#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CAMTA1	23261	broad.mit.edu	37	1	7792638	7792638	+	Silent	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:7792638G>T	ENST00000303635.7	+	12	3252	c.3045G>T	c.(3043-3045)ggG>ggT	p.G1015G	CAMTA1_ENST00000439411.2_Silent_p.G1015G	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1015					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GCGGGAGCGGGAATGGAGGGA	0.632			T	WWTR1	epitheliod hemangioendothelioma																																		uc001aoi.2		NA		Dom	yes		1	1p36.31-p36.23	611501		calmodulin binding transcription activator 1			M					0				ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9						c.(3043-3045)GGG>GGT		calmodulin-binding transcription activator 1							48.0	54.0	52.0					1																	7792638		2203	4299	6502	SO:0001819	synonymous_variant	23261				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding	g.chr1:7792638G>T	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3045G>T	1.37:g.7792638G>T			Somatic				CAMTA1_uc010nzv.1_Silent_p.G102G|CAMTA1_uc001aok.3_Silent_p.G58G	p.G1015G	NM_015215	NP_056030	WXS	Illumina HiSeq	Unspecified	Q9Y6Y1	CMTA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)	12	3252	+	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)	1015					A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	ENST00000303635.7	37	c.3045G>T	CCDS30576.1																																																																																				0.632	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215		3	10	1	0	1.23904e-05	0.000602	1.5366e-05	3	10				
UTS2	10911	broad.mit.edu	37	1	7913047	7913047	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:7913047G>A	ENST00000361696.5	-	1	48	c.17C>T	c.(16-18)tCc>tTc	p.S6F	UTS2_ENST00000054668.5_Intron|UTS2_ENST00000377516.2_Missense_Mutation_p.S6F	NM_006786.3	NP_006777.1	O95399	UTS2_HUMAN	urotensin 2	6					muscle contraction (GO:0006936)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell differentiation (GO:0045597)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of heart rate (GO:0010460)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to testosterone (GO:0033574)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			kidney(1)|lung(4)|urinary_tract(1)	6	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		CAAACAGCAGGAGGCCAGCTT	0.423																																							uc001aor.2		NA																	0					0						c.(16-18)TCC>TTC		urotensin 2 isoform b preproprotein							67.0	70.0	69.0					1																	7913047		2203	4300	6503	SO:0001583	missense	10911				muscle contraction|regulation of blood pressure|synaptic transmission	extracellular space	hormone activity	g.chr1:7913047G>A	AF104118	CCDS90.1, CCDS91.1	1p36	2013-02-28			ENSG00000049247	ENSG00000049247		"""Endogenous ligands"""	12636	protein-coding gene	gene with protein product	"""prepro U-II"""	604097				9861051, 10499587	Standard	NM_021995		Approved	UII, U-II, UCN2, PRO1068	uc001aos.3	O95399	OTTHUMG00000001218	ENST00000361696.5:c.17C>T	1.37:g.7913047G>A	ENSP00000355163:p.Ser6Phe		Somatic				UTS2_uc001aoq.2_Missense_Mutation_p.S6F|UTS2_uc001aos.2_Intron	p.S6F	NM_006786	NP_006777	WXS	Illumina HiSeq	Unspecified	O95399	UTS2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)	1	58	-	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)	6					Q5H8X7|Q6UXF6|Q9UKP7	Missense_Mutation	SNP	ENST00000361696.5	37	c.17C>T	CCDS91.1	.	.	.	.	.	.	.	.	.	.	G	1.533	-0.543797	0.04053	.	.	ENSG00000049247	ENST00000377516;ENST00000400910;ENST00000361696	T;T	0.27557	1.66;1.72	4.78	-0.297	0.12820	.	0.626933	0.15786	N	0.244698	T	0.09379	0.0231	N	0.05078	-0.115	0.19575	N	0.999965	B;B	0.16396	0.006;0.017	B;B	0.12156	0.002;0.007	T	0.33828	-0.9853	10	0.02654	T	1	-2.3105	3.7012	0.08383	0.5468:0.0:0.267:0.1862	.	6;6	O95399;Q5H8X8	UTS2_HUMAN;.	F	6	ENSP00000366738:S6F;ENSP00000355163:S6F	ENSP00000355163:S6F	S	-	2	0	UTS2	7835634	0.244000	0.23889	0.113000	0.21522	0.549000	0.35272	0.559000	0.23485	0.307000	0.22880	0.650000	0.86243	TCC		0.423	UTS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003612.1	NM_006786		6	35	0	0	0	0.001168	0	6	35				
UBE4B	10277	broad.mit.edu	37	1	10238772	10238772	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:10238772T>C	ENST00000253251.8	+	25	4048	c.3209T>C	c.(3208-3210)aTa>aCa	p.I1070T	UBE4B_ENST00000377157.3_Missense_Mutation_p.I954T|UBE4B_ENST00000343090.6_Missense_Mutation_p.I1199T					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		AAATCCACAATAGCAATAGAA	0.458																																							uc001aqs.3		NA																	0				ovary(2)|skin(2)	4						c.(3595-3597)ATA>ACA		ubiquitination factor E4B isoform 1							70.0	68.0	69.0					1																	10238772		2203	4300	6503	SO:0001583	missense	10277				apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding	g.chr1:10238772T>C	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.3209T>C	1.37:g.10238772T>C	ENSP00000253251:p.Ile1070Thr		Somatic				UBE4B_uc001aqr.3_Missense_Mutation_p.I1070T|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Missense_Mutation_p.I654T|UBE4B_uc001aqu.2_Missense_Mutation_p.I80T	p.I1199T	NM_001105562	NP_001099032	WXS	Illumina HiSeq	Unspecified	O95155	UBE4B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)	26	4309	+		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	1199						Missense_Mutation	SNP	ENST00000253251.8	37	c.3596T>C	CCDS110.1	.	.	.	.	.	.	.	.	.	.	T	10.52	1.371988	0.24857	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.40225	1.04;1.04;1.04	5.62	5.62	0.85841	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.22399	0.0540	N	0.02802	-0.49	0.80722	D	1	B;B	0.26258	0.145;0.043	B;B	0.30105	0.111;0.031	T	0.16041	-1.0416	10	0.14252	T	0.57	-23.8571	16.1203	0.81346	0.0:0.0:0.0:1.0	.	1199;1070	O95155;O95155-2	UBE4B_HUMAN;.	T	1070;954;1199	ENSP00000253251:I1070T;ENSP00000366362:I954T;ENSP00000343001:I1199T	ENSP00000253251:I1070T	I	+	2	0	UBE4B	10161359	1.000000	0.71417	0.677000	0.29947	0.798000	0.45092	7.997000	0.88414	2.274000	0.75844	0.533000	0.62120	ATA		0.458	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048		8	22	0	0	0	0.004482	0	8	22				
PADI3	51702	broad.mit.edu	37	1	17593303	17593303	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:17593303T>G	ENST00000375460.3	+	5	538	c.498T>G	c.(496-498)aaT>aaG	p.N166K		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	166					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TCCAGGACAATTGTGACCAGC	0.617																																							uc001bai.2		NA																	0				ovary(1)|breast(1)	2						c.(496-498)AAT>AAG		peptidyl arginine deiminase, type III	L-Citrulline(DB00155)						182.0	142.0	156.0					1																	17593303		2203	4300	6503	SO:0001583	missense	51702				peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity	g.chr1:17593303T>G	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.498T>G	1.37:g.17593303T>G	ENSP00000364609:p.Asn166Lys		Somatic					p.N166K	NM_016233	NP_057317	WXS	Illumina HiSeq	Unspecified	Q9ULW8	PADI3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	5	538	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	166					Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	37	c.498T>G	CCDS179.1	.	.	.	.	.	.	.	.	.	.	C	4.265	0.048311	0.08243	.	.	ENSG00000142619	ENST00000375460	T	0.16324	2.35	4.85	3.94	0.45596	Protein-arginine deiminase (PAD), central domain (2);	0.213426	0.48767	D	0.000170	T	0.16727	0.0402	L	0.55481	1.735	0.39406	D	0.96666	P	0.36354	0.549	B	0.38378	0.272	T	0.05750	-1.0866	10	0.27785	T	0.31	-40.578	7.9999	0.30291	0.0:0.8088:0.0:0.1912	.	166	Q9ULW8	PADI3_HUMAN	K	166	ENSP00000364609:N166K	ENSP00000364609:N166K	N	+	3	2	PADI3	17465890	0.433000	0.25562	0.982000	0.44146	0.001000	0.01503	0.788000	0.26872	0.590000	0.29694	-0.974000	0.02594	AAT		0.617	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1			22	90	0	0	0	0.005443	0	22	90				
KIF17	57576	broad.mit.edu	37	1	20992805	20992805	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:20992805A>T	ENST00000247986.2	-	14	3123	c.2813T>A	c.(2812-2814)cTc>cAc	p.L938H	KIF17_ENST00000400463.3_Missense_Mutation_p.L937H|KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000375044.1_Missense_Mutation_p.L838H			Q9P2E2	KIF17_HUMAN	kinesin family member 17	938					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		ACTGAGCATGAGCCTGTAGCG	0.597																																							uc001bdr.3		NA																	0				ovary(3)|skin(1)	4						c.(2812-2814)CTC>CAC		kinesin family member 17 isoform a							186.0	157.0	167.0					1																	20992805		2203	4300	6503	SO:0001583	missense	57576				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding	g.chr1:20992805A>T	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2813T>A	1.37:g.20992805A>T	ENSP00000247986:p.Leu938His		Somatic				KIF17_uc001bdp.3_Missense_Mutation_p.L215H|KIF17_uc001bdq.3_Missense_Mutation_p.L216H|KIF17_uc009vpx.2_Missense_Mutation_p.L308H|KIF17_uc001bds.3_Missense_Mutation_p.L937H	p.L938H	NM_020816	NP_065867	WXS	Illumina HiSeq	Unspecified	Q9P2E2	KIF17_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)	14	2931	-		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	938					A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	c.2813T>A	CCDS213.1	.	.	.	.	.	.	.	.	.	.	A	14.57	2.574260	0.45902	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	T;T;T	0.71222	-0.55;-0.44;-0.44	5.95	4.8	0.61643	.	.	.	.	.	T	0.77239	0.4101	L	0.55481	1.735	0.26957	N	0.965891	D;D;D	0.65815	0.991;0.995;0.991	P;P;P	0.58873	0.707;0.847;0.707	T	0.68557	-0.5377	9	0.51188	T	0.08	.	11.6415	0.51235	0.867:0.0:0.0:0.133	.	938;937;938	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	H	838;937;938;319	ENSP00000364184:L838H;ENSP00000383311:L937H;ENSP00000247986:L938H	ENSP00000247986:L938H	L	-	2	0	KIF17	20865392	1.000000	0.71417	1.000000	0.80357	0.073000	0.16967	4.182000	0.58310	1.038000	0.40049	0.460000	0.39030	CTC		0.597	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816		33	101	0	0	0	0.002522	0	33	101				
C1orf109	54955	broad.mit.edu	37	1	38155304	38155304	+	Silent	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:38155304G>T	ENST00000358011.4	-	2	438	c.249C>A	c.(247-249)atC>atA	p.I83I	CDCA8_ENST00000327331.2_5'Flank|C1orf109_ENST00000464085.1_Silent_p.I83I|CDCA8_ENST00000373055.1_5'Flank	NM_017850.1	NP_060320.1	Q9NX04	CA109_HUMAN	chromosome 1 open reading frame 109	83										lung(2)|prostate(2)	4		Myeloproliferative disorder(586;0.0393)				TGTCCAGGACGATGTCACCAG	0.532																																							uc001cbp.2		NA																	0					0						c.(247-249)ATC>ATA		hypothetical protein LOC54955							98.0	104.0	102.0					1																	38155304		2203	4300	6503	SO:0001819	synonymous_variant	54955							g.chr1:38155304G>T	AK000515	CCDS423.1	1p34.3	2012-06-21			ENSG00000116922	ENSG00000116922			26039	protein-coding gene	gene with protein product		614799				22548824	Standard	XM_005270979		Approved	FLJ20508	uc001cbp.3	Q9NX04	OTTHUMG00000004323	ENST00000358011.4:c.249C>A	1.37:g.38155304G>T			Somatic				C1orf109_uc010oig.1_Silent_p.I146I|C1orf109_uc001cbo.2_Silent_p.I145I|C1orf109_uc001cbq.1_Intron|CDCA8_uc001cbr.2_5'Flank|CDCA8_uc001cbs.2_5'Flank	p.I83I	NM_017850	NP_060320	WXS	Illumina HiSeq	Unspecified	Q9NX04	CA109_HUMAN			2	439	-		Myeloproliferative disorder(586;0.0393)	83					D3DPT1|Q8WVD1	Silent	SNP	ENST00000358011.4	37	c.249C>A	CCDS423.1																																																																																				0.532	C1orf109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012486.1	NM_017850		4	79	1	0	0.00116845	0.001168	0.00132874	4	79				
ELTD1	64123	broad.mit.edu	37	1	79387384	79387384	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:79387384G>T	ENST00000370742.3	-	9	1234	c.1171C>A	c.(1171-1173)Ctg>Atg	p.L391M		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	391	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GAGTATGTCAGCTCACAGCCC	0.423																																							uc001diq.3		NA																	0				ovary(1)|skin(1)	2						c.(1171-1173)CTG>ATG		EGF, latrophilin and seven transmembrane domain							146.0	140.0	142.0					1																	79387384		1993	4176	6169	SO:0001583	missense	64123				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr1:79387384G>T	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1171C>A	1.37:g.79387384G>T	ENSP00000359778:p.Leu391Met		Somatic					p.L391M	NM_022159	NP_071442	WXS	Illumina HiSeq	Unspecified	Q9HBW9	ELTD1_HUMAN		COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)	9	1327	-			391			GPS.|Extracellular (Potential).		B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	c.1171C>A	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.484865	0.44147	.	.	ENSG00000162618	ENST00000370742	T	0.70045	-0.45	5.32	-1.07	0.09968	GPS domain (3);	0.445495	0.24686	N	0.036424	T	0.41719	0.1171	L	0.53561	1.675	0.09310	N	0.999992	B	0.22909	0.077	B	0.38056	0.264	T	0.50363	-0.8837	9	.	.	.	.	7.1183	0.25429	0.0717:0.4532:0.3589:0.1162	.	391	Q9HBW9	ELTD1_HUMAN	M	391	ENSP00000359778:L391M	.	L	-	1	2	ELTD1	79159972	0.505000	0.26131	0.843000	0.33291	0.996000	0.88848	0.837000	0.27558	-0.044000	0.13491	0.585000	0.79938	CTG		0.423	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159		17	61	1	0	6.49762e-13	0.006122	9.79306e-13	17	61				
OLFM3	118427	broad.mit.edu	37	1	102270424	102270424	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:102270424G>A	ENST00000338858.5	-	6	806	c.807C>T	c.(805-807)taC>taT	p.Y269Y	OLFM3_ENST00000370103.4_Silent_p.Y249Y|OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	269	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		CAATTGATTTGTATTCACGAA	0.378																																							uc001duf.2		NA																	0				ovary(2)|skin(1)	3						c.(805-807)TAC>TAT		olfactomedin 3							73.0	69.0	70.0					1																	102270424		2203	4299	6502	SO:0001819	synonymous_variant	118427					extracellular region		g.chr1:102270424G>A	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.807C>T	1.37:g.102270424G>A			Somatic				OLFM3_uc001dug.2_Silent_p.Y249Y|OLFM3_uc001duh.2_RNA|OLFM3_uc001dui.2_RNA|OLFM3_uc001duj.2_Silent_p.Y174Y|OLFM3_uc001due.2_RNA	p.Y269Y	NM_058170	NP_477518	WXS	Illumina HiSeq	Unspecified	Q96PB7	NOE3_HUMAN		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)	6	878	-		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)	269			Olfactomedin-like.		Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Silent	SNP	ENST00000338858.5	37	c.807C>T																																																																																					0.378	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1			3	53	0	0	0	0.004672	0	3	53				
CEPT1	10390	broad.mit.edu	37	1	111724837	111724837	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:111724837T>C	ENST00000545121.1	+	6	951	c.743T>C	c.(742-744)aTt>aCt	p.I248T	CEPT1_ENST00000467362.1_3'UTR|RP5-1180E21.4_ENST00000607951.1_RNA|RP5-1180E21.5_ENST00000610049.1_RNA|CEPT1_ENST00000357172.4_Missense_Mutation_p.I248T	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1	248					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	CAAATGAAAATTTTTCCTGCA	0.318																																							uc001eah.1		NA																	0					0						c.(742-744)ATT>ACT		choline/ethanolaminephosphotransferase	Choline(DB00122)						63.0	62.0	62.0					1																	111724837		2203	4300	6503	SO:0001583	missense	10390					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	diacylglycerol cholinephosphotransferase activity|ethanolaminephosphotransferase activity|metal ion binding	g.chr1:111724837T>C	AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.743T>C	1.37:g.111724837T>C	ENSP00000441980:p.Ile248Thr		Somatic				CEPT1_uc001eai.1_Missense_Mutation_p.I248T|CEPT1_uc001eaj.1_Missense_Mutation_p.I248T|CEPT1_uc009wfz.1_Intron	p.I248T	NM_001007794	NP_001007795	WXS	Illumina HiSeq	Unspecified	Q9Y6K0	CEPT1_HUMAN		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	6	951	+		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)	248			Helical; (Potential).		Q69YJ9|Q9P0Y8	Missense_Mutation	SNP	ENST00000545121.1	37	c.743T>C	CCDS830.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.628167	0.46944	.	.	ENSG00000134255	ENST00000545121;ENST00000357172	T;T	0.46063	0.88;0.88	6.16	6.16	0.99307	.	0.246811	0.49916	D	0.000124	T	0.15305	0.0369	N	0.16478	0.41	0.49687	D	0.999818	B	0.10296	0.003	B	0.18871	0.023	T	0.08953	-1.0697	10	0.23302	T	0.38	-15.8937	14.7581	0.69583	0.0:0.0:0.0:1.0	.	248	Q9Y6K0	CEPT1_HUMAN	T	248	ENSP00000441980:I248T;ENSP00000349696:I248T	ENSP00000349696:I248T	I	+	2	0	CEPT1	111526360	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.665000	0.83852	2.367000	0.80283	0.528000	0.53228	ATT		0.318	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034462.2	NM_006090		2	29	0	0	0	0.004672	0	2	29				
FLG2	388698	broad.mit.edu	37	1	152328222	152328222	+	Silent	SNP	A	A	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:152328222A>G	ENST00000388718.5	-	3	2112	c.2040T>C	c.(2038-2040)ggT>ggC	p.G680G	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	680	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTGTCCAAAACCAGAGGATT	0.478																																							uc001ezw.3		NA																	0				ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(2038-2040)GGT>GGC		filaggrin family member 2							291.0	292.0	292.0					1																	152328222		2203	4300	6503	SO:0001819	synonymous_variant	388698						calcium ion binding|structural molecule activity	g.chr1:152328222A>G	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2040T>C	1.37:g.152328222A>G			Somatic				uc001ezv.2_Intron	p.G680G	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2113	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		680			Ser-rich.		Q9H4U1	Silent	SNP	ENST00000388718.5	37	c.2040T>C	CCDS30861.1																																																																																				0.478	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		4	354	0	0	0	0.001368	0	4	354				
NES	10763	broad.mit.edu	37	1	156646857	156646857	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:156646857A>T	ENST00000368223.3	-	1	332	c.200T>A	c.(199-201)gTt>gAt	p.V67D		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	67	Coil 1B.|Rod.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCGTTGGTCAACGAGGGCCCG	0.736																																							uc001fpq.2		NA																	0				ovary(6)	6						c.(199-201)GTT>GAT		nestin							4.0	6.0	5.0					1																	156646857		1870	3827	5697	SO:0001583	missense	10763				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity	g.chr1:156646857A>T	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.200T>A	1.37:g.156646857A>T	ENSP00000357206:p.Val67Asp		Somatic					p.V67D	NM_006617	NP_006608	WXS	Illumina HiSeq	Unspecified	P48681	NEST_HUMAN			1	333	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		67			Coil 1B.|Rod.		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	c.200T>A	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	A	17.85	3.489730	0.64074	.	.	ENSG00000132688	ENST00000368223;ENST00000255024	D	0.90133	-2.62	4.2	3.02	0.34903	Filament (1);	.	.	.	.	D	0.91758	0.7393	M	0.81614	2.55	0.58432	D	0.999999	P	0.52842	0.956	P	0.59424	0.857	D	0.91497	0.5216	9	0.87932	D	0	.	9.5308	0.39193	0.8218:0.1782:0.0:0.0	.	67	P48681	NEST_HUMAN	D	67	ENSP00000357206:V67D	ENSP00000255024:V67D	V	-	2	0	NES	154913481	1.000000	0.71417	0.490000	0.27465	0.291000	0.27294	6.388000	0.73195	0.595000	0.29777	0.379000	0.24179	GTT		0.736	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		4	4	0	0	0	0.000602	0	4	4				
INSRR	3645	broad.mit.edu	37	1	156814505	156814505	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:156814505C>A	ENST00000368195.3	-	13	2964	c.2568G>T	c.(2566-2568)ttG>ttT	p.L856F	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	856	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTACCTCTCCCAAGCGGCGGT	0.617																																							uc010pht.1		NA																	0				lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20						c.(2566-2568)TTG>TTT		insulin receptor-related receptor precursor							63.0	64.0	64.0					1																	156814505		2203	4300	6503	SO:0001583	missense	3645				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:156814505C>A	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2568G>T	1.37:g.156814505C>A	ENSP00000357178:p.Leu856Phe		Somatic				NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	p.L856F	NM_014215	NP_055030	WXS	Illumina HiSeq	Unspecified	P14616	INSRR_HUMAN			13	2822	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		856			Fibronectin type-III 3.|Extracellular (Potential).		O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	c.2568G>T	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	9.642	1.139124	0.21205	.	.	ENSG00000027644	ENST00000368195	T	0.58210	0.35	4.86	-3.32	0.04973	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.269718	0.19716	N	0.107688	T	0.11750	0.0286	.	.	.	0.09310	N	0.999999	B	0.32425	0.371	B	0.38296	0.27	T	0.33033	-0.9884	9	0.16420	T	0.52	.	1.4287	0.02328	0.3254:0.3431:0.1006:0.2309	.	856	P14616	INSRR_HUMAN	F	856	ENSP00000357178:L856F	ENSP00000357178:L856F	L	-	3	2	INSRR	155081129	0.000000	0.05858	0.456000	0.27044	0.992000	0.81027	-0.192000	0.09587	-0.479000	0.06813	0.563000	0.77884	TTG		0.617	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		34	45	1	0	1.59361e-14	0.006999	2.48508e-14	34	45				
CD1E	913	broad.mit.edu	37	1	158324263	158324263	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:158324263A>T	ENST00000368167.3	+	2	394	c.155A>T	c.(154-156)cAc>cTc	p.H52L	CD1E_ENST00000368157.1_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.H50L|CD1E_ENST00000368155.3_Missense_Mutation_p.H52L|CD1E_ENST00000368165.3_Missense_Mutation_p.H52L|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000444681.2_Intron|CD1E_ENST00000368160.3_Missense_Mutation_p.H52L|CD1E_ENST00000368156.1_Missense_Mutation_p.H52L|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.H52L|CD1E_ENST00000368163.3_Missense_Mutation_p.H52L|CD1E_ENST00000464822.1_Intron|CD1E_ENST00000452291.2_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	52					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					AGCTGGGCACACAGTGAGGGC	0.572																																							uc001fse.2		NA																	0				skin(3)	3						c.(154-156)CAC>CTC		CD1E antigen isoform a precursor							84.0	88.0	87.0					1																	158324263		2184	4296	6480	SO:0001583	missense	913				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen		g.chr1:158324263A>T	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.155A>T	1.37:g.158324263A>T	ENSP00000357149:p.His52Leu		Somatic				CD1E_uc010pid.1_Missense_Mutation_p.H50L|CD1E_uc010pie.1_Intron|CD1E_uc010pif.1_Intron|CD1E_uc001fsd.2_Missense_Mutation_p.H52L|CD1E_uc001fsk.2_Missense_Mutation_p.H52L|CD1E_uc001fsj.2_Missense_Mutation_p.H52L|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Missense_Mutation_p.H52L|CD1E_uc001fry.2_Missense_Mutation_p.H52L|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Missense_Mutation_p.H52L|CD1E_uc009wsv.2_Intron|CD1E_uc001frz.2_Missense_Mutation_p.H52L|CD1E_uc009wsw.2_5'Flank	p.H52L	NM_030893	NP_112155	WXS	Illumina HiSeq	Unspecified	P15812	CD1E_HUMAN			2	394	+	all_hematologic(112;0.0378)		52					B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	c.155A>T	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	A	2.783	-0.253117	0.05829	.	.	ENSG00000158488	ENST00000434258;ENST00000368167;ENST00000368165;ENST00000368163;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155	T;T;T;T;T;T;T;T	0.05996	3.36;3.36;3.54;3.36;3.36;3.36;3.74;3.67	3.8	-0.13	0.13498	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	2.285000	0.01858	N	0.036395	T	0.01835	0.0058	L	0.43152	1.355	0.09310	N	1	B;B;B;B;B;B;B;B	0.29671	0.005;0.103;0.103;0.016;0.002;0.161;0.254;0.006	B;B;B;B;B;B;B;B	0.22386	0.0;0.039;0.039;0.024;0.002;0.029;0.033;0.002	T	0.42068	-0.9473	10	0.54805	T	0.06	0.9144	3.4639	0.07543	0.5758:0.2008:0.2234:0.0	.	50;52;52;52;52;52;52;52	E7ET31;P15812-5;P15812-7;P15812-2;P15812;P15812-3;P15812-6;P15812-4	.;.;.;.;CD1E_HUMAN;.;.;.	L	50;52;52;52;52;52;52;52	ENSP00000401957:H50L;ENSP00000357149:H52L;ENSP00000357147:H52L;ENSP00000357145:H52L;ENSP00000357142:H52L;ENSP00000357143:H52L;ENSP00000357138:H52L;ENSP00000357137:H52L	ENSP00000357137:H52L	H	+	2	0	CD1E	156590887	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-0.347000	0.07750	-0.028000	0.13850	0.460000	0.39030	CAC		0.572	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893		30	49	0	0	0	0.007291	0	30	49				
OR10K2	391107	broad.mit.edu	37	1	158390131	158390131	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:158390131G>C	ENST00000314902.2	-	1	525	c.526C>G	c.(526-528)Cac>Gac	p.H176D		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					CAGAAGAAGTGATGTAGTTGA	0.468																																							uc010pii.1		NA																	0				pancreas(1)	1						c.(526-528)CAC>GAC		olfactory receptor, family 10, subfamily K,							160.0	142.0	148.0					1																	158390131		2203	4300	6503	SO:0001583	missense	391107				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158390131G>C	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.526C>G	1.37:g.158390131G>C	ENSP00000324251:p.His176Asp		Somatic					p.H176D	NM_001004476	NP_001004476	WXS	Illumina HiSeq	Unspecified	Q6IF99	O10K2_HUMAN			1	526	-	all_hematologic(112;0.0378)		176			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000314902.2	37	c.526C>G	CCDS30896.1	.	.	.	.	.	.	.	.	.	.	G	9.723	1.160152	0.21454	.	.	ENSG00000180708	ENST00000314902	T	0.00174	8.62	4.1	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000137	T	0.00356	0.0011	M	0.88704	2.975	0.28927	N	0.891772	D	0.67145	0.996	D	0.69142	0.962	T	0.18681	-1.0329	10	0.87932	D	0	.	15.5895	0.76517	0.0:0.0:1.0:0.0	.	176	Q6IF99	O10K2_HUMAN	D	176	ENSP00000324251:H176D	ENSP00000324251:H176D	H	-	1	0	OR10K2	156656755	0.840000	0.29493	0.963000	0.40424	0.016000	0.09150	1.183000	0.32041	2.265000	0.75225	0.467000	0.42956	CAC		0.468	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476		10	113	0	0	0	0.001368	0	10	113				
OR6N2	81442	broad.mit.edu	37	1	158747012	158747012	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:158747012G>A	ENST00000339258.1	-	1	413	c.414C>T	c.(412-414)acC>acT	p.T138T		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					CACAGAGTGTGGTGGTCATAA	0.512																																							uc010pir.1		NA																	0					0						c.(412-414)ACC>ACT		olfactory receptor, family 6, subfamily N,							84.0	86.0	85.0					1																	158747012		2203	4300	6503	SO:0001819	synonymous_variant	81442				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158747012G>A	BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.414C>T	1.37:g.158747012G>A			Somatic					p.T138T	NM_001005278	NP_001005278	WXS	Illumina HiSeq	Unspecified	Q8NGY6	OR6N2_HUMAN			1	414	-	all_hematologic(112;0.0378)		138			Cytoplasmic (Potential).		Q6IFR2	Silent	SNP	ENST00000339258.1	37	c.414C>T	CCDS30906.1																																																																																				0.512	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1			21	44	0	0	0	0.00333	0	21	44				
RGS8	85397	broad.mit.edu	37	1	182636035	182636035	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:182636035G>C	ENST00000483095.2	-	4	357	c.100C>G	c.(100-102)Ctt>Gtt	p.L34V	RGS8_ENST00000367556.1_Missense_Mutation_p.L34V|RGS8_ENST00000491420.2_5'UTR|RGS8_ENST00000367557.4_Missense_Mutation_p.L34V|RGS8_ENST00000258302.4_Missense_Mutation_p.L52V			P57771	RGS8_HUMAN	regulator of G-protein signaling 8	34					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						TTGTCTGGAAGAATAGCTGTG	0.502																																					Ovarian(189;1262 3804 41973)	Ovarian(189;1262 3804 41973)	uc010pnw.1		NA																	0				ovary(1)	1						c.(100-102)CTT>GTT		regulator of G-protein signalling 8 isoform 2							203.0	165.0	178.0					1																	182636035		2203	4300	6503	SO:0001583	missense	85397				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:182636035G>C	AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.100C>G	1.37:g.182636035G>C	ENSP00000426289:p.Leu34Val		Somatic				RGS8_uc001gpn.1_Missense_Mutation_p.L34V|RGS8_uc001gpm.1_Missense_Mutation_p.L52V	p.L34V	NM_001102450	NP_001095920	WXS	Illumina HiSeq	Unspecified	P57771	RGS8_HUMAN			4	358	-			34					B4DGL9|Q3SYD2	Missense_Mutation	SNP	ENST00000483095.2	37	c.100C>G	CCDS41443.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864589	0.32977	.	.	ENSG00000135824	ENST00000483095;ENST00000258302;ENST00000367557;ENST00000367556;ENST00000508450	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.45	5.45	0.79879	.	1.296250	0.05424	N	0.544787	T	0.40570	0.1122	L	0.44542	1.39	0.36802	D	0.885429	P;P	0.45715	0.731;0.865	B;B	0.42827	0.225;0.399	T	0.16158	-1.0412	10	0.18276	T	0.48	.	10.3258	0.43792	0.0896:0.0:0.9104:0.0	.	34;52	P57771;P57771-2	RGS8_HUMAN;.	V	34;52;34;34;34	ENSP00000426289:L34V;ENSP00000258302:L52V;ENSP00000356528:L34V;ENSP00000356527:L34V	ENSP00000258302:L52V	L	-	1	0	RGS8	180902658	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.183000	0.58317	2.565000	0.86533	0.655000	0.94253	CTT		0.502	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358979.1	NM_033345		6	105	0	0	0	0.00308	0	6	105				
NMNAT2	23057	broad.mit.edu	37	1	183221856	183221856	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:183221856C>T	ENST00000287713.6	-	11	1178	c.844G>A	c.(844-846)Ggc>Agc	p.G282S	NMNAT2_ENST00000294868.4_Missense_Mutation_p.G277S	NM_015039.3	NP_055854.1	Q9BZQ4	NMNA2_HUMAN	nicotinamide nucleotide adenylyltransferase 2	282					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|late endosome (GO:0005770)|synapse (GO:0045202)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)	p.G282S(3)		endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	18						ACAACATGGCCGTCCCCATGC	0.582																																							uc001gqc.1		NA																	3	Substitution - Missense(3)		haematopoietic_and_lymphoid_tissue(3)	skin(1)	1						c.(844-846)GGC>AGC		nicotinamide mononucleotide adenylyltransferase							136.0	113.0	121.0					1																	183221856		2203	4300	6503	SO:0001583	missense	23057				water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity	g.chr1:183221856C>T	AF288395	CCDS1353.1, CCDS1354.1	1q25	2008-02-05	2003-04-30	2003-05-02	ENSG00000157064	ENSG00000157064			16789	protein-coding gene	gene with protein product		608701	"""chromosome 1 open reading frame 15"""	C1orf15		11318611, 12359228	Standard	NM_015039		Approved	KIAA0479, PNAT2	uc001gqc.2	Q9BZQ4	OTTHUMG00000035519	ENST00000287713.6:c.844G>A	1.37:g.183221856C>T	ENSP00000287713:p.Gly282Ser		Somatic				NMNAT2_uc009wye.1_RNA|NMNAT2_uc001gqb.1_Missense_Mutation_p.G277S	p.G282S	NM_015039	NP_055854	WXS	Illumina HiSeq	Unspecified	Q9BZQ4	NMNA2_HUMAN			11	1179	-			282					O75067|Q5T1Q3|Q8WU99|Q96QW1	Missense_Mutation	SNP	ENST00000287713.6	37	c.844G>A	CCDS1353.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.185821	0.57909	.	.	ENSG00000157064	ENST00000287713;ENST00000294868	D;D	0.97186	-4.28;-4.14	5.58	4.65	0.58169	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.048633	0.85682	D	0.000000	D	0.95076	0.8405	N	0.08118	0	0.58432	D	0.999999	P;D	0.89917	0.929;1.0	B;D	0.91635	0.138;0.999	D	0.91416	0.5155	10	0.02654	T	1	-20.1782	15.9859	0.80151	0.0:0.8647:0.1353:0.0	.	282;277	Q9BZQ4;Q9BZQ4-2	NMNA2_HUMAN;.	S	282;277	ENSP00000287713:G282S;ENSP00000294868:G277S	ENSP00000287713:G282S	G	-	1	0	NMNAT2	181488479	1.000000	0.71417	0.873000	0.34254	0.972000	0.66771	7.496000	0.81526	1.314000	0.45095	0.650000	0.86243	GGC		0.582	NMNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086255.1			32	53	0	0	0	0.003271	0	32	53				
PPP1R12B	4660	broad.mit.edu	37	1	202418211	202418211	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:202418211C>T	ENST00000608999.1	+	13	1915	c.1762C>T	c.(1762-1764)Ctt>Ttt	p.L588F	PPP1R12B_ENST00000336894.4_Missense_Mutation_p.L588F	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	588					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)	p.L588F(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			CAATCGCCCTCTTCCTAGCAC	0.512																																							uc001gya.1		NA																	1	Substitution - Missense(1)		cervix(1)	ovary(3)	3						c.(1762-1764)CTT>TTT		protein phosphatase 1, regulatory (inhibitor)							124.0	104.0	111.0					1																	202418211		2203	4300	6503	SO:0001583	missense	4660				regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity	g.chr1:202418211C>T	AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1762C>T	1.37:g.202418211C>T	ENSP00000476755:p.Leu588Phe		Somatic				PPP1R12B_uc001gxz.1_Missense_Mutation_p.L588F	p.L588F	NM_002481	NP_002472	WXS	Illumina HiSeq	Unspecified	O60237	MYPT2_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.166)		13	1906	+			588					A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	ENST00000608999.1	37	c.1762C>T	CCDS1426.1	.	.	.	.	.	.	.	.	.	.	C	1.658	-0.512105	0.04200	.	.	ENSG00000077157	ENST00000406302;ENST00000336894	T;T	0.41400	1.0;1.02	5.51	2.56	0.30785	.	0.868455	0.10084	N	0.718028	T	0.21674	0.0522	N	0.08118	0	0.18873	N	0.999989	B;B	0.32203	0.13;0.36	B;B	0.27608	0.036;0.081	T	0.15150	-1.0447	10	0.56958	D	0.05	.	7.121	0.25444	0.0:0.4873:0.3515:0.1612	.	588;588	O60237;F8W8M3	MYPT2_HUMAN;.	F	588	ENSP00000384496:L588F;ENSP00000337897:L588F	ENSP00000337897:L588F	L	+	1	0	PPP1R12B	200684834	0.130000	0.22417	0.381000	0.26106	0.635000	0.38103	0.371000	0.20450	0.353000	0.24079	-0.140000	0.14226	CTT		0.512	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105		6	56	0	0	0	0.001168	0	6	56				
