#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
HSPG2	3339	broad.mit.edu	37	1	22179193	22179193	+	Splice_Site	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:22179193C>A	ENST00000374695.3	-	52	6803	c.6724G>T	c.(6724-6726)Gga>Tga	p.G2242*	HSPG2_ENST00000430507.1_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2242	Ig-like C2-type 7.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	AGTCACTCACCAGGGATGACA	0.637																																							uc001bfj.2		NA																	0				ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9						c.(6724-6726)GGA>TGA		heparan sulfate proteoglycan 2 precursor	Becaplermin(DB00102)|Palifermin(DB00039)						95.0	103.0	101.0					1																	22179193		2203	4300	6503	SO:0001630	splice_region_variant	3339				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	g.chr1:22179193C>A	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.6724+1G>T	1.37:g.22179193C>A			Somatic				HSPG2_uc009vqd.2_Nonsense_Mutation_p.G2243*	p.G2242*	NM_005529	NP_005520	WXS	Illumina HiSeq	Unspecified	P98160	PGBM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	52	6764	-		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	2242			Ig-like C2-type 7.		Q16287|Q5SZI3|Q9H3V5	Nonsense_Mutation	SNP	ENST00000374695.3	37	c.6724G>T	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	48	14.680994	0.99805	.	.	ENSG00000142798	ENST00000374695	.	.	.	5.13	5.13	0.70059	.	0.215364	0.23121	N	0.051681	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9397	0.64048	0.0:1.0:0.0:0.0	.	.	.	.	X	2242	.	.	G	-	1	0	HSPG2	22051780	0.014000	0.17966	1.000000	0.80357	0.915000	0.54546	-0.103000	0.10940	2.667000	0.90743	0.561000	0.74099	GGA		0.637	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	Nonsense_Mutation	27	161	1	0	1.88708e-17	0.008361	2.96823e-17	27	161				
DAB1	1600	broad.mit.edu	37	1	57480716	57480716	+	Silent	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:57480716G>A	ENST00000371231.1	-	13	1417	c.1383C>T	c.(1381-1383)tcC>tcT	p.S461S	DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000439789.2_Silent_p.S342S|DAB1_ENST00000371236.2_Silent_p.S428S|DAB1_ENST00000420954.2_Silent_p.S426S|DAB1_ENST00000371234.4_Silent_p.S428S|DAB1_ENST00000414851.2_Silent_p.S410S			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	461					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CGGGTTTGCGGGAGGGCACGG	0.567																																							uc001cys.1		NA																	0				skin(2)|ovary(1)	3						c.(1282-1284)TCC>TCT		disabled homolog 1							74.0	77.0	76.0					1																	57480716		2203	4300	6503	SO:0001819	synonymous_variant	1600				cell differentiation|nervous system development			g.chr1:57480716G>A	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1383C>T	1.37:g.57480716G>A			Somatic				DAB1_uc001cyt.1_Silent_p.S426S|DAB1_uc001cyq.1_Silent_p.S426S|DAB1_uc001cyr.1_Silent_p.S342S|DAB1_uc009vzw.1_Silent_p.S410S|DAB1_uc009vzx.1_Silent_p.S428S	p.S428S	NM_021080	NP_066566	WXS	Illumina HiSeq	Unspecified	O75553	DAB1_HUMAN			14	1958	-			461					A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	ENST00000371231.1	37	c.1284C>T																																																																																					0.567	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080		3	81	0	0	0	0.009096	0	3	81				
TTLL7	79739	broad.mit.edu	37	1	84373239	84373239	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:84373239C>T	ENST00000260505.8	-	16	2269	c.1892G>A	c.(1891-1893)cGg>cAg	p.R631Q	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	631					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		AGAAGTTGGCCGTGACACAGA	0.507																																							uc001djc.2		NA																	0				ovary(1)	1						c.(1891-1893)CGG>CAG		tubulin tyrosine ligase-like family, member 7							142.0	125.0	131.0					1																	84373239		2203	4300	6503	SO:0001583	missense	79739				cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity	g.chr1:84373239C>T	AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.1892G>A	1.37:g.84373239C>T	ENSP00000260505:p.Arg631Gln		Somatic				TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_RNA|TTLL7_uc001djg.2_RNA	p.R631Q	NM_024686	NP_078962	WXS	Illumina HiSeq	Unspecified	Q6ZT98	TTLL7_HUMAN		all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)	16	2288	-			631					Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	ENST00000260505.8	37	c.1892G>A	CCDS690.2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329094	0.81690	.	.	ENSG00000137941	ENST00000260505;ENST00000370704;ENST00000370703	T	0.06068	3.35	5.34	5.34	0.76211	.	0.485095	0.23098	N	0.051946	T	0.13713	0.0332	M	0.64997	1.995	0.58432	D	0.999996	D	0.76494	0.999	P	0.59595	0.86	T	0.00817	-1.1554	10	0.54805	T	0.06	.	18.6485	0.91421	0.0:1.0:0.0:0.0	.	631	Q6ZT98	TTLL7_HUMAN	Q	631;408;631	ENSP00000260505:R631Q	ENSP00000260505:R631Q	R	-	2	0	TTLL7	84145827	0.961000	0.32948	0.747000	0.31113	0.920000	0.55202	2.186000	0.42593	2.499000	0.84300	0.460000	0.39030	CGG		0.507	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686		4	105	0	0	0	0.009096	0	4	105				
CLCA1	1179	broad.mit.edu	37	1	86951243	86951243	+	Splice_Site	SNP	C	C	T	rs371482526		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:86951243C>T	ENST00000234701.3	+	7	1304	c.953C>T	c.(952-954)gCg>gTg	p.A318V	CLCA1_ENST00000394711.1_Splice_Site_p.A318V			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	318	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		GGAAGCATGGCGGTATGTTCA	0.468																																							uc001dlt.2		NA																	0				ovary(1)	1						c.(952-954)GCG>GTG		chloride channel accessory 1 precursor		C	VAL/ALA	0,4406		0,0,2203	161.0	139.0	146.0		953	-2.7	0.0	1		146	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice	CLCA1	NM_001285.3	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	318/915	86951243	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	1179				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity	g.chr1:86951243C>T		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.954+1C>T	1.37:g.86951243C>T			Somatic				CLCA1_uc001dls.1_Missense_Mutation_p.A257V	p.A318V	NM_001285	NP_001276	WXS	Illumina HiSeq	Unspecified	A8K7I4	CLCA1_HUMAN		all cancers(265;0.0249)|Epithelial(280;0.0476)	6	1082	+		Lung NSC(277;0.239)	318			VWFA.		B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	c.953C>T	CCDS709.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760898	0.89932	0.0	1.16E-4	ENSG00000016490	ENST00000234701;ENST00000394711;ENST00000539889	D;D	0.88277	-2.36;-2.36	5.92	-2.72	0.05968	von Willebrand factor, type A (3);	2.053990	0.01909	N	0.039715	T	0.77831	0.4189	M	0.64676	1.99	0.09310	N	1	B;P	0.41345	0.19;0.746	B;B	0.43658	0.23;0.426	T	0.66536	-0.5899	10	0.46703	T	0.11	7.0413	1.6248	0.02721	0.2054:0.2387:0.3544:0.2014	.	318;81	A8K7I4;B4DUZ6	CLCA1_HUMAN;.	V	318;318;31	ENSP00000234701:A318V;ENSP00000378200:A318V	ENSP00000234701:A318V	A	+	2	0	CLCA1	86723831	.	.	0.000000	0.03702	0.916000	0.54674	.	.	-0.427000	0.07350	0.650000	0.86243	GCG		0.468	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	Missense_Mutation	11	138	0	0	0	0.00245	0	11	138				
KCNA3	3738	broad.mit.edu	37	1	111216622	111216622	+	Silent	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:111216622C>A	ENST00000369769.2	-	1	1033	c.810G>T	c.(808-810)tcG>tcT	p.S270S		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	270					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	ATGAGTCCTGCGACGTCGAGG	0.622																																							uc001dzv.1		NA																	0				ovary(4)|pancreas(1)	5						c.(808-810)TCG>TCT		potassium voltage-gated channel, shaker-related							44.0	47.0	46.0					1																	111216622		2203	4300	6503	SO:0001819	synonymous_variant	3738					voltage-gated potassium channel complex	delayed rectifier potassium channel activity	g.chr1:111216622C>A	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.810G>T	1.37:g.111216622C>A			Somatic					p.S270S	NM_002232	NP_002223	WXS	Illumina HiSeq	Unspecified	P22001	KCNA3_HUMAN		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	1	1034	-		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)	270					Q5VWN2	Silent	SNP	ENST00000369769.2	37	c.810G>T	CCDS828.2																																																																																				0.622	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232		17	76	1	0	1.99824e-07	0.00499	2.49367e-07	17	76				
TRIM33	51592	broad.mit.edu	37	1	114940316	114940316	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:114940316C>T	ENST00000358465.2	-	20	3421	c.3338G>A	c.(3337-3339)cGc>cAc	p.R1113H	TRIM33_ENST00000450349.2_Missense_Mutation_p.R745H|TRIM33_ENST00000369543.2_Missense_Mutation_p.R1096H	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	1113					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCGTTTTCTGCGGGGCTGTAT	0.373			T	RET	papillary thyroid																																		uc001eew.2		NA		Dom	yes		1	1p13	51592	T	""" tripartite motif-containing 33 (PTC7,TIF1G)"""			E	RET		papillary thyroid		0				lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11						c.(3337-3339)CGC>CAC		tripartite motif-containing 33 protein isoform							133.0	137.0	135.0					1																	114940316		2203	4300	6503	SO:0001583	missense	51592				negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding	g.chr1:114940316C>T	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.3338G>A	1.37:g.114940316C>T	ENSP00000351250:p.Arg1113His		Somatic				TRIM33_uc010owr.1_Missense_Mutation_p.R727H|TRIM33_uc010ows.1_Missense_Mutation_p.R745H|TRIM33_uc001eex.2_Missense_Mutation_p.R1096H	p.R1113H	NM_015906	NP_056990	WXS	Illumina HiSeq	Unspecified	Q9UPN9	TRI33_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	20	3422	-	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	1113					O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	ENST00000358465.2	37	c.3338G>A	CCDS872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.20|18.20	3.571629|3.571629	0.65765|0.65765	.|.	.|.	ENSG00000197323|ENSG00000197323	ENST00000448034|ENST00000358465;ENST00000369543;ENST00000450349	.|T;T;T	.|0.79653	.|-1.16;-0.95;-1.29	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.046228	.|0.85682	.|D	.|0.000000	D|D	0.86606|0.86606	0.5973|0.5973	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D;D;D	.|0.89917	.|1.0;0.999;0.999;0.999	.|D;D;D;P	.|0.83275	.|0.996;0.948;0.984;0.893	D|D	0.86918|0.86918	0.2065|0.2065	5|10	.|0.72032	.|D	.|0.01	-8.1496|-8.1496	19.6651|19.6651	0.95890|0.95890	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|745;745;1096;1113	.|E7EN20;B3KN30;Q9UPN9-2;Q9UPN9	.|.;.;.;TRI33_HUMAN	T|H	874|1113;1096;745	.|ENSP00000351250:R1113H;ENSP00000358556:R1096H;ENSP00000412077:R745H	.|ENSP00000351250:R1113H	A|R	-|-	1|2	0|0	TRIM33|TRIM33	114741839|114741839	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.164000|4.164000	0.58190|0.58190	2.722000|2.722000	0.93159|0.93159	0.650000|0.650000	0.86243|0.86243	GCA|CGC		0.373	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906		4	141	0	0	0	0.000602	0	4	141				
NBPF10	100132406	broad.mit.edu	37	1	145295453	145295453	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:145295453T>G	ENST00000342960.5	+	2	241	c.206T>G	c.(205-207)tTt>tGt	p.F69C	NBPF10_ENST00000369338.1_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	69						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CTCATAAAATTTATGCTGAGG	0.532																																							uc001end.3		NA																	0					0						c.(205-207)TTT>TGT		hypothetical protein LOC100132406																																				SO:0001583	missense	100132406							g.chr1:145295453T>G	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.206T>G	1.37:g.145295453T>G	ENSP00000345684:p.Phe69Cys		Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Missense_Mutation_p.F69C|NOTCH2NL_uc010oyh.1_RNA|NBPF10_uc001emq.1_Intron	p.F69C	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	2	241	+	all_hematologic(923;0.032)		69					Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	c.206T>G	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	2.955	-0.215879	0.06101	.	.	ENSG00000163386	ENST00000369339;ENST00000342960	T	0.03152	4.03	1.15	0.124	0.14714	.	.	.	.	.	T	0.01592	0.0051	L	0.44542	1.39	0.09310	N	1	.	.	.	.	.	.	T	0.46190	-0.9209	7	0.66056	D	0.02	.	4.1409	0.10193	0.0:0.7493:0.0:0.2507	.	.	.	.	C	69	ENSP00000345684:F69C	ENSP00000345684:F69C	F	+	2	0	NBPF10	144006810	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	0.023000	0.13533	0.037000	0.15575	-1.550000	0.00899	TTT		0.532	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		3	112	0	0	0	0.004672	0	3	112				
BCL9	607	broad.mit.edu	37	1	147084715	147084715	+	Silent	SNP	T	T	C			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:147084715T>C	ENST00000234739.3	+	5	827	c.87T>C	c.(85-87)cgT>cgC	p.R29R	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	29					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					TGATGGTCCGTCCCCCTACAG	0.502			T	"""IGH@, IGL@"""	B-ALL																																		uc001epq.2		NA		Dom	yes		1	1q21	607	T	B-cell CLL/lymphoma 9			L	IGH@|IGL@		B-ALL		0				ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(85-87)CGT>CGC		B-cell CLL/lymphoma 9							87.0	90.0	89.0					1																	147084715		2203	4300	6503	SO:0001819	synonymous_variant	607				Wnt receptor signaling pathway	nucleus	protein binding	g.chr1:147084715T>C	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.87T>C	1.37:g.147084715T>C			Somatic				BCL9_uc010ozr.1_Silent_p.R29R	p.R29R	NM_004326	NP_004317	WXS	Illumina HiSeq	Unspecified	O00512	BCL9_HUMAN			5	827	+	all_hematologic(923;0.115)		29					Q5T489	Silent	SNP	ENST00000234739.3	37	c.87T>C	CCDS30833.1																																																																																				0.502	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326		3	141	0	0	0	0.009096	0	3	141				
ARNT	405	broad.mit.edu	37	1	150807080	150807080	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:150807080T>C	ENST00000358595.5	-	8	937	c.737A>G	c.(736-738)aAg>aGg	p.K246R	ARNT_ENST00000354396.2_Missense_Mutation_p.K246R|ARNT_ENST00000468970.1_5'UTR|ARNT_ENST00000505755.1_Missense_Mutation_p.K231R|ARNT_ENST00000515192.1_Missense_Mutation_p.K237R	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	246					cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTGACCTTCCTTTTTCACTGT	0.463			T	ETV6	AML																																		uc001evr.1		NA		Dom	yes		1	1q21	405	T	aryl hydrocarbon receptor nuclear translocator			L	ETV6		AML		0				skin(4)|lung(3)|central_nervous_system(1)|kidney(1)	9						c.(736-738)AAG>AGG		aryl hydrocarbon receptor nuclear translocator							186.0	160.0	168.0					1																	150807080		2203	4300	6503	SO:0001583	missense	405				positive regulation of hormone biosynthetic process|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hypoxia		aryl hydrocarbon receptor binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity	g.chr1:150807080T>C	AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.737A>G	1.37:g.150807080T>C	ENSP00000351407:p.Lys246Arg		Somatic				ARNT_uc001evs.1_Missense_Mutation_p.K231R|ARNT_uc009wmb.1_Missense_Mutation_p.K237R|ARNT_uc009wmc.1_Missense_Mutation_p.K246R|ARNT_uc009wmd.1_Missense_Mutation_p.K231R|ARNT_uc009wme.1_Missense_Mutation_p.K246R|ARNT_uc010pcl.1_Missense_Mutation_p.K230R	p.K246R	NM_001668	NP_001659	WXS	Illumina HiSeq	Unspecified	P27540	ARNT_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)		8	880	-	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		246					B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Missense_Mutation	SNP	ENST00000358595.5	37	c.737A>G	CCDS970.1	.	.	.	.	.	.	.	.	.	.	T	29.7	5.030726	0.93575	.	.	ENSG00000143437	ENST00000358595;ENST00000368975;ENST00000354396;ENST00000515192;ENST00000394700;ENST00000505755	T;T;T;T	0.06218	3.45;3.44;3.46;3.33	5.61	5.61	0.85477	PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.16085	0.0387	M	0.66560	2.04	0.80722	D	1	D;D;D;P;P;D;D	0.89917	0.999;1.0;1.0;0.733;0.83;0.959;0.999	D;D;D;P;P;P;D	0.91635	0.998;0.998;0.999;0.525;0.756;0.835;0.998	T	0.00512	-1.1696	10	0.62326	D	0.03	.	15.8039	0.78477	0.0:0.0:0.0:1.0	.	230;246;231;246;237;231;246	B4E3L5;A6NGV6;A8K6P0;F8WAP6;P27540-3;P27540-2;P27540	.;.;.;.;.;.;ARNT_HUMAN	R	246;246;246;237;230;231	ENSP00000351407:K246R;ENSP00000346372:K246R;ENSP00000423851:K237R;ENSP00000427571:K231R	ENSP00000346372:K246R	K	-	2	0	ARNT	149073704	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.671000	0.83941	2.135000	0.66039	0.383000	0.25322	AAG		0.463	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084741.2			3	174	0	0	0	0.009096	0	3	174				
FLG	2312	broad.mit.edu	37	1	152275555	152275555	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:152275555T>A	ENST00000368799.1	-	3	11842	c.11807A>T	c.(11806-11808)cAa>cTa	p.Q3936L	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3936	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGCAGAATCTTGTGAAAGACT	0.453									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(11806-11808)CAA>CTA		filaggrin							140.0	135.0	137.0					1																	152275555		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152275555T>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11807A>T	1.37:g.152275555T>A	ENSP00000357789:p.Gln3936Leu		Somatic					p.Q3936L	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	11843	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3936			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.11807A>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	T	3.784	-0.045050	0.07452	.	.	ENSG00000143631	ENST00000368799	T	0.01438	4.89	3.03	0.631	0.17699	.	.	.	.	.	T	0.00356	0.0011	N	0.22421	0.69	0.09310	N	1	P	0.44090	0.826	B	0.37650	0.255	T	0.43829	-0.9367	9	0.35671	T	0.21	.	2.3403	0.04258	0.321:0.1544:0.0:0.5245	.	3936	P20930	FILA_HUMAN	L	3936	ENSP00000357789:Q3936L	ENSP00000357789:Q3936L	Q	-	2	0	FLG	150542179	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	1.252000	0.32874	0.089000	0.17243	-0.250000	0.11733	CAA		0.453	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		19	84	0	0	0	0.010504	0	19	84				
TNN	63923	broad.mit.edu	37	1	175054540	175054540	+	Splice_Site	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:175054540G>T	ENST00000239462.4	+	6	1347		c.e6-1			NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N						axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.?(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CTTGTTTCCAGGTCTGCACCC	0.597																																							uc001gkl.1		NA																	1	Unknown(1)		lung(1)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.e6-1		tenascin N precursor							51.0	45.0	47.0					1																	175054540		2203	4300	6503	SO:0001630	splice_region_variant	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175054540G>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1235-1G>T	1.37:g.175054540G>T			Somatic				TNN_uc010pmx.1_Splice_Site_p.G412_splice	p.G412_splice	NM_022093	NP_071376	WXS	Illumina HiSeq	Unspecified	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	6	1348	+		Breast(1374;0.000962)						B9EGP3|Q5R360	Splice_Site	SNP	ENST00000239462.4	37	c.1235_splice	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	19.16	3.773566	0.69992	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5808	0.95467	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNN	173321163	1.000000	0.71417	0.998000	0.56505	0.618000	0.37518	8.016000	0.88706	2.706000	0.92434	0.655000	0.94253	.		0.597	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	Intron	3	27	1	0	0.004672	0.004672	0.00507534	3	27				
DISP1	84976	broad.mit.edu	37	1	223178305	223178305	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:223178305A>C	ENST00000284476.6	+	8	3730	c.3566A>C	c.(3565-3567)cAt>cCt	p.H1189P		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	1189					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		GAACTGGAGCATGAGTTTTAT	0.453																																							uc001hnu.1		NA																	0					0						c.(3565-3567)CAT>CCT		dispatched A							71.0	75.0	73.0					1																	223178305		2203	4300	6503	SO:0001583	missense	84976				diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity	g.chr1:223178305A>C	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.3566A>C	1.37:g.223178305A>C	ENSP00000284476:p.His1189Pro		Somatic					p.H1189P	NM_032890	NP_116279	WXS	Illumina HiSeq	Unspecified	Q96F81	DISP1_HUMAN		GBM - Glioblastoma multiforme(131;0.102)	8	3713	+			1189					Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	37	c.3566A>C	CCDS1536.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711404	0.30322	.	.	ENSG00000154309	ENST00000284476	D	0.92858	-3.12	5.75	0.413	0.16401	.	0.634630	0.17205	N	0.182945	D	0.84374	0.5458	L	0.34521	1.04	0.45172	D	0.998184	B	0.02656	0.0	B	0.04013	0.001	T	0.71849	-0.4468	10	0.46703	T	0.11	-4.1586	5.8959	0.18939	0.6411:0.1265:0.2324:0.0	.	1189	Q96F81	DISP1_HUMAN	P	1189	ENSP00000284476:H1189P	ENSP00000284476:H1189P	H	+	2	0	DISP1	221244928	0.997000	0.39634	0.895000	0.35142	0.986000	0.74619	3.027000	0.49697	-0.172000	0.10779	0.459000	0.35465	CAT		0.453	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890		11	55	0	0	0	0.013537	0	11	55				
ITPKB	3707	broad.mit.edu	37	1	226923355	226923355	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:226923355G>A	ENST00000272117.3	-	1	1804	c.1805C>T	c.(1804-1806)tCg>tTg	p.S602L	ITPKB_ENST00000429204.1_Missense_Mutation_p.S602L|ITPKB_ENST00000366784.1_Missense_Mutation_p.S602L			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	602	Poly-Ser.				cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				GGAGGAGGCCGAGGAAGAGGA	0.612																																					Colon(84;110 1851 5306 33547)	Colon(84;110 1851 5306 33547)	uc010pvo.1		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1804-1806)TCG>TTG		1D-myo-inositol-trisphosphate 3-kinase B							66.0	62.0	63.0					1																	226923355		2203	4300	6503	SO:0001583	missense	3707						ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity	g.chr1:226923355G>A	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1805C>T	1.37:g.226923355G>A	ENSP00000272117:p.Ser602Leu		Somatic				ITPKB_uc001hqh.2_Missense_Mutation_p.S602L	p.S602L	NM_002221	NP_002212	WXS	Illumina HiSeq	Unspecified	P27987	IP3KB_HUMAN			2	2145	-		Prostate(94;0.0773)	602			Poly-Ser.		Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	c.1805C>T	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.481524	0.84747	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.53857	1.19;1.19;0.6	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.63390	0.2507	L	0.27053	0.805	0.51012	D	0.999903	D	0.89917	1.0	D	0.83275	0.996	T	0.61549	-0.7040	10	0.42905	T	0.14	-13.3479	20.14	0.98056	0.0:0.0:1.0:0.0	.	602	P27987	IP3KB_HUMAN	L	602	ENSP00000272117:S602L;ENSP00000411152:S602L;ENSP00000355748:S602L	ENSP00000272117:S602L	S	-	2	0	ITPKB	224989978	1.000000	0.71417	0.984000	0.44739	0.998000	0.95712	8.181000	0.89696	2.837000	0.97791	0.591000	0.81541	TCG		0.612	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221		3	58	0	0	0	0.004672	0	3	58				
FMN2	56776	broad.mit.edu	37	1	240635673	240635673	+	Splice_Site	SNP	G	G	C			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:240635673G>C	ENST00000319653.9	+	17	5292	c.5062G>C	c.(5062-5064)Gta>Cta	p.V1688L	AL646016.1_ENST00000596886.1_Intron|FMN2_ENST00000543681.1_Missense_Mutation_p.V8L|FMN2_ENST00000545751.1_Splice_Site_p.V284L|FMN2_ENST00000496950.1_3'UTR	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1688	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCCATCAGAGTAAAAGAAGC	0.333																																							uc010pyd.1		NA																	0				ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(5062-5064)GTA>CTA		formin 2							73.0	77.0	76.0					1																	240635673		2203	4299	6502	SO:0001630	splice_region_variant	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240635673G>C	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.5061-1G>C	1.37:g.240635673G>C			Somatic				FMN2_uc010pye.1_Missense_Mutation_p.V1692L|FMN2_uc010pyg.1_Missense_Mutation_p.V284L|FMN2_uc001hyr.2_RNA	p.V1688L	NM_020066	NP_064450	WXS	Illumina HiSeq	Unspecified	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		17	5287	+	Ovarian(103;0.127)	all_cancers(173;0.013)	1688			Potential.|FH2.		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	c.5062G>C	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	0.291	-0.980287	0.02197	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355;ENST00000406993;ENST00000543681	T;T	0.40225	1.04;1.04	5.83	5.83	0.93111	Actin-binding FH2 (2);	0.114026	0.38436	N	0.001690	T	0.12390	0.0301	N	0.00413	-1.525	0.33271	D	0.561031	B;B;B	0.29936	0.0;0.262;0.04	B;B;B	0.28139	0.001;0.086;0.015	T	0.25433	-1.0132	10	0.02654	T	1	.	14.7404	0.69448	0.0:0.1439:0.8561:0.0	.	284;317;1688	B4DP05;B4DN09;Q9NZ56	.;.;FMN2_HUMAN	L	1688;284;315;164;8	ENSP00000318884:V1688L;ENSP00000437918:V284L	ENSP00000318884:V1688L	V	+	1	0	FMN2	238702296	1.000000	0.71417	0.975000	0.42487	0.217000	0.24651	3.402000	0.52608	2.758000	0.94735	0.655000	0.94253	GTA		0.333	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	Missense_Mutation	3	83	0	0	0	0.009096	0	3	83				
KMO	8564	broad.mit.edu	37	1	241714278	241714278	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:241714278G>T	ENST00000366559.4	+	4	557	c.246G>T	c.(244-246)atG>atT	p.M82I	KMO_ENST00000366557.4_Missense_Mutation_p.M82I|KMO_ENST00000366558.3_Missense_Mutation_p.M82I|KMO_ENST00000484628.1_3'UTR	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			GTATTCCCATGAGAGCAAGAA	0.378																																							uc009xgp.2		NA																	0				ovary(2)	2						c.(244-246)ATG>ATT		kynurenine 3-monooxygenase							188.0	184.0	185.0					1																	241714278		2203	4300	6503	SO:0001583	missense	8564				pyridine nucleotide biosynthetic process|response to salt stress	cytosol|integral to membrane|mitochondrial outer membrane	electron carrier activity|flavin adenine dinucleotide binding|kynurenine 3-monooxygenase activity|NAD(P)H oxidase activity	g.chr1:241714278G>T	AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.246G>T	1.37:g.241714278G>T	ENSP00000355517:p.Met82Ile		Somatic				KMO_uc001hyy.2_Missense_Mutation_p.M82I|KMO_uc009xgo.1_Missense_Mutation_p.M82I	p.M82I	NM_003679	NP_003670	WXS	Illumina HiSeq	Unspecified	O15229	KMO_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0176)		4	311	+	Ovarian(103;0.103)|all_lung(81;0.23)		82						Missense_Mutation	SNP	ENST00000366559.4	37	c.246G>T	CCDS1618.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193396	0.78902	.	.	ENSG00000117009	ENST00000366559;ENST00000366558;ENST00000366557	T;T;T	0.50001	0.76;0.76;0.76	6.17	6.17	0.99709	Monooxygenase, FAD-binding (1);	0.000000	0.85682	D	0.000000	T	0.62344	0.2420	M	0.85710	2.77	0.80722	D	1	P;P;P	0.47910	0.866;0.866;0.902	P;P;B	0.47626	0.552;0.552;0.416	T	0.68307	-0.5443	10	0.87932	D	0	.	16.3795	0.83443	0.0:0.0:1.0:0.0	.	82;82;82	O15229;A8K693;O15229-2	KMO_HUMAN;.;.	I	82	ENSP00000355517:M82I;ENSP00000355516:M82I;ENSP00000355515:M82I	ENSP00000355515:M82I	M	+	3	0	KMO	239780901	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.330000	0.79181	2.941000	0.99782	0.655000	0.94253	ATG		0.378	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095612.1	NM_003679		52	193	1	0	1.55088e-19	0.01441	2.54547e-19	52	193				
PRKCQ	5588	broad.mit.edu	37	10	6540402	6540402	+	Missense_Mutation	SNP	G	G	C	rs568379112		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr10:6540402G>C	ENST00000263125.5	-	5	597	c.498C>G	c.(496-498)ttC>ttG	p.F166L	PRKCQ_ENST00000397176.2_Missense_Mutation_p.F166L|PRKCQ_ENST00000539722.1_Missense_Mutation_p.F41L	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	166					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	GCTGTGGGAAGAAGGTGGCAG	0.522																																					Ovarian(50;572 1126 10530 25349 30594)	Ovarian(50;572 1126 10530 25349 30594)	uc001ijj.1		NA																	0				ovary(3)|lung(2)|large_intestine(1)	6						c.(496-498)TTC>TTG		protein kinase C, theta							319.0	252.0	275.0					10																	6540402		2203	4300	6503	SO:0001583	missense	5588				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr10:6540402G>C	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.498C>G	10.37:g.6540402G>C	ENSP00000263125:p.Phe166Leu		Somatic				PRKCQ_uc009xim.1_Missense_Mutation_p.F166L|PRKCQ_uc001iji.1_Missense_Mutation_p.F199L|PRKCQ_uc009xin.1_Missense_Mutation_p.F130L|PRKCQ_uc010qax.1_Missense_Mutation_p.F41L	p.F166L	NM_006257	NP_006248	WXS	Illumina HiSeq	Unspecified	Q04759	KPCT_HUMAN			5	573	-			166			Phorbol-ester/DAG-type 1.		B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	c.498C>G	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444696	0.83993	.	.	ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722	D;D;D	0.92805	-3.11;-3.11;-3.11	5.62	-5.94	0.02247	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.85682	D	0.000000	D	0.94679	0.8284	M	0.72479	2.2	0.49130	D	0.999758	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.80764	0.994;0.993;0.992	D	0.92195	0.5763	10	0.72032	D	0.01	.	20.2663	0.98460	0.2498:0.0:0.7502:0.0	.	41;166;166	B4DF52;Q04759-2;Q04759	.;.;KPCT_HUMAN	L	166;166;41	ENSP00000263125:F166L;ENSP00000380361:F166L;ENSP00000441752:F41L	ENSP00000263125:F166L	F	-	3	2	PRKCQ	6580408	0.998000	0.40836	0.733000	0.30861	0.900000	0.52787	0.408000	0.21065	-1.611000	0.01581	-0.793000	0.03317	TTC		0.522	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257		23	127	0	0	0	0.010818	0	23	127				
