular response to xenobiotic stimulus (GO:0071466)|clearance of foreign intracellular DNA by conversion of DNA cytidine to uridine (GO:0044356)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(2)|ovary(1)|skin(1)	5	Melanoma(58;0.04)					ACACACACGTGAGACTGCGTA	0.572																																							uc003awn.2		NA																	0				ovary(1)	1						c.(358-360)GTG>GTA		phorbolin 1							97.0	95.0	96.0					22																	39357577		2129	4074	6203	SO:0001819	synonymous_variant	200315				cellular response to xenobiotic stimulus|defense response to virus|DNA cytosine deamination|DNA demethylation|innate immune response|negative regulation of transposition|negative regulation of viral genome replication	cytoplasm|nucleus	cytidine deaminase activity|zinc ion binding	g.chr22:39357577G>A	U03891	CCDS13981.1	22q13.1-q13.2	2014-01-28			ENSG00000128383	ENSG00000128383		"""Apolipoprotein B mRNA editing enzymes"""	17343	protein-coding gene	gene with protein product	"""phorbolin I"""	607109				11863358, 10469298	Standard	NM_145699		Approved	ARP3, PHRBN		P31941	OTTHUMG00000151004	ENST00000402255.1:c.360G>A	22.37:g.39357577G>A			Somatic				APOBEC3A_uc011aob.1_Silent_p.V102V|APOBEC3A_uc011aoc.1_Silent_p.V120V	p.V120V	NM_145699	NP_663745	WXS	Illumina HiSeq	Unspecified	P31941	ABC3A_HUMAN			3	530	+	Melanoma(58;0.04)		120					A0AVM1|Q12807|Q5JZ93|Q9UH18	Silent	SNP	ENST00000402255.1	37	c.360G>A	CCDS13981.1																																																																																				0.572	APOBEC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320915.2	NM_145699		46	131	0	0	0	0.01441	0	46	131				
MLH1	4292	broad.mit.edu	37	3	37081768	37081768	+	Silent	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:37081768C>G	ENST00000231790.2	+	14	1866	c.1650C>G	c.(1648-1650)ctC>ctG	p.L550L	MLH1_ENST00000539477.1_Silent_p.L309L|MLH1_ENST00000536378.1_Silent_p.L309L|MLH1_ENST00000435176.1_Silent_p.L452L|MLH1_ENST00000458205.2_Silent_p.L309L|MLH1_ENST00000455445.2_Silent_p.L309L	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	550	Interaction with EXO1.		L -> P (in HNPCC2). {ECO:0000269|PubMed:16083711}.		ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						TATACCTTCTCAACACCACCA	0.498		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc003cgl.2		1	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	D|Mis|N|F|S	E.coli MutL homolog gene			"""E, O"""		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		1	Whole gene deletion(1)	p.0?(1)	ovary(1)	large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						c.(1648-1650)CTC>CTG	MMR	MutL protein homolog 1							140.0	115.0	123.0					3																	37081768		2203	4300	6503	SO:0001819	synonymous_variant	4292	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	g.chr3:37081768C>G	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.1650C>G	3.37:g.37081768C>G			Somatic				MLH1_uc011aye.1_Silent_p.L309L|MLH1_uc011ayb.1_Silent_p.L309L|MLH1_uc010hge.2_Silent_p.L550L|MLH1_uc003cgn.3_Silent_p.L309L|MLH1_uc011ayc.1_Silent_p.L452L|MLH1_uc011ayd.1_Silent_p.L309L|MLH1_uc003cgo.2_Silent_p.L309L|MLH1_uc010hgj.1_Silent_p.L192L|MLH1_uc010hgk.2_Silent_p.L192L|MLH1_uc010hgl.1_Silent_p.L125L|MLH1_uc010hgn.2_Silent_p.L192L|MLH1_uc010hgm.2_Intron|MLH1_uc010hgo.2_Intron|MLH1_uc010hgp.2_5'Flank|MLH1_uc010hgq.2_5'Flank	p.L550L	NM_000249	NP_000240	WXS	Illumina HiSeq	Unspecified	P40692	MLH1_HUMAN			14	1710	+			550		L -> P (in HNPCC2).	Interaction with EXO1.		B4DI13|B4DQ11|E9PCU2	Silent	SNP	ENST00000231790.2	37	c.1650C>G	CCDS2663.1	.	.	.	.	.	.	.	.	.	.	C	0.034	-1.314410	0.01331	.	.	ENSG00000076242	ENST00000421440;ENST00000456676	.	.	.	5.74	1.71	0.24356	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.0699	6.8028	0.23760	0.1228:0.456:0.3564:0.0649	.	.	.	.	X	92;542	.	ENSP00000413580:S92X	S	+	2	0	MLH1	37056772	0.999000	0.42202	0.999000	0.59377	0.001000	0.01503	0.744000	0.26245	0.331000	0.23511	-1.099000	0.02127	TCA		0.498	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249		13	51	0	0	0	0.007413	0	13	51				
ITGA9	3680	broad.mit.edu	37	3	37565099	37565099	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:37565099C>T	ENST00000264741.5	+	12	1580	c.1324C>T	c.(1324-1326)Cct>Tct	p.P442S	ITGA9_ENST00000422441.1_Missense_Mutation_p.P442S	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	442					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.P442T(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		AAATGGCTATCCTGGTAAGCT	0.383																																							uc003chd.2		NA																	1	Substitution - Missense(1)		skin(1)	breast(3)|pancreas(1)|lung(1)|skin(1)	6						c.(1324-1326)CCT>TCT		integrin, alpha 9 precursor							113.0	104.0	107.0					3																	37565099		2203	4300	6503	SO:0001583	missense	3680				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr3:37565099C>T	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1324C>T	3.37:g.37565099C>T	ENSP00000264741:p.Pro442Ser		Somatic				ITGA9_uc003chc.2_Missense_Mutation_p.P442S	p.P442S	NM_002207	NP_002198	WXS	Illumina HiSeq	Unspecified	Q13797	ITA9_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)	12	1377	+			442			Extracellular (Potential).|Potential.|FG-GAP 7.		Q14638	Missense_Mutation	SNP	ENST00000264741.5	37	c.1324C>T	CCDS2669.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.718870	0.48622	.	.	ENSG00000144668	ENST00000422441;ENST00000264741	T;T	0.58060	0.36;0.36	5.97	5.97	0.96955	.	0.213397	0.42964	D	0.000630	T	0.53932	0.1827	M	0.70842	2.15	0.44492	D	0.99743	P;B	0.36753	0.568;0.049	B;B	0.38106	0.265;0.04	T	0.52419	-0.8578	10	0.33940	T	0.23	.	13.6104	0.62074	0.0:0.9296:0.0:0.0704	.	442;442	Q13797;E9PDS3	ITA9_HUMAN;.	S	442	ENSP00000397258:P442S;ENSP00000264741:P442S	ENSP00000264741:P442S	P	+	1	0	ITGA9	37540103	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	4.138000	0.58017	2.836000	0.97738	0.655000	0.94253	CCT		0.383	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207		7	65	0	0	0	0.00308	0	7	65				
GORASP1	64689	broad.mit.edu	37	3	39139759	39139759	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:39139759C>T	ENST00000319283.3	-	9	2112	c.1291G>A	c.(1291-1293)Gac>Aac	p.D431N	GORASP1_ENST00000422110.2_Missense_Mutation_p.D276N|GORASP1_ENST00000476334.1_5'Flank|GORASP1_ENST00000479927.1_Missense_Mutation_p.D336N	NM_031899.2	NP_114105.1	Q9BQQ3	GORS1_HUMAN	golgi reassembly stacking protein 1, 65kDa	431					Golgi organization (GO:0007030)|mitotic cell cycle (GO:0000278)|negative regulation of dendrite morphogenesis (GO:0050774)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(1)|ovary(3)|urinary_tract(1)	14				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GCCTGGCTGTCCAGCCCCTCA	0.607																																							uc003ciw.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1291-1293)GAC>AAC		Golgi reassembly stacking protein 1							85.0	75.0	79.0					3																	39139759		2203	4300	6503	SO:0001583	missense	64689				mitotic prophase|protein transport	cytosol|Golgi apparatus|membrane		g.chr3:39139759C>T	AJ409349	CCDS2681.1, CCDS63596.1, CCDS63597.1	3p22-p21.33	2008-04-23	2002-08-29	2002-05-24	ENSG00000114745	ENSG00000114745			16769	protein-coding gene	gene with protein product		606867	"""golgi phosphoprotein 5"""	GOLPH5			Standard	NM_001278789		Approved	GRASP65, P65, FLJ23443	uc003ciw.1	Q9BQQ3	OTTHUMG00000131292	ENST00000319283.3:c.1291G>A	3.37:g.39139759C>T	ENSP00000313869:p.Asp431Asn		Somatic				GORASP1_uc003civ.1_RNA|GORASP1_uc003cix.1_RNA|GORASP1_uc003ciy.1_RNA|GORASP1_uc011ayw.1_Missense_Mutation_p.D336N|GORASP1_uc003ciz.1_Missense_Mutation_p.D276N	p.D431N	NM_031899	NP_114105	WXS	Illumina HiSeq	Unspecified	Q9BQQ3	GORS1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)	9	1389	-			431					B3KWC8|Q3SYG7|Q8N272|Q96H42	Missense_Mutation	SNP	ENST00000319283.3	37	c.1291G>A	CCDS2681.1	.	.	.	.	.	.	.	.	.	.	C	11.48	1.652440	0.29336	.	.	ENSG00000114745	ENST00000319283;ENST00000422110;ENST00000479927	T;T;T	0.44083	0.95;0.93;0.94	4.64	3.76	0.43208	.	1.733330	0.02911	N	0.136681	T	0.27731	0.0682	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.15122	-1.0448	10	0.35671	T	0.21	-3.3769	8.6994	0.34316	0.0:0.8954:0.0:0.1046	.	336;276;431	B4E1H8;B3KPY8;Q9BQQ3	.;.;GORS1_HUMAN	N	431;276;336	ENSP00000313869:D431N;ENSP00000395709:D276N;ENSP00000419123:D336N	ENSP00000313869:D431N	D	-	1	0	GORASP1	39114763	0.003000	0.15002	0.018000	0.16275	0.021000	0.10359	1.297000	0.33400	1.298000	0.44778	0.650000	0.86243	GAC		0.607	GORASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254060.1			20	47	0	0	0	0.012319	0	20	47				
BOC	91653	broad.mit.edu	37	3	112991470	112991470	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:112991470C>G	ENST00000495514.1	+	7	1585	c.881C>G	c.(880-882)tCa>tGa	p.S294*	BOC_ENST00000273395.4_Nonsense_Mutation_p.S294*|BOC_ENST00000355385.3_Nonsense_Mutation_p.S294*			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	294	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GAGGAGGACTCAGGCACCTAC	0.617																																							uc003dzx.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6						c.(880-882)TCA>TGA		brother of CDO precursor							108.0	97.0	101.0					3																	112991470		2203	4300	6503	SO:0001587	stop_gained	91653				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding	g.chr3:112991470C>G	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.881C>G	3.37:g.112991470C>G	ENSP00000418663:p.Ser294*		Somatic				BOC_uc003dzy.2_Nonsense_Mutation_p.S294*|BOC_uc003dzz.2_Nonsense_Mutation_p.S294*|BOC_uc003eab.2_5'UTR	p.S294*	NM_033254	NP_150279	WXS	Illumina HiSeq	Unspecified	Q9BWV1	BOC_HUMAN	Epithelial(53;0.227)		7	1502	+			294			Ig-like C2-type 3.|Extracellular (Potential).		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Nonsense_Mutation	SNP	ENST00000495514.1	37	c.881C>G	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	C	41	8.574826	0.98870	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.3213	0.98679	0.0:1.0:0.0:0.0	.	.	.	.	X	294	.	ENSP00000273395:S294X	S	+	2	0	BOC	114474160	1.000000	0.71417	0.992000	0.48379	0.758000	0.43043	7.378000	0.79679	2.810000	0.96702	0.650000	0.86243	TCA		0.617	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		15	47	0	0	0	0.024245	0	15	47				
MAATS1	89876	broad.mit.edu	37	3	119434438	119434438	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:119434438C>T	ENST00000273390.5	+	6	607	c.530C>T	c.(529-531)tCt>tTt	p.S177F	MAATS1_ENST00000463700.1_Missense_Mutation_p.S177F	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	177						mitochondrion (GO:0005739)											CCTCCTACTTCTACTAAGCAC	0.368																																							uc003ede.3		NA																	0				ovary(2)|pancreas(1)	3						c.(529-531)TCT>TTT		AAT1-alpha							186.0	187.0	187.0					3																	119434438		2203	4300	6503	SO:0001583	missense	89876					mitochondrion	protein binding	g.chr3:119434438C>T	AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.530C>T	3.37:g.119434438C>T	ENSP00000273390:p.Ser177Phe		Somatic				C3orf15_uc003edc.2_Missense_Mutation_p.S177F|C3orf15_uc010hqy.1_Missense_Mutation_p.S177F|C3orf15_uc010hqz.2_Missense_Mutation_p.S115F|C3orf15_uc011bjd.1_Missense_Mutation_p.S51F|C3orf15_uc011bje.1_Missense_Mutation_p.S157F|C3orf15_uc010hra.1_5'UTR	p.S177F	NM_033364	NP_203528	WXS	Illumina HiSeq	Unspecified	Q7Z4T9	AAT1_HUMAN		GBM - Glioblastoma multiforme(114;0.186)	6	607	+			177					A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Missense_Mutation	SNP	ENST00000273390.5	37	c.530C>T	CCDS2994.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.809886	0.70797	.	.	ENSG00000183833	ENST00000273390;ENST00000463700	T;T	0.49139	1.82;0.79	4.79	3.91	0.45181	.	1.112010	0.06637	N	0.760413	T	0.55924	0.1951	M	0.63428	1.95	0.09310	N	1	B;P;P;P;B	0.49783	0.418;0.79;0.928;0.925;0.01	B;B;P;P;B	0.48141	0.32;0.223;0.548;0.568;0.015	T	0.45614	-0.9249	10	0.56958	D	0.05	-2.1974	11.393	0.49825	0.0:0.9121:0.0:0.0879	.	177;115;177;177;177	Q7Z4T9;Q7Z4T9-3;Q4G0Y0;Q7Z4T9-7;Q7Z4T9-2	AAT1_HUMAN;.;.;.;.	F	177	ENSP00000273390:S177F;ENSP00000419489:S177F	ENSP00000273390:S177F	S	+	2	0	C3orf15	120917128	0.000000	0.05858	0.001000	0.08648	0.629000	0.37895	0.969000	0.29370	1.241000	0.43820	0.585000	0.79938	TCT		0.368	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355222.1	NM_033364		37	175	0	0	0	0.01441	0	37	175				