KLHDC8A	55220	broad.mit.edu	37	1	205312401	205312401	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:205312401C>T	ENST00000367156.3	-	5	1148	c.332G>A	c.(331-333)aGc>aAc	p.S111N	KLHDC8A_ENST00000606529.1_5'Flank|KLHDC8A_ENST00000537168.1_Intron|KLHDC8A_ENST00000539253.1_Missense_Mutation_p.S111N|KLHDC8A_ENST00000460687.1_Intron|KLHDC8A_ENST00000367155.3_Missense_Mutation_p.S111N	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	111										breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			ACGCAGCATGCTCCTCTTCTT	0.622																																							uc001hcf.1		NA																	0				ovary(1)	1						c.(331-333)AGC>AAC		kelch domain containing 8A							102.0	98.0	100.0					1																	205312401		2203	4300	6503	SO:0001583	missense	55220							g.chr1:205312401C>T		CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.332G>A	1.37:g.205312401C>T	ENSP00000356124:p.Ser111Asn		Somatic				KLHDC8A_uc010prg.1_Intron|KLHDC8A_uc001hcg.1_Missense_Mutation_p.S111N	p.S111N	NM_018203	NP_060673	WXS	Illumina HiSeq	Unspecified	Q8IYD2	KLD8A_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.117)		2	900	-	Breast(84;0.23)		111			Kelch 3.		B3KU70|Q9NVG5	Missense_Mutation	SNP	ENST00000367156.3	37	c.332G>A	CCDS30985.1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.111495	0.56398	.	.	ENSG00000162873	ENST00000367155;ENST00000367156;ENST00000539253	T;T;T	0.78924	-1.22;-1.22;-1.22	5.65	5.65	0.86999	Kelch-type beta propeller (1);	0.085779	0.85682	D	0.000000	T	0.71837	0.3387	L	0.50919	1.6	0.43118	D	0.99483	B	0.12630	0.006	B	0.15870	0.014	T	0.68819	-0.5308	10	0.54805	T	0.06	-29.9045	11.1355	0.48373	0.0:0.8837:0.0:0.1163	.	111	Q8IYD2	KLD8A_HUMAN	N	111	ENSP00000356123:S111N;ENSP00000356124:S111N;ENSP00000442229:S111N	ENSP00000356123:S111N	S	-	2	0	KLHDC8A	203579024	0.996000	0.38824	0.985000	0.45067	0.808000	0.45660	3.283000	0.51701	2.646000	0.89796	0.655000	0.94253	AGC		0.622	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090397.1	NM_018203		13	190	0	0	0	0.003163	0	13	190				
IRF6	3664	broad.mit.edu	37	1	209965758	209965758	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:209965758G>C	ENST00000367021.3	-	6	695	c.523C>G	c.(523-525)Cca>Gca	p.P175A	IRF6_ENST00000542854.1_Missense_Mutation_p.P80A	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	175					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		ACACTGGCTGGCGCCATGGGA	0.547										HNSCC(57;0.16)																													uc001hhq.1		NA																	0				ovary(2)	2						c.(523-525)CCA>GCA		interferon regulatory factor 6							66.0	60.0	62.0					1																	209965758		2203	4300	6503	SO:0001583	missense	3664				cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr1:209965758G>C	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.523C>G	1.37:g.209965758G>C	ENSP00000355988:p.Pro175Ala	HNSCC(57;0.16)	Somatic				IRF6_uc010psm.1_Missense_Mutation_p.P80A|IRF6_uc009xct.1_Missense_Mutation_p.P175A	p.P175A	NM_006147	NP_006138	WXS	Illumina HiSeq	Unspecified	O14896	IRF6_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0351)	6	786	-			175					B4DLE2|D3DT90|F5GWX8|G0ZTL0	Missense_Mutation	SNP	ENST00000367021.3	37	c.523C>G	CCDS1492.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147388	0.57151	.	.	ENSG00000117595	ENST00000367021;ENST00000542854;ENST00000456314	D;D;D	0.97831	-4.43;-3.97;-4.56	5.82	5.82	0.92795	.	1.047180	0.07482	N	0.904061	D	0.94262	0.8157	N	0.19112	0.55	0.80722	D	1	B	0.30406	0.278	B	0.24974	0.057	D	0.84652	0.0701	9	.	.	.	.	13.3228	0.60442	0.0719:0.0:0.9281:0.0	.	175	O14896	IRF6_HUMAN	A	175;80;175	ENSP00000355988:P175A;ENSP00000440532:P80A;ENSP00000403855:P175A	.	P	-	1	0	IRF6	208032381	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.129000	0.71657	2.756000	0.94617	0.563000	0.77884	CCA		0.547	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147		3	40	0	0	0	0.000602	0	3	40				
USH2A	7399	broad.mit.edu	37	1	215972392	215972392	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:215972392G>T	ENST00000307340.3	-	50	10201	c.9815C>A	c.(9814-9816)cCg>cAg	p.P3272Q	USH2A_ENST00000366943.2_Missense_Mutation_p.P3272Q	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3272					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGTGGAGTACGGCATTCTGCC	0.483										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26	GRCh37	CM081850	USH2A	M		c.(9814-9816)CCG>CAG		usherin isoform B							106.0	93.0	97.0					1																	215972392		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215972392G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9815C>A	1.37:g.215972392G>T	ENSP00000305941:p.Pro3272Gln	HNSCC(13;0.011)	Somatic					p.P3272Q	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	50	10202	-			3272			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.9815C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.990349	0.93106	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.13538	2.59;2.58	5.81	5.81	0.92471	Fibronectin, type III (2);	0.000000	0.43579	D	0.000542	T	0.40909	0.1136	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.11518	-1.0584	10	0.87932	D	0	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	3272	O75445	USH2A_HUMAN	Q	3272	ENSP00000305941:P3272Q;ENSP00000355910:P3272Q	ENSP00000305941:P3272Q	P	-	2	0	USH2A	214039015	1.000000	0.71417	0.966000	0.40874	0.999000	0.98932	8.842000	0.92136	2.736000	0.93811	0.655000	0.94253	CCG		0.483	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		18	31	1	0	1.67942e-08	0.006122	2.30007e-08	18	31				
MIA3	375056	broad.mit.edu	37	1	222828121	222828121	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:222828121G>T	ENST00000344922.5	+	18	4618	c.4593G>T	c.(4591-4593)gaG>gaT	p.E1531D	MIA3_ENST00000344507.1_Intron|MIA3_ENST00000340535.7_Missense_Mutation_p.E409D|MIA3_ENST00000344441.6_Missense_Mutation_p.E1531D	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1531					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		AGCAGAAGGAGATGGCTTTGC	0.373																																							uc001hnl.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(4591-4593)GAG>GAT		melanoma inhibitory activity family, member 3							102.0	96.0	98.0					1																	222828121		1938	4141	6079	SO:0001583	missense	375056				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr1:222828121G>T		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.4593G>T	1.37:g.222828121G>T	ENSP00000340900:p.Glu1531Asp		Somatic				MIA3_uc001hnm.2_Missense_Mutation_p.E409D	p.E1531D	NM_198551	NP_940953	WXS	Illumina HiSeq	Unspecified	Q5JRA6	MIA3_HUMAN		GBM - Glioblastoma multiforme(131;0.0199)	18	4602	+			1531			Cytoplasmic (Potential).|Potential.		A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	c.4593G>T	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004819	0.74932	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000340535;ENST00000284471	T;T;T	0.47528	1.5;1.5;0.84	5.46	4.55	0.56014	.	.	.	.	.	T	0.64757	0.2627	M	0.88450	2.955	0.47065	D	0.999303	P;D	0.54397	0.905;0.966	P;P	0.52823	0.624;0.71	T	0.71457	-0.4587	9	0.51188	T	0.08	.	12.7114	0.57092	0.1387:0.0:0.8613:0.0	.	409;1531	Q5JRA6-4;Q5JRA6	.;MIA3_HUMAN	D	1531;1531;1472;409;409	ENSP00000340900:E1531D;ENSP00000340587:E1531D;ENSP00000345866:E409D	ENSP00000284471:E409D	E	+	3	2	MIA3	220894744	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.030000	0.49720	1.439000	0.47511	0.655000	0.94253	GAG		0.373	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551		22	38	1	0	4.26978e-12	0.00333	6.31446e-12	22	38				
TRIM67	440730	broad.mit.edu	37	1	231298752	231298752	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:231298752C>G	ENST00000366653.5	+	1	37	c.37C>G	c.(37-39)Ctg>Gtg	p.L13V	TRIM67_ENST00000449018.3_Missense_Mutation_p.L13V|TRIM67_ENST00000444294.3_Missense_Mutation_p.L13V|TRIM67_ENST00000366652.2_Missense_Mutation_p.L13V			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	13					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GTGCGGCTCTCTGTTTCGGGA	0.667																																							uc009xfn.1		NA																	0				ovary(2)|breast(1)|kidney(1)	4						c.(37-39)CTG>GTG		tripartite motif-containing 67							37.0	41.0	40.0					1																	231298752		2056	4209	6265	SO:0001583	missense	440730					cytoplasm|cytoskeleton	zinc ion binding	g.chr1:231298752C>G	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.37C>G	1.37:g.231298752C>G	ENSP00000355613:p.Leu13Val		Somatic					p.L13V	NM_001004342	NP_001004342	WXS	Illumina HiSeq	Unspecified	Q6ZTA4	TRI67_HUMAN			1	79	+	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)	13			RING-type; degenerate.		Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	ENST00000366653.5	37	c.37C>G	CCDS44333.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069245	0.36470	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99	5.05	3.15	0.36227	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, C3HC4 RING-type (1);	0.258266	0.32161	N	0.006498	T	0.79604	0.4474	N	0.20610	0.595	0.40846	D	0.983716	P	0.46578	0.88	P	0.51945	0.685	T	0.78074	-0.2346	10	0.72032	D	0.01	.	5.8788	0.18844	0.1552:0.6821:0.0:0.1626	.	13	Q6ZTA4	TRI67_HUMAN	V	13	ENSP00000412124:L13V;ENSP00000355612:L13V;ENSP00000400163:L13V;ENSP00000355613:L13V	ENSP00000355612:L13V	L	+	1	2	TRIM67	229365375	0.355000	0.24921	0.987000	0.45799	0.627000	0.37826	0.911000	0.28584	0.623000	0.30267	-0.521000	0.04368	CTG		0.667	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342		3	23	0	0	0	0.000602	0	3	23				
OR2T2	401992	broad.mit.edu	37	1	248616171	248616171	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:248616171C>A	ENST00000342927.3	+	1	95	c.73C>A	c.(73-75)Ccc>Acc	p.P25T		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCCTGCCTTCCCCGGGCTTCT	0.532																																							uc001iek.1		NA																	0				skin(1)	1						c.(73-75)CCC>ACC		olfactory receptor, family 2, subfamily T,							174.0	194.0	187.0					1																	248616171		2202	4300	6502	SO:0001583	missense	401992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248616171C>A	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.73C>A	1.37:g.248616171C>A	ENSP00000343062:p.Pro25Thr		Somatic					p.P25T	NM_001004136	NP_001004136	WXS	Illumina HiSeq	Unspecified	Q6IF00	OR2T2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	73	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		25			Extracellular (Potential).		B2RNM1|B9EH01	Missense_Mutation	SNP	ENST00000342927.3	37	c.73C>A	CCDS31116.1	.	.	.	.	.	.	.	.	.	.	c	0.480	-0.880461	0.02530	.	.	ENSG00000196240	ENST00000342927	T	0.00449	7.37	3.2	3.2	0.36748	.	0.000000	0.47852	D	0.000217	T	0.00300	0.0009	L	0.49350	1.555	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.43081	-0.9413	10	0.06099	T	0.92	.	8.9905	0.36022	0.2218:0.7782:0.0:0.0	.	25	Q6IF00	OR2T2_HUMAN	T	25	ENSP00000343062:P25T	ENSP00000343062:P25T	P	+	1	0	OR2T2	246682794	0.000000	0.05858	0.050000	0.19076	0.392000	0.30506	0.089000	0.15002	1.621000	0.50320	0.298000	0.19748	CCC		0.532	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		4	149	1	0	2.17888e-05	0.006214	2.68104e-05	4	149				
OR2T3	343173	broad.mit.edu	37	1	248637204	248637204	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr1:248637204G>T	ENST00000359594.2	+	1	578	c.553G>T	c.(553-555)Gag>Tag	p.E185*		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTTTTTCTGTGAGACTCCTGC	0.517																																							uc001iel.1		NA																	0				skin(1)	1						c.(553-555)GAG>TAG		olfactory receptor, family 2, subfamily T,							79.0	70.0	73.0					1																	248637204		2161	4267	6428	SO:0001587	stop_gained	343173				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248637204G>T		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.553G>T	1.37:g.248637204G>T	ENSP00000352604:p.Glu185*		Somatic					p.E185*	NM_001005495	NP_001005495	WXS	Illumina HiSeq	Unspecified	Q8NH03	OR2T3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	553	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		185			Extracellular (Potential).		B2RNJ1	Nonsense_Mutation	SNP	ENST00000359594.2	37	c.553G>T	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	g	17.78	3.473878	0.63737	.	.	ENSG00000196539	ENST00000359594	.	.	.	2.37	2.37	0.29283	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.721	0.51683	0.0:0.0:1.0:0.0	.	.	.	.	X	185	.	ENSP00000352604:E185X	E	+	1	0	OR2T3	246703827	1.000000	0.71417	0.411000	0.26484	0.143000	0.21401	2.462000	0.45049	1.014000	0.39417	0.186000	0.17326	GAG		0.517	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495		7	45	1	0	3.09899e-07	0.004482	4.06742e-07	7	45				
GAD2	2572	broad.mit.edu	37	10	26589834	26589834	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr10:26589834C>A	ENST00000376261.3	+	16	2205	c.1702C>A	c.(1702-1704)Cac>Aac	p.H568N	GAD2_ENST00000259271.3_Missense_Mutation_p.H568N	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	568					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						AGCGGCAACTCACCAAGACAT	0.448																																							uc001isp.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1702-1704)CAC>AAC		glutamate decarboxylase 2	L-Glutamic Acid(DB00142)						157.0	146.0	150.0					10																	26589834		2203	4300	6503	SO:0001583	missense	2572				glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding	g.chr10:26589834C>A	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1702C>A	10.37:g.26589834C>A	ENSP00000365437:p.His568Asn		Somatic				GAD2_uc001isq.2_Missense_Mutation_p.H568N	p.H568N	NM_001134366	NP_001127838	WXS	Illumina HiSeq	Unspecified	Q05329	DCE2_HUMAN			16	2205	+			568					Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	c.1702C>A	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.691348	0.30052	.	.	ENSG00000136750	ENST00000376261;ENST00000259271	T;T	0.37411	1.2;1.2	5.71	5.71	0.89125	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.203468	0.53938	D	0.000060	T	0.29817	0.0745	N	0.24115	0.695	0.80722	D	1	B	0.19706	0.038	B	0.22753	0.041	T	0.04454	-1.0950	10	0.25106	T	0.35	-19.2167	19.8579	0.96771	0.0:1.0:0.0:0.0	.	568	Q05329	DCE2_HUMAN	N	568	ENSP00000365437:H568N;ENSP00000259271:H568N	ENSP00000259271:H568N	H	+	1	0	GAD2	26629840	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.215000	0.58534	2.687000	0.91594	0.655000	0.94253	CAC		0.448	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818		21	76	1	0	1.55469e-16	0.00333	2.49862e-16	21	76				
ANKRD30A	91074	broad.mit.edu	37	10	37430773	37430773	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr10:37430773G>A	ENST00000602533.1	+	7	879	c.780G>A	c.(778-780)acG>acA	p.T260T	ANKRD30A_ENST00000361713.1_Silent_p.T260T|ANKRD30A_ENST00000374660.1_Silent_p.T260T			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	316					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CACCTGACACGGCTGAAAGCT	0.493																																							uc001iza.1		NA																	0				ovary(7)|breast(1)|skin(1)	9						c.(778-780)ACG>ACA		ankyrin repeat domain 30A							54.0	56.0	55.0					10																	37430773		1872	4110	5982	SO:0001819	synonymous_variant	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37430773G>A	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.780G>A	10.37:g.37430773G>A			Somatic					p.T260T	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			7	879	+			316					Q5W025	Silent	SNP	ENST00000602533.1	37	c.780G>A																																																																																					0.493	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		3	37	0	0	0	0.004672	0	3	37				
SGMS1	259230	broad.mit.edu	37	10	52103589	52103589	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr10:52103589C>A	ENST00000361781.2	-	7	1245	c.286G>T	c.(286-288)Ggc>Tgc	p.G96C	SGMS1_ENST00000492601.2_5'Flank|SGMS1_ENST00000361543.2_Missense_Mutation_p.G96C|SGMS1_ENST00000429490.1_Intron	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	102					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						CTGAAGCTGCCGTCGGGGGTG	0.512																																							uc001jje.2		NA																	0				ovary(1)|kidney(1)	2						c.(286-288)GGC>TGC		sphingomyelin synthase 1							98.0	93.0	95.0					10																	52103589		2203	4300	6503	SO:0001583	missense	259230				apoptosis|cell growth|sphingomyelin biosynthetic process	endoplasmic reticulum|Golgi trans cisterna|integral to Golgi membrane|nucleus|plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity	g.chr10:52103589C>A	AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.286G>T	10.37:g.52103589C>A	ENSP00000354829:p.Gly96Cys		Somatic				SGMS1_uc010qhk.1_Intron|SGMS1_uc009xot.1_Intron|SGMS1_uc009xou.1_Missense_Mutation_p.G96C|SGMS1_uc010qhl.1_RNA	p.G96C	NM_147156	NP_671512	WXS	Illumina HiSeq	Unspecified	Q86VZ5	SMS1_HUMAN			7	1240	-			102					Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	ENST00000361781.2	37	c.286G>T	CCDS7240.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761869	0.49468	.	.	ENSG00000198964	ENST00000361781;ENST00000361543	T;T	0.46819	0.86;0.86	5.06	0.669	0.17918	.	0.548590	0.21177	N	0.078883	T	0.34542	0.0901	N	0.22421	0.69	0.20638	N	0.999878	D	0.52996	0.957	P	0.48571	0.582	T	0.17471	-1.0368	10	0.56958	D	0.05	-21.4278	5.6045	0.17371	0.1552:0.5899:0.0:0.2548	.	102	Q86VZ5	SMS1_HUMAN	C	96	ENSP00000354829:G96C;ENSP00000355235:G96C	ENSP00000355235:G96C	G	-	1	0	SGMS1	51773595	0.525000	0.26290	0.250000	0.24296	0.944000	0.59088	0.875000	0.28079	0.173000	0.19788	0.555000	0.69702	GGC		0.512	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048074.2	NM_147156		8	56	1	0	0.00448238	0.004482	0.00500691	8	56				
HK1	3098	broad.mit.edu	37	10	71158462	71158462	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr10:71158462G>C	ENST00000359426.6	+	17	2591	c.2487G>C	c.(2485-2487)agG>agC	p.R829S	HK1_ENST00000360289.2_Missense_Mutation_p.R817S|HK1_ENST00000448642.2_Missense_Mutation_p.R864S|HK1_ENST00000404387.2_Missense_Mutation_p.R833S|HK1_ENST00000298649.3_Missense_Mutation_p.R828S	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	829	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						TGTCCAGGAGGGCCGCACAGC	0.602																																							uc001jpl.3		NA																	0				ovary(1)	1						c.(2485-2487)AGG>AGC		hexokinase 1 isoform HKI							92.0	81.0	84.0					10																	71158462		2203	4300	6503	SO:0001583	missense	3098				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity	g.chr10:71158462G>C	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.2487G>C	10.37:g.71158462G>C	ENSP00000352398:p.Arg829Ser		Somatic				HK1_uc001jpg.3_Missense_Mutation_p.R817S|HK1_uc001jph.3_Missense_Mutation_p.R833S|HK1_uc001jpi.3_Missense_Mutation_p.R833S|HK1_uc001jpj.3_Missense_Mutation_p.R864S|HK1_uc001jpk.3_Missense_Mutation_p.R828S	p.R829S	NM_000188	NP_000179	WXS	Illumina HiSeq	Unspecified	P19367	HXK1_HUMAN			17	2588	+			829			Catalytic.		E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	37	c.2487G>C	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431923	0.62844	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.99619	-6.28;-6.28;-6.28;-6.28;-6.28	5.49	3.63	0.41609	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99782	0.9909	H	0.99130	4.44	0.80722	D	1	D;D;D;D;B	0.89917	1.0;1.0;1.0;1.0;0.15	D;D;D;D;B	0.97110	1.0;1.0;1.0;1.0;0.002	D	0.97328	0.9948	10	0.87932	D	0	-33.5027	10.241	0.43312	0.215:0.0:0.785:0.0	.	829;828;864;833;817	P19367;P19367-2;E7ENR4;P19367-3;P19367-4	HXK1_HUMAN;.;.;.;.	S	817;864;833;828;829;829	ENSP00000353433:R817S;ENSP00000402103:R864S;ENSP00000384774:R833S;ENSP00000298649:R828S;ENSP00000352398:R829S	ENSP00000298649:R828S	R	+	3	2	HK1	70828468	0.994000	0.37717	0.957000	0.39632	0.789000	0.44602	0.408000	0.21065	1.307000	0.44944	0.563000	0.77884	AGG		0.602	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188		8	45	0	0	0	0.000978	0	8	45				
TRIM8	81603	broad.mit.edu	37	10	104416839	104416839	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr10:104416839G>T	ENST00000302424.7	+	6	1506	c.1384G>T	c.(1384-1386)Ggc>Tgc	p.G462C		NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	462					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCAGTATGGCGGCCGCAAGAT	0.657																																							uc001kvz.2		NA																	0				ovary(1)	1						c.(1384-1386)GGC>TGC		tripartite motif-containing 8							41.0	47.0	45.0					10																	104416839		2203	4300	6503	SO:0001583	missense	81603					cytoplasm|PML body	ligase activity|protein homodimerization activity|zinc ion binding	g.chr10:104416839G>T	AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.1384G>T	10.37:g.104416839G>T	ENSP00000302120:p.Gly462Cys		Somatic					p.G462C	NM_030912	NP_112174	WXS	Illumina HiSeq	Unspecified	Q9BZR9	TRIM8_HUMAN		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	6	1507	+		Colorectal(252;0.122)	462					A6NI31|Q9C028	Missense_Mutation	SNP	ENST00000302424.7	37	c.1384G>T	CCDS31274.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672762	0.67928	.	.	ENSG00000171206	ENST00000302424;ENST00000369896	D	0.83075	-1.68	5.43	4.53	0.55603	.	0.000000	0.85682	D	0.000000	D	0.83529	0.5274	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	P	0.62298	0.9	D	0.85878	0.1420	10	0.87932	D	0	.	14.2575	0.66062	0.0722:0.0:0.9278:0.0	.	462	Q9BZR9	TRIM8_HUMAN	C	462;461	ENSP00000302120:G462C	ENSP00000302120:G462C	G	+	1	0	TRIM8	104406829	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.337000	0.72958	1.298000	0.44778	0.491000	0.48974	GGC		0.657	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050084.3	NM_030912		9	53	1	0	0.000673444	0.008291	0.000768605	9	53				
PDCD11	22984	broad.mit.edu	37	10	105205183	105205183	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr10:105205183G>T	ENST00000369797.3	+	36	5587	c.5493G>T	c.(5491-5493)atG>atT	p.M1831I		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1831					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CCAAGAGAATGAAGTTCTTCT	0.542																																							uc001kwy.1		NA																	0				ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7						c.(5491-5493)ATG>ATT		programmed cell death 11							166.0	143.0	151.0					10																	105205183		2203	4300	6503	SO:0001583	missense	22984				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding	g.chr10:105205183G>T	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.5493G>T	10.37:g.105205183G>T	ENSP00000358812:p.Met1831Ile		Somatic					p.M1831I	NM_014976	NP_055791	WXS	Illumina HiSeq	Unspecified	Q14690	RRP5_HUMAN		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	36	5580	+		Colorectal(252;0.0747)|Breast(234;0.128)	1831			HAT 4.		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	c.5493G>T	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686572	0.47991	.	.	ENSG00000148843	ENST00000369797	T	0.33438	1.41	5.6	5.6	0.85130	Suppressor of forked (1);	0.041581	0.85682	D	0.000000	T	0.20455	0.0492	L	0.28694	0.88	0.58432	D	0.999999	P	0.35684	0.515	B	0.28991	0.097	T	0.05386	-1.0888	10	0.14656	T	0.56	-36.3637	15.1249	0.72475	0.0:0.1409:0.8591:0.0	.	1831	Q14690	RRP5_HUMAN	I	1831	ENSP00000358812:M1831I	ENSP00000358812:M1831I	M	+	3	0	PDCD11	105195173	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.536000	0.67180	2.653000	0.90120	0.561000	0.74099	ATG		0.542	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			15	78	1	0	2.35188e-11	0.006122	3.44578e-11	15	78				
SORCS3	22986	broad.mit.edu	37	10	106401672	106401672	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr10:106401672A>C	ENST00000369701.3	+	1	814	c.587A>C	c.(586-588)cAc>cCc	p.H196P		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	196					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GACTCGGCCCACAACCAAGCC	0.706																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	0				ovary(6)|skin(3)|central_nervous_system(1)	10						c.(586-588)CAC>CCC		VPS10 domain receptor protein SORCS 3 precursor							8.0	9.0	9.0					10																	106401672		2165	4214	6379	SO:0001583	missense	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106401672A>C	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.587A>C	10.37:g.106401672A>C	ENSP00000358715:p.His196Pro		Somatic					p.H196P	NM_014978	NP_055793	WXS	Illumina HiSeq	Unspecified	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	1	814	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	196			Lumenal (Potential).		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	c.587A>C	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.278052	0.80692	.	.	ENSG00000156395	ENST00000369701	T	0.36157	1.27	4.4	3.23	0.37069	.	0.425981	0.21216	N	0.078230	T	0.45155	0.1328	L	0.52011	1.625	0.44104	D	0.996874	P	0.52577	0.954	P	0.56216	0.794	T	0.36672	-0.9738	10	0.72032	D	0.01	.	9.879	0.41222	0.8466:0.0:0.0:0.1534	.	196	Q9UPU3	SORC3_HUMAN	P	196	ENSP00000358715:H196P	ENSP00000358715:H196P	H	+	2	0	SORCS3	106391662	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.909000	0.92647	0.685000	0.31468	0.460000	0.39030	CAC		0.706	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		3	20	0	0	0	0.000602	0	3	20				
TUBGCP2	10844	broad.mit.edu	37	10	135097385	135097385	+	Splice_Site	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr10:135097385C>T	ENST00000252936.3	-	13	2185		c.e13+1		TUBGCP2_ENST00000368563.2_Splice_Site|TUBGCP2_ENST00000368562.1_Splice_Site|TUBGCP2_ENST00000543663.1_Splice_Site|TUBGCP2_ENST00000417178.2_Splice_Site			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CTAAAACTCACGGATTTCAGG	0.493																																							uc001lmg.1		NA																	0					0						c.e14+1		tubulin, gamma complex associated protein 2							154.0	142.0	146.0					10																	135097385		2203	4300	6503	SO:0001630	splice_region_variant	10844				G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding	g.chr10:135097385C>T	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.2145+1G>A	10.37:g.135097385C>T			Somatic				TUBGCP2_uc001lmf.1_Splice_Site_p.S308_splice|TUBGCP2_uc010qvc.1_Splice_Site_p.S743_splice|TUBGCP2_uc009ybk.1_Splice_Site_p.S738_splice|TUBGCP2_uc010qvd.1_Splice_Site_p.S585_splice|TUBGCP2_uc001lmh.1_Splice_Site	p.S715_splice	NM_006659	NP_006650	WXS	Illumina HiSeq	Unspecified	Q9BSJ2	GCP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)	14	2502	-		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)						B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Splice_Site	SNP	ENST00000252936.3	37	c.2145_splice	CCDS7676.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468945	0.84533	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8382	0.85961	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TUBGCP2	134947375	1.000000	0.71417	0.967000	0.41034	0.874000	0.50279	7.373000	0.79623	2.391000	0.81399	0.655000	0.94253	.		0.493	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		Intron	3	73	0	0	0	0.000602	0	3	73				
EPS8L2	64787	broad.mit.edu	37	11	721571	721571	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:721571C>G	ENST00000533256.1	+	11	1150	c.775C>G	c.(775-777)Ctc>Gtc	p.L259V	EPS8L2_ENST00000318562.8_Missense_Mutation_p.L259V|EPS8L2_ENST00000526198.1_Missense_Mutation_p.L275V|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000530636.1_Missense_Mutation_p.L259V			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	259					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCAGCAAATCCTCAACTGCGC	0.632																																							uc001lqt.2		NA																	0				pancreas(1)	1						c.(775-777)CTC>GTC		epidermal growth factor receptor pathway							23.0	27.0	26.0					11																	721571		2189	4277	6466	SO:0001583	missense	64787					cytoplasm		g.chr11:721571C>G	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.775C>G	11.37:g.721571C>G	ENSP00000435585:p.Leu259Val		Somatic				EPS8L2_uc010qwj.1_Missense_Mutation_p.L275V|EPS8L2_uc001lqu.2_Missense_Mutation_p.L259V|EPS8L2_uc010qwk.1_Missense_Mutation_p.L275V|EPS8L2_uc001lqv.2_Missense_Mutation_p.L214V|EPS8L2_uc001lqw.2_5'UTR|EPS8L2_uc001lqx.2_5'Flank|EPS8L2_uc001lqy.2_5'Flank	p.L259V	NM_022772	NP_073609	WXS	Illumina HiSeq	Unspecified	Q9H6S3	ES8L2_HUMAN		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)	10	1022	+		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)	259					B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Missense_Mutation	SNP	ENST00000533256.1	37	c.775C>G	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	c	19.98	3.927262	0.73327	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	3.75	3.75	0.43078	.	0.102594	0.40554	U	0.001075	T	0.65883	0.2734	M	0.71036	2.16	0.54753	D	0.99998	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.83275	0.996;0.991;0.991	T	0.68085	-0.5502	10	0.87932	D	0	-37.1105	5.9387	0.19181	0.0:0.7797:0.0:0.2203	.	275;303;259	B7ZKL3;B4DFD2;Q9H6S3	.;.;ES8L2_HUMAN	V	259;259;259;275	ENSP00000320828:L259V;ENSP00000435585:L259V;ENSP00000436035:L259V;ENSP00000436230:L275V	ENSP00000320828:L259V	L	+	1	0	EPS8L2	711571	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.339000	0.59322	2.107000	0.64212	0.552000	0.68991	CTC		0.632	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772		3	15	0	0	0	0.004672	0	3	15				
KRTAP5-4	387267	broad.mit.edu	37	11	1643028	1643028	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:1643028C>A	ENST00000399682.1	-	1	340	c.296G>T	c.(295-297)gGg>gTg	p.G99V		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCCACAGCCCCCCTTGGAACC	0.682																																							uc009ycy.1		NA																	0					0						c.(433-435)GGG>GTG		keratin associated protein 5-4							6.0	12.0	10.0					11																	1643028		636	1503	2139	SO:0001583	missense	387267					keratin filament		g.chr11:1643028C>A	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.296G>T	11.37:g.1643028C>A	ENSP00000382590:p.Gly99Val		Somatic					p.G145V	NM_001012709	NP_001012727	WXS	Illumina HiSeq	Unspecified	Q6L8H1	KRA54_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	3	521	-		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	159			9 X 4 AA repeats of C-C-X-P.			Missense_Mutation	SNP	ENST00000399682.1	37	c.434G>T		.	.	.	.	.	.	.	.	.	.	c	3.111	-0.182655	0.06340	.	.	ENSG00000241598	ENST00000399682;ENST00000328953	T	0.00801	5.68	3.13	2.2	0.27929	.	.	.	.	.	T	0.05135	0.0137	M	0.88310	2.945	0.34090	D	0.660606	D	0.69078	0.997	D	0.63488	0.915	T	0.09079	-1.0691	9	0.62326	D	0.03	.	9.4676	0.38822	0.2145:0.7854:0.0:0.0	.	159	Q6L8H1	KRA54_HUMAN	V	99	ENSP00000382590:G99V	ENSP00000331603:G99V	G	-	2	0	KRTAP5-4	1599604	0.020000	0.18652	0.753000	0.31225	0.162000	0.22319	1.210000	0.32370	0.403000	0.25479	-0.267000	0.10333	GGG		0.682	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709		10	79	1	0	2.48551e-13	0.00499	3.81919e-13	10	79				
CALCA	796	broad.mit.edu	37	11	14992652	14992652	+	Splice_Site	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:14992652C>G	ENST00000486207.1	-	1	95		c.e1+1		CALCA_ENST00000331587.4_Splice_Site|CALCA_ENST00000396372.2_Splice_Site|CALCA_ENST00000359642.3_Splice_Site|CALCA_ENST00000361010.3_Splice_Site|CALCB_ENST00000523376.1_Intron			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha						activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						GGCTGTCTTACCTGAATGGTG	0.532																																							uc001mlt.1		NA																	0				central_nervous_system(1)	1						c.e2+1		calcitonin isoform CGRP preproprotein	Phentolamine(DB00692)						100.0	89.0	93.0					11																	14992652		2200	4294	6494	SO:0001630	splice_region_variant	796				activation of adenylate cyclase activity|cell-cell signaling|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|endothelial cell migration|endothelial cell proliferation|leukocyte cell-cell adhesion|negative regulation of blood pressure|negative regulation of bone resorption|negative regulation of calcium ion transport into cytosol|negative regulation of osteoclast differentiation|neurological system process involved in regulation of systemic arterial blood pressure|positive regulation of interleukin-1 alpha production|positive regulation of interleukin-8 production|positive regulation of macrophage differentiation|positive regulation of vasodilation|regulation of blood pressure|vasculature development|vasodilation	cytosol|extracellular space	hormone activity	g.chr11:14992652C>G	X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.86+1G>C	11.37:g.14992652C>G			Somatic				CALCA_uc001mlu.1_Splice_Site|CALCA_uc001mlv.1_Splice_Site_p.R29_splice|CALCA_uc001mlw.1_Splice_Site_p.R29_splice	p.R29_splice	NM_001033953	NP_001029125	WXS	Illumina HiSeq	Unspecified	P06881	CALCA_HUMAN			2	161	-								Q93048|Q9UCP0	Splice_Site	SNP	ENST00000486207.1	37	c.86_splice	CCDS31432.1	.	.	.	.	.	.	.	.	.	.	C	9.760	1.169748	0.21621	.	.	ENSG00000110680	ENST00000486207;ENST00000361010;ENST00000359642;ENST00000331587;ENST00000396372	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3501	0.83202	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CALCA	14949228	1.000000	0.71417	0.805000	0.32314	0.067000	0.16453	3.007000	0.49536	2.615000	0.88500	0.655000	0.94253	.		0.532	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357068.1	NM_001741	Intron	7	58	0	0	0	0.00308	0	7	58				
SLC17A6	57084	broad.mit.edu	37	11	22399021	22399021	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:22399021C>A	ENST00000263160.3	+	12	1921	c.1484C>A	c.(1483-1485)gCa>gAa	p.A495E		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	495					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						ATATTTTATGCAATATTTGCC	0.438																																							uc001mqk.2		NA																	0				ovary(3)|breast(1)	4						c.(1483-1485)GCA>GAA		solute carrier family 17 (sodium-dependent							72.0	74.0	73.0					11																	22399021		2203	4300	6503	SO:0001583	missense	57084				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity	g.chr11:22399021C>A	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1484C>A	11.37:g.22399021C>A	ENSP00000263160:p.Ala495Glu		Somatic					p.A495E	NM_020346	NP_065079	WXS	Illumina HiSeq	Unspecified	Q9P2U8	VGLU2_HUMAN			12	1897	+			495			Helical; (Potential).		A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	c.1484C>A	CCDS7856.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307216	0.60305	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.59906	0.23	5.98	2.91	0.33838	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.154450	0.56097	D	0.000021	T	0.56411	0.1983	L	0.54323	1.7	0.47511	D	0.999441	P	0.36315	0.547	B	0.40228	0.323	T	0.55692	-0.8101	10	0.30854	T	0.27	.	16.8431	0.85973	0.0:0.3253:0.6747:0.0	.	495	Q9P2U8	VGLU2_HUMAN	E	495;383	ENSP00000263160:A495E	ENSP00000263160:A495E	A	+	2	0	SLC17A6	22355597	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.367000	0.52350	0.794000	0.33899	0.655000	0.94253	GCA		0.438	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346		7	39	1	0	5.18039e-06	0.00308	6.55351e-06	7	39				