CUBN	8029	broad.mit.edu	37	10	16990602	16990602	+	Missense_Mutation	SNP	C	C	T	rs145880377		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr10:16990602C>T	ENST00000377833.4	-	35	5149	c.5084G>A	c.(5083-5085)cGt>cAt	p.R1695H		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1695	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GCCACAGTAACGGCCTAAATA	0.473																																							uc001ioo.2		NA																	0				ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(5083-5085)CGT>CAT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	80.0	72.0	74.0		5084	5.6	0.9	10	dbSNP_134	74	0,8600		0,0,4300	no	missense	CUBN	NM_001081.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1695/3624	16990602	1,13005	2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:16990602C>T	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5084G>A	10.37:g.16990602C>T	ENSP00000367064:p.Arg1695His		Somatic					p.R1695H	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			35	5136	-			1695			CUB 11.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.5084G>A	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560343	0.86335	2.27E-4	0.0	ENSG00000107611	ENST00000377833	T	0.20069	2.1	5.55	5.55	0.83447	CUB (5);	0.213163	0.20298	N	0.095090	T	0.53174	0.1780	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.57069	-0.7874	10	0.72032	D	0.01	.	19.5027	0.95103	0.0:1.0:0.0:0.0	.	1695	O60494	CUBN_HUMAN	H	1695	ENSP00000367064:R1695H	ENSP00000367064:R1695H	R	-	2	0	CUBN	17030608	1.000000	0.71417	0.865000	0.33974	0.526000	0.34562	5.121000	0.64691	2.601000	0.87937	0.655000	0.94253	CGT		0.473	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		3	28	0	0	0	0.009096	0	3	28				
ARHGAP12	94134	broad.mit.edu	37	10	32099639	32099639	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr10:32099639T>A	ENST00000344936.2	-	16	2222	c.1988A>T	c.(1987-1989)cAg>cTg	p.Q663L	ARHGAP12_ENST00000375250.5_Missense_Mutation_p.Q633L|ARHGAP12_ENST00000311380.4_Missense_Mutation_p.Q611L|ARHGAP12_ENST00000375245.4_Missense_Mutation_p.Q611L|ARHGAP12_ENST00000396144.4_Missense_Mutation_p.Q658L|ARHGAP12_ENST00000492028.1_5'UTR	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	663	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				ATTCTCTCTCTGACACAGATT	0.318																																							uc001ivz.1		NA																	0					0						c.(1987-1989)CAG>CTG		Rho GTPase activating protein 12							122.0	122.0	122.0					10																	32099639		2203	4300	6503	SO:0001583	missense	94134				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr10:32099639T>A	AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.1988A>T	10.37:g.32099639T>A	ENSP00000345808:p.Gln663Leu		Somatic				ARHGAP12_uc001ivy.1_Missense_Mutation_p.Q609L|ARHGAP12_uc009xls.2_Missense_Mutation_p.Q614L|ARHGAP12_uc001iwb.1_Missense_Mutation_p.Q656L|ARHGAP12_uc001iwc.1_Missense_Mutation_p.Q631L|ARHGAP12_uc009xlq.1_Missense_Mutation_p.Q584L|ARHGAP12_uc001ivw.1_5'Flank|ARHGAP12_uc001ivx.1_5'Flank	p.Q663L	NM_018287	NP_060757	WXS	Illumina HiSeq	Unspecified	Q8IWW6	RHG12_HUMAN			16	2258	-		Prostate(175;0.0199)	663			Rho-GAP.		B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	ENST00000344936.2	37	c.1988A>T	CCDS7170.1	.	.	.	.	.	.	.	.	.	.	T	17.90	3.501868	0.64298	.	.	ENSG00000165322	ENST00000311380;ENST00000375250;ENST00000344936;ENST00000396144;ENST00000375245	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.55	5.55	0.83447	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.054607	0.85682	D	0.000000	T	0.45296	0.1335	M	0.64170	1.965	0.80722	D	1	B;B;B;B;B	0.23591	0.058;0.043;0.053;0.053;0.088	B;B;B;B;B	0.27076	0.022;0.034;0.035;0.035;0.076	T	0.41698	-0.9494	10	0.56958	D	0.05	.	15.6988	0.77521	0.0:0.0:0.0:1.0	.	616;633;658;663;611	Q1RLN5;Q8IWW6-2;Q504X1;Q8IWW6;Q8IWW6-3	.;.;.;RHG12_HUMAN;.	L	611;633;663;658;611	ENSP00000310984:Q611L;ENSP00000364399:Q633L;ENSP00000345808:Q663L;ENSP00000379448:Q658L;ENSP00000364394:Q611L	ENSP00000310984:Q611L	Q	-	2	0	ARHGAP12	32139645	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.096000	0.71446	2.115000	0.64714	0.455000	0.32223	CAG		0.318	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047465.1			32	124	0	0	0	0.01441	0	32	124				
B4GALNT4	338707	broad.mit.edu	37	11	381703	381703	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr11:381703C>T	ENST00000329962.6	+	20	3031	c.3031C>T	c.(3031-3033)Cga>Tga	p.R1011*		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	1011					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAGCGGCTCCGACTGCGGAA	0.687																																							uc001lpb.2		NA																	0				pancreas(1)	1						c.(3031-3033)CGA>TGA		beta							24.0	27.0	26.0					11																	381703		2195	4288	6483	SO:0001587	stop_gained	338707					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity	g.chr11:381703C>T	AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.3031C>T	11.37:g.381703C>T	ENSP00000328277:p.Arg1011*		Somatic					p.R1011*	NM_178537	NP_848632	WXS	Illumina HiSeq	Unspecified	Q76KP1	B4GN4_HUMAN		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)	20	3040	+		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	1011			Lumenal (Potential).		Q96LV2	Nonsense_Mutation	SNP	ENST00000329962.6	37	c.3031C>T	CCDS7694.1	.	.	.	.	.	.	.	.	.	.	c	34	5.348851	0.95807	.	.	ENSG00000182272	ENST00000329962	.	.	.	3.82	2.9	0.33743	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-11.4827	11.5054	0.50463	0.0:0.911:0.0:0.089	.	.	.	.	X	1011	.	ENSP00000328277:R1011X	R	+	1	2	B4GALNT4	371703	0.152000	0.22762	0.018000	0.16275	0.119000	0.20118	1.003000	0.29809	0.951000	0.37770	0.450000	0.29827	CGA		0.687	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239289.2	NM_178537		7	89	0	0	0	0.004482	0	7	89				
NELL1	4745	broad.mit.edu	37	11	21250897	21250897	+	Silent	SNP	C	C	T	rs561513540		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr11:21250897C>T	ENST00000357134.5	+	14	1598	c.1446C>T	c.(1444-1446)agC>agT	p.S482S	NELL1_ENST00000325319.5_Silent_p.S425S|NELL1_ENST00000532434.1_Silent_p.S482S|NELL1_ENST00000298925.5_Silent_p.S510S	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	482	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						AATGTGGCAGCGGCCAGCACA	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		21339	0.0		0.0	False		,,,				2504	0.001						uc001mqe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1444-1446)AGC>AGT		nel-like 1 isoform 1 precursor							83.0	67.0	73.0					11																	21250897		2203	4300	6503	SO:0001819	synonymous_variant	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:21250897C>T	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1446C>T	11.37:g.21250897C>T			Somatic				NELL1_uc001mqf.2_Silent_p.S482S|NELL1_uc009yid.2_Silent_p.S510S|NELL1_uc010rdo.1_Silent_p.S425S|NELL1_uc010rdp.1_Silent_p.S242S	p.S482S	NM_006157	NP_006148	WXS	Illumina HiSeq	Unspecified	Q92832	NELL1_HUMAN			14	1599	+			482			EGF-like 3.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Silent	SNP	ENST00000357134.5	37	c.1446C>T	CCDS7855.1																																																																																				0.488	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		17	71	0	0	0	0.00278	0	17	71				
OR4C16	219428	broad.mit.edu	37	11	55339695	55339695	+	Missense_Mutation	SNP	G	G	A	rs374191202		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr11:55339695G>A	ENST00000314634.3	+	1	92	c.92G>A	c.(91-93)cGt>cAt	p.R31H		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R31H(2)|p.R31L(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				ATTTTTTTGCGTCTCTACTTG	0.368													g|||	1	0.000199681	0.0	0.0	5008	,	,		18843	0.0		0.0	False		,,,				2504	0.001						uc010rih.1		NA																	3	Substitution - Missense(3)		prostate(2)|lung(1)	ovary(1)|skin(1)	2						c.(91-93)CGT>CAT		olfactory receptor, family 4, subfamily C,							189.0	177.0	181.0					11																	55339695		2201	4296	6497	SO:0001583	missense	219428				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55339695G>A	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.92G>A	11.37:g.55339695G>A	ENSP00000324913:p.Arg31His		Somatic					p.R31H	NM_001004701	NP_001004701	WXS	Illumina HiSeq	Unspecified	Q8NGL9	OR4CG_HUMAN			1	92	+		all_epithelial(135;0.0748)	31			Helical; Name=1; (Potential).		Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	c.92G>A	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519004	0.27211	.	.	ENSG00000181935	ENST00000314634	T	0.00438	7.42	4.98	3.85	0.44370	.	2.239510	0.01631	N	0.023546	T	0.00300	0.0009	N	0.14661	0.345	0.09310	N	1	B	0.25351	0.124	B	0.12837	0.008	T	0.47156	-0.9139	10	0.87932	D	0	.	9.0123	0.36148	0.0:0.0:0.1863:0.8137	.	31	Q8NGL9	OR4CG_HUMAN	H	31	ENSP00000324913:R31H	ENSP00000324913:R31H	R	+	2	0	OR4C16	55096271	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.003000	0.12901	0.915000	0.36847	-0.425000	0.05940	CGT		0.368	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		5	111	0	0	0	0.008291	0	5	111				
FADS1	3992	broad.mit.edu	37	11	61580035	61580035	+	Silent	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr11:61580035G>A	ENST00000350997.7	-	3	824	c.592C>T	c.(592-594)Ctg>Ttg	p.L198L	FADS1_ENST00000541683.1_5'Flank|FADS1_ENST00000433932.1_Silent_p.L57L|FADS1_ENST00000542506.1_Silent_p.L57L|FADS2_ENST00000574708.1_Intron|MIR1908_ENST00000410394.1_RNA	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	141					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CCATCCAGCAGCAAGATGTGC	0.592																																							uc010rlm.1		NA																	0				central_nervous_system(1)	1						c.(592-594)CTG>TTG		fatty acid desaturase 1	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						60.0	65.0	64.0					11																	61580035		2100	4227	6327	SO:0001819	synonymous_variant	3992				cell-cell signaling|cellular response to starvation|electron transport chain|icosanoid biosynthetic process|phospholipid biosynthetic process|regulation of cell differentiation|regulation of transcription, DNA-dependent|transport	endoplasmic reticulum membrane|integral to membrane|microsome	C-5 sterol desaturase activity|heme binding|protein binding	g.chr11:61580035G>A		CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.592C>T	11.37:g.61580035G>A			Somatic				FADS1_uc001nsh.2_Silent_p.L57L|FADS1_uc010rln.1_Silent_p.L57L	p.L198L	NM_013402	NP_037534	WXS	Illumina HiSeq	Unspecified	O60427	FADS1_HUMAN			3	720	-			141			Helical; (Potential).		A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Silent	SNP	ENST00000350997.7	37	c.592C>T	CCDS8011.2																																																																																				0.592	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347648.2	NM_013402		3	68	0	0	0	0.000602	0	3	68				
PPP2R5B	5526	broad.mit.edu	37	11	64695896	64695896	+	Splice_Site	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr11:64695896C>T	ENST00000164133.2	+	6	1343	c.721C>T	c.(721-723)Cgg>Tgg	p.R241W		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	241					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						CATCTTCCTCCGGTGAGTGGC	0.607																																							uc001oby.2		NA																	0				ovary(2)	2						c.(721-723)CGG>TGG		beta isoform of regulatory subunit B56, protein							82.0	76.0	78.0					11																	64695896		2201	4297	6498	SO:0001630	splice_region_variant	5526				signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity	g.chr11:64695896C>T	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.722+1C>T	11.37:g.64695896C>T			Somatic				PPP2R5B_uc001obz.2_Missense_Mutation_p.R241W	p.R241W	NM_006244	NP_006235	WXS	Illumina HiSeq	Unspecified	Q15173	2A5B_HUMAN			6	1306	+			241					Q13853	Missense_Mutation	SNP	ENST00000164133.2	37	c.721C>T	CCDS8085.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850569	0.71719	.	.	ENSG00000068971	ENST00000164133;ENST00000359279;ENST00000527441	.	.	.	3.56	2.64	0.31445	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81602	0.4857	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.83334	-0.0011	9	0.87932	D	0	-21.4244	8.6122	0.33808	0.4175:0.5825:0.0:0.0	.	241	Q15173	2A5B_HUMAN	W	241;268;241	.	ENSP00000164133:R241W	R	+	1	2	PPP2R5B	64452472	0.593000	0.26840	1.000000	0.80357	0.995000	0.86356	0.813000	0.27225	1.080000	0.41073	0.549000	0.68633	CGG		0.607	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244	Missense_Mutation	4	126	0	0	0	0.000602	0	4	126				
DPP3	10072	broad.mit.edu	37	11	66258810	66258810	+	Missense_Mutation	SNP	G	G	C	rs200834438		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr11:66258810G>C	ENST00000360510.2	+	7	819	c.754G>C	c.(754-756)Gcg>Ccg	p.A252P	DPP3_ENST00000530165.1_Missense_Mutation_p.A222P|DPP3_ENST00000531863.1_Missense_Mutation_p.A272P|DPP3_ENST00000541961.1_Missense_Mutation_p.A252P|DPP3_ENST00000453114.1_Missense_Mutation_p.A252P|DPP3_ENST00000532677.1_Missense_Mutation_p.A271P			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	252					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						GGGGGACTACGCGCCCATCCT	0.627											OREG0021109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001oig.1		NA																	0				ovary(1)|skin(1)	2						c.(754-756)GCG>CCG		dipeptidyl peptidase III							48.0	54.0	52.0					11																	66258810		2200	4295	6495	SO:0001583	missense	10072				proteolysis	cytoplasm	aminopeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity	g.chr11:66258810G>C	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.754G>C	11.37:g.66258810G>C	ENSP00000353701:p.Ala252Pro		Somatic	OREG0021109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1090	DPP3_uc001oif.1_Missense_Mutation_p.A252P|DPP3_uc010rpe.1_Missense_Mutation_p.A241P	p.A252P	NM_005700	NP_005691	WXS	Illumina HiSeq	Unspecified	Q9NY33	DPP3_HUMAN			7	816	+			252					B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	ENST00000360510.2	37	c.754G>C	CCDS8141.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753071	0.49362	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000533725;ENST00000543807	T;T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88;1.88	5.34	0.697	0.18081	.	0.636018	0.17294	N	0.179504	T	0.42698	0.1214	M	0.80183	2.485	0.09310	N	1	D;D	0.59767	0.986;0.96	P;P	0.60117	0.718;0.869	T	0.18777	-1.0326	10	0.59425	D	0.04	.	7.003	0.24820	0.0913:0.0:0.3839:0.5249	.	271;252	G3V1D3;Q9NY33	.;DPP3_HUMAN	P	272;271;252;252;252;222;150;150	ENSP00000432782:A272P;ENSP00000435284:A271P;ENSP00000353701:A252P;ENSP00000389943:A252P;ENSP00000440502:A252P;ENSP00000436941:A222P;ENSP00000434518:A150P	ENSP00000353701:A252P	A	+	1	0	DPP3	66015386	0.009000	0.17119	0.002000	0.10522	0.476000	0.33039	0.527000	0.22987	0.234000	0.21139	0.650000	0.86243	GCG		0.627	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2			18	93	0	0	0	0.008871	0	18	93				
CTTN	2017	broad.mit.edu	37	11	70279299	70279299	+	Silent	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr11:70279299C>T	ENST00000301843.8	+	16	1565	c.1359C>T	c.(1357-1359)taC>taT	p.Y453Y	CTTN_ENST00000376561.3_Silent_p.Y416Y|CTTN_ENST00000346329.3_Silent_p.Y416Y|CTTN_ENST00000538675.1_Silent_p.Y137Y	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	453					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		CCGCTGACTACCGAGAGGCCA	0.657																																							uc001opv.3		NA																	0				ovary(1)	1						c.(1357-1359)TAC>TAT		cortactin isoform a							33.0	35.0	35.0					11																	70279299		2200	4294	6494	SO:0001819	synonymous_variant	2017					cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding	g.chr11:70279299C>T	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.1359C>T	11.37:g.70279299C>T			Somatic				CTTN_uc001opu.2_Silent_p.Y416Y|CTTN_uc001opw.3_Silent_p.Y416Y|CTTN_uc010rqm.1_Silent_p.Y137Y|CTTN_uc001opx.2_Silent_p.Y137Y	p.Y453Y	NM_005231	NP_005222	WXS	Illumina HiSeq	Unspecified	Q14247	SRC8_HUMAN	BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)	16	1565	+			453					Q8N707|Q96H99	Silent	SNP	ENST00000301843.8	37	c.1359C>T	CCDS41680.1																																																																																				0.657	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259233.2	NM_138565		7	44	0	0	0	0.006214	0	7	44				
FAT3	120114	broad.mit.edu	37	11	92533638	92533638	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr11:92533638C>T	ENST00000298047.6	+	9	7476	c.7459C>T	c.(7459-7461)Ctt>Ttt	p.L2487F	FAT3_ENST00000525166.1_Missense_Mutation_p.L2337F|FAT3_ENST00000409404.2_Missense_Mutation_p.L2487F			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2487	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TATTAGGGTACTTGGGGCTAA	0.507										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(7459-7461)CTT>TTT		FAT tumor suppressor homolog 3							110.0	106.0	107.0					11																	92533638		2041	4207	6248	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92533638C>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7459C>T	11.37:g.92533638C>T	ENSP00000298047:p.Leu2487Phe	TCGA Ovarian(4;0.039)	Somatic					p.L2487F	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			9	7476	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2487			Cadherin 22.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.7459C>T		.	.	.	.	.	.	.	.	.	.	C	14.31	2.497956	0.44455	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.56444	0.46;0.46;0.46	5.95	5.95	0.96441	.	.	.	.	.	T	0.73628	0.3611	M	0.89601	3.045	0.80722	D	1	D	0.65815	0.995	P	0.56163	0.793	T	0.72010	-0.4419	9	0.21014	T	0.42	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	2487	Q8TDW7-3	.	F	2487;2487;2337	ENSP00000298047:L2487F;ENSP00000387040:L2487F;ENSP00000432586:L2337F	ENSP00000298047:L2487F	L	+	1	0	FAT3	92173286	0.964000	0.33143	0.201000	0.23476	0.690000	0.40134	3.725000	0.54970	2.824000	0.97209	0.655000	0.94253	CTT		0.507	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		17	51	0	0	0	0.006122	0	17	51				
LRP6	4040	broad.mit.edu	37	12	12279682	12279682	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr12:12279682C>A	ENST00000261349.4	-	20	4331	c.4255G>T	c.(4255-4257)Gct>Tct	p.A1419S	LRP6_ENST00000540415.1_Intron|BCL2L14_ENST00000396369.1_Intron|LRP6_ENST00000543091.1_Missense_Mutation_p.A1374S	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1419					anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				GGCACAGAAGCTGGTCCATGA	0.458																																							uc001rah.3		NA																	0				lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12						c.(4255-4257)GCT>TCT		low density lipoprotein receptor-related protein							204.0	166.0	179.0					12																	12279682		2203	4300	6503	SO:0001583	missense	4040				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding	g.chr12:12279682C>A	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.4255G>T	12.37:g.12279682C>A	ENSP00000261349:p.Ala1419Ser		Somatic				BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.A1374S	p.A1419S	NM_002336	NP_002327	WXS	Illumina HiSeq	Unspecified	O75581	LRP6_HUMAN			20	4397	-		Prostate(47;0.0865)	1419			Cytoplasmic (Potential).		Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	c.4255G>T	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560208	0.45590	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	T;T	0.38401	1.14;1.14	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000010	T	0.20251	0.0487	N	0.03608	-0.345	0.51012	D	0.999906	B;B	0.14012	0.009;0.001	B;B	0.14023	0.01;0.003	T	0.12426	-1.0548	10	0.15499	T	0.54	.	19.8306	0.96634	0.0:1.0:0.0:0.0	.	1374;1419	F5H7J9;O75581	.;LRP6_HUMAN	S	1419;1374	ENSP00000261349:A1419S;ENSP00000442472:A1374S	ENSP00000261349:A1419S	A	-	1	0	LRP6	12170949	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.921000	0.48852	2.682000	0.91365	0.563000	0.77884	GCT		0.458	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1			27	107	1	0	7.11191e-15	0.013726	1.08475e-14	27	107				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		21	28	1	0	3.73148e-12	0.007291	5.36622e-12	21	28				
KMT2D	8085	broad.mit.edu	37	12	49434727	49434727	+	Missense_Mutation	SNP	G	G	A	rs368486128		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr12:49434727G>A	ENST00000301067.7	-	31	6825	c.6826C>T	c.(6826-6828)Cca>Tca	p.P2276S		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2276	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCAAAAGGTGGGGGCGAGAGC	0.622																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(6826-6828)CCA>TCA		myeloid/lymphoid or mixed-lineage leukemia 2		G	SER/PRO	2,3712		0,2,1855	33.0	36.0	35.0		6826	4.2	0.9	12		35	0,8202		0,0,4101	no	missense	MLL2	NM_003482.3	74	0,2,5956	AA,AG,GG		0.0,0.0539,0.0168	benign	2276/5538	49434727	2,11914	1857	4101	5958	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49434727G>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6826C>T	12.37:g.49434727G>A	ENSP00000301067:p.Pro2276Ser	HNSCC(34;0.089)	Somatic					p.P2276S	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			31	6826	-			2276			Pro-rich.		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.6826C>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	8.279	0.815027	0.16607	5.39E-4	0.0	ENSG00000167548	ENST00000301067	T	0.78595	-1.19	5.07	4.18	0.49190	.	0.206528	0.24654	N	0.036692	T	0.58018	0.2093	N	0.08118	0	0.29438	N	0.859323	B	0.06786	0.001	B	0.04013	0.001	T	0.57359	-0.7825	10	0.87932	D	0	.	9.0483	0.36360	0.1716:0.0:0.8284:0.0	.	2276	O14686	MLL2_HUMAN	S	2276	ENSP00000301067:P2276S	ENSP00000301067:P2276S	P	-	1	0	MLL2	47720994	1.000000	0.71417	0.885000	0.34714	0.986000	0.74619	3.048000	0.49862	1.285000	0.44548	0.655000	0.94253	CCA		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			34	46	0	0	0	0.004878	0	34	46				
KCNH3	23416	broad.mit.edu	37	12	49951615	49951615	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr12:49951615C>A	ENST00000257981.6	+	15	3391	c.3131C>A	c.(3130-3132)cCc>cAc	p.P1044H	MCRS1_ENST00000547182.1_5'Flank	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	1044	Pro-rich.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						ACTGGAGAGCCCCCACCAGGG	0.677																																							uc001ruh.1		NA																	0					0						c.(3130-3132)CCC>CAC		potassium voltage-gated channel, subfamily H							25.0	28.0	27.0					12																	49951615		2202	4300	6502	SO:0001583	missense	23416				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity	g.chr12:49951615C>A	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.3131C>A	12.37:g.49951615C>A	ENSP00000257981:p.Pro1044His		Somatic				KCNH3_uc010smj.1_Missense_Mutation_p.P984H	p.P1044H	NM_012284	NP_036416	WXS	Illumina HiSeq	Unspecified	Q9ULD8	KCNH3_HUMAN			15	3391	+			1044			Pro-rich.|Cytoplasmic (Potential).		Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	c.3131C>A	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411956	0.42817	.	.	ENSG00000135519	ENST00000257981	D	0.98901	-5.22	5.02	5.02	0.67125	.	0.000000	0.41396	D	0.000898	D	0.94899	0.8351	N	0.08118	0	0.80722	D	1	P	0.49635	0.926	B	0.41466	0.358	D	0.95541	0.8612	10	0.66056	D	0.02	.	13.7179	0.62710	0.0:1.0:0.0:0.0	.	1044	Q9ULD8	KCNH3_HUMAN	H	1044	ENSP00000257981:P1044H	ENSP00000257981:P1044H	P	+	2	0	KCNH3	48237882	0.982000	0.34865	1.000000	0.80357	0.974000	0.67602	0.746000	0.26275	2.607000	0.88179	0.561000	0.74099	CCC		0.677	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284		8	48	1	0	0.000274275	0.004482	0.000311395	8	48				
PLA2G1B	5319	broad.mit.edu	37	12	120765547	120765547	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr12:120765547G>T	ENST00000308366.4	-	1	45	c.10C>A	c.(10-12)Ctt>Att	p.L4I	PLA2G1B_ENST00000423423.3_Missense_Mutation_p.L4I|PLA2G1B_ENST00000549767.1_5'Flank	NM_000928.2	NP_000919.1	P04054	PA21B_HUMAN	phospholipase A2, group IB (pancreas)	4					actin filament organization (GO:0007015)|activation of MAPK activity (GO:0000187)|activation of phospholipase A2 activity (GO:0032431)|antibacterial humoral response (GO:0019731)|arachidonic acid secretion (GO:0050482)|cellular response to insulin stimulus (GO:0032869)|defense response to Gram-positive bacterium (GO:0050830)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response in mucosa (GO:0002227)|interleukin-8 production (GO:0032637)|intracellular signal transduction (GO:0035556)|leukotriene biosynthetic process (GO:0019370)|multicellular organismal lipid catabolic process (GO:0044240)|neutrophil chemotaxis (GO:0030593)|neutrophil mediated immunity (GO:0002446)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine metabolic process (GO:0046470)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of immune response (GO:0050778)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	bile acid binding (GO:0032052)|calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|phospholipase A2 activity (GO:0004623)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)				Niflumic Acid(DB04552)|Sulfasalazine(DB00795)	GCTAGCACAAGGAGTTTCATC	0.527																																					NSCLC(64;1781 1795 22266 42732)|Esophageal Squamous(30;459 829 25326 35148)	NSCLC(64;1781 1795 22266 42732)|Esophageal Squamous(30;459 829 25326 35148)	uc001tyd.2		NA																	0				skin(1)	1						c.(10-12)CTT>ATT		phospholipase A2 group IB precursor							127.0	115.0	119.0					12																	120765547		2203	4300	6503	SO:0001583	missense	5319				actin filament organization|activation of MAPK activity|activation of phospholipase A2 activity|arachidonic acid secretion|cellular response to insulin stimulus|glucose transport|interleukin-8 production|leukotriene biosynthetic process|multicellular organismal lipid catabolic process|neutrophil chemotaxis|neutrophil mediated immunity|phosphatidylcholine metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of DNA replication|positive regulation of immune response|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein secretion|positive regulation of transcription from RNA polymerase II promoter	extracellular space	bile acid binding|calcium ion binding|calcium-dependent phospholipase A2 activity|cell surface binding|receptor binding	g.chr12:120765547G>T		CCDS9195.1	12q24.31	2013-09-19			ENSG00000170890	ENSG00000170890	3.1.1.4		9030	protein-coding gene	gene with protein product		172410		PLA2, PPLA2, PLA2A		8175726	Standard	NM_000928		Approved		uc001tyd.3	P04054	OTTHUMG00000169343	ENST00000308366.4:c.10C>A	12.37:g.120765547G>T	ENSP00000312286:p.Leu4Ile		Somatic				PLA2G1B_uc009zwx.2_Missense_Mutation_p.L4I	p.L4I	NM_000928	NP_000919	WXS	Illumina HiSeq	Unspecified	P04054	PA21B_HUMAN			1	46	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		4					B2R4H5|Q3KPI1	Missense_Mutation	SNP	ENST00000308366.4	37	c.10C>A	CCDS9195.1	.	.	.	.	.	.	.	.	.	.	G	8.405	0.842938	0.16963	.	.	ENSG00000170890	ENST00000308366;ENST00000423423	T;T	0.69806	1.79;-0.43	4.7	2.7	0.31948	.	0.840400	0.10709	N	0.643049	T	0.57460	0.2055	L	0.50919	1.6	0.58432	D	0.999994	B;B	0.20368	0.044;0.011	B;B	0.15870	0.014;0.014	T	0.60326	-0.7285	10	0.72032	D	0.01	-2.5703	5.5711	0.17198	0.1012:0.0:0.7057:0.193	.	4;4	Q9BS22;P04054	.;PA21B_HUMAN	I	4	ENSP00000312286:L4I;ENSP00000413594:L4I	ENSP00000312286:L4I	L	-	1	0	PLA2G1B	119249930	1.000000	0.71417	0.930000	0.37139	0.281000	0.26958	1.603000	0.36794	1.332000	0.45431	0.591000	0.81541	CTT		0.527	PLA2G1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403626.1			23	91	1	0	5.77227e-19	0.008361	9.37218e-19	23	91				