ZBBX	79740	broad.mit.edu	37	3	167023506	167023506	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:167023506G>C	ENST00000392766.2	-	17	1990	c.1650C>G	c.(1648-1650)atC>atG	p.I550M	ZBBX_ENST00000307529.5_Missense_Mutation_p.I550M|ZBBX_ENST00000392767.2_Missense_Mutation_p.I550M|ZBBX_ENST00000392764.1_Missense_Mutation_p.I521M|ZBBX_ENST00000455345.2_Missense_Mutation_p.I550M	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	550						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						AGGATTCTTTGATGTCTTGAG	0.343																																							uc003fep.2		NA																	0				ovary(2)	2						c.(1648-1650)ATC>ATG		zinc finger, B-box domain containing							75.0	66.0	69.0					3																	167023506		1813	4067	5880	SO:0001583	missense	79740					intracellular	zinc ion binding	g.chr3:167023506G>C	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1650C>G	3.37:g.167023506G>C	ENSP00000376519:p.Ile550Met		Somatic				ZBBX_uc011bpc.1_Missense_Mutation_p.I550M|ZBBX_uc003feq.2_Missense_Mutation_p.I521M	p.I550M	NM_024687	NP_078963	WXS	Illumina HiSeq	Unspecified	A8MT70	ZBBX_HUMAN			17	1973	-			550					A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	c.1650C>G	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	G	4.046	0.006117	0.07866	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.10763	3.01;3.01;3.01;3.01;2.84	5.3	0.804	0.18697	.	1.467820	0.03870	N	0.275489	T	0.11067	0.0270	L	0.29908	0.895	0.09310	N	1	P;P	0.40794	0.729;0.61	P;B	0.45138	0.471;0.191	T	0.20405	-1.0276	10	0.42905	T	0.14	0.1191	2.9839	0.05962	0.3448:0.0:0.4639:0.1913	.	550;550	A8MT70-2;A8MT70	.;ZBBX_HUMAN	M	550;550;550;550;521	ENSP00000376519:I550M;ENSP00000376520:I550M;ENSP00000390232:I550M;ENSP00000305065:I550M;ENSP00000376517:I521M	ENSP00000305065:I550M	I	-	3	3	ZBBX	168506200	0.927000	0.31430	0.009000	0.14445	0.068000	0.16541	2.032000	0.41127	0.308000	0.22923	-0.145000	0.13849	ATC		0.343	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687		16	31	0	0	0	0.006122	0	16	31				
MCCC1	56922	broad.mit.edu	37	3	182738007	182738007	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:182738007C>G	ENST00000265594.4	-	17	2034	c.1888G>C	c.(1888-1890)Gac>Cac	p.D630H	MCCC1_ENST00000539926.1_3'UTR|MCCC1_ENST00000489909.1_5'Flank|MCCC1_ENST00000492597.1_Missense_Mutation_p.D521H|MCCC1-AS1_ENST00000471731.2_RNA	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	630					biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	ACTGGAATGTCAATCTCAATA	0.378																																							uc003fle.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1888-1890)GAC>CAC		methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)	Biotin(DB00121)						86.0	90.0	89.0					3																	182738007		2203	4300	6503	SO:0001583	missense	56922				biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity	g.chr3:182738007C>G	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.1888G>C	3.37:g.182738007C>G	ENSP00000265594:p.Asp630His		Somatic				MCCC1_uc010hxi.2_RNA|MCCC1_uc011bqo.1_RNA|MCCC1_uc003flf.2_Missense_Mutation_p.D513H|MCCC1_uc003flg.2_Missense_Mutation_p.D521H|MCCC1_uc011bqp.1_Missense_Mutation_p.D583H	p.D630H	NM_020166	NP_064551	WXS	Illumina HiSeq	Unspecified	Q96RQ3	MCCA_HUMAN	all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		17	2025	-	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		630			Biotinyl-binding.		Q59ES4|Q9H959|Q9NS97	Missense_Mutation	SNP	ENST00000265594.4	37	c.1888G>C	CCDS3241.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.909506	0.33721	.	.	ENSG00000078070	ENST00000265594;ENST00000492597;ENST00000392616;ENST00000476176	D;D;D	0.95482	-3.72;-3.65;-3.45	5.87	5.87	0.94306	Biotin/lipoyl attachment (1);	0.782162	0.12933	N	0.427245	D	0.90573	0.7045	N	0.08118	0	0.80722	D	1	B;B;B	0.12013	0.005;0.001;0.004	B;B;B	0.16289	0.004;0.002;0.015	T	0.83206	-0.0076	10	0.37606	T	0.19	.	18.9775	0.92743	0.0:1.0:0.0:0.0	.	583;521;630	E9PG35;E9PHF7;Q96RQ3	.;.;MCCA_HUMAN	H	630;521;480;583	ENSP00000265594:D630H;ENSP00000419898:D521H;ENSP00000420433:D583H	ENSP00000265594:D630H	D	-	1	0	MCCC1	184220701	0.992000	0.36948	0.835000	0.33067	0.709000	0.40893	2.581000	0.46077	2.785000	0.95823	0.655000	0.94253	GAC		0.378	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166		6	46	0	0	0	0.02938	0	6	46				
MUC4	4585	broad.mit.edu	37	3	195508133	195508133	+	Missense_Mutation	SNP	G	G	A	rs202065387		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:195508133G>A	ENST00000463781.3	-	2	10777	c.10318C>T	c.(10318-10320)Cct>Tct	p.P3440S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3440S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3440S(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAACAGGGGTGGCGTGA	0.592																																							uc011bto.1		NA																	2	Substitution - Missense(2)		endometrium(2)		0						c.(9934-9936)CCT>TCT		mucin 4 isoform a							30.0	24.0	26.0					3																	195508133		685	1583	2268	SO:0001583	missense	4585				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity	g.chr3:195508133G>A	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10318C>T	3.37:g.195508133G>A	ENSP00000417498:p.Pro3440Ser		Somatic				MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	p.P3312S	NM_018406	NP_060876	WXS	Illumina HiSeq	Unspecified	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)	3	10394	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	c.9934C>T	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.286	-0.146045	0.06627	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29917	1.58;1.55	.	.	.	.	.	.	.	.	T	0.22003	0.0530	N	0.14661	0.345	0.09310	N	1	P	0.48350	0.909	P	0.50440	0.641	T	0.15809	-1.0424	6	.	.	.	.	.	.	.	.	3312	E7ESK3	.	S	3440	ENSP00000417498:P3440S;ENSP00000420243:P3440S	.	P	-	1	0	MUC4	196992912	0.016000	0.18221	0.006000	0.13384	0.005000	0.04900	-0.684000	0.05173	0.088000	0.17205	0.089000	0.15464	CCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406		3	7	0	0	0	0.009096	0	3	7				
HTT	3064	broad.mit.edu	37	4	3179079	3179079	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:3179079G>T	ENST00000355072.5	+	34	4573	c.4428G>T	c.(4426-4428)ttG>ttT	p.L1476F		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1476					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GCTTTGTATTGAAACAGTTTG	0.299																																							uc011bvq.1		NA																	0				skin(2)|ovary(1)|lung(1)	4						c.(4432-4434)TTG>TTT		huntingtin							153.0	134.0	140.0					4																	3179079		1799	4064	5863	SO:0001583	missense	3064				establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding	g.chr4:3179079G>T	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.4428G>T	4.37:g.3179079G>T	ENSP00000347184:p.Leu1476Phe		Somatic					p.L1478F	NM_002111	NP_002102	WXS	Illumina HiSeq	Unspecified	P42858	HD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)	35	4579	+		all_epithelial(65;0.18)	1476					Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	c.4434G>T	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789986	0.70337	.	.	ENSG00000197386	ENST00000355072	T	0.07567	3.18	6.07	1.14	0.20703	.	0.000000	0.64402	D	0.000001	T	0.17874	0.0429	L	0.55743	1.74	0.52099	D	0.999944	D	0.76494	0.999	D	0.83275	0.996	T	0.01238	-1.1409	10	0.72032	D	0.01	.	5.0892	0.14698	0.259:0.3156:0.4254:0.0	.	1476	P42858	HD_HUMAN	F	1476	ENSP00000347184:L1476F	ENSP00000347184:L1476F	L	+	3	2	HTT	3148877	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	1.336000	0.33850	0.094000	0.17404	0.655000	0.94253	TTG		0.299	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111		8	18	1	0	3.86212e-05	0.008291	4.102e-05	8	18				
EVC	2121	broad.mit.edu	37	4	5754640	5754640	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:5754640G>A	ENST00000264956.6	+	9	1360	c.1176G>A	c.(1174-1176)gaG>gaA	p.E392E	EVC_ENST00000509451.1_Silent_p.E392E|EVC_ENST00000382674.2_Silent_p.E392E	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	392					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				TCCAGGAGGAGACCAGGTGCC	0.627																																							uc003gil.1		NA																	0				ovary(1)|skin(1)	2						c.(1174-1176)GAG>GAA		Ellis van Creveld syndrome protein							63.0	58.0	60.0					4																	5754640		2203	4300	6503	SO:0001819	synonymous_variant	2121				muscle organ development	integral to membrane		g.chr4:5754640G>A	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1176G>A	4.37:g.5754640G>A			Somatic				EVC_uc003gim.1_RNA|CRMP1_uc003gin.1_Intron	p.E392E	NM_153717	NP_714928	WXS	Illumina HiSeq	Unspecified	P57679	EVC_HUMAN			9	1360	+		Myeloproliferative disorder(84;0.117)	392						Silent	SNP	ENST00000264956.6	37	c.1176G>A	CCDS3383.1																																																																																				0.627	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1			14	38	0	0	0	0.007413	0	14	38				
TAPT1	202018	broad.mit.edu	37	4	16188416	16188416	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:16188416C>T	ENST00000405303.2	-	6	917	c.834G>A	c.(832-834)atG>atA	p.M278I	TAPT1_ENST00000508888.1_5'UTR|TAPT1_ENST00000399920.3_Missense_Mutation_p.M167I|TAPT1_ENST00000304584.8_Intron	NM_153365.2	NP_699196.2	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation 1	278					embryonic skeletal system development (GO:0048706)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|post-embryonic development (GO:0009791)	integral component of membrane (GO:0016021)	growth hormone-releasing hormone receptor activity (GO:0016520)			NS(1)|breast(2)|cervix(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	10						TATTAGACATCATGATAGTAA	0.318																																							uc010ied.1		NA																	0					0						c.(832-834)ATG>ATA		transmembrane anterior posterior transformation							87.0	82.0	84.0					4																	16188416		1816	4079	5895	SO:0001583	missense	202018					integral to membrane	growth hormone-releasing hormone receptor activity	g.chr4:16188416C>T	AK074494	CCDS47030.1	4p15.32	2014-01-28			ENSG00000169762	ENSG00000169762			26887	protein-coding gene	gene with protein product		612758				12477932	Standard	NM_153365		Approved	FLJ90013	uc010ied.1	Q6NXT6	OTTHUMG00000160177	ENST00000405303.2:c.834G>A	4.37:g.16188416C>T	ENSP00000385347:p.Met278Ile		Somatic				TAPT1_uc011bxd.1_Intron|TAPT1_uc011bxe.1_Missense_Mutation_p.M167I	p.M278I	NM_153365	NP_699196	WXS	Illumina HiSeq	Unspecified	Q6NXT6	TAPT1_HUMAN			6	915	-			278					Q8N2S3|Q9NZK9	Missense_Mutation	SNP	ENST00000405303.2	37	c.834G>A	CCDS47030.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655691	0.67586	.	.	ENSG00000169762	ENST00000405303;ENST00000542770;ENST00000399920	T;T	0.34072	1.38;1.42	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.55226	0.1907	L	0.46157	1.445	0.80722	D	1	D	0.54964	0.969	D	0.70227	0.968	T	0.50955	-0.8766	10	0.48119	T	0.1	-27.5918	19.472	0.94966	0.0:1.0:0.0:0.0	.	278	Q6NXT6	TAPT1_HUMAN	I	278;278;167	ENSP00000385347:M278I;ENSP00000382803:M167I	ENSP00000382803:M167I	M	-	3	0	TAPT1	15797514	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.445000	0.80570	2.665000	0.90641	0.591000	0.81541	ATG		0.318	TAPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359568.1	NM_153365		4	28	0	0	0	0.021553	0	4	28				