KIAA1549L	25758	broad.mit.edu	37	11	33566850	33566850	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:33566850C>T	ENST00000321505.4	+	2	2600	c.2420C>T	c.(2419-2421)gCt>gTt	p.A807V	KIAA1549L_ENST00000265654.5_Missense_Mutation_p.A813V|KIAA1549L_ENST00000389726.3_Missense_Mutation_p.A813V			Q6ZVL6	K154L_HUMAN	KIAA1549-like	807						integral component of membrane (GO:0016021)											GCTGCATCGGCTGCAGTGGTC	0.547																																							uc001mup.3		NA																	0				ovary(2)	2						c.(2437-2439)GCT>GTT		hypothetical protein LOC25758							38.0	45.0	43.0					11																	33566850		2145	4262	6407	SO:0001583	missense	25758					integral to membrane		g.chr11:33566850C>T	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2420C>T	11.37:g.33566850C>T	ENSP00000315295:p.Ala807Val		Somatic				C11orf41_uc001mun.1_Missense_Mutation_p.A813V	p.A813V	NM_012194	NP_036326	WXS	Illumina HiSeq	Unspecified	Q6ZVL6	CK041_HUMAN			2	2562	+			807					B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	c.2438C>T	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	C	7.574	0.667339	0.14710	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568	.	.	.	5.81	3.96	0.45880	.	0.355212	0.29493	N	0.012000	T	0.26340	0.0643	N	0.14661	0.345	0.09310	N	1	B;B	0.23442	0.085;0.034	B;B	0.24394	0.039;0.053	T	0.17776	-1.0358	9	0.46703	T	0.11	-2.9019	10.6231	0.45491	0.0:0.7994:0.1312:0.0694	.	813;813	E9PAT2;Q6ZVL6-2	.;.	V	807;813;813;646	.	ENSP00000265654:A813V	A	+	2	0	C11orf41	33523426	0.001000	0.12720	0.002000	0.10522	0.006000	0.05464	0.893000	0.28336	0.821000	0.34540	-0.225000	0.12378	GCT		0.547	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194		3	27	0	0	0	0.004672	0	3	27				
CREB3L1	90993	broad.mit.edu	37	11	46342033	46342033	+	Missense_Mutation	SNP	G	G	A	rs368441030		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:46342033G>A	ENST00000529193.1	+	11	1928	c.1477G>A	c.(1477-1479)Ggc>Agc	p.G493S	CREB3L1_ENST00000288400.3_Missense_Mutation_p.G493S			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	493					regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		CGGTGGAAACGGCACCAGCCC	0.637			T	FUS	myxofibrosarcoma																																Pancreas(3;159 194 19597 26278 47995)	Pancreas(3;159 194 19597 26278 47995)	uc001ncf.2		NA		Dom	yes		11	11p11.2	90993	T	cAMP responsive element binding protein 3-like 1			M	FUS		myxofibrosarcoma	FUS/CREB3L1(6)	0				soft_tissue(6)|ovary(2)	8						c.(1477-1479)GGC>AGC		cAMP responsive element binding protein 3-like		G	SER/GLY	0,4234		0,0,2117	27.0	36.0	33.0		1477	0.3	0.3	11		33	1,8399		0,1,4199	no	missense	CREB3L1	NM_052854.2	56	0,1,6316	AA,AG,GG		0.0119,0.0,0.0079	benign	493/520	46342033	1,12633	2117	4200	6317	SO:0001583	missense	90993				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:46342033G>A		CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.1477G>A	11.37:g.46342033G>A	ENSP00000434939:p.Gly493Ser		Somatic				CREB3L1_uc001ncg.2_Missense_Mutation_p.G127S	p.G493S	NM_052854	NP_443086	WXS	Illumina HiSeq	Unspecified	Q96BA8	CR3L1_HUMAN		GBM - Glioblastoma multiforme(35;0.0285)	11	1912	+			493			Lumenal (Potential).		Q8N2D5|Q96CP0	Missense_Mutation	SNP	ENST00000529193.1	37	c.1477G>A	CCDS53620.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785777	0.31593	0.0	1.19E-4	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415	T;T	0.62788	-0.0;-0.0	4.69	0.291	0.15732	.	0.496834	0.18800	N	0.130816	T	0.23727	0.0574	N	0.02011	-0.69	0.23454	N	0.997643	B;B	0.25235	0.121;0.0	B;B	0.14023	0.01;0.0	T	0.28586	-1.0039	10	0.06625	T	0.88	-0.2329	5.1429	0.14969	0.2949:0.2543:0.4508:0.0	.	405;493	Q96BA8-2;Q96BA8	.;CR3L1_HUMAN	S	493;493;405	ENSP00000434939:G493S;ENSP00000288400:G493S	ENSP00000288400:G493S	G	+	1	0	CREB3L1	46298609	0.056000	0.20664	0.341000	0.25589	0.937000	0.57800	0.521000	0.22893	0.071000	0.16664	0.430000	0.28490	GGC		0.637	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854		3	11	0	0	0	0.000248	0	3	11				
OR4C6	219432	broad.mit.edu	37	11	55433333	55433333	+	Missense_Mutation	SNP	C	C	T	rs140747151	byFrequency	TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:55433333C>T	ENST00000314259.3	+	1	720	c.691C>T	c.(691-693)Cgg>Tgg	p.R231W		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R231W(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						CTCTAAAGGGCGGCACAAAGC	0.502													c|||	2	0.000399361	0.0	0.0	5008	,	,		18006	0.0		0.002	False		,,,				2504	0.0						uc001nht.3		NA																	1	Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(1)	skin(2)	2						c.(691-693)CGG>TGG		olfactory receptor, family 4, subfamily C,		C	TRP/ARG	0,4400		0,0,2200	132.0	126.0	128.0		691	-8.1	0.0	11	dbSNP_134	128	3,8589	3.0+/-9.4	0,3,4293	yes	missense	OR4C6	NM_001004704.1	101	0,3,6493	TT,TC,CC		0.0349,0.0,0.0231	benign	231/310	55433333	3,12989	2200	4296	6496	SO:0001583	missense	219432				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55433333C>T	CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.691C>T	11.37:g.55433333C>T	ENSP00000324769:p.Arg231Trp		Somatic				OR4C6_uc010rik.1_Missense_Mutation_p.R231W	p.R231W	NM_001004704	NP_001004704	WXS	Illumina HiSeq	Unspecified	Q8NH72	OR4C6_HUMAN			3	956	+			231			Cytoplasmic (Potential).		B2RP11|Q6IFD2	Missense_Mutation	SNP	ENST00000314259.3	37	c.691C>T	CCDS31506.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	5.384	0.256036	0.10185	0.0	3.49E-4	ENSG00000181903	ENST00000314259	T	0.00335	8.06	4.07	-8.14	0.01069	GPCR, rhodopsin-like superfamily (1);	0.754623	0.10587	N	0.657205	T	0.00328	0.0010	M	0.87971	2.92	0.09310	N	1	B	0.22146	0.065	B	0.26693	0.072	T	0.27773	-1.0064	10	0.72032	D	0.01	.	6.9124	0.24342	0.6124:0.1383:0.0:0.2493	.	231	Q8NH72	OR4C6_HUMAN	W	231	ENSP00000324769:R231W	ENSP00000324769:R231W	R	+	1	2	OR4C6	55189909	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-4.913000	0.00170	-1.249000	0.02500	0.543000	0.68304	CGG		0.502	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1	NM_001004704		3	94	0	0	0	0.000248	0	3	94				
OR5L1	219437	broad.mit.edu	37	11	55579671	55579672	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:55579671_55579672CC>TA	ENST00000333973.2	+	1	818_819	c.729_730CC>TA	c.(727-732)tcCCac>tcTAac	p.H244N		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CCTGTGCTTCCCACCTCACAGC	0.52																																							uc001nhw.1		NA																	0				skin(3)|ovary(2)	5						c.(727-732)TCCCAC>TCTAAC		olfactory receptor, family 5, subfamily L,																																				SO:0001583	missense	219437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55579671_55579672CC>TA	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	Exception_encountered	11.37:g.55579671_55579672delinsTA	ENSP00000335529:p.His244Asn		Somatic					p.H244N	NM_001004738	NP_001004738	WXS	Illumina HiSeq	Unspecified	Q8NGL2	OR5L1_HUMAN			1	729_730	+		all_epithelial(135;0.208)	244			Helical; Name=6; (Potential).		B2RNK6|Q6IFD0	Missense_Mutation	DNP	ENST00000333973.2	37	c.729_730CC>TA	CCDS31509.1																																																																																				0.520	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738		11	75	0	0	0	0.004672	0	11	75				
OR5AS1	219447	broad.mit.edu	37	11	55798471	55798471	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:55798471C>A	ENST00000313555.1	+	1	577	c.577C>A	c.(577-579)Cag>Aag	p.Q193K		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					TACAGACACTCAGATCAACCA	0.418																																							uc010riw.1		NA																	0				ovary(3)|liver(1)|skin(1)	5						c.(577-579)CAG>AAG		olfactory receptor, family 5, subfamily AS,							309.0	307.0	307.0					11																	55798471		2201	4296	6497	SO:0001583	missense	219447				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55798471C>A	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.577C>A	11.37:g.55798471C>A	ENSP00000324111:p.Gln193Lys		Somatic					p.Q193K	NM_001001921	NP_001001921	WXS	Illumina HiSeq	Unspecified	Q8N127	O5AS1_HUMAN			1	577	+	Esophageal squamous(21;0.00693)		193			Extracellular (Potential).		Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	37	c.577C>A	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	C	3.182	-0.167761	0.06461	.	.	ENSG00000181785	ENST00000313555	T	0.00054	8.8	5.46	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	1.418270	0.05129	U	0.492240	T	0.00144	0.0004	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38067	-0.9678	10	0.72032	D	0.01	.	4.0708	0.09880	0.0:0.3679:0.2988:0.3333	.	193	Q8N127	O5AS1_HUMAN	K	193	ENSP00000324111:Q193K	ENSP00000324111:Q193K	Q	+	1	0	OR5AS1	55555047	0.000000	0.05858	0.015000	0.15790	0.029000	0.11900	-2.110000	0.01334	0.681000	0.31386	0.643000	0.83706	CAG		0.418	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		28	206	1	0	3.76114e-14	0.004289	5.83625e-14	28	206				
OR5AS1	219447	broad.mit.edu	37	11	55798836	55798836	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:55798836G>T	ENST00000313555.1	+	1	942	c.942G>T	c.(940-942)tgG>tgT	p.W314C		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					CAAATGAATGGTATTTAAATC	0.269																																							uc010riw.1		NA																	0				ovary(3)|liver(1)|skin(1)	5						c.(940-942)TGG>TGT		olfactory receptor, family 5, subfamily AS,							44.0	53.0	50.0					11																	55798836		2194	4291	6485	SO:0001583	missense	219447				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55798836G>T	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.942G>T	11.37:g.55798836G>T	ENSP00000324111:p.Trp314Cys		Somatic					p.W314C	NM_001001921	NP_001001921	WXS	Illumina HiSeq	Unspecified	Q8N127	O5AS1_HUMAN			1	942	+	Esophageal squamous(21;0.00693)		314			Cytoplasmic (Potential).		Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	37	c.942G>T	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	G	4.845	0.157089	0.09236	.	.	ENSG00000181785	ENST00000313555	T	0.00358	7.88	3.79	-7.59	0.01308	.	.	.	.	.	T	0.00109	0.0003	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40496	-0.9560	9	0.66056	D	0.02	.	2.5727	0.04798	0.1397:0.1032:0.3544:0.4027	.	314	Q8N127	O5AS1_HUMAN	C	314	ENSP00000324111:W314C	ENSP00000324111:W314C	W	+	3	0	OR5AS1	55555412	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.248000	0.08854	-2.202000	0.00745	-0.496000	0.04628	TGG		0.269	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		5	26	1	0	0.000157383	0.00308	0.000184984	5	26				
OR5T2	219464	broad.mit.edu	37	11	55999767	55999767	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:55999767C>A	ENST00000313264.4	-	1	970	c.895G>T	c.(895-897)Gtg>Ttg	p.V299L		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					CTTGGTCTCACATACATGAAG	0.428																																							uc010rjc.1		NA																	0				ovary(2)	2						c.(895-897)GTG>TTG		olfactory receptor, family 5, subfamily T,							202.0	178.0	186.0					11																	55999767		2201	4296	6497	SO:0001583	missense	219464				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55999767C>A	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.895G>T	11.37:g.55999767C>A	ENSP00000323688:p.Val299Leu		Somatic					p.V299L	NM_001004746	NP_001004746	WXS	Illumina HiSeq	Unspecified	Q8NGG2	OR5T2_HUMAN			1	895	-	Esophageal squamous(21;0.00448)		299			Extracellular (Potential).		B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	c.895G>T	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	C	0.263	-0.998444	0.02145	.	.	ENSG00000181718	ENST00000313264	T	0.33654	1.4	5.07	0.734	0.18294	GPCR, rhodopsin-like superfamily (1);	0.211258	0.22737	U	0.056255	T	0.08758	0.0217	N	0.02181	-0.65	0.18873	N	0.999986	B	0.06786	0.001	B	0.15484	0.013	T	0.28490	-1.0042	10	0.02654	T	1	.	1.5599	0.02593	0.3782:0.3313:0.127:0.1635	.	299	Q8NGG2	OR5T2_HUMAN	L	299	ENSP00000323688:V299L	ENSP00000323688:V299L	V	-	1	0	OR5T2	55756343	0.000000	0.05858	0.743000	0.31040	0.725000	0.41563	-3.052000	0.00627	0.250000	0.21479	-0.534000	0.04291	GTG		0.428	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		22	116	1	0	1.22574e-08	0.002299	1.70091e-08	22	116				
OR5M1	390168	broad.mit.edu	37	11	56380698	56380698	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:56380698T>A	ENST00000526538.1	-	1	280	c.281A>T	c.(280-282)tAc>tTc	p.Y94F		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						GCATCCAGCGTAGGAGATGGT	0.448																																							uc001nja.1		NA																	0				central_nervous_system(1)	1						c.(280-282)TAC>TTC		olfactory receptor, family 5, subfamily M,							152.0	141.0	145.0					11																	56380698		1933	4134	6067	SO:0001583	missense	390168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56380698T>A	AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.281A>T	11.37:g.56380698T>A	ENSP00000435416:p.Tyr94Phe		Somatic					p.Y94F	NM_001004740	NP_001004740	WXS	Illumina HiSeq	Unspecified	Q8NGP8	OR5M1_HUMAN			1	281	-			94			Extracellular (Potential).		Q6IF60|Q96RB6	Missense_Mutation	SNP	ENST00000526538.1	37	c.281A>T	CCDS53631.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.528346	0.00959	.	.	ENSG00000255012	ENST00000526538	T	0.01767	4.65	3.71	-0.762	0.11034	GPCR, rhodopsin-like superfamily (1);	0.464680	0.16091	N	0.230043	T	0.00815	0.0027	N	0.04387	-0.21	0.09310	N	0.999998	B	0.02656	0.0	B	0.09377	0.004	T	0.47923	-0.9079	10	0.05525	T	0.97	-48.0024	8.8053	0.34934	0.6035:0.0:0.0:0.3965	.	94	Q8NGP8	OR5M1_HUMAN	F	94	ENSP00000435416:Y94F	ENSP00000435416:Y94F	Y	-	2	0	OR5M1	56137274	0.000000	0.05858	0.988000	0.46212	0.513000	0.34164	-0.595000	0.05727	0.047000	0.15862	0.232000	0.17820	TAC		0.448	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391610.1	NM_001004740		12	56	0	0	0	0.00499	0	12	56				
CLP1	10978	broad.mit.edu	37	11	57427353	57427353	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:57427353C>T	ENST00000302731.4	+	2	525	c.405C>T	c.(403-405)ctC>ctT	p.L135L	CLP1_ENST00000525602.1_Silent_p.L135L|CLP1_ENST00000533682.1_Silent_p.L135L|CLP1_ENST00000529430.1_Silent_p.L146L	NM_001142597.1|NM_006831.2	NP_001136069.1|NP_006822.1	Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						GCCTTCTGCTCAACTACGCAG	0.597																																							uc001nkw.2		NA																	0				ovary(1)	1						c.(403-405)CTC>CTT		ATP/GTP-binding protein isoform 1							106.0	88.0	94.0					11																	57427353		2201	4296	6497	SO:0001819	synonymous_variant	10978				mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|siRNA loading onto RISC involved in RNA interference|targeting of mRNA for destruction involved in RNA interference|termination of RNA polymerase II transcription|tRNA splicing, via endonucleolytic cleavage and ligation	nucleoplasm|tRNA-intron endonuclease complex	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|ATP-dependent polyribonucleotide 5'-hydroxyl-kinase activity	g.chr11:57427353C>T	BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000302731.4:c.405C>T	11.37:g.57427353C>T			Somatic				CLP1_uc010rjw.1_Silent_p.L135L|CLP1_uc009yml.2_Silent_p.L135L	p.L135L	NM_006831	NP_006822	WXS	Illumina HiSeq	Unspecified	Q92989	CLP1_HUMAN			2	544	+			135					Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000302731.4	37	c.405C>T	CCDS44600.1																																																																																				0.597	CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000393465.1	NM_006831		4	23	0	0	0	0.000602	0	4	23				
TCN1	6947	broad.mit.edu	37	11	59622172	59622172	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:59622172G>T	ENST00000257264.3	-	7	1178	c.1074C>A	c.(1072-1074)ttC>ttA	p.F358L	TCN1_ENST00000532419.1_5'UTR	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	358	Globular C-terminal beta domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCACACTGAGGAAGACAGAAC	0.383																																							uc001noj.2		NA																	0				ovary(2)	2						c.(1072-1074)TTC>TTA		transcobalamin I precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						158.0	144.0	149.0					11																	59622172		2201	4295	6496	SO:0001583	missense	6947				cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding	g.chr11:59622172G>T	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.1074C>A	11.37:g.59622172G>T	ENSP00000257264:p.Phe358Leu		Somatic					p.F358L	NM_001062	NP_001053	WXS	Illumina HiSeq	Unspecified	P20061	TCO1_HUMAN			7	1172	-		all_epithelial(135;0.198)	358					A8KAC5|Q8WV77	Missense_Mutation	SNP	ENST00000257264.3	37	c.1074C>A	CCDS7978.1	.	.	.	.	.	.	.	.	.	.	G	7.556	0.663708	0.14710	.	.	ENSG00000134827	ENST00000257264	T	0.22743	1.94	5.28	3.41	0.39046	.	0.098369	0.43416	D	0.000575	T	0.24586	0.0596	N	0.20845	0.615	0.27391	N	0.955125	D	0.76494	0.999	D	0.78314	0.991	T	0.09250	-1.0683	10	0.18710	T	0.47	.	8.231	0.31597	0.1853:0.0:0.8147:0.0	.	358	P20061	TCO1_HUMAN	L	358	ENSP00000257264:F358L	ENSP00000257264:F358L	F	-	3	2	TCN1	59378748	1.000000	0.71417	0.993000	0.49108	0.014000	0.08584	4.678000	0.61641	0.617000	0.30160	-0.162000	0.13425	TTC		0.383	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394503.1	NM_001062		16	66	1	0	1.37522e-17	0.007413	2.23297e-17	16	66				
AHNAK	79026	broad.mit.edu	37	11	62303495	62303495	+	Missense_Mutation	SNP	C	C	A	rs539541618		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:62303495C>A	ENST00000378024.4	-	3	350	c.76G>T	c.(76-78)Gcc>Tcc	p.A26S	RP11-864I4.3_ENST00000544108.1_RNA|AHNAK_ENST00000257247.7_Missense_Mutation_p.A26S|AHNAK_ENST00000530124.1_Missense_Mutation_p.A26S	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	26	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCCCTCTGGGCGATGGTCAGC	0.637																																							uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(76-78)GCC>TCC		AHNAK nucleoprotein isoform 1							57.0	54.0	55.0					11																	62303495		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62303495C>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.76G>T	11.37:g.62303495C>A	ENSP00000367263:p.Ala26Ser		Somatic				AHNAK_uc001ntk.1_Missense_Mutation_p.A26S	p.A26S	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			3	376	-		Melanoma(852;0.155)	26			PDZ.		A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.76G>T	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.337903	0.24253	.	.	ENSG00000124942	ENST00000530124;ENST00000257247;ENST00000533365;ENST00000378024;ENST00000530285;ENST00000528508;ENST00000531324	T;T;T;T;T;T;T	0.42513	1.7;1.7;1.7;0.97;1.7;1.7;1.7	5.36	1.46	0.22682	PDZ/DHR/GLGF (3);	0.173980	0.24642	U	0.036793	T	0.25606	0.0623	N	0.24115	0.695	0.22500	N	0.999045	P;B	0.38370	0.628;0.201	B;B	0.35470	0.203;0.098	T	0.08911	-1.0699	10	0.51188	T	0.08	-16.3996	9.4167	0.38525	0.0:0.704:0.0:0.296	.	26;26	Q09666;A1A586	AHNK_HUMAN;.	S	26	ENSP00000433789:A26S;ENSP00000257247:A26S;ENSP00000433635:A26S;ENSP00000367263:A26S;ENSP00000433286:A26S;ENSP00000435357:A26S;ENSP00000436845:A26S	ENSP00000257247:A26S	A	-	1	0	AHNAK	62060071	0.989000	0.36119	0.655000	0.29622	0.115000	0.19883	2.611000	0.46334	0.024000	0.15214	-0.734000	0.03567	GCC		0.637	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		8	54	1	0	7.48243e-07	0.006214	9.58116e-07	8	54				
SLC22A12	116085	broad.mit.edu	37	11	64359055	64359055	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:64359055C>T	ENST00000377574.1	+	1	774	c.27C>T	c.(25-27)ctC>ctT	p.L9L	SLC22A12_ENST00000336464.7_Silent_p.L9L|SLC22A12_ENST00000377567.2_Silent_p.L9L|SLC22A12_ENST00000473690.1_Intron|SLC22A12_ENST00000377572.1_Silent_p.L9L	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	9					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	TCCTGGACCTCGTGGGTGGCC	0.597																																							uc001oam.1		NA																	0				ovary(1)	1						c.(25-27)CTC>CTT		urate anion exchanger 1 isoform a							81.0	81.0	81.0					11																	64359055		2201	4297	6498	SO:0001819	synonymous_variant	116085				cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity	g.chr11:64359055C>T	AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.27C>T	11.37:g.64359055C>T			Somatic				SLC22A12_uc009ypr.1_Silent_p.L9L|SLC22A12_uc001oal.1_Intron|SLC22A12_uc009yps.1_Silent_p.L9L|SLC22A12_uc001oan.1_Silent_p.L9L|SLC22A12_uc009ypt.2_5'Flank	p.L9L	NM_144585	NP_653186	WXS	Illumina HiSeq	Unspecified	Q96S37	S22AC_HUMAN			1	774	+			9			Helical; (Potential).		B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Silent	SNP	ENST00000377574.1	37	c.27C>T	CCDS8075.1																																																																																				0.597	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	NM_144585		12	75	0	0	0	0.00245	0	12	75				
SUV420H1	51111	broad.mit.edu	37	11	67953299	67953299	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:67953299C>G	ENST00000304363.4	-	3	610	c.257G>C	c.(256-258)aGt>aCt	p.S86T	SUV420H1_ENST00000405515.1_Missense_Mutation_p.S86T|SUV420H1_ENST00000402185.2_Missense_Mutation_p.S86T|SUV420H1_ENST00000401547.2_Missense_Mutation_p.S86T|SUV420H1_ENST00000402789.1_Missense_Mutation_p.S86T	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	86					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						AAGAACCAAACTGGTTGCTAG	0.393																																							uc001onm.1		NA																	0				ovary(2)|kidney(1)	3						c.(256-258)AGT>ACT		suppressor of variegation 4-20 homolog 1 isoform							124.0	122.0	123.0					11																	67953299		2200	4294	6494	SO:0001583	missense	51111				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr11:67953299C>G	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.257G>C	11.37:g.67953299C>G	ENSP00000305899:p.Ser86Thr		Somatic				SUV420H1_uc009yse.1_5'UTR|SUV420H1_uc001onn.1_5'UTR|SUV420H1_uc009ysf.2_5'UTR|SUV420H1_uc001ono.1_Missense_Mutation_p.S86T|SUV420H1_uc001onp.2_Missense_Mutation_p.S86T|SUV420H1_uc010rqa.1_Missense_Mutation_p.S86T|SUV420H1_uc001onq.2_Missense_Mutation_p.S86T	p.S86T	NM_017635	NP_060105	WXS	Illumina HiSeq	Unspecified	Q4FZB7	SV421_HUMAN			3	513	-			86					B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	37	c.257G>C	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	C	32	5.113079	0.94339	.	.	ENSG00000110066	ENST00000304363;ENST00000401547;ENST00000405515;ENST00000402789;ENST00000402185;ENST00000453170;ENST00000458496;ENST00000434573	T;T;T;T;T;T;T;T	0.50277	0.84;0.84;0.84;0.84;0.75;0.84;0.84;0.84	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	M	0.64997	1.995	0.80722	D	1	D;P;D;D	0.69078	0.991;0.623;0.974;0.997	P;P;D;D	0.75020	0.908;0.53;0.969;0.985	T	0.65253	-0.6213	10	0.52906	T	0.07	-36.0854	20.8794	0.99867	0.0:1.0:0.0:0.0	.	86;86;86;86	B7WNX0;B5MCB3;Q4FZB7-2;Q4FZB7	.;.;.;SV421_HUMAN	T	86;86;86;86;86;15;15;86	ENSP00000305899:S86T;ENSP00000385965:S86T;ENSP00000385640:S86T;ENSP00000385005:S86T;ENSP00000384724:S86T;ENSP00000406377:S15T;ENSP00000403233:S15T;ENSP00000402921:S86T	ENSP00000305899:S86T	S	-	2	0	SUV420H1	67709875	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	AGT		0.393	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635		12	50	0	0	0	0.003163	0	12	50				
ARHGEF17	9828	broad.mit.edu	37	11	73078683	73078683	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:73078683C>T	ENST00000263674.3	+	21	6400	c.6050C>T	c.(6049-6051)cCc>cTc	p.P2017L		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	2017					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CACCGAGGCCCCGCCCCTGCC	0.647																																							uc001otu.2		NA																	0					0						c.(6049-6051)CCC>CTC		Rho guanine nucleotide exchange factor (GEF) 17							68.0	70.0	69.0					11																	73078683		2200	4293	6493	SO:0001583	missense	9828				actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity	g.chr11:73078683C>T	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.6050C>T	11.37:g.73078683C>T	ENSP00000263674:p.Pro2017Leu		Somatic					p.P2017L	NM_014786	NP_055601	WXS	Illumina HiSeq	Unspecified	Q96PE2	ARHGH_HUMAN			21	6071	+			2017					B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	c.6050C>T	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	C	9.341	1.062937	0.19987	.	.	ENSG00000110237	ENST00000263674	T	0.56776	0.44	5.42	2.4	0.29515	.	0.137033	0.51477	N	0.000099	T	0.30978	0.0782	N	0.17082	0.46	0.42364	D	0.992421	B	0.02656	0.0	B	0.04013	0.001	T	0.06625	-1.0816	10	0.37606	T	0.19	-9.0636	6.0968	0.20025	0.1512:0.6831:0.0:0.1657	.	2017	Q96PE2	ARHGH_HUMAN	L	2017	ENSP00000263674:P2017L	ENSP00000263674:P2017L	P	+	2	0	ARHGEF17	72756331	0.935000	0.31712	0.622000	0.29159	0.292000	0.27327	2.114000	0.41911	0.669000	0.31146	-0.254000	0.11334	CCC		0.647	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786		15	72	0	0	0	0.003163	0	15	72				
ME3	10873	broad.mit.edu	37	11	86209163	86209163	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:86209163C>A	ENST00000393324.3	-	5	800	c.547G>T	c.(547-549)Gtg>Ttg	p.V183L	ME3_ENST00000525957.1_5'UTR|ME3_ENST00000543262.1_Missense_Mutation_p.V183L|RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000359636.2_Missense_Mutation_p.V183L|ME3_ENST00000323418.6_Missense_Mutation_p.V121L	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	183					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GTCACCACCACGGCCTGAAAA	0.622																																							uc001pbz.2		NA																	0				ovary(1)	1						c.(547-549)GTG>TTG		mitochondrial malic enzyme 3 precursor	NADH(DB00157)						76.0	70.0	72.0					11																	86209163		2202	4299	6501	SO:0001583	missense	10873				aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding	g.chr11:86209163C>A	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.547G>T	11.37:g.86209163C>A	ENSP00000376998:p.Val183Leu		Somatic				ME3_uc001pca.2_Missense_Mutation_p.V183L|ME3_uc009yvk.2_Missense_Mutation_p.V183L|ME3_uc010rtr.1_RNA	p.V183L	NM_001014811	NP_001014811	WXS	Illumina HiSeq	Unspecified	Q16798	MAON_HUMAN			5	801	-		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)	183					B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	c.547G>T	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.769060	0.49680	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000545395;ENST00000323418	T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95	5.63	5.63	0.86233	Malic enzyme, N-terminal (2);	0.196256	0.44285	D	0.000479	T	0.35653	0.0939	L	0.39467	1.215	0.40000	D	0.975152	P	0.36587	0.559	B	0.41510	0.359	T	0.17107	-1.0380	9	.	.	.	.	7.7322	0.28793	0.0:0.8022:0.0:0.1978	.	183	Q16798	MAON_HUMAN	L	183;183;183;183;121;121	ENSP00000352657:V183L;ENSP00000440246:V183L;ENSP00000376998:V183L;ENSP00000431182:V183L;ENSP00000315255:V121L	.	V	-	1	0	ME3	85886811	0.473000	0.25878	0.996000	0.52242	0.610000	0.37248	1.000000	0.29770	2.644000	0.89710	0.655000	0.94253	GTG		0.622	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2			10	69	1	0	2.27111e-07	0.001368	3.00588e-07	10	69				
FOLH1B	219595	broad.mit.edu	37	11	89405081	89405081	+	RNA	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:89405081C>A	ENST00000532352.1	+	0	1021							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						GGGAGGTCACCGGGACTCATG	0.418																																							uc001pda.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(208-210)CGG>AGG		folate hydrolase 1B							132.0	124.0	127.0					11																	89405081		2201	4296	6497			219595				proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity	g.chr11:89405081C>A	AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89405081C>A			Somatic					p.R70R	NM_153696	NP_710163	WXS	Illumina HiSeq	Unspecified	Q9HBA9	FOH1B_HUMAN			5	734	+			70						Silent	SNP	ENST00000532352.1	37	c.208C>A																																																																																					0.418	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1	NM_153696		5	44	1	0	3.59834e-05	0.001168	4.39332e-05	5	44				
FAT3	120114	broad.mit.edu	37	11	92086148	92086148	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:92086148A>T	ENST00000298047.6	+	1	887	c.870A>T	c.(868-870)ttA>ttT	p.L290F	FAT3_ENST00000541502.1_Missense_Mutation_p.L290F|FAT3_ENST00000409404.2_Missense_Mutation_p.L290F|FAT3_ENST00000525166.1_Missense_Mutation_p.L140F			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	290	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTGATGACTTAGATGATGGAG	0.443										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	0				ovary(4)|pancreas(1)	5						c.(868-870)TTA>TTT		FAT tumor suppressor homolog 3							143.0	134.0	137.0					11																	92086148		2032	4205	6237	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92086148A>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.870A>T	11.37:g.92086148A>T	ENSP00000298047:p.Leu290Phe	TCGA Ovarian(4;0.039)	Somatic					p.L290F	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			1	887	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	290			Cadherin 3.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.870A>T		.	.	.	.	.	.	.	.	.	.	A	0.011	-1.708431	0.00712	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.29	-10.6	0.00265	.	.	.	.	.	T	0.43277	0.1240	M	0.64170	1.965	0.21445	N	0.999685	B	0.09022	0.002	B	0.09377	0.004	T	0.32719	-0.9896	9	0.52906	T	0.07	.	3.812	0.08801	0.1475:0.3312:0.3555:0.1659	.	290	Q8TDW7-3	.	F	290;290;290;140	ENSP00000298047:L290F;ENSP00000387040:L290F;ENSP00000443786:L290F;ENSP00000432586:L140F	ENSP00000298047:L290F	L	+	3	2	FAT3	91725796	0.000000	0.05858	0.005000	0.12908	0.225000	0.24961	-0.435000	0.06931	-3.059000	0.00257	-0.379000	0.06801	TTA		0.443	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		3	37	0	0	0	0.000248	0	3	37				
CARD16	114769	broad.mit.edu	37	11	104915304	104915304	+	Nonsense_Mutation	SNP	A	A	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:104915304A>C	ENST00000375706.2	-	2	106	c.89T>G	c.(88-90)tTa>tGa	p.L30*	CASP1_ENST00000598974.1_Intron|CARD16_ENST00000525374.1_Nonsense_Mutation_p.L30*|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000593315.1_Intron|CARD16_ENST00000375704.3_Nonsense_Mutation_p.L30*	NM_001017534.1	NP_001017534.1	Q5EG05	CAR16_HUMAN	caspase recruitment domain family, member 16	30	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				regulation of apoptotic process (GO:0042981)		cysteine-type endopeptidase inhibitor activity (GO:0004869)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	11						CCTTGTCTGTAATAATTCATC	0.423																																							uc001pip.1		NA																	0				skin(1)	1						c.(88-90)TTA>TGA		caspase-1 dominant-negative inhibitor pseudo-ICE							311.0	287.0	295.0					11																	104915304		2202	4299	6501	SO:0001587	stop_gained	114769				regulation of apoptosis	intracellular	cysteine-type endopeptidase inhibitor activity	g.chr11:104915304A>C		CCDS31661.1, CCDS41705.1	11q23	2008-09-15				ENSG00000204397			33701	protein-coding gene	gene with protein product		615680				11432859, 11536016	Standard	NM_052889		Approved	COP1, COP, PSEUDO-ICE		Q5EG05		ENST00000375706.2:c.89T>G	11.37:g.104915304A>C	ENSP00000364858:p.Leu30*		Somatic				CASP1_uc010rve.1_Intron|CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|CARD16_uc001pio.1_Nonsense_Mutation_p.L30*	p.L30*	NM_001017534	NP_001017534	WXS	Illumina HiSeq	Unspecified	Q5EG05	CAR16_HUMAN			2	116	-			30			CARD.		Q96RJ9	Nonsense_Mutation	SNP	ENST00000375706.2	37	c.89T>G	CCDS31661.1	.	.	.	.	.	.	.	.	.	.	.	14.76	2.631962	0.46944	.	.	ENSG00000204397	ENST00000375706;ENST00000375704;ENST00000525374;ENST00000528513	.	.	.	3.34	2.2	0.27929	.	0.271361	0.30177	U	0.010225	.	.	.	.	.	.	0.58432	A	0.99999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.2481	0.15508	0.8602:0.0:0.1398:0.0	.	.	.	.	X	30;30;30;14	.	ENSP00000364856:L30X	L	-	2	0	CARD16	104420514	0.020000	0.18652	0.000000	0.03702	0.118000	0.20060	3.823000	0.55715	0.484000	0.27630	-0.425000	0.05940	TTA		0.423	CARD16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388147.1			50	178	0	0	0	0.00361	0	50	178				
RAB39A	54734	broad.mit.edu	37	11	107832694	107832694	+	Missense_Mutation	SNP	C	C	T	rs549198709		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:107832694C>T	ENST00000320578.2	+	2	316	c.250C>T	c.(250-252)Cgc>Tgc	p.R84C		NM_017516.1	NP_059986.1	Q14964	RB39A_HUMAN	RAB39A, member RAS oncogene family	84					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)										ATCTTATTACCGCAACTCAGT	0.353													C|||	1	0.000199681	0.0	0.0	5008	,	,		18389	0.001		0.0	False		,,,				2504	0.0						uc001pjt.2		NA																	0					0						c.(250-252)CGC>TGC		RAB39, member RAS oncogene family							67.0	65.0	65.0					11																	107832694		2201	4298	6499	SO:0001583	missense	54734				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding	g.chr11:107832694C>T	X99962	CCDS8338.1	11q22.3	2011-11-22	2011-11-22	2011-11-22	ENSG00000179331	ENSG00000179331		"""RAB, member RAS oncogene"""	16521	protein-coding gene	gene with protein product	"""rab-related GTP-binding protein"""		"""RAB39, member RAS oncogene family"""	RAB39		9119394	Standard	NM_017516		Approved		uc001pjt.3	Q14964	OTTHUMG00000166367	ENST00000320578.2:c.250C>T	11.37:g.107832694C>T	ENSP00000322594:p.Arg84Cys		Somatic					p.R84C	NM_017516	NP_059986	WXS	Illumina HiSeq	Unspecified	Q14964	RB39A_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)|Epithelial(105;8.56e-05)|all cancers(92;0.00179)	2	268	+			84					A8KAA4|Q8N6W2	Missense_Mutation	SNP	ENST00000320578.2	37	c.250C>T	CCDS8338.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.263427	0.80358	.	.	ENSG00000179331	ENST00000320578	D	0.82526	-1.62	5.4	5.4	0.78164	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000010	D	0.95072	0.8404	H	0.99545	4.62	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.96494	0.9366	10	0.87932	D	0	.	14.2282	0.65873	0.149:0.851:0.0:0.0	.	84	Q14964	RB39A_HUMAN	C	84	ENSP00000322594:R84C	ENSP00000322594:R84C	R	+	1	0	RAB39	107337904	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.363000	0.66104	2.794000	0.96219	0.650000	0.86243	CGC		0.353	RAB39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389423.1	NM_017516		4	23	0	0	0	0.000602	0	4	23				