GOLGA3	2802	broad.mit.edu	37	12	133384781	133384781	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr12:133384781C>A	ENST00000450791.2	-	4	1057	c.874G>T	c.(874-876)Gac>Tac	p.D292Y	GOLGA3_ENST00000537452.1_Missense_Mutation_p.D292Y|GOLGA3_ENST00000456883.2_Missense_Mutation_p.D292Y|GOLGA3_ENST00000545875.1_Missense_Mutation_p.D292Y|GOLGA3_ENST00000204726.3_Missense_Mutation_p.D292Y			Q08378	GOGA3_HUMAN	golgin A3	292					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TCGTCAGTGTCGGGGGACAGG	0.592																																							uc001ukz.1		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(874-876)GAC>TAC		Golgi autoantigen, golgin subfamily a, 3							115.0	115.0	115.0					12																	133384781		2203	4300	6503	SO:0001583	missense	2802				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity	g.chr12:133384781C>A	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.874G>T	12.37:g.133384781C>A	ENSP00000410378:p.Asp292Tyr		Somatic				GOLGA3_uc001ula.1_Missense_Mutation_p.D292Y|GOLGA3_uc001ulb.2_Missense_Mutation_p.D292Y	p.D292Y	NM_005895	NP_005886	WXS	Illumina HiSeq	Unspecified	Q08378	GOGA3_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)	5	1433	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)	292					A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	c.874G>T	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425851	0.43020	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	5.32	4.43	0.53597	.	0.460024	0.25467	N	0.030480	T	0.41096	0.1144	N	0.19112	0.55	0.80722	D	1	D;P;D	0.59767	0.971;0.949;0.986	P;P;P	0.61201	0.732;0.659;0.885	T	0.40979	-0.9534	10	0.72032	D	0.01	.	12.9075	0.58160	0.0:0.9239:0.0:0.0761	.	292;292;292	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	Y	292	ENSP00000204726:D292Y;ENSP00000410378:D292Y;ENSP00000409303:D292Y;ENSP00000442143:D292Y;ENSP00000442603:D292Y	ENSP00000204726:D292Y	D	-	1	0	GOLGA3	131894854	1.000000	0.71417	0.008000	0.14137	0.002000	0.02628	4.602000	0.61098	1.392000	0.46585	-0.133000	0.14855	GAC		0.592	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895		32	116	1	0	8.4185e-14	0.012213	1.24627e-13	32	116				
PARP4	143	broad.mit.edu	37	13	25023877	25023877	+	Silent	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr13:25023877G>A	ENST00000381989.3	-	25	3198	c.3093C>T	c.(3091-3093)tcC>tcT	p.S1031S		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1031	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AACTATGCTTGGATTTTGCAT	0.333																																							uc001upl.2		NA																	0				ovary(3)|skin(1)	4						c.(3091-3093)TCC>TCT		poly (ADP-ribose) polymerase family, member 4							59.0	59.0	59.0					13																	25023877		2203	4300	6503	SO:0001819	synonymous_variant	143				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity	g.chr13:25023877G>A	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3093C>T	13.37:g.25023877G>A			Somatic					p.S1031S	NM_006437	NP_006428	WXS	Illumina HiSeq	Unspecified	Q9UKK3	PARP4_HUMAN		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)	25	3199	-		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)	1031			VWFA.		O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	ENST00000381989.3	37	c.3093C>T	CCDS9307.1																																																																																				0.333	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437		17	82	0	0	0	0.008871	0	17	82				
OR4K1	79544	broad.mit.edu	37	14	20404299	20404299	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr14:20404299C>A	ENST00000285600.4	+	1	533	c.474C>A	c.(472-474)agC>agA	p.S158R		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		ATTCTGTGAGCCACTTGGCTT	0.478																																							uc001vwj.1		NA																	0				skin(2)|ovary(1)	3						c.(472-474)AGC>AGA		olfactory receptor, family 4, subfamily K,							130.0	129.0	130.0					14																	20404299		2203	4300	6503	SO:0001583	missense	79544				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20404299C>A		CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.474C>A	14.37:g.20404299C>A	ENSP00000285600:p.Ser158Arg		Somatic					p.S158R	NM_001004063	NP_001004063	WXS	Illumina HiSeq	Unspecified	Q8NGD4	OR4K1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)	1	474	+	all_cancers(95;0.00108)		158			Helical; Name=4; (Potential).		B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	ENST00000285600.4	37	c.474C>A	CCDS32025.1	.	.	.	.	.	.	.	.	.	.	.	14.19	2.460919	0.43736	.	.	ENSG00000155249	ENST00000285600	T	0.37752	1.18	4.82	-4.37	0.03633	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.54431	0.1858	M	0.86028	2.79	0.18873	N	0.999986	D	0.89917	1.0	D	0.85130	0.997	T	0.50346	-0.8839	10	0.62326	D	0.03	.	9.0487	0.36363	0.0:0.2333:0.1171:0.6496	.	158	Q8NGD4	OR4K1_HUMAN	R	158	ENSP00000285600:S158R	ENSP00000285600:S158R	S	+	3	2	OR4K1	19474139	0.000000	0.05858	0.896000	0.35187	0.895000	0.52256	-1.678000	0.01942	-0.872000	0.04037	-0.251000	0.11542	AGC		0.478	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1			26	63	1	0	4.59853e-10	0.005443	6.25566e-10	26	63				
LTBP2	4053	broad.mit.edu	37	14	74973502	74973502	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr14:74973502G>C	ENST00000261978.4	-	27	4318	c.3932C>G	c.(3931-3933)aCc>aGc	p.T1311S	LTBP2_ENST00000556690.1_Missense_Mutation_p.T1267S	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1311	Cys-rich.|EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GCCACACATGGTGTCGTTGGC	0.592																																							uc001xqa.2		NA																	0				liver(1)|skin(1)	2						c.(3931-3933)ACC>AGC		latent transforming growth factor beta binding							103.0	72.0	83.0					14																	74973502		2203	4300	6503	SO:0001583	missense	4053				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding	g.chr14:74973502G>C		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.3932C>G	14.37:g.74973502G>C	ENSP00000261978:p.Thr1311Ser		Somatic					p.T1311S	NM_000428	NP_000419	WXS	Illumina HiSeq	Unspecified	Q14767	LTBP2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)	27	4319	-			1311			Cys-rich.|EGF-like 15; calcium-binding (Potential).		Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	37	c.3932C>G	CCDS9831.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.93|13.93	2.384766|2.384766	0.42308|0.42308	.|.	.|.	ENSG00000119681|ENSG00000119681	ENST00000556206|ENST00000261978;ENST00000556690	.|D;D	.|0.95377	.|-2.15;-3.69	4.71|4.71	4.71|4.71	0.59529|0.59529	.|EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.|0.184578	.|0.26176	.|N	.|0.025894	D|D	0.90820|0.90820	0.7117|0.7117	N|N	0.01800|0.01800	-0.715|-0.715	0.32993|0.32993	D|D	0.525226|0.525226	.|P	.|0.51057	.|0.941	.|P	.|0.58820	.|0.846	D|D	0.86261|0.86261	0.1655|0.1655	5|10	.|0.02654	.|T	.|1	.|.	17.8474|17.8474	0.88734|0.88734	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1311	.|Q14767	.|LTBP2_HUMAN	Q|S	202|1311;1267	.|ENSP00000261978:T1311S;ENSP00000451477:T1267S	.|ENSP00000261978:T1311S	H|T	-|-	3|2	2|0	LTBP2|LTBP2	74043255|74043255	1.000000|1.000000	0.71417|0.71417	0.944000|0.944000	0.38274|0.38274	0.652000|0.652000	0.38707|0.38707	4.574000|4.574000	0.60900|0.60900	2.446000|2.446000	0.82766|0.82766	0.561000|0.561000	0.74099|0.74099	CAC|ACC		0.592	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428		9	50	0	0	0	0.013537	0	9	50				
NRXN3	9369	broad.mit.edu	37	14	79270063	79270063	+	Silent	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr14:79270063C>A	ENST00000554719.1	+	6	1517	c.1026C>A	c.(1024-1026)tcC>tcA	p.S342S	NRXN3_ENST00000335750.5_Silent_p.S342S	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	119					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GCTTCATGTCCCAGCGAGCTT	0.557																																							uc001xun.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10						c.(1024-1026)TCC>TCA		neurexin 3 isoform 1 precursor							194.0	140.0	158.0					14																	79270063		2203	4300	6503	SO:0001819	synonymous_variant	9369				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity	g.chr14:79270063C>A	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1026C>A	14.37:g.79270063C>A			Somatic				NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Silent_p.S476S	p.S342S	NM_004796	NP_004787	WXS	Illumina HiSeq	Unspecified	Q9Y4C0	NRX3A_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)	6	1517	+		Renal(4;0.00876)	715			Laminin G-like 4.|Extracellular (Potential).		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	ENST00000554719.1	37	c.1026C>A	CCDS9870.1																																																																																				0.557	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250		27	84	1	0	8.58068e-18	0.007291	1.36388e-17	27	84				
UNC79	57578	broad.mit.edu	37	14	94139798	94139798	+	Silent	SNP	T	T	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr14:94139798T>A	ENST00000393151.2	+	42	6855	c.6855T>A	c.(6853-6855)gtT>gtA	p.V2285V	UNC79_ENST00000256339.4_Silent_p.V2108V|UNC79_ENST00000553484.1_Silent_p.V2307V|UNC79_ENST00000555664.1_Silent_p.V2246V			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2285					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TTCTGCTTGTTCAGGTAAGCT	0.373																																							uc001ybv.1		NA																	0				ovary(10)|skin(4)|large_intestine(3)	17						c.(6388-6390)GTT>GTA		hypothetical protein LOC57578							134.0	127.0	129.0					14																	94139798		2203	4300	6503	SO:0001819	synonymous_variant	57578					integral to membrane		g.chr14:94139798T>A	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6855T>A	14.37:g.94139798T>A			Somatic				KIAA1409_uc001ybs.1_Silent_p.V2108V	p.V2130V	NM_020818	NP_065869	WXS	Illumina HiSeq	Unspecified	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	40	6473	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	2285					B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37	c.6390T>A																																																																																					0.373	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		17	81	0	0	0	0.00499	0	17	81				
NPAP1	23742	broad.mit.edu	37	15	24924367	24924367	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr15:24924367C>A	ENST00000329468.2	+	1	3827	c.3353C>A	c.(3352-3354)gCt>gAt	p.A1118D		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1118					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TGTGTTCCTGCTTTTCAACAG	0.488																																							uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(3352-3354)GCT>GAT		hypothetical protein LOC23742							142.0	120.0	127.0					15																	24924367		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24924367C>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3353C>A	15.37:g.24924367C>A	ENSP00000333735:p.Ala1118Asp		Somatic					p.A1118D	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	3827	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	1118						Missense_Mutation	SNP	ENST00000329468.2	37	c.3353C>A	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	13.17	2.156985	0.38119	.	.	ENSG00000185823	ENST00000329468	T	0.10960	2.82	2.07	2.07	0.26955	.	.	.	.	.	T	0.06005	0.0156	N	0.22421	0.69	0.09310	N	1	P	0.50710	0.938	B	0.34931	0.192	T	0.32079	-0.9920	9	0.72032	D	0.01	.	7.6729	0.28470	0.0:1.0:0.0:0.0	.	1118	Q9NZP6	CO002_HUMAN	D	1118	ENSP00000333735:A1118D	ENSP00000333735:A1118D	A	+	2	0	C15orf2	22475460	0.003000	0.15002	0.002000	0.10522	0.417000	0.31264	1.204000	0.32296	1.483000	0.48342	0.313000	0.20887	GCT		0.488	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		25	143	1	0	8.58068e-18	0.007291	1.36388e-17	25	143				
SLC12A6	9990	broad.mit.edu	37	15	34529746	34529746	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr15:34529746C>A	ENST00000354181.3	-	22	3300	c.2808G>T	c.(2806-2808)tgG>tgT	p.W936C	SLC12A6_ENST00000451844.2_Missense_Mutation_p.W748C|SLC12A6_ENST00000397702.2_Missense_Mutation_p.W877C|SLC12A6_ENST00000458406.2_Missense_Mutation_p.W877C|SLC12A6_ENST00000558589.1_Missense_Mutation_p.W927C|SLC12A6_ENST00000560164.1_Missense_Mutation_p.W748C|SLC12A6_ENST00000558667.1_Missense_Mutation_p.W936C|SLC12A6_ENST00000560611.1_Missense_Mutation_p.W936C|SLC12A6_ENST00000290209.5_Missense_Mutation_p.W885C|SLC12A6_ENST00000397707.2_Missense_Mutation_p.W921C			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	936					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	TGCACTTTCGCCACACCTGAG	0.418																																							uc001zhw.2		NA																	0				central_nervous_system(5)|ovary(1)|skin(1)	7						c.(2806-2808)TGG>TGT		solute carrier family 12, member 6 isoform a	Potassium Chloride(DB00761)						242.0	189.0	207.0					15																	34529746		2201	4298	6499	SO:0001583	missense	9990				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity	g.chr15:34529746C>A	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.2808G>T	15.37:g.34529746C>A	ENSP00000346112:p.Trp936Cys		Somatic				SLC12A6_uc001zhv.2_Missense_Mutation_p.W885C|SLC12A6_uc001zhx.2_Missense_Mutation_p.W921C|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.W877C|SLC12A6_uc001zib.2_Missense_Mutation_p.W927C|SLC12A6_uc001zic.2_Missense_Mutation_p.W936C|SLC12A6_uc010bau.2_Missense_Mutation_p.W936C|SLC12A6_uc001zid.2_Missense_Mutation_p.W877C|SLC12A6_uc001zht.2_RNA|SLC12A6_uc001zhu.2_Missense_Mutation_p.W748C	p.W936C	NM_133647	NP_598408	WXS	Illumina HiSeq	Unspecified	Q9UHW9	S12A6_HUMAN		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	21	2972	-		all_lung(180;2.78e-08)	936			Cytoplasmic (Potential).		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	c.2808G>T	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281221	0.80692	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.97782	0.9272	H	0.95402	3.665	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98794	1.0737	10	0.87932	D	0	.	17.5108	0.87759	0.0:1.0:0.0:0.0	.	921;936;885;748	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	C	885;921;927;877;877;748	ENSP00000290209:W885C;ENSP00000380819:W921C;ENSP00000380814:W877C;ENSP00000387725:W877C;ENSP00000390199:W748C	ENSP00000290209:W885C	W	-	3	0	SLC12A6	32317038	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.651000	0.83577	2.662000	0.90505	0.563000	0.77884	TGG		0.418	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135		12	77	1	0	0.00316338	0.003163	0.00348664	12	77				
PAQR5	54852	broad.mit.edu	37	15	69696075	69696075	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr15:69696075A>T	ENST00000340965.3	+	9	1575	c.907A>T	c.(907-909)Atc>Ttc	p.I303F	Y_RNA_ENST00000384665.1_RNA|RP11-253M7.1_ENST00000558617.1_RNA|RP11-253M7.1_ENST00000560539.1_RNA|PAQR5_ENST00000395407.2_Missense_Mutation_p.I303F|RP11-253M7.1_ENST00000558107.1_RNA|PAQR5_ENST00000561153.1_Missense_Mutation_p.I303F	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	303					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						ACTTCTGTGCATCATCTTCAG	0.458																																							uc002arz.2		NA																	0				ovary(2)	2						c.(907-909)ATC>TTC		progestin and adipoQ receptor family member V							99.0	90.0	93.0					15																	69696075		2199	4298	6497	SO:0001583	missense	54852				cell differentiation|multicellular organismal development|oogenesis	integral to membrane	receptor activity|steroid binding	g.chr15:69696075A>T		CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.907A>T	15.37:g.69696075A>T	ENSP00000343877:p.Ile303Phe		Somatic				PAQR5_uc002asa.2_Missense_Mutation_p.I303F	p.I303F	NM_017705	NP_060175	WXS	Illumina HiSeq	Unspecified	Q9NXK6	MPRG_HUMAN			9	1285	+			303			Helical; Name=7; (Potential).		Q8IXU2	Missense_Mutation	SNP	ENST00000340965.3	37	c.907A>T	CCDS10232.1	.	.	.	.	.	.	.	.	.	.	A	11.83	1.755474	0.31046	.	.	ENSG00000137819	ENST00000395407;ENST00000340965	T;T	0.24538	1.85;1.85	5.71	-11.4	0.00090	.	0.580802	0.19449	N	0.113980	T	0.09992	0.0245	N	0.25647	0.755	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.05435	-1.0885	10	0.52906	T	0.07	-12.8934	4.5283	0.11992	0.1294:0.2896:0.4275:0.1535	.	303	Q9NXK6	MPRG_HUMAN	F	303	ENSP00000378803:I303F;ENSP00000343877:I303F	ENSP00000343877:I303F	I	+	1	0	PAQR5	67483129	0.000000	0.05858	0.000000	0.03702	0.511000	0.34104	-0.828000	0.04419	-2.003000	0.00962	-0.256000	0.11100	ATC		0.458	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416671.1	NM_017705		15	69	0	0	0	0.00499	0	15	69				
SEPT12	124404	broad.mit.edu	37	16	4833675	4833675	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr16:4833675T>A	ENST00000268231.8	-	6	868	c.605A>T	c.(604-606)gAg>gTg	p.E202V	SEPT12_ENST00000396693.5_Missense_Mutation_p.E156V|SEPT12_ENST00000591861.1_5'Flank	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	202	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						CTCTCGCTCCTCCATGGTCAG	0.687																																							uc002cxq.2		NA																	0				skin(1)	1						c.(604-606)GAG>GTG		septin 12 isoform 2							50.0	53.0	52.0					16																	4833675		2197	4300	6497	SO:0001583	missense	124404				cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity	g.chr16:4833675T>A	AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.605A>T	16.37:g.4833675T>A	ENSP00000268231:p.Glu202Val		Somatic				SEPT12_uc002cxr.2_Missense_Mutation_p.E156V|SEPT12_uc010bty.2_RNA	p.E202V	NM_144605	NP_653206	WXS	Illumina HiSeq	Unspecified	Q8IYM1	SEP12_HUMAN			6	746	-			202			GTP (By similarity).		Q0P6B0|Q1PBH0|Q96LL0	Missense_Mutation	SNP	ENST00000268231.8	37	c.605A>T	CCDS10522.1	.	.	.	.	.	.	.	.	.	.	T	16.56	3.158380	0.57368	.	.	ENSG00000140623	ENST00000396693;ENST00000268231	T;T	0.54866	0.55;0.55	4.62	4.62	0.57501	.	0.103041	0.64402	D	0.000005	T	0.76884	0.4050	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.82394	-0.0479	10	0.72032	D	0.01	.	12.9887	0.58606	0.0:0.0:0.0:1.0	.	156;202	Q8IYM1-2;Q8IYM1	.;SEP12_HUMAN	V	156;202	ENSP00000379922:E156V;ENSP00000268231:E202V	ENSP00000268231:E202V	E	-	2	0	SEPT12	4773676	1.000000	0.71417	0.743000	0.31040	0.095000	0.18619	7.734000	0.84928	1.956000	0.56807	0.260000	0.18958	GAG		0.687	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251645.2	NM_144605		18	61	0	0	0	0.010504	0	18	61				
COQ7	10229	broad.mit.edu	37	16	19088645	19088645	+	Silent	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr16:19088645G>A	ENST00000321998.5	+	5	591	c.525G>A	c.(523-525)cgG>cgA	p.R175R	COQ7_ENST00000568985.1_Silent_p.R175R|COQ7_ENST00000569127.1_Silent_p.R152R|COQ7_ENST00000544894.2_Silent_p.R137R	NM_016138.4	NP_057222.2	Q99807	COQ7_HUMAN	coenzyme Q7 homolog, ubiquinone (yeast)	175	2 X approximate tandem repeats.				age-dependent response to oxidative stress (GO:0001306)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|in utero embryonic development (GO:0001701)|mitochondrial ATP synthesis coupled electron transport (GO:0042775)|mitochondrion morphogenesis (GO:0070584)|neural tube formation (GO:0001841)|neurogenesis (GO:0022008)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|large_intestine(1)|lung(3)|prostate(1)|skin(3)|urinary_tract(1)	10						AGAAATTTCGGGATGAAGAGC	0.448																																							uc002dfr.2		NA																	0				skin(1)	1						c.(523-525)CGG>CGA		COQ7 protein							112.0	106.0	108.0					16																	19088645		2197	4300	6497	SO:0001819	synonymous_variant	10229				ubiquinone biosynthetic process	mitochondrial inner membrane|nucleus	oxidoreductase activity|transition metal ion binding	g.chr16:19088645G>A	U81276	CCDS10574.1, CCDS53993.1	16p12.3	2008-05-14	2001-11-28		ENSG00000167186	ENSG00000167186			2244	protein-coding gene	gene with protein product		601683	"""coenzyme Q, 7 (rat, yeast) homolog"""			9020081, 10373325	Standard	NM_016138		Approved	CLK-1, CAT5	uc002dfr.3	Q99807	OTTHUMG00000131455	ENST00000321998.5:c.525G>A	16.37:g.19088645G>A			Somatic				COQ7_uc002dfs.2_Silent_p.R161R	p.R175R	NM_016138	NP_057222	WXS	Illumina HiSeq	Unspecified	Q99807	COQ7_HUMAN			5	585	+			175			2.|2 X approximate tandem repeats.		B2RDA9|Q9BTT7|Q9H0T5|Q9UEW5|Q9UNR5	Silent	SNP	ENST00000321998.5	37	c.525G>A	CCDS10574.1																																																																																				0.448	COQ7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254275.3	NM_016138		12	32	0	0	0	0.004007	0	12	32				
SULT1A1	6817	broad.mit.edu	37	16	28619895	28619895	+	Missense_Mutation	SNP	T	T	A	rs201317421		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr16:28619895T>A	ENST00000395607.1	-	3	451	c.178A>T	c.(178-180)Atg>Ttg	p.M60L	SULT1A1_ENST00000314752.7_Missense_Mutation_p.M60L|SULT1A1_ENST00000395609.1_Missense_Mutation_p.M60L|SULT1A1_ENST00000569554.1_Missense_Mutation_p.M60L|SULT1A1_ENST00000350842.4_Intron	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	60					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)			endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	TGGTAGATCATGTCCAGAATC	0.602																																							uc002dqi.2		NA																	0					0						c.(178-180)ATG>TTG		sulfotransferase family, cytosolic, 1A,							112.0	80.0	91.0					16																	28619895		2197	4300	6497	SO:0001583	missense	6817				3'-phosphoadenosine 5'-phosphosulfate metabolic process|catecholamine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity	g.chr16:28619895T>A	U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.178A>T	16.37:g.28619895T>A	ENSP00000378971:p.Met60Leu		Somatic				uc010vct.1_Intron|SULT1A1_uc002dqj.2_Missense_Mutation_p.M60L|SULT1A1_uc002dqk.2_Missense_Mutation_p.M60L|SULT1A1_uc002dql.2_Missense_Mutation_p.M60L|SULT1A1_uc002dqm.2_Intron|SULT1A1_uc002dqn.2_Missense_Mutation_p.M151L|SULT1A1_uc002dqo.2_Missense_Mutation_p.M60L|SULT1A1_uc002dqp.2_Missense_Mutation_p.M60L	p.M60L	NM_177534	NP_803878	WXS	Illumina HiSeq	Unspecified	P50225	ST1A1_HUMAN			2	651	-			60					Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Missense_Mutation	SNP	ENST00000395607.1	37	c.178A>T	CCDS32420.1	.	.	.	.	.	.	.	.	.	.	.	4.815	0.151591	0.09185	.	.	ENSG00000196502	ENST00000314752;ENST00000395609;ENST00000395607	T;T;T	0.80033	-1.33;-1.33;-1.33	2.53	-1.54	0.08584	Sulfotransferase domain (1);	0.256191	0.40728	N	0.001032	T	0.50377	0.1612	N	0.03903	-0.33	0.22918	N	0.998569	B	0.02656	0.0	B	0.14023	0.01	T	0.40664	-0.9551	10	0.15499	T	0.54	.	5.5956	0.17325	0.1784:0.0:0.5427:0.2788	.	60	P50225	ST1A1_HUMAN	L	60	ENSP00000321988:M60L;ENSP00000378972:M60L;ENSP00000378971:M60L	ENSP00000321988:M60L	M	-	1	0	SULT1A1	28527396	1.000000	0.71417	0.796000	0.32109	0.060000	0.15804	0.509000	0.22707	-0.347000	0.08299	0.254000	0.18369	ATG		0.602	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254694.2	NM_001055		4	41	0	0	0	0.00499	0	4	41				
ITGAL	3683	broad.mit.edu	37	16	30532924	30532924	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr16:30532924G>C	ENST00000356798.6	+	31	3631	c.3451G>C	c.(3451-3453)Gat>Cat	p.D1151H	ITGAL_ENST00000358164.5_Missense_Mutation_p.D1067H|ITGAL_ENST00000433423.2_Missense_Mutation_p.D385H	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	1151					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	AGAGGCTGGGGATCCCGGCTG	0.597																																					NSCLC(110;1462 1641 3311 33990 49495)	NSCLC(110;1462 1641 3311 33990 49495)	uc002dyi.3		NA																	0				ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10						c.(3451-3453)GAT>CAT		integrin alpha L isoform a precursor	Efalizumab(DB00095)						65.0	70.0	68.0					16																	30532924		2197	4300	6497	SO:0001583	missense	3683				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity	g.chr16:30532924G>C		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.3451G>C	16.37:g.30532924G>C	ENSP00000349252:p.Asp1151His		Somatic				ITGAL_uc002dyj.3_Missense_Mutation_p.D1067H|ITGAL_uc010vev.1_Missense_Mutation_p.D385H	p.D1151H	NM_002209	NP_002200	WXS	Illumina HiSeq	Unspecified	P20701	ITAL_HUMAN			31	3627	+			1151			Cytoplasmic (Potential).		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	c.3451G>C	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787075	0.49997	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	T;T;T	0.60548	0.18;0.53;1.6	4.81	3.84	0.44239	.	0.339051	0.25283	N	0.031789	T	0.64371	0.2592	L	0.36672	1.1	0.23227	N	0.998083	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.99	T	0.54912	-0.8222	10	0.87932	D	0	.	9.6218	0.39725	0.0997:0.0:0.9003:0.0	.	385;1067;1151	B4E021;Q96HB1;P20701	.;.;ITAL_HUMAN	H	1151;1067;385	ENSP00000349252:D1151H;ENSP00000350886:D1067H;ENSP00000409377:D385H	ENSP00000349252:D1151H	D	+	1	0	ITGAL	30440425	0.091000	0.21658	0.004000	0.12327	0.007000	0.05969	1.452000	0.35156	1.131000	0.42111	0.555000	0.69702	GAT		0.597	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2			18	87	0	0	0	0.00333	0	18	87				
RFFL	117584	broad.mit.edu	37	17	33348651	33348651	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr17:33348651C>A	ENST00000315249.7	-	3	552	c.330G>T	c.(328-330)agG>agT	p.R110S	RAD51L3-RFFL_ENST00000593039.1_Intron|RFFL_ENST00000584655.1_Missense_Mutation_p.R110S|RFFL_ENST00000378516.2_Missense_Mutation_p.R110S|RFFL_ENST00000394597.2_Missense_Mutation_p.R110S|RFFL_ENST00000415395.2_Missense_Mutation_p.R110S|RFFL_ENST00000413582.2_Missense_Mutation_p.R110S|RFFL_ENST00000268850.7_Missense_Mutation_p.R110S|RFFL_ENST00000447669.2_Missense_Mutation_p.R110S					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TGAGATAGTCCCTCAAGTCCT	0.552																																							uc002hin.1		NA																	0					0						c.(328-330)AGG>AGT		rififylin							103.0	97.0	99.0					17																	33348651		2203	4300	6503	SO:0001583	missense	117584				apoptosis	membrane	ligase activity|zinc ion binding	g.chr17:33348651C>A	AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.330G>T	17.37:g.33348651C>A	ENSP00000326170:p.Arg110Ser		Somatic				RFFL_uc002hiq.2_Intron|RFFL_uc002him.1_Missense_Mutation_p.R110S|RFFL_uc010cti.1_Missense_Mutation_p.R116S|RFFL_uc002hip.1_Missense_Mutation_p.R110S|RFFL_uc002hio.1_Missense_Mutation_p.R110S	p.R110S	NM_001017368	NP_001017368	WXS	Illumina HiSeq	Unspecified	Q8WZ73	RFFL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)	3	503	-		Ovarian(249;0.17)	110			SAP 1.			Missense_Mutation	SNP	ENST00000315249.7	37	c.330G>T	CCDS11286.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409087	0.83340	.	.	ENSG00000092871	ENST00000315249;ENST00000394597;ENST00000378516;ENST00000268850;ENST00000413582;ENST00000415395;ENST00000414419	T;T;T;T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9;-0.9;-0.9;-0.9	5.65	5.65	0.86999	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.84683	0.5526	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.89917	0.996;0.996;1.0;0.996	D;D;D;D	0.87578	0.99;0.99;0.998;0.99	D	0.85391	0.1125	10	0.87932	D	0	-20.8323	11.9078	0.52723	0.0:0.9145:0.0:0.0855	.	110;110;110;110	C9JN73;Q8WZ73-3;Q8WZ73;Q8WZ73-2	.;.;RFFL_HUMAN;.	S	110	ENSP00000326170:R110S;ENSP00000378096:R110S;ENSP00000367777:R110S;ENSP00000268850:R110S;ENSP00000408513:R110S;ENSP00000412322:R110S;ENSP00000395090:R110S	ENSP00000268850:R110S	R	-	3	2	RFFL	30372764	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.530000	0.36007	2.941000	0.99782	0.655000	0.94253	AGG		0.552	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256460.2	NM_057178		18	84	1	0	8.10497e-08	0.010504	1.03716e-07	18	84				
KLHL11	55175	broad.mit.edu	37	17	40021265	40021265	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr17:40021265T>A	ENST00000319121.3	-	1	419	c.359A>T	c.(358-360)gAg>gTg	p.E120V	ACLY_ENST00000588779.1_5'Flank	NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	120	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				CGTGAAGTACTCGGTGGCGGC	0.701																																							uc002hyf.1		NA																	0					0						c.(358-360)GAG>GTG		kelch-like 11 precursor							14.0	17.0	16.0					17																	40021265		2184	4275	6459	SO:0001583	missense	55175					extracellular region		g.chr17:40021265T>A		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.359A>T	17.37:g.40021265T>A	ENSP00000314608:p.Glu120Val		Somatic					p.E120V	NM_018143	NP_060613	WXS	Illumina HiSeq	Unspecified	Q9NVR0	KLH11_HUMAN			1	365	-		Breast(137;0.00156)	120			BTB.			Missense_Mutation	SNP	ENST00000319121.3	37	c.359A>T	CCDS11411.1	.	.	.	.	.	.	.	.	.	.	t	19.12	3.766561	0.69878	.	.	ENSG00000178502	ENST00000319121	T	0.72051	-0.62	4.69	4.69	0.59074	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.183396	0.47093	D	0.000243	T	0.63189	0.2490	L	0.43152	1.355	0.42832	D	0.994027	B	0.29612	0.251	B	0.25614	0.062	T	0.67130	-0.5748	10	0.87932	D	0	-0.3559	14.3323	0.66566	0.0:0.0:0.0:1.0	.	120	Q9NVR0	KLH11_HUMAN	V	120	ENSP00000314608:E120V	ENSP00000314608:E120V	E	-	2	0	KLHL11	37274791	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.573000	0.67417	1.973000	0.57446	0.524000	0.50904	GAG		0.701	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143		6	34	0	0	0	0.001168	0	6	34				