ARAP2	116984	broad.mit.edu	37	4	36189162	36189162	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:36189162G>C	ENST00000303965.4	-	8	2078	c.1589C>G	c.(1588-1590)tCt>tGt	p.S530C		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	530	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TGATATAGCAGAAAGGGGAAT	0.308																																							uc003gsq.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(1588-1590)TCT>TGT		ArfGAP with RhoGAP domain, ankyrin repeat and PH							81.0	82.0	82.0					4																	36189162		2203	4293	6496	SO:0001583	missense	116984				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding	g.chr4:36189162G>C	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.1589C>G	4.37:g.36189162G>C	ENSP00000302895:p.Ser530Cys		Somatic				ARAP2_uc003gsr.1_Missense_Mutation_p.S530C	p.S530C	NM_015230	NP_056045	WXS	Illumina HiSeq	Unspecified	Q8WZ64	ARAP2_HUMAN			8	1927	-			530			PH 1.		Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	c.1589C>G	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474722	0.84640	.	.	ENSG00000047365	ENST00000303965	T	0.77750	-1.12	5.61	5.61	0.85477	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.245643	0.36555	N	0.002529	D	0.87446	0.6179	M	0.70595	2.14	0.42336	D	0.992314	D;D	0.67145	0.977;0.996	D;D	0.65773	0.911;0.938	D	0.88026	0.2772	10	0.72032	D	0.01	.	19.5868	0.95493	0.0:0.0:1.0:0.0	.	460;530	A7E2A5;Q8WZ64	.;ARAP2_HUMAN	C	530	ENSP00000302895:S530C	ENSP00000302895:S530C	S	-	2	0	ARAP2	35865557	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.365000	0.79537	2.791000	0.96007	0.650000	0.86243	TCT		0.308	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230		16	34	0	0	0	0.012319	0	16	34				
MUC7	4589	broad.mit.edu	37	4	71346978	71346978	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:71346978T>C	ENST00000304887.5	+	3	707	c.517T>C	c.(517-519)Tct>Cct	p.S173P	MUC7_ENST00000413702.1_Missense_Mutation_p.S173P|MUC7_ENST00000514512.1_3'UTR|MUC7_ENST00000456088.1_Missense_Mutation_p.S173P	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	173	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.S173P(3)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACCCACACCTTCTGCAACTAC	0.522																																							uc011cat.1		NA																	3	Substitution - Missense(3)		lung(2)|kidney(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(517-519)TCT>CCT		mucin 7, secreted precursor							341.0	284.0	303.0					4																	71346978		2203	4300	6503	SO:0001583	missense	4589					extracellular region	protein binding	g.chr4:71346978T>C	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.517T>C	4.37:g.71346978T>C	ENSP00000302021:p.Ser173Pro		Somatic				MUC7_uc011cau.1_Missense_Mutation_p.S173P|MUC7_uc003hfj.2_Missense_Mutation_p.S173P|uc011cav.1_RNA	p.S173P	NM_001145006	NP_001138478	WXS	Illumina HiSeq	Unspecified	Q8TAX7	MUC7_HUMAN	Lung(101;0.211)		4	805	+			173			1.|Thr-rich.		Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	c.517T>C	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	T	8.294	0.818323	0.16607	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.52754	0.65;0.65;0.65	2.59	-1.83	0.07833	.	.	.	.	.	T	0.22360	0.0539	N	0.12182	0.205	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.19451	-1.0305	8	.	.	.	-1.8981	3.858	0.08984	0.0:0.2646:0.3931:0.3423	.	173	Q8TAX7	MUC7_HUMAN	P	173	ENSP00000407422:S173P;ENSP00000400585:S173P;ENSP00000302021:S173P	.	S	+	1	0	MUC7	71381567	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.097000	0.01348	-0.350000	0.08262	-0.605000	0.04089	TCT		0.522	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291		3	158	0	0	0	0.009096	0	3	158				
ART3	419	broad.mit.edu	37	4	76997033	76997033	+	Splice_Site	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:76997033G>C	ENST00000355810.4	+	2	110		c.e2-1		ART3_ENST00000349321.3_Splice_Site|ART3_ENST00000513494.1_Splice_Site|ART3_ENST00000341029.5_Splice_Site	NM_001130016.2	NP_001123488.1	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3						protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|stomach(1)	16			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTTTAATTTAGAAGAGAAAAA	0.358																																							uc003hjo.2		NA																	0				ovary(2)	2						c.e2-1		ADP-ribosyltransferase 3 isoform a							66.0	71.0	69.0					4																	76997033		2201	4299	6500	SO:0001630	splice_region_variant	419				protein ADP-ribosylation	anchored to membrane|integral to plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity	g.chr4:76997033G>C	X95827	CCDS3575.1, CCDS47079.1, CCDS47080.1	4q21.1	2008-05-15			ENSG00000156219	ENSG00000156219			725	protein-coding gene	gene with protein product		603086				9119374	Standard	NM_001130017		Approved		uc003hjo.3	Q13508	OTTHUMG00000130110	ENST00000355810.4:c.-9-1G>C	4.37:g.76997033G>C			Somatic				ART3_uc003hji.2_Splice_Site|ART3_uc003hjj.2_Splice_Site|ART3_uc003hjk.2_Splice_Site|ART3_uc010ija.1_Splice_Site|ART3_uc003hjn.2_Splice_Site|ART3_uc003hjp.2_5'Flank|ART3_uc010ijb.2_5'Flank|ART3_uc003hjq.2_5'Flank		NM_001130016	NP_001123488	WXS	Illumina HiSeq	Unspecified	Q13508	NAR3_HUMAN	Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)		2	111	+								Q53XW3|Q6FHT7|Q8WVJ7|Q93069|Q96HL1	Splice_Site	SNP	ENST00000355810.4	37	c.-8_splice	CCDS47079.1																																																																																				0.358	ART3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252416.2	NM_001179	Intron	4	56	0	0	0	0.014758	0	4	56				
FRAS1	80144	broad.mit.edu	37	4	79362436	79362436	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:79362436G>T	ENST00000325942.6	+	41	6090	c.5650G>T	c.(5650-5652)Gag>Tag	p.E1884*	FRAS1_ENST00000264895.6_Nonsense_Mutation_p.E1884*	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1884					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TGGCTGCATTGAGAACACAGG	0.453																																							uc003hlb.2		NA																	0				large_intestine(5)	5						c.(5650-5652)GAG>TAG		Fraser syndrome 1							71.0	63.0	66.0					4																	79362436		1909	4130	6039	SO:0001587	stop_gained	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79362436G>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.5650G>T	4.37:g.79362436G>T	ENSP00000326330:p.Glu1884*		Somatic				FRAS1_uc003hkw.2_Nonsense_Mutation_p.E1884*|FRAS1_uc010ijj.1_Nonsense_Mutation_p.E304*	p.E1884*	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			41	6090	+			1883			CSPG 7.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Nonsense_Mutation	SNP	ENST00000325942.6	37	c.5650G>T	CCDS54772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.365934|5.365934	0.95900|0.95900	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895|ENST00000510944;ENST00000512123	.|.	.|.	.|.	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.052142|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.66056|.	D|.	0.02|.	.|.	17.5472|17.5472	0.87865|0.87865	0.0:0.1233:0.8767:0.0|0.0:0.1233:0.8767:0.0	.|.	.|.	.|.	.|.	X|L	1884|333;112	.|.	ENSP00000264895:E1884X|.	E|X	+|+	1|2	0|2	FRAS1|FRAS1	79581460|79581460	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	5.887000|5.887000	0.69751|0.69751	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	GAG|TGA		0.453	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2			6	6	1	0	0.00116845	0.021553	0.00122579	6	6				
PITX2	5308	broad.mit.edu	37	4	111542381	111542381	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:111542381G>A	ENST00000354925.2	-	6	2034	c.329C>T	c.(328-330)cCg>cTg	p.P110L	PITX2_ENST00000306732.3_Missense_Mutation_p.P117L|PITX2_ENST00000394595.3_Intron|PITX2_ENST00000394598.2_Missense_Mutation_p.P110L|PITX2_ENST00000355080.5_Missense_Mutation_p.P64L|PITX2_ENST00000557119.2_Missense_Mutation_p.P117L|PITX2_ENST00000556049.1_5'Flank	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2	110			P -> L (in RIEG1). {ECO:0000269|PubMed:12381896, ECO:0000269|PubMed:16936096}.|P -> R (in RIEG1). {ECO:0000269|PubMed:16936096}.		atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		GGACATGTCCGGGTAGCGGTT	0.622																																							uc003iad.2		NA																	0					0	GRCh37	CM024243|CM064163	PITX2	M		c.(328-330)CCG>CTG		paired-like homeodomain transcription factor 2							52.0	52.0	52.0					4																	111542381		2203	4300	6503	SO:0001583	missense	5308				determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding	g.chr4:111542381G>A	U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.329C>T	4.37:g.111542381G>A	ENSP00000347004:p.Pro110Leu		Somatic				PITX2_uc003iac.2_Missense_Mutation_p.P117L|PITX2_uc003iae.2_Missense_Mutation_p.P64L|PITX2_uc010iml.2_Intron|PITX2_uc003iaf.2_Missense_Mutation_p.P110L|PITX2_uc003iag.1_Missense_Mutation_p.P117L	p.P110L	NM_153426	NP_700475	WXS	Illumina HiSeq	Unspecified	Q99697	PITX2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00222)	4	911	-		Hepatocellular(203;0.217)	110		P -> L (in RIEG1).|P -> R (in RIEG1).	Homeobox.		A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Missense_Mutation	SNP	ENST00000354925.2	37	c.329C>T	CCDS3692.1	.	.	.	.	.	.	.	.	.	.	G	36	5.715431	0.96830	.	.	ENSG00000164093	ENST00000306732;ENST00000394598;ENST00000355080;ENST00000354925;ENST00000511837;ENST00000511990	D;D;D;D;D;D	0.98264	-4.83;-4.83;-4.83;-4.83;-4.83;-4.83	5.37	5.37	0.77165	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98874	0.9619	M	0.74258	2.255	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.992;1.0;1.0	D	0.99872	1.1098	10	0.87932	D	0	.	19.4788	0.95000	0.0:0.0:1.0:0.0	.	110;64;110;117	D6RFI4;Q99697-3;Q99697;Q99697-2	.;.;PITX2_HUMAN;.	L	117;110;64;110;110;64	ENSP00000304169:P117L;ENSP00000378097:P110L;ENSP00000347192:P64L;ENSP00000347004:P110L;ENSP00000421454:P110L;ENSP00000424142:P64L	ENSP00000304169:P117L	P	-	2	0	PITX2	111761830	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.721000	0.98766	2.676000	0.91093	0.655000	0.94253	CCG		0.622	PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256308.2			8	30	0	0	0	0.004482	0	8	30				
JADE1	79960	broad.mit.edu	37	4	129793167	129793167	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:129793167A>T	ENST00000226319.6	+	11	2559	c.2279A>T	c.(2278-2280)cAg>cTg	p.Q760L	PHF17_ENST00000452328.2_Missense_Mutation_p.Q748L|PHF17_ENST00000512960.1_Missense_Mutation_p.Q760L	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGGGAACGGCAGCAGCAGGGA	0.532																																							uc003igk.2		NA																	0					0						c.(2278-2280)CAG>CTG		PHD finger protein 17 long isoform							26.0	29.0	28.0					4																	129793167		2203	4300	6503	SO:0001583	missense	79960				apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding	g.chr4:129793167A>T																												ENST00000226319.6:c.2279A>T	4.37:g.129793167A>T	ENSP00000226319:p.Gln760Leu		Somatic				PHF17_uc003igl.2_Missense_Mutation_p.Q748L|PHF17_uc011cgy.1_Missense_Mutation_p.Q760L	p.Q760L	NM_199320	NP_955352	WXS	Illumina HiSeq	Unspecified	Q6IE81	JADE1_HUMAN			11	2559	+			760						Missense_Mutation	SNP	ENST00000226319.6	37	c.2279A>T	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.368499	0.42003	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960	T;T;T	0.39406	1.08;1.08;1.08	4.67	1.94	0.25998	.	0.756932	0.13133	N	0.411310	T	0.29749	0.0743	L	0.27053	0.805	0.80722	D	1	B;B	0.19200	0.034;0.001	B;B	0.25291	0.059;0.001	T	0.06250	-1.0837	9	.	.	.	.	11.5436	0.50679	0.7202:0.2798:0.0:0.0	.	748;760	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	L	760;748;760	ENSP00000226319:Q760L;ENSP00000388015:Q748L;ENSP00000425730:Q760L	.	Q	+	2	0	PHF17	130012617	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.708000	0.47152	0.860000	0.35481	0.528000	0.53228	CAG		0.532	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1			3	24	0	0	0	0.004672	0	3	24				