OR10G8	219869	broad.mit.edu	37	11	123900657	123900657	+	Missense_Mutation	SNP	G	G	A	rs371942684		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:123900657G>A	ENST00000431524.1	+	1	361	c.328G>A	c.(328-330)Gag>Aag	p.E110K		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AGGGGGCACCGAGTGTTTCCT	0.537																																							uc001pzp.1		NA																	0				ovary(1)|skin(1)	2						c.(328-330)GAG>AAG		olfactory receptor, family 10, subfamily G,		G	LYS/GLU	0,4402		0,0,2201	145.0	137.0	140.0		328	3.0	1.0	11		140	1,8597	1.2+/-3.3	0,1,4298	no	missense	OR10G8	NM_001004464.1	56	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	110/312	123900657	1,12999	2201	4299	6500	SO:0001583	missense	219869				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123900657G>A	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.328G>A	11.37:g.123900657G>A	ENSP00000389072:p.Glu110Lys		Somatic					p.E110K	NM_001004464	NP_001004464	WXS	Illumina HiSeq	Unspecified	Q8NGN5	O10G8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	328	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	110			Helical; Name=3; (Potential).		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	c.328G>A	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	G	9.604	1.129451	0.21041	0.0	1.16E-4	ENSG00000234560	ENST00000431524	T	0.40225	1.04	3.04	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	0.136470	0.33457	N	0.004895	T	0.68403	0.2997	M	0.89658	3.05	0.20403	N	0.999908	D	0.89917	1.0	D	0.87578	0.998	T	0.62845	-0.6768	10	0.66056	D	0.02	.	13.2906	0.60269	0.0:0.0:1.0:0.0	.	110	Q8NGN5	O10G8_HUMAN	K	110	ENSP00000389072:E110K	ENSP00000389072:E110K	E	+	1	0	OR10G8	123405867	0.000000	0.05858	0.995000	0.50966	0.335000	0.28730	0.644000	0.24766	1.684000	0.51022	0.650000	0.86243	GAG		0.537	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464		11	96	0	0	0	0.008291	0	11	96				
CCDC15	80071	broad.mit.edu	37	11	124857495	124857495	+	Missense_Mutation	SNP	A	A	C	rs113451248	byFrequency	TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr11:124857495A>C	ENST00000344762.5	+	8	1632	c.1373A>C	c.(1372-1374)cAc>cCc	p.H458P	CCDC15_ENST00000529051.1_Missense_Mutation_p.H458P	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	458						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		CATGTTCTCCACAAAGACCAA	0.418													C|||	6	0.00119808	0.0008	0.0	5008	,	,		19182	0.005		0.0	False		,,,				2504	0.0						uc001qbm.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1372-1374)CAC>CCC		coiled-coil domain containing 15		C	PRO/HIS	5,3679		0,5,1837	109.0	105.0	106.0		1373	-1.4	0.0	11	dbSNP_132	106	0,8170		0,0,4085	yes	missense	CCDC15	NM_025004.2	77	0,5,5922	CC,CA,AA		0.0,0.1357,0.0422	benign	458/952	124857495	5,11849	1842	4085	5927	SO:0001583	missense	80071					centrosome		g.chr11:124857495A>C	BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.1373A>C	11.37:g.124857495A>C	ENSP00000341684:p.His458Pro		Somatic					p.H458P	NM_025004	NP_079280	WXS	Illumina HiSeq	Unspecified	Q0P6D6	CCD15_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)	8	1632	+	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	458					Q9H8U7	Missense_Mutation	SNP	ENST00000344762.5	37	c.1373A>C	CCDS44756.1	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	C	0.007	-1.935858	0.00484	0.001357	0.0	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.29142	1.6;1.58	3.32	-1.4	0.08968	.	.	.	.	.	T	0.04272	0.0118	N	0.00841	-1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29882	-0.9997	9	0.02654	T	1	0.0636	3.381	0.07255	0.5595:0.2054:0.1382:0.0969	.	458	Q0P6D6	CCD15_HUMAN	P	458	ENSP00000435403:H458P;ENSP00000341684:H458P	ENSP00000341684:H458P	H	+	2	0	CCDC15	124362705	.	.	0.000000	0.03702	0.085000	0.17905	.	.	-0.576000	0.05974	-0.215000	0.12644	CAC		0.418	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387131.1	NM_025004		3	74	0	0	0	0.000248	0	3	74				
GALNT8	26290	broad.mit.edu	37	12	4881637	4881637	+	Silent	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:4881637C>G	ENST00000252318.2	+	11	2125	c.1788C>G	c.(1786-1788)acC>acG	p.T596T		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	596	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						ACAGAGATACCAAGCGGTGTC	0.517																																					Colon(108;631 1558 7270 20097 39846)	Colon(108;631 1558 7270 20097 39846)	uc001qne.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1786-1788)ACC>ACG		polypeptide N-acetylgalactosaminyltransferase 8							102.0	95.0	98.0					12																	4881637		2203	4300	6503	SO:0001819	synonymous_variant	26290					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:4881637C>G	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1788C>G	12.37:g.4881637C>G			Somatic					p.T596T	NM_017417	NP_059113	WXS	Illumina HiSeq	Unspecified	Q9NY28	GALT8_HUMAN			11	1880	+			596			Ricin B-type lectin.|Lumenal (Potential).		B2RU02	Silent	SNP	ENST00000252318.2	37	c.1788C>G	CCDS8533.1																																																																																				0.517	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417		8	65	0	0	0	0.006214	0	8	65				
CLEC4A	50856	broad.mit.edu	37	12	8276539	8276539	+	Missense_Mutation	SNP	A	A	G	rs36113649		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:8276539A>G	ENST00000229332.5	+	1	312	c.65A>G	c.(64-66)aAc>aGc	p.N22S	CLEC4A_ENST00000352620.3_Missense_Mutation_p.N22S|CLEC4A_ENST00000345999.3_Missense_Mutation_p.N22S|CLEC4A_ENST00000360500.3_Missense_Mutation_p.N22S	NM_016184.3|NM_194447.2|NM_194450.2	NP_057268.1|NP_919429.2|NP_919432.1	Q9UMR7	CLC4A_HUMAN	C-type lectin domain family 4, member A	22					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)	11				Kidney(36;0.0915)		TCAGGCATCAACACAGCCTCT	0.418																																							uc001qtz.1		NA																	0					0						c.(64-66)AAC>AGC		C-type lectin domain family 4, member A isoform							91.0	79.0	83.0					12																	8276539		2203	4300	6503	SO:0001583	missense	50856				cell adhesion|cell surface receptor linked signaling pathway|innate immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity	g.chr12:8276539A>G	AJ133532	CCDS8590.1, CCDS8591.1, CCDS8592.1, CCDS41745.1	12p13	2005-02-09	2005-02-09	2005-02-09	ENSG00000111729	ENSG00000111729		"""C-type lectin domain containing"""	13257	protein-coding gene	gene with protein product		605306	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 6"""	CLECSF6		10438934	Standard	NM_016184		Approved	DCIR, DDB27	uc001qtz.1	Q9UMR7	OTTHUMG00000168571	ENST00000229332.5:c.65A>G	12.37:g.8276539A>G	ENSP00000229332:p.Asn22Ser		Somatic				CLEC4A_uc009zga.1_Missense_Mutation_p.N22S|CLEC4A_uc001qub.1_Missense_Mutation_p.N22S|CLEC4A_uc001quc.1_Missense_Mutation_p.N22S|CLEC4A_uc009zgb.1_Missense_Mutation_p.N22S	p.N22S	NM_016184	NP_057268	WXS	Illumina HiSeq	Unspecified	Q9UMR7	CLC4A_HUMAN		Kidney(36;0.0915)	1	312	+			22			Cytoplasmic (Potential).		Q17R69|Q8WXW9|Q9H2Z9|Q9NS33|Q9UI34	Missense_Mutation	SNP	ENST00000229332.5	37	c.65A>G	CCDS8590.1	.	.	.	.	.	.	.	.	.	.	A	4.942	0.175102	0.09391	.	.	ENSG00000111729	ENST00000229332;ENST00000345999;ENST00000352620;ENST00000360500;ENST00000546339	T;T;T;T;T	0.45668	5.5;5.47;5.37;5.29;0.89	4.31	-1.2	0.09554	.	.	.	.	.	T	0.15522	0.0374	N	0.08118	0	0.09310	N	1	B;B;B;B	0.14012	0.008;0.001;0.009;0.006	B;B;B;B	0.12837	0.008;0.003;0.008;0.003	T	0.25779	-1.0122	9	0.10111	T	0.7	.	1.764	0.02998	0.4083:0.3346:0.0952:0.1619	rs36113649	22;22;22;22	Q9UMR7-3;Q9UMR7-4;Q9UMR7-2;Q9UMR7	.;.;.;CLC4A_HUMAN	S	22;22;22;22;11	ENSP00000229332:N22S;ENSP00000344646:N22S;ENSP00000247243:N22S;ENSP00000353690:N22S;ENSP00000443082:N11S	ENSP00000229332:N22S	N	+	2	0	CLEC4A	8167806	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.917000	0.28665	-0.186000	0.10533	-0.321000	0.08615	AAC		0.418	CLEC4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400257.1	NM_194450		28	45	0	0	0	0.003271	0	28	45				
CD69	969	broad.mit.edu	37	12	9907713	9907713	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:9907713T>A	ENST00000228434.3	-	3	412	c.332A>T	c.(331-333)aAt>aTt	p.N111I	CD69_ENST00000536709.1_Missense_Mutation_p.N111I	NM_001781.2	NP_001772.1	Q07108	CD69_HUMAN	CD69 molecule	111	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular response to drug (GO:0035690)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10						AGAACAAGCATTTTGGGCTGA	0.383																																							uc001qwk.2		NA																	0					0						c.(331-333)AAT>ATT		CD69 molecule							98.0	102.0	100.0					12																	9907713		2203	4300	6503	SO:0001583	missense	969					integral to plasma membrane	sugar binding|transmembrane receptor activity	g.chr12:9907713T>A	Z22576	CCDS8604.1	12p13	2011-08-30	2006-03-28		ENSG00000110848	ENSG00000110848		"""C-type lectin domain containing"", ""CD molecules"""	1694	protein-coding gene	gene with protein product		107273	"""CD69 antigen (p60, early T-cell activation antigen)"""			1612643	Standard	NM_001781		Approved	CLEC2C	uc001qwk.3	Q07108	OTTHUMG00000168481	ENST00000228434.3:c.332A>T	12.37:g.9907713T>A	ENSP00000228434:p.Asn111Ile		Somatic				CD69_uc010sgu.1_Missense_Mutation_p.N111I|CD69_uc010sgv.1_Missense_Mutation_p.N111I	p.N111I	NM_001781	NP_001772	WXS	Illumina HiSeq	Unspecified	Q07108	CD69_HUMAN			3	413	-			111			C-type lectin.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000228434.3	37	c.332A>T	CCDS8604.1	.	.	.	.	.	.	.	.	.	.	T	10.19	1.281225	0.23392	.	.	ENSG00000110848	ENST00000228434;ENST00000536709	T;T	0.66280	-0.2;-0.2	5.0	-2.81	0.05805	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.668590	0.02957	N	0.142619	T	0.54549	0.1865	L	0.37750	1.13	0.09310	N	1	P;B	0.43542	0.81;0.067	P;B	0.45998	0.5;0.056	T	0.48031	-0.9070	9	.	.	.	0.5063	4.997	0.14245	0.1477:0.4138:0.0:0.4385	.	111;111	B4E0H7;Q07108	.;CD69_HUMAN	I	111	ENSP00000228434:N111I;ENSP00000442597:N111I	.	N	-	2	0	CD69	9798980	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.670000	0.05256	-0.461000	0.06993	-1.588000	0.00846	AAT		0.383	CD69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399876.1			29	53	0	0	0	0.006999	0	29	53				
CLEC1A	51267	broad.mit.edu	37	12	10228148	10228148	+	Silent	SNP	A	A	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:10228148A>C	ENST00000315330.4	-	4	560	c.498T>G	c.(496-498)ctT>ctG	p.L166L	CLEC1A_ENST00000457018.2_Silent_p.L133L|CLEC1A_ENST00000420265.2_Silent_p.L74L	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	166	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						AGTTTTCACTAAGGCAGAAAT	0.393																																							uc001qxb.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(496-498)CTT>CTG		C-type lectin-like receptor-1							145.0	140.0	141.0					12																	10228148		2203	4300	6503	SO:0001819	synonymous_variant	51267				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity	g.chr12:10228148A>C	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.498T>G	12.37:g.10228148A>C			Somatic				CLEC1A_uc009zhf.2_Silent_p.L78L|CLEC1A_uc001qxc.2_Silent_p.L78L|CLEC1A_uc001qxd.2_Silent_p.L123L|CLEC1A_uc010sgx.1_Silent_p.L64L	p.L166L	NM_016511	NP_057595	WXS	Illumina HiSeq	Unspecified	Q8NC01	CLC1A_HUMAN			4	582	-			166			C-type lectin.|Extracellular (Potential).		Q8IUW7|Q9NZH3	Silent	SNP	ENST00000315330.4	37	c.498T>G	CCDS8612.1																																																																																				0.393	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511		26	47	0	0	0	0.00632	0	26	47				
TAS2R42	353164	broad.mit.edu	37	12	11338798	11338798	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:11338798G>A	ENST00000334266.1	-	1	745	c.746C>T	c.(745-747)tCc>tTc	p.S249F		NM_181429.1	NP_852094.1	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	249					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(2)|lung(4)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			CACTTGTAAGGAAAAAAAATG	0.418																																					Melanoma(15;352 722 10077 19546 48810)	Melanoma(15;352 722 10077 19546 48810)	uc001qzr.1		NA																	0				ovary(1)	1						c.(745-747)TCC>TTC		taste receptor, type 2, member 42							79.0	76.0	77.0					12																	11338798		2203	4300	6503	SO:0001583	missense	353164				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr12:11338798G>A	AX097739, AB199241	CCDS31747.1	12p13	2012-08-22			ENSG00000186136	ENSG00000186136		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18888	protein-coding gene	gene with protein product		613966				12679530	Standard	NM_181429		Approved	T2R24, T2R55, hT2R55, TAS2R55	uc001qzr.1	Q7RTR8	OTTHUMG00000168567	ENST00000334266.1:c.746C>T	12.37:g.11338798G>A	ENSP00000334050:p.Ser249Phe		Somatic				PRB4_uc001qzf.1_Intron	p.S249F	NM_181429	NP_852094	WXS	Illumina HiSeq	Unspecified	Q7RTR8	T2R42_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;0.0455)		1	746	-			249			Helical; Name=6; (Potential).		A2RRP4|Q645X0	Missense_Mutation	SNP	ENST00000334266.1	37	c.746C>T	CCDS31747.1	.	.	.	.	.	.	.	.	.	.	G	8.124	0.781535	0.16120	.	.	ENSG00000186136	ENST00000334266	T	0.36699	1.24	3.59	-0.35	0.12606	GPCR, rhodopsin-like superfamily (1);	1.111370	0.07004	N	0.823802	T	0.37544	0.1007	L	0.56340	1.77	0.09310	N	1	B	0.26081	0.141	B	0.37451	0.25	T	0.49890	-0.8891	10	0.46703	T	0.11	.	6.0056	0.19544	0.5026:0.0:0.4974:0.0	.	249	Q7RTR8	T2R42_HUMAN	F	249	ENSP00000334050:S249F	ENSP00000334050:S249F	S	-	2	0	TAS2R42	11230065	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.659000	0.05323	0.048000	0.15891	0.650000	0.86243	TCC		0.418	TAS2R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400243.1	NM_181429		8	32	0	0	0	0.00308	0	8	32				
PRB2	653247	broad.mit.edu	37	12	11546771	11546771	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:11546771G>C	ENST00000389362.4	-	3	276	c.241C>G	c.(241-243)Cca>Gca	p.P81A	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	81	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)		p.P81A(1)|p.P60A(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGTGGGGGTGGTCCTTGTGGC	0.612																																							uc010shk.1		NA																	2	Substitution - Missense(2)		urinary_tract(2)		0						c.(241-243)CCA>GCA		proline-rich protein BstNI subfamily 2							119.0	137.0	131.0					12																	11546771		2162	4222	6384	SO:0001583	missense	653247							g.chr12:11546771G>C	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.241C>G	12.37:g.11546771G>C	ENSP00000374013:p.Pro81Ala		Somatic					p.P81A	NM_006248	NP_006239	WXS	Illumina HiSeq	Unspecified			OV - Ovarian serous cystadenocarcinoma(49;0.185)		3	276	-		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)						O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	c.241C>G	CCDS41757.2	.	.	.	.	.	.	.	.	.	.	.	7.105	0.574795	0.13623	.	.	ENSG00000121335	ENST00000389362	T	0.04275	3.66	1.69	-1.72	0.08107	.	924.301000	0.02017	U	0.047463	T	0.11281	0.0275	M	0.80982	2.52	0.27230	N	0.959422	D	0.64830	0.994	P	0.52217	0.693	T	0.49597	-0.8923	10	0.08179	T	0.78	.	4.3941	0.11355	0.0:0.2425:0.5138:0.2437	.	81	P02812	PRB2_HUMAN	A	81	ENSP00000374013:P81A	ENSP00000374013:P81A	P	-	1	0	PRB2	11438038	0.741000	0.28217	0.112000	0.21494	0.160000	0.22226	-0.004000	0.12878	-0.045000	0.13468	0.418000	0.28097	CCA		0.612	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248		7	372	0	0	0	0.001984	0	7	372				
KRAS	3845	broad.mit.edu	37	12	25380196	25380196	+	Nonsense_Mutation	SNP	T	T	A	rs397517038		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:25380196T>A	ENST00000256078.4	-	3	325	c.262A>T	c.(262-264)Aaa>Taa	p.K88*	KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Nonsense_Mutation_p.K88*	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	88					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)		UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TCAAATGATTTAGTATTATTT	0.348		119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1		119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		0				large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(262-264)AAA>TAA		c-K-ras2 protein isoform a precursor							81.0	79.0	80.0					12																	25380196		2203	4300	6503	SO:0001587	stop_gained	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25380196T>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.262A>T	12.37:g.25380196T>A	ENSP00000256078:p.Lys88*	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Nonsense_Mutation_p.K88*	p.K88*	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		3	443	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		88					A8K8Z5|B0LPF9|P01118|Q96D10	Nonsense_Mutation	SNP	ENST00000256078.4	37	c.262A>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	T	36	5.805367	0.96967	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5753	0.76373	0.0:0.0:0.0:1.0	.	.	.	.	X	88	.	ENSP00000256078:K88X	K	-	1	0	KRAS	25271463	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.983000	0.88140	2.326000	0.78906	0.533000	0.62120	AAA		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		12	39	0	0	0	0.001855	0	12	39				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		9	16	1	0	4.3838e-07	0.001855	5.6827e-07	9	16				
DDX11	1663	broad.mit.edu	37	12	31236747	31236747	+	Splice_Site	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:31236747G>T	ENST00000407793.2	+	3	396	c.145G>T	c.(145-147)Ggg>Tgg	p.G49W	DDX11_ENST00000251758.5_Splice_Site_p.G49W|DDX11_ENST00000545668.1_Splice_Site_p.G49W|DDX11_ENST00000228264.6_Splice_Site_p.G23W|DDX11_ENST00000350437.4_Splice_Site_p.G49W|DDX11_ENST00000542838.1_Splice_Site_p.G49W	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	49	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CTTCCTGCAGGGGAAGTCCTT	0.443										Multiple Myeloma(12;0.14)																													uc001rjt.1		NA																	0				breast(3)	3						c.(145-147)GGG>TGG		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11							41.0	47.0	45.0					12																	31236747		2202	4298	6500	SO:0001630	splice_region_variant	1663				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding	g.chr12:31236747G>T	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.145-1G>T	12.37:g.31236747G>T		Multiple Myeloma(12;0.14)	Somatic				DDX11_uc010sjw.1_Missense_Mutation_p.G49W|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Missense_Mutation_p.G49W|DDX11_uc001rjs.1_Missense_Mutation_p.G49W|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Missense_Mutation_p.G49W|DDX11_uc001rjw.1_Missense_Mutation_p.G23W	p.G49W	NM_152438	NP_689651	WXS	Illumina HiSeq	Unspecified	Q96FC9	DDX11_HUMAN			3	396	+	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)		49			ATP (By similarity).|Helicase ATP-binding.		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	c.145G>T	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610514	0.66558	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000251758;ENST00000228264;ENST00000438391;ENST00000415475;ENST00000545668;ENST00000350437;ENST00000535317	D;D;T;D;D;D;D;D;T	0.96104	-3.91;-3.91;0.63;-3.91;-3.91;-3.15;-3.91;-3.91;0.63	4.48	4.48	0.54585	Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.000000	0.85682	D	0.000000	D	0.98327	0.9445	H	0.95574	3.69	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99312	1.0904	9	.	.	.	.	14.7369	0.69422	0.0:0.0:1.0:0.0	.	49;49;49;49	B4DZY1;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	W	49;49;49;23;49;23;49;49;85	ENSP00000443426:G49W;ENSP00000384703:G49W;ENSP00000251758:G49W;ENSP00000228264:G23W;ENSP00000407646:G49W;ENSP00000406457:G23W;ENSP00000440402:G49W;ENSP00000309965:G49W;ENSP00000440171:G85W	.	G	+	1	0	DDX11	31128014	1.000000	0.71417	0.992000	0.48379	0.699000	0.40488	8.057000	0.89457	2.330000	0.79161	0.430000	0.28490	GGG		0.443	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	Missense_Mutation	4	42	1	0	8.12818e-05	0.001984	9.80988e-05	4	42				
SYT10	341359	broad.mit.edu	37	12	33592396	33592396	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:33592396G>T	ENST00000228567.3	-	1	358	c.62C>A	c.(61-63)aCc>aAc	p.T21N	SYT10_ENST00000535526.1_5'UTR	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	21					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					GCACAGCTCGGTGACGATGTG	0.572																																							uc001rll.1		NA																	0				ovary(1)|skin(1)	2						c.(61-63)ACC>AAC		synaptotagmin X							227.0	207.0	214.0					12																	33592396		2203	4300	6503	SO:0001583	missense	341359					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr12:33592396G>T	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.62C>A	12.37:g.33592396G>T	ENSP00000228567:p.Thr21Asn		Somatic				SYT10_uc009zju.1_5'UTR	p.T21N	NM_198992	NP_945343	WXS	Illumina HiSeq	Unspecified	Q6XYQ8	SYT10_HUMAN			1	359	-	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)		21			Vesicular (Potential).		Q495U2	Missense_Mutation	SNP	ENST00000228567.3	37	c.62C>A	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965977	0.53507	.	.	ENSG00000110975	ENST00000228567	T	0.47528	0.84	4.4	3.49	0.39957	.	0.404531	0.17970	U	0.155916	T	0.37100	0.0991	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.18967	-1.0320	10	0.49607	T	0.09	.	13.6929	0.62559	0.0:0.1569:0.843:0.0	.	21	Q6XYQ8	SYT10_HUMAN	N	21	ENSP00000228567:T21N	ENSP00000228567:T21N	T	-	2	0	SYT10	33483663	1.000000	0.71417	0.989000	0.46669	0.997000	0.91878	4.388000	0.59633	1.114000	0.41781	0.650000	0.86243	ACC		0.572	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992		76	170	1	0	2.02624e-56	0.00361	3.48778e-56	76	170				
WIF1	11197	broad.mit.edu	37	12	65445163	65445163	+	Missense_Mutation	SNP	C	C	G	rs138241385		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:65445163C>G	ENST00000286574.4	-	10	1480	c.1106G>C	c.(1105-1107)cGg>cCg	p.R369P		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	369					multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		TGGATCCCGCCGCTCCTCGGC	0.498			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)	Esophageal Squamous(148;1595 1816 48559 49439 49664)	uc001ssk.2		NA		Dom	yes		12	12q14.3	11197	T	WNT inhibitory factor 1			E	HMGA2		pleomorphic salivary gland adenoma		0				ovary(2)|lung(1)|skin(1)	4						c.(1105-1107)CGG>CCG		WNT inhibitory factor 1 precursor							68.0	67.0	67.0					12																	65445163		2203	4300	6503	SO:0001583	missense	11197				multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity	g.chr12:65445163C>G	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.1106G>C	12.37:g.65445163C>G	ENSP00000286574:p.Arg369Pro		Somatic					p.R369P	NM_007191	NP_009122	WXS	Illumina HiSeq	Unspecified	Q9Y5W5	WIF1_HUMAN	LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)	10	1251	-			369					Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	37	c.1106G>C	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938471	0.34189	.	.	ENSG00000156076	ENST00000286574;ENST00000543094	D;T	0.89123	-2.47;-0.99	5.43	-4.18	0.03846	.	0.872893	0.09820	N	0.751586	T	0.75170	0.3813	L	0.27053	0.805	0.24858	N	0.992368	B	0.02656	0.0	B	0.01281	0.0	T	0.58584	-0.7611	9	.	.	.	.	2.5726	0.04798	0.0934:0.3337:0.2756:0.2973	.	369	Q9Y5W5	WIF1_HUMAN	P	369;118	ENSP00000286574:R369P;ENSP00000439024:R118P	.	R	-	2	0	WIF1	63731430	0.056000	0.20664	0.002000	0.10522	0.903000	0.53119	-0.951000	0.03885	-0.672000	0.05266	0.643000	0.83706	CGG		0.498	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2			12	34	0	0	0	0.001855	0	12	34				
BEST3	144453	broad.mit.edu	37	12	70065291	70065291	+	Silent	SNP	G	G	A	rs113525790	byFrequency	TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:70065291G>A	ENST00000330891.5	-	9	1243	c.1017C>T	c.(1015-1017)gaC>gaT	p.D339D	BEST3_ENST00000331471.4_Silent_p.D339D|BEST3_ENST00000476098.1_Silent_p.D126D|BEST3_ENST00000553096.1_Silent_p.D233D|BEST3_ENST00000488961.1_Silent_p.D126D	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	339					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			CAGCAGAATCGTCCCAGTAAA	0.433													G|||	10	0.00199681	0.0076	0.0	5008	,	,		16487	0.0		0.0	False		,,,				2504	0.0						uc001svg.2		NA																	0					0						c.(1015-1017)GAC>GAT		vitelliform macular dystrophy 2-like 3 isoform		G	,	21,3973		0,21,1976	125.0	123.0	124.0		1017,378	-7.7	0.7	12	dbSNP_132	124	0,8388		0,0,4194	no	coding-synonymous,coding-synonymous	BEST3	NM_032735.2,NM_152439.2	,	0,21,6170	AA,AG,GG		0.0,0.5258,0.1696	,	339/669,126/456	70065291	21,12361	1997	4194	6191	SO:0001819	synonymous_variant	144453					chloride channel complex|plasma membrane	chloride channel activity	g.chr12:70065291G>A	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1017C>T	12.37:g.70065291G>A			Somatic				BEST3_uc001svd.1_Silent_p.D339D|BEST3_uc001sve.1_RNA|BEST3_uc001svf.2_Silent_p.D126D|BEST3_uc010stm.1_Silent_p.D233D|BEST3_uc001svh.2_Silent_p.D126D	p.D339D	NM_032735	NP_116124	WXS	Illumina HiSeq	Unspecified	Q8N1M1	BEST3_HUMAN	Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)		9	1244	-	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		339			Cytoplasmic (Potential).		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Silent	SNP	ENST00000330891.5	37	c.1017C>T	CCDS8992.2																																																																																				0.433	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439		5	49	0	0	0	0.001984	0	5	49				
PPFIA2	8499	broad.mit.edu	37	12	81768487	81768487	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:81768487G>T	ENST00000549396.1	-	11	1352	c.1192C>A	c.(1192-1194)Cag>Aag	p.Q398K	PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000550584.2_Missense_Mutation_p.Q398K|PPFIA2_ENST00000333447.7_Missense_Mutation_p.Q380K|PPFIA2_ENST00000443686.3_Missense_Mutation_p.Q299K|PPFIA2_ENST00000549325.1_Missense_Mutation_p.Q380K|PPFIA2_ENST00000407050.4_Missense_Mutation_p.Q324K|PPFIA2_ENST00000548586.1_Missense_Mutation_p.Q398K|PPFIA2_ENST00000552948.1_Missense_Mutation_p.Q398K|PPFIA2_ENST00000550359.2_Missense_Mutation_p.Q245K	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	398	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CTCATGGTCTGCTGCAACTTT	0.458																																							uc001szo.1		NA																	0				ovary(3)|lung(2)|pancreas(1)	6						c.(1192-1194)CAG>AAG		PTPRF interacting protein alpha 2							146.0	134.0	138.0					12																	81768487		1928	4128	6056	SO:0001583	missense	8499							g.chr12:81768487G>T	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1192C>A	12.37:g.81768487G>T	ENSP00000450337:p.Gln398Lys		Somatic				PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA	p.Q398K	NM_003625	NP_003616	WXS	Illumina HiSeq	Unspecified	B7Z663	B7Z663_HUMAN			11	1353	-			324					B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	c.1192C>A	CCDS55857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.434810|5.434810	0.96150|0.96150	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948|ENST00000548790	T;T;T;T;T;T;T|.	0.36878|.	1.23;1.23;1.23;1.23;1.23;1.23;1.23|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86585|0.86585	0.5968|0.5968	M|M	0.91300|0.91300	3.195|3.195	0.80722|0.80722	D|D	1|1	P|.	0.40332|.	0.713|.	P|.	0.54815|.	0.761|.	D|D	0.88051|0.88051	0.2787|0.2787	10|5	0.72032|.	D|.	0.01|.	-15.5927|-15.5927	20.3312|20.3312	0.98718|0.98718	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	398|.	O75334|.	LIPA2_HUMAN|.	K|R	398;380;324;409;380;398;299;398|236	ENSP00000450337:Q398K;ENSP00000450298:Q380K;ENSP00000385093:Q324K;ENSP00000327416:Q380K;ENSP00000449338:Q398K;ENSP00000388373:Q299K;ENSP00000447868:Q398K|.	ENSP00000327416:Q380K|.	Q|S	-|-	1|3	0|2	PPFIA2|PPFIA2	80292618|80292618	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.928000|0.928000	0.56348|0.56348	9.805000|9.805000	0.99149|0.99149	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	CAG|AGC		0.458	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1			5	27	1	0	0.000602214	0.000602	0.000694863	5	27				
PLXNC1	10154	broad.mit.edu	37	12	94634438	94634438	+	Silent	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:94634438C>A	ENST00000258526.4	+	11	2547	c.2298C>A	c.(2296-2298)atC>atA	p.I766I		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	766					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CCACCTGGATCAGGTACTTTC	0.388																																							uc001tdc.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2296-2298)ATC>ATA		plexin C1 precursor							209.0	189.0	196.0					12																	94634438		2203	4300	6503	SO:0001819	synonymous_variant	10154				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding	g.chr12:94634438C>A	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.2298C>A	12.37:g.94634438C>A			Somatic					p.I766I	NM_005761	NP_005752	WXS	Illumina HiSeq	Unspecified	O60486	PLXC1_HUMAN			11	2547	+			766			Extracellular (Potential).		Q59H25	Silent	SNP	ENST00000258526.4	37	c.2298C>A	CCDS9049.1																																																																																				0.388	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2			15	68	1	0	6.31663e-08	0.003163	8.43109e-08	15	68				
GAS2L3	283431	broad.mit.edu	37	12	101012237	101012237	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:101012237G>C	ENST00000539410.1	+	7	906	c.520G>C	c.(520-522)Gag>Cag	p.E174Q	GAS2L3_ENST00000266754.5_Missense_Mutation_p.E174Q|GAS2L3_ENST00000537247.1_Missense_Mutation_p.E70Q|GAS2L3_ENST00000547754.1_Missense_Mutation_p.E174Q			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	174					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						ATACGGGGTTGAGCCACCAGT	0.393																																							uc001thu.2		NA																	0				skin(1)	1						c.(520-522)GAG>CAG		growth arrest-specific 2 like 3							123.0	132.0	129.0					12																	101012237		2203	4300	6503	SO:0001583	missense	283431				cell cycle arrest			g.chr12:101012237G>C	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.520G>C	12.37:g.101012237G>C	ENSP00000439672:p.Glu174Gln		Somatic				GAS2L3_uc009zty.2_Missense_Mutation_p.E174Q|GAS2L3_uc001thv.2_Missense_Mutation_p.E70Q	p.E174Q	NM_174942	NP_777602	WXS	Illumina HiSeq	Unspecified	Q86XJ1	GA2L3_HUMAN			8	746	+			174					B2RCN2	Missense_Mutation	SNP	ENST00000539410.1	37	c.520G>C	CCDS9079.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.607145	0.87157	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000537247;ENST00000539410	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.27	5.27	0.74061	Calponin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.66336	0.2779	M	0.78049	2.395	0.49798	D	0.999827	D	0.76494	0.999	D	0.71414	0.973	T	0.65865	-0.6064	10	0.41790	T	0.15	-16.0408	19.2547	0.93941	0.0:0.0:1.0:0.0	.	174	Q86XJ1	GA2L3_HUMAN	Q	174;174;70;174	ENSP00000266754:E174Q;ENSP00000448955:E174Q;ENSP00000442406:E70Q;ENSP00000439672:E174Q	ENSP00000266754:E174Q	E	+	1	0	GAS2L3	99536368	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	8.862000	0.92283	2.616000	0.88540	0.484000	0.47621	GAG		0.393	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409143.1	NM_174942		7	38	0	0	0	0.00308	0	7	38				
STAB2	55576	broad.mit.edu	37	12	104089428	104089428	+	Splice_Site	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:104089428C>T	ENST00000388887.2	+	32	3678		c.e32+2			NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TACATCATTGCAAGTACCACA	0.512																																							uc001tjw.2		NA																	0				ovary(9)|skin(5)	14						c.e32+2		stabilin 2 precursor							129.0	121.0	124.0					12																	104089428		2203	4300	6503	SO:0001630	splice_region_variant	55576				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr12:104089428C>T	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3474+2C>T	12.37:g.104089428C>T			Somatic					p.I1158_splice	NM_017564	NP_060034	WXS	Illumina HiSeq	Unspecified	Q8WWQ8	STAB2_HUMAN			32	3660	+									Splice_Site	SNP	ENST00000388887.2	37	c.3474_splice	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007741	0.54361	.	.	ENSG00000136011	ENST00000388887	.	.	.	6.17	2.21	0.28008	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.3355	0.11083	0.1492:0.4098:0.0:0.4411	.	.	.	.	.	-1	.	.	.	+	.	.	STAB2	102613558	0.999000	0.42202	0.983000	0.44433	0.913000	0.54294	0.380000	0.20602	0.127000	0.18452	-0.140000	0.14226	.		0.512	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		Intron	4	47	0	0	0	0.001168	0	4	47				
TCP11L2	255394	broad.mit.edu	37	12	106729479	106729479	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:106729479T>G	ENST00000299045.3	+	7	1009	c.835T>G	c.(835-837)Tct>Gct	p.S279A		NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	279										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						ATTTTCTCTTTCTGAGAGTGC	0.398																																							uc001tln.2		NA																	0				ovary(3)	3						c.(835-837)TCT>GCT		t-complex 11 (mouse) like 2							71.0	76.0	74.0					12																	106729479		2203	4300	6503	SO:0001583	missense	255394							g.chr12:106729479T>G	BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.835T>G	12.37:g.106729479T>G	ENSP00000299045:p.Ser279Ala		Somatic					p.S279A	NM_152772	NP_689985	WXS	Illumina HiSeq	Unspecified	Q8N4U5	T11L2_HUMAN			7	1009	+			279					B2RA65|G3V1Y9	Missense_Mutation	SNP	ENST00000299045.3	37	c.835T>G	CCDS9104.1	.	.	.	.	.	.	.	.	.	.	T	10.16	1.273566	0.23221	.	.	ENSG00000166046	ENST00000299045	T	0.12361	2.69	5.43	4.28	0.50868	.	0.372563	0.33691	N	0.004647	T	0.12646	0.0307	L	0.29908	0.895	0.80722	D	1	P	0.38020	0.615	P	0.46452	0.517	T	0.03993	-1.0986	10	0.02654	T	1	-0.8467	11.069	0.47993	0.0:0.0728:0.0:0.9272	.	279	Q8N4U5	T11L2_HUMAN	A	279	ENSP00000299045:S279A	ENSP00000299045:S279A	S	+	1	0	TCP11L2	105253609	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.387000	0.52501	0.895000	0.36342	0.533000	0.62120	TCT		0.398	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407206.1	NM_152772		4	35	0	0	0	0.000248	0	4	35				