BZRAP1	9256	broad.mit.edu	37	17	56387946	56387946	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr17:56387946C>G	ENST00000343736.4	-	20	3789	c.3626G>C	c.(3625-3627)cGg>cCg	p.R1209P	BZRAP1_ENST00000268893.6_Missense_Mutation_p.R1149P|BZRAP1_ENST00000355701.3_Missense_Mutation_p.R1209P			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1209						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGCTGGGCCCGTGCTCCCTG	0.672																																							uc002ivx.3		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(3625-3627)CGG>CCG		peripheral benzodiazepine receptor-associated							37.0	41.0	39.0					17																	56387946		2203	4299	6502	SO:0001583	missense	9256					mitochondrion	benzodiazepine receptor binding	g.chr17:56387946C>G	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.3626G>C	17.37:g.56387946C>G	ENSP00000345824:p.Arg1209Pro		Somatic				BZRAP1_uc010dcs.2_Missense_Mutation_p.R1149P|BZRAP1_uc010wnt.1_Missense_Mutation_p.R1209P	p.R1209P	NM_004758	NP_004749	WXS	Illumina HiSeq	Unspecified	O95153	RIMB1_HUMAN			20	4497	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		1209					O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	37	c.3626G>C	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	A	0.478	-0.881175	0.02530	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	D;D;D	0.87650	-2.28;-2.28;-2.28	5.45	-1.03	0.10102	.	1.038350	0.07548	N	0.914872	T	0.68302	0.2986	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.54330	-0.8310	10	0.28530	T	0.3	.	5.346	0.16010	0.3123:0.317:0.3707:0.0	.	1209;1149;1209	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	P	1209;1209;1149	ENSP00000347929:R1209P;ENSP00000345824:R1209P;ENSP00000268893:R1149P	ENSP00000268893:R1149P	R	-	2	0	BZRAP1	53742945	0.000000	0.05858	0.004000	0.12327	0.021000	0.10359	-0.498000	0.06420	-0.149000	0.11215	-0.525000	0.04345	CGG		0.672	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758		8	43	0	0	0	0.00308	0	8	43				
CACNG1	786	broad.mit.edu	37	17	65040854	65040854	+	Silent	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr17:65040854C>A	ENST00000226021.3	+	1	149	c.78C>A	c.(76-78)gcC>gcA	p.A26A		NM_000727.3	NP_000718.1	Q06432	CCG1_HUMAN	calcium channel, voltage-dependent, gamma subunit 1	26					muscle contraction (GO:0006936)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transport (GO:0006810)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)	8	all_cancers(12;1.04e-10)|Breast(2;1.45e-16)|all_epithelial(3;4.81e-12)				Diltiazem(DB00343)|Fluspirilene(DB04842)|Ibutilide(DB00308)|Lercanidipine(DB00528)|Magnesium Sulfate(DB00653)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CCATGACAGCCGTGGTAACCG	0.632																																							uc002jfu.2		NA																	0					0						c.(76-78)GCC>GCA		voltage-dependent calcium channel gamma-1	Amlodipine(DB00381)|Diltiazem(DB00343)|Ibutilide(DB00308)|Lercanidipine(DB00528)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Nitrendipine(DB01054)|Verapamil(DB00661)						92.0	78.0	83.0					17																	65040854		2203	4300	6503	SO:0001819	synonymous_variant	786				muscle contraction	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr17:65040854C>A	L07738	CCDS11668.1	17q24	2008-05-02				ENSG00000108878		"""Calcium channel subunits"""	1405	protein-coding gene	gene with protein product		114209		CACNLG		8395940	Standard	NM_000727		Approved		uc002jfu.3	Q06432		ENST00000226021.3:c.78C>A	17.37:g.65040854C>A			Somatic					p.A26A	NM_000727	NP_000718	WXS	Illumina HiSeq	Unspecified	Q06432	CCG1_HUMAN			1	149	+	all_cancers(12;1.04e-10)|Breast(2;1.45e-16)|all_epithelial(3;4.81e-12)		26			Helical; (Potential).		B2R9N3|Q14D59	Silent	SNP	ENST00000226021.3	37	c.78C>A	CCDS11668.1																																																																																				0.632	CACNG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447039.1			24	106	1	0	1.7881e-09	0.008361	2.38941e-09	24	106				
DNAH17	8632	broad.mit.edu	37	17	76566359	76566359	+	Silent	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr17:76566359C>A	ENST00000585328.1	-	7	1138	c.1014G>T	c.(1012-1014)ctG>ctT	p.L338L	DNAH17_ENST00000389840.5_Silent_p.L338L	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	338	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGAACTCCTGCAGGATGACGA	0.587																																							uc002jvv.1		NA																	0				ovary(6)|breast(2)|skin(1)	9						c.(118-120)CTG>CTT		RecName: Full=Dynein heavy chain 17, axonemal; AltName: Full=Axonemal beta dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain-like protein 1; AltName: Full=Axonemal dynein heavy chain-like protein 1; AltName: Full=Dynein light chain 2, axonemal;							63.0	50.0	54.0					17																	76566359		2203	4299	6502	SO:0001819	synonymous_variant	8632							g.chr17:76566359C>A	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.1014G>T	17.37:g.76566359C>A			Somatic					p.L40L			WXS	Illumina HiSeq	Unspecified			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)		3	226	-								O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	37	c.120G>T																																																																																					0.587	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628		3	9	1	0	0.004672	0.004672	0.00507534	3	9				
TUBB6	84617	broad.mit.edu	37	18	12325517	12325517	+	Silent	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr18:12325517G>A	ENST00000317702.5	+	4	963	c.729G>A	c.(727-729)ccG>ccA	p.P243P	TUBB6_ENST00000590967.1_Intron|TUBB6_ENST00000591909.1_Intron|TUBB6_ENST00000591208.1_3'UTR			Q9BUF5	TBB6_HUMAN	tubulin, beta 6 class V	243					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)	14				READ - Rectum adenocarcinoma(1;0.0649)		TGCGCTTCCCGGGCCAGCTCA	0.657																																							uc002kqw.2		NA																	0					0						c.(727-729)CCG>CCA		tubulin, beta 6							64.0	60.0	62.0					18																	12325517		2203	4300	6503	SO:0001819	synonymous_variant	84617				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr18:12325517G>A	AK001295	CCDS11858.1	18p11.21	2011-10-10	2011-10-10		ENSG00000176014	ENSG00000176014		"""Tubulins"""	20776	protein-coding gene	gene with protein product	"""tubulin beta MGC4083"", ""class V beta-tubulin"""	615103	"""tubulin, beta 6"""			12477932	Standard	NM_032525		Approved	MGC4083, HsT1601	uc002kqw.3	Q9BUF5	OTTHUMG00000131692	ENST00000317702.5:c.729G>A	18.37:g.12325517G>A			Somatic				TUBB6_uc002kqv.2_Silent_p.P171P|TUBB6_uc010dld.2_RNA|TUBB6_uc002kqx.2_Silent_p.P206P|TUBB6_uc002kqy.2_Intron	p.P243P	NM_032525	NP_115914	WXS	Illumina HiSeq	Unspecified	Q9BUF5	TBB6_HUMAN		READ - Rectum adenocarcinoma(1;0.0649)	4	774	+			243					B3KM76|Q9HA42	Silent	SNP	ENST00000317702.5	37	c.729G>A	CCDS11858.1																																																																																				0.657	TUBB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254600.2	NM_032525		12	80	0	0	0	0.00245	0	12	80				
GATA6	2627	broad.mit.edu	37	18	19751291	19751291	+	Silent	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr18:19751291G>T	ENST00000269216.3	+	2	463	c.186G>T	c.(184-186)acG>acT	p.T62T	GATA6-AS1_ENST00000583490.1_lincRNA|GATA6_ENST00000581694.1_Silent_p.T62T	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	62					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			ACTGCGGGACGCCTCAGCTCG	0.751																																					Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	uc002ktt.1		NA																	0				central_nervous_system(3)	3						c.(184-186)ACG>ACT		GATA binding protein 6							6.0	8.0	7.0					18																	19751291		1930	3893	5823	SO:0001819	synonymous_variant	2627				blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chr18:19751291G>T	U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.186G>T	18.37:g.19751291G>T			Somatic				GATA6_uc002ktu.1_Silent_p.T62T	p.T62T	NM_005257	NP_005248	WXS	Illumina HiSeq	Unspecified	Q92908	GATA6_HUMAN	STAD - Stomach adenocarcinoma(5;0.106)		2	451	+	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		62					B0YJ17|P78327	Silent	SNP	ENST00000269216.3	37	c.186G>T	CCDS11872.1																																																																																				0.751	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257		18	15	1	0	1.10513e-12	0.014323	1.62015e-12	18	15				
CNDP2	55748	broad.mit.edu	37	18	72176088	72176088	+	Silent	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr18:72176088G>A	ENST00000324262.4	+	5	697	c.381G>A	c.(379-381)ggG>ggA	p.G127G	CNDP2_ENST00000579847.1_Silent_p.G127G|CNDP2_ENST00000324301.8_Intron	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	127					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		AGCTGTATGGGAGAGGTTCGA	0.522																																							uc002llm.1		NA																	0				ovary(2)|skin(1)	3						c.(379-381)GGG>GGA		CNDP dipeptidase 2							85.0	78.0	80.0					18																	72176088		2203	4300	6503	SO:0001819	synonymous_variant	55748					cytoplasm	carboxypeptidase activity|metal ion binding|metallopeptidase activity|protein binding|tripeptidase activity	g.chr18:72176088G>A	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.381G>A	18.37:g.72176088G>A			Somatic				CNDP2_uc002lln.1_Intron|CNDP2_uc002llo.2_Silent_p.G127G|CNDP2_uc002llp.1_RNA|CNDP2_uc010dqs.2_5'Flank	p.G127G	NM_018235	NP_060705	WXS	Illumina HiSeq	Unspecified	Q96KP4	CNDP2_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.22)	5	543	+		Esophageal squamous(42;0.131)|Prostate(75;0.173)	127					B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Silent	SNP	ENST00000324262.4	37	c.381G>A	CCDS12006.1																																																																																				0.522	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235		7	34	0	0	0	0.008291	0	7	34				
ADNP2	22850	broad.mit.edu	37	18	77894355	77894355	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr18:77894355G>T	ENST00000262198.4	+	4	1514	c.1059G>T	c.(1057-1059)caG>caT	p.Q353H		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	353	Pro-rich.				cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CAGCACCTCAGCCCGTCTTTC	0.582																																							uc002lnw.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1057-1059)CAG>CAT		ADNP homeobox 2							63.0	60.0	61.0					18																	77894355		2203	4300	6503	SO:0001583	missense	22850				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:77894355G>T	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.1059G>T	18.37:g.77894355G>T	ENSP00000262198:p.Gln353His		Somatic					p.Q353H	NM_014913	NP_055728	WXS	Illumina HiSeq	Unspecified	Q6IQ32	ADNP2_HUMAN		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)	4	1514	+		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)	353			Pro-rich.		A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	c.1059G>T	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	G	9.653	1.142186	0.21205	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.23	2.4	0.29515	.	0.104655	0.40728	N	0.001039	T	0.19087	0.0458	L	0.27053	0.805	0.09310	N	1	B	0.29988	0.264	B	0.23852	0.049	T	0.12967	-1.0527	8	.	.	.	-9.6807	4.846	0.13514	0.2884:0.0:0.5718:0.1398	.	353	Q6IQ32	ADNP2_HUMAN	H	353	.	.	Q	+	3	2	ADNP2	75995346	0.196000	0.23350	0.012000	0.15200	0.157000	0.22087	-0.454000	0.06770	0.321000	0.23259	-0.145000	0.13849	CAG		0.582	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		13	60	1	0	2.23348e-06	0.004007	2.63481e-06	13	60				
HNRNPM	4670	broad.mit.edu	37	19	8528531	8528531	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:8528531C>A	ENST00000325495.4	+	5	440	c.399C>A	c.(397-399)aaC>aaA	p.N133K	HNRNPM_ENST00000348943.3_Missense_Mutation_p.N133K	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	133	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						AAGTCCTAAACAAGCATAGTC	0.418																																							uc010dwe.2		NA																	0					0						c.(397-399)AAC>AAA		heterogeneous nuclear ribonucleoprotein M							129.0	106.0	114.0					19																	8528531		2203	4300	6503	SO:0001583	missense	4670				alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding	g.chr19:8528531C>A	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.399C>A	19.37:g.8528531C>A	ENSP00000325376:p.Asn133Lys		Somatic				HNRNPM_uc010dwc.1_Missense_Mutation_p.N133K|HNRNPM_uc010xke.1_Missense_Mutation_p.N133K|HNRNPM_uc010dwd.2_Missense_Mutation_p.N133K|HNRNPM_uc002mka.2_Missense_Mutation_p.N13K	p.N133K	NM_005968	NP_005959	WXS	Illumina HiSeq	Unspecified	P52272	HNRPM_HUMAN			5	479	+			133			RRM 1.		Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	c.399C>A	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.322461	0.60634	.	.	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159	T;T	0.79940	-1.32;2.97	6.17	6.17	0.99709	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.88081	0.6341	M	0.71036	2.16	0.58432	D	0.999998	D;D;D;D	0.63046	0.99;0.992;0.987;0.987	D;D;D;D	0.70016	0.967;0.917;0.926;0.95	D	0.88314	0.2958	10	0.87932	D	0	.	12.7145	0.57107	0.0:0.9252:0.0:0.0748	.	133;133;133;33	P52272;P52272-2;B4DEG4;Q59ES8	HNRPM_HUMAN;.;.;.	K	133;133;33	ENSP00000325376:N133K;ENSP00000325732:N133K	ENSP00000325376:N133K	N	+	3	2	HNRNPM	8434531	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.088000	0.50175	2.941000	0.99782	0.655000	0.94253	AAC		0.418	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1			9	44	1	0	9.05144e-12	0.001855	1.27735e-11	9	44				
ZNF699	374879	broad.mit.edu	37	19	9407173	9407173	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:9407173C>T	ENST00000591998.1	-	6	1135	c.907G>A	c.(907-909)Gga>Aga	p.G303R	CTC-325H20.4_ENST00000591336.1_RNA|ZNF699_ENST00000308650.3_Missense_Mutation_p.G303R			Q32M78	ZN699_HUMAN	zinc finger protein 699	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGCTTATCTCCACTGTGAATT	0.393																																							uc002mlc.1		NA																	0					0						c.(907-909)GGA>AGA		zinc finger protein 699							103.0	104.0	104.0					19																	9407173		2173	4281	6454	SO:0001583	missense	374879				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9407173C>T	BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.907G>A	19.37:g.9407173C>T	ENSP00000467723:p.Gly303Arg		Somatic					p.G303R	NM_198535	NP_940937	WXS	Illumina HiSeq	Unspecified	Q32M78	ZN699_HUMAN			5	907	-			303					Q8N9A1	Missense_Mutation	SNP	ENST00000591998.1	37	c.907G>A	CCDS42495.1	.	.	.	.	.	.	.	.	.	.	c	16.16	3.044855	0.55110	.	.	ENSG00000196110	ENST00000308650	T	0.26223	1.75	3.28	1.13	0.20643	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34959	N	0.003553	T	0.21427	0.0516	L	0.51422	1.61	0.26195	N	0.979522	P	0.45827	0.867	B	0.41988	0.372	T	0.11012	-1.0605	10	0.66056	D	0.02	.	6.9936	0.24769	0.0:0.7598:0.0:0.2402	.	303	Q32M78	ZN699_HUMAN	R	303	ENSP00000311596:G303R	ENSP00000311596:G303R	G	-	1	0	ZNF699	9268173	0.050000	0.20438	0.004000	0.12327	0.007000	0.05969	3.058000	0.49939	0.406000	0.25560	0.550000	0.68814	GGA		0.393	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449010.1	NM_198535		25	121	0	0	0	0.00632	0	25	121				
FDX1L	112812	broad.mit.edu	37	19	10421212	10421212	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:10421212T>A	ENST00000393708.3	-	5	520	c.502A>T	c.(502-504)Aag>Tag	p.K168*	CTD-2369P2.10_ENST00000452032.2_3'UTR|ZGLP1_ENST00000403352.1_5'Flank|FDX1L_ENST00000492239.1_5'UTR|FDX1L_ENST00000494368.1_Nonsense_Mutation_p.K33*|ZGLP1_ENST00000403903.3_5'Flank|FDX1L_ENST00000541276.1_3'UTR	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like	168	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			CTGGTGATCTTGGGCAGGGTG	0.602																																							uc002mny.1		NA																	0				skin(1)	1						c.(502-504)AAG>TAG		ferredoxin 1-like precursor							129.0	105.0	113.0					19																	10421212		2203	4300	6503	SO:0001587	stop_gained	112812				electron transport chain|transport	mitochondrial matrix	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding	g.chr19:10421212T>A	AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299	ENST00000393708.3:c.502A>T	19.37:g.10421212T>A	ENSP00000377311:p.Lys168*		Somatic				ZGLP1_uc002mnw.3_5'Flank|FDX1L_uc002mnx.1_RNA	p.K168*	NM_001031734	NP_001026904	WXS	Illumina HiSeq	Unspecified	Q6P4F2	ADXL_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)		5	521	-			168			2Fe-2S ferredoxin-type.		Q8N8B8	Nonsense_Mutation	SNP	ENST00000393708.3	37	c.502A>T	CCDS32905.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.886333	0.91814	.	.	ENSG00000167807	ENST00000393708	.	.	.	4.25	4.25	0.50352	.	0.124551	0.52532	D	0.000072	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.1793	11.3635	0.49657	0.0:0.0:0.0:1.0	.	.	.	.	X	168	.	ENSP00000377311:K168X	K	-	1	0	FDX1L	10282212	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.235000	0.65348	1.560000	0.49568	0.454000	0.30748	AAG		0.602	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280567.2			7	67	0	0	0	0.001984	0	7	67				
ZNF99	7652	broad.mit.edu	37	19	22939472	22939472	+	IGR	SNP	A	A	G	rs55891931		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:22939472A>G	ENST00000596209.1	-	0	2686				ZNF99_ENST00000397104.3_Missense_Mutation_p.F900S|CTC-451A6.4_ENST00000442497.2_lincRNA	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AAGGGTCGAGAAATTGTTAAA	0.353																																							uc010xrh.1		NA																	0				ovary(1)|skin(1)	2						c.(2698-2700)TTC>TCC		zinc finger protein 99							40.0	53.0	49.0					19																	22939472		1825	4165	5990	SO:0001628	intergenic_variant	7652							g.chr19:22939472A>G	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4			19.37:g.22939472A>G			Somatic					p.F900S	NM_001080409	NP_001073878	WXS	Illumina HiSeq	Unspecified					7	2699	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.2699T>C	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	0.001	-2.974208	0.00047	.	.	ENSG00000213973	ENST00000397104	T	0.36157	1.27	0.503	-1.01	0.10169	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14657	0.0354	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.25676	-1.0125	7	0.12766	T	0.61	.	.	.	.	rs55891931	900	A8MXY4	ZNF99_HUMAN	S	900	ENSP00000380293:F900S	ENSP00000380293:F900S	F	-	2	0	ZNF99	22731312	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-6.020000	0.00085	-2.544000	0.00483	-1.973000	0.00462	TTC		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		3	88	0	0	0	0.004672	0	3	88				
AXL	558	broad.mit.edu	37	19	41748808	41748808	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:41748808G>T	ENST00000301178.4	+	11	1523	c.1333G>T	c.(1333-1335)Gcc>Tcc	p.A445S	AXL_ENST00000359092.3_Missense_Mutation_p.A436S|AXL_ENST00000593513.1_Missense_Mutation_p.A177S	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	445					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						TTCAACTCCTGCCTTCTCGTG	0.567																																							uc010ehj.2		NA																	0				lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						c.(1333-1335)GCC>TCC		AXL receptor tyrosine kinase isoform 1							161.0	130.0	141.0					19																	41748808		2203	4300	6503	SO:0001583	missense	558					integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr19:41748808G>T	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.1333G>T	19.37:g.41748808G>T	ENSP00000301178:p.Ala445Ser		Somatic				CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Missense_Mutation_p.A445S|AXL_uc010ehk.2_Missense_Mutation_p.A436S	p.A445S	NM_021913	NP_068713	WXS	Illumina HiSeq	Unspecified	P30530	UFO_HUMAN			11	1523	+			445			Extracellular (Potential).		Q8N5L2|Q9UD27	Missense_Mutation	SNP	ENST00000301178.4	37	c.1333G>T	CCDS12575.1	.	.	.	.	.	.	.	.	.	.	g	13.28	2.189004	0.38707	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.74632	-0.86;-0.79	4.49	4.49	0.54785	.	0.074982	0.52532	D	0.000079	T	0.67097	0.2857	L	0.43152	1.355	0.37226	D	0.905488	B;B	0.23937	0.077;0.094	B;B	0.23716	0.048;0.022	T	0.68044	-0.5513	10	0.33940	T	0.23	-23.1999	14.4576	0.67428	0.0:0.0:1.0:0.0	.	436;445	P30530-2;P30530	.;UFO_HUMAN	S	445;436	ENSP00000301178:A445S;ENSP00000351995:A436S	ENSP00000301178:A445S	A	+	1	0	AXL	46440648	1.000000	0.71417	0.999000	0.59377	0.769000	0.43574	3.122000	0.50446	2.198000	0.70561	0.650000	0.86243	GCC		0.567	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2			17	81	1	0	4.96729e-08	0.008871	6.46604e-08	17	81				
GRIK5	2901	broad.mit.edu	37	19	42509946	42509946	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:42509946C>T	ENST00000262895.3	-	16	2191	c.2192G>A	c.(2191-2193)cGc>cAc	p.R731H	GRIK5_ENST00000301218.4_Missense_Mutation_p.R731H|GRIK5_ENST00000593562.1_Missense_Mutation_p.R731H	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	731					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				GCAGTTGAGGCGCCGGTGGTA	0.622																																							uc002osj.1		NA																	0					0						c.(2191-2193)CGC>CAC		glutamate receptor KA2 precursor	L-Glutamic Acid(DB00142)						124.0	85.0	98.0					19																	42509946		2203	4300	6503	SO:0001583	missense	2901					cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr19:42509946C>T		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.2192G>A	19.37:g.42509946C>T	ENSP00000262895:p.Arg731His		Somatic				GRIK5_uc002osi.1_Missense_Mutation_p.R303H	p.R731H	NM_002088	NP_002079	WXS	Illumina HiSeq	Unspecified	Q16478	GRIK5_HUMAN			16	2227	-		Prostate(69;0.059)	731			Extracellular (Potential).		Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	37	c.2192G>A	CCDS12595.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994413	0.93167	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	T;T	0.11930	2.73;2.73	5.23	5.23	0.72850	Ionotropic glutamate receptor (2);	0.073598	0.56097	D	0.000029	T	0.25121	0.0610	L	0.33339	1.005	0.46499	D	0.999073	D	0.58970	0.984	P	0.60345	0.873	T	0.00684	-1.1611	10	0.51188	T	0.08	.	17.5664	0.87921	0.0:1.0:0.0:0.0	.	731	Q16478	GRIK5_HUMAN	H	731	ENSP00000262895:R731H;ENSP00000301218:R731H	ENSP00000262895:R731H	R	-	2	0	GRIK5	47201786	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.760000	0.38430	2.450000	0.82876	0.563000	0.77884	CGC		0.622	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1			8	42	0	0	0	0.008291	0	8	42				
ZNF526	116115	broad.mit.edu	37	19	42730535	42730535	+	Silent	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:42730535C>A	ENST00000301215.3	+	3	2205	c.1980C>A	c.(1978-1980)ggC>ggA	p.G660G		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	660					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				GTGAAGCAGGCGGGCTCTTGC	0.597																																							uc002osz.1		NA																	0					0						c.(1978-1980)GGC>GGA		zinc finger protein 526							83.0	86.0	85.0					19																	42730535		2203	4300	6503	SO:0001819	synonymous_variant	116115				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:42730535C>A	AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1980C>A	19.37:g.42730535C>A			Somatic					p.G660G	NM_133444	NP_597701	WXS	Illumina HiSeq	Unspecified	Q8TF50	ZN526_HUMAN			3	2136	+		Prostate(69;0.0704)	660					B3KV29|Q69YI2|Q96E24	Silent	SNP	ENST00000301215.3	37	c.1980C>A	CCDS12598.1																																																																																				0.597	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463681.2	XM_057401		4	167	1	0	0.000602214	0.000602	0.000673588	4	167				
ZNF404	342908	broad.mit.edu	37	19	44376838	44376838	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:44376838G>T	ENST00000587539.1	-	3	1527	c.1528C>A	c.(1528-1530)Ctt>Att	p.L510I	ZNF404_ENST00000324394.6_Missense_Mutation_p.L508I	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	510					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				TGTTGAGTAAGTCGATCACTG	0.373																																							uc002oxs.3		NA																	0					0						c.(1519-1521)CTT>ATT		zinc finger protein 404							69.0	71.0	70.0					19																	44376838		2155	4277	6432	SO:0001583	missense	342908				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44376838G>T	XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.1528C>A	19.37:g.44376838G>T	ENSP00000466051:p.Leu510Ile		Somatic					p.L507I	NM_001033719	NP_001028891	WXS	Illumina HiSeq	Unspecified	Q494X3	ZN404_HUMAN			2	1528	-		Prostate(69;0.0352)	510			C2H2-type 14.		A4FU30|K7ELF2	Missense_Mutation	SNP	ENST00000587539.1	37	c.1519C>A	CCDS59394.1	.	.	.	.	.	.	.	.	.	.	G	8.301	0.819988	0.16678	.	.	ENSG00000176222	ENST00000324394	T	0.53857	0.6	2.45	1.14	0.20703	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.74291	0.3697	M	0.94021	3.485	0.09310	N	1	D	0.61080	0.989	D	0.71870	0.975	T	0.61377	-0.7075	9	0.72032	D	0.01	.	6.2029	0.20585	0.2371:0.0:0.7629:0.0	.	510	Q494X3	ZN404_HUMAN	I	508	ENSP00000319479:L508I	ENSP00000319479:L508I	L	-	1	0	ZNF404	49068678	0.705000	0.27846	0.001000	0.08648	0.059000	0.15707	1.166000	0.31834	0.085000	0.17107	0.543000	0.68304	CTT		0.373	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460019.1	NM_001033719		6	33	1	0	2.0095e-06	0.001984	2.40821e-06	6	33				
PRRG2	5639	broad.mit.edu	37	19	50093639	50093639	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:50093639C>T	ENST00000246794.5	+	7	771	c.602C>T	c.(601-603)cCt>cTt	p.P201L	PRRG2_ENST00000596700.1_3'UTR|PRR12_ENST00000418929.2_5'Flank	NM_000951.2	NP_000942.1	O14669	TMG2_HUMAN	proline rich Gla (G-carboxyglutamic acid) 2	201						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			lung(1)|skin(1)|soft_tissue(1)	3		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0121)		CTCAGGAGGCCTCACTGAAGA	0.597																																							uc002pon.3		NA																	0				skin(1)	1						c.(601-603)CCT>CTT		proline rich Gla (G-carboxyglutamic acid) 2							155.0	148.0	151.0					19																	50093639		2203	4300	6503	SO:0001583	missense	5639					extracellular region|integral to plasma membrane	calcium ion binding	g.chr19:50093639C>T		CCDS12773.1	19q13.33	2008-02-05	2004-05-27						9470	protein-coding gene	gene with protein product		604429	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 2"""			9256434	Standard	NM_000951		Approved	PRGP2	uc002pon.3	O14669		ENST00000246794.5:c.602C>T	19.37:g.50093639C>T	ENSP00000246794:p.Pro201Leu		Somatic				PRRG2_uc010yaz.1_Missense_Mutation_p.P178L|PRR12_uc002poo.3_5'Flank	p.P201L	NM_000951	NP_000942	WXS	Illumina HiSeq	Unspecified	O14669	TMG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0121)	7	767	+		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.196)|Ovarian(192;0.231)	201			Cytoplasmic (Potential).		Q6IBF8	Missense_Mutation	SNP	ENST00000246794.5	37	c.602C>T	CCDS12773.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.941917	0.53079	.	.	ENSG00000126460	ENST00000246794;ENST00000543867	D	0.97209	-4.29	3.47	1.26	0.21427	.	0.396100	0.19374	U	0.115821	D	0.89357	0.6692	N	0.08118	0	0.09310	N	1	B;B	0.26809	0.16;0.099	B;B	0.21708	0.036;0.016	D	0.83379	0.0011	10	0.87932	D	0	-2.6829	4.1409	0.10193	0.2283:0.6478:0.0:0.1239	.	178;201	F5GZ13;O14669	.;TMG2_HUMAN	L	201;178	ENSP00000246794:P201L	ENSP00000246794:P201L	P	+	2	0	PRRG2	54785451	0.002000	0.14202	0.006000	0.13384	0.842000	0.47809	0.352000	0.20113	0.450000	0.26774	0.313000	0.20887	CCT		0.597	PRRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465257.1	NM_000951		43	186	0	0	0	0.01441	0	43	186				
ZNF677	342926	broad.mit.edu	37	19	53740556	53740556	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:53740556C>T	ENST00000598513.1	-	5	1574	c.1424G>A	c.(1423-1425)tGg>tAg	p.W475*	ZNF677_ENST00000333952.4_Nonsense_Mutation_p.W475*	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		CTGATGACCCCAAAGGTGTGA	0.363																																							uc002qbf.1		NA																	0				ovary(1)	1						c.(1423-1425)TGG>TAG		zinc finger protein 677							64.0	63.0	64.0					19																	53740556		2203	4300	6503	SO:0001587	stop_gained	342926				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53740556C>T	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1424G>A	19.37:g.53740556C>T	ENSP00000469391:p.Trp475*		Somatic				ZNF677_uc002qbg.1_Nonsense_Mutation_p.W475*	p.W475*	NM_182609	NP_872415	WXS	Illumina HiSeq	Unspecified	Q86XU0	ZN677_HUMAN		GBM - Glioblastoma multiforme(134;0.00352)	5	1609	-			475			C2H2-type 8.			Nonsense_Mutation	SNP	ENST00000598513.1	37	c.1424G>A	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075712	0.76415	.	.	ENSG00000197928	ENST00000333952	.	.	.	2.21	-3.15	0.05233	.	1.208770	0.06391	N	0.717166	.	.	.	.	.	.	0.58432	A	0.999999	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	5.6594	0.17660	0.653:0.2278:0.0:0.1192	.	.	.	.	X	475	.	ENSP00000334394:W475X	W	-	2	0	ZNF677	58432368	0.000000	0.05858	0.001000	0.08648	0.650000	0.38633	-2.499000	0.00968	-0.674000	0.05253	0.655000	0.94253	TGG		0.363	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609		15	66	0	0	0	0.004007	0	15	66				