DNAJC21	134218	broad.mit.edu	37	5	34954703	34954703	+	Missense_Mutation	SNP	C	C	T	rs141076061		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr5:34954703C>T	ENST00000342382.4	+	12	1707	c.1480C>T	c.(1480-1482)Cgg>Tgg	p.R494W	DNAJC21_ENST00000303525.7_Missense_Mutation_p.R507W|DNAJC21_ENST00000382021.2_Missense_Mutation_p.R539W			Q5F1R6	DJC21_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 21	494					protein folding (GO:0006457)	ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			ATTTCCATCTCGGAATAAACT	0.388																																							uc003jjc.2		NA																	0				breast(1)|skin(1)	2						c.(1480-1482)CGG>TGG		DnaJ homology subfamily A member 5 isoform 2		C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	106.0	105.0	106.0		1480,1615	5.3	1.0	5	dbSNP_134	106	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DNAJC21	NM_001012339.2,NM_194283.3	101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	494/532,539/577	34954703	1,13005	2203	4300	6503	SO:0001583	missense	134218				protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding	g.chr5:34954703C>T		CCDS3907.2, CCDS34144.1	5p13-p12	2012-10-05			ENSG00000168724	ENSG00000168724		"""Heat shock proteins / DNAJ (HSP40)"""	27030	protein-coding gene	gene with protein product	"""JJJ1 DnaJ domain protein homolog (S. cerevisiae)"""					15067379	Standard	XM_005248250		Approved	GS3, DNAJA5, JJJ1	uc003jjc.3	Q5F1R6	OTTHUMG00000074103	ENST00000342382.4:c.1480C>T	5.37:g.34954703C>T	ENSP00000343728:p.Arg494Trp		Somatic				DNAJC21_uc003jjb.2_Missense_Mutation_p.R539W	p.R494W	NM_001012339	NP_001012339	WXS	Illumina HiSeq	Unspecified	Q5F1R6	DJC21_HUMAN	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		12	1707	+	all_lung(31;7.08e-05)		494			C2H2-type 2.		Q3B7J9|Q6P086|Q6ZS43|Q86VC6	Missense_Mutation	SNP	ENST00000342382.4	37	c.1480C>T	CCDS34144.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.454209	0.63290	0.0	1.16E-4	ENSG00000168724	ENST00000342382;ENST00000382021;ENST00000303525	T;T;T	0.44881	0.91;0.91;0.91	6.16	5.28	0.74379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.104015	0.64402	N	0.000003	T	0.55401	0.1918	M	0.89287	3.02	0.80722	D	1	P;B	0.47253	0.892;0.412	B;B	0.42112	0.376;0.043	T	0.68496	-0.5393	10	0.87932	D	0	-3.4337	17.4014	0.87460	0.0:0.8753:0.1247:0.0	.	494;539	Q5F1R6;Q5F1R6-2	DJC21_HUMAN;.	W	494;539;507	ENSP00000343728:R494W;ENSP00000371451:R539W;ENSP00000306289:R507W	ENSP00000306289:R507W	R	+	1	2	DNAJC21	34990460	0.998000	0.40836	0.995000	0.50966	0.991000	0.79684	3.880000	0.56145	1.582000	0.49881	0.650000	0.86243	CGG		0.388	DNAJC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157337.1	NM_194283		11	132	0	0	0	0.016723	0	11	132				
RICTOR	253260	broad.mit.edu	37	5	38950389	38950389	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr5:38950389C>G	ENST00000357387.3	-	31	3591	c.3561G>C	c.(3559-3561)aaG>aaC	p.K1187N	RICTOR_ENST00000296782.5_Missense_Mutation_p.K1187N	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TACCAAAATTCTTGGTGAATT	0.363																																							uc003jlp.2		NA																	0				ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10						c.(3559-3561)AAG>AAC		rapamycin-insensitive companion of mTOR							138.0	150.0	146.0					5																	38950389		2203	4299	6502	SO:0001583	missense	253260				actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding	g.chr5:38950389C>G		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.3561G>C	5.37:g.38950389C>G	ENSP00000349959:p.Lys1187Asn		Somatic				RICTOR_uc003jlo.2_Missense_Mutation_p.K1187N|RICTOR_uc010ivf.2_Missense_Mutation_p.K902N	p.K1187N	NM_152756	NP_689969	WXS	Illumina HiSeq	Unspecified	Q6R327	RICTR_HUMAN			31	3585	-	all_lung(31;0.000396)		1187						Missense_Mutation	SNP	ENST00000357387.3	37	c.3561G>C	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	C	7.223	0.597719	0.13875	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.48522	0.82;0.81	5.73	4.86	0.63082	.	0.240046	0.50627	D	0.000102	T	0.37433	0.1003	L	0.36672	1.1	0.39466	D	0.96764	B;B	0.29301	0.241;0.241	B;B	0.32583	0.148;0.148	T	0.39078	-0.9631	10	0.66056	D	0.02	-15.2468	7.0455	0.25042	0.0:0.714:0.0:0.286	.	1187;1187	Q6R327;Q6R327-3	RICTR_HUMAN;.	N	1187	ENSP00000349959:K1187N;ENSP00000296782:K1187N	ENSP00000296782:K1187N	K	-	3	2	RICTOR	38986146	1.000000	0.71417	1.000000	0.80357	0.192000	0.23643	1.107000	0.31110	1.568000	0.49683	0.555000	0.69702	AAG		0.363	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756		24	176	0	0	0	0.01892	0	24	176				
RHOBTB3	22836	broad.mit.edu	37	5	95099311	95099311	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr5:95099311A>G	ENST00000379982.3	+	7	1656	c.1148A>G	c.(1147-1149)aAa>aGa	p.K383R	GLRX_ENST00000508780.1_Intron	NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	383					ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		TGCATTTTAAAAACACCAGGA	0.328																																							uc003klm.2		NA																	0				lung(1)|skin(1)	2						c.(1147-1149)AAA>AGA		rho-related BTB domain containing 3							85.0	88.0	87.0					5																	95099311		2203	4299	6502	SO:0001583	missense	22836				retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding	g.chr5:95099311A>G	AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.1148A>G	5.37:g.95099311A>G	ENSP00000369318:p.Lys383Arg		Somatic					p.K383R	NM_014899	NP_055714	WXS	Illumina HiSeq	Unspecified	O94955	RHBT3_HUMAN		all cancers(79;8.79e-16)	7	1685	+		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)	383					A0PJA4|A8K1W9|Q8IW06	Missense_Mutation	SNP	ENST00000379982.3	37	c.1148A>G	CCDS4077.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.411255	0.83340	.	.	ENSG00000164292	ENST00000379982	T	0.65549	-0.16	5.47	5.47	0.80525	BTB/POZ-like (1);	0.107625	0.64402	D	0.000006	T	0.64571	0.2610	L	0.27053	0.805	0.80722	D	1	D	0.65815	0.995	P	0.60068	0.868	T	0.62613	-0.6817	10	0.29301	T	0.29	-26.65	15.2512	0.73549	1.0:0.0:0.0:0.0	.	383	O94955	RHBT3_HUMAN	R	383	ENSP00000369318:K383R	ENSP00000369318:K383R	K	+	2	0	RHOBTB3	95125067	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.062000	0.71155	2.078000	0.62432	0.528000	0.53228	AAA		0.328	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241658.1	NM_014899		8	38	0	0	0	0.006214	0	8	38				
PCDH1	5097	broad.mit.edu	37	5	141244682	141244682	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr5:141244682G>C	ENST00000394536.3	-	3	1353	c.1214C>G	c.(1213-1215)tCa>tGa	p.S405*	PCDH1_ENST00000456271.1_Nonsense_Mutation_p.S393*|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000536585.1_Nonsense_Mutation_p.S383*|PCDH1_ENST00000287008.3_Nonsense_Mutation_p.S405*	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	405	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CACATCCTCTGAGATGTTAGC	0.557																																					Ovarian(132;1609 1739 4190 14731 45037)	Ovarian(132;1609 1739 4190 14731 45037)	uc003llq.2		NA																	0				ovary(5)	5						c.(1213-1215)TCA>TGA		protocadherin 1 isoform 1 precursor							135.0	108.0	117.0					5																	141244682		2203	4300	6503	SO:0001587	stop_gained	5097				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding	g.chr5:141244682G>C	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1214C>G	5.37:g.141244682G>C	ENSP00000378043:p.Ser405*		Somatic				PCDH1_uc003llp.2_Nonsense_Mutation_p.S405*|PCDH1_uc011dbf.1_Nonsense_Mutation_p.S383*	p.S405*	NM_002587	NP_002578	WXS	Illumina HiSeq	Unspecified	Q08174	PCDH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)	3	1331	-		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	405			Extracellular (Potential).|Cadherin 4.		Q8IUP2	Nonsense_Mutation	SNP	ENST00000394536.3	37	c.1214C>G	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	g	36	5.720864	0.96839	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	.	.	.	5.88	5.88	0.94601	.	0.000000	0.42682	D	0.000674	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.7556	0.88447	0.0:0.0:1.0:0.0	.	.	.	.	X	405;405;393;416;383	.	ENSP00000287008:S405X	S	-	2	0	PCDH1	141224866	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.804000	0.96469	0.645000	0.84053	TCA		0.557	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420		6	89	0	0	0	0.021553	0	6	89				
NEDD9	4739	broad.mit.edu	37	6	11190841	11190841	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr6:11190841C>G	ENST00000379446.5	-	5	1427	c.1261G>C	c.(1261-1263)Gag>Cag	p.E421Q	NEDD9_ENST00000504387.1_Missense_Mutation_p.E421Q|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	421					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			ACACCCATCTCAAGGGCCTGC	0.532																																							uc003mzv.2		NA																	0					0						c.(1261-1263)GAG>CAG		neural precursor cell expressed, developmentally							70.0	67.0	68.0					6																	11190841		2203	4300	6503	SO:0001583	missense	4739				actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding	g.chr6:11190841C>G	L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.1261G>C	6.37:g.11190841C>G	ENSP00000368759:p.Glu421Gln		Somatic				NEDD9_uc010joz.2_Missense_Mutation_p.E421Q|NEDD9_uc003mzw.3_Missense_Mutation_p.E275Q	p.E421Q	NM_006403	NP_006394	WXS	Illumina HiSeq	Unspecified	Q14511	CASL_HUMAN	Epithelial(50;0.0647)|all cancers(50;0.179)		5	1428	-	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	421					A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	ENST00000379446.5	37	c.1261G>C	CCDS4520.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120366	0.77323	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.24350	1.86;1.86	5.92	5.92	0.95590	Serine rich protein interaction (1);	0.042517	0.85682	D	0.000000	T	0.41949	0.1181	M	0.71581	2.175	0.80722	D	1	D;D;D	0.67145	0.978;0.969;0.996	P;P;D	0.63488	0.789;0.775;0.915	T	0.03086	-1.1074	10	0.30854	T	0.27	-38.3777	20.3248	0.98698	0.0:1.0:0.0:0.0	.	421;421;421	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	Q	421	ENSP00000368759:E421Q;ENSP00000422871:E421Q	ENSP00000368759:E421Q	E	-	1	0	NEDD9	11298827	1.000000	0.71417	1.000000	0.80357	0.583000	0.36354	7.487000	0.81328	2.818000	0.97014	0.655000	0.94253	GAG		0.532	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403		10	54	0	0	0	0.010729	0	10	54				