KNTC1	9735	broad.mit.edu	37	12	123082445	123082445	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:123082445C>A	ENST00000333479.7	+	44	4700	c.4523C>A	c.(4522-4524)aCa>aAa	p.T1508K	KNTC1_ENST00000450485.2_Intron|KNTC1_ENST00000545065.1_3'UTR	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1508					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CTGACGAGCACAAAAGATTTG	0.498																																							uc001ucv.2		NA																	0				ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10						c.(4522-4524)ACA>AAA		Rough Deal homolog, centromere/kinetochore							78.0	80.0	79.0					12																	123082445		1946	4138	6084	SO:0001583	missense	9735				cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding	g.chr12:123082445C>A		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.4523C>A	12.37:g.123082445C>A	ENSP00000328236:p.Thr1508Lys		Somatic				KNTC1_uc010taf.1_Intron	p.T1508K	NM_014708	NP_055523	WXS	Illumina HiSeq	Unspecified	P50748	KNTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)	44	4686	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		1508					A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	c.4523C>A	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.542641	0.45280	.	.	ENSG00000184445	ENST00000333479;ENST00000423927	T;T	0.48522	2.49;0.81	5.71	5.71	0.89125	.	0.107097	0.64402	D	0.000006	T	0.50939	0.1645	L	0.58101	1.795	0.80722	D	1	P	0.46512	0.879	B	0.42738	0.396	T	0.53823	-0.8384	10	0.52906	T	0.07	-20.135	18.8558	0.92251	0.0:1.0:0.0:0.0	.	1508	P50748	KNTC1_HUMAN	K	1508;67	ENSP00000328236:T1508K;ENSP00000397140:T67K	ENSP00000328236:T1508K	T	+	2	0	KNTC1	121648398	0.997000	0.39634	0.998000	0.56505	0.976000	0.68499	3.872000	0.56085	2.709000	0.92574	0.655000	0.94253	ACA		0.498	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			7	58	1	0	0.000157383	0.00308	0.000184984	7	58				
POLE	5426	broad.mit.edu	37	12	133220029	133220029	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr12:133220029T>A	ENST00000320574.5	-	34	4451	c.4408A>T	c.(4408-4410)Atg>Ttg	p.M1470L	POLE_ENST00000434528.3_5'Flank|POLE_ENST00000535270.1_Missense_Mutation_p.M1443L	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1470					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	AGAGAGCGCATCTCCAGGTGC	0.597								DNA polymerases (catalytic subunits)																															uc001uks.1		NA																	0				ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8						c.(4408-4410)ATG>TTG	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA-directed DNA polymerase epsilon							140.0	134.0	136.0					12																	133220029		2203	4300	6503	SO:0001583	missense	5426				base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding	g.chr12:133220029T>A		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4408A>T	12.37:g.133220029T>A	ENSP00000322570:p.Met1470Leu		Somatic				POLE_uc001ukq.1_5'Flank|POLE_uc001ukr.1_Missense_Mutation_p.M274L|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Missense_Mutation_p.M1443L	p.M1470L	NM_006231	NP_006222	WXS	Illumina HiSeq	Unspecified	Q07864	DPOE1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	34	4452	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)	1470					Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	c.4408A>T	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	T	12.43	1.936194	0.34189	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.02552	4.25;4.25;4.26	5.71	5.71	0.89125	.	0.068929	0.85682	D	0.000000	T	0.04003	0.0112	L	0.49778	1.585	0.49798	D	0.999823	B;B	0.10296	0.003;0.002	B;B	0.14578	0.011;0.003	T	0.41484	-0.9506	10	0.10636	T	0.68	.	14.6068	0.68486	0.0:0.0:0.0:1.0	.	1443;1470	F5H1D6;Q07864	.;DPOE1_HUMAN	L	1470;1481;1443	ENSP00000322570:M1470L;ENSP00000406383:M1481L;ENSP00000445753:M1443L	ENSP00000322570:M1470L	M	-	1	0	POLE	131730102	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.252000	0.72447	2.193000	0.70182	0.529000	0.55759	ATG		0.597	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231		7	93	0	0	0	0.00308	0	7	93				
RNF17	56163	broad.mit.edu	37	13	25370318	25370319	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr13:25370318_25370319CC>AA	ENST00000255324.5	+	11	1336_1337	c.1284_1285CC>AA	c.(1282-1287)tgCCat>tgAAat	p.428_429CH>*N	RNF17_ENST00000255326.4_3'UTR|RNF17_ENST00000381921.1_Nonsense_Mutation_p.428_429CH>*N|RNF17_ENST00000255325.6_Nonsense_Mutation_p.428_429CH>*N	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	428					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TAGATCCTTGCCATTTCTACAT	0.347																																							uc001upr.2		NA																	0				ovary(1)|skin(1)	2						c.(1282-1287)TGCCAT>TGAAAT		ring finger protein 17																																				SO:0001587	stop_gained	56163				multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding	g.chr13:25370318_25370319CC>AA	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	Exception_encountered	13.37:g.25370318_25370319delinsAA	ENSP00000255324:p.C428_H429delins*N		Somatic				RNF17_uc010tdd.1_Nonsense_Mutation_p.287_288CH>*N|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Nonsense_Mutation_p.428_429CH>*N|RNF17_uc001ups.2_Nonsense_Mutation_p.367_368CH>*N|RNF17_uc001upq.1_3'UTR	p.428_429CH>*N	NM_031277	NP_112567	WXS	Illumina HiSeq	Unspecified	Q9BXT8	RNF17_HUMAN		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)	11	1325_1326	+		Lung SC(185;0.0225)|Breast(139;0.077)	428_429					Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Nonsense_Mutation	DNP	ENST00000255324.5	37	c.1284_1285CC>AA	CCDS9308.2																																																																																				0.347	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994		3	56	0	0	0	0.004672	0	3	56				
RXFP2	122042	broad.mit.edu	37	13	32356828	32356828	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr13:32356828T>G	ENST00000298386.2	+	11	944	c.873T>G	c.(871-873)aaT>aaG	p.N291K	RXFP2_ENST00000380314.1_Intron	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	291					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		TGCCTAGAAATCAAATTGGTT	0.408																																							uc001utt.2		NA																	0					0						c.(871-873)AAT>AAG		relaxin/insulin-like family peptide receptor 2							84.0	82.0	83.0					13																	32356828		2203	4300	6503	SO:0001583	missense	122042					integral to membrane|plasma membrane		g.chr13:32356828T>G	AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.873T>G	13.37:g.32356828T>G	ENSP00000298386:p.Asn291Lys		Somatic				RXFP2_uc010aba.2_Intron	p.N291K	NM_130806	NP_570718	WXS	Illumina HiSeq	Unspecified	Q8WXD0	RXFP2_HUMAN		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)	11	944	+		Lung SC(185;0.0262)	291			LRR 7.|Extracellular (Potential).		B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	c.873T>G	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	T	18.45	3.627141	0.66901	.	.	ENSG00000133105	ENST00000298386	T	0.74421	-0.84	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.90051	0.6893	H	0.96805	3.885	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92443	0.5963	10	0.87932	D	0	.	11.3145	0.49383	0.0:0.0:0.152:0.848	.	291	Q8WXD0	RXFP2_HUMAN	K	291	ENSP00000298386:N291K	ENSP00000298386:N291K	N	+	3	2	RXFP2	31254828	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.075000	0.41538	2.141000	0.66446	0.533000	0.62120	AAT		0.408	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806		6	39	0	0	0	0.00308	0	6	39				
DIS3	22894	broad.mit.edu	37	13	73352425	73352425	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr13:73352425C>T	ENST00000377767.4	-	3	580	c.480G>A	c.(478-480)ttG>ttA	p.L160L	DIS3_ENST00000377780.4_Silent_p.L130L|DIS3_ENST00000475871.1_5'Flank|DIS3_ENST00000545453.1_5'UTR	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	160	PINc.				CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		ACATTTTTTTCAAATGTTCAT	0.373										Multiple Myeloma(4;0.011)																													uc001vix.3		NA																	0				central_nervous_system(1)	1						c.(478-480)TTG>TTA		DIS3 mitotic control isoform a							200.0	176.0	184.0					13																	73352425		2203	4299	6502	SO:0001819	synonymous_variant	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73352425C>T	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.480G>A	13.37:g.73352425C>T		Multiple Myeloma(4;0.011)	Somatic				DIS3_uc001viy.3_Silent_p.L130L|DIS3_uc001viz.2_RNA	p.L160L	NM_014953	NP_055768	WXS	Illumina HiSeq	Unspecified	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	3	854	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	160			PINc.		A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Silent	SNP	ENST00000377767.4	37	c.480G>A	CCDS9447.1																																																																																				0.373	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		4	27	0	0	0	0.000248	0	4	27				
ZIC5	85416	broad.mit.edu	37	13	100617983	100617983	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr13:100617983C>A	ENST00000267294.4	-	2	1873	c.1640G>T	c.(1639-1641)aGt>aTt	p.S547I		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	547					cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GGGCTTGTCACTGGTGTGGAC	0.488																																							uc001vom.1		NA																	0					0						c.(1639-1641)AGT>ATT		zinc finger protein of the cerebellum 5							190.0	168.0	175.0					13																	100617983		2203	4300	6503	SO:0001583	missense	85416				cell differentiation	nucleus	DNA binding|zinc ion binding	g.chr13:100617983C>A	AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.1640G>T	13.37:g.100617983C>A	ENSP00000267294:p.Ser547Ile		Somatic					p.S547I	NM_033132	NP_149123	WXS	Illumina HiSeq	Unspecified	Q96T25	ZIC5_HUMAN			2	1889	-	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		547					Q5VYB0	Missense_Mutation	SNP	ENST00000267294.4	37	c.1640G>T	CCDS9494.2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107836	0.77096	.	.	ENSG00000139800	ENST00000397451;ENST00000267294	T	0.15952	2.38	5.79	5.79	0.91817	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31796	0.0808	L	0.31207	0.915	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.02059	-1.1221	9	0.87932	D	0	.	16.2241	0.82283	0.0:0.8671:0.1329:0.0	.	547	Q96T25	ZIC5_HUMAN	I	185;547	ENSP00000267294:S547I	ENSP00000267294:S547I	S	-	2	0	ZIC5	99415984	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.088000	0.57678	2.722000	0.93159	0.655000	0.94253	AGT		0.488	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045623.3	NM_033132		9	67	1	0	0.00829132	0.008291	0.00916409	9	67				
OR4M1	441670	broad.mit.edu	37	14	20248765	20248765	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr14:20248765G>T	ENST00000315957.4	+	1	365	c.284G>T	c.(283-285)gGt>gTt	p.G95V		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATTTCCTTTGGTGGATGCATT	0.463																																							uc010tku.1		NA																	0					0						c.(283-285)GGT>GTT		olfactory receptor, family 4, subfamily M,							251.0	271.0	264.0					14																	20248765		2203	4300	6503	SO:0001583	missense	441670				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20248765G>T		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.284G>T	14.37:g.20248765G>T	ENSP00000319654:p.Gly95Val		Somatic					p.G95V	NM_001005500	NP_001005500	WXS	Illumina HiSeq	Unspecified	Q8NGD0	OR4M1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	284	+	all_cancers(95;0.00108)		95			Extracellular (Potential).		B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	c.284G>T	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	1.328	-0.597631	0.03771	.	.	ENSG00000176299	ENST00000315957	T	0.00392	7.58	4.2	1.36	0.22044	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000206	T	0.00178	0.0005	N	0.26092	0.79	0.09310	N	0.999995	B	0.19583	0.037	B	0.18263	0.021	T	0.37888	-0.9686	10	0.29301	T	0.29	-0.7896	3.7808	0.08680	0.3093:0.1837:0.5071:0.0	.	95	Q8NGD0	OR4M1_HUMAN	V	95	ENSP00000319654:G95V	ENSP00000319654:G95V	G	+	2	0	OR4M1	19318605	0.000000	0.05858	0.908000	0.35775	0.704000	0.40688	-0.544000	0.06077	0.541000	0.28827	-0.504000	0.04507	GGT		0.463	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1			26	128	1	0	1.77063e-15	0.005443	2.80276e-15	26	128				
RABGGTA	5875	broad.mit.edu	37	14	24738889	24738889	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr14:24738889C>A	ENST00000399409.3	-	5	922	c.439G>T	c.(439-441)Gac>Tac	p.D147Y	RABGGTA_ENST00000560777.1_5'UTR|RABGGTA_ENST00000559586.1_5'UTR|RABGGTA_ENST00000216840.6_Missense_Mutation_p.D147Y	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	147					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		CGCCGATAGTCCCAGCAGTGA	0.587																																							uc001wof.2		NA																	0					0						c.(439-441)GAC>TAC		Rab geranylgeranyltransferase alpha							27.0	34.0	32.0					14																	24738889		2029	4165	6194	SO:0001583	missense	5875				visual perception		Rab geranylgeranyltransferase activity|zinc ion binding	g.chr14:24738889C>A		CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.439G>T	14.37:g.24738889C>A	ENSP00000382341:p.Asp147Tyr		Somatic				RABGGTA_uc001woe.2_RNA|RABGGTA_uc001wog.2_Missense_Mutation_p.D147Y|RABGGTA_uc001woh.2_RNA|RABGGTA_uc001woi.2_RNA	p.D147Y	NM_004581	NP_004572	WXS	Illumina HiSeq	Unspecified	Q92696	PGTA_HUMAN		GBM - Glioblastoma multiforme(265;0.0184)	5	861	-			147			PFTA 3.		A8K5N2|D3DS69	Missense_Mutation	SNP	ENST00000399409.3	37	c.439G>T	CCDS45088.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236466	0.79800	.	.	ENSG00000100949	ENST00000216840;ENST00000399409;ENST00000543002	T;T	0.42131	0.98;0.98	5.41	5.41	0.78517	Protein prenyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.70527	0.3234	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76206	-0.3044	10	0.87932	D	0	-21.5611	17.9632	0.89092	0.0:1.0:0.0:0.0	.	147	Q92696	PGTA_HUMAN	Y	147;147;110	ENSP00000216840:D147Y;ENSP00000382341:D147Y	ENSP00000216840:D147Y	D	-	1	0	RABGGTA	23808729	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.684000	0.74538	2.536000	0.85505	0.462000	0.41574	GAC		0.587	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5	NM_182836		9	26	1	0	0.000442599	0.006214	0.000514461	9	26				
CTSG	1511	broad.mit.edu	37	14	25044576	25044576	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr14:25044576G>T	ENST00000216336.2	-	2	134	c.98C>A	c.(97-99)cCc>cAc	p.P33H		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	33	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		CGCCATGTAGGGGCGGGAGTG	0.572																																							uc001wpq.2		NA																	0				ovary(2)	2						c.(97-99)CCC>CAC		cathepsin G preproprotein							115.0	115.0	115.0					14																	25044576		2203	4300	6503	SO:0001583	missense	1511				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity	g.chr14:25044576G>T	M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.98C>A	14.37:g.25044576G>T	ENSP00000216336:p.Pro33His		Somatic					p.P33H	NM_001911	NP_001902	WXS	Illumina HiSeq	Unspecified	P08311	CATG_HUMAN		GBM - Glioblastoma multiforme(265;0.0269)	2	135	-			33			Peptidase S1.		Q6IBJ6|Q9UCA5|Q9UCU6	Missense_Mutation	SNP	ENST00000216336.2	37	c.98C>A	CCDS9631.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226960	0.79576	.	.	ENSG00000100448	ENST00000216336	D	0.99113	-5.44	5.38	5.38	0.77491	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.37761	N	0.001950	D	0.99612	0.9859	H	0.98996	4.395	0.45995	D	0.998806	D	0.71674	0.998	D	0.83275	0.996	D	0.97657	1.0158	10	0.72032	D	0.01	.	15.0163	0.71588	0.0:0.0:1.0:0.0	.	33	P08311	CATG_HUMAN	H	33	ENSP00000216336:P33H	ENSP00000216336:P33H	P	-	2	0	CTSG	24114416	1.000000	0.71417	0.993000	0.49108	0.849000	0.48306	4.282000	0.58971	2.687000	0.91594	0.655000	0.94253	CCC		0.572	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	NM_001911		17	141	1	0	5.45727e-16	0.008361	8.72609e-16	17	141				
RTN1	6252	broad.mit.edu	37	14	60074098	60074098	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr14:60074098G>A	ENST00000267484.5	-	4	2213	c.1878C>T	c.(1876-1878)taC>taT	p.Y626Y	RTN1_ENST00000395090.1_Silent_p.Y43Y|RTN1_ENST00000557422.1_5'UTR|RTN1_ENST00000342503.4_Silent_p.Y58Y	NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	626	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		CCAGGGCCAGGTAGGCCACGA	0.562																																							uc001xen.1		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1876-1878)TAC>TAT		reticulon 1 isoform A							79.0	70.0	73.0					14																	60074098		2203	4300	6503	SO:0001819	synonymous_variant	6252				neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity	g.chr14:60074098G>A	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1878C>T	14.37:g.60074098G>A			Somatic				RTN1_uc001xem.1_Silent_p.Y206Y|RTN1_uc001xek.1_Silent_p.Y58Y|RTN1_uc001xel.1_RNA|RTN1_uc010apl.1_Silent_p.Y43Y	p.Y626Y	NM_021136	NP_066959	WXS	Illumina HiSeq	Unspecified	Q16799	RTN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0968)	4	2087	-			626			Reticulon.		Q16800|Q16801|Q5BKZ4|Q9BQ59	Silent	SNP	ENST00000267484.5	37	c.1878C>T	CCDS9740.1																																																																																				0.562	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2			6	43	0	0	0	0.001168	0	6	43				
SMOC1	64093	broad.mit.edu	37	14	70442456	70442456	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr14:70442456T>A	ENST00000381280.4	+	4	656	c.403T>A	c.(403-405)Tac>Aac	p.Y135N	SMOC1_ENST00000361956.3_Missense_Mutation_p.Y135N	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	135	Thyroglobulin type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		TTACACTGGGTACTGCTGGTG	0.502																																							uc001xls.1		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(403-405)TAC>AAC		secreted modular calcium-binding protein 1							136.0	120.0	125.0					14																	70442456		2203	4300	6503	SO:0001583	missense	64093				cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding	g.chr14:70442456T>A	AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.403T>A	14.37:g.70442456T>A	ENSP00000370680:p.Tyr135Asn		Somatic				SMOC1_uc001xlt.1_Missense_Mutation_p.Y135N	p.Y135N	NM_022137	NP_071420	WXS	Illumina HiSeq	Unspecified	Q9H4F8	SMOC1_HUMAN		all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)	4	656	+			135			Thyroglobulin type-1 1.		A8K1S3|B2R7P5|Q96F78	Missense_Mutation	SNP	ENST00000381280.4	37	c.403T>A	CCDS9798.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.677602	0.88445	.	.	ENSG00000198732	ENST00000361956;ENST00000381280	T;T	0.64618	-0.11;-0.11	5.07	5.07	0.68467	Thyroglobulin type-1 (6);	0.000000	0.85682	D	0.000000	T	0.79947	0.4534	M	0.83483	2.645	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.998	T	0.82798	-0.0279	10	0.62326	D	0.03	-19.9877	13.9462	0.64086	0.0:0.0:0.0:1.0	.	135;135	Q9H4F8-2;Q9H4F8	.;SMOC1_HUMAN	N	135	ENSP00000355110:Y135N;ENSP00000370680:Y135N	ENSP00000355110:Y135N	Y	+	1	0	SMOC1	69512209	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.614000	0.82996	2.131000	0.65755	0.379000	0.24179	TAC		0.502	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000412467.1			11	55	0	0	0	0.00245	0	11	55				
TMED10	10972	broad.mit.edu	37	14	75614413	75614413	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr14:75614413A>T	ENST00000303575.4	-	3	416	c.365T>A	c.(364-366)gTg>gAg	p.V122E	TMED10_ENST00000557670.1_5'UTR	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	122	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.|Required for interaction with STX17.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		GTCTAGGATCACGAGTTGGTC	0.483																																							uc001xrm.1		NA																	0					0						c.(364-366)GTG>GAG		transmembrane emp24 domain-containing protein 10							239.0	216.0	224.0					14																	75614413		2203	4300	6503	SO:0001583	missense	10972				protein transport|regulated secretory pathway|vesicle targeting, to, from or within Golgi	cis-Golgi network|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|melanosome|microsome|zymogen granule membrane	protein binding	g.chr14:75614413A>T	AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.365T>A	14.37:g.75614413A>T	ENSP00000303145:p.Val122Glu		Somatic				TMED10_uc010ash.1_RNA|TMED10_uc010asg.1_RNA|TMED10_uc010tuz.1_5'UTR	p.V122E	NM_006827	NP_006818	WXS	Illumina HiSeq	Unspecified	P49755	TMEDA_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0126)	3	432	-			122			Lumenal (Potential).|GOLD.		B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Missense_Mutation	SNP	ENST00000303575.4	37	c.365T>A	CCDS9840.1	.	.	.	.	.	.	.	.	.	.	A	32	5.122141	0.94429	.	.	ENSG00000170348	ENST00000303575	T	0.26223	1.75	6.06	6.06	0.98353	GOLD (2);	0.056724	0.64402	D	0.000001	T	0.62380	0.2423	H	0.94734	3.575	0.80722	D	1	D	0.56746	0.977	D	0.65323	0.934	T	0.73858	-0.3850	10	0.87932	D	0	-6.3074	16.6245	0.84952	1.0:0.0:0.0:0.0	.	122	P49755	TMEDA_HUMAN	E	122	ENSP00000303145:V122E	ENSP00000303145:V122E	V	-	2	0	TMED10	74684166	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.958000	0.93099	2.323000	0.78572	0.528000	0.53228	GTG		0.483	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415034.1	NM_006827		48	172	0	0	0	0.00361	0	48	172				
DYNC1H1	1778	broad.mit.edu	37	14	102483598	102483598	+	Silent	SNP	T	T	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr14:102483598T>C	ENST00000360184.4	+	39	8186	c.8022T>C	c.(8020-8022)taT>taC	p.Y2674Y		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2674	AAA 3. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGGATAAATATGGGACCCAGA	0.453																																							uc001yks.2		NA																	0				ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(8020-8022)TAT>TAC		cytoplasmic dynein 1 heavy chain 1							107.0	105.0	106.0					14																	102483598		2203	4300	6503	SO:0001819	synonymous_variant	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102483598T>C	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8022T>C	14.37:g.102483598T>C			Somatic				DYNC1H1_uc001ykt.1_Silent_p.Y165Y	p.Y2674Y	NM_001376	NP_001367	WXS	Illumina HiSeq	Unspecified	Q14204	DYHC1_HUMAN			39	8186	+			2674			AAA 3 (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	c.8022T>C	CCDS9966.1																																																																																				0.453	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		17	59	0	0	0	0.008871	0	17	59				
PACS2	23241	broad.mit.edu	37	14	105833558	105833558	+	Silent	SNP	A	A	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr14:105833558A>G	ENST00000325438.8	+	5	936	c.432A>G	c.(430-432)caA>caG	p.Q144Q	PACS2_ENST00000430725.2_Silent_p.Q77Q|PACS2_ENST00000447393.1_Silent_p.Q144Q|PACS2_ENST00000547217.1_Silent_p.Q114Q|PACS2_ENST00000458164.2_Silent_p.Q144Q			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	144					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		AGGTGATGCAACACCCGTCTG	0.642																																							uc001yqt.2		NA																	0				pancreas(1)	1						c.(430-432)CAA>CAG		phosphofurin acidic cluster sorting protein 2							38.0	40.0	39.0					14																	105833558		2203	4300	6503	SO:0001819	synonymous_variant	23241				apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion		g.chr14:105833558A>G	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.432A>G	14.37:g.105833558A>G			Somatic				PACS2_uc001yqs.2_Silent_p.Q77Q|PACS2_uc001yqv.2_Silent_p.Q144Q|PACS2_uc001yqu.2_Silent_p.Q144Q	p.Q144Q	NM_015197	NP_056012	WXS	Illumina HiSeq	Unspecified	Q86VP3	PACS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)	5	607	+		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	144					A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Silent	SNP	ENST00000325438.8	37	c.432A>G	CCDS32168.1																																																																																				0.642	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355		6	29	0	0	0	0.001168	0	6	29				
C14orf80	283643	broad.mit.edu	37	14	105960174	105960174	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr14:105960174C>T	ENST00000392523.4	+	5	709	c.588C>T	c.(586-588)atC>atT	p.I196I	C14orf80_ENST00000392527.1_Intron|C14orf80_ENST00000392522.3_Silent_p.I196I|C14orf80_ENST00000329886.7_Intron|C14orf80_ENST00000334656.7_Intron|C14orf80_ENST00000354560.6_Intron|C14orf80_ENST00000450383.1_Silent_p.I18I|C14orf80_ENST00000551054.1_Intron			Q86SX3	CN080_HUMAN	chromosome 14 open reading frame 80	196										central_nervous_system(1)	1		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.239)		TGTTTTAGATCCACCTGTACA	0.602																																							uc001yrm.2		NA																	0					0						c.(586-588)ATC>ATT		hypothetical protein LOC283643 isoform 1							56.0	40.0	45.0					14																	105960174		2198	4299	6497	SO:0001819	synonymous_variant	283643							g.chr14:105960174C>T		CCDS45180.1, CCDS45181.1, CCDS45182.1, CCDS55955.1	14q32.33	2012-09-25			ENSG00000185347	ENSG00000185347			20127	protein-coding gene	gene with protein product							Standard	NM_001134875		Approved		uc001yrn.3	Q86SX3	OTTHUMG00000170426	ENST00000392523.4:c.588C>T	14.37:g.105960174C>T			Somatic				C14orf80_uc001yrj.2_Intron|C14orf80_uc001yrk.2_Intron|C14orf80_uc001yrn.2_Silent_p.I196I|C14orf80_uc001yro.2_Intron|C14orf80_uc010tys.1_Silent_p.I18I	p.I196I	NM_001134875	NP_001128347	WXS	Illumina HiSeq	Unspecified	Q86SX3	CN080_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.239)	5	715	+		Melanoma(154;0.226)	196					B5MDG3|E9PAQ4|Q86TT3|Q86TT4|Q86TT5|Q96B41|Q9H7H4	Silent	SNP	ENST00000392523.4	37	c.588C>T																																																																																					0.602	C14orf80-017	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409090.1	NM_001134875		5	32	0	0	0	0.001984	0	5	32				
GABRG3	2567	broad.mit.edu	37	15	27222209	27222209	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:27222209G>A	ENST00000333743.6	+	2	368	c.114G>A	c.(112-114)ttG>ttA	p.L38L	GABRG3_ENST00000555083.1_Silent_p.L38L	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	38					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGTGGGTCTTGGCTCCAAAAT	0.418																																					NSCLC(114;800 1656 7410 37729 45293)	NSCLC(114;800 1656 7410 37729 45293)	uc001zbg.1		NA																	0					0						c.(112-114)TTG>TTA		gamma-aminobutyric acid (GABA) A receptor, gamma							99.0	97.0	98.0					15																	27222209		1851	4083	5934	SO:0001819	synonymous_variant	2567				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27222209G>A		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.114G>A	15.37:g.27222209G>A			Somatic				GABRG3_uc001zbf.2_Silent_p.L38L	p.L38L	NM_033223	NP_150092	WXS	Illumina HiSeq	Unspecified	Q99928	GBRG3_HUMAN		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	2	280	+		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)	38			Extracellular (Probable).		G3V594|Q9HD46|Q9NYT2	Silent	SNP	ENST00000333743.6	37	c.114G>A	CCDS45195.1																																																																																				0.418	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			9	28	0	0	0	0.004482	0	9	28				
GABRG3	2567	broad.mit.edu	37	15	27777771	27777771	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:27777771C>A	ENST00000333743.6	+	10	1402	c.1148C>A	c.(1147-1149)cCa>cAa	p.P383Q	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	383					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GACATGAGGCCACCACCAACT	0.433																																					NSCLC(114;800 1656 7410 37729 45293)	NSCLC(114;800 1656 7410 37729 45293)	uc001zbg.1		NA																	0					0						c.(1147-1149)CCA>CAA		gamma-aminobutyric acid (GABA) A receptor, gamma							99.0	98.0	98.0					15																	27777771		1976	4165	6141	SO:0001583	missense	2567				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27777771C>A		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1148C>A	15.37:g.27777771C>A	ENSP00000331912:p.Pro383Gln		Somatic					p.P383Q	NM_033223	NP_150092	WXS	Illumina HiSeq	Unspecified	Q99928	GBRG3_HUMAN		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	10	1314	+		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)	383			Cytoplasmic (Probable).		G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	c.1148C>A	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.390452	0.82902	.	.	ENSG00000182256	ENST00000333743	D	0.84442	-1.85	5.85	5.85	0.93711	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.349613	0.26265	N	0.025370	T	0.81221	0.4777	N	0.16478	0.41	0.80722	D	1	P	0.49696	0.927	P	0.48952	0.596	T	0.78430	-0.2207	10	0.21540	T	0.41	.	19.1488	0.93479	0.0:1.0:0.0:0.0	.	383	Q99928	GBRG3_HUMAN	Q	383	ENSP00000331912:P383Q	ENSP00000331912:P383Q	P	+	2	0	GABRG3	25451366	1.000000	0.71417	0.870000	0.34147	0.970000	0.65996	5.706000	0.68362	2.772000	0.95346	0.650000	0.86243	CCA		0.433	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			7	27	1	0	8.12818e-05	0.001984	9.80988e-05	7	27				
MTMR10	54893	broad.mit.edu	37	15	31233850	31233850	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:31233850G>A	ENST00000435680.1	-	16	2254	c.2157C>T	c.(2155-2157)aaC>aaT	p.N719N	FAN1_ENST00000362065.4_3'UTR|MTMR10_ENST00000314404.8_Intron|MTMR10_ENST00000425768.1_3'UTR	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	719							phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		GGCCGCTGGCGTTGAAGTACA	0.587																																							uc001zfh.1		NA																	0				ovary(1)	1						c.(2155-2157)AAC>AAT		myotubularin related protein 10							33.0	34.0	34.0					15																	31233850		2035	4187	6222	SO:0001819	synonymous_variant	54893						phosphatase activity	g.chr15:31233850G>A	AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.2157C>T	15.37:g.31233850G>A			Somatic				MTMR15_uc001zff.2_3'UTR|MTMR15_uc001zfe.2_3'UTR|MTMR10_uc010ubk.1_Silent_p.N133N|MTMR10_uc001zfg.1_Silent_p.N300N|MTMR10_uc010azx.1_Silent_p.N471N|MTMR10_uc001zfi.1_3'UTR	p.N719N	NM_017762	NP_060232	WXS	Illumina HiSeq	Unspecified	Q9NXD2	MTMRA_HUMAN		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)	16	2255	-		all_lung(180;2.81e-11)	719					Q6P4Q6	Silent	SNP	ENST00000435680.1	37	c.2157C>T	CCDS45204.1																																																																																				0.587	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430747.1	NM_017762		3	6	0	0	0	0.004672	0	3	6				
SEMA6D	80031	broad.mit.edu	37	15	48063809	48063809	+	Missense_Mutation	SNP	G	G	A	rs371308825		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:48063809G>A	ENST00000316364.5	+	19	3488	c.3049G>A	c.(3049-3051)Gtg>Atg	p.V1017M	SEMA6D_ENST00000536845.2_Missense_Mutation_p.V1017M|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000389433.2_Missense_Mutation_p.V998M|SEMA6D_ENST00000354744.4_Missense_Mutation_p.V961M|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000558014.1_Missense_Mutation_p.V955M|SEMA6D_ENST00000389428.3_Missense_Mutation_p.V942M|SEMA6D_ENST00000389432.2_Missense_Mutation_p.V974M|SEMA6D_ENST00000358066.4_Missense_Mutation_p.V955M|SEMA6D_ENST00000537942.1_Missense_Mutation_p.V955M	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	1017					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GGGAACACCAGTGAGTGTTCA	0.517																																							uc010bek.2		NA																	0				skin(3)|breast(1)	4						c.(3049-3051)GTG>ATG		semaphorin 6D isoform 4 precursor							128.0	121.0	123.0					15																	48063809		2198	4297	6495	SO:0001583	missense	80031				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity	g.chr15:48063809G>A	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.3049G>A	15.37:g.48063809G>A	ENSP00000324857:p.Val1017Met		Somatic				SEMA6D_uc001zvw.2_Missense_Mutation_p.V955M|SEMA6D_uc001zvy.2_Missense_Mutation_p.V1017M|SEMA6D_uc001zvz.2_Missense_Mutation_p.V961M|SEMA6D_uc001zwa.2_3'UTR|SEMA6D_uc001zwb.2_Missense_Mutation_p.V955M|SEMA6D_uc001zwc.2_Missense_Mutation_p.V942M	p.V1017M	NM_153618	NP_705871	WXS	Illumina HiSeq	Unspecified	Q8NFY4	SEM6D_HUMAN		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)	19	3409	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	1017			Cytoplasmic (Potential).		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	c.3049G>A	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.308256	0.23821	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.18174	2.23;2.24;2.24;2.24;2.23;2.23;2.23;2.24	5.8	5.8	0.92144	.	0.288560	0.34223	N	0.004156	T	0.07188	0.0182	N	0.02011	-0.69	0.80722	D	1	B;B;B;B	0.29988	0.264;0.098;0.004;0.061	B;B;B;B	0.23275	0.045;0.031;0.007;0.027	T	0.32981	-0.9886	10	0.52906	T	0.07	.	13.2846	0.60235	0.0719:0.0:0.9281:0.0	.	942;961;1017;955	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	M	955;1017;1017;998;974;961;955;942	ENSP00000442040:V955M;ENSP00000446152:V1017M;ENSP00000324857:V1017M;ENSP00000374084:V998M;ENSP00000374083:V974M;ENSP00000346786:V961M;ENSP00000350770:V955M;ENSP00000374079:V942M	ENSP00000324857:V1017M	V	+	1	0	SEMA6D	45851101	1.000000	0.71417	0.972000	0.41901	0.873000	0.50193	4.577000	0.60922	2.758000	0.94735	0.563000	0.77884	GTG		0.517	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966		24	100	0	0	0	0.007291	0	24	100				
CEP152	22995	broad.mit.edu	37	15	49059641	49059641	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:49059641G>A	ENST00000380950.2	-	16	2225	c.2038C>T	c.(2038-2040)Cag>Tag	p.Q680*	CEP152_ENST00000559398.1_5'Flank|CEP152_ENST00000399334.3_Nonsense_Mutation_p.Q680*|CEP152_ENST00000325747.5_Nonsense_Mutation_p.Q587*	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	680					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TCATGGTGCTGCTGATAAGTC	0.443																																							uc001zwy.2		NA																	0				lung(2)	2						c.(2038-2040)CAG>TAG		centrosomal protein 152kDa							133.0	127.0	129.0					15																	49059641		1984	4180	6164	SO:0001587	stop_gained	22995				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding	g.chr15:49059641G>A	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.2038C>T	15.37:g.49059641G>A	ENSP00000370337:p.Gln680*		Somatic				CEP152_uc001zwz.2_Nonsense_Mutation_p.Q680*|CEP152_uc001zxa.1_Nonsense_Mutation_p.Q587*	p.Q680*	NM_014985	NP_055800	WXS	Illumina HiSeq	Unspecified	O94986	CE152_HUMAN		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)	16	2072	-		all_lung(180;0.0428)	680					E7ER66|Q17RV1|Q6NTA0	Nonsense_Mutation	SNP	ENST00000380950.2	37	c.2038C>T	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	G	41	8.865505	0.98982	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-13.9799	17.5169	0.87776	0.0:0.0:1.0:0.0	.	.	.	.	X	680;587;680	.	ENSP00000321000:Q587X	Q	-	1	0	CEP152	46846933	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.338000	0.72963	2.669000	0.90835	0.655000	0.94253	CAG		0.443	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985		7	54	0	0	0	0.004482	0	7	54				