PTPRH	5794	broad.mit.edu	37	19	55697831	55697831	+	Splice_Site	SNP	C	C	A	rs74901631		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr19:55697831C>A	ENST00000376350.3	-	15	2666		c.e15+1		PTPRH_ENST00000263434.5_Splice_Site	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H						apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CACGACCTTACGGGCATGAAG	0.587																																							uc002qjq.2		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.e15+1		protein tyrosine phosphatase, receptor type, H		C	,	0,4406		0,0,2203	77.0	77.0	77.0		,	5.4	0.8	19	dbSNP_131	77	2,8598	2.2+/-6.3	0,2,4298	no	splice-5,splice-5	PTPRH	NM_001161440.1,NM_002842.3	,	0,2,6501	AA,AC,CC		0.0233,0.0,0.0154	,	,	55697831	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	5794				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr19:55697831C>A		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.2643+1G>T	19.37:g.55697831C>A			Somatic				PTPRH_uc010esv.2_Splice_Site_p.P703_splice	p.P881_splice	NM_002842	NP_002833	WXS	Illumina HiSeq	Unspecified	Q9HD43	PTPRH_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)	15	2716	-		Renal(1328;0.245)						C9JCH2|Q15426|Q2NKN9|Q2NKP0	Splice_Site	SNP	ENST00000376350.3	37	c.2643_splice	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496724	0.85069	0.0	2.33E-4	ENSG00000080031	ENST00000376350;ENST00000263434	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2866	0.90115	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTPRH	60389643	1.000000	0.71417	0.752000	0.31206	0.887000	0.51463	6.955000	0.76007	2.696000	0.92011	0.650000	0.86243	.		0.587	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		Intron	26	80	1	0	5.45727e-16	0.008361	8.40865e-16	26	80				
OTOF	9381	broad.mit.edu	37	2	26686972	26686972	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:26686972G>T	ENST00000272371.2	-	40	5089	c.4963C>A	c.(4963-4965)Cag>Aag	p.Q1655K	OTOF_ENST00000403946.3_Missense_Mutation_p.Q1655K|OTOF_ENST00000402415.3_Missense_Mutation_p.Q965K|OTOF_ENST00000338581.6_Missense_Mutation_p.Q888K|OTOF_ENST00000339598.3_Missense_Mutation_p.Q888K	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1655					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCTTCCTCTGACCTGTGGGT	0.627																																					GBM(102;732 1451 20652 24062 31372)	GBM(102;732 1451 20652 24062 31372)	uc002rhk.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.(4963-4965)CAG>AAG		otoferlin isoform a							48.0	52.0	50.0					2																	26686972		2203	4298	6501	SO:0001583	missense	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26686972G>T	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4963C>A	2.37:g.26686972G>T	ENSP00000272371:p.Gln1655Lys		Somatic				OTOF_uc010yla.1_Missense_Mutation_p.Q385K|OTOF_uc002rhh.2_Missense_Mutation_p.Q888K|OTOF_uc002rhi.2_Missense_Mutation_p.Q965K|OTOF_uc002rhj.2_Missense_Mutation_p.Q888K	p.Q1655K	NM_194248	NP_919224	WXS	Illumina HiSeq	Unspecified	Q9HC10	OTOF_HUMAN			40	5090	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1655			Cytoplasmic (Potential).		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	c.4963C>A	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	G	8.937	0.964884	0.18583	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24	4.4	4.4	0.53042	.	0.069259	0.64402	D	0.000012	T	0.36358	0.0964	N	0.04880	-0.145	0.48762	D	0.999701	B;B;B;B	0.12630	0.004;0.0;0.006;0.0	B;B;B;B	0.17979	0.005;0.004;0.02;0.004	T	0.17837	-1.0356	10	0.15499	T	0.54	-32.3344	16.7839	0.85569	0.0:0.0:1.0:0.0	.	1655;888;965;888	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	K	888;888;965;1655;1655	ENSP00000345137:Q888K;ENSP00000344521:Q888K;ENSP00000383906:Q965K;ENSP00000272371:Q1655K;ENSP00000385255:Q1655K	ENSP00000272371:Q1655K	Q	-	1	0	OTOF	26540476	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	7.535000	0.82014	2.264000	0.75181	0.561000	0.74099	CAG		0.627	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			12	81	1	0	0.00316338	0.003163	0.00348664	12	81				
ALK	238	broad.mit.edu	37	2	29455179	29455179	+	Missense_Mutation	SNP	C	C	T	rs148001139		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:29455179C>T	ENST00000389048.3	-	15	3529	c.2623G>A	c.(2623-2625)Gga>Aga	p.G875R	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	875	Gly-rich.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CCTGCGGCTCCGGAATTGCCG	0.617			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														uc002rmy.2		NA	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	T|Mis|A	anaplastic lymphoma kinase (Ki-1)			"""L, E, M"""	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	neuroblastoma	ALCL|NSCLC|Neuroblastoma	NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	0				haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218						c.(2623-2625)GGA>AGA		anaplastic lymphoma kinase precursor	Adenosine triphosphate(DB00171)	C	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	101.0	95.0	97.0		2623	5.4	1.0	2	dbSNP_134	97	0,8600		0,0,4300	no	missense	ALK	NM_004304.4	125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	875/1621	29455179	1,13005	2203	4300	6503	SO:0001583	missense	238	Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr2:29455179C>T	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2623G>A	2.37:g.29455179C>T	ENSP00000373700:p.Gly875Arg		Somatic					p.G875R	NM_004304	NP_004295	WXS	Illumina HiSeq	Unspecified	Q9UM73	ALK_HUMAN			15	3530	-	Acute lymphoblastic leukemia(172;0.155)		875			Gly-rich.|Extracellular (Potential).		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	c.2623G>A	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515411	0.85389	2.27E-4	0.0	ENSG00000171094	ENST00000389048	T	0.61158	0.13	5.41	5.41	0.78517	.	0.000000	0.46758	D	0.000265	T	0.74419	0.3714	M	0.64260	1.97	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.73193	-0.4060	9	.	.	.	.	19.2048	0.93726	0.0:1.0:0.0:0.0	.	875	Q9UM73	ALK_HUMAN	R	875	ENSP00000373700:G875R	.	G	-	1	0	ALK	29308683	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.432000	0.66514	2.534000	0.85438	0.555000	0.69702	GGA		0.617	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304		34	123	0	0	0	0.004878	0	34	123				
ALK	238	broad.mit.edu	37	2	29606679	29606679	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:29606679G>A	ENST00000389048.3	-	5	2107	c.1201C>T	c.(1201-1203)Cga>Tga	p.R401*	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	401	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R401*(3)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	AGGGCCACTCGAAATGGGTTG	0.483			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														uc002rmy.2		NA	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	T|Mis|A	anaplastic lymphoma kinase (Ki-1)			"""L, E, M"""	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	neuroblastoma	ALCL|NSCLC|Neuroblastoma	NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	3	Substitution - Nonsense(3)	p.R401Q(1)|p.R401*(1)	large_intestine(2)|ovary(1)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218						c.(1201-1203)CGA>TGA		anaplastic lymphoma kinase precursor	Adenosine triphosphate(DB00171)						120.0	113.0	115.0					2																	29606679		2203	4300	6503	SO:0001587	stop_gained	238	Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr2:29606679G>A	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1201C>T	2.37:g.29606679G>A	ENSP00000373700:p.Arg401*		Somatic					p.R401*	NM_004304	NP_004295	WXS	Illumina HiSeq	Unspecified	Q9UM73	ALK_HUMAN			5	2108	-	Acute lymphoblastic leukemia(172;0.155)		401			MAM 1.|Extracellular (Potential).		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Nonsense_Mutation	SNP	ENST00000389048.3	37	c.1201C>T	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	G	46	12.444284	0.99668	.	.	ENSG00000171094	ENST00000389048	.	.	.	6.02	6.02	0.97574	.	0.000000	0.29980	N	0.010702	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6932	0.88275	0.0:0.0:1.0:0.0	.	.	.	.	X	401	.	.	R	-	1	2	ALK	29460183	1.000000	0.71417	0.998000	0.56505	0.459000	0.32528	4.361000	0.59461	2.857000	0.98124	0.650000	0.86243	CGA		0.483	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304		16	92	0	0	0	0.00499	0	16	92				
SRD5A2	6716	broad.mit.edu	37	2	31805946	31805946	+	RNA	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:31805946G>A	ENST00000405650.1	-	0	190							P31213	S5A2_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)						androgen biosynthetic process (GO:0006702)|androgen metabolic process (GO:0008209)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|male gonad development (GO:0008584)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|sterol 5-alpha reductase activity (GO:0009917)					Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)|Finasteride(DB01216)|Spironolactone(DB00421)	CCAGCACTGGGCTCTGCTGGC	0.682																																							uc002rnw.1		NA																	0					0						c.(22-24)AGC>AGT		3-oxo-5 alpha-steroid 4-dehydrogenase 2	Azelaic Acid(DB00548)|Dutasteride(DB01126)						20.0	23.0	22.0					2																	31805946		2022	4161	6183			6716				androgen biosynthetic process|cell differentiation|cell-cell signaling|male gonad development	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|sterol 5-alpha reductase activity	g.chr2:31805946G>A	M74047	CCDS74503.1	2p23.1	2013-01-31			ENSG00000049319	ENSG00000277893	1.3.99.5		11285	protein-coding gene	gene with protein product		607306				1522235	Standard	NM_000348		Approved		uc002rnw.1	P31213	OTTHUMG00000152057		2.37:g.31805946G>A			Somatic					p.S8S	NM_000348	NP_000339	WXS	Illumina HiSeq	Unspecified	P31213	S5A2_HUMAN			1	95	-	Acute lymphoblastic leukemia(172;0.155)		8			Helical; (Potential).		B2RE87|Q2M1R4|Q9BYE6	Silent	SNP	ENST00000405650.1	37	c.24C>T																																																																																					0.682	SRD5A2-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000325124.1	NM_000348		8	29	0	0	0	0.013537	0	8	29				
C2orf78	388960	broad.mit.edu	37	2	74043183	74043183	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:74043183A>T	ENST00000409561.1	+	3	1954	c.1833A>T	c.(1831-1833)caA>caT	p.Q611H		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	611	Lys-rich.									cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						AGAAAAATCAACCTGAGCTTA	0.448																																							uc002sjr.1		NA																	0				ovary(2)	2						c.(1831-1833)CAA>CAT		hypothetical protein LOC388960							86.0	83.0	84.0					2																	74043183		1857	4102	5959	SO:0001583	missense	388960							g.chr2:74043183A>T	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1833A>T	2.37:g.74043183A>T	ENSP00000387124:p.Gln611His		Somatic					p.Q611H	NM_001080474	NP_001073943	WXS	Illumina HiSeq	Unspecified	A6NCI8	CB078_HUMAN			3	1954	+			611			Lys-rich.			Missense_Mutation	SNP	ENST00000409561.1	37	c.1833A>T	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	A	0.032	-1.329014	0.01298	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	.	.	.	5.13	-4.02	0.04034	.	1.061350	0.07424	N	0.894460	T	0.23727	0.0574	L	0.41415	1.275	0.09310	N	1	B	0.19331	0.035	B	0.19391	0.025	T	0.29912	-0.9996	9	0.11182	T	0.66	-0.9301	1.0608	0.01600	0.3206:0.1439:0.3414:0.1941	.	611	A6NCI8	CB078_HUMAN	H	611;581	.	ENSP00000340692:Q581H	Q	+	3	2	C2orf78	73896691	0.002000	0.14202	0.001000	0.08648	0.034000	0.12701	-0.311000	0.08124	-0.293000	0.08986	0.460000	0.39030	CAA		0.448	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		9	49	0	0	0	0.006214	0	9	49				
POU3F3	5455	broad.mit.edu	37	2	105472206	105472206	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:105472206G>T	ENST00000361360.2	+	1	238	c.238G>T	c.(238-240)Ggg>Tgg	p.G80W	RP11-13J10.1_ENST00000598623.1_RNA|AC018730.1_ENST00000447876.1_RNA	NM_006236.1	NP_006227.1	P20264	PO3F3_HUMAN	POU class 3 homeobox 3	80	Gly-rich.				central nervous system development (GO:0007417)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain ventricular zone progenitor cell division (GO:0021869)|metanephric ascending thin limb development (GO:0072218)|metanephric DCT cell differentiation (GO:0072240)|metanephric loop of Henle development (GO:0072236)|metanephric macula densa development (GO:0072227)|metanephric thick ascending limb development (GO:0072233)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						CTTCATGCAGGGGGCCATGGC	0.761																																							uc010ywg.1		NA																	0				ovary(1)	1						c.(238-240)GGG>TGG		POU class 3 homeobox 3							8.0	11.0	10.0					2																	105472206		1495	3007	4502	SO:0001583	missense	5455				metanephric ascending thin limb development|metanephric DCT cell differentiation|metanephric macula densa development|metanephric thick ascending limb development|negative regulation of apoptosis|positive regulation of cell proliferation	nucleus	sequence-specific DNA binding	g.chr2:105472206G>T		CCDS33265.1	2q12.1	2011-06-20	2007-07-13		ENSG00000198914	ENSG00000198914		"""Homeoboxes / POU class"""	9216	protein-coding gene	gene with protein product		602480	"""POU domain class 3, transcription factor 3"""				Standard	NM_006236		Approved	BRN1, OTF8	uc010ywg.2	P20264	OTTHUMG00000153067	ENST00000361360.2:c.238G>T	2.37:g.105472206G>T	ENSP00000355001:p.Gly80Trp		Somatic					p.G80W	NM_006236	NP_006227	WXS	Illumina HiSeq	Unspecified	P20264	PO3F3_HUMAN			1	238	+			80			Gly-rich.		P78379|Q4ZG25	Missense_Mutation	SNP	ENST00000361360.2	37	c.238G>T	CCDS33265.1	.	.	.	.	.	.	.	.	.	.	g	8.862	0.947097	0.18356	.	.	ENSG00000198914	ENST00000361360	D	0.92446	-3.04	1.13	1.13	0.20643	.	0.089164	0.43579	U	0.000552	D	0.91865	0.7425	L	0.38175	1.15	0.48236	D	0.999619	D	0.89917	1.0	D	0.72982	0.979	D	0.90078	0.4168	10	0.87932	D	0	.	8.097	0.30835	0.0:0.0:1.0:0.0	.	80	P20264	PO3F3_HUMAN	W	80	ENSP00000355001:G80W	ENSP00000355001:G80W	G	+	1	0	POU3F3	104838638	1.000000	0.71417	1.000000	0.80357	0.000000	0.00434	3.668000	0.54554	0.678000	0.31325	0.000000	0.15137	GGG		0.761	POU3F3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329335.2			5	17	1	0	0.000157383	0.00308	0.000180037	5	17				
ACTR3	10096	broad.mit.edu	37	2	114685027	114685027	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:114685027C>G	ENST00000263238.2	+	4	651	c.331C>G	c.(331-333)Ctt>Gtt	p.L111V	ACTR3_ENST00000536059.1_Missense_Mutation_p.L49V|ACTR3_ENST00000535589.2_Missense_Mutation_p.L60V	NM_001277140.1|NM_005721.3	NP_001264069.1|NP_005712.1	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog (yeast)	111					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron differentiation (GO:0045666)|regulation of myosin II filament organization (GO:0043519)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|spindle localization (GO:0051653)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|hemidesmosome (GO:0030056)|lamellipodium (GO:0030027)|membrane (GO:0016020)|podosome (GO:0002102)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(2)	15						CCATTATTTTCTTTTGGTAAG	0.308																																							uc002tkx.1		NA																	0				skin(1)	1						c.(331-333)CTT>GTT		ARP3 actin-related protein 3 homolog							63.0	65.0	65.0					2																	114685027		2203	4297	6500	SO:0001583	missense	10096				cellular component movement|cilium morphogenesis	Arp2/3 protein complex	actin binding|ATP binding	g.chr2:114685027C>G	AF006083	CCDS33277.1, CCDS63000.1	2q14.1	2010-07-20	2001-11-28		ENSG00000115091	ENSG00000115091			170	protein-coding gene	gene with protein product		604222	"""ARP3 (actin-related protein 3, yeast) homolog"""			9230079	Standard	NM_005721		Approved	ARP3	uc002tkx.2	P61158	OTTHUMG00000153497	ENST00000263238.2:c.331C>G	2.37:g.114685027C>G	ENSP00000263238:p.Leu111Val		Somatic				ACTR3_uc010yyc.1_Missense_Mutation_p.L49V|ACTR3_uc010yyd.1_Missense_Mutation_p.L60V	p.L111V	NM_005721	NP_005712	WXS	Illumina HiSeq	Unspecified	P61158	ARP3_HUMAN			4	651	+			111					P32391|Q53QM2	Missense_Mutation	SNP	ENST00000263238.2	37	c.331C>G	CCDS33277.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996523	0.74818	.	.	ENSG00000115091	ENST00000263238;ENST00000536059;ENST00000535589	D;D;D	0.96491	-4.03;-4.03;-4.03	5.27	4.39	0.52855	Actin/actin-like conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98086	0.9369	M	0.89715	3.055	0.80722	D	1	P;D	0.67145	0.935;0.996	P;D	0.64144	0.599;0.922	D	0.98891	1.0773	10	0.87932	D	0	-13.3629	13.9172	0.63905	0.0:0.927:0.0:0.073	.	49;111	F5H3P5;P61158	.;ARP3_HUMAN	V	111;49;60	ENSP00000263238:L111V;ENSP00000445257:L49V;ENSP00000444987:L60V	ENSP00000263238:L111V	L	+	1	0	ACTR3	114401497	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.923000	0.70045	1.453000	0.47775	0.561000	0.74099	CTT		0.308	ACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331366.2	NM_005721		13	50	0	0	0	0.001855	0	13	50				
TTN	7273	broad.mit.edu	37	2	179439161	179439161	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:179439161G>A	ENST00000591111.1	-	276	66999	c.66775C>T	c.(66775-66777)Cgg>Tgg	p.R22259W	TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R21332W|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R14835W|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R14960W|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R15027W|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R23900W|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22259	Fibronectin type-III 61. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAATCACCCGGAACTCATAA	0.453																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(63994-63996)CGG>TGG		titin isoform N2-A							221.0	219.0	219.0					2																	179439161		1921	4127	6048	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179439161G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.66775C>T	2.37:g.179439161G>A	ENSP00000465570:p.Arg22259Trp		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R15027W|TTN_uc010zfi.1_Missense_Mutation_p.R14960W|TTN_uc010zfj.1_Missense_Mutation_p.R14835W	p.R21332W	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	64218	-			22259					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.63994C>T		.	.	.	.	.	.	.	.	.	.	G	11.35	1.613447	0.28712	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.53	5.53	0.82687	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85864	0.5796	H	0.98833	4.345	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91256	0.5033	9	0.87932	D	0	.	15.816	0.78599	0.0:0.0:0.8636:0.1364	.	14835;14960;15027;22259	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	W	21332;14835;15027;14960;14833	ENSP00000343764:R21332W;ENSP00000434586:R14835W;ENSP00000340554:R15027W;ENSP00000352154:R14960W	ENSP00000340554:R15027W	R	-	1	2	TTN	179147407	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.625000	0.74248	2.613000	0.88420	0.455000	0.32223	CGG		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		35	339	0	0	0	0.006999	0	35	339				
CCDC150	284992	broad.mit.edu	37	2	197597246	197597246	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:197597246C>T	ENST00000389175.4	+	28	3401	c.3266C>T	c.(3265-3267)cCc>cTc	p.P1089L	CCDC150_ENST00000272831.7_Missense_Mutation_p.P736L|CCDC150_ENST00000409270.1_Missense_Mutation_p.P576L	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	1089										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AATCTTAGGCCCATGCCCAAG	0.443																																							uc002utp.1		NA																	0					0						c.(3265-3267)CCC>CTC		coiled-coil domain containing 150							210.0	195.0	200.0					2																	197597246		1968	4161	6129	SO:0001583	missense	284992							g.chr2:197597246C>T		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.3266C>T	2.37:g.197597246C>T	ENSP00000373827:p.Pro1089Leu		Somatic				CCDC150_uc010zgs.1_Missense_Mutation_p.P736L	p.P1089L	NM_001080539	NP_001074008	WXS	Illumina HiSeq	Unspecified	Q8NCX0	CC150_HUMAN			28	3401	+			1089					Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	ENST00000389175.4	37	c.3266C>T	CCDS46478.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.096289	0.00364	.	.	ENSG00000144395	ENST00000272831;ENST00000389175;ENST00000409270	T	0.36878	1.23	5.16	-0.147	0.13428	.	1.156280	0.06539	N	0.742920	T	0.09818	0.0241	N	0.01048	-1.04	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.31586	-0.9938	10	0.05436	T	0.98	.	4.2903	0.10874	0.1558:0.2799:0.0:0.5643	.	736;1089	B4DZ03;Q8NCX0	.;CC150_HUMAN	L	736;1089;576	ENSP00000373827:P1089L	ENSP00000272831:P736L	P	+	2	0	CCDC150	197305491	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	0.410000	0.21098	0.118000	0.18165	-0.312000	0.09012	CCC		0.443	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539		34	160	0	0	0	0.010771	0	34	160				
ERBB4	2066	broad.mit.edu	37	2	212295790	212295790	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:212295790A>T	ENST00000342788.4	-	21	2833	c.2523T>A	c.(2521-2523)caT>caA	p.H841Q	ERBB4_ENST00000436443.1_Missense_Mutation_p.H841Q|ERBB4_ENST00000402597.1_Missense_Mutation_p.H831Q	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	841	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CCAAATCCCGATGAACGAGTC	0.398										TSP Lung(8;0.080)																													uc002veg.1		NA																	0				lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(2521-2523)CAT>CAA		v-erb-a erythroblastic leukemia viral oncogene							128.0	126.0	127.0					2																	212295790		2203	4300	6503	SO:0001583	missense	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212295790A>T	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2523T>A	2.37:g.212295790A>T	ENSP00000342235:p.His841Gln	TSP Lung(8;0.080)	Somatic				ERBB4_uc002veh.1_Missense_Mutation_p.H841Q|ERBB4_uc010zji.1_Missense_Mutation_p.H831Q|ERBB4_uc010zjj.1_Missense_Mutation_p.H831Q	p.H841Q	NM_005235	NP_005226	WXS	Illumina HiSeq	Unspecified	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	21	2621	-		Renal(323;0.06)|Lung NSC(271;0.197)	841			Protein kinase.|Cytoplasmic (Potential).		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	c.2523T>A	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	A	18.96	3.734726	0.69189	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	D;D;D	0.84516	-1.86;-1.86;-1.86	5.17	5.17	0.71159	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94853	0.8337	H	0.99058	4.415	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.94963	0.8110	10	0.87932	D	0	.	7.7255	0.28757	0.8347:0.0:0.1653:0.0	.	831;831;841;841	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	Q	841;841;831	ENSP00000342235:H841Q;ENSP00000403204:H841Q;ENSP00000385565:H831Q	ENSP00000342235:H841Q	H	-	3	2	ERBB4	212004035	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.829000	0.55760	2.056000	0.61249	0.533000	0.62120	CAT		0.398	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		10	127	0	0	0	0.001855	0	10	127				
SLC11A1	6556	broad.mit.edu	37	2	219259426	219259426	+	Missense_Mutation	SNP	A	A	G	rs139317500		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:219259426A>G	ENST00000233202.6	+	14	1800	c.1460A>G	c.(1459-1461)tAt>tGt	p.Y487C	SLC11A1_ENST00000539932.1_Missense_Mutation_p.Y369C	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	487					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGGTCAGCTATCTGCCCAGC	0.622																																							uc002vhv.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1459-1461)TAT>TGT		natural resistance-associated macrophage protein							128.0	119.0	122.0					2																	219259426		2203	4300	6503	SO:0001583	missense	6556				activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity	g.chr2:219259426A>G	D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.1460A>G	2.37:g.219259426A>G	ENSP00000233202:p.Tyr487Cys		Somatic				SLC11A1_uc010zkc.1_Missense_Mutation_p.Y420C|SLC11A1_uc002vhu.1_Missense_Mutation_p.Y282C|SLC11A1_uc002vhw.2_Missense_Mutation_p.Y369C|SLC11A1_uc010fvr.2_Missense_Mutation_p.Y282C	p.Y487C	NM_000578	NP_000569	WXS	Illumina HiSeq	Unspecified	P49279	NRAM1_HUMAN		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	14	1800	+		Renal(207;0.0474)	487			Helical; (Potential).		C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	37	c.1460A>G	CCDS2415.1	.	.	.	.	.	.	.	.	.	.	A	17.78	3.474105	0.63737	.	.	ENSG00000018280	ENST00000233202;ENST00000539932	T;T	0.22539	1.95;1.95	4.74	3.57	0.40892	.	0.188356	0.37219	N	0.002193	T	0.41282	0.1152	M	0.81802	2.56	0.42659	D	0.993478	D;D	0.63046	0.992;0.981	P;P	0.60886	0.88;0.827	T	0.35226	-0.9797	10	0.72032	D	0.01	-15.8964	8.8882	0.35416	0.6841:0.0:0.0:0.3159	.	369;487	C0H5Y3;P49279	.;NRAM1_HUMAN	C	487;369	ENSP00000233202:Y487C;ENSP00000443435:Y369C	ENSP00000233202:Y487C	Y	+	2	0	SLC11A1	218967670	0.992000	0.36948	0.998000	0.56505	0.811000	0.45836	3.258000	0.51507	0.836000	0.34901	-0.516000	0.04426	TAT		0.622	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578		28	135	0	0	0	0.012213	0	28	135				
MSL3P1	151507	broad.mit.edu	37	2	234775527	234775527	+	RNA	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr2:234775527C>A	ENST00000438684.1	-	0	587					NR_024322.1		P0C860	MS3L2_HUMAN	male-specific lethal 3 homolog (Drosophila) pseudogene 1						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											AGAGTAAAACCAACGGGAGAG	0.393																																							uc010znf.1		NA																	0					0						c.(313-315)TTG>TTT		SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;							186.0	146.0	158.0					2																	234775527		692	1591	2283			151507							g.chr2:234775527C>A	BI831020		2q37.1	2011-03-21	2011-03-21	2011-03-21	ENSG00000224287	ENSG00000224287			17837	pseudogene	pseudogene			"""male-specific lethal 3-like 2 (Drosophila)"""	MSL3L2			Standard	NR_024322		Approved		uc010znf.2	P0C860	OTTHUMG00000059126		2.37:g.234775527C>A			Somatic					p.L105F	NR_024322		WXS	Illumina HiSeq	Unspecified					2	553	-									Missense_Mutation	SNP	ENST00000438684.1	37	c.315G>T																																																																																					0.393	MSL3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000131002.2	NR_024322		7	47	1	0	7.48243e-07	0.006214	9.11167e-07	7	47				
CHGB	1114	broad.mit.edu	37	20	5897563	5897563	+	Missense_Mutation	SNP	C	C	T	rs143107119		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr20:5897563C>T	ENST00000378961.4	+	3	392	c.188C>T	c.(187-189)aCg>aTg	p.T63M	CHGB_ENST00000488832.1_3'UTR	NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	63						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						GTCCTGAAGACGAGTAAGTGT	0.547													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20957	0.0		0.0	False		,,,				2504	0.0						uc002wmg.2		NA																	0				breast(3)|skin(2)|ovary(1)	6						c.(187-189)ACG>ATG		chromogranin B precursor		C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	115.0	87.0	96.0		188	2.2	0.9	20	dbSNP_134	96	0,8600		0,0,4300	yes	missense	CHGB	NM_001819.2	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	63/678	5897563	1,13005	2203	4300	6503	SO:0001583	missense	1114					extracellular region	hormone activity	g.chr20:5897563C>T		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.188C>T	20.37:g.5897563C>T	ENSP00000368244:p.Thr63Met		Somatic				CHGB_uc010zqz.1_Intron	p.T63M	NM_001819	NP_001810	WXS	Illumina HiSeq	Unspecified	P05060	SCG1_HUMAN			3	494	+			63					A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	ENST00000378961.4	37	c.188C>T	CCDS13092.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885346	0.51908	2.27E-4	0.0	ENSG00000089199	ENST00000378961;ENST00000455042	T;T	0.01685	4.69;4.69	5.79	2.22	0.28083	.	0.359861	0.27572	N	0.018765	T	0.01254	0.0041	N	0.08118	0	0.29345	N	0.865749	P	0.43431	0.807	B	0.37943	0.261	T	0.44360	-0.9333	10	0.72032	D	0.01	-16.8672	12.8882	0.58055	0.6056:0.3944:0.0:0.0	.	63	P05060	SCG1_HUMAN	M	63;43	ENSP00000368244:T63M;ENSP00000416643:T43M	ENSP00000368244:T63M	T	+	2	0	CHGB	5845563	1.000000	0.71417	0.941000	0.38009	0.913000	0.54294	2.637000	0.46553	0.096000	0.17463	-0.256000	0.11100	ACG		0.547	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2	NM_001819		24	84	0	0	0	0.005443	0	24	84				
PAK7	57144	broad.mit.edu	37	20	9546720	9546720	+	Silent	SNP	C	C	T	rs200630536		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr20:9546720C>T	ENST00000378429.3	-	6	1848	c.1302G>A	c.(1300-1302)gcG>gcA	p.A434A	PAK7_ENST00000378423.1_Silent_p.A434A|PAK7_ENST00000353224.5_Silent_p.A434A	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	434	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			GCTGCAGGGCCGCCCGAAACT	0.632																																							uc002wnl.2		NA																	0				lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23						c.(1300-1302)GCG>GCA		p21-activated kinase 7							86.0	85.0	85.0					20																	9546720		2203	4300	6503	SO:0001819	synonymous_variant	57144						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr20:9546720C>T	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1302G>A	20.37:g.9546720C>T			Somatic				PAK7_uc002wnk.2_Silent_p.A434A|PAK7_uc002wnj.2_Silent_p.A434A|PAK7_uc010gby.1_Silent_p.A434A	p.A434A	NM_020341	NP_065074	WXS	Illumina HiSeq	Unspecified	Q9P286	PAK7_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		6	1847	-			434			Linker.		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	ENST00000378429.3	37	c.1302G>A	CCDS13107.1																																																																																				0.632	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1			26	87	0	0	0	0.00333	0	26	87				