MDC1	9656	broad.mit.edu	37	6	30672941	30672941	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr6:30672941T>C	ENST00000376406.3	-	10	4666	c.4019A>G	c.(4018-4020)cAa>cGa	p.Q1340R	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Missense_Mutation_p.Q1076R	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1340	Interaction with the PRKDC complex.|Pro-rich.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						GGTGACAGGTTGGTCTGTGGA	0.537								Other conserved DNA damage response genes																															uc003nrg.3		NA																	0				breast(2)|ovary(1)|kidney(1)	4						c.(4018-4020)CAA>CGA	Other_conserved_DNA_damage_response_genes	mediator of DNA-damage checkpoint 1							140.0	154.0	149.0					6																	30672941		2203	4300	6503	SO:0001583	missense	9656				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding	g.chr6:30672941T>C	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4019A>G	6.37:g.30672941T>C	ENSP00000365588:p.Gln1340Arg		Somatic				MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Missense_Mutation_p.Q947R	p.Q1340R	NM_014641	NP_055456	WXS	Illumina HiSeq	Unspecified	Q14676	MDC1_HUMAN			10	4459	-			1340			Pro-rich.|Interaction with the PRKDC complex.		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	37	c.4019A>G	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	T	9.816	1.184601	0.21870	.	.	ENSG00000137337	ENST00000376406;ENST00000376405	T;T	0.08458	3.09;3.09	3.0	1.8	0.24995	.	.	.	.	.	T	0.08891	0.0220	M	0.70275	2.135	0.09310	N	1	D;P	0.67145	0.996;0.952	P;P	0.59948	0.866;0.5	T	0.16012	-1.0417	9	0.33940	T	0.23	.	6.3891	0.21577	0.0:0.0:0.2526:0.7474	.	1076;1340	Q14676-2;Q14676	.;MDC1_HUMAN	R	1340;1076	ENSP00000365588:Q1340R;ENSP00000365587:Q1076R	ENSP00000365587:Q1076R	Q	-	2	0	MDC1	30780920	0.376000	0.25098	0.149000	0.22428	0.009000	0.06853	0.731000	0.26058	0.551000	0.29008	0.392000	0.25879	CAA		0.537	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641		4	252	0	0	0	0.00308	0	4	252				
SHPRH	257218	broad.mit.edu	37	6	146276084	146276084	+	Silent	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr6:146276084A>T	ENST00000367505.2	-	2	639	c.375T>A	c.(373-375)ccT>ccA	p.P125P	SHPRH_ENST00000438092.2_Silent_p.P125P|SHPRH_ENST00000367503.3_Silent_p.P125P|SHPRH_ENST00000275233.7_Silent_p.P125P			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	125					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		AACTCTGTGCAGGAAGAAGCT	0.338																																							uc003qlf.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(373-375)CCT>CCA		SNF2 histone linker PHD RING helicase isoform a							65.0	61.0	62.0					6																	146276084		1807	4069	5876	SO:0001819	synonymous_variant	257218				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr6:146276084A>T	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.375T>A	6.37:g.146276084A>T			Somatic				SHPRH_uc003qld.2_Silent_p.P125P|SHPRH_uc003qle.2_Silent_p.P125P|SHPRH_uc003qlg.1_5'UTR|SHPRH_uc003qlj.1_Intron|SHPRH_uc003qlk.1_Silent_p.P125P	p.P125P	NM_001042683	NP_001036148	WXS	Illumina HiSeq	Unspecified	Q149N8	SHPRH_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	2	774	-		Ovarian(120;0.0365)	125					Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Silent	SNP	ENST00000367505.2	37	c.375T>A	CCDS43513.2																																																																																				0.338	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		11	24	0	0	0	0.016723	0	11	24				
MAD1L1	8379	broad.mit.edu	37	7	1997277	1997277	+	Missense_Mutation	SNP	C	C	T	rs201537051		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:1997277C>T	ENST00000406869.1	-	16	2140	c.1583G>A	c.(1582-1584)cGg>cAg	p.R528Q	MAD1L1_ENST00000399654.2_Missense_Mutation_p.R528Q|MAD1L1_ENST00000402746.1_Missense_Mutation_p.R436Q|MAD1L1_ENST00000265854.7_Missense_Mutation_p.R528Q			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)	528	Necessary for interaction with NEK2.				mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CAGAGCTCGCCGCTCCAGCTG	0.637																																							uc003slh.1		NA																	0				lung(1)|central_nervous_system(1)	2						c.(1582-1584)CGG>CAG		MAD1-like 1 protein		C	GLN/ARG,GLN/ARG,GLN/ARG	1,4321		0,1,2160	42.0	52.0	49.0		1583,1583,1583	-0.1	0.0	7		49	4,8514		0,4,4255	yes	missense,missense,missense	MAD1L1	NM_001013836.1,NM_001013837.1,NM_003550.2	43,43,43	0,5,6415	TT,TC,CC		0.047,0.0231,0.0389	benign,benign,benign	528/719,528/719,528/719	1997277	5,12835	2161	4259	6420	SO:0001583	missense	8379				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding	g.chr7:1997277C>T	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.1583G>A	7.37:g.1997277C>T	ENSP00000385334:p.Arg528Gln		Somatic				MAD1L1_uc003sle.1_Missense_Mutation_p.R257Q|MAD1L1_uc003slf.1_Missense_Mutation_p.R528Q|MAD1L1_uc003slg.1_Missense_Mutation_p.R528Q|MAD1L1_uc010ksh.1_Missense_Mutation_p.R528Q|MAD1L1_uc003sli.1_Missense_Mutation_p.R436Q|MAD1L1_uc010ksi.1_Missense_Mutation_p.R481Q|MAD1L1_uc010ksj.2_Missense_Mutation_p.R528Q	p.R528Q	NM_001013836	NP_001013858	WXS	Illumina HiSeq	Unspecified	Q9Y6D9	MD1L1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)	16	1849	-		Ovarian(82;0.0272)	528			Necessary for interaction with NEK2.|Potential.		B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Missense_Mutation	SNP	ENST00000406869.1	37	c.1583G>A	CCDS43539.1	.	.	.	.	.	.	.	.	.	.	C	1.265	-0.614619	0.03663	2.31E-4	4.7E-4	ENSG00000002822	ENST00000402746;ENST00000399654;ENST00000406869;ENST00000442131;ENST00000265854;ENST00000450235;ENST00000438959	T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98	4.83	-0.0589	0.13795	.	0.287226	0.35677	N	0.003043	T	0.08758	0.0217	N	0.25332	0.735	0.09310	N	1	P;B;B	0.36438	0.553;0.342;0.051	B;B;B	0.18561	0.015;0.022;0.015	T	0.37502	-0.9703	10	0.18276	T	0.48	-27.0288	8.0847	0.30765	0.0:0.4128:0.0:0.5872	.	527;436;528	A4D218;B3KR41;Q9Y6D9	.;.;MD1L1_HUMAN	Q	436;528;528;79;528;79;195	ENSP00000384155:R436Q;ENSP00000382562:R528Q;ENSP00000385334:R528Q;ENSP00000265854:R528Q;ENSP00000394886:R79Q;ENSP00000414877:R195Q	ENSP00000265854:R528Q	R	-	2	0	MAD1L1	1963803	0.013000	0.17824	0.030000	0.17652	0.013000	0.08279	0.448000	0.21726	0.040000	0.15660	0.462000	0.41574	CGG		0.637	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322871.1	NM_003550		14	96	0	0	0	0.0333	0	14	96				
RADIL	55698	broad.mit.edu	37	7	4917450	4917450	+	Silent	SNP	G	G	A	rs372501424		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:4917450G>A	ENST00000399583.3	-	2	508	c.321C>T	c.(319-321)gcC>gcT	p.A107A	RADIL_ENST00000536091.1_Silent_p.A107A	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	107	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CGTACTGGCCGGCCTGCCTGG	0.692																																							uc003snj.1		NA																	0				lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7						c.(319-321)GCC>GCT		Rap GTPase interactor		G		0,4076		0,0,2038	33.0	40.0	38.0		321	4.0	0.3	7		38	1,8313		0,1,4156	no	coding-synonymous	RADIL	NM_018059.4		0,1,6194	AA,AG,GG		0.012,0.0,0.0081		107/1076	4917450	1,12389	2038	4157	6195	SO:0001819	synonymous_variant	55698				cell adhesion|multicellular organismal development|signal transduction		protein binding	g.chr7:4917450G>A	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.321C>T	7.37:g.4917450G>A			Somatic				RADIL_uc003sng.1_RNA|RADIL_uc011jwd.1_RNA	p.A107A	NM_018059	NP_060529	WXS	Illumina HiSeq	Unspecified	Q96JH8	RADIL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)	2	494	-		Ovarian(82;0.0175)	107			Ras-associating.		A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	ENST00000399583.3	37	c.321C>T	CCDS43544.1																																																																																				0.692	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059		12	88	0	0	0	0.010729	0	12	88				
ADAM22	53616	broad.mit.edu	37	7	87778374	87778374	+	Splice_Site	SNP	T	T	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:87778374T>A	ENST00000265727.7	+	18	1645		c.e18+2		ADAM22_ENST00000398209.3_Splice_Site|ADAM22_ENST00000398201.4_Splice_Site|ADAM22_ENST00000398204.4_Splice_Site|ADAM22_ENST00000315984.7_Splice_Site			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22						adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TCAAGCCAGGTAATTTACAAA	0.388																																							uc003ujn.2		NA																	0				ovary(4)|skin(2)|lung(1)|kidney(1)	8						c.e18+2		ADAM metallopeptidase domain 22 isoform 1							58.0	52.0	54.0					7																	87778374		1833	4079	5912	SO:0001630	splice_region_variant	53616				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding	g.chr7:87778374T>A	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1566+2T>A	7.37:g.87778374T>A			Somatic				ADAM22_uc003ujk.1_Splice_Site_p.Q522_splice|ADAM22_uc003ujl.1_Splice_Site_p.Q522_splice|ADAM22_uc003ujm.2_Splice_Site_p.Q522_splice|ADAM22_uc003ujo.2_Splice_Site_p.Q522_splice|ADAM22_uc003ujp.1_Splice_Site_p.Q574_splice	p.Q522_splice	NM_021723	NP_068369	WXS	Illumina HiSeq	Unspecified	Q9P0K1	ADA22_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		18	1645	+	Esophageal squamous(14;0.00202)							O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Splice_Site	SNP	ENST00000265727.7	37	c.1566_splice	CCDS47637.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.941184	0.92526	.	.	ENSG00000008277	ENST00000398204;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.899	0.70664	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM22	87616310	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.142000	0.77339	2.157000	0.67596	0.533000	0.62120	.		0.388	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	Intron	3	28	0	0	0	0.004672	0	3	28				
ZNF789	285989	broad.mit.edu	37	7	99084102	99084102	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:99084102C>G	ENST00000331410.5	+	5	539	c.269C>G	c.(268-270)tCt>tGt	p.S90C	ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000448667.1_3'UTR	NM_213603.2	NP_998768.2	Q5FWF6	ZN789_HUMAN	zinc finger protein 789	90					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)	11	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TGGCTAGGTTCTGAAGCCAGA	0.373																																							uc003uqq.1		NA																	0					0						c.(268-270)TCT>TGT		zinc finger protein 789 isoform 1							32.0	33.0	33.0					7																	99084102		2203	4298	6501	SO:0001583	missense	285989				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:99084102C>G	AK093141	CCDS34693.1, CCDS34694.1	7q22.1	2013-01-08			ENSG00000198556	ENSG00000198556		"""Zinc fingers, C2H2-type"", ""-"""	27801	protein-coding gene	gene with protein product						12477932	Standard	XM_005250281		Approved		uc003uqq.1	Q5FWF6	OTTHUMG00000154601	ENST00000331410.5:c.269C>G	7.37:g.99084102C>G	ENSP00000331927:p.Ser90Cys		Somatic				ZNF789_uc010lfw.1_5'UTR|ZNF789_uc003uqr.1_Missense_Mutation_p.S32C	p.S90C	NM_213603	NP_998768	WXS	Illumina HiSeq	Unspecified	Q5FWF6	ZN789_HUMAN			5	488	+	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		90					A4D282|A6NH61|Q6ZMZ9	Missense_Mutation	SNP	ENST00000331410.5	37	c.269C>G	CCDS34693.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214552	0.58452	.	.	ENSG00000198556	ENST00000331410	T	0.05447	3.44	2.8	-0.268	0.12934	.	.	.	.	.	T	0.06371	0.0164	L	0.36672	1.1	0.42906	D	0.994243	D	0.56746	0.977	P	0.49561	0.615	T	0.50406	-0.8832	9	0.38643	T	0.18	.	2.8957	0.05690	0.0:0.4576:0.2448:0.2976	.	90	Q5FWF6	ZN789_HUMAN	C	90	ENSP00000331927:S90C	ENSP00000331927:S90C	S	+	2	0	ZNF789	98922038	0.000000	0.05858	0.574000	0.28523	0.982000	0.71751	-0.010000	0.12743	-0.071000	0.12886	0.650000	0.86243	TCT		0.373	ZNF789-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336266.1	NM_213603		4	13	0	0	0	0.021553	0	4	13				