THSD4	79875	broad.mit.edu	37	15	72040905	72040905	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:72040905G>T	ENST00000355327.3	+	14	2521	c.2387G>T	c.(2386-2388)aGc>aTc	p.S796I	THSD4_ENST00000357769.4_Missense_Mutation_p.S436I|THSD4_ENST00000567838.1_3'UTR|THSD4_ENST00000261862.6_Missense_Mutation_p.S796I			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	796	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TGTGCCAAGAGCTGGTTCCTC	0.572																																							uc002atb.1		NA																	0				ovary(2)	2						c.(2386-2388)AGC>ATC		thrombospondin, type I, domain containing 4							105.0	117.0	113.0					15																	72040905		2085	4217	6302	SO:0001583	missense	79875					proteinaceous extracellular matrix	metalloendopeptidase activity	g.chr15:72040905G>T	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.2387G>T	15.37:g.72040905G>T	ENSP00000347484:p.Ser796Ile		Somatic				THSD4_uc002ate.2_Missense_Mutation_p.S436I	p.S796I	NM_024817	NP_079093	WXS	Illumina HiSeq	Unspecified	Q6ZMP0	THSD4_HUMAN			13	2466	+			796			TSP type-1 4.		B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	37	c.2387G>T	CCDS10238.2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218750	0.79464	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.62941	-0.01;-0.01;0.27	4.68	4.68	0.58851	.	.	.	.	.	T	0.75481	0.3855	L	0.56769	1.78	0.53005	D	0.999966	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.77083	-0.2719	9	0.54805	T	0.06	.	15.4257	0.75048	0.0:0.0:1.0:0.0	.	436;796	B4DR13;Q6ZMP0	.;THSD4_HUMAN	I	796;796;436	ENSP00000347484:S796I;ENSP00000261862:S796I;ENSP00000350413:S436I	ENSP00000261862:S796I	S	+	2	0	THSD4	69827959	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.585000	0.82584	2.313000	0.78055	0.563000	0.77884	AGC		0.572	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817		7	37	1	0	7.48243e-07	0.006214	9.58116e-07	7	37				
ACSBG1	23205	broad.mit.edu	37	15	78474874	78474874	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:78474874G>A	ENST00000258873.4	-	7	1033	c.828C>T	c.(826-828)tgC>tgT	p.C276C	ACSBG1_ENST00000541759.1_Silent_p.C34C|ACSBG1_ENST00000560817.1_Silent_p.C34C	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	276					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CTAGCACACAGCACTGGTTGG	0.592																																							uc002bdh.2		NA																	0				ovary(1)	1						c.(826-828)TGC>TGT		lipidosin							80.0	66.0	70.0					15																	78474874		2196	4293	6489	SO:0001819	synonymous_variant	23205				long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity	g.chr15:78474874G>A	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.828C>T	15.37:g.78474874G>A			Somatic				ACSBG1_uc010umw.1_Silent_p.C272C|ACSBG1_uc010umx.1_Silent_p.C34C|ACSBG1_uc010umy.1_Silent_p.C169C	p.C276C	NM_015162	NP_055977	WXS	Illumina HiSeq	Unspecified	Q96GR2	ACBG1_HUMAN			7	884	-			276					B2RB61|O75126|Q76N27|Q9HC26	Silent	SNP	ENST00000258873.4	37	c.828C>T	CCDS10298.1																																																																																				0.592	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162		3	32	0	0	0	0.000248	0	3	32				
NTRK3	4916	broad.mit.edu	37	15	88678344	88678344	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:88678344C>G	ENST00000360948.2	-	9	1353	c.1192G>C	c.(1192-1194)Gag>Cag	p.E398Q	NTRK3_ENST00000558676.1_Missense_Mutation_p.E398Q|NTRK3_ENST00000542733.2_Missense_Mutation_p.E300Q|NTRK3_ENST00000394480.2_Missense_Mutation_p.E398Q|NTRK3_ENST00000355254.2_Missense_Mutation_p.E398Q|NTRK3_ENST00000557856.1_Missense_Mutation_p.E398Q|NTRK3_ENST00000540489.2_Missense_Mutation_p.E398Q|NTRK3_ENST00000317501.3_Missense_Mutation_p.E398Q|NTRK3_ENST00000357724.2_Missense_Mutation_p.E398Q	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	398					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGAAAGGGCTCCTTGAGGAAG	0.532			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	0				soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(1192-1194)GAG>CAG		neurotrophic tyrosine kinase, receptor, type 3							198.0	180.0	186.0					15																	88678344		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88678344C>G	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1192G>C	15.37:g.88678344C>G	ENSP00000354207:p.Glu398Gln	TSP Lung(13;0.10)	Somatic				NTRK3_uc002bmh.2_Missense_Mutation_p.E398Q|NTRK3_uc002bmf.1_Missense_Mutation_p.E398Q|NTRK3_uc010upl.1_Missense_Mutation_p.E300Q|NTRK3_uc010bnh.1_Missense_Mutation_p.E398Q|NTRK3_uc002bmg.2_Missense_Mutation_p.E398Q	p.E398Q	NM_001012338	NP_001012338	WXS	Illumina HiSeq	Unspecified	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		9	1354	-			398			Extracellular (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.1192G>C	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	8.663	0.900939	0.17760	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.74209	-0.82;-0.77;-0.8;-0.82;-0.7;0.08;0.08	5.28	5.28	0.74379	Immunoglobulin-like fold (1);	0.228982	0.45126	D	0.000399	T	0.55465	0.1922	L	0.27053	0.805	0.25761	N	0.984946	B;B;B;B;B;B	0.26975	0.022;0.025;0.022;0.165;0.043;0.022	B;B;B;B;B;B	0.21360	0.005;0.014;0.028;0.005;0.034;0.028	T	0.39099	-0.9630	10	0.16896	T	0.51	.	7.1668	0.25695	0.0:0.7305:0.1753:0.0942	.	300;398;398;398;398;398	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	Q	398;398;398;398;300;398;398	ENSP00000377990:E398Q;ENSP00000354207:E398Q;ENSP00000350356:E398Q;ENSP00000347397:E398Q;ENSP00000437773:E300Q;ENSP00000444673:E398Q;ENSP00000318328:E398Q	ENSP00000318328:E398Q	E	-	1	0	NTRK3	86479348	0.983000	0.35010	1.000000	0.80357	0.977000	0.68977	1.282000	0.33226	2.466000	0.83321	0.563000	0.77884	GAG		0.532	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				15	78	0	0	0	0.00499	0	15	78				
DNM1P47	100216544	broad.mit.edu	37	15	102292767	102292767	+	RNA	SNP	C	C	T	rs113047734		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:102292767C>T	ENST00000561463.1	+	0	813									DNM1 pseudogene 47																		CACAGCGGCGCGACGAGATGC	0.597																																							uc010usj.1		NA																	0					NA						c.(355-357)CGA>TGA		RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																																						0							g.chr15:102292767C>T	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102292767C>T			Somatic				uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank	p.R119*			WXS	Illumina HiSeq	Unspecified					4	414	+									Nonsense_Mutation	SNP	ENST00000561463.1	37	c.355C>T																																																																																					0.597	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149		6	23	0	0	0	0.00245	0	6	23				
DNM1P47	100216544	broad.mit.edu	37	15	102292785	102292785	+	RNA	SNP	C	C	G	rs61084368|rs143389223	byFrequency	TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:102292785C>G	ENST00000561463.1	+	0	831									DNM1 pseudogene 47									p.Q125E(1)									TGCTGCTTCTCAGAGCTGCTG	0.602																																							uc010usj.1		NA																	1	Substitution - Missense(1)		kidney(1)		NA						c.(373-375)CAG>GAG		RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																																						0							g.chr15:102292785C>G	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102292785C>G			Somatic				uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank	p.Q125E			WXS	Illumina HiSeq	Unspecified					4	432	+									Missense_Mutation	SNP	ENST00000561463.1	37	c.373C>G																																																																																					0.602	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149		3	28	0	0	0	0.00308	0	3	28				
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	RNA	SNP	G	G	A	rs201972834		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr15:102515299G>A	ENST00000557932.1	+	0	1145				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.G374S(10)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						TGGGGGCATCGGCAAGGCCAA	0.652																																							uc002cdi.2		NA																	10	Substitution - Missense(10)		kidney(7)|prostate(2)|endometrium(1)		0						c.(523-525)GGC>AGC		RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;																																						374666							g.chr15:102515299G>A			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515299G>A			Somatic				WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	p.G175S	NR_003659		WXS	Illumina HiSeq	Unspecified					9	1943	+									Missense_Mutation	SNP	ENST00000557932.1	37	c.523G>A		.	.	.	.	.	.	.	.	.	.	g	2.376	-0.343229	0.05243	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	1.01	0.19927	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	-23.1056	7.9382	0.29941	0.0:0.0:1.0:0.0	.	.	.	.	S	383;374	.	.	G	+	1	0	WASH3P	100332822	1.000000	0.71417	0.997000	0.53966	0.230000	0.25150	8.205000	0.89743	0.863000	0.35553	0.184000	0.17185	GGC		0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163		2	13	0	0	0	0.004672	0	2	13				
ABAT	18	broad.mit.edu	37	16	8868846	8868846	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr16:8868846G>T	ENST00000396600.2	+	13	1992	c.1054G>T	c.(1054-1056)Gtg>Ttg	p.V352L	ABAT_ENST00000268251.8_Missense_Mutation_p.V352L|ABAT_ENST00000425191.2_Missense_Mutation_p.V352L|ABAT_ENST00000569156.1_Missense_Mutation_p.V352L|ABAT_ENST00000567812.1_Missense_Mutation_p.V367L	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	352					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)			breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	CCCAGCAGACGTGATGACCTT	0.582																																							uc002czc.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(1054-1056)GTG>TTG		4-aminobutyrate aminotransferase precursor	Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)						113.0	90.0	98.0					16																	8868846		2197	4300	6497	SO:0001583	missense	18				behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding	g.chr16:8868846G>T	L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.1054G>T	16.37:g.8868846G>T	ENSP00000379845:p.Val352Leu		Somatic				ABAT_uc002czd.3_Missense_Mutation_p.V352L|ABAT_uc010buh.2_Missense_Mutation_p.V294L|ABAT_uc010bui.2_Missense_Mutation_p.V352L	p.V352L	NM_020686	NP_065737	WXS	Illumina HiSeq	Unspecified	P80404	GABT_HUMAN			13	1220	+			352					A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Missense_Mutation	SNP	ENST00000396600.2	37	c.1054G>T	CCDS10534.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.019057	0.35606	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	D;D;D	0.83673	-1.75;-1.75;-1.75	5.79	1.48	0.22813	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.395792	0.28853	N	0.013940	T	0.70745	0.3259	N	0.21194	0.64	0.48901	D	0.999728	B	0.06786	0.001	B	0.10450	0.005	T	0.59716	-0.7402	10	0.38643	T	0.18	-2.4947	11.8851	0.52598	0.0661:0.3035:0.6304:0.0	.	352	P80404	GABT_HUMAN	L	352	ENSP00000268251:V352L;ENSP00000379845:V352L;ENSP00000411916:V352L	ENSP00000268251:V352L	V	+	1	0	ABAT	8776347	0.642000	0.27260	0.315000	0.25238	0.916000	0.54674	0.927000	0.28818	0.073000	0.16731	-0.304000	0.09214	GTG		0.582	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433620.2	NM_020686		11	48	1	0	2.61681e-11	0.00245	3.81619e-11	11	48				
SLC6A2	6530	broad.mit.edu	37	16	55729223	55729223	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr16:55729223C>T	ENST00000379906.2	+	7	1311	c.1056C>T	c.(1054-1056)atC>atT	p.I352I	SLC6A2_ENST00000219833.8_Silent_p.I352I|SLC6A2_ENST00000561820.1_Silent_p.I352I|SLC6A2_ENST00000568943.1_Silent_p.I352I|SLC6A2_ENST00000414754.3_Silent_p.I352I|SLC6A2_ENST00000567238.1_Silent_p.I247I|SLC6A2_ENST00000566163.1_Silent_p.I307I	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	352					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	TCAACTGTATCACCAGCTTCG	0.547																																							uc002eif.2		NA																	0				lung(4)|ovary(2)|pancreas(2)	8						c.(1054-1056)ATC>ATT		solute carrier family 6 member 2	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)						187.0	126.0	147.0					16																	55729223		2198	4300	6498	SO:0001819	synonymous_variant	6530				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity	g.chr16:55729223C>T		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.1056C>T	16.37:g.55729223C>T			Somatic				SLC6A2_uc010ccd.2_Silent_p.I352I|SLC6A2_uc002eig.2_Silent_p.I352I|SLC6A2_uc002eih.2_Silent_p.I352I|SLC6A2_uc002eii.2_Silent_p.I247I|SLC6A2_uc002eij.2_Silent_p.I66I	p.I352I	NM_001043	NP_001034	WXS	Illumina HiSeq	Unspecified	P23975	SC6A2_HUMAN		BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	8	1167	+			352			Helical; Name=7; (Potential).		B2R707|B4DX48|Q96KH8	Silent	SNP	ENST00000379906.2	37	c.1056C>T	CCDS10754.1																																																																																				0.547	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2			10	86	0	0	0	0.00245	0	10	86				
RSPRY1	89970	broad.mit.edu	37	16	57265200	57265200	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr16:57265200C>T	ENST00000537866.1	+	13	2371	c.1498C>T	c.(1498-1500)Cta>Tta	p.L500L	RSPRY1_ENST00000394420.4_Silent_p.L500L|RSPRY1_ENST00000563073.1_3'UTR			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	500						extracellular region (GO:0005576)	zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						CTACGCCTTCCTAACAGCTGA	0.338																																							uc002elb.2		NA																	0				ovary(1)	1						c.(1498-1500)CTA>TTA		ring finger and SPRY domain containing 1							101.0	96.0	98.0					16																	57265200		2198	4300	6498	SO:0001819	synonymous_variant	89970					extracellular region	zinc ion binding	g.chr16:57265200C>T	AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1498C>T	16.37:g.57265200C>T			Somatic				RSPRY1_uc002elc.2_Silent_p.L500L|RSPRY1_uc002eld.2_Silent_p.L500L	p.L500L	NM_133368	NP_588609	WXS	Illumina HiSeq	Unspecified	Q96DX4	RSPRY_HUMAN			13	1776	+			500					Q6UX21|Q8ND53	Silent	SNP	ENST00000537866.1	37	c.1498C>T	CCDS10775.1																																																																																				0.338	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1	NM_133368		6	55	0	0	0	0.001984	0	6	55				
CSNK2A2	1459	broad.mit.edu	37	16	58220711	58220711	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr16:58220711A>C	ENST00000262506.3	-	3	449	c.266T>G	c.(265-267)cTt>cGt	p.L89R	CSNK2A2_ENST00000566813.1_5'UTR	NM_001896.2	NP_001887.1	P19784	CSK22_HUMAN	casein kinase 2, alpha prime polypeptide	89	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)	1						TCCACCACGAAGGTTCTCCAG	0.413																																					Melanoma(54;119 1219 18349 35700 39738)	Melanoma(54;119 1219 18349 35700 39738)	uc002enc.2		NA																	0				central_nervous_system(1)	1						c.(265-267)CTT>CGT		casein kinase 2, alpha prime polypeptide							175.0	162.0	166.0					16																	58220711		2198	4300	6498	SO:0001583	missense	1459				axon guidance|Wnt receptor signaling pathway	cytosol|nucleus	ATP binding|protein N-terminus binding|protein serine/threonine kinase activity	g.chr16:58220711A>C	M55268	CCDS10794.1	16q21	2013-01-17			ENSG00000070770	ENSG00000070770			2459	protein-coding gene	gene with protein product		115442				2174700, 1766873	Standard	NM_001896		Approved	CSNK2A1	uc002enc.3	P19784	OTTHUMG00000133488	ENST00000262506.3:c.266T>G	16.37:g.58220711A>C	ENSP00000262506:p.Leu89Arg		Somatic					p.L89R	NM_001896	NP_001887	WXS	Illumina HiSeq	Unspecified	P19784	CSK22_HUMAN			3	408	-			89			Protein kinase.			Missense_Mutation	SNP	ENST00000262506.3	37	c.266T>G	CCDS10794.1	.	.	.	.	.	.	.	.	.	.	A	18.96	3.734069	0.69189	.	.	ENSG00000070770	ENST00000262506	T	0.11604	2.76	5.9	2.39	0.29439	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.38134	0.1029	H	0.94808	3.585	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.11665	-1.0578	10	0.87932	D	0	-8.8414	6.3853	0.21558	0.7277:0.1332:0.1391:0.0	.	89	P19784	CSK22_HUMAN	R	89	ENSP00000262506:L89R	ENSP00000262506:L89R	L	-	2	0	CSNK2A2	56778212	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.335000	0.96500	0.131000	0.18576	0.528000	0.53228	CTT		0.413	CSNK2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257386.2	NM_001896		18	88	0	0	0	0.001523	0	18	88				
ZNF19	7567	broad.mit.edu	37	16	71509851	71509851	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr16:71509851C>A	ENST00000288177.5	-	6	854	c.599G>T	c.(598-600)gGt>gTt	p.G200V	ZNF19_ENST00000565637.1_Missense_Mutation_p.G158V|ZNF19_ENST00000565100.2_Missense_Mutation_p.G130V|AC010547.9_ENST00000561908.1_Intron|ZNF19_ENST00000564230.1_Missense_Mutation_p.G200V|ZNF19_ENST00000567225.1_Intron	NM_006961.3	NP_008892.2	P17023	ZNF19_HUMAN	zinc finger protein 19	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|prostate(1)|stomach(1)	22		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		CGAAGAATTACCATTAAAGGC	0.443																																							uc010cgc.1		NA																	0					0						c.(598-600)GGT>GTT		zinc finger protein 19							73.0	77.0	76.0					16																	71509851		2198	4300	6498	SO:0001583	missense	7567					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:71509851C>A	X52343	CCDS10901.1	16q22	2013-01-08	2006-05-10		ENSG00000157429	ENSG00000157429		"""Zinc fingers, C2H2-type"", ""-"""	12981	protein-coding gene	gene with protein product		194525	"""zinc finger protein 19 (KOX 12)"""			1505991, 1946370	Standard	NM_006961		Approved	KOX12, MGC51021	uc002fam.1	P17023	OTTHUMG00000137593	ENST00000288177.5:c.599G>T	16.37:g.71509851C>A	ENSP00000288177:p.Gly200Val		Somatic				ZNF23_uc002fai.2_Intron|ZNF19_uc002fak.1_Missense_Mutation_p.G188V|ZNF19_uc002fal.1_Missense_Mutation_p.G188V|ZNF19_uc002fam.1_Missense_Mutation_p.G200V	p.G200V	NM_006961	NP_008892	WXS	Illumina HiSeq	Unspecified	P17023	ZNF19_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)	6	1105	-		Ovarian(137;0.00965)	200			C2H2-type 2.		A8K895|Q86Y66|Q8NDE2|Q96M79|Q96NE5	Missense_Mutation	SNP	ENST00000288177.5	37	c.599G>T	CCDS10901.1	.	.	.	.	.	.	.	.	.	.	C	10.27	1.302564	0.23736	.	.	ENSG00000157429	ENST00000288177	T	0.35421	1.31	3.49	1.51	0.23008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38897	N	0.001537	T	0.17066	0.0410	N	0.17594	0.5	0.26024	N	0.981836	B	0.28998	0.23	B	0.32211	0.142	T	0.12243	-1.0555	10	0.17832	T	0.49	.	2.9453	0.05843	0.2196:0.5502:0.0:0.2302	.	200	P17023	ZNF19_HUMAN	V	200	ENSP00000288177:G200V	ENSP00000288177:G200V	G	-	2	0	ZNF19	70067352	0.000000	0.05858	0.699000	0.30290	0.989000	0.77384	-1.612000	0.02061	0.467000	0.27218	0.655000	0.94253	GGT		0.443	ZNF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268993.2	NM_006961		5	30	1	0	1.6384e-10	0.001984	2.3566e-10	5	30				
CHST5	23563	broad.mit.edu	37	16	75563351	75563351	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr16:75563351G>A	ENST00000336257.3	-	3	2326	c.932C>T	c.(931-933)gCc>gTc	p.A311V	CHST5_ENST00000541075.1_Missense_Mutation_p.A317V|RP11-77K12.7_ENST00000460606.1_3'UTR	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	311			A -> T (in dbSNP:rs7206332).		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						GCCGGTGAAGGCGTAGAGTGC	0.677																																							uc002fei.2		NA																	0					0						c.(931-933)GCC>GTC		carbohydrate (N-acetylglucosamine 6-O)							67.0	68.0	68.0					16																	75563351		2197	4300	6497	SO:0001583	missense	23563				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity	g.chr16:75563351G>A	AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.932C>T	16.37:g.75563351G>A	ENSP00000338783:p.Ala311Val		Somatic				CHST5_uc002fej.1_Missense_Mutation_p.A317V	p.A311V	NM_024533	NP_078809	WXS	Illumina HiSeq	Unspecified	Q9GZS9	CHST5_HUMAN			3	2327	-			311			Lumenal (Potential).		B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	ENST00000336257.3	37	c.932C>T	CCDS10919.1	.	.	.	.	.	.	.	.	.	.	G	9.431	1.085441	0.20390	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	T;T	0.25085	1.82;1.82	2.84	0.477	0.16784	Sulfotransferase domain (1);	0.322809	0.31495	N	0.007547	T	0.19685	0.0473	L	0.29908	0.895	0.26938	N	0.966306	B;B	0.30146	0.228;0.27	B;B	0.38755	0.185;0.281	T	0.20638	-1.0269	10	0.41790	T	0.15	.	8.4922	0.33106	0.0:0.0:0.3619:0.6381	.	317;311	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	V	311;317	ENSP00000338783:A311V;ENSP00000441220:A317V	ENSP00000338783:A311V	A	-	2	0	CHST5	74120852	0.001000	0.12720	0.995000	0.50966	0.138000	0.21146	1.133000	0.31430	0.500000	0.27991	0.313000	0.20887	GCC		0.677	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	NM_012126		19	96	0	0	0	0.002299	0	19	96				
TP53	7157	broad.mit.edu	37	17	7578498	7578498	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:7578498C>A	ENST00000269305.4	-	5	621	c.432G>T	c.(430-432)caG>caT	p.Q144H	TP53_ENST00000359597.4_Missense_Mutation_p.Q144H|TP53_ENST00000445888.2_Missense_Mutation_p.Q144H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.Q144H|TP53_ENST00000413465.2_Missense_Mutation_p.Q144H|TP53_ENST00000420246.2_Missense_Mutation_p.Q144H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	144	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Q144H(4)|p.Q144fs*25(3)|p.Q144del(2)|p.Q144Q(2)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.Q51fs*25(1)|p.Q144K(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.P142_Q144delPVQ(1)|p.Q12fs*25(1)|p.V143_S149del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAACCCACAGCTGCACAGGGC	0.602		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		28	Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Substitution - Missense(5)|Substitution - coding silent(2)	p.Q144*(29)|p.Q144L(8)|p.0?(7)|p.Q144H(4)|p.Q144P(4)|p.Q144R(4)|p.Q144fs*26(3)|p.Q144K(2)|p.Q144del(2)|p.Q144Q(2)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.Q144fs*4(1)|p.P142_Q144delPVQ(1)|p.V143_S149del(1)	upper_aerodigestive_tract(7)|breast(6)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|ovary(2)|large_intestine(1)|stomach(1)|urinary_tract(1)|liver(1)|skin(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(430-432)CAG>CAT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							57.0	57.0	57.0					17																	7578498		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578498C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.432G>T	17.37:g.7578498C>A	ENSP00000269305:p.Gln144His	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.Q144H|TP53_uc002gih.2_Missense_Mutation_p.Q144H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Q12H|TP53_uc010cng.1_Missense_Mutation_p.Q12H|TP53_uc002gii.1_Missense_Mutation_p.Q12H|TP53_uc010cnh.1_Missense_Mutation_p.Q144H|TP53_uc010cni.1_Missense_Mutation_p.Q144H|TP53_uc002gij.2_Missense_Mutation_p.Q144H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Q51H|TP53_uc002gio.2_Missense_Mutation_p.Q12H|TP53_uc010vug.1_Missense_Mutation_p.Q105H	p.Q144H	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	626	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	144		Q -> P (in sporadic cancers; somatic mutation).|Q -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.432G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.100197	0.37048	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	5.48	2.38	0.29361	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.121732	0.56097	D	0.000038	D	0.99554	0.9840	M	0.71036	2.16	0.41522	D	0.988409	P;D;B;P;D;D;D	0.89917	0.908;0.994;0.425;0.955;0.999;1.0;1.0	P;D;B;D;D;D;D	0.83275	0.582;0.987;0.164;0.943;0.996;0.996;0.993	D	0.99490	1.0950	10	0.87932	D	0	-30.9139	7.234	0.26059	0.0:0.7011:0.141:0.1579	.	105;144;144;51;144;144;144	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	144;144;144;144;144;144;133;51;12;51;12;144	ENSP00000410739:Q144H;ENSP00000352610:Q144H;ENSP00000269305:Q144H;ENSP00000398846:Q144H;ENSP00000391127:Q144H;ENSP00000391478:Q144H;ENSP00000425104:Q12H;ENSP00000423862:Q51H;ENSP00000424104:Q144H	ENSP00000269305:Q144H	Q	-	3	2	TP53	7519223	1.000000	0.71417	0.639000	0.29394	0.012000	0.07955	2.687000	0.46976	0.358000	0.24211	-0.176000	0.13171	CAG		0.602	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		13	45	1	0	0.00400662	0.004007	0.00449141	13	45				
MYH2	4620	broad.mit.edu	37	17	10447064	10447064	+	Silent	SNP	G	G	A	rs201018335		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:10447064G>A	ENST00000245503.5	-	8	1089	c.705C>T	c.(703-705)aaC>aaT	p.N235N	MYH2_ENST00000397183.2_Silent_p.N235N|MYH2_ENST00000532183.2_Silent_p.N235N|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	235	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CGGTCTTGGCGTTGCCAAAGG	0.478																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(703-705)AAC>AAT		myosin heavy chain IIa							84.0	84.0	84.0					17																	10447064		2203	4297	6500	SO:0001819	synonymous_variant	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10447064G>A		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.705C>T	17.37:g.10447064G>A			Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.N235N|MYH2_uc010coj.2_Silent_p.N235N	p.N235N	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			8	833	-			235			Myosin head-like.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	ENST00000245503.5	37	c.705C>T	CCDS11156.1																																																																																				0.478	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		11	39	0	0	0	0.00245	0	11	39				
KCNJ12	3768	broad.mit.edu	37	17	21319335	21319335	+	Silent	SNP	T	T	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:21319335T>C	ENST00000583088.1	+	3	1576	c.681T>C	c.(679-681)caT>caC	p.H227H	KCNJ12_ENST00000331718.5_Silent_p.H227H	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	227					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TGGAGGCCCATGTGCGCGCGC	0.642										Prostate(3;0.18)																													uc002gyv.1		NA																	0				ovary(3)|skin(1)	4						c.(679-681)CAT>CAC		potassium inwardly-rectifying channel, subfamily	Dofetilide(DB00204)						87.0	71.0	76.0					17																	21319335		2203	4300	6503	SO:0001819	synonymous_variant	3768				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity	g.chr17:21319335T>C	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.681T>C	17.37:g.21319335T>C		Prostate(3;0.18)	Somatic					p.H227H	NM_021012	NP_066292	WXS	Illumina HiSeq	Unspecified	Q14500	IRK12_HUMAN		Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	3	1386	+			227			Cytoplasmic (By similarity).		O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	c.681T>C	CCDS11219.1																																																																																				0.642	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		17	46	0	0	0	0.007413	0	17	46				
PIGS	94005	broad.mit.edu	37	17	26888618	26888618	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:26888618C>T	ENST00000308360.7	-	6	873	c.498G>A	c.(496-498)agG>agA	p.R166R	PIGS_ENST00000543734.1_Silent_p.R105R|PIGS_ENST00000465444.1_5'UTR|PIGS_ENST00000395346.2_Silent_p.R158R	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	166					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					CCACTGCTGTCCTCTTGGGCC	0.562																																							uc002hbo.2		NA																	0				breast(2)|urinary_tract(1)|kidney(1)	4						c.(496-498)AGG>AGA		phosphatidylinositol glycan anchor biosynthesis,							50.0	41.0	44.0					17																	26888618		2203	4300	6503	SO:0001819	synonymous_variant	94005				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding	g.chr17:26888618C>T		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.498G>A	17.37:g.26888618C>T			Somatic				PIGS_uc002hbn.2_Silent_p.R158R|PIGS_uc010wap.1_Silent_p.R105R	p.R166R	NM_033198	NP_149975	WXS	Illumina HiSeq	Unspecified	Q96S52	PIGS_HUMAN			6	871	-	Lung NSC(42;0.00431)		166			Lumenal (Potential).		Q6UVX6	Silent	SNP	ENST00000308360.7	37	c.498G>A	CCDS11235.1																																																																																				0.562	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198		3	22	0	0	0	0.000248	0	3	22				
KRT33A	3883	broad.mit.edu	37	17	39502461	39502461	+	Silent	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:39502461G>C	ENST00000007735.3	-	7	1169	c.1125C>G	c.(1123-1125)acC>acG	p.T375T		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	375	Tail.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				CACATGCATTGGTTGTGGCGC	0.512																																							uc002hwk.1		NA																	0					0						c.(1123-1125)ACC>ACG		keratin 33A							109.0	102.0	104.0					17																	39502461		2203	4300	6503	SO:0001819	synonymous_variant	3883					intermediate filament	protein binding|structural molecule activity	g.chr17:39502461G>C	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.1125C>G	17.37:g.39502461G>C			Somatic					p.T375T	NM_004138	NP_004129	WXS	Illumina HiSeq	Unspecified	O76009	KT33A_HUMAN			7	1162	-		Breast(137;0.000496)	375			Tail.		B2RA87|Q6NTB9|Q6ZZB9	Silent	SNP	ENST00000007735.3	37	c.1125C>G	CCDS11388.1																																																																																				0.512	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	NM_004138		3	82	0	0	0	0.004672	0	3	82				
CDC27	996	broad.mit.edu	37	17	45219643	45219643	+	Missense_Mutation	SNP	T	T	C	rs77510601		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:45219643T>C	ENST00000066544.3	-	11	1423	c.1330A>G	c.(1330-1332)Aca>Gca	p.T444A	CDC27_ENST00000531206.1_Missense_Mutation_p.T450A|CDC27_ENST00000446365.2_Missense_Mutation_p.T383A|CDC27_ENST00000527547.1_Missense_Mutation_p.T444A	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	444					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GGTGTGATTGTGGATATTTTC	0.308																																							uc002ild.3		NA																	0				lung(2)|breast(2)|ovary(1)	5						c.(1330-1332)ACA>GCA		cell division cycle protein 27 isoform 2							29.0	29.0	29.0					17																	45219643		2201	4296	6497	SO:0001583	missense	996				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding	g.chr17:45219643T>C	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1330A>G	17.37:g.45219643T>C	ENSP00000066544:p.Thr444Ala		Somatic				CDC27_uc002ile.3_Missense_Mutation_p.T450A|CDC27_uc002ilf.3_Missense_Mutation_p.T444A|CDC27_uc010wkp.1_Missense_Mutation_p.T383A|CDC27_uc010wkq.1_Intron	p.T444A	NM_001256	NP_001247	WXS	Illumina HiSeq	Unspecified	P30260	CDC27_HUMAN			11	1457	-			444					G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	c.1330A>G	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.256222	0.22965	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.68181	-0.31;-0.3;-0.03;-0.27	5.58	4.51	0.55191	.	0.200616	0.45606	D	0.000341	T	0.38427	0.1040	N	0.05230	-0.09	0.31391	N	0.677831	B;B;B;B	0.12013	0.002;0.005;0.001;0.0	B;B;B;B	0.12156	0.002;0.007;0.002;0.0	T	0.35201	-0.9798	10	0.07030	T	0.85	-10.2342	9.0285	0.36245	0.0:0.0864:0.0:0.9136	.	383;444;450;444	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	A	444;450;383;444	ENSP00000066544:T444A;ENSP00000434614:T450A;ENSP00000392802:T383A;ENSP00000437339:T444A	ENSP00000066544:T444A	T	-	1	0	CDC27	42574642	0.985000	0.35326	0.997000	0.53966	0.864000	0.49448	1.620000	0.36976	2.126000	0.65437	0.455000	0.32223	ACA		0.308	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2			4	30	0	0	0	0.000248	0	4	30				
PPP1R9B	84687	broad.mit.edu	37	17	48216665	48216665	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:48216665G>A	ENST00000316878.6	-	9	2032	c.2030C>T	c.(2029-2031)gCg>gTg	p.A677V	PPP1R9B_ENST00000501501.2_5'UTR|AC002401.1_ENST00000451776.1_RNA	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B	677	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						CTCAGTGACCGCATGCTTGAT	0.602																																							uc002iqh.3		NA																	0					0						c.(2035-2037)GCG>GTG		protein phosphatase 1, regulatory subunit 9B							174.0	181.0	179.0					17																	48216665		2139	4238	6377	SO:0001583	missense	84687				cell cycle arrest|cell differentiation|cell migration|filopodium assembly|negative regulation of cell growth|nervous system development|regulation of cell growth by extracellular stimulus|regulation of cell proliferation|regulation of exit from mitosis|RNA splicing	adherens junction|cytoskeleton|dendritic spine|filopodium|lamellipodium|nucleoplasm|protein phosphatase type 1 complex|ruffle membrane|synapse	actin binding|protein phosphatase 1 binding|protein phosphatase inhibitor activity	g.chr17:48216665G>A	AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.2030C>T	17.37:g.48216665G>A	ENSP00000475417:p.Ala677Val		Somatic					p.A679V	NM_032595	NP_115984	WXS	Illumina HiSeq	Unspecified	Q96SB3	NEB2_HUMAN			9	2039	-			677			Potential.|Interacts with TGN38 (By similarity).		Q8TCR9	Missense_Mutation	SNP	ENST00000316878.6	37	c.2036C>T																																																																																					0.602	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032595		4	202	0	0	0	0.000602	0	4	202				