PPP1R16B	26051	broad.mit.edu	37	20	37547102	37547102	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr20:37547102C>G	ENST00000299824.1	+	11	1686	c.1497C>G	c.(1495-1497)agC>agG	p.S499R	PPP1R16B_ENST00000373331.2_Missense_Mutation_p.S457R	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	499					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				CCTTCCTTAGCACACACCTGG	0.632																																							uc002xje.2		NA																	0				upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3						c.(1495-1497)AGC>AGG		protein phosphatase 1 regulatory inhibitor							58.0	50.0	53.0					20																	37547102		2203	4300	6503	SO:0001583	missense	26051				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding	g.chr20:37547102C>G	AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.1497C>G	20.37:g.37547102C>G	ENSP00000299824:p.Ser499Arg		Somatic				PPP1R16B_uc010ggc.2_Missense_Mutation_p.S457R	p.S499R	NM_015568	NP_056383	WXS	Illumina HiSeq	Unspecified	Q96T49	PP16B_HUMAN			11	1686	+		Myeloproliferative disorder(115;0.00878)	499					A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Missense_Mutation	SNP	ENST00000299824.1	37	c.1497C>G	CCDS13309.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.40|13.40	2.224574|2.224574	0.39300|0.39300	.|.	.|.	ENSG00000101445|ENSG00000101445	ENST00000438192|ENST00000299824;ENST00000373331	.|T;T	.|0.71103	.|-0.33;-0.54	5.35|5.35	4.41|4.41	0.53225|0.53225	.|.	.|0.188857	.|0.56097	.|D	.|0.000032	T|T	0.55178|0.55178	0.1904|0.1904	L|L	0.29908|0.29908	0.895|0.895	0.27829|0.27829	N|N	0.941505|0.941505	.|B;B	.|0.33857	.|0.282;0.429	.|B;B	.|0.33042	.|0.07;0.157	T|T	0.47736|0.47736	-0.9094|-0.9094	5|10	.|0.24483	.|T	.|0.36	.|.	9.6521|9.6521	0.39904|0.39904	0.0:0.8401:0.0:0.1599|0.0:0.8401:0.0:0.1599	.|.	.|457;499	.|E9PFS8;Q96T49	.|.;PP16B_HUMAN	G|R	400|499;457	.|ENSP00000299824:S499R;ENSP00000362428:S457R	.|ENSP00000299824:S499R	A|S	+|+	2|3	0|2	PPP1R16B|PPP1R16B	36980516|36980516	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	1.151000|1.151000	0.31651|0.31651	1.258000|1.258000	0.44101|0.44101	0.655000|0.655000	0.94253|0.94253	GCA|AGC		0.632	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079220.2	NM_015568		13	45	0	0	0	0.001855	0	13	45				
HELZ2	85441	broad.mit.edu	37	20	62191918	62191918	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr20:62191918C>A	ENST00000467148.1	-	16	7483	c.7414G>T	c.(7414-7416)Gtg>Ttg	p.V2472L	HELZ2_ENST00000427522.2_Missense_Mutation_p.V1903L	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2472	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TGGCCCTGCACGTGGCCAAAG	0.632																																							uc002yfm.2		NA																	0				central_nervous_system(2)	2						c.(7414-7416)GTG>TTG		PPAR-alpha interacting complex protein 285							128.0	123.0	124.0					20																	62191918		2203	4300	6503	SO:0001583	missense	85441				cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding	g.chr20:62191918C>A	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7414G>T	20.37:g.62191918C>A	ENSP00000417401:p.Val2472Leu		Somatic				PRIC285_uc002yfl.1_Missense_Mutation_p.V1903L	p.V2472L	NM_001037335	NP_001032412	WXS	Illumina HiSeq	Unspecified	Q9BYK8	PR285_HUMAN	Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)		17	8306	-	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		2472					Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	c.7414G>T	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	C	8.183	0.794208	0.16327	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.92699	-3.09;-3.09	4.12	-5.0	0.03001	ATPase, AAA+ type, core (1);	0.459602	0.20340	N	0.094259	D	0.87935	0.6303	M	0.67397	2.05	0.20975	N	0.999817	B;B	0.28178	0.202;0.168	B;B	0.33620	0.167;0.148	T	0.79354	-0.1838	10	0.59425	D	0.04	-11.7215	6.5301	0.22322	0.0:0.3512:0.2251:0.4237	.	2472;1903	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	L	1903;2472	ENSP00000393257:V1903L;ENSP00000417401:V2472L	ENSP00000393257:V1903L	V	-	1	0	RP4-697K14.7	61662362	0.000000	0.05858	0.004000	0.12327	0.063000	0.16089	-1.151000	0.03175	-0.755000	0.04709	-1.141000	0.01876	GTG		0.632	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335		23	103	1	0	1.33986e-20	0.004656	2.22329e-20	23	103				
ITPR1	3708	broad.mit.edu	37	3	4712560	4712560	+	Silent	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr3:4712560G>A	ENST00000443694.2	+	17	2109	c.2109G>A	c.(2107-2109)caG>caA	p.Q703Q	ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000357086.4_Silent_p.Q718Q|ITPR1_ENST00000423119.2_Silent_p.Q718Q|ITPR1_ENST00000302640.8_Silent_p.Q703Q|ITPR1_ENST00000354582.6_Silent_p.Q718Q|ITPR1_ENST00000456211.2_Silent_p.Q703Q			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	718					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	AATTGGCTCAGGATGCTAAAG	0.552																																							uc003bqa.2		NA																	0				lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21						c.(2152-2154)CAG>CAA		inositol 1,4,5-triphosphate receptor, type 1							75.0	77.0	77.0					3																	4712560		2034	4192	6226	SO:0001819	synonymous_variant	3708				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding	g.chr3:4712560G>A	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2109G>A	3.37:g.4712560G>A			Somatic				ITPR1_uc010hca.1_Silent_p.Q703Q|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Silent_p.Q703Q	p.Q718Q	NM_001099952	NP_001093422	WXS	Illumina HiSeq	Unspecified	Q14643	ITPR1_HUMAN		Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	20	2502	+			718			Cytoplasmic (Potential).		E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	ENST00000443694.2	37	c.2154G>A	CCDS54551.1																																																																																				0.552	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222		4	15	0	0	0	0.009096	0	4	15				
SCAP	22937	broad.mit.edu	37	3	47476594	47476594	+	Silent	SNP	T	T	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr3:47476594T>A	ENST00000265565.5	-	3	568	c.156A>T	c.(154-156)acA>acT	p.T52T	SCAP_ENST00000441517.2_5'UTR|SCAP_ENST00000545718.1_5'UTR	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	52					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CCACAGGTCCTGTTCCTGGCA	0.537																																					Pancreas(149;978 1908 29304 37806 46700)	Pancreas(149;978 1908 29304 37806 46700)	uc003crh.1		NA																	0				ovary(1)	1						c.(154-156)ACA>ACT		SREBF chaperone protein							95.0	90.0	91.0					3																	47476594		2203	4300	6503	SO:0001819	synonymous_variant	22937				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding	g.chr3:47476594T>A	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.156A>T	3.37:g.47476594T>A			Somatic				SCAP_uc011baz.1_5'UTR|SCAP_uc003crg.2_5'UTR	p.T52T	NM_012235	NP_036367	WXS	Illumina HiSeq	Unspecified	Q12770	SCAP_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)	3	411	-			52			Lumenal (By similarity).		Q8N2E0|Q8WUA1	Silent	SNP	ENST00000265565.5	37	c.156A>T	CCDS2755.2																																																																																				0.537	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235		19	63	0	0	0	0.010504	0	19	63				
TMEM89	440955	broad.mit.edu	37	3	48659116	48659116	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr3:48659116C>A	ENST00000330862.3	-	1	172	c.74G>T	c.(73-75)aGa>aTa	p.R25I		NM_001008269.1	NP_001008270.1	A2RUT3	TMM89_HUMAN	transmembrane protein 89	25						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|lung(1)|stomach(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		CCAGAGGGGTCTCGACCAGGC	0.662																																							uc011bbo.1		NA																	0					0						c.(73-75)AGA>ATA		transmembrane protein 89 precursor							42.0	41.0	41.0					3																	48659116		2203	4300	6503	SO:0001583	missense	440955					integral to membrane		g.chr3:48659116C>A	AX657016	CCDS33751.1	3p21.31	2005-11-02			ENSG00000183396	ENSG00000183396			32372	protein-coding gene	gene with protein product							Standard	NM_001008269		Approved		uc011bbo.2	A2RUT3	OTTHUMG00000156647	ENST00000330862.3:c.74G>T	3.37:g.48659116C>A	ENSP00000329557:p.Arg25Ile		Somatic					p.R25I	NM_001008269	NP_001008270	WXS	Illumina HiSeq	Unspecified	A2RUT3	TMM89_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)	1	74	-			25			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000330862.3	37	c.74G>T	CCDS33751.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.168702	0.57584	.	.	ENSG00000183396	ENST00000330862	T	0.57752	0.38	4.94	4.94	0.65067	.	0.000000	0.43919	D	0.000504	T	0.65428	0.2690	L	0.47190	1.495	0.47778	D	0.999514	D	0.89917	1.0	D	0.91635	0.999	T	0.67550	-0.5642	10	0.87932	D	0	-52.8443	13.5254	0.61593	0.0:1.0:0.0:0.0	.	25	A2RUT3	TMM89_HUMAN	I	25	ENSP00000329557:R25I	ENSP00000329557:R25I	R	-	2	0	TMEM89	48634120	0.987000	0.35691	0.926000	0.36857	0.227000	0.25037	3.280000	0.51677	2.562000	0.86427	0.462000	0.41574	AGA		0.662	TMEM89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345046.1	NM_001008269		18	55	1	0	8.10497e-08	0.010504	1.03716e-07	18	55				
FAM3D	131177	broad.mit.edu	37	3	58639474	58639474	+	Silent	SNP	T	T	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr3:58639474T>A	ENST00000358781.2	-	3	358	c.48A>T	c.(46-48)atA>atT	p.I16I		NM_138805.2	NP_620160.1	Q96BQ1	FAM3D_HUMAN	family with sequence similarity 3, member D	16					negative regulation of insulin secretion (GO:0046676)	extracellular region (GO:0005576)	cytokine activity (GO:0005125)			large_intestine(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(55;0.000225)|Kidney(10;0.000667)|KIRC - Kidney renal clear cell carcinoma(10;0.000802)|OV - Ovarian serous cystadenocarcinoma(275;0.169)		ATGTCGTGACTATGGCAAAGA	0.567																																							uc003dkq.2		NA																	0					0						c.(46-48)ATA>ATT		family with sequence similarity 3, member D							119.0	113.0	115.0					3																	58639474		2203	4300	6503	SO:0001819	synonymous_variant	131177				negative regulation of insulin secretion	extracellular region	cytokine activity	g.chr3:58639474T>A	AF494381	CCDS2893.1	3p21.1	2008-07-18			ENSG00000198643	ENSG00000198643			18665	protein-coding gene	gene with protein product		608619				12160727	Standard	NM_138805		Approved	EF7, OIT1	uc003dkq.3	Q96BQ1	OTTHUMG00000159148	ENST00000358781.2:c.48A>T	3.37:g.58639474T>A			Somatic					p.I16I	NM_138805	NP_620160	WXS	Illumina HiSeq	Unspecified	Q96BQ1	FAM3D_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000225)|Kidney(10;0.000667)|KIRC - Kidney renal clear cell carcinoma(10;0.000802)|OV - Ovarian serous cystadenocarcinoma(275;0.169)	3	345	-			16					Q547G2	Silent	SNP	ENST00000358781.2	37	c.48A>T	CCDS2893.1																																																																																				0.567	FAM3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353494.1	NM_138805		27	102	0	0	0	0.005443	0	27	102				
ROBO2	6092	broad.mit.edu	37	3	77651370	77651370	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr3:77651370C>A	ENST00000461745.1	+	20	3764	c.2864C>A	c.(2863-2865)cCa>cAa	p.P955Q	ROBO2_ENST00000332191.8_Missense_Mutation_p.P955Q|ROBO2_ENST00000487694.3_Missense_Mutation_p.P971Q	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	955					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GATGTGCTGCCACCAGTTCCA	0.438																																							uc003dpy.3		NA																	0				lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(2863-2865)CCA>CAA		roundabout, axon guidance receptor, homolog 2							97.0	96.0	96.0					3																	77651370		1990	4163	6153	SO:0001583	missense	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77651370C>A	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2864C>A	3.37:g.77651370C>A	ENSP00000417164:p.Pro955Gln		Somatic				ROBO2_uc003dpz.2_Missense_Mutation_p.P959Q|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.P959Q|ROBO2_uc003dqa.2_Missense_Mutation_p.P82Q	p.P955Q	NM_002942	NP_002933	WXS	Illumina HiSeq	Unspecified	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	20	3507	+			955			Cytoplasmic (Potential).		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	c.2864C>A	CCDS43109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.00|19.00	3.741059|3.741059	0.69304|0.69304	.|.	.|.	ENSG00000185008|ENSG00000185008	ENST00000490991|ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	.|T;T;T	.|0.61040	.|0.14;0.18;0.17	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	.|0.000000	.|0.45606	.|D	.|0.000345	T|T	0.44329|0.44329	0.1288|0.1288	N|N	0.14661|0.14661	0.345|0.345	.|.	.|.	.|.	.|P;P;P	.|0.46706	.|0.883;0.7;0.565	.|B;B;B	.|0.40825	.|0.341;0.263;0.135	T|T	0.42999|0.42999	-0.9418|-0.9418	4|9	.|0.24483	.|T	.|0.36	.|.	20.1236|20.1236	0.97970|0.97970	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|971;955;955	.|Q19AB5;F8W703;Q9HCK4	.|.;.;ROBO2_HUMAN	N|Q	112|971;971;975;955;955	.|ENSP00000417335:P971Q;ENSP00000417164:P955Q;ENSP00000327536:P955Q	.|ENSP00000327536:P955Q	H|P	+|+	1|2	0|0	ROBO2|ROBO2	77734060|77734060	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.677000|5.677000	0.68142|0.68142	2.765000|2.765000	0.95021|0.95021	0.555000|0.555000	0.69702|0.69702	CAC|CCA		0.438	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		14	80	1	0	6.94344e-10	0.006122	9.36125e-10	14	80				
FBXO40	51725	broad.mit.edu	37	3	121341659	121341659	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr3:121341659C>A	ENST00000338040.4	+	3	1797	c.1383C>A	c.(1381-1383)agC>agA	p.S461R		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	461					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		AGCTCCACAGCGAGTGTGTGA	0.527																																							uc003eeg.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(1381-1383)AGC>AGA		F-box protein 40							81.0	78.0	79.0					3																	121341659		2203	4300	6503	SO:0001583	missense	51725				muscle cell differentiation	centrosome|nucleus	ubiquitin-protein ligase activity|zinc ion binding	g.chr3:121341659C>A	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.1383C>A	3.37:g.121341659C>A	ENSP00000337510:p.Ser461Arg		Somatic					p.S461R	NM_016298	NP_057382	WXS	Illumina HiSeq	Unspecified	Q9UH90	FBX40_HUMAN		GBM - Glioblastoma multiforme(114;0.189)	3	1593	+			461					B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	c.1383C>A	CCDS33835.1	.	.	.	.	.	.	.	.	.	.	C	9.849	1.193163	0.22037	.	.	ENSG00000163833	ENST00000338040	T	0.55760	0.5	5.97	-7.62	0.01294	.	0.138081	0.64402	D	0.000004	T	0.50803	0.1637	L	0.34521	1.04	0.27645	N	0.947578	D	0.71674	0.998	D	0.69142	0.962	T	0.58775	-0.7577	10	0.51188	T	0.08	-15.7596	11.8921	0.52635	0.0:0.5205:0.1009:0.3786	.	461	Q9UH90	FBX40_HUMAN	R	461	ENSP00000337510:S461R	ENSP00000337510:S461R	S	+	3	2	FBXO40	122824349	0.043000	0.20138	0.786000	0.31890	0.453000	0.32348	-0.869000	0.04232	-1.466000	0.01897	-3.170000	0.00057	AGC		0.527	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298		9	33	1	0	3.09899e-07	0.004482	3.83563e-07	9	33				
ACKR4	51554	broad.mit.edu	37	3	132320031	132320031	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr3:132320031G>T	ENST00000249887.2	+	2	886	c.790G>T	c.(790-792)Gcc>Tcc	p.A264S	ACAD11_ENST00000355458.3_Intron|ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000264990.6_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	264					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)										GTTCTGCCGAGCCATAGACAT	0.448																																						Pancreas(96;1505 1524 4501 17831 18121)	uc003eow.2		NA																	0					0						c.(790-792)GCC>TCC		chemokine (C-C motif) receptor-like 1							45.0	43.0	44.0					3																	132320031		2200	4275	6475	SO:0001583	missense	51554				chemotaxis|immune response	integral to plasma membrane	C-C chemokine receptor activity	g.chr3:132320031G>T	AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.790G>T	3.37:g.132320031G>T	ENSP00000249887:p.Ala264Ser		Somatic				ACAD11_uc003eov.3_Intron|ACAD11_uc011blr.1_Intron|CCRL1_uc003eox.2_Missense_Mutation_p.A264S	p.A264S	NM_016557	NP_057641	WXS	Illumina HiSeq	Unspecified	Q9NPB9	CCRL1_HUMAN			2	873	+			264			Extracellular (Potential).		B2R9U7	Missense_Mutation	SNP	ENST00000249887.2	37	c.790G>T	CCDS3075.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539722	0.65085	.	.	ENSG00000129048	ENST00000249887	T	0.38077	1.16	5.42	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.052627	0.85682	D	0.000000	T	0.34658	0.0905	L	0.39147	1.195	0.43890	D	0.996516	P	0.49783	0.928	P	0.44477	0.451	T	0.15723	-1.0427	10	0.56958	D	0.05	.	14.1042	0.65078	0.0724:0.0:0.9276:0.0	.	264	Q9NPB9	CCRL1_HUMAN	S	264	ENSP00000249887:A264S	ENSP00000249887:A264S	A	+	1	0	CCRL1	133802721	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	6.103000	0.71492	1.310000	0.45006	-0.136000	0.14681	GCC		0.448	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357238.2	NM_016557		20	155	1	0	1.13719e-10	0.008361	1.57537e-10	20	155				
BCHE	590	broad.mit.edu	37	3	165548821	165548821	+	Start_Codon_SNP	SNP	T	T	G			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr3:165548821T>G	ENST00000264381.3	-	2	167	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	1					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	TTGCTATGCATATTGATTTCT	0.308																																							uc003fem.3		NA																	0				ovary(3)|pancreas(1)	4						c.(1-3)ATG>CTG		butyrylcholinesterase precursor	Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)						25.0	24.0	24.0					3																	165548821		2202	4292	6494	SO:0001582	initiator_codon_variant	590				choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding	g.chr3:165548821T>G	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1A>C	3.37:g.165548821T>G	ENSP00000264381:p.Met1Leu		Somatic				BCHE_uc003fen.3_Intron	p.M1L	NM_000055	NP_000046	WXS	Illumina HiSeq	Unspecified	P06276	CHLE_HUMAN			2	161	-			1					A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	37	c.1A>C	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	T	11.39	1.624859	0.28889	.	.	ENSG00000114200	ENST00000264381	T	0.62941	-0.01	5.68	4.5	0.54988	.	0.384170	0.29722	N	0.011362	T	0.51702	0.1690	.	.	.	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.48647	-0.9017	9	0.56958	D	0.05	.	8.3059	0.32042	0.0:0.0714:0.1338:0.7948	.	1	P06276	CHLE_HUMAN	L	1	ENSP00000264381:M1L	ENSP00000264381:M1L	M	-	1	0	BCHE	167031515	0.428000	0.25522	0.825000	0.32803	0.307000	0.27823	1.069000	0.30641	0.952000	0.37798	0.460000	0.39030	ATG		0.308	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		Missense_Mutation	5	25	0	0	0	0.000602	0	5	25				
ATP11B	23200	broad.mit.edu	37	3	182584182	182584182	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr3:182584182T>C	ENST00000323116.5	+	14	1830	c.1570T>C	c.(1570-1572)Tac>Cac	p.Y524H		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	524					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			GCAGTTGGAGTACTATGCATC	0.433																																							uc003flb.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1570-1572)TAC>CAC		ATPase, class VI, type 11B							103.0	98.0	99.0					3																	182584182		2203	4300	6503	SO:0001583	missense	23200				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr3:182584182T>C	AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.1570T>C	3.37:g.182584182T>C	ENSP00000321195:p.Tyr524His		Somatic				ATP11B_uc003flc.2_Missense_Mutation_p.Y108H	p.Y524H	NM_014616	NP_055431	WXS	Illumina HiSeq	Unspecified	Q9Y2G3	AT11B_HUMAN	all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)		14	1827	+	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		524			Cytoplasmic (Potential).		Q96FN1|Q9UKK7	Missense_Mutation	SNP	ENST00000323116.5	37	c.1570T>C	CCDS33896.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171221	0.78452	.	.	ENSG00000058063	ENST00000323116	D	0.84800	-1.9	5.28	5.28	0.74379	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.94833	0.8331	H	0.96398	3.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96431	0.9319	10	0.87932	D	0	.	15.5028	0.75713	0.0:0.0:0.0:1.0	.	98;524	B3KSJ2;Q9Y2G3	.;AT11B_HUMAN	H	524	ENSP00000321195:Y524H	ENSP00000321195:Y524H	Y	+	1	0	ATP11B	184066876	1.000000	0.71417	0.998000	0.56505	0.681000	0.39784	7.655000	0.83696	2.109000	0.64355	0.477000	0.44152	TAC		0.433	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350598.1	NM_014616		11	127	0	0	0	0.013537	0	11	127				
WDFY3	23001	broad.mit.edu	37	4	85748131	85748131	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr4:85748131C>A	ENST00000295888.4	-	10	1367	c.960G>T	c.(958-960)ttG>ttT	p.L320F	WDFY3_ENST00000322366.6_Missense_Mutation_p.L320F	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	320					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TTGCTTGTTCCAATCTAGAAA	0.313																																							uc003hpd.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(958-960)TTG>TTT		WD repeat and FYVE domain containing 3 isoform							97.0	91.0	93.0					4																	85748131		2203	4300	6503	SO:0001583	missense	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85748131C>A	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.960G>T	4.37:g.85748131C>A	ENSP00000295888:p.Leu320Phe		Somatic				WDFY3_uc003hpf.2_Missense_Mutation_p.L320F	p.L320F	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	10	1368	-		Hepatocellular(203;0.114)	320					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	c.960G>T	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	7.919	0.738208	0.15574	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.22945	1.93;1.93	5.41	3.65	0.41850	.	0.138996	0.45867	D	0.000321	T	0.32102	0.0818	L	0.35723	1.085	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.68765	0.96;0.916	T	0.02275	-1.1184	10	0.36615	T	0.2	.	5.6242	0.17473	0.0:0.6727:0.0:0.3273	.	320;320	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	F	320	ENSP00000318466:L320F;ENSP00000295888:L320F	ENSP00000295888:L320F	L	-	3	2	WDFY3	85967155	1.000000	0.71417	1.000000	0.80357	0.558000	0.35554	2.594000	0.46189	2.532000	0.85374	0.563000	0.77884	TTG		0.313	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		17	86	1	0	4.96729e-08	0.008871	6.46604e-08	17	86				
SH3D19	152503	broad.mit.edu	37	4	152048799	152048799	+	Missense_Mutation	SNP	C	C	A	rs146787893		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr4:152048799C>A	ENST00000409252.2	-	19	2934	c.2227G>T	c.(2227-2229)Ggg>Tgg	p.G743W	SH3D19_ENST00000514152.1_Missense_Mutation_p.G720W|SH3D19_ENST00000424281.1_Missense_Mutation_p.G684W|SH3D19_ENST00000455740.1_Missense_Mutation_p.G720W|SH3D19_ENST00000427414.2_Missense_Mutation_p.G684W|SH3D19_ENST00000304527.4_Missense_Mutation_p.G743W|SH3D19_ENST00000409598.4_Missense_Mutation_p.G720W			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	743	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TCATTCTCCCCTCGGAAATCA	0.363																																							uc010ipl.1		NA																	0				ovary(1)|skin(1)	2						c.(2227-2229)GGG>TGG		SH3 domain containing 19 isoform a							93.0	85.0	88.0					4																	152048799		2203	4300	6503	SO:0001583	missense	152503				cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding	g.chr4:152048799C>A	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.2227G>T	4.37:g.152048799C>A	ENSP00000386848:p.Gly743Trp		Somatic				SH3D19_uc003imb.2_Missense_Mutation_p.G498W|SH3D19_uc003imc.2_Missense_Mutation_p.G684W|SH3D19_uc003ime.2_Missense_Mutation_p.G720W|SH3D19_uc010ipm.2_Missense_Mutation_p.G720W	p.G743W	NM_001009555	NP_001009555	WXS	Illumina HiSeq	Unspecified	Q5HYK7	SH319_HUMAN			20	3317	-	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)	743			SH3 5.		B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	37	c.2227G>T	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095022	0.76870	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.84	5.84	0.93424	Src homology-3 domain (5);	0.105878	0.41712	D	0.000839	T	0.78052	0.4223	M	0.92923	3.36	0.48571	D	0.999678	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.91635	0.998;0.985;0.994;0.999	T	0.82573	-0.0390	10	0.87932	D	0	-14.4824	20.1392	0.98050	0.0:1.0:0.0:0.0	.	743;720;684;498	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	W	720;743;720;684;684;743;720	ENSP00000387030:G720W;ENSP00000302913:G743W;ENSP00000416708:G720W;ENSP00000404542:G684W;ENSP00000415694:G684W;ENSP00000386848:G743W;ENSP00000423449:G720W	ENSP00000302913:G743W	G	-	1	0	SH3D19	152268249	0.997000	0.39634	0.963000	0.40424	0.887000	0.51463	3.234000	0.51320	2.751000	0.94390	0.591000	0.81541	GGG		0.363	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555		7	41	1	0	1.08611e-07	0.010729	1.37817e-07	7	41				
TRIML1	339976	broad.mit.edu	37	4	189068081	189068081	+	Missense_Mutation	SNP	C	C	T	rs546391133		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr4:189068081C>T	ENST00000332517.3	+	6	1102	c.962C>T	c.(961-963)cCg>cTg	p.P321L	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	321	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P321Q(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		CCCGACAACCCGGAAAGATTT	0.537													c|||	1	0.000199681	0.0	0.0	5008	,	,		17372	0.001		0.0	False		,,,				2504	0.0				Melanoma(31;213 1036 16579 23968 32372)	Melanoma(31;213 1036 16579 23968 32372)	uc003izm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|breast(1)|skin(1)	4						c.(961-963)CCG>CTG		tripartite motif family-like 1							110.0	104.0	106.0					4																	189068081		2203	4300	6503	SO:0001583	missense	339976				multicellular organismal development		ligase activity|zinc ion binding	g.chr4:189068081C>T	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.962C>T	4.37:g.189068081C>T	ENSP00000327738:p.Pro321Leu		Somatic				TRIML1_uc003izn.1_Missense_Mutation_p.P45L	p.P321L	NM_178556	NP_848651	WXS	Illumina HiSeq	Unspecified	Q8N9V2	TRIML_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)	6	1077	+		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)	321			B30.2/SPRY.		Q96BE5	Missense_Mutation	SNP	ENST00000332517.3	37	c.962C>T	CCDS3851.1	.	.	.	.	.	.	.	.	.	.	c	22.5	4.304315	0.81136	.	.	ENSG00000184108	ENST00000332517	T	0.24151	1.87	4.92	4.92	0.64577	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.000000	0.52532	D	0.000065	T	0.52837	0.1759	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.50499	-0.8821	10	0.38643	T	0.18	-18.9823	16.0461	0.80722	0.0:1.0:0.0:0.0	.	321	Q8N9V2	TRIML_HUMAN	L	321	ENSP00000327738:P321L	ENSP00000327738:P321L	P	+	2	0	TRIML1	189305075	0.998000	0.40836	0.968000	0.41197	0.659000	0.38960	4.692000	0.61746	2.749000	0.94314	0.550000	0.68814	CCG		0.537	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556		31	80	0	0	0	0.013726	0	31	80				
CCDC127	133957	broad.mit.edu	37	5	205868	205868	+	Missense_Mutation	SNP	C	C	A	rs147467162		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr5:205868C>A	ENST00000296824.3	-	3	459	c.327G>T	c.(325-327)caG>caT	p.Q109H		NM_145265.2	NP_660308.1	Q96BQ5	CC127_HUMAN	coiled-coil domain containing 127	109										breast(1)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12			all cancers(22;0.0236)|Lung(60;0.113)			ACTTGCGTCCCTGAGAGATAA	0.478																																							uc003jam.1		NA																	0					0						c.(325-327)CAG>CAT		coiled-coil domain containing 127							98.0	100.0	99.0					5																	205868		2203	4300	6503	SO:0001583	missense	133957							g.chr5:205868C>A	AK098567	CCDS3852.1	5p15.33	2008-02-05			ENSG00000164366	ENSG00000164366			30520	protein-coding gene	gene with protein product						12477932	Standard	NM_145265		Approved	FLJ25701	uc003jam.1	Q96BQ5	OTTHUMG00000161586	ENST00000296824.3:c.327G>T	5.37:g.205868C>A	ENSP00000296824:p.Gln109His		Somatic					p.Q109H	NM_145265	NP_660308	WXS	Illumina HiSeq	Unspecified	Q96BQ5	CC127_HUMAN	all cancers(22;0.0236)|Lung(60;0.113)		3	427	-			109			Potential.			Missense_Mutation	SNP	ENST00000296824.3	37	c.327G>T	CCDS3852.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.759355	0.31137	.	.	ENSG00000164366	ENST00000296824	T	0.48201	0.82	5.77	4.91	0.64330	.	0.050416	0.85682	D	0.000000	T	0.44371	0.1290	L	0.56396	1.775	0.41125	D	0.985846	P	0.39759	0.687	B	0.37833	0.259	T	0.42865	-0.9426	10	0.40728	T	0.16	-26.995	12.4017	0.55416	0.0:0.919:0.0:0.081	.	109	Q96BQ5	CC127_HUMAN	H	109	ENSP00000296824:Q109H	ENSP00000296824:Q109H	Q	-	3	2	CCDC127	258868	0.999000	0.42202	1.000000	0.80357	0.956000	0.61745	1.663000	0.37429	1.445000	0.47624	0.561000	0.74099	CAG		0.478	CCDC127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365459.2	NM_145265		15	41	1	0	2.23348e-06	0.004007	2.63481e-06	15	41				