FOXP2	93986	broad.mit.edu	37	7	114268618	114268618	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:114268618G>A	ENST00000393494.2	+	4	561	c.282G>A	c.(280-282)atG>atA	p.M94I	FOXP2_ENST00000390668.3_Missense_Mutation_p.M118I|FOXP2_ENST00000350908.4_Missense_Mutation_p.M94I|FOXP2_ENST00000393491.3_Missense_Mutation_p.M2I|FOXP2_ENST00000403559.4_Missense_Mutation_p.M94I|FOXP2_ENST00000393498.2_Missense_Mutation_p.M94I|FOXP2_ENST00000408937.3_Missense_Mutation_p.M119I|FOXP2_ENST00000393489.3_Missense_Mutation_p.M2I|FOXP2_ENST00000360232.4_Missense_Mutation_p.M94I|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000393500.3_Missense_Mutation_p.M2I|FOXP2_ENST00000459666.1_3'UTR|FOXP2_ENST00000378237.3_Missense_Mutation_p.M94I			O15409	FOXP2_HUMAN	forkhead box P2	94	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						TGGCCATGATGACTCCCCAGG	0.468																																							uc003vhb.2		NA																	0				ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						c.(280-282)ATG>ATA		forkhead box P2 isoform I							181.0	159.0	167.0					7																	114268618		2203	4300	6503	SO:0001583	missense	93986				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding	g.chr7:114268618G>A	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.282G>A	7.37:g.114268618G>A	ENSP00000377132:p.Met94Ile		Somatic				FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Missense_Mutation_p.M119I|FOXP2_uc003vha.2_Missense_Mutation_p.M2I|FOXP2_uc011kmu.1_Missense_Mutation_p.M94I|FOXP2_uc011kmv.1_Missense_Mutation_p.M94I|FOXP2_uc010ljz.1_Missense_Mutation_p.M2I|FOXP2_uc003vgt.1_RNA|FOXP2_uc003vgv.1_Missense_Mutation_p.M94I|FOXP2_uc003vgw.2_Missense_Mutation_p.M119I|FOXP2_uc003vgx.2_Missense_Mutation_p.M94I|FOXP2_uc003vhd.2_Missense_Mutation_p.M94I|FOXP2_uc003vhc.2_Missense_Mutation_p.M119I	p.M94I	NM_014491	NP_055306	WXS	Illumina HiSeq	Unspecified	O15409	FOXP2_HUMAN			4	656	+			94			Gln-rich.		A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	37	c.282G>A	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	G	33	5.236811	0.95240	.	.	ENSG00000128573	ENST00000393500;ENST00000324462;ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000378237;ENST00000393489;ENST00000360232;ENST00000452963;ENST00000390668;ENST00000393491	T;T;T;T;T;T;D;T;T;D	0.93189	-0.48;1.31;1.93;1.62;1.31;1.31;-3.02;1.31;0.99;-3.18	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.95284	0.8470	L	0.43152	1.355	0.80722	D	1	D;P;P;P;P;D;P;P	0.56287	0.975;0.525;0.525;0.656;0.656;0.975;0.887;0.656	D;B;B;P;P;D;P;P	0.66196	0.942;0.38;0.38;0.584;0.679;0.942;0.899;0.584	D	0.95587	0.8651	10	0.87932	D	0	.	19.6177	0.95640	0.0:0.0:1.0:0.0	.	94;94;2;94;118;94;119;119	B7ZLK5;B4DLD9;Q0PRL4;O15409-6;Q8N6B5;O15409;O15409-4;O15409-5	.;.;.;.;.;FOXP2_HUMAN;.;.	I	2;94;94;119;94;94;94;94;2;94;94;118;2	ENSP00000377137:M2I;ENSP00000377132:M94I;ENSP00000386200:M119I;ENSP00000385069:M94I;ENSP00000265436:M94I;ENSP00000367482:M94I;ENSP00000377129:M2I;ENSP00000353367:M94I;ENSP00000375084:M118I;ENSP00000377130:M2I	ENSP00000319424:M94I	M	+	3	0	FOXP2	114055854	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.632000	0.89209	0.650000	0.86243	ATG		0.468	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491		10	162	0	0	0	0.016723	0	10	162				
PTPRZ1	5803	broad.mit.edu	37	7	121652803	121652803	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:121652803A>G	ENST00000393386.2	+	12	4114	c.3703A>G	c.(3703-3705)Atg>Gtg	p.M1235V	PTPRZ1_ENST00000483028.1_Intron|PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1235					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.M1235V(2)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AAGTGAAAACATGCTGCACTC	0.393																																							uc003vjy.2		NA																	2	Substitution - Missense(2)		kidney(2)	ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						c.(3703-3705)ATG>GTG		protein tyrosine phosphatase, receptor-type,							160.0	160.0	160.0					7																	121652803		2203	4300	6503	SO:0001583	missense	5803				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:121652803A>G	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.3703A>G	7.37:g.121652803A>G	ENSP00000377047:p.Met1235Val		Somatic				PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	p.M1235V	NM_002851	NP_002842	WXS	Illumina HiSeq	Unspecified	P23471	PTPRZ_HUMAN			12	4098	+			1235			Extracellular (Potential).		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	c.3703A>G	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	A	4.942	0.175072	0.09391	.	.	ENSG00000106278	ENST00000393386	T	0.39787	1.06	5.69	1.91	0.25777	.	0.680568	0.14690	N	0.304207	T	0.23014	0.0556	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.12243	-1.0555	10	0.17832	T	0.49	.	2.1006	0.03679	0.5963:0.1344:0.1404:0.129	.	1235	P23471	PTPRZ_HUMAN	V	1235	ENSP00000377047:M1235V	ENSP00000377047:M1235V	M	+	1	0	PTPRZ1	121440039	0.007000	0.16637	0.686000	0.30086	0.633000	0.38033	0.549000	0.23329	0.988000	0.38734	0.454000	0.30748	ATG		0.393	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		9	130	0	0	0	0.004482	0	9	130				
POLR2K	5440	broad.mit.edu	37	8	101163574	101163575	+	5'UTR	DNP	GG	GG	AC			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr8:101163574_101163575GG>AC	ENST00000353107.3	+	0	126_127				POLR2K_ENST00000519765.1_3'UTR|POLR2K_ENST00000522439.1_5'UTR	NM_005034.3	NP_005025.1	P53803	RPAB4_HUMAN	polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa						7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|RNA splicing (GO:0008380)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|prostate(1)	3	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.59e-09)|all cancers(13;1.74e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			TGTGATTTCAGGGGCTAACAAT	0.416																																							uc003yjf.2		NA																	0					0						c.e2-1		DNA directed RNA polymerase II polypeptide K																																				SO:0001623	5_prime_UTR_variant	5440				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding	g.chr8:101163574_101163575GG>AC		CCDS6285.1	8q22	2013-01-21	2002-08-29		ENSG00000147669	ENSG00000147669		"""RNA polymerase subunits"""	9198	protein-coding gene	gene with protein product		606033	"""polymerase (RNA) II (DNA directed) polypeptide K (7.0kD)"""				Standard	NM_005034		Approved	RPB10alpha	uc003yjf.3	P53803	OTTHUMG00000164705	Exception_encountered	8.37:g.101163574_101163575delinsAC			Somatic						NM_005034	NP_005025	WXS	Illumina HiSeq	Unspecified	P53803	RPAB4_HUMAN	Epithelial(11;1.59e-09)|all cancers(13;1.74e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)		2	100	+	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)							Q6IBD4	Splice_Site	DNP	ENST00000353107.3	37	c.-8_splice	CCDS6285.1																																																																																				0.416	POLR2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379849.1	NM_005034		11	69	0	0	0	0.004672	0	11	69				
POLR2K	5440	broad.mit.edu	37	8	101164063	101164063	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr8:101164063G>A	ENST00000353107.3	+	3	208	c.73G>A	c.(73-75)Gaa>Aaa	p.E25K	POLR2K_ENST00000519765.1_3'UTR|POLR2K_ENST00000522439.1_Missense_Mutation_p.E25K	NM_005034.3	NP_005025.1	P53803	RPAB4_HUMAN	polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa	25					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|RNA splicing (GO:0008380)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|prostate(1)	3	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.59e-09)|all cancers(13;1.74e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			GTGTCACACAGAAAATGAAAT	0.294																																							uc003yjf.2		NA																	0					0						c.(73-75)GAA>AAA		DNA directed RNA polymerase II polypeptide K							62.0	63.0	63.0					8																	101164063		2203	4296	6499	SO:0001583	missense	5440				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding	g.chr8:101164063G>A		CCDS6285.1	8q22	2013-01-21	2002-08-29		ENSG00000147669	ENSG00000147669		"""RNA polymerase subunits"""	9198	protein-coding gene	gene with protein product		606033	"""polymerase (RNA) II (DNA directed) polypeptide K (7.0kD)"""				Standard	NM_005034		Approved	RPB10alpha	uc003yjf.3	P53803	OTTHUMG00000164705	ENST00000353107.3:c.73G>A	8.37:g.101164063G>A	ENSP00000342889:p.Glu25Lys		Somatic					p.E25K	NM_005034	NP_005025	WXS	Illumina HiSeq	Unspecified	P53803	RPAB4_HUMAN	Epithelial(11;1.59e-09)|all cancers(13;1.74e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)		3	181	+	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		25			C4-type (Potential).		Q6IBD4	Missense_Mutation	SNP	ENST00000353107.3	37	c.73G>A	CCDS6285.1	.	.	.	.	.	.	.	.	.	.	G	35	5.428591	0.96131	.	.	ENSG00000147669	ENST00000353107;ENST00000522439	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.59715	0.2214	.	.	.	0.80722	D	1	B	0.31413	0.322	B	0.32980	0.156	T	0.55016	-0.8206	8	0.37606	T	0.19	.	20.017	0.97481	0.0:0.0:1.0:0.0	.	25	P53803	RPAB4_HUMAN	K	25	.	ENSP00000342889:E25K	E	+	1	0	POLR2K	101233239	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.528000	0.98046	2.832000	0.97577	0.655000	0.94253	GAA		0.294	POLR2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379849.1	NM_005034		4	18	0	0	0	0.009096	0	4	18				
MTSS1	9788	broad.mit.edu	37	8	125577908	125577908	+	Silent	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr8:125577908G>C	ENST00000518547.1	-	9	1292	c.819C>G	c.(817-819)gtC>gtG	p.V273V	MTSS1_ENST00000395508.2_Silent_p.V7V|MTSS1_ENST00000354184.4_Silent_p.V73V|MTSS1_ENST00000378017.3_Silent_p.V273V|MTSS1_ENST00000523587.1_5'Flank|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000524090.1_Silent_p.V163V|MTSS1_ENST00000325064.5_Silent_p.V277V|MTSS1_ENST00000431961.2_Silent_p.V73V	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	273	Ser-rich.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CTCACCTGCAGACACTGGACT	0.507																																					Esophageal Squamous(160;622 1893 3862 8546 12509)	Esophageal Squamous(160;622 1893 3862 8546 12509)	uc003yrk.2		NA																	0				ovary(1)	1						c.(817-819)GTC>GTG		metastasis suppressor 1							92.0	76.0	82.0					8																	125577908		2203	4300	6503	SO:0001819	synonymous_variant	9788				actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding	g.chr8:125577908G>C	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.819C>G	8.37:g.125577908G>C			Somatic				NDUFB9_uc011lim.1_Intron|MTSS1_uc011lin.1_Silent_p.V7V|MTSS1_uc011lio.1_Silent_p.V163V|MTSS1_uc003yri.2_Silent_p.V73V|MTSS1_uc003yrj.2_Silent_p.V273V|MTSS1_uc003yrl.2_Silent_p.V277V	p.V273V	NM_014751	NP_055566	WXS	Illumina HiSeq	Unspecified	O43312	MTSS1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		9	1353	-	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		273			Ser-rich.		J3KNK6|Q8TCA2|Q96RX2	Silent	SNP	ENST00000518547.1	37	c.819C>G	CCDS6353.1	.	.	.	.	.	.	.	.	.	.	G	9.618	1.132974	0.21041	.	.	ENSG00000170873	ENST00000519168;ENST00000523179	.	.	.	5.41	0.712	0.18167	.	.	.	.	.	T	0.56016	0.1957	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49360	-0.8948	4	.	.	.	-23.8925	8.9276	0.35650	0.1066:0.4046:0.4888:0.0	.	.	.	.	V	21;121	.	.	L	-	1	2	MTSS1	125647089	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	1.148000	0.31614	0.290000	0.22444	-0.175000	0.13238	CTG		0.507	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751		13	39	0	0	0	0.024245	0	13	39				