TOB1	10140	broad.mit.edu	37	17	48940956	48940956	+	Silent	SNP	G	G	A	rs142180537		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:48940956G>A	ENST00000268957.3	-	3	851	c.423C>T	c.(421-423)ccC>ccT	p.P141P	TOB1_ENST00000509385.1_5'UTR|TOB1_ENST00000499247.2_Silent_p.P141P	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	141					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			GGTCACTTATGGGCATAAAAA	0.488											OREG0024576	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(144;643 1919 24513 29423 40686)	NSCLC(144;643 1919 24513 29423 40686)	uc002isw.2		NA																	0				large_intestine(1)	1						c.(421-423)CCC>CCT		transducer of ERBB2, 1		G		1,4405	2.1+/-5.4	0,1,2202	109.0	95.0	100.0		423	4.5	1.0	17	dbSNP_134	100	0,8600		0,0,4300	no	coding-synonymous	TOB1	NM_005749.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		141/346	48940956	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10140				negative regulation of cell proliferation		SH3/SH2 adaptor activity	g.chr17:48940956G>A	D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.423C>T	17.37:g.48940956G>A			Somatic	OREG0024576	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	958	TOB1_uc010wmy.1_Silent_p.P141P|TOB1_uc010wmz.1_Silent_p.P141P	p.P141P	NM_005749	NP_005740	WXS	Illumina HiSeq	Unspecified	P50616	TOB1_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.09e-08)		1	458	-			141					B2R9T0|D3DTY3|Q4KMQ0	Silent	SNP	ENST00000268957.3	37	c.423C>T	CCDS11576.1																																																																																				0.488	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1			13	45	0	0	0	0.001368	0	13	45				
SRSF1	6426	broad.mit.edu	37	17	56082810	56082810	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:56082810G>A	ENST00000258962.4	-	4	912	c.704C>T	c.(703-705)cCa>cTa	p.P235L	SRSF1_ENST00000582730.2_3'UTR|SRSF1_ENST00000584773.1_Missense_Mutation_p.P235L|SRSF1_ENST00000585096.1_Intron|RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000581497.1_5'Flank	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	235	Arg/Ser-rich (RS domain).|Interacts with SAFB1.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGAATAGCGTGGTGATCCTCT	0.473																																							uc002ivi.2		NA																	0					0						c.(703-705)CCA>CTA		splicing factor, arginine/serine-rich 1 isoform							216.0	190.0	199.0					17																	56082810		2203	4300	6503	SO:0001583	missense	6426				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding	g.chr17:56082810G>A		CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.704C>T	17.37:g.56082810G>A	ENSP00000258962:p.Pro235Leu		Somatic				SFRS1_uc002ivj.2_3'UTR	p.P235L	NM_006924	NP_008855	WXS	Illumina HiSeq	Unspecified	Q07955	SRSF1_HUMAN		LUAD - Lung adenocarcinoma(1115;0.247)	4	913	-		Colorectal(1115;0.0691)	235	Missing: In RS-C; loss of ability to activate splicing but retains splice site switching.|Missing: In MR-A; loss of ability to activate splicing.|Missing: In MR-B; strongly inhibits splicing.|Missing: In RS-B; retains both splice activation and splice site switching activity.		Arg/Ser-rich (RS domain).|Interacts with SAFB1.		B2R6Z7|D3DTZ3|Q13809	Missense_Mutation	SNP	ENST00000258962.4	37	c.704C>T	CCDS11600.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.710158	0.30322	.	.	ENSG00000136450	ENST00000258962	T	0.21031	2.03	5.65	5.65	0.86999	.	0.839256	0.10986	N	0.612187	T	0.48978	0.1530	M	0.72353	2.195	0.80722	D	1	D	0.64830	0.994	P	0.62885	0.908	T	0.31998	-0.9923	10	0.52906	T	0.07	.	20.1057	0.97893	0.0:0.0:1.0:0.0	.	235	Q07955	SRSF1_HUMAN	L	235	ENSP00000258962:P235L	ENSP00000258962:P235L	P	-	2	0	SRSF1	53437809	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.282000	0.95840	2.827000	0.97445	0.650000	0.86243	CCA		0.473	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443335.1	NM_006924		68	191	0	0	0	0.00361	0	68	191				
CDC42EP4	23580	broad.mit.edu	37	17	71281643	71281643	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:71281643C>A	ENST00000335793.3	-	2	1391	c.997G>T	c.(997-999)Gct>Tct	p.A333S	CDC42EP4_ENST00000581014.1_Missense_Mutation_p.G65V|CDC42EP4_ENST00000439510.2_Missense_Mutation_p.A263S			Q9H3Q1	BORG4_HUMAN	CDC42 effector protein (Rho GTPase binding) 4	333					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(7)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			GAGACAGCAGCCCGGGCCCTG	0.657																																							uc002jjn.2		NA																	0					0						c.(997-999)GCT>TCT		Cdc42 effector protein 4							55.0	65.0	62.0					17																	71281643		2203	4300	6503	SO:0001583	missense	23580				positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding	g.chr17:71281643C>A	AB042237	CCDS11695.1	17q24-q25	2008-07-18				ENSG00000179604			17147	protein-coding gene	gene with protein product	"""Cdc42 effector protein 4"", ""binder of Rho GTPases 4"""	605468				11035016, 10490598	Standard	NM_012121		Approved	CEP4, KAIA1777, BORG4, MGC3740, MGC17125	uc002jjo.3	Q9H3Q1		ENST00000335793.3:c.997G>T	17.37:g.71281643C>A	ENSP00000338258:p.Ala333Ser		Somatic				CDC42EP4_uc002jjo.2_Missense_Mutation_p.A333S|CDC42EP4_uc002jjp.1_Missense_Mutation_p.A263S	p.A333S	NM_012121	NP_036253	WXS	Illumina HiSeq	Unspecified	Q9H3Q1	BORG4_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)		2	1144	-			333					B3KUS7|O95828|Q96FT3	Missense_Mutation	SNP	ENST00000335793.3	37	c.997G>T	CCDS11695.1	.	.	.	.	.	.	.	.	.	.	C	4.829	0.154177	0.09236	.	.	ENSG00000179604	ENST00000335793;ENST00000439510	T;T	0.32272	1.48;1.46	4.29	4.29	0.51040	.	0.771602	0.10297	N	0.691641	T	0.26629	0.0651	L	0.57536	1.79	0.38295	D	0.942828	B;B	0.30482	0.281;0.099	B;B	0.19946	0.027;0.027	T	0.08126	-1.0737	10	0.12103	T	0.63	-16.1952	10.2378	0.43294	0.0:0.9072:0.0:0.0928	.	263;333	B3KUS7;Q9H3Q1	.;BORG4_HUMAN	S	333;263	ENSP00000338258:A333S;ENSP00000404270:A263S	ENSP00000338258:A333S	A	-	1	0	CDC42EP4	68793238	0.073000	0.21202	0.135000	0.22099	0.017000	0.09413	0.630000	0.24553	2.229000	0.72834	0.484000	0.47621	GCT		0.657	CDC42EP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441898.1	NM_012121		28	81	1	0	3.73148e-12	0.007291	5.54441e-12	28	81				
FOXK2	3607	broad.mit.edu	37	17	80543836	80543836	+	Missense_Mutation	SNP	G	G	T	rs139089969		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr17:80543836G>T	ENST00000335255.5	+	7	1510	c.1336G>T	c.(1336-1338)Gcc>Tcc	p.A446S	RP13-638C3.3_ENST00000575085.1_RNA	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	446					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			GCTACCACAGGCCATCAAGCC	0.587																																							uc002kfn.2		NA																	0					0						c.(1336-1338)GCC>TCC		forkhead box K2							71.0	58.0	63.0					17																	80543836		2199	4288	6487	SO:0001583	missense	3607				embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr17:80543836G>T	U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.1336G>T	17.37:g.80543836G>T	ENSP00000335677:p.Ala446Ser		Somatic				FOXK2_uc002kfm.1_Missense_Mutation_p.A446S|FOXK2_uc010diu.2_Intron	p.A446S	NM_004514	NP_004505	WXS	Illumina HiSeq	Unspecified	Q01167	FOXK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)		7	1507	+	Breast(20;0.00106)|all_neural(118;0.0952)		446					A6NEP5|Q13622|Q13623|Q13624	Missense_Mutation	SNP	ENST00000335255.5	37	c.1336G>T	CCDS11813.1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346439	0.24426	.	.	ENSG00000141568	ENST00000535184;ENST00000335255	D	0.93366	-3.21	5.19	3.09	0.35607	.	0.103668	0.64402	D	0.000004	T	0.81987	0.4939	N	0.08118	0	0.25161	N	0.990356	B;B	0.14805	0.004;0.011	B;B	0.19391	0.011;0.025	T	0.67150	-0.5743	10	0.15499	T	0.54	.	6.54	0.22375	0.5524:0.0:0.4476:0.0	.	446;446	Q01167;Q01167-2	FOXK2_HUMAN;.	S	442;446	ENSP00000335677:A446S	ENSP00000335677:A446S	A	+	1	0	FOXK2	78137125	1.000000	0.71417	0.022000	0.16811	0.867000	0.49689	4.549000	0.60726	0.602000	0.29896	0.655000	0.94253	GCC		0.587	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277099.2	NM_181430		31	77	1	0	1.36615e-20	0.002836	2.26493e-20	31	77				
ZNF521	25925	broad.mit.edu	37	18	22804575	22804575	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr18:22804575C>A	ENST00000361524.3	-	4	3455	c.3307G>T	c.(3307-3309)Gcc>Tcc	p.A1103S	ZNF521_ENST00000584787.1_Missense_Mutation_p.A883S|ZNF521_ENST00000538137.2_Missense_Mutation_p.A1103S|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1103					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CCTGGGCTGGCGCTCTTACTG	0.537			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(3307-3309)GCC>TCC		zinc finger protein 521							96.0	87.0	90.0					18																	22804575		2203	4300	6503	SO:0001583	missense	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22804575C>A	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3307G>T	18.37:g.22804575C>A	ENSP00000354794:p.Ala1103Ser		Somatic				ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.A1103S|ZNF521_uc002kvl.2_Missense_Mutation_p.A883S	p.A1103S	NM_015461	NP_056276	WXS	Illumina HiSeq	Unspecified	Q96K83	ZN521_HUMAN			4	3554	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		1103					A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	c.3307G>T	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	5.743	0.321497	0.10845	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.07800	3.16;3.17	5.98	1.89	0.25635	.	0.486367	0.24907	N	0.034654	T	0.02571	0.0078	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47471	-0.9115	10	0.08179	T	0.78	-0.6698	7.7031	0.28634	0.0:0.5046:0.0:0.4954	.	1103	Q96K83	ZN521_HUMAN	S	1103;1137;1103	ENSP00000354794:A1103S;ENSP00000382352:A1103S	ENSP00000354794:A1103S	A	-	1	0	ZNF521	21058573	0.832000	0.29368	0.003000	0.11579	0.841000	0.47740	1.352000	0.34033	0.037000	0.15575	0.650000	0.86243	GCC		0.537	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		17	61	1	0	2.94398e-08	0.007413	3.96305e-08	17	61				
CDH2	1000	broad.mit.edu	37	18	25572690	25572690	+	Missense_Mutation	SNP	C	C	G	rs201382169		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr18:25572690C>G	ENST00000269141.3	-	9	1696	c.1273G>C	c.(1273-1275)Gga>Cga	p.G425R	CDH2_ENST00000399380.3_Missense_Mutation_p.G394R	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	425	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GTAGGATCTCCGCCACTGATT	0.522																																							uc002kwg.2		NA																	0				ovary(3)|lung(1)	4						c.(1273-1275)GGA>CGA		cadherin 2, type 1 preproprotein							215.0	165.0	182.0					18																	25572690		2203	4300	6503	SO:0001583	missense	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25572690C>G	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1273G>C	18.37:g.25572690C>G	ENSP00000269141:p.Gly425Arg		Somatic				CDH2_uc010xbn.1_Missense_Mutation_p.G394R	p.G425R	NM_001792	NP_001783	WXS	Illumina HiSeq	Unspecified	P19022	CADH2_HUMAN			9	1732	-			425			Extracellular (Potential).|Cadherin 3.		A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	c.1273G>C	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175591	0.78564	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.66460	-0.21;-0.21	5.39	5.39	0.77823	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.89361	0.6693	H	0.97874	4.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92999	0.6421	10	0.87932	D	0	.	19.5228	0.95192	0.0:1.0:0.0:0.0	.	394;425	A8MWK3;P19022	.;CADH2_HUMAN	R	425;394	ENSP00000269141:G425R;ENSP00000382312:G394R	ENSP00000269141:G425R	G	-	1	0	CDH2	23826688	1.000000	0.71417	1.000000	0.80357	0.261000	0.26267	7.772000	0.85439	2.674000	0.91012	0.655000	0.94253	GGA		0.522	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		12	75	0	0	0	0.001855	0	12	75				
CD209	30835	broad.mit.edu	37	19	7810766	7810766	+	Missense_Mutation	SNP	C	C	T	rs200171403		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:7810766C>T	ENST00000315599.7	-	4	408	c.386G>A	c.(385-387)cGg>cAg	p.R129Q	CD209_ENST00000601951.1_Missense_Mutation_p.R105Q|CD209_ENST00000204801.8_Missense_Mutation_p.R85Q|CD209_ENST00000593821.1_Missense_Mutation_p.R85Q|CD209_ENST00000394173.4_Intron|CD209_ENST00000315591.8_Missense_Mutation_p.R105Q|CD209_ENST00000394161.5_Intron|CD209_ENST00000354397.6_Missense_Mutation_p.R129Q|CD209_ENST00000593660.1_Missense_Mutation_p.R105Q|CD209_ENST00000602261.1_Missense_Mutation_p.R129Q|CD209_ENST00000601256.1_Missense_Mutation_p.R105Q|CD209_ENST00000301357.8_Missense_Mutation_p.R85Q	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	129	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)			endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						AGCCTTCAGCCGGGTCAGCTC	0.567																																							uc002mht.2		NA																	0				skin(1)	1						c.(385-387)CGG>CAG		CD209 molecule isoform 1							88.0	91.0	90.0					19																	7810766		2202	4297	6499	SO:0001583	missense	30835				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding	g.chr19:7810766C>T	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.386G>A	19.37:g.7810766C>T	ENSP00000315477:p.Arg129Gln		Somatic				CD209_uc010xju.1_Intron|CD209_uc010dvp.2_Missense_Mutation_p.R105Q|CD209_uc002mhr.2_Missense_Mutation_p.R105Q|CD209_uc002mhs.2_Missense_Mutation_p.R105Q|CD209_uc002mhu.2_Missense_Mutation_p.R129Q|CD209_uc010dvq.2_Missense_Mutation_p.R129Q|CD209_uc002mhq.2_Missense_Mutation_p.R129Q|CD209_uc002mhv.2_Missense_Mutation_p.R105Q|CD209_uc002mhx.2_Missense_Mutation_p.R85Q|CD209_uc002mhw.2_Missense_Mutation_p.R85Q|CD209_uc010dvr.2_Intron	p.R129Q	NM_021155	NP_066978	WXS	Illumina HiSeq	Unspecified	Q9NNX6	CD209_HUMAN			4	453	-			129			Extracellular (Probable).|2.|7 X approximate tandem repeats.		A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Missense_Mutation	SNP	ENST00000315599.7	37	c.386G>A	CCDS12186.1	.	.	.	.	.	.	.	.	.	.	C	0.564	-0.844081	0.02671	.	.	ENSG00000090659	ENST00000315599;ENST00000354397;ENST00000315591;ENST00000204801;ENST00000394173;ENST00000301357;ENST00000540789	T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;2.29	1.41	-2.82	0.05787	.	.	.	.	.	T	0.07413	0.0187	N	0.04787	-0.16	0.09310	N	1	B;B;B;B;B;B;B;B;B;B	0.19935	0.038;0.002;0.002;0.012;0.021;0.005;0.013;0.02;0.04;0.021	B;B;B;B;B;B;B;B;B;B	0.12156	0.006;0.006;0.001;0.004;0.004;0.002;0.002;0.005;0.005;0.007	T	0.38866	-0.9641	9	0.09843	T	0.71	.	6.588	0.22632	0.0:0.4003:0.0:0.5997	.	129;105;85;85;105;129;129;105;105;129	Q9NNX6-2;Q9NNX6-12;Q9NNX6-7;Q9NNX6-8;Q9NNX6-6;G5E9C4;Q9NNX6;Q9NNX6-11;Q9NNX6-10;Q9NNX6-5	.;.;.;.;.;.;CD209_HUMAN;.;.;.	Q	129;129;105;85;129;85;113	ENSP00000315477:R129Q;ENSP00000346373:R129Q;ENSP00000315407:R105Q;ENSP00000204801:R85Q;ENSP00000301357:R85Q	ENSP00000204801:R85Q	R	-	2	0	CD209	7716766	0.000000	0.05858	0.009000	0.14445	0.384000	0.30261	-1.923000	0.01567	-1.604000	0.01595	-1.804000	0.00617	CGG		0.567	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462241.1	NM_021155		4	141	0	0	0	0.000602	0	4	141				
CPAMD8	27151	broad.mit.edu	37	19	17100505	17100505	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:17100505T>A	ENST00000443236.1	-	13	1515	c.1484A>T	c.(1483-1485)tAc>tTc	p.Y495F	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	448						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GCTGGGGGAGTACCAGCTGCC	0.587																																							uc002nfb.2		NA																	0				ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						c.(1483-1485)TAC>TTC		C3 and PZP-like, alpha-2-macroglobulin domain							35.0	44.0	41.0					19																	17100505		1953	4132	6085	SO:0001583	missense	27151					extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr19:17100505T>A	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1484A>T	19.37:g.17100505T>A	ENSP00000402505:p.Tyr495Phe		Somatic					p.Y495F	NM_015692	NP_056507	WXS	Illumina HiSeq	Unspecified	Q8IZJ3	CPMD8_HUMAN			13	1516	-			448					Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	c.1484A>T	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.07|17.07	3.295581|3.295581	0.60086|0.60086	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	2.87|2.87	2.87|2.87	0.33458|0.33458	.|.	.|0.000000	.|0.64402	.|U	.|0.000015	T|T	0.52370|0.52370	0.1730|0.1730	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|P	.|0.57620	.|0.824	T|T	0.53358|0.53358	-0.8450|-0.8450	5|9	.|0.51188	.|T	.|0.08	.|.	11.2533|11.2533	0.49039|0.49039	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|448	.|Q8IZJ3	.|CPMD8_HUMAN	S|F	506|495	.|.	.|ENSP00000291440:Y495F	T|Y	-|-	1|2	0|0	CPAMD8|CPAMD8	16961505|16961505	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.889000|0.889000	0.51656|0.51656	2.802000|2.802000	0.47916|0.47916	1.120000|1.120000	0.41904|0.41904	0.454000|0.454000	0.30748|0.30748	ACT|TAC		0.587	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		14	51	0	0	0	0.00245	0	14	51				
ZNF382	84911	broad.mit.edu	37	19	37117917	37117917	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:37117917C>A	ENST00000292928.2	+	5	1231	c.1118C>A	c.(1117-1119)aCa>aAa	p.T373K	ZNF382_ENST00000439428.1_Missense_Mutation_p.T372K|ZNF382_ENST00000423582.1_Missense_Mutation_p.T324K|ZNF382_ENST00000435416.1_Missense_Mutation_p.T372K|CTD-3234P18.2_ENST00000585467.1_lincRNA	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	373	Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CATCACAAAACACATACGGGG	0.458																																							uc002oek.2		NA																	0					0						c.(1117-1119)ACA>AAA		zinc finger protein 382							81.0	85.0	83.0					19																	37117917		2203	4300	6503	SO:0001583	missense	84911				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37117917C>A	AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.1118C>A	19.37:g.37117917C>A	ENSP00000292928:p.Thr373Lys		Somatic				ZNF382_uc010efa.2_Missense_Mutation_p.T324K|ZNF382_uc010efb.2_Missense_Mutation_p.T372K|ZNF382_uc002oel.2_Missense_Mutation_p.T372K	p.T373K	NM_032825	NP_116214	WXS	Illumina HiSeq	Unspecified	Q96SR6	ZN382_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		5	1231	+	Esophageal squamous(110;0.198)		373			Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding (By similarity).|C2H2-type 4.		A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Missense_Mutation	SNP	ENST00000292928.2	37	c.1118C>A	CCDS33004.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964837	0.34659	.	.	ENSG00000161298	ENST00000423582;ENST00000292928;ENST00000439428;ENST00000435416	T;T;T;T	0.16897	2.31;2.31;2.31;2.31	4.47	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.522501	0.16155	N	0.227047	T	0.09642	0.0237	N	0.21583	0.68	0.24998	N	0.991489	B;B;B	0.30664	0.245;0.245;0.289	B;B;B	0.26416	0.041;0.041;0.069	T	0.21861	-1.0233	10	0.72032	D	0.01	.	5.9767	0.19385	0.0:0.5695:0.0:0.4305	.	372;372;373	Q96SR6-2;Q96SR6-3;Q96SR6	.;.;ZN382_HUMAN	K	324;373;372;372	ENSP00000389722:T324K;ENSP00000292928:T373K;ENSP00000407593:T372K;ENSP00000410113:T372K	ENSP00000292928:T373K	T	+	2	0	ZNF382	41809757	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-0.246000	0.08878	0.559000	0.29153	0.591000	0.81541	ACA		0.458	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825		9	61	1	0	0.000673444	0.008291	0.000768605	9	61				
HNRNPUL1	11100	broad.mit.edu	37	19	41779913	41779913	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:41779913A>C	ENST00000392006.3	+	4	772	c.599A>C	c.(598-600)gAa>gCa	p.E200A	HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.E100A|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.E157A|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.E200A|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.E100A|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.E100A|HNRNPUL1_ENST00000594207.1_3'UTR|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.E111A	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	200	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						CCTCCTGCTGAAGAGGATGAA	0.433																																							uc002oqb.3		NA																	0				central_nervous_system(1)|skin(1)	2						c.(598-600)GAA>GCA		heterogeneous nuclear ribonucleoprotein U-like 1							131.0	115.0	121.0					19																	41779913		2203	4300	6503	SO:0001583	missense	11100				nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding	g.chr19:41779913A>C	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.599A>C	19.37:g.41779913A>C	ENSP00000375863:p.Glu200Ala		Somatic				CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Missense_Mutation_p.E100A|HNRNPUL1_uc002oqa.3_Missense_Mutation_p.E100A|HNRNPUL1_uc010ehm.2_Missense_Mutation_p.E200A|HNRNPUL1_uc002oqc.3_Missense_Mutation_p.E157A|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Missense_Mutation_p.E100A|HNRNPUL1_uc010ehn.2_Missense_Mutation_p.E100A|HNRNPUL1_uc010eho.2_Missense_Mutation_p.E100A|HNRNPUL1_uc010xvy.1_Missense_Mutation_p.E100A|HNRNPUL1_uc010ehp.2_Missense_Mutation_p.E56A|HNRNPUL1_uc010ehl.1_Missense_Mutation_p.E100A	p.E200A	NM_007040	NP_008971	WXS	Illumina HiSeq	Unspecified	Q9BUJ2	HNRL1_HUMAN			4	888	+			200			B30.2/SPRY.		B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	37	c.599A>C	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.132324	0.56828	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.50548	0.74;1.7;1.28;1.31	5.64	5.64	0.86602	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.178510	0.53938	D	0.000056	T	0.60779	0.2295	M	0.79475	2.455	0.47441	D	0.999422	B;B;P;D;B;P	0.59767	0.402;0.402;0.851;0.986;0.23;0.537	B;B;P;P;B;B	0.56163	0.119;0.074;0.493;0.793;0.119;0.155	T	0.64846	-0.6311	10	0.54805	T	0.06	-15.9701	9.4164	0.38523	0.9208:0.0:0.0792:0.0	.	111;100;200;157;200;100	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	A	100;200;157;111	ENSP00000340857:E100A;ENSP00000375863:E200A;ENSP00000367460:E157A;ENSP00000263367:E111A	ENSP00000263367:E111A	E	+	2	0	HNRNPUL1	46471753	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.565000	0.90730	2.367000	0.80283	0.528000	0.53228	GAA		0.433	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040		12	59	0	0	0	0.004007	0	12	59				
ZNF221	7638	broad.mit.edu	37	19	44470922	44470922	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:44470922A>T	ENST00000251269.5	+	6	1596	c.1268A>T	c.(1267-1269)aAa>aTa	p.K423I	ZNF221_ENST00000592350.1_Missense_Mutation_p.K423I|ZNF221_ENST00000587682.1_Missense_Mutation_p.K423I	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	423					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				AAATCCTTCAAATGTGAAGAA	0.413																																							uc002oxx.2		NA																	0				skin(1)	1						c.(1267-1269)AAA>ATA		zinc finger protein 221							71.0	73.0	72.0					19																	44470922		2203	4300	6503	SO:0001583	missense	7638				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44470922A>T	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.1268A>T	19.37:g.44470922A>T	ENSP00000251269:p.Lys423Ile		Somatic				ZNF221_uc010ejb.1_Missense_Mutation_p.K423I|ZNF221_uc010xws.1_Missense_Mutation_p.K423I	p.K423I	NM_013359	NP_037491	WXS	Illumina HiSeq	Unspecified	Q9UK13	ZN221_HUMAN			6	1596	+		Prostate(69;0.0352)	423			C2H2-type 10.		B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	ENST00000251269.5	37	c.1268A>T	CCDS12633.1	.	.	.	.	.	.	.	.	.	.	a	17.18	3.324965	0.60634	.	.	ENSG00000159905	ENST00000251269	T	0.20881	2.04	2.16	-0.583	0.11706	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29288	0.0729	L	0.41079	1.255	0.09310	N	1	P	0.52170	0.951	D	0.71656	0.974	T	0.16188	-1.0411	9	0.66056	D	0.02	.	3.4913	0.07638	0.4132:0.1982:0.0:0.3886	.	423	Q9UK13	ZN221_HUMAN	I	423	ENSP00000251269:K423I	ENSP00000251269:K423I	K	+	2	0	ZNF221	49162762	0.000000	0.05858	0.002000	0.10522	0.805000	0.45488	-1.549000	0.02182	-0.410000	0.07542	0.260000	0.18958	AAA		0.413	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1			10	36	0	0	0	0.000978	0	10	36				
PTPRH	5794	broad.mit.edu	37	19	55713588	55713588	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:55713588T>A	ENST00000376350.3	-	6	1011	c.989A>T	c.(988-990)tAc>tTc	p.Y330F	PTPRH_ENST00000588559.1_5'UTR|PTPRH_ENST00000263434.5_Missense_Mutation_p.Y152F	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	330	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CTCAACCCCGTAGGTGGAGTT	0.582																																							uc002qjq.2		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(988-990)TAC>TTC		protein tyrosine phosphatase, receptor type, H							129.0	110.0	116.0					19																	55713588		2203	4300	6503	SO:0001583	missense	5794				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr19:55713588T>A		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.989A>T	19.37:g.55713588T>A	ENSP00000365528:p.Tyr330Phe		Somatic				PTPRH_uc010esv.2_Missense_Mutation_p.Y152F|PTPRH_uc002qjs.2_Missense_Mutation_p.Y337F	p.Y330F	NM_002842	NP_002833	WXS	Illumina HiSeq	Unspecified	Q9HD43	PTPRH_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)	6	1062	-		Renal(1328;0.245)	330			Extracellular (Potential).|Fibronectin type-III 4.		C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	c.989A>T	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	T	13.24	2.178167	0.38511	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	T;T	0.75704	-0.96;-0.96	4.02	4.02	0.46733	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84009	0.5378	M	0.80982	2.52	0.33199	D	0.551867	D;D;D	0.89917	1.0;1.0;0.994	D;D;D	0.91635	0.999;0.999;0.934	D	0.85343	0.1097	9	0.30854	T	0.27	.	9.5466	0.39284	0.0:0.0:0.0:1.0	.	152;152;330	C9JCH2;Q9HD43-2;Q9HD43	.;.;PTPRH_HUMAN	F	330;152	ENSP00000365528:Y330F;ENSP00000263434:Y152F	ENSP00000263434:Y152F	Y	-	2	0	PTPRH	60405400	1.000000	0.71417	0.992000	0.48379	0.009000	0.06853	1.747000	0.38298	1.800000	0.52685	0.374000	0.22700	TAC		0.582	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1			17	85	0	0	0	0.006122	0	17	85				
AURKC	6795	broad.mit.edu	37	19	57746650	57746650	+	Silent	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:57746650G>T	ENST00000302804.7	+	7	981	c.795G>T	c.(793-795)ggG>ggT	p.G265G	AURKC_ENST00000599062.1_Silent_p.G262G|AURKC_ENST00000598785.1_Silent_p.G231G|AURKC_ENST00000415300.2_Silent_p.G246G|AURKC_ENST00000448930.1_Silent_p.G231G	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		TGCCTCTGGGGGCCCGGGACT	0.532																																							uc002qoe.2		NA																	0				lung(4)|ovary(2)	6						c.(793-795)GGG>GGT		aurora kinase C isoform 1							66.0	71.0	69.0					19																	57746650		2203	4300	6503	SO:0001819	synonymous_variant	6795				cell cycle|cytokinesis	condensed chromosome|cytoplasm|midbody|spindle midzone	ATP binding|protein serine/threonine kinase activity	g.chr19:57746650G>T		CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.795G>T	19.37:g.57746650G>T			Somatic				AURKC_uc002qoc.2_Silent_p.G246G|AURKC_uc002qod.2_Silent_p.G231G|AURKC_uc010etv.2_Silent_p.G262G	p.G265G	NM_001015878	NP_001015878	WXS	Illumina HiSeq	Unspecified	Q9UQB9	AURKC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)	7	984	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	265			Protein kinase.		O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Silent	SNP	ENST00000302804.7	37	c.795G>T	CCDS33128.1																																																																																				0.532	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465089.1	NM_003160		9	22	1	0	2.17888e-05	0.006214	2.68104e-05	9	22				
ZIK1	284307	broad.mit.edu	37	19	58102405	58102405	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:58102405G>T	ENST00000597850.1	+	4	1441	c.1226G>T	c.(1225-1227)tGt>tTt	p.C409F	ZIK1_ENST00000307468.4_3'UTR|ZIK1_ENST00000599456.1_Missense_Mutation_p.C354F|ZIK1_ENST00000536878.2_Missense_Mutation_p.C396F	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	409					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CCTTATAAGTGTGGTGACTGT	0.458																																							uc002qpg.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1225-1227)TGT>TTT		zinc finger protein interacting with K protein							66.0	61.0	63.0					19																	58102405		2203	4300	6503	SO:0001583	missense	284307				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58102405G>T	AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.1226G>T	19.37:g.58102405G>T	ENSP00000472867:p.Cys409Phe		Somatic				ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.C354F|ZIK1_uc002qpi.2_Missense_Mutation_p.C396F|ZIK1_uc002qpj.2_Missense_Mutation_p.C306F	p.C409F	NM_001010879	NP_001010879	WXS	Illumina HiSeq	Unspecified	Q3SY52	ZIK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	4	1323	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)	409			C2H2-type 7.		O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	37	c.1226G>T	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575810	0.45902	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	D	0.85088	-1.94	3.37	3.37	0.38596	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94578	0.8253	H	0.96943	3.91	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96141	0.9100	9	0.87932	D	0	.	14.0247	0.64580	0.0:0.0:1.0:0.0	.	396;409	F5H435;Q3SY52	.;ZIK1_HUMAN	F	396;362;409	ENSP00000438487:C396F	ENSP00000303820:C409F	C	+	2	0	ZIK1	62794217	1.000000	0.71417	0.218000	0.23776	0.241000	0.25554	6.953000	0.75995	1.881000	0.54492	0.655000	0.94253	TGT		0.458	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879		5	32	1	0	1.23904e-05	0.000602	1.5366e-05	5	32				
ZIK1	284307	broad.mit.edu	37	19	58102412	58102412	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:58102412C>A	ENST00000597850.1	+	4	1448	c.1233C>A	c.(1231-1233)gaC>gaA	p.D411E	ZIK1_ENST00000307468.4_3'UTR|ZIK1_ENST00000599456.1_Missense_Mutation_p.D356E|ZIK1_ENST00000536878.2_Missense_Mutation_p.D398E	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGTGTGGTGACTGTGGGAAAT	0.448																																							uc002qpg.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1231-1233)GAC>GAA		zinc finger protein interacting with K protein							66.0	61.0	63.0					19																	58102412		2203	4300	6503	SO:0001583	missense	284307				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58102412C>A	AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.1233C>A	19.37:g.58102412C>A	ENSP00000472867:p.Asp411Glu		Somatic				ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.D356E|ZIK1_uc002qpi.2_Missense_Mutation_p.D398E|ZIK1_uc002qpj.2_Missense_Mutation_p.D308E	p.D411E	NM_001010879	NP_001010879	WXS	Illumina HiSeq	Unspecified	Q3SY52	ZIK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	4	1330	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)	411			C2H2-type 7.		O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	37	c.1233C>A	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.640369	0.00112	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.35605	1.3	3.37	-3.32	0.04973	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08891	0.0220	N	0.01250	-0.93	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34453	-0.9828	9	0.02654	T	1	.	5.9059	0.19001	0.336:0.2751:0.3888:0.0	.	398;411	F5H435;Q3SY52	.;ZIK1_HUMAN	E	398;364;411	ENSP00000438487:D398E	ENSP00000303820:D411E	D	+	3	2	ZIK1	62794224	0.000000	0.05858	0.083000	0.20561	0.067000	0.16453	-8.484000	0.00020	-0.535000	0.06307	-0.256000	0.11100	GAC		0.448	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879		3	31	1	0	0.004672	0.004672	0.00518197	3	31				
DDX1	1653	broad.mit.edu	37	2	15760486	15760486	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:15760486G>T	ENST00000381341.2	+	18	1750	c.1361G>T	c.(1360-1362)aGa>aTa	p.R454I	DDX1_ENST00000233084.3_Missense_Mutation_p.R454I			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	454	Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		AAAACTGACAGACTCTGGGAA	0.373																																							uc002rce.2		NA																	0				central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(1360-1362)AGA>ATA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 1							74.0	71.0	72.0					2																	15760486		2203	4300	6503	SO:0001583	missense	1653				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity	g.chr2:15760486G>T	X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1361G>T	2.37:g.15760486G>T	ENSP00000370745:p.Arg454Ile		Somatic				DDX1_uc010yjq.1_Missense_Mutation_p.R362I	p.R454I	NM_004939	NP_004930	WXS	Illumina HiSeq	Unspecified	Q92499	DDX1_HUMAN	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)	17	1649	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	454			Necessary for interaction with RELA.		B4DME8|B4DPN6	Missense_Mutation	SNP	ENST00000381341.2	37	c.1361G>T	CCDS1686.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223028	0.39300	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	T;T	0.42131	0.98;0.98	5.97	4.17	0.49024	.	0.262894	0.44902	D	0.000402	T	0.29716	0.0742	L	0.31926	0.97	0.44547	D	0.997502	B	0.02656	0.0	B	0.04013	0.001	T	0.07290	-1.0780	10	0.45353	T	0.12	-17.5009	7.4445	0.27203	0.3552:0.0:0.6448:0.0	.	454	Q92499	DDX1_HUMAN	I	454;454;438	ENSP00000370745:R454I;ENSP00000233084:R454I	ENSP00000233084:R454I	R	+	2	0	DDX1	15677937	0.990000	0.36364	0.938000	0.37757	0.793000	0.44817	2.019000	0.41001	0.845000	0.35118	0.585000	0.79938	AGA		0.373	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2	NM_004939		7	25	1	0	0.000157383	0.00308	0.000184984	7	25				
OTOF	9381	broad.mit.edu	37	2	26712109	26712109	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:26712109T>C	ENST00000272371.2	-	11	1141	c.1015A>G	c.(1015-1017)Atg>Gtg	p.M339V	OTOF_ENST00000403946.3_Missense_Mutation_p.M339V	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	339					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCACGTCCATTTTGAAGGAG	0.622																																					GBM(102;732 1451 20652 24062 31372)	GBM(102;732 1451 20652 24062 31372)	uc002rhk.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.(1015-1017)ATG>GTG		otoferlin isoform a							65.0	51.0	56.0					2																	26712109		2203	4300	6503	SO:0001583	missense	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26712109T>C	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1015A>G	2.37:g.26712109T>C	ENSP00000272371:p.Met339Val		Somatic					p.M339V	NM_194248	NP_919224	WXS	Illumina HiSeq	Unspecified	Q9HC10	OTOF_HUMAN			11	1142	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		339			Cytoplasmic (Potential).		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	c.1015A>G	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	T	8.062	0.768310	0.15983	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.67865	-0.29;-0.29	5.37	5.37	0.77165	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);FerIin domain (1);	0.215542	0.56097	D	0.000032	T	0.49081	0.1536	N	0.26042	0.785	0.32801	D	0.500169	B	0.12013	0.005	B	0.13407	0.009	T	0.52472	-0.8571	10	0.10636	T	0.68	-27.0595	10.4197	0.44344	0.0:0.0:0.1637:0.8363	.	339	Q9HC10	OTOF_HUMAN	V	339	ENSP00000272371:M339V;ENSP00000385255:M339V	ENSP00000272371:M339V	M	-	1	0	OTOF	26565613	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.115000	0.41921	2.066000	0.61787	0.374000	0.22700	ATG		0.622	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			5	20	0	0	0	0.001984	0	5	20				