WDR36	134430	broad.mit.edu	37	5	110441783	110441783	+	Missense_Mutation	SNP	G	G	A	rs145743089	byFrequency	TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr5:110441783G>A	ENST00000513710.2	+	11	1293	c.1289G>A	c.(1288-1290)cGt>cAt	p.R430H	WDR36_ENST00000505303.1_Missense_Mutation_p.R374H|WDR36_ENST00000506538.2_Missense_Mutation_p.R430H			Q8NI36	WDR36_HUMAN	WD repeat domain 36	430					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		AGAGTTAAACGTAAAGGACTT	0.353																																							uc003kpd.2		NA																	0				ovary(1)|skin(1)	2						c.(1288-1290)CGT>CAT		WD repeat domain 36		G	HIS/ARG	0,4404		0,0,2202	97.0	101.0	100.0		1289	5.7	1.0	5	dbSNP_134	100	1,8599	1.2+/-3.3	0,1,4299	yes	missense	WDR36	NM_139281.2	29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	430/952	110441783	1,13003	2202	4300	6502	SO:0001583	missense	134430				response to stimulus|rRNA processing|visual perception	small-subunit processome		g.chr5:110441783G>A	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.1289G>A	5.37:g.110441783G>A	ENSP00000424628:p.Arg430His		Somatic				WDR36_uc010jbu.2_RNA	p.R430H	NM_139281	NP_644810	WXS	Illumina HiSeq	Unspecified	Q8NI36	WDR36_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)	11	1406	+		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)	430					A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	37	c.1289G>A	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218083	0.79352	0.0	1.16E-4	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	T;T;T	0.68025	-0.3;-0.3;0.25	5.73	5.73	0.89815	Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.144126	0.56097	D	0.000026	T	0.75191	0.3816	M	0.79805	2.47	0.36567	D	0.872742	D	0.69078	0.997	P	0.51453	0.67	T	0.83088	-0.0134	10	0.87932	D	0	-16.9817	12.4358	0.55598	0.0795:0.0:0.9205:0.0	.	430	Q8NI36	WDR36_HUMAN	H	430;430;374	ENSP00000423067:R430H;ENSP00000424628:R430H;ENSP00000422158:R374H	ENSP00000422158:R374H	R	+	2	0	WDR36	110469682	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.343000	0.44001	2.698000	0.92095	0.655000	0.94253	CGT		0.353	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281		6	110	0	0	0	0.001984	0	6	110				
SNCAIP	9627	broad.mit.edu	37	5	121786347	121786347	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr5:121786347C>A	ENST00000261368.8	+	10	2067	c.1805C>A	c.(1804-1806)tCa>tAa	p.S602*	SNCAIP_ENST00000503116.2_3'UTR|CTC-210G5.1_ENST00000510972.1_RNA|CTC-210G5.1_ENST00000509993.1_RNA|SNCAIP_ENST00000261367.7_Nonsense_Mutation_p.S649*|CTC-210G5.1_ENST00000505546.1_RNA|CTC-210G5.1_ENST00000503529.1_RNA|SNCAIP_ENST00000379536.2_Nonsense_Mutation_p.S542*|SNCAIP_ENST00000379533.2_Nonsense_Mutation_p.S649*|SNCAIP_ENST00000504884.2_3'UTR|SNCAIP_ENST00000414317.2_Nonsense_Mutation_p.S204*|SNCAIP_ENST00000542191.1_Nonsense_Mutation_p.S160*|CTC-210G5.1_ENST00000506053.1_RNA|SNCAIP_ENST00000379538.3_Nonsense_Mutation_p.S236*	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	602					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GGAAGCCTGTCAGCCTCCAGC	0.473																																							uc003ksw.1		NA																	0				ovary(1)|pancreas(1)	2						c.(1804-1806)TCA>TAA		synuclein alpha interacting protein							68.0	80.0	76.0					5																	121786347		2202	4300	6502	SO:0001587	stop_gained	9627				cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding	g.chr5:121786347C>A	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1805C>A	5.37:g.121786347C>A	ENSP00000261368:p.Ser602*		Somatic				SNCAIP_uc011cwl.1_Nonsense_Mutation_p.S160*|SNCAIP_uc003ksx.1_Nonsense_Mutation_p.S649*|SNCAIP_uc003ksy.1_Nonsense_Mutation_p.S236*|SNCAIP_uc003ksz.1_Nonsense_Mutation_p.S236*|SNCAIP_uc010jcu.2_Nonsense_Mutation_p.S198*|SNCAIP_uc011cwm.1_Nonsense_Mutation_p.S236*|SNCAIP_uc003kta.1_Nonsense_Mutation_p.S234*|SNCAIP_uc010jcv.1_RNA|SNCAIP_uc010jcw.1_Nonsense_Mutation_p.S296*|SNCAIP_uc010jcx.1_Nonsense_Mutation_p.S542*|uc003ktb.1_RNA|SNCAIP_uc003ktc.1_Nonsense_Mutation_p.S118*	p.S602*	NM_005460	NP_005451	WXS	Illumina HiSeq	Unspecified	Q9Y6H5	SNCAP_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)	10	2011	+		all_cancers(142;0.00787)|Prostate(80;0.0327)	602					D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Nonsense_Mutation	SNP	ENST00000261368.8	37	c.1805C>A	CCDS4131.1	.	.	.	.	.	.	.	.	.	.	C	38	6.813547	0.97857	.	.	ENSG00000064692	ENST00000542191;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000379538;ENST00000261367;ENST00000414317;ENST00000447854	.	.	.	5.97	5.97	0.96955	.	0.416593	0.25912	N	0.027492	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.3152	16.1294	0.81414	0.0:0.8305:0.1695:0.0	.	.	.	.	X	160;542;602;649;542;236;649;204;242	.	ENSP00000261367:S649X	S	+	2	0	SNCAIP	121814246	0.054000	0.20591	0.916000	0.36221	0.741000	0.42261	2.548000	0.45794	2.831000	0.97527	0.655000	0.94253	TCA		0.473	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1			21	61	1	0	3.51602e-12	0.008871	5.10499e-12	21	61				
PCDHB7	56129	broad.mit.edu	37	5	140553136	140553136	+	Silent	SNP	T	T	C			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr5:140553136T>C	ENST00000231137.3	+	1	894	c.720T>C	c.(718-720)ccT>ccC	p.P240P		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	240	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAACGCCCCTGATTTTGTGC	0.537																																							uc003lit.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(718-720)CCT>CCC		protocadherin beta 7 precursor							60.0	64.0	62.0					5																	140553136		2203	4300	6503	SO:0001819	synonymous_variant	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140553136T>C	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.720T>C	5.37:g.140553136T>C			Somatic					p.P240P	NM_018940	NP_061763	WXS	Illumina HiSeq	Unspecified	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	894	+			240			Extracellular (Potential).|Cadherin 2.		A1L3Y8	Silent	SNP	ENST00000231137.3	37	c.720T>C	CCDS4249.1																																																																																				0.537	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		3	75	0	0	0	0.004672	0	3	75				
PCDHB12	56124	broad.mit.edu	37	5	140590121	140590121	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr5:140590121C>A	ENST00000239450.2	+	1	1831	c.1642C>A	c.(1642-1644)Cgc>Agc	p.R548S	PCDHB12_ENST00000541609.1_Missense_Mutation_p.R211S	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	548	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCGCTGGTGCGCGTGCTGGT	0.706																																							uc003liz.2		NA																	0				skin(2)|ovary(1)	3						c.(1642-1644)CGC>AGC		protocadherin beta 12 precursor							31.0	36.0	34.0					5																	140590121		2201	4296	6497	SO:0001583	missense	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140590121C>A	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1642C>A	5.37:g.140590121C>A	ENSP00000239450:p.Arg548Ser		Somatic				PCDHB12_uc011dak.1_Missense_Mutation_p.R211S	p.R548S	NM_018932	NP_061755	WXS	Illumina HiSeq	Unspecified	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1831	+			548			Extracellular (Potential).|Cadherin 5.		B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	c.1642C>A	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.005667	0.54254	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.01584	4.75;4.75	3.41	2.5	0.30297	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.04497	0.0123	L	0.35593	1.075	0.26397	N	0.976482	D	0.71674	0.998	D	0.74023	0.982	T	0.47355	-0.9124	9	0.23891	T	0.37	.	9.945	0.41602	0.3687:0.6313:0.0:0.0	.	548	Q9Y5F1	PCDBC_HUMAN	S	211;548;168	ENSP00000440199:R211S;ENSP00000239450:R548S	ENSP00000239450:R548S	R	+	1	0	PCDHB12	140570305	0.000000	0.05858	0.796000	0.32109	0.995000	0.86356	0.601000	0.24119	0.523000	0.28482	0.485000	0.47835	CGC		0.706	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		15	59	1	0	3.32936e-07	0.006122	4.08726e-07	15	59				
PCDHB15	56121	broad.mit.edu	37	5	140625391	140625391	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr5:140625391G>A	ENST00000231173.3	+	1	245	c.245G>A	c.(244-246)gGg>gAg	p.G82E		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	82	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGCAGACCGGGCAGTTGATA	0.527																																							uc003lje.2		NA																	0				ovary(2)|breast(2)|skin(1)	5						c.(244-246)GGG>GAG		protocadherin beta 15 precursor							49.0	55.0	53.0					5																	140625391		2203	4300	6503	SO:0001583	missense	56121				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140625391G>A	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.245G>A	5.37:g.140625391G>A	ENSP00000231173:p.Gly82Glu		Somatic					p.G82E	NM_018935	NP_061758	WXS	Illumina HiSeq	Unspecified	Q9Y5E8	PCDBF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	245	+			82			Extracellular (Potential).|Cadherin 1.		Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	37	c.245G>A	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033838	0.75504	.	.	ENSG00000113248	ENST00000231173	T	0.39997	1.05	4.92	4.92	0.64577	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.79639	0.4480	H	0.98833	4.345	0.58432	D	0.999997	D	0.65815	0.995	D	0.76575	0.988	D	0.88581	0.3136	9	0.87932	D	0	.	18.0878	0.89463	0.0:0.0:1.0:0.0	.	82	Q9Y5E8	PCDBF_HUMAN	E	82	ENSP00000231173:G82E	ENSP00000231173:G82E	G	+	2	0	PCDHB15	140605575	1.000000	0.71417	0.382000	0.26119	0.706000	0.40770	6.714000	0.74692	2.442000	0.82660	0.491000	0.48974	GGG		0.527	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935		11	70	0	0	0	0.001855	0	11	70				
HIST1H2AA	221613	broad.mit.edu	37	6	25726547	25726547	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr6:25726547G>T	ENST00000297012.3	-	1	243	c.209C>A	c.(208-210)gCg>gAg	p.A70E	HIST1H2BA_ENST00000274764.2_5'Flank	NM_170745.3	NP_734466.1	Q96QV6	H2A1A_HUMAN	histone cluster 1, H2aa	70						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A70E(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(8)	13						ATCGCGAGACGCATTGCCTGC	0.517																																							uc003nfc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(208-210)GCG>GAG		histone cluster 1, H2aa							306.0	242.0	263.0					6																	25726547		2203	4300	6503	SO:0001583	missense	221613				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:25726547G>T	AY131982	CCDS4562.1	6p22.2	2011-01-27	2006-10-11		ENSG00000164508	ENSG00000164508		"""Histones / Replication-dependent"""	18729	protein-coding gene	gene with protein product		613499	"""H2A histone family, member R"", ""histone 1, H2aa"""			12408966	Standard	NM_170745		Approved	bA317E16.2, H2AFR	uc003nfc.3	Q96QV6	OTTHUMG00000014407	ENST00000297012.3:c.209C>A	6.37:g.25726547G>T	ENSP00000297012:p.Ala70Glu		Somatic				HIST1H2BA_uc003nfd.2_5'Flank	p.A70E	NM_170745	NP_734466	WXS	Illumina HiSeq	Unspecified	Q96QV6	H2A1A_HUMAN			1	244	-			70						Missense_Mutation	SNP	ENST00000297012.3	37	c.209C>A	CCDS4562.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256963	0.39896	.	.	ENSG00000164508	ENST00000297012	T	0.70045	-0.45	3.55	0.749	0.18381	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.49305	D	0.000143	T	0.75781	0.3896	M	0.92784	3.345	0.58432	D	0.999996	D	0.76494	0.999	D	0.65987	0.94	T	0.76948	-0.2770	10	0.87932	D	0	.	7.6749	0.28480	0.3067:0.0:0.6933:0.0	.	70	Q96QV6	H2A1A_HUMAN	E	70	ENSP00000297012:A70E	ENSP00000297012:A70E	A	-	2	0	HIST1H2AA	25834526	1.000000	0.71417	0.001000	0.08648	0.000000	0.00434	7.407000	0.80029	0.147000	0.19030	-0.142000	0.14014	GCG		0.517	HIST1H2AA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040065.1	NM_170745		14	74	1	0	9.31168e-06	0.001855	1.08159e-05	14	74				
CUL9	23113	broad.mit.edu	37	6	43154806	43154806	+	Missense_Mutation	SNP	G	G	T	rs145250491	byFrequency	TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr6:43154806G>T	ENST00000252050.4	+	5	1444	c.1360G>T	c.(1360-1362)Ggg>Tgg	p.G454W	CUL9_ENST00000354495.3_Intron|CUL9_ENST00000372647.2_Missense_Mutation_p.G454W	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	454					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TGTGGAGAAGGGGGCAGGGGC	0.572																																							uc003ouk.2		NA																	0				ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						c.(1360-1362)GGG>TGG		p53-associated parkin-like cytoplasmic protein							59.0	54.0	55.0					6																	43154806		2203	4300	6503	SO:0001583	missense	23113				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding	g.chr6:43154806G>T	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.1360G>T	6.37:g.43154806G>T	ENSP00000252050:p.Gly454Trp		Somatic				CUL9_uc003ouj.1_Intron|CUL9_uc003oul.2_Missense_Mutation_p.G454W|CUL9_uc010jyk.2_5'UTR|CUL9_uc003oum.1_5'UTR	p.G454W	NM_015089	NP_055904	WXS	Illumina HiSeq	Unspecified	Q8IWT3	CUL9_HUMAN			5	1435	+			454					O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	c.1360G>T	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101027	0.56183	.	.	ENSG00000112659	ENST00000252050;ENST00000372647	T;T	0.73897	-0.79;-0.68	5.11	4.24	0.50183	.	0.915025	0.09468	N	0.798047	T	0.67211	0.2869	L	0.46157	1.445	0.80722	D	1	D;D	0.63880	0.993;0.993	P;P	0.53006	0.715;0.715	T	0.65455	-0.6164	10	0.87932	D	0	-15.577	8.5883	0.33670	0.0813:0.1524:0.7662:0.0	.	454;454	E9PEZ1;Q8IWT3	.;CUL9_HUMAN	W	454	ENSP00000252050:G454W;ENSP00000361730:G454W	ENSP00000252050:G454W	G	+	1	0	CUL9	43262784	0.915000	0.31059	1.000000	0.80357	0.933000	0.57130	1.170000	0.31883	1.150000	0.42419	0.467000	0.42956	GGG		0.572	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		12	26	1	0	3.07112e-06	0.010729	3.59487e-06	12	26				
IMPG1	3617	broad.mit.edu	37	6	76713658	76713658	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr6:76713658C>T	ENST00000369950.3	-	11	1334	c.1145G>A	c.(1144-1146)gGa>gAa	p.G382E	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TGGCAGTGATCCAGCAATTTC	0.393																																					Pancreas(37;839 1141 2599 26037)	Pancreas(37;839 1141 2599 26037)	uc003pik.1		NA																	0				ovary(2)|skin(1)	3						c.(1144-1146)GGA>GAA		interphotoreceptor matrix proteoglycan 1							81.0	75.0	77.0					6																	76713658		2203	4300	6503	SO:0001583	missense	3617				visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity	g.chr6:76713658C>T	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1145G>A	6.37:g.76713658C>T	ENSP00000358966:p.Gly382Glu		Somatic					p.G382E	NM_001563	NP_001554	WXS	Illumina HiSeq	Unspecified	Q17R60	IMPG1_HUMAN			11	1275	-		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)	382						Missense_Mutation	SNP	ENST00000369950.3	37	c.1145G>A	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	C	5.361	0.251920	0.10185	.	.	ENSG00000112706	ENST00000369950	T	0.18810	2.19	4.18	-0.956	0.10353	.	0.737231	0.12283	N	0.482676	T	0.03651	0.0104	L	0.43152	1.355	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.44892	-0.9298	10	0.09084	T	0.74	.	4.3145	0.10986	0.0:0.4379:0.165:0.3971	.	382	Q17R60	IMPG1_HUMAN	E	382	ENSP00000358966:G382E	ENSP00000358966:G382E	G	-	2	0	IMPG1	76770378	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.613000	0.05610	-0.092000	0.12417	0.563000	0.77884	GGA		0.393	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563		13	47	0	0	0	0.00499	0	13	47				
ENPP1	5167	broad.mit.edu	37	6	132211538	132211538	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr6:132211538A>G	ENST00000360971.2	+	25	2685	c.2665A>G	c.(2665-2667)Atc>Gtc	p.I889V		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	889	Nuclease.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	CAGAGCACGGATCACAGATGT	0.383																																					Colon(104;336 1535 5856 11019 33782)	Colon(104;336 1535 5856 11019 33782)	uc011ecf.1		NA																	0				upper_aerodigestive_tract(2)|ovary(2)	4						c.(2665-2667)ATC>GTC		ectonucleotide pyrophosphatase/phosphodiesterase	Amifostine(DB01143)|Ribavirin(DB00811)						137.0	126.0	130.0					6																	132211538		2203	4300	6503	SO:0001583	missense	5167				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity	g.chr6:132211538A>G	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.2665A>G	6.37:g.132211538A>G	ENSP00000354238:p.Ile889Val		Somatic					p.I889V	NM_006208	NP_006199	WXS	Illumina HiSeq	Unspecified	P22413	ENPP1_HUMAN		GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	25	2685	+	Breast(56;0.0505)		889			Nuclease.|Extracellular (Potential).		Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	ENST00000360971.2	37	c.2665A>G	CCDS5150.2	.	.	.	.	.	.	.	.	.	.	A	3.889	-0.024311	0.07634	.	.	ENSG00000197594	ENST00000360971	T	0.63255	-0.03	5.82	0.0994	0.14502	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.318475	0.30890	N	0.008665	T	0.12987	0.0315	N	0.04994	-0.135	0.35244	D	0.778055	B	0.10296	0.003	B	0.10450	0.005	T	0.31194	-0.9952	10	0.02654	T	1	-6.5884	10.2057	0.43112	0.4013:0.0:0.5987:0.0	.	889	P22413	ENPP1_HUMAN	V	889	ENSP00000354238:I889V	ENSP00000354238:I889V	I	+	1	0	ENPP1	132253231	0.983000	0.35010	0.993000	0.49108	0.994000	0.84299	0.385000	0.20685	0.086000	0.17137	0.528000	0.53228	ATC		0.383	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2			12	105	0	0	0	0.003163	0	12	105				
TIAM2	26230	broad.mit.edu	37	6	155458593	155458593	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr6:155458593C>A	ENST00000461783.3	+	7	2750	c.1477C>A	c.(1477-1479)Ctg>Atg	p.L493M	TIAM2_ENST00000456144.1_Missense_Mutation_p.L493M|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000318981.5_Missense_Mutation_p.L493M|TIAM2_ENST00000360366.4_Missense_Mutation_p.L493M|TIAM2_ENST00000529824.2_Missense_Mutation_p.L493M			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	493					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		ACTCAGCTCTCTGGAACAGCT	0.527																																							uc003qqb.2		NA																	0				ovary(3)|breast(1)	4						c.(1477-1479)CTG>ATG		T-cell lymphoma invasion and metastasis 2							83.0	90.0	88.0					6																	155458593		2203	4300	6503	SO:0001583	missense	26230				apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr6:155458593C>A		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1477C>A	6.37:g.155458593C>A	ENSP00000437188:p.Leu493Met		Somatic				TIAM2_uc003qqe.2_Missense_Mutation_p.L493M|TIAM2_uc010kjj.2_Missense_Mutation_p.L26M	p.L493M	NM_012454	NP_036586	WXS	Illumina HiSeq	Unspecified	Q8IVF5	TIAM2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)	7	2750	+		Ovarian(120;0.196)	493					B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	c.1477C>A	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.998449	0.54147	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.06687	3.36;3.27;3.32;3.36;3.38;3.32	6.08	2.72	0.32119	.	0.075576	0.53938	D	0.000045	T	0.11707	0.0285	M	0.73598	2.24	0.27538	N	0.950871	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.988	T	0.08186	-1.0734	10	0.36615	T	0.2	.	8.2378	0.31636	0.0:0.607:0.0:0.393	.	493;493	Q8IVF5-2;Q8IVF5	.;TIAM2_HUMAN	M	493;739;493;493;493;493;493	ENSP00000437188:L493M;ENSP00000434901:L493M;ENSP00000407746:L493M;ENSP00000327315:L493M;ENSP00000353528:L493M;ENSP00000433348:L493M	ENSP00000327315:L493M	L	+	1	2	TIAM2	155500285	0.020000	0.18652	0.293000	0.24932	0.810000	0.45777	0.255000	0.18333	0.280000	0.22209	0.655000	0.94253	CTG		0.527	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454		26	123	1	0	2.61193e-14	0.009535	3.90497e-14	26	123				
NOX3	50508	broad.mit.edu	37	6	155776234	155776235	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr6:155776234_155776235CA>AG	ENST00000159060.2	-	2	179_180	c.77_78TG>CT	c.(76-78)cTG>cCT	p.L26P		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	26					detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TGTCAATAAACAGATAAAAATT	0.347																																							uc003qqm.2		NA																	0				ovary(1)	1						c.(76-78)CTG>CCT		NADPH oxidase 3																																				SO:0001583	missense	50508						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding	g.chr6:155776234_155776235CA>AG	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.77_78delinsAG	6.37:g.155776234_155776235delinsAG	ENSP00000159060:p.Leu26Pro		Somatic					p.L26P	NM_015718	NP_056533	WXS	Illumina HiSeq	Unspecified	Q9HBY0	NOX3_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)	2	180_181	-		Breast(66;0.0183)	26			Helical; (Potential).		Q9HBJ9	Missense_Mutation	DNP	ENST00000159060.2	37	c.77_78TG>CT	CCDS5250.1																																																																																				0.347	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1			12	42	0	0	0	0.004672	0	12	42				
ADCYAP1R1	117	broad.mit.edu	37	7	31123774	31123774	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr7:31123774G>T	ENST00000304166.4	+	7	636	c.347G>T	c.(346-348)cGg>cTg	p.R116L	ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.R95L|ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.R116L|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.R116L	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	116					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						GTGGTGAGCCGGAACTGCACG	0.483																																					Ovarian(44;225 1186 2158 11092)	Ovarian(44;225 1186 2158 11092)	uc003tca.1		NA																	0				ovary(1)	1						c.(346-348)CGG>CTG		adenylate cyclase activating polypeptide 1							164.0	159.0	160.0					7																	31123774		2203	4300	6503	SO:0001583	missense	117				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity	g.chr7:31123774G>T		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.347G>T	7.37:g.31123774G>T	ENSP00000306620:p.Arg116Leu		Somatic				ADCYAP1R1_uc003tcb.1_Missense_Mutation_p.R95L|ADCYAP1R1_uc003tcc.1_Missense_Mutation_p.R116L|ADCYAP1R1_uc003tcd.1_Missense_Mutation_p.R116L|ADCYAP1R1_uc003tce.1_Missense_Mutation_p.R116L|ADCYAP1R1_uc003tcf.1_5'Flank	p.R116L	NM_001118	NP_001109	WXS	Illumina HiSeq	Unspecified	P41586	PACR_HUMAN			7	570	+			116			Extracellular (Potential).		A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	37	c.347G>T	CCDS5433.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570953	0.65765	.	.	ENSG00000078549	ENST00000304166;ENST00000409363;ENST00000396211;ENST00000409489	T;T;T;T	0.74209	-0.41;-0.82;-0.41;-0.41	5.66	3.85	0.44370	GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.85682	D	0.000000	D	0.87059	0.6083	M	0.90198	3.095	0.52099	D	0.999946	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.87578	0.998;0.989;0.996;0.998;0.983	D	0.88631	0.3169	10	0.87932	D	0	.	10.6656	0.45728	0.1594:0.0:0.8406:0.0	.	116;116;116;95;116	B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.;.;.;.;PACR_HUMAN	L	116;95;116;116	ENSP00000306620:R116L;ENSP00000387335:R95L;ENSP00000379514:R116L;ENSP00000386395:R116L	ENSP00000306620:R116L	R	+	2	0	ADCYAP1R1	31090299	1.000000	0.71417	1.000000	0.80357	0.432000	0.31715	7.567000	0.82357	1.390000	0.46547	-0.251000	0.11542	CGG		0.483	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118		11	68	1	0	6.72482e-11	0.003163	9.4023e-11	11	68				
ZNF479	90827	broad.mit.edu	37	7	57187809	57187809	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr7:57187809T>G	ENST00000331162.4	-	5	1583	c.1313A>C	c.(1312-1314)aAa>aCa	p.K438T		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TTCTTCACATTTGTAGGGTCT	0.453																																							uc010kzo.2		NA																	0				ovary(3)|skin(1)	4						c.(1312-1314)AAA>ACA		zinc finger protein 479							15.0	13.0	14.0					7																	57187809		1651	3694	5345	SO:0001583	missense	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57187809T>G	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1313A>C	7.37:g.57187809T>G	ENSP00000333776:p.Lys438Thr		Somatic					p.K438T	NM_033273	NP_150376	WXS	Illumina HiSeq	Unspecified	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	1584	-			438			C2H2-type 10.			Missense_Mutation	SNP	ENST00000331162.4	37	c.1313A>C	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	N	0.007	-1.944203	0.00479	.	.	ENSG00000185177	ENST00000331162	T	0.58060	0.36	0.955	-1.91	0.07641	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32133	0.0819	N	0.20574	0.59	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10497	-1.0627	9	0.59425	D	0.04	.	4.2411	0.10648	0.1773:0.0:0.4807:0.342	.	438	Q96JC4	ZN479_HUMAN	T	438	ENSP00000333776:K438T	ENSP00000333776:K438T	K	-	2	0	ZNF479	57191751	0.000000	0.05858	0.013000	0.15412	0.012000	0.07955	-1.673000	0.01951	-4.325000	0.00056	-4.471000	0.00005	AAA		0.453	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		5	103	0	0	0	0.006214	0	5	103				
BHLHA15	168620	broad.mit.edu	37	7	97841993	97841993	+	Silent	SNP	C	C	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr7:97841993C>T	ENST00000609256.1	+	2	498	c.372C>T	c.(370-372)atC>atT	p.I124I	BHLHA15_ENST00000314018.2_Silent_p.I124I			Q7RTS1	BHA15_HUMAN	basic helix-loop-helix family, member a15	124	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|Golgi organization (GO:0007030)|intracellular distribution of mitochondria (GO:0048312)|mitochondrial calcium ion transport (GO:0006851)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)										AGAACTACATCAAATCGCTGA	0.622																																							uc003upe.1		NA																	0					0						c.(370-372)ATC>ATT		basic helix-loop-helix family, member a15							53.0	38.0	43.0					7																	97841993		2189	4283	6472	SO:0001819	synonymous_variant	168620				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr7:97841993C>T	BK000276	CCDS5655.1	7q21.3	2009-01-12	2009-01-12	2009-01-12	ENSG00000180535	ENSG00000180535		"""Basic helix-loop-helix proteins"""	22265	protein-coding gene	gene with protein product		608606	"""basic helix-loop-helix domain containing, class B, 8"""	BHLHB8		14516699, 18557763	Standard	NM_177455		Approved	MIST1, bHLHa15	uc003upf.1	Q7RTS1	OTTHUMG00000154289	ENST00000609256.1:c.372C>T	7.37:g.97841993C>T			Somatic				BHLHA15_uc003upf.1_Silent_p.I124I	p.I124I	NM_177455	NP_803238	WXS	Illumina HiSeq	Unspecified	Q7RTS1	BHA15_HUMAN			2	459	+			124			Helix-loop-helix motif.		A4D271|Q14DE4	Silent	SNP	ENST00000609256.1	37	c.372C>T	CCDS5655.1																																																																																				0.622	BHLHA15-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472733.1	NM_177455		3	2	0	0	0	0.004672	0	3	2				
ADAM18	8749	broad.mit.edu	37	8	39467017	39467017	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr8:39467017A>T	ENST00000265707.5	+	5	326	c.281A>T	c.(280-282)tAc>tTc	p.Y94F	ADAM18_ENST00000379866.1_Missense_Mutation_p.Y94F|ADAM18_ENST00000520772.1_Missense_Mutation_p.Y94F|ADAM18_ENST00000541111.1_5'UTR	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	94					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			CATTGCCATTACCAAGGATAT	0.323																																							uc003xni.2		NA																	0				central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6						c.(280-282)TAC>TTC		a disintegrin and metalloprotease domain 18							97.0	91.0	93.0					8																	39467017		2203	4299	6502	SO:0001583	missense	8749				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding	g.chr8:39467017A>T	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.281A>T	8.37:g.39467017A>T	ENSP00000265707:p.Tyr94Phe		Somatic				ADAM18_uc003xnh.2_Missense_Mutation_p.Y94F|ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Missense_Mutation_p.Y94F	p.Y94F	NM_014237	NP_055052	WXS	Illumina HiSeq	Unspecified	Q9Y3Q7	ADA18_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000199)		5	281	+		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	94					B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	ENST00000265707.5	37	c.281A>T	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.095296	0.56075	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000520772;ENST00000522198	T;T;T	0.17691	2.26;2.26;2.26	4.89	4.89	0.63831	Peptidase M12B, propeptide (1);	0.000000	0.42548	D	0.000690	T	0.46171	0.1379	M	0.90145	3.09	0.80722	D	1	D;D;D	0.69078	0.992;0.994;0.997	D;D;D	0.71870	0.957;0.975;0.975	T	0.53774	-0.8391	10	0.62326	D	0.03	.	11.0718	0.48008	1.0:0.0:0.0:0.0	.	94;94;94	Q9Y3Q7-2;Q9Y3Q7;Q6IRW9	.;ADA18_HUMAN;.	F	94;94;94;50	ENSP00000265707:Y94F;ENSP00000369195:Y94F;ENSP00000429908:Y94F	ENSP00000265707:Y94F	Y	+	2	0	ADAM18	39586174	1.000000	0.71417	1.000000	0.80357	0.428000	0.31595	4.186000	0.58337	2.168000	0.68352	0.528000	0.53228	TAC		0.323	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237		16	62	0	0	0	0.008871	0	16	62				