GRIN3A	116443	broad.mit.edu	37	9	104433325	104433325	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:104433325C>T	ENST00000361820.3	-	3	1969	c.1369G>A	c.(1369-1371)Gtc>Atc	p.V457I		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	457					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TCTGAGCTGACGATGGTGGAA	0.478																																							uc004bbp.1		NA																	0				ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(1369-1371)GTC>ATC		glutamate receptor, ionotropic,	Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)						141.0	143.0	142.0					9																	104433325		2203	4300	6503	SO:0001583	missense	116443				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding	g.chr9:104433325C>T		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1369G>A	9.37:g.104433325C>T	ENSP00000355155:p.Val457Ile		Somatic				GRIN3A_uc004bbq.1_Missense_Mutation_p.V457I	p.V457I	NM_133445	NP_597702	WXS	Illumina HiSeq	Unspecified	Q8TCU5	NMD3A_HUMAN			3	1970	-		Acute lymphoblastic leukemia(62;0.0568)	457			Extracellular (Potential).		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	c.1369G>A	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	5.119	0.207487	0.09704	.	.	ENSG00000198785	ENST00000361820	D	0.86297	-2.1	5.76	-2.88	0.05682	.	0.914830	0.09384	N	0.809519	T	0.65678	0.2714	N	0.04203	-0.255	0.22446	N	0.999094	B	0.06786	0.001	B	0.08055	0.003	T	0.56553	-0.7960	10	0.05833	T	0.94	.	8.7915	0.34854	0.0:0.3956:0.1036:0.5008	.	457	Q8TCU5	NMD3A_HUMAN	I	457	ENSP00000355155:V457I	ENSP00000355155:V457I	V	-	1	0	GRIN3A	103473146	0.254000	0.23992	0.991000	0.47740	0.994000	0.84299	-0.289000	0.08365	-0.285000	0.09089	-0.238000	0.12139	GTC		0.478	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			40	148	0	0	0	0.01441	0	40	148				
TLR4	7099	broad.mit.edu	37	9	120475322	120475322	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:120475322T>G	ENST00000355622.6	+	3	1017	c.916T>G	c.(916-918)Tgt>Ggt	p.C306G	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.C266G	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	306			C -> W (in dbSNP:rs2770145).		activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	CTTATTTAATTGTTTGACAAA	0.338																																							uc004bjz.2		NA																	0				lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(916-918)TGT>GGT		toll-like receptor 4 precursor							83.0	89.0	87.0					9																	120475322		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120475322T>G	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.916T>G	9.37:g.120475322T>G	ENSP00000363089:p.Cys306Gly		Somatic				TLR4_uc004bka.2_Missense_Mutation_p.C266G|TLR4_uc004bkb.2_Missense_Mutation_p.C106G	p.C306G	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	1207	+			306			Extracellular (Potential).		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.916T>G	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065736	0.55539	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.20200	2.09;2.09	5.78	4.64	0.57946	.	0.169780	0.45606	D	0.000341	T	0.45094	0.1325	M	0.78456	2.415	0.58432	D	0.999994	D	0.89917	1.0	D	0.75020	0.985	T	0.37079	-0.9721	10	0.44086	T	0.13	.	11.8228	0.52250	0.0:0.0686:0.0:0.9314	.	306	O00206	TLR4_HUMAN	G	266;306	ENSP00000377997:C266G;ENSP00000363089:C306G	ENSP00000363089:C306G	C	+	1	0	TLR4	119515143	1.000000	0.71417	0.846000	0.33378	0.500000	0.33767	4.317000	0.59184	1.015000	0.39444	0.533000	0.62120	TGT		0.338	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		12	55	0	0	0	0.020292	0	12	55				
SLC25A25	114789	broad.mit.edu	37	9	130868088	130868088	+	Silent	SNP	C	C	A	rs376606350		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:130868088C>A	ENST00000373064.5	+	6	989	c.726C>A	c.(724-726)ctC>ctA	p.L242L	RP11-395P17.11_ENST00000602939.1_RNA|SLC25A25_ENST00000373068.2_Silent_p.L276L|SLC25A25_ENST00000373069.5_Silent_p.L288L|SLC25A25_ENST00000433501.1_Silent_p.L139L|SLC25A25_ENST00000373066.5_Silent_p.L274L|SLC25A25_ENST00000432073.2_Silent_p.L262L	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	242					adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						CCAGGTCACTCTGGCGGGGCA	0.577																																							uc004bte.2		NA																	0					0						c.(724-726)CTC>CTA		solute carrier family 25, member 25 isoform a							82.0	72.0	76.0					9																	130868088		2203	4300	6503	SO:0001819	synonymous_variant	114789				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding	g.chr9:130868088C>A	AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.726C>A	9.37:g.130868088C>A			Somatic				SLC25A25_uc004btb.2_Silent_p.L276L|SLC25A25_uc004btc.2_Silent_p.L262L|SLC25A25_uc004btd.2_Silent_p.L274L|SLC25A25_uc004btf.2_Silent_p.L139L	p.L242L	NM_052901	NP_443133	WXS	Illumina HiSeq	Unspecified	Q6KCM7	SCMC2_HUMAN			6	755	+			242			Solcar 1.|Mitochondrial matrix (Potential).		Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Silent	SNP	ENST00000373064.5	37	c.726C>A	CCDS6890.1																																																																																				0.577	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054407.1	NM_052901		15	76	1	0	6.31663e-08	0.024245	6.79335e-08	15	76				
NUP188	23511	broad.mit.edu	37	9	131721149	131721149	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:131721149C>G	ENST00000372577.2	+	7	462	c.441C>G	c.(439-441)ttC>ttG	p.F147L		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	147					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						TCACTTACTTCCAAGATGAAA	0.313																																							uc004bws.1		NA																	0				ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						c.(439-441)TTC>TTG		nucleoporin 188kDa							65.0	62.0	63.0					9																	131721149		2203	4300	6503	SO:0001583	missense	23511				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr9:131721149C>G	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.441C>G	9.37:g.131721149C>G	ENSP00000361658:p.Phe147Leu		Somatic					p.F147L	NM_015354	NP_056169	WXS	Illumina HiSeq	Unspecified	Q5SRE5	NU188_HUMAN			7	463	+			147					Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	c.441C>G	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.315836	0.81469	.	.	ENSG00000095319	ENST00000372577	T	0.30714	1.52	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.39809	0.1092	L	0.27053	0.805	0.58432	D	0.999996	D	0.53885	0.963	P	0.62382	0.901	T	0.16541	-1.0399	10	0.62326	D	0.03	-3.8146	13.8863	0.63710	0.0:0.9242:0.0:0.0758	.	147	Q5SRE5	NU188_HUMAN	L	147	ENSP00000361658:F147L	ENSP00000361658:F147L	F	+	3	2	NUP188	130760970	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.000000	0.29770	2.710000	0.92621	0.491000	0.48974	TTC		0.313	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			3	28	0	0	0	0.009096	0	3	28				
NTNG2	84628	broad.mit.edu	37	9	135073778	135073778	+	Silent	SNP	C	C	T	rs371305436		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:135073778C>T	ENST00000393229.3	+	3	1415	c.639C>T	c.(637-639)ttC>ttT	p.F213F	NTNG2_ENST00000360670.3_Silent_p.F213F|NTNG2_ENST00000393228.4_Silent_p.F213F|NTNG2_ENST00000372179.3_Silent_p.F213F	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	213	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		ACGTGCGCTTCGAGGTGCGGG	0.667																																							uc004cbh.2		NA																	0					0						c.(637-639)TTC>TTT		netrin G2 precursor		C		0,4406		0,0,2203	45.0	39.0	41.0		639	1.8	1.0	9		41	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NTNG2	NM_032536.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		213/531	135073778	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84628				axonogenesis	anchored to plasma membrane		g.chr9:135073778C>T	AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.639C>T	9.37:g.135073778C>T			Somatic					p.F213F	NM_032536	NP_115925	WXS	Illumina HiSeq	Unspecified	Q96CW9	NTNG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)	3	1415	+			213			Laminin N-terminal.		Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	ENST00000393229.3	37	c.639C>T	CCDS6946.1																																																																																				0.667	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	NM_032536		9	37	0	0	0	0.006214	0	9	37				
ANAPC2	29882	broad.mit.edu	37	9	140077680	140077680	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:140077680C>G	ENST00000323927.2	-	6	1187	c.1183G>C	c.(1183-1185)Gac>Cac	p.D395H		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	395					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GTGATGATGTCACACGTGTTG	0.617																																							uc004clr.1		NA																	0				ovary(1)	1						c.(1183-1185)GAC>CAC		anaphase-promoting complex subunit 2							138.0	134.0	135.0					9																	140077680		2203	4300	6503	SO:0001583	missense	29882				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity	g.chr9:140077680C>G	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1183G>C	9.37:g.140077680C>G	ENSP00000314004:p.Asp395His		Somatic				ANAPC2_uc004clq.1_Missense_Mutation_p.D251H	p.D395H	NM_013366	NP_037498	WXS	Illumina HiSeq	Unspecified	Q9UJX6	ANC2_HUMAN	STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)	6	1256	-	all_cancers(76;0.0926)		395					Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	37	c.1183G>C	CCDS7033.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.386364	0.82902	.	.	ENSG00000176248	ENST00000323927	T	0.03152	4.03	4.83	4.83	0.62350	.	0.093926	0.64402	D	0.000001	T	0.21801	0.0525	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.00934	-1.1509	10	0.87932	D	0	-33.4643	15.4405	0.75178	0.0:1.0:0.0:0.0	.	395;392	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	H	395	ENSP00000314004:D395H	ENSP00000314004:D395H	D	-	1	0	ANAPC2	139197501	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	7.145000	0.77365	2.515000	0.84797	0.561000	0.74099	GAC		0.617	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	NM_013366		39	139	0	0	0	0.010771	0	39	139				
VDAC1	7416	broad.mit.edu	37	X	80185639	80185639	+	IGR	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:80185639A>T								RNU6-493P (29276 upstream) : RNU6-995P (6293 downstream)																							AGCAGGAAACAGTAACACGCG	0.493																																							uc004eec.1		NA																	0					NA						c.(538-540)AGT>TGT		SubName: Full=cDNA FLJ16670 fis, clone THYMU3001133, highly similar to Voltage-dependent anion-selective channel protein 1; SubName: Full=Voltage-dependent anion channel 1, isoform CRA_a;																																				SO:0001628	intergenic_variant	0							g.chrX:80185639A>T																													X.37:g.80185639A>T			Somatic					p.S180C			WXS	Illumina HiSeq	Unspecified					1	712	+									Missense_Mutation	SNP		37	c.538A>T																																																																																				0	0.493									16	96	0	0	0	0.008871	0	16	96				
FAM122C	159091	broad.mit.edu	37	X	133941655	133941655	+	Silent	SNP	T	T	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:133941655T>G	ENST00000370784.4	+	1	433	c.27T>G	c.(25-27)ggT>ggG	p.G9G	FAM122C_ENST00000414371.2_Silent_p.G45G|FAM122C_ENST00000445123.1_5'UTR|FAM122C_ENST00000475361.1_3'UTR|FAM122C_ENST00000370785.3_Silent_p.G9G	NM_001170779.1	NP_001164250.1	Q6P4D5	F222C_HUMAN	family with sequence similarity 122C	9										endometrium(2)|kidney(1)|lung(2)	5	Acute lymphoblastic leukemia(192;0.000127)					TGAAACTAGGTTTCAAGTCGC	0.522																																							uc004exz.1		NA																	0					0						c.(25-27)GGT>GGG		hypothetical protein LOC159091							121.0	107.0	112.0					X																	133941655		2203	4300	6503	SO:0001819	synonymous_variant	159091							g.chrX:133941655T>G	BC017868	CCDS14644.1, CCDS55500.1, CCDS55501.1, CCDS76028.1	Xq26.3	2008-02-05	2006-07-11		ENSG00000156500	ENSG00000156500			25202	protein-coding gene	gene with protein product						12477932	Standard	NM_138819		Approved	RP3-473B4.1	uc004exz.2	Q6P4D5	OTTHUMG00000022716	ENST00000370784.4:c.27T>G	X.37:g.133941655T>G			Somatic				FAM122C_uc010nru.1_Silent_p.G45G|FAM122C_uc004exw.2_Silent_p.G9G|FAM122C_uc004exx.2_RNA|FAM122C_uc011mvq.1_RNA|FAM122C_uc004exy.1_Silent_p.G9G	p.G9G	NM_138819	NP_620174	WXS	Illumina HiSeq	Unspecified	Q6P4D5	F222C_HUMAN			1	432	+	Acute lymphoblastic leukemia(192;0.000127)		9					F5H036|Q8WVK9	Silent	SNP	ENST00000370784.4	37	c.27T>G	CCDS55501.1																																																																																				0.522	FAM122C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_138819		18	125	0	0	0	0.01892	0	18	125				