DCSTAMP	81501	broad.mit.edu	37	8	105361635	105361635	+	Silent	SNP	G	G	A	rs553927963		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr8:105361635G>A	ENST00000297581.2	+	2	904	c.855G>A	c.(853-855)ccG>ccA	p.P285P	DCSTAMP_ENST00000517991.1_Intron|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	285					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											CTTTCTGGCCGACTCCTAAAG	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		19782	0.0		0.0	False		,,,				2504	0.001						uc003ylx.1		NA																	0				pancreas(2)|large_intestine(1)|ovary(1)	4						c.(853-855)CCG>CCA		dendritic cell-specific transmembrane protein							99.0	106.0	103.0					8																	105361635		2203	4300	6503	SO:0001819	synonymous_variant	81501				osteoclast differentiation	cell surface|integral to membrane|plasma membrane		g.chr8:105361635G>A	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.855G>A	8.37:g.105361635G>A			Somatic					p.P285P	NM_030788	NP_110415	WXS	Illumina HiSeq	Unspecified	Q9H295	TM7S4_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		2	904	+			285					B7ZVW2|E7ESG0|Q2M2D5	Silent	SNP	ENST00000297581.2	37	c.855G>A	CCDS6301.1																																																																																				0.478	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788		4	87	0	0	0	0.009096	0	4	87				
PKHD1L1	93035	broad.mit.edu	37	8	110498976	110498976	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr8:110498976C>A	ENST00000378402.5	+	59	9910	c.9806C>A	c.(9805-9807)cCc>cAc	p.P3269H		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3269					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GAAGATTACCCCGGTTGGTCT	0.423										HNSCC(38;0.096)																													uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(9805-9807)CCC>CAC		fibrocystin L precursor							226.0	224.0	225.0					8																	110498976		1946	4129	6075	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110498976C>A	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9806C>A	8.37:g.110498976C>A	ENSP00000367655:p.Pro3269His	HNSCC(38;0.096)	Somatic					p.P3269H	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		59	9910	+			3269			Extracellular (Potential).		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.9806C>A	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529622	0.44969	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.82984	-1.67;-1.67	5.42	5.42	0.78866	Pectin lyase fold/virulence factor (1);	0.060408	0.64402	D	0.000002	D	0.82309	0.5009	L	0.58428	1.81	0.43550	D	0.995858	B	0.25850	0.136	B	0.29077	0.098	T	0.80810	-0.1216	10	0.72032	D	0.01	.	17.0713	0.86574	0.0:1.0:0.0:0.0	.	3269	Q86WI1	PKHL1_HUMAN	H	3269;197	ENSP00000367655:P3269H;ENSP00000437376:P197H	ENSP00000367655:P3269H	P	+	2	0	PKHD1L1	110568152	1.000000	0.71417	1.000000	0.80357	0.305000	0.27757	6.177000	0.71961	2.704000	0.92352	0.563000	0.77884	CCC		0.423	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		41	244	1	0	1.6237e-14	0.013114	2.45178e-14	41	244				
PLEC	5339	broad.mit.edu	37	8	144991090	144991090	+	Missense_Mutation	SNP	C	C	T	rs371875530		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr8:144991090C>T	ENST00000322810.4	-	32	13479	c.13310G>A	c.(13309-13311)cGg>cAg	p.R4437Q	PLEC_ENST00000354958.2_Missense_Mutation_p.R4278Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R4300Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R4286Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R4268Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R4304Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R4327Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R4300Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R4323Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4437	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CACCAGGTTCCGGTGCATGGC	0.677																																							uc003zaf.1		NA																	0				large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(13309-13311)CGG>CAG		plectin isoform 1		C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4211		0,1,2105	33.0	39.0	37.0		12980,12857,12833,13310,12803,12899,12911,12899	5.4	1.0	8		37	0,8434		0,0,4217	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	43,43,43,43,43,43,43,43	0,1,6322	TT,TC,CC		0.0,0.0237,0.0079	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	4327/4575,4286/4534,4278/4526,4437/4685,4268/4516,4300/4548,4304/4552,4300/4548	144991090	1,12645	2106	4217	6323	SO:0001583	missense	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:144991090C>T	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13310G>A	8.37:g.144991090C>T	ENSP00000323856:p.Arg4437Gln		Somatic				PLEC_uc003zab.1_Missense_Mutation_p.R4300Q|PLEC_uc003zac.1_Missense_Mutation_p.R4304Q|PLEC_uc003zad.2_Missense_Mutation_p.R4300Q|PLEC_uc003zae.1_Missense_Mutation_p.R4268Q|PLEC_uc003zag.1_Missense_Mutation_p.R4278Q|PLEC_uc003zah.2_Missense_Mutation_p.R4286Q|PLEC_uc003zaj.2_Missense_Mutation_p.R4327Q	p.R4437Q	NM_201380	NP_958782	WXS	Illumina HiSeq	Unspecified	Q15149	PLEC_HUMAN			32	13480	-			4437			Globular 2.|Plectin 29.		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	c.13310G>A	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.517347	0.27123	2.37E-4	0.0	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	5.38	5.38	0.77491	.	0.000000	0.64402	U	0.000009	T	0.80974	0.4727	M	0.79475	2.455	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	P;P;P;P;P;P;P;P	0.60609	0.877;0.877;0.877;0.757;0.877;0.877;0.877;0.877	T	0.82210	-0.0570	10	0.59425	D	0.04	.	18.9233	0.92534	0.0:1.0:0.0:0.0	.	4327;4286;4278;4437;4268;4300;4304;4300	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	4300;4304;4300;4268;4437;4278;4286;4327;4323	ENSP00000344848:R4300Q;ENSP00000350277:R4304Q;ENSP00000346602:R4300Q;ENSP00000381756:R4268Q;ENSP00000323856:R4437Q;ENSP00000347044:R4278Q;ENSP00000348702:R4286Q;ENSP00000388180:R4327Q;ENSP00000434583:R4323Q	ENSP00000323856:R4437Q	R	-	2	0	PLEC	145063078	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.604000	0.82830	2.795000	0.96236	0.643000	0.83706	CGG		0.677	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		5	57	0	0	0	0.000602	0	5	57				
TTC39B	158219	broad.mit.edu	37	9	15185366	15185366	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr9:15185366G>A	ENST00000512701.2	-	16	1562	c.1526C>T	c.(1525-1527)tCt>tTt	p.S509F	TTC39B_ENST00000297615.5_Missense_Mutation_p.S440F|TTC39B_ENST00000380850.4_Missense_Mutation_p.S496F|TTC39B_ENST00000355694.2_Missense_Mutation_p.S443F|TTC39B_ENST00000507993.1_Missense_Mutation_p.S344F|TTC39B_ENST00000507285.1_Missense_Mutation_p.S344F			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	509										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						AGTAGGGATAGATTTCCCGGC	0.512																																							uc003zlr.1		NA																	0				ovary(1)	1						c.(1327-1329)TCT>TTT		tetratricopeptide repeat domain 39B							105.0	101.0	102.0					9																	15185366		2203	4300	6503	SO:0001583	missense	158219						binding	g.chr9:15185366G>A	AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.1526C>T	9.37:g.15185366G>A	ENSP00000422496:p.Ser509Phe		Somatic				TTC39B_uc003zlq.1_Missense_Mutation_p.S412F|TTC39B_uc011lmp.1_Missense_Mutation_p.S344F|TTC39B_uc010mie.1_Missense_Mutation_p.S441F|TTC39B_uc011lmq.1_Missense_Mutation_p.S430F|TTC39B_uc011lmr.1_Missense_Mutation_p.S374F|TTC39B_uc003zlp.1_Missense_Mutation_p.S26F	p.S443F	NM_152574	NP_689787	WXS	Illumina HiSeq	Unspecified	Q5VTQ0	TT39B_HUMAN			16	1449	-			443					A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	ENST00000512701.2	37	c.1328C>T	CCDS6477.2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.948774	0.92660	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.73613	0.3609	M	0.82517	2.595	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.991;0.991;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.986;0.976;0.999	T	0.75642	-0.3247	10	0.66056	D	0.02	-16.0834	20.1393	0.98055	0.0:0.0:1.0:0.0	.	440;496;441;443;26	F5H705;E9PAQ9;A5PLN1;Q5VTQ0;Q8IXZ6	.;.;.;TT39B_HUMAN;.	F	496;440;443;509;344;344	ENSP00000370231:S496F;ENSP00000297615:S440F;ENSP00000347920:S443F;ENSP00000422496:S509F;ENSP00000426539:S344F;ENSP00000423392:S344F	ENSP00000297615:S440F	S	-	2	0	TTC39B	15175366	1.000000	0.71417	0.992000	0.48379	0.958000	0.62258	9.700000	0.98707	2.759000	0.94783	0.563000	0.77884	TCT		0.512	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051758.3	NM_152574		25	130	0	0	0	0.010818	0	25	130				
PPEF1	5475	broad.mit.edu	37	X	18775846	18775846	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chrX:18775846G>T	ENST00000361511.4	+	8	992	c.498G>T	c.(496-498)gaG>gaT	p.E166D	PPEF1_ENST00000349874.5_Missense_Mutation_p.E166D|PPEF1_ENST00000359763.6_Missense_Mutation_p.E113D|PPEF1_ENST00000544635.1_Missense_Mutation_p.E101D|PPEF1_ENST00000543630.1_Missense_Mutation_p.E166D	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	166	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					CCTCCAAAGAGGTAACAATCT	0.393																																							uc004cyq.2		NA																	0					0						c.(496-498)GAG>GAT		protein phosphatase with EF hand calcium-binding							145.0	136.0	139.0					X																	18775846		2203	4300	6503	SO:0001583	missense	5475				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity	g.chrX:18775846G>T	BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.498G>T	X.37:g.18775846G>T	ENSP00000354871:p.Glu166Asp		Somatic				PPEF1_uc004cyp.2_Missense_Mutation_p.E166D|PPEF1_uc004cyr.2_Missense_Mutation_p.E166D|PPEF1_uc004cys.2_Missense_Mutation_p.E166D|PPEF1_uc011mja.1_Missense_Mutation_p.E101D|PPEF1_uc011mjb.1_Missense_Mutation_p.E110D	p.E166D	NM_006240	NP_006231	WXS	Illumina HiSeq	Unspecified	O14829	PPE1_HUMAN			8	979	+	Hepatocellular(33;0.183)		166			Catalytic.		A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	ENST00000361511.4	37	c.498G>T	CCDS14188.1	.	.	.	.	.	.	.	.	.	.	G	3.644	-0.072914	0.07228	.	.	ENSG00000086717	ENST00000361511;ENST00000359763;ENST00000349874;ENST00000543630;ENST00000472826;ENST00000544635	T;T;T;T;T;T	0.05382	3.45;3.45;3.45;3.45;3.45;3.45	5.19	-1.48	0.08745	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);	0.241984	0.29624	N	0.011627	T	0.06188	0.0160	L	0.60067	1.865	0.23855	N	0.99666	B;B;B	0.18610	0.01;0.029;0.003	B;B;B	0.23716	0.009;0.048;0.004	T	0.27536	-1.0071	10	0.44086	T	0.13	-8.6652	4.4622	0.11671	0.3938:0.3026:0.3036:0.0	.	166;166;166	O14829-5;O14829;O14829-3	.;PPE1_HUMAN;.	D	166;113;166;166;76;101	ENSP00000354871:E166D;ENSP00000352806:E113D;ENSP00000341892:E166D;ENSP00000437785:E166D;ENSP00000419948:E76D;ENSP00000441289:E101D	ENSP00000341892:E166D	E	+	3	2	PPEF1	18685767	0.985000	0.35326	0.077000	0.20336	0.017000	0.09413	0.564000	0.23563	-0.300000	0.08895	0.523000	0.50628	GAG		0.393	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3	NM_006240		32	128	1	0	1.61788e-16	0.012213	2.51855e-16	32	128				
PFKFB1	5207	broad.mit.edu	37	X	54989698	54989698	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chrX:54989698G>T	ENST00000375006.3	-	2	285	c.215C>A	c.(214-216)cCa>cAa	p.P72Q	PFKFB1_ENST00000545676.1_Intron|PFKFB1_ENST00000374992.2_Missense_Mutation_p.P72Q	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	72	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						ACCTTTAGTTGGTGTTCCTAT	0.448																																							uc004dty.1		NA																	0				ovary(1)	1						c.(214-216)CCA>CAA		6-phosphofructo-2-kinase/fructose-2,							237.0	194.0	209.0					X																	54989698		2203	4300	6503	SO:0001583	missense	5207				energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding	g.chrX:54989698G>T		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.215C>A	X.37:g.54989698G>T	ENSP00000364145:p.Pro72Gln		Somatic				PFKFB1_uc010nkd.1_Missense_Mutation_p.P80Q|PFKFB1_uc011mol.1_Intron	p.P72Q	NM_002625	NP_002616	WXS	Illumina HiSeq	Unspecified	P16118	F261_HUMAN			2	286	-			72			6-phosphofructo-2-kinase.		B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	ENST00000375006.3	37	c.215C>A	CCDS14364.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664059	0.88251	.	.	ENSG00000158571	ENST00000375006;ENST00000374992	T	0.43688	0.94	5.51	5.51	0.81932	6-phosphofructo-2-kinase (1);	0.048785	0.85682	D	0.000000	T	0.62539	0.2436	M	0.75264	2.295	0.35873	D	0.828406	D;B	0.76494	0.999;0.209	D;B	0.75020	0.985;0.049	T	0.64330	-0.6433	10	0.13853	T	0.58	-11.5942	17.3619	0.87353	0.0:0.0:1.0:0.0	.	72;72	Q4VBA9;P16118	.;F261_HUMAN	Q	72	ENSP00000364131:P72Q	ENSP00000364131:P72Q	P	-	2	0	PFKFB1	55006423	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.361000	0.79497	2.454000	0.82982	0.600000	0.82982	CCA		0.448	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1			57	238	1	0	1.37693e-34	0.01441	2.31019e-34	57	238				
NHSL2	340527	broad.mit.edu	37	X	71360515	71360515	+	Silent	SNP	G	G	A	rs147793067		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chrX:71360515G>A	ENST00000373677.1	+	2	3281	c.2019G>A	c.(2017-2019)ctG>ctA	p.L673L	NHSL2_ENST00000535692.1_Silent_p.L673L|NHSL2_ENST00000540800.1_Silent_p.L1039L|NHSL2_ENST00000510661.1_Silent_p.L808L			Q5HYW2	NHSL2_HUMAN	NHS-like 2	673										NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					TCATCACCCTGGAGGAAGACA	0.567																																							uc011mqa.1		NA																	0					0						c.(3115-3117)CTG>CTA		NHS-like 2							53.0	50.0	51.0					X																	71360515		2203	4300	6503	SO:0001819	synonymous_variant	340527							g.chrX:71360515G>A			Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.2019G>A	X.37:g.71360515G>A			Somatic				NHSL2_uc004eak.1_Silent_p.L673L|NHSL2_uc010nli.2_Silent_p.L808L	p.L1039L	NM_001013627	NP_001013649	WXS	Illumina HiSeq	Unspecified	Q5HYW2	NHSL2_HUMAN			6	3117	+	Renal(35;0.156)		1039					B2RN94	Silent	SNP	ENST00000373677.1	37	c.3117G>A																																																																																					0.567	NHSL2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057170.1	NM_001013627		7	50	0	0	0	0.001984	0	7	50				
SATL1	340562	broad.mit.edu	37	X	84362763	84362763	+	Silent	SNP	T	T	A			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chrX:84362763T>A	ENST00000395409.3	-	1	1211	c.651A>T	c.(649-651)tcA>tcT	p.S217S	SATL1_ENST00000509231.1_Silent_p.S404S|SATL1_ENST00000332921.5_Silent_p.S217S			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	217	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						GGCTTGTGCCTGATTGGCTGG	0.537																																							uc011mqx.1		NA																	0				breast(2)	2						c.(1210-1212)TCA>TCT		spermidine/spermine N1-acetyl transferase-like 1							209.0	143.0	165.0					X																	84362763		2203	4300	6503	SO:0001819	synonymous_variant	340562						N-acetyltransferase activity	g.chrX:84362763T>A	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.651A>T	X.37:g.84362763T>A			Somatic				SATL1_uc004een.2_Silent_p.S404S	p.S404S	NM_001163541	NP_001157013	WXS	Illumina HiSeq	Unspecified	Q86VE3	SATL1_HUMAN			1	1212	-			217			Gln-rich.		A0AVK7|E9PB72|Q5H8V9	Silent	SNP	ENST00000395409.3	37	c.1212A>T																																																																																					0.537	SATL1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_291339		39	95	0	0	0	0.007835	0	39	95				
GPR50	9248	broad.mit.edu	37	X	150349245	150349245	+	Missense_Mutation	SNP	G	G	A	rs200441669		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chrX:150349245G>A	ENST00000218316.3	+	2	1259	c.1190G>A	c.(1189-1191)cGc>cAc	p.R397H	AF003625.3_ENST00000602313.1_lincRNA|GPR50-AS1_ENST00000454196.1_RNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	397	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					TCTGCCTATCGCAAATCTGCC	0.582																																							uc010ntg.1		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(1189-1191)CGC>CAC		G protein-coupled receptor 50		G	HIS/ARG	0,3613		0,0,0,1521,571	102.0	114.0	110.0		1190	-3.2	0.0	X		110	1,6590		0,0,1,2386,1818	no	missense	GPR50	NM_004224.3	29	0,0,1,3907,2389	AA,AG,A,GG,G		0.0152,0.0,0.0098	benign	397/618	150349245	1,10203	2092	4205	6297	SO:0001583	missense	9248				cell-cell signaling	integral to plasma membrane	melatonin receptor activity	g.chrX:150349245G>A	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1190G>A	X.37:g.150349245G>A	ENSP00000218316:p.Arg397His		Somatic				uc004fes.1_5'Flank	p.R397H	NM_004224	NP_004215	WXS	Illumina HiSeq	Unspecified	Q13585	MTR1L_HUMAN			2	1325	+	Acute lymphoblastic leukemia(192;6.56e-05)		397			Cytoplasmic (Potential).|Pro-rich.		Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	c.1190G>A	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	G	1.398	-0.578974	0.03854	0.0	1.52E-4	ENSG00000102195	ENST00000218316	T	0.72942	-0.7	3.65	-3.23	0.05109	.	0.673531	0.12373	N	0.474620	T	0.46619	0.1402	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28267	-1.0049	10	0.72032	D	0.01	-0.7203	0.4108	0.00441	0.2158:0.2668:0.2458:0.2717	.	397	Q13585	MTR1L_HUMAN	H	397	ENSP00000218316:R397H	ENSP00000218316:R397H	R	+	2	0	GPR50	150099903	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.269000	0.08596	-1.112000	0.02984	-0.516000	0.04426	CGC		0.582	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224		48	166	0	0	0	0.01441	0	48	166				
PLXNA3	55558	broad.mit.edu	37	X	153696202	153696202	+	Silent	SNP	G	G	T			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chrX:153696202G>T	ENST00000369682.3	+	21	3853	c.3678G>T	c.(3676-3678)gcG>gcT	p.A1226A		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1226					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGCTGGCGGCGGGGGGTGGGC	0.687																																							uc004flm.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(3676-3678)GCG>GCT		plexin A3 precursor							18.0	23.0	21.0					X																	153696202		2170	4232	6402	SO:0001819	synonymous_variant	55558				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity	g.chrX:153696202G>T	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.3678G>T	X.37:g.153696202G>T			Somatic					p.A1226A	NM_017514	NP_059984	WXS	Illumina HiSeq	Unspecified	P51805	PLXA3_HUMAN			21	3851	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		1226			Helical; (Potential).		Q5HY36	Silent	SNP	ENST00000369682.3	37	c.3678G>T	CCDS14752.1																																																																																				0.687	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514		14	52	1	0	1.99824e-07	0.00499	2.49367e-07	14	52				
OR2M2	391194	broad.mit.edu	37	1	248343596	248343597	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr1:248343596_248343597insTA	ENST00000359682.2	+	1	309_310	c.309_310insTA	c.(310-312)tatfs	p.Y104fs		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AAATTTTCTTCTATATATCACT	0.431																																							uc010pzf.1		NA																	0				ovary(3)|skin(1)	4						c.(307-312)TTCTATfs		olfactory receptor, family 2, subfamily M,																																				SO:0001589	frameshift_variant	391194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248343596_248343597insTA	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.314_315dupTA	1.37:g.248343601_248343602dupTA	ENSP00000352710:p.Tyr104fs		Somatic					p.F103fs	NM_001004688	NP_001004688	WXS	Illumina HiSeq	Unspecified	Q96R28	OR2M2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	309_310	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		103_104			Helical; Name=3; (Potential).		A3KFT4	Frame_Shift_Ins	INS	ENST00000359682.2	37	c.309_310insTA	CCDS31106.1																																																																																				0.431	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688		11	434	NA	NA	NA	NA	NA	11	434	---	---	---	---
FAR2	55711	broad.mit.edu	37	12	29450110	29450110	+	Frame_Shift_Del	DEL	A	A	-			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr12:29450110delA	ENST00000536681.3	+	4	768	c.522delA	c.(520-522)ccafs	p.P174fs	RP11-996F15.2_ENST00000553105.1_RNA|FAR2_ENST00000182377.4_Frame_Shift_Del_p.P174fs|FAR2_ENST00000547116.1_Frame_Shift_Del_p.P77fs	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	174					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						CTGTGGAGCCAAAAAAAATCA	0.388																																							uc001ris.3		NA																	0					0						c.(520-522)CCAfs		fatty acyl CoA reductase 2							108.0	116.0	113.0					12																	29450110		2203	4300	6503	SO:0001589	frameshift_variant	55711				ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor	g.chr12:29450110delA	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.522delA	12.37:g.29450110delA	ENSP00000443291:p.Pro174fs		Somatic				FAR2_uc001rit.2_Frame_Shift_Del_p.P174fs|FAR2_uc009zjm.2_Frame_Shift_Del_p.P77fs|uc001riu.1_Intron	p.P174fs	NM_018099	NP_060569	WXS	Illumina HiSeq	Unspecified	Q96K12	FACR2_HUMAN			4	669	+			174					F8VV73|Q9H0D5|Q9NVW8	Frame_Shift_Del	DEL	ENST00000536681.3	37	c.522delA	CCDS8717.1																																																																																				0.388	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099		7	294	NA	NA	NA	NA	NA	7	294	---	---	---	---
FDXR	2232	broad.mit.edu	37	17	72862664	72862665	+	Frame_Shift_Del	DEL	CG	CG	-	rs141174234		TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr17:72862664_72862665delCG	ENST00000293195.5	-	4	374_375	c.296_297delCG	c.(295-297)acgfs	p.T99fs	FDXR_ENST00000455107.2_Frame_Shift_Del_p.T55fs|FDXR_ENST00000582944.1_Splice_Site_p.T91fs|FDXR_ENST00000581530.1_Frame_Shift_Del_p.T99fs|FDXR_ENST00000442102.2_Frame_Shift_Del_p.T142fs|FDXR_ENST00000544854.1_Frame_Shift_Del_p.T47fs|FDXR_ENST00000420580.2_Intron|FDXR_ENST00000413947.2_Frame_Shift_Del_p.T130fs|FDXR_ENST00000583917.1_Frame_Shift_Del_p.T100fs|FDXR_ENST00000581969.1_5'UTR	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	99					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	CAGAATGGGCCGTCTGGGTAAA	0.639																																							uc002jly.2		NA																	0					0						c.(295-297)ACGfs		ferredoxin reductase isoform 1 precursor																																				SO:0001589	frameshift_variant	2232				cholesterol metabolic process|electron transport chain|steroid biosynthetic process|transport	mitochondrial matrix	ferredoxin-NADP+ reductase activity|protein binding	g.chr17:72862664_72862665delCG	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.296_297delCG	17.37:g.72862664_72862665delCG	ENSP00000293195:p.Thr99fs		Somatic				FDXR_uc010wri.1_Frame_Shift_Del_p.T47fs|FDXR_uc010wrj.1_Frame_Shift_Del_p.T97fs|FDXR_uc002jlw.2_5'UTR|FDXR_uc002jlx.2_Frame_Shift_Del_p.T99fs|FDXR_uc002jmc.2_Frame_Shift_Del_p.T100fs|FDXR_uc010wrk.1_Frame_Shift_Del_p.T130fs|FDXR_uc010wrl.1_Frame_Shift_Del_p.T142fs|FDXR_uc002jma.2_Frame_Shift_Del_p.T100fs|FDXR_uc010wrm.1_Intron|FDXR_uc002jlz.2_Frame_Shift_Del_p.T91fs|FDXR_uc002jmb.2_RNA	p.T99fs	NM_024417	NP_077728	WXS	Illumina HiSeq	Unspecified	P22570	ADRO_HUMAN			4	383_384	-	all_lung(278;0.172)|Lung NSC(278;0.207)		99					B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Frame_Shift_Del	DEL	ENST00000293195.5	37	c.296_297delCG	CCDS58593.1																																																																																				0.639	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110		7	71	NA	NA	NA	NA	NA	7	71	---	---	---	---
SYNDIG1	79953	broad.mit.edu	37	20	24524183	24524185	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	GGA	GGA	-	-	GGA	GGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr20:24524183_24524185delGGA	ENST00000376862.3	+	2	1083_1085	c.450_452delGGA	c.(448-453)gtggag>gtg	p.E155del		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	155	Poly-Glu.				intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						CCTACGATGTGGAGGAGGAGGAG	0.547																																							uc002wtw.1		NA																	0					0						c.(448-453)GTGGAG>GTG		transmembrane protein 90B																																				SO:0001651	inframe_deletion	79953				response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane		g.chr20:24524183_24524185delGGA	AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.450_452delGGA	20.37:g.24524192_24524194delGGA	ENSP00000366058:p.Glu155del		Somatic					p.E155del	NM_024893	NP_079169	WXS	Illumina HiSeq	Unspecified	Q9H7V2	SYNG1_HUMAN			2	1083_1085	+			155			Poly-Glu.|Cytoplasmic (Potential).		Q6IA30|Q9H514	In_Frame_Del	DEL	ENST00000376862.3	37	c.450_452delGGA	CCDS13164.1																																																																																				0.547	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893		7	310	NA	NA	NA	NA	NA	7	310	---	---	---	---
EGF	1950	broad.mit.edu	37	4	110883117	110883120	+	Frame_Shift_Del	DEL	GAGA	GAGA	-			TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	GAGA	GAGA	-	-	GAGA	GAGA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr4:110883117_110883120delGAGA	ENST00000265171.5	+	8	1733_1736	c.1288_1291delGAGA	c.(1288-1293)gagagafs	p.ER430fs	EGF_ENST00000503392.1_Frame_Shift_Del_p.ER430fs|EGF_ENST00000509793.1_Frame_Shift_Del_p.ER388fs	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	430	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CTCAGTGCTTGAGAGAGATGGGAA	0.397																																							uc003hzy.3		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(1288-1293)GAGAGAfs		epidermal growth factor precursor	Sulindac(DB00605)																																			SO:0001589	frameshift_variant	1950				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity	g.chr4:110883117_110883120delGAGA	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1288_1291delGAGA	4.37:g.110883121_110883124delGAGA	ENSP00000265171:p.Glu430fs		Somatic				EGF_uc011cfu.1_Frame_Shift_Del_p.E388fs|EGF_uc011cfv.1_Frame_Shift_Del_p.E430fs	p.E430fs	NM_001963	NP_001954	WXS	Illumina HiSeq	Unspecified	P01133	EGF_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	8	1740_1743	+		Hepatocellular(203;0.0893)	430_431			EGF-like 3.|Extracellular (Potential).		B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Frame_Shift_Del	DEL	ENST00000265171.5	37	c.1288_1291delGAGA	CCDS3689.1																																																																																				0.397	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1			9	232	NA	NA	NA	NA	NA	9	232	---	---	---	---
BHLHA15	168620	broad.mit.edu	37	7	97842081	97842083	+	In_Frame_Del	DEL	CAG	CAG	-	rs546266645	byFrequency	TCGA-55-7728-01A-11D-2184-08	TCGA-55-7728-10A-01D-2184-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	be345756-62d1-4c2f-a2f2-fceb95f13364	d97318e0-a7ec-44e9-a46d-ef62081afc05	g.chr7:97842081_97842083delCAG	ENST00000609256.1	+	2	586_588	c.460_462delCAG	c.(460-462)cagdel	p.Q158del	BHLHA15_ENST00000314018.2_In_Frame_Del_p.Q158del			Q7RTS1	BHA15_HUMAN	basic helix-loop-helix family, member a15	158					calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|Golgi organization (GO:0007030)|intracellular distribution of mitochondria (GO:0048312)|mitochondrial calcium ion transport (GO:0006851)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)										CCAGCACTACCAGCAGCAGCAGC	0.665																																							uc003upe.1		NA																	0					0						c.(460-462)CAGdel		basic helix-loop-helix family, member a15				35,3945		7,21,1962						0.5	1.0			10	96,7758		18,60,3849	no	coding	BHLHA15	NM_177455.3		25,81,5811	A1A1,A1R,RR		1.2223,0.8794,1.107				131,11703				SO:0001651	inframe_deletion	168620				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr7:97842081_97842083delCAG	BK000276	CCDS5655.1	7q21.3	2009-01-12	2009-01-12	2009-01-12	ENSG00000180535	ENSG00000180535		"""Basic helix-loop-helix proteins"""	22265	protein-coding gene	gene with protein product		608606	"""basic helix-loop-helix domain containing, class B, 8"""	BHLHB8		14516699, 18557763	Standard	NM_177455		Approved	MIST1, bHLHa15	uc003upf.1	Q7RTS1	OTTHUMG00000154289	ENST00000609256.1:c.460_462delCAG	7.37:g.97842090_97842092delCAG	ENSP00000476312:p.Gln158del		Somatic				BHLHA15_uc003upf.1_In_Frame_Del_p.Q158del	p.Q158del	NM_177455	NP_803238	WXS	Illumina HiSeq	Unspecified	Q7RTS1	BHA15_HUMAN			2	547_549	+			158					A4D271|Q14DE4	In_Frame_Del	DEL	ENST00000609256.1	37	c.460_462delCAG	CCDS5655.1																																																																																				0.665	BHLHA15-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472733.1	NM_177455		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