MAGEC1	9947	broad.mit.edu	37	X	140994960	140994960	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:140994960G>A	ENST00000285879.4	+	4	2056	c.1770G>A	c.(1768-1770)ctG>ctA	p.L590L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	590										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGGACTCCCTGTCTCCTCACT	0.567										HNSCC(15;0.026)																													uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1768-1770)CTG>CTA		melanoma antigen family C, 1							229.0	245.0	240.0					X																	140994960		2203	4300	6503	SO:0001819	synonymous_variant	9947						protein binding	g.chrX:140994960G>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1770G>A	X.37:g.140994960G>A		HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_Intron	p.L590L	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	2056	+	Acute lymphoblastic leukemia(192;6.56e-05)		590					A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	c.1770G>A	CCDS35417.1																																																																																				0.567	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		7	481	0	0	0	0.00308	0	7	481				
MTMR1	8776	broad.mit.edu	37	X	149901147	149901147	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:149901147C>A	ENST00000370390.3	+	9	1158	c.1001C>A	c.(1000-1002)tCa>tAa	p.S334*	MTMR1_ENST00000544228.1_Nonsense_Mutation_p.S334*|MTMR1_ENST00000538506.1_Nonsense_Mutation_p.S221*|MTMR1_ENST00000542156.1_Nonsense_Mutation_p.S334*|MTMR1_ENST00000451863.2_Nonsense_Mutation_p.S334*|MTMR1_ENST00000541925.1_Nonsense_Mutation_p.S240*|MTMR1_ENST00000445323.2_Nonsense_Mutation_p.S342*	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	334	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)	p.S334*(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					AACGCACAGTCACACAAGCTT	0.423																																							uc004fei.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1000-1002)TCA>TAA		myotubularin-related protein 1							129.0	102.0	111.0					X																	149901147		2203	4300	6503	SO:0001587	stop_gained	8776					plasma membrane	protein tyrosine phosphatase activity	g.chrX:149901147C>A	U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.1001C>A	X.37:g.149901147C>A	ENSP00000359417:p.Ser334*		Somatic				MTMR1_uc011mya.1_Nonsense_Mutation_p.S240*|MTMR1_uc004feg.1_Nonsense_Mutation_p.S334*|MTMR1_uc004feh.1_Nonsense_Mutation_p.S342*|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_RNA	p.S334*	NM_003828	NP_003819	WXS	Illumina HiSeq	Unspecified	Q13613	MTMR1_HUMAN			9	1136	+	Acute lymphoblastic leukemia(192;6.56e-05)		334			Myotubularin phosphatase.		A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Nonsense_Mutation	SNP	ENST00000370390.3	37	c.1001C>A	CCDS14695.1	.	.	.	.	.	.	.	.	.	.	C	38	6.902986	0.97924	.	.	ENSG00000063601	ENST00000541925;ENST00000542156;ENST00000370390;ENST00000445323;ENST00000544228;ENST00000451863;ENST00000538506	.	.	.	5.93	5.93	0.95920	.	0.054740	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2891	0.94092	0.0:1.0:0.0:0.0	.	.	.	.	X	240;334;334;342;334;334;221	.	ENSP00000359417:S334X	S	+	2	0	MTMR1	149651805	1.000000	0.71417	0.995000	0.50966	0.800000	0.45204	7.818000	0.86416	2.508000	0.84585	0.523000	0.50628	TCA		0.423	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789		9	54	1	0	4.68919e-08	0.008291	5.07501e-08	9	54				
F8	2157	broad.mit.edu	37	X	154197823	154197823	+	Silent	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:154197823C>G	ENST00000360256.4	-	7	992	c.792G>C	c.(790-792)ctG>ctC	p.L264L		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	264	F5/8 type A 1.|Plastocyanin-like 2.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GGCATCCAATCAGACCTGTAA	0.418																																							uc004fmt.2		NA																	0				ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(790-792)CTG>CTC		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						107.0	92.0	97.0					X																	154197823		2203	4300	6503	SO:0001819	synonymous_variant	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154197823C>G	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.792G>C	X.37:g.154197823C>G			Somatic					p.L264L	NM_000132	NP_000123	WXS	Illumina HiSeq	Unspecified	P00451	FA8_HUMAN			7	963	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		264			Plastocyanin-like 2.|F5/8 type A 1.		Q14286|Q5HY69	Silent	SNP	ENST00000360256.4	37	c.792G>C	CCDS35457.1																																																																																				0.418	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			27	67	0	0	0	0.034045	0	27	67				
CD37	951	broad.mit.edu	37	19	49841253	49841253	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:49841253delG	ENST00000323906.4	+	5	555	c.414delG	c.(412-414)gcgfs	p.A139fs	CD37_ENST00000535669.2_Frame_Shift_Del_p.A139fs|CD37_ENST00000426897.2_Frame_Shift_Del_p.A71fs|CD37_ENST00000596426.1_3'UTR|CD37_ENST00000598095.1_Frame_Shift_Del_p.A71fs|CTC-301O7.4_ENST00000358234.4_lincRNA	NM_001774.2	NP_001765.1	P11049	CD37_HUMAN	CD37 molecule	139					defense response to protozoan (GO:0042832)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid dendritic cell activation (GO:0030886)|positive regulation of immunoglobulin production (GO:0002639)|regulation of defense response to virus (GO:0050688)|regulation of humoral immune response (GO:0002920)	extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	11		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		AGGAGACCGCGGCCGAGGAGA	0.632																																							uc002pnd.2		NA																	0					0						c.(412-414)GCGfs		CD37 antigen isoform A							105.0	96.0	99.0					19																	49841253		2203	4300	6503	SO:0001589	frameshift_variant	951					integral to membrane		g.chr19:49841253delG		CCDS12760.1, CCDS46139.1	19p13-q13.4	2013-02-14	2006-03-28			ENSG00000104894		"""CD molecules"", ""Tetraspanins"""	1666	protein-coding gene	gene with protein product		151523	"""CD37 antigen"""			8436422	Standard	XM_005259435		Approved	TSPAN26	uc002pnd.3	P11049		ENST00000323906.4:c.414delG	19.37:g.49841253delG	ENSP00000325708:p.Ala139fs		Somatic				uc002pnb.1_Intron|CD37_uc002pnc.2_RNA|CD37_uc010yam.1_Frame_Shift_Del_p.A138fs|CD37_uc010yan.1_Frame_Shift_Del_p.A70fs|CD37_uc002pnf.3_Frame_Shift_Del_p.A110fs|CD37_uc002pne.2_Frame_Shift_Del_p.A70fs	p.A138fs	NM_001774	NP_001765	WXS	Illumina HiSeq	Unspecified	P11049	CD37_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)	5	535	+		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	138			Extracellular (Potential).		B4DVC1|Q3KPF9	Frame_Shift_Del	DEL	ENST00000323906.4	37	c.414delG	CCDS12760.1																																																																																				0.632	CD37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465532.1			17	49	NA	NA	NA	NA	NA	17	49	---	---	---	---
ALS2CR11	151254	broad.mit.edu	37	2	202352352	202352352	+	Frame_Shift_Del	DEL	T	T	-			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:202352352delT	ENST00000286195.3	-	15	1899	c.1855delA	c.(1855-1857)attfs	p.I619fs	ALS2CR11_ENST00000439802.1_3'UTR|ALS2CR11_ENST00000482942.1_5'Flank|ALS2CR11_ENST00000439140.1_Frame_Shift_Del_p.I1816fs	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	619										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						CCTCTTTTAATTTTTTTTGGC	0.323																																							uc002uye.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(1855-1857)ATTfs		amyotrophic lateral sclerosis 2 (juvenile)							97.0	96.0	96.0					2																	202352352		2203	4300	6503	SO:0001589	frameshift_variant	151254							g.chr2:202352352delT	AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1855delA	2.37:g.202352352delT	ENSP00000286195:p.Ile619fs		Somatic				ALS2CR11_uc002uyf.2_Frame_Shift_Del_p.I1816fs|ALS2CR11_uc010fti.2_3'UTR	p.I619fs	NM_152525	NP_689738	WXS	Illumina HiSeq	Unspecified	Q53TS8	AL2SA_HUMAN			15	1903	-			619					C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Frame_Shift_Del	DEL	ENST00000286195.3	37	c.1855delA	CCDS2349.1																																																																																				0.323	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	NM_152525		7	55	NA	NA	NA	NA	NA	7	55	---	---	---	---
NBEAL1	65065	broad.mit.edu	37	2	204030880	204030882	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	AAG	AAG	-	-	AAG	AAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:204030880_204030882delAAG	ENST00000449802.1	+	36	5969_5971	c.5636_5638delAAG	c.(5635-5640)aaagaa>aaa	p.E1881del		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1881										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AGTGATGAGAAAGAAGAACAGGA	0.281																																							uc002uzt.3		NA																	0				ovary(1)|skin(1)	2						c.(5635-5640)AAAGAA>AAA		neurobeachin-like 1 isoform 3																																				SO:0001651	inframe_deletion	65065						binding	g.chr2:204030880_204030882delAAG	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.5636_5638delAAG	2.37:g.204030883_204030885delAAG	ENSP00000399903:p.Glu1881del		Somatic				NBEAL1_uc002uzs.3_In_Frame_Del_p.E591del	p.E1881del	NM_001114132	NP_001107604	WXS	Illumina HiSeq	Unspecified	Q6ZS30	NBEL1_HUMAN			36	5969_5971	+			1881					A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	In_Frame_Del	DEL	ENST00000449802.1	37	c.5636_5638delAAG	CCDS46495.1																																																																																				0.281	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4			15	33	NA	NA	NA	NA	NA	15	33	---	---	---	---
LRRC14	9684	broad.mit.edu	37	8	145746499	145746502	+	Frame_Shift_Del	DEL	TGAG	TGAG	-			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	TGAG	TGAG	-	-	TGAG	TGAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr8:145746499_145746502delTGAG	ENST00000292524.1	+	4	1265_1268	c.1119_1122delTGAG	c.(1117-1122)actgagfs	p.TE373fs	LRRC14_ENST00000529022.1_Frame_Shift_Del_p.TE373fs	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	373										endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGGAGCTGACTGAGTGTCAGCTCG	0.593																																							uc003zdk.1		NA																	0					0						c.(1117-1122)ACTGAGfs		leucine rich repeat containing 14																																				SO:0001589	frameshift_variant	9684							g.chr8:145746499_145746502delTGAG	BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179	ENST00000292524.1:c.1119_1122delTGAG	8.37:g.145746499_145746502delTGAG	ENSP00000292524:p.Thr373fs		Somatic				LRRC14_uc003zdl.1_Frame_Shift_Del_p.T373fs|LRRC14_uc003zdo.2_5'Flank	p.T373fs	NM_014665	NP_055480	WXS	Illumina HiSeq	Unspecified	Q15048	LRC14_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		4	1265_1268	+	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		373_374			LRR 4.		A8K0A8|D3DWM8	Frame_Shift_Del	DEL	ENST00000292524.1	37	c.1119_1122delTGAG	CCDS6432.1																																																																																				0.593	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382494.1	NM_014665		10	50	NA	NA	NA	NA	NA	10	50	---	---	---	---