EML4	27436	broad.mit.edu	37	2	42488428	42488428	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:42488428C>T	ENST00000318522.5	+	4	768	c.506C>T	c.(505-507)aCc>aTc	p.T169I	EML4_ENST00000402711.2_Intron|EML4_ENST00000401738.3_Missense_Mutation_p.T169I	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	169					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						GCTACTCCCACCAAAAGGTTT	0.433			T	ALK	NSCLC																																		uc002rsi.2		NA		Dom	yes		2	2p21	27436	T	echinoderm microtubule associated protein like 4			E	ALK		NSCLC	EML4/ALK(246)	0				lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250						c.(505-507)ACC>ATC		echinoderm microtubule associated protein like 4							154.0	153.0	153.0					2																	42488428		2203	4300	6503	SO:0001583	missense	27436				microtubule-based process|mitosis	cytoplasm|microtubule	protein binding	g.chr2:42488428C>T	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.506C>T	2.37:g.42488428C>T	ENSP00000320663:p.Thr169Ile		Somatic				EML4_uc002rsh.3_Missense_Mutation_p.T169I|EML4_uc010fap.2_Intron	p.T169I	NM_019063	NP_061936	WXS	Illumina HiSeq	Unspecified	Q9HC35	EMAL4_HUMAN			4	768	+			169					A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	ENST00000318522.5	37	c.506C>T	CCDS1807.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.756124	0.31137	.	.	ENSG00000143924	ENST00000318522;ENST00000401738	T;D	0.97870	1.12;-4.58	5.52	4.63	0.57726	.	0.337856	0.26328	N	0.025011	D	0.91317	0.7262	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	D	0.86923	0.2068	10	0.26408	T	0.33	-4.3916	11.0885	0.48102	0.0:0.8008:0.1285:0.0707	.	169;169	Q9HC35;A6P4T4	EMAL4_HUMAN;.	I	169	ENSP00000320663:T169I;ENSP00000384939:T169I	ENSP00000320663:T169I	T	+	2	0	EML4	42341932	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.330000	0.43885	1.297000	0.44761	0.555000	0.69702	ACC		0.433	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250463.3	NM_019063		12	108	0	0	0	0.003163	0	12	108				
LRPPRC	10128	broad.mit.edu	37	2	44204415	44204415	+	Splice_Site	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:44204415C>A	ENST00000260665.7	-	4	527	c.470G>T	c.(469-471)gGt>gTt	p.G157V	LRPPRC_ENST00000409659.1_Splice_Site_p.G157V|LRPPRC_ENST00000409946.1_Splice_Site_p.G157V	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	157					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ATACACAGCACCTACAAATGA	0.289																																							uc002rtr.2		NA																	0				ovary(2)|skin(1)	3						c.(469-471)GGT>GTT		leucine-rich PPR motif-containing protein							70.0	71.0	71.0					2																	44204415		2202	4296	6498	SO:0001630	splice_region_variant	10128				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding	g.chr2:44204415C>A	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.470-1G>T	2.37:g.44204415C>A			Somatic				LRPPRC_uc010yob.1_Missense_Mutation_p.G57V|LRPPRC_uc010faw.1_Missense_Mutation_p.G131V	p.G157V	NM_133259	NP_573566	WXS	Illumina HiSeq	Unspecified	P42704	LPPRC_HUMAN			4	528	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	157			PPR 1.		A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	ENST00000260665.7	37	c.470G>T	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.326389	0.81690	.	.	ENSG00000138095	ENST00000465633;ENST00000260665;ENST00000409946;ENST00000409659;ENST00000447246	T;T;T;T	0.75477	-0.41;-0.48;-0.5;-0.94	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.87030	0.6076	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.98;0.999	D	0.88291	0.2943	10	0.87932	D	0	.	19.2133	0.93766	0.0:1.0:0.0:0.0	.	57;131;157	F5H4J6;C9JCA9;P42704	.;.;LPPRC_HUMAN	V	57;157;157;157;131	ENSP00000260665:G157V;ENSP00000386234:G157V;ENSP00000386562:G157V;ENSP00000403637:G131V	ENSP00000260665:G157V	G	-	2	0	LRPPRC	44057919	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.772000	0.85439	2.613000	0.88420	0.484000	0.47621	GGT		0.289	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	Missense_Mutation	12	35	1	0	4.3838e-07	0.001855	5.6827e-07	12	35				
USP34	9736	broad.mit.edu	37	2	61516014	61516014	+	Splice_Site	SNP	T	T	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:61516014T>G	ENST00000398571.2	-	34	4625		c.e34-2			NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34						positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TAGCTGCCACTGTAAATGAGA	0.338																																							uc002sbe.2		NA																	0				ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19						c.e34-1		ubiquitin specific protease 34							53.0	50.0	51.0					2																	61516014		1847	4087	5934	SO:0001630	splice_region_variant	9736				positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr2:61516014T>G	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.4549-2A>C	2.37:g.61516014T>G			Somatic					p.W1517_splice	NM_014709	NP_055524	WXS	Illumina HiSeq	Unspecified	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)		34	4571	-								A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Splice_Site	SNP	ENST00000398571.2	37	c.4549_splice	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.208904	0.79240	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6681	0.62407	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP34	61369518	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.977000	0.88081	1.824000	0.53156	0.477000	0.44152	.		0.338	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		Intron	13	52	0	0	0	0.004007	0	13	52				
SPRED2	200734	broad.mit.edu	37	2	65571931	65571931	+	Silent	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:65571931C>A	ENST00000356388.4	-	2	315	c.126G>T	c.(124-126)ggG>ggT	p.G42G	SPRED2_ENST00000474228.1_5'UTR|SPRED2_ENST00000443619.2_Silent_p.G39G	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	42	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						CCTTACAGACCCCGACGCGAC	0.542																																							uc002sdr.3		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(124-126)GGG>GGT		sprouty-related protein with EVH-1 domain 2							109.0	90.0	97.0					2																	65571931		2203	4300	6503	SO:0001819	synonymous_variant	200734				inactivation of MAPK activity|multicellular organismal development	transport vesicle membrane	stem cell factor receptor binding	g.chr2:65571931C>A	AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.126G>T	2.37:g.65571931C>A			Somatic				SPRED2_uc010fcw.2_Silent_p.G39G|SPRED2_uc010fcx.1_RNA	p.G42G	NM_181784	NP_861449	WXS	Illumina HiSeq	Unspecified	Q7Z698	SPRE2_HUMAN			2	661	-			42			WH1.		A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Silent	SNP	ENST00000356388.4	37	c.126G>T	CCDS33211.1																																																																																				0.542	SPRED2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327632.1			13	29	1	0	4.3838e-07	0.001855	5.6827e-07	13	29				
REG1B	5968	broad.mit.edu	37	2	79313983	79313983	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:79313983G>T	ENST00000305089.3	-	3	218	c.138C>A	c.(136-138)taC>taA	p.Y46*		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	46	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						AGTAGTAGCAGTAGGAGCGAT	0.517																																							uc002sny.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(136-138)TAC>TAA		regenerating islet-derived 1 beta precursor							156.0	151.0	153.0					2																	79313983		2203	4300	6503	SO:0001587	stop_gained	5968				cell proliferation	extracellular region	sugar binding	g.chr2:79313983G>T		CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.138C>A	2.37:g.79313983G>T	ENSP00000303206:p.Tyr46*		Somatic				REG1B_uc010ffv.1_Nonsense_Mutation_p.Y46*|REG1B_uc010ffw.2_Nonsense_Mutation_p.Y46*	p.Y46*	NM_006507	NP_006498	WXS	Illumina HiSeq	Unspecified	P48304	REG1B_HUMAN			3	250	-			46			C-type lectin.			Nonsense_Mutation	SNP	ENST00000305089.3	37	c.138C>A	CCDS1963.1	.	.	.	.	.	.	.	.	.	.	g	27.4	4.831559	0.91036	.	.	ENSG00000172023	ENST00000305089	.	.	.	3.74	1.85	0.25348	.	0.451753	0.16384	N	0.216798	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4681	0.21993	0.2323:0.0:0.7677:0.0	.	.	.	.	X	46	.	ENSP00000303206:Y46X	Y	-	3	2	REG1B	79167491	0.121000	0.22262	0.883000	0.34634	0.791000	0.44710	0.276000	0.18716	0.340000	0.23745	0.561000	0.74099	TAC		0.517	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252292.2	NM_006507		37	107	1	0	3.61848e-18	0.007835	5.96765e-18	37	107				
LRRTM1	347730	broad.mit.edu	37	2	80530209	80530209	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:80530209C>A	ENST00000295057.3	-	2	1392	c.736G>T	c.(736-738)Gcc>Tcc	p.A246S	CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.A246S|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000541047.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	246					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						ACCACAATGGCCACCTTGTTC	0.587										HNSCC(69;0.2)																													uc002sok.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(736-738)GCC>TCC		leucine rich repeat transmembrane neuronal 1							92.0	88.0	89.0					2																	80530209		2203	4300	6503	SO:0001583	missense	347730					axon|endoplasmic reticulum membrane|growth cone|integral to membrane		g.chr2:80530209C>A	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.736G>T	2.37:g.80530209C>A	ENSP00000295057:p.Ala246Ser	HNSCC(69;0.2)	Somatic				CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	p.A246S	NM_178839	NP_849161	WXS	Illumina HiSeq	Unspecified	Q86UE6	LRRT1_HUMAN			2	1006	-			246			LRR 7.|Lumenal (Potential).		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	c.736G>T	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	C	2.812	-0.246731	0.05867	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.78126	-1.15;-1.15	5.26	4.37	0.52481	.	0.071063	0.56097	U	0.000036	T	0.45915	0.1366	N	0.01874	-0.695	0.38793	D	0.955024	B	0.09022	0.002	B	0.08055	0.003	T	0.47560	-0.9108	9	.	.	.	.	4.9906	0.14213	0.0:0.7025:0.0:0.2975	.	246	Q86UE6	LRRT1_HUMAN	S	246	ENSP00000295057:A246S;ENSP00000386646:A246S	.	A	-	1	0	LRRTM1	80383720	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.866000	0.63005	2.416000	0.81992	0.655000	0.94253	GCC		0.587	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		16	80	1	0	6.49762e-13	0.006122	9.79306e-13	16	80				
POLR1A	25885	broad.mit.edu	37	2	86258460	86258460	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:86258460C>A	ENST00000263857.6	-	30	4949	c.4571G>T	c.(4570-4572)tGg>tTg	p.W1524L	POLR1A_ENST00000409681.1_Intron			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1524					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GACCTGGCACCACAGGCTCTC	0.657																																							uc002sqs.2		NA																	0				ovary(2)|skin(1)	3						c.(4570-4572)TGG>TTG		DNA-directed RNA polymerase I A							70.0	76.0	74.0					2																	86258460		2106	4214	6320	SO:0001583	missense	25885				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding	g.chr2:86258460C>A	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4571G>T	2.37:g.86258460C>A	ENSP00000263857:p.Trp1524Leu		Somatic				POLR1A_uc010ytb.1_Missense_Mutation_p.W890L	p.W1524L	NM_015425	NP_056240	WXS	Illumina HiSeq	Unspecified	O95602	RPA1_HUMAN			30	4950	-			1524					B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	c.4571G>T	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743125	0.89663	.	.	ENSG00000068654	ENST00000263857	T	0.67345	-0.26	5.11	5.11	0.69529	RNA polymerase Rpb1, domain 5 (1);	0.064270	0.64402	D	0.000002	T	0.77731	0.4174	L	0.45581	1.43	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76708	-0.2860	10	0.42905	T	0.14	-13.1059	18.5184	0.90943	0.0:1.0:0.0:0.0	.	1524	O95602	RPA1_HUMAN	L	1524	ENSP00000263857:W1524L	ENSP00000263857:W1524L	W	-	2	0	POLR1A	86111971	1.000000	0.71417	1.000000	0.80357	0.668000	0.39293	5.401000	0.66326	2.534000	0.85438	0.555000	0.69702	TGG		0.657	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425		33	78	1	0	1.07637e-12	0.004878	1.61455e-12	33	78				
GPR148	344561	broad.mit.edu	37	2	131487520	131487520	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:131487520C>T	ENST00000309926.4	+	1	878	c.796C>T	c.(796-798)Cac>Tac	p.H266Y		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					CCTGCTGATCCACTCAGTGCT	0.567																																							uc002trv.1		NA																	0				skin(1)	1						c.(796-798)CAC>TAC		G protein-coupled receptor 148							145.0	123.0	131.0					2																	131487520		2203	4300	6503	SO:0001583	missense	344561					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr2:131487520C>T	AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.796C>T	2.37:g.131487520C>T	ENSP00000308908:p.His266Tyr		Somatic					p.H266Y	NM_207364	NP_997247	WXS	Illumina HiSeq	Unspecified	Q8TDV2	GP148_HUMAN			1	798	+	Colorectal(110;0.1)		266			Helical; Name=6; (Potential).		Q2M369|Q86SP7|Q86U87	Missense_Mutation	SNP	ENST00000309926.4	37	c.796C>T	CCDS2163.1	.	.	.	.	.	.	.	.	.	.	.	18.69	3.678069	0.68042	.	.	ENSG00000173302	ENST00000309926	T	0.40476	1.03	3.19	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	U	0.000030	T	0.48169	0.1485	N	0.24115	0.695	0.34608	D	0.717227	D	0.89917	1.0	D	0.91635	0.999	T	0.63102	-0.6712	10	0.87932	D	0	-8.5145	12.2126	0.54388	0.0:1.0:0.0:0.0	.	266	Q8TDV2	GP148_HUMAN	Y	266	ENSP00000308908:H266Y	ENSP00000308908:H266Y	H	+	1	0	GPR148	131203990	1.000000	0.71417	0.482000	0.27366	0.955000	0.61496	5.255000	0.65462	1.504000	0.48704	0.462000	0.41574	CAC		0.567	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254552.3	XM_293092		24	92	0	0	0	0.00632	0	24	92				
POTEE	445582	broad.mit.edu	37	2	132021446	132021446	+	Silent	SNP	C	C	T	rs373046417		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:132021446C>T	ENST00000356920.5	+	15	2512	c.2418C>T	c.(2416-2418)acC>acT	p.T806T	PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	806	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											TCCTGCTGACCGAGGCCCCCC	0.597																																							uc002tsn.2		NA																	0					0						c.(2416-2418)ACC>ACT		protein expressed in prostate, ovary, testis,		C		0,4402		0,0,2201	70.0	73.0	72.0		2418		0.3	2		72	3,8587		0,3,4292	no	coding-synonymous	POTEE	NM_001083538.1		0,3,6493	TT,TC,CC		0.0349,0.0,0.0231		806/1076	132021446	3,12989	2201	4295	6496	SO:0001819	synonymous_variant	445582						ATP binding	g.chr2:132021446C>T	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2418C>T	2.37:g.132021446C>T			Somatic				PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Silent_p.T406T|POTEE_uc002tsl.2_Silent_p.T388T|POTEE_uc010fmy.1_Silent_p.T270T	p.T806T	NM_001083538	NP_001077007	WXS	Illumina HiSeq	Unspecified	Q6S8J3	POTEE_HUMAN			15	2470	+			806			Actin-like.		Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	ENST00000356920.5	37	c.2418C>T	CCDS46414.1																																																																																				0.597	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538		34	116	0	0	0	0.003214	0	34	116				
NCKAP5	344148	broad.mit.edu	37	2	133539542	133539542	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:133539542T>A	ENST00000409261.1	-	14	5215	c.4842A>T	c.(4840-4842)aaA>aaT	p.K1614N	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.K1614N|NCKAP5_ENST00000473859.1_5'UTR	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1614										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGAAGGTGTCTTTCGTTGAAC	0.428																																							uc002ttp.2		NA																	0					0						c.(4840-4842)AAA>AAT		Nck-associated protein 5 isoform 1							240.0	210.0	220.0					2																	133539542		1917	4131	6048	SO:0001583	missense	344148						protein binding	g.chr2:133539542T>A	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4842A>T	2.37:g.133539542T>A	ENSP00000387128:p.Lys1614Asn		Somatic				NCKAP5_uc002ttq.2_Intron	p.K1614N	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			14	5216	-			1614					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.4842A>T	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	T	9.179	1.023165	0.19433	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.12984	2.63;2.63	5.14	1.44	0.22558	.	0.000000	0.33875	U	0.004465	T	0.08626	0.0214	L	0.29908	0.895	0.80722	D	1	B	0.32203	0.36	B	0.34385	0.181	T	0.27226	-1.0080	10	0.48119	T	0.1	.	3.1728	0.06558	0.1381:0.0753:0.1445:0.6421	.	1614	O14513	NCKP5_HUMAN	N	1614	ENSP00000387128:K1614N;ENSP00000380603:K1614N	ENSP00000380603:K1614N	K	-	3	2	NCKAP5	133256012	1.000000	0.71417	0.994000	0.49952	0.418000	0.31294	1.261000	0.32980	0.100000	0.17581	0.377000	0.23210	AAA		0.428	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		23	59	0	0	0	0.001786	0	23	59				
MGAT5	4249	broad.mit.edu	37	2	135107399	135107399	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:135107399C>T	ENST00000409645.1	+	10	1388	c.1136C>T	c.(1135-1137)tCa>tTa	p.S379L	MGAT5_ENST00000281923.2_Missense_Mutation_p.S379L			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	379					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		GTCCTTGATTCATTTGGTACT	0.423																																							uc002ttv.1		NA																	0				ovary(2)|skin(1)	3						c.(1135-1137)TCA>TTA		N-acetylglucosaminyltransferase V							148.0	138.0	142.0					2																	135107399		2203	4300	6503	SO:0001583	missense	4249				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity	g.chr2:135107399C>T	D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.1136C>T	2.37:g.135107399C>T	ENSP00000386377:p.Ser379Leu		Somatic					p.S379L	NM_002410	NP_002401	WXS	Illumina HiSeq	Unspecified	Q09328	MGT5A_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0964)	9	1281	+			379			Lumenal (Potential).		D3DP70	Missense_Mutation	SNP	ENST00000409645.1	37	c.1136C>T	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.879944	0.72294	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.79644	0.4481	M	0.75615	2.305	0.80722	D	1	D	0.61080	0.989	D	0.75020	0.985	T	0.82279	-0.0536	9	0.87932	D	0	-10.0865	18.7133	0.91666	0.0:1.0:0.0:0.0	.	379	Q09328	MGT5A_HUMAN	L	379	.	ENSP00000281923:S379L	S	+	2	0	MGAT5	134823869	1.000000	0.71417	0.689000	0.30133	0.046000	0.14306	7.772000	0.85439	2.461000	0.83175	0.655000	0.94253	TCA		0.423	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410		11	77	0	0	0	0.000978	0	11	77				
ACVR1C	130399	broad.mit.edu	37	2	158412698	158412698	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:158412698C>T	ENST00000243349.8	-	3	811	c.451G>A	c.(451-453)Gtg>Atg	p.V151M	ACVR1C_ENST00000409680.3_Missense_Mutation_p.V101M|ACVR1C_ENST00000335450.7_Intron|ACVR1C_ENST00000348328.5_Intron	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC									p.V151L(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						GGTTCCTCCACATTTGGTCTC	0.478																																							uc002tzk.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(2)|skin(2)	7						c.(451-453)GTG>ATG		activin A receptor, type IC isoform 1							102.0	90.0	94.0					2																	158412698		2203	4300	6503	SO:0001583	missense	130399				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity	g.chr2:158412698C>T	BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.451G>A	2.37:g.158412698C>T	ENSP00000243349:p.Val151Met		Somatic				ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Missense_Mutation_p.V101M	p.V151M	NM_145259	NP_660302	WXS	Illumina HiSeq	Unspecified	Q8NER5	ACV1C_HUMAN			3	694	-			151			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000243349.8	37	c.451G>A	CCDS2205.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.722351	0.30503	.	.	ENSG00000123612	ENST00000243349;ENST00000409680	D;D	0.88046	-2.33;-2.22	5.73	4.85	0.62838	.	0.147765	0.31450	N	0.007627	T	0.80854	0.4703	L	0.40543	1.245	0.80722	D	1	B	0.11235	0.004	B	0.12156	0.007	T	0.74372	-0.3687	10	0.30078	T	0.28	.	11.2098	0.48790	0.0:0.86:0.0:0.14	.	151	Q8NER5	ACV1C_HUMAN	M	151;101	ENSP00000243349:V151M;ENSP00000387168:V101M	ENSP00000243349:V151M	V	-	1	0	ACVR1C	158120944	0.063000	0.20901	0.847000	0.33407	0.809000	0.45718	0.190000	0.17057	2.710000	0.92621	0.650000	0.86243	GTG		0.478	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259		7	25	0	0	0	0.00308	0	7	25				
SCN3A	6328	broad.mit.edu	37	2	165947802	165947802	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:165947802G>C	ENST00000360093.3	-	28	5352	c.4861C>G	c.(4861-4863)Cga>Gga	p.R1621G	SCN3A_ENST00000409101.3_Missense_Mutation_p.R1572G|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000283254.7_Missense_Mutation_p.R1621G|SCN3A_ENST00000540861.1_Missense_Mutation_p.R104G|SCN3A_ENST00000465043.1_5'Flank	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1621					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R1621*(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CGGATCACTCGGAACAAGGTA	0.448																																							uc002ucx.2		NA																	1	Substitution - Nonsense(1)	p.R1621*(1)	ovary(1)	ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(4861-4863)CGA>GGA		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						109.0	112.0	111.0					2																	165947802		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165947802G>C	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4861C>G	2.37:g.165947802G>C	ENSP00000353206:p.Arg1621Gly		Somatic				SCN3A_uc010zcy.1_Missense_Mutation_p.R104G|SCN3A_uc002ucy.2_Missense_Mutation_p.R1572G|SCN3A_uc002ucz.2_Missense_Mutation_p.R1572G	p.R1621G	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			28	5353	-			1621			Helical; Voltage-sensor; Name=S4 of repeat IV; (Potential).		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.4861C>G		.	.	.	.	.	.	.	.	.	.	G	14.70	2.614313	0.46631	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.98012	-4.66;-4.66;-4.66;-4.66	6.07	6.07	0.98685	.	0.000000	0.51477	D	0.000092	D	0.99052	0.9675	H	0.94964	3.605	0.51482	D	0.999926	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.91635	0.994;0.997;0.999	D	0.99226	1.0880	10	0.87932	D	0	.	14.5344	0.67950	0.0:0.0:0.7423:0.2577	.	1572;1572;1621	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	G	1621;1621;1572;104	ENSP00000353206:R1621G;ENSP00000283254:R1621G;ENSP00000386726:R1572G;ENSP00000439920:R104G	ENSP00000283254:R1621G	R	-	1	2	SCN3A	165656048	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.659000	0.37387	2.890000	0.99128	0.585000	0.79938	CGA		0.448	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		26	95	0	0	0	0.001786	0	26	95				
CHRNA1	1134	broad.mit.edu	37	2	175614782	175614782	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:175614782C>G	ENST00000261007.5	-	8	1035	c.969G>C	c.(967-969)atG>atC	p.M323I	AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000348749.5_Missense_Mutation_p.M298I|CHRNA1_ENST00000409542.1_Missense_Mutation_p.M216I|CHRNA1_ENST00000409219.1_Missense_Mutation_p.M298I	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	323					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TGGTGAACAGCATGTATTTTC	0.517																																							uc002ujd.2		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(967-969)ATG>ATC		nicotinic cholinergic receptor alpha 1 isoform a							223.0	170.0	188.0					2																	175614782		2203	4300	6503	SO:0001583	missense	1134				muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr2:175614782C>G	Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.969G>C	2.37:g.175614782C>G	ENSP00000261007:p.Met323Ile		Somatic				uc002uiw.2_Intron|CHRNA1_uc002uje.2_Missense_Mutation_p.M298I	p.M323I	NM_001039523	NP_001034612	WXS	Illumina HiSeq	Unspecified	P02708	ACHA_HUMAN			8	1047	-			323			Helical.		B4DRV6|D3DPE8	Missense_Mutation	SNP	ENST00000261007.5	37	c.969G>C	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424583	0.62733	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219	T;T;T;D	0.83506	-1.43;-1.43;-1.43;-1.73	5.5	5.5	0.81552	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	T	0.81399	0.4814	N	0.05554	-0.025	0.80722	D	1	B;P	0.43352	0.374;0.804	B;P	0.55222	0.268;0.771	D	0.84890	0.0836	10	0.62326	D	0.03	.	19.4077	0.94655	0.0:1.0:0.0:0.0	.	298;323	Q53SH4;P02708	.;ACHA_HUMAN	I	298;323;216;298	ENSP00000261008:M298I;ENSP00000261007:M323I;ENSP00000387026:M216I;ENSP00000386611:M298I	ENSP00000261007:M323I	M	-	3	0	CHRNA1	175323028	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.832000	0.62759	2.586000	0.87340	0.655000	0.94253	ATG		0.517	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1			14	94	0	0	0	0.003163	0	14	94				
HOXD13	3239	broad.mit.edu	37	2	176957919	176957919	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:176957919G>C	ENST00000392539.3	+	1	301	c.301G>C	c.(301-303)Gct>Cct	p.A101P		NM_000523.3	NP_000514.2	P35453	HXD13_HUMAN	homeobox D13	101					anterior/posterior pattern specification (GO:0009952)|branch elongation of an epithelium (GO:0060602)|embryonic digit morphogenesis (GO:0042733)|embryonic hindgut morphogenesis (GO:0048619)|male genitalia development (GO:0030539)|morphogenesis of an epithelial fold (GO:0060571)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0526)|READ - Rectum adenocarcinoma(9;0.0678)		GCGCCCGGAGGCTCCCCCAGC	0.726			T	NUP98	AML*																																		uc002ukf.1		NA		Dom	yes		2	2q31-q32	3239	T	homeo box D13			L	NUP98		AML*		0				lung(1)	1						c.(301-303)GCT>CCT		homeobox D13							10.0	13.0	12.0					2																	176957919		2035	4012	6047	SO:0001583	missense	3239				skeletal system development|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding	g.chr2:176957919G>C	AF005219	CCDS2264.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128714	ENSG00000128714		"""Homeoboxes / ANTP class : HOXL subclass"""	5136	protein-coding gene	gene with protein product		142989	"""homeo box D13"""	HOX4I, SPD		2574852, 1973146	Standard	NM_000523		Approved		uc002ukf.1	P35453	OTTHUMG00000132431	ENST00000392539.3:c.301G>C	2.37:g.176957919G>C	ENSP00000376322:p.Ala101Pro		Somatic					p.A101P	NM_000523	NP_000514	WXS	Illumina HiSeq	Unspecified	P35453	HXD13_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0526)|READ - Rectum adenocarcinoma(9;0.0678)	1	388	+			101						Missense_Mutation	SNP	ENST00000392539.3	37	c.301G>C	CCDS2264.2	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940434	0.73557	.	.	ENSG00000128714	ENST00000392539	T	0.49432	0.78	3.66	3.66	0.41972	.	0.000000	0.34507	N	0.003918	T	0.49949	0.1587	N	0.25890	0.77	0.37151	D	0.902149	D	0.63046	0.992	P	0.62089	0.898	T	0.52026	-0.8630	10	0.23891	T	0.37	.	14.3122	0.66424	0.0:0.0:1.0:0.0	.	101	P35453	HXD13_HUMAN	P	101	ENSP00000376322:A101P	ENSP00000376322:A101P	A	+	1	0	HOXD13	176666165	0.047000	0.20315	0.967000	0.41034	0.941000	0.58515	1.493000	0.35605	1.868000	0.54150	0.563000	0.77884	GCT		0.726	HOXD13-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359256.1			9	17	0	0	0	0.001855	0	9	17				
HNRNPA3	220988	broad.mit.edu	37	2	178081586	178081586	+	Splice_Site	SNP	A	A	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:178081586A>T	ENST00000392524.2	+	7	976		c.e7-1		HNRNPA3_ENST00000411529.2_Splice_Site|HNRNPA3_ENST00000435711.1_Splice_Site			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						GTTTTTCCTCAGGAGGCTAtg	0.408																																							uc002ulb.1		NA																	0				ovary(2)	2						c.e7-2		heterogeneous nuclear ribonucleoprotein A3							81.0	81.0	81.0					2																	178081586		2203	4300	6503	SO:0001630	splice_region_variant	220988					catalytic step 2 spliceosome|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr2:178081586A>T	AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.740-1A>T	2.37:g.178081586A>T			Somatic				HNRNPA3_uc002ulc.1_Splice_Site_p.G247_splice|HNRNPA3_uc002uld.2_Splice_Site_p.G225_splice|HNRNPA3_uc002ule.2_Splice_Site_p.G24_splice	p.G247_splice	NM_194247	NP_919223	WXS	Illumina HiSeq	Unspecified	P51991	ROA3_HUMAN			7	846	+								D3DPF4|Q53RW7|Q6URK5	Splice_Site	SNP	ENST00000392524.2	37	c.740_splice	CCDS2273.1	.	.	.	.	.	.	.	.	.	.	a	16.08	3.022509	0.54683	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000435711	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2116	0.43145	0.9173:0.0:0.0827:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNRNPA3	177789832	1.000000	0.71417	0.933000	0.37362	0.964000	0.63967	4.423000	0.59861	1.780000	0.52325	0.446000	0.29264	.		0.408	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255729.3	NM_194247	Intron	9	31	0	0	0	0.004482	0	9	31				
ANKRD44	91526	broad.mit.edu	37	2	197863664	197863664	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:197863664T>G	ENST00000328737.2	-	24	2633	c.2557A>C	c.(2557-2559)Atg>Ctg	p.M853L	ANKRD44_ENST00000450567.1_Missense_Mutation_p.M853L|ANKRD44_ENST00000282272.8_Missense_Mutation_p.M870L|ANKRD44_ENST00000337207.5_Missense_Mutation_p.M853L			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	878										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TCAGCAGCCATCATCAGTGCT	0.478																																							uc002uua.1		NA																	0				ovary(4)|skin(1)	5						c.(2557-2559)ATG>CTG		ankyrin repeat domain 44							125.0	109.0	114.0					2																	197863664		2203	4300	6503	SO:0001583	missense	91526						protein binding	g.chr2:197863664T>G	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.2557A>C	2.37:g.197863664T>G	ENSP00000331516:p.Met853Leu		Somatic				ANKRD44_uc002utz.3_Missense_Mutation_p.M585L	p.M853L	NM_153697	NP_710181	WXS	Illumina HiSeq	Unspecified	Q8N8A2	ANR44_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)		24	2634	-			878			ANK 26.		Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	37	c.2557A>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.15|15.15	2.747122|2.747122	0.49257|0.49257	.|.	.|.	ENSG00000065413|ENSG00000065413	ENST00000448801|ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207	.|T;T;T;T;T	.|0.60548	.|0.18;0.18;0.43;0.43;0.18	4.97|4.97	3.82|3.82	0.43975|0.43975	.|.	.|0.044339	.|0.85682	.|D	.|0.000000	T|T	0.19604|0.19604	0.0471|0.0471	N|N	0.00303|0.00303	-1.675|-1.675	0.80722|0.80722	D|D	1|1	.|B	.|0.09022	.|0.002	.|B	.|0.13407	.|0.009	T|T	0.10177|0.10177	-1.0641|-1.0641	5|10	.|0.09084	.|T	.|0.74	.|.	10.4398|10.4398	0.44457|0.44457	0.0:0.0764:0.0:0.9236|0.0:0.0764:0.0:0.9236	.|.	.|896	.|Q8N8A2-2	.|.	A|L	66|693;870;853;853;853	.|ENSP00000403415:M693L;ENSP00000282272:M870L;ENSP00000331516:M853L;ENSP00000402420:M853L;ENSP00000338794:M853L	.|ENSP00000282272:M870L	D|M	-|-	2|1	0|0	ANKRD44|ANKRD44	197571909|197571909	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.095000|4.095000	0.57728|0.57728	0.919000|0.919000	0.36945|0.36945	0.477000|0.477000	0.44152|0.44152	GAT|ATG		0.478	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697		16	40	0	0	0	0.006122	0	16	40				
FAM126B	285172	broad.mit.edu	37	2	201857028	201857028	+	Silent	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:201857028T>A	ENST00000418596.3	-	10	994	c.807A>T	c.(805-807)ctA>ctT	p.L269L	AC005037.3_ENST00000413848.1_RNA	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	269						intracellular (GO:0005622)				endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						AAAAAAGCTCTAGCTGGGCTC	0.338																																							uc002uws.3		NA																	0				ovary(1)	1						c.(805-807)CTA>CTT		hypothetical protein LOC285172							82.0	89.0	87.0					2																	201857028		2203	4300	6503	SO:0001819	synonymous_variant	285172					intracellular		g.chr2:201857028T>A	BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.807A>T	2.37:g.201857028T>A			Somatic				FAM126B_uc002uwu.2_Silent_p.L187L|FAM126B_uc002uwv.2_Silent_p.L269L	p.L269L	NM_173822	NP_776183	WXS	Illumina HiSeq	Unspecified	Q8IXS8	F126B_HUMAN			10	995	-			269					B2RCG7|Q4ZG87|Q53TX6	Silent	SNP	ENST00000418596.3	37	c.807A>T	CCDS2335.1																																																																																				0.338	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256285.3	NM_173822		15	66	0	0	0	0.004007	0	15	66				
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	A	rs121913500		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:209113112C>A	ENST00000415913.1	-	4	776	c.395G>T	c.(394-396)cGt>cTt	p.R132L	IDH1_ENST00000345146.2_Missense_Mutation_p.R132L|IDH1_ENST00000446179.1_Missense_Mutation_p.R132L	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)	Pancreas(158;264 1958 3300 35450 36047)	uc002vcs.2		NA		Dom	yes		2	2q33.3	3417	Mis	"""isocitrate dehydrogenase 1 (NADP+), soluble"""			O			gliobastoma 		2835	Substitution - Missense(2834)|Complex - compound substitution(1)	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)	central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868						c.(394-396)CGT>CTT		isocitrate dehydrogenase 1 (NADP+), soluble							79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	g.chr2:209113112C>A		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>T	2.37:g.209113112C>A	ENSP00000390265:p.Arg132Leu		Somatic				IDH1_uc002vct.2_Missense_Mutation_p.R132L|IDH1_uc002vcu.2_Missense_Mutation_p.R132L	p.R132L	NM_005896	NP_005887	WXS	Illumina HiSeq	Unspecified	O75874	IDHC_HUMAN		Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)	4	641	-			132		R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		Substrate.	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	c.395G>T	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.757535	0.89843	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93413	0.7899	H	0.99379	4.54	0.80722	D	1	B	0.18310	0.027	B	0.25759	0.063	D	0.92167	0.5740	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	L	132	ENSP00000260985:R132L;ENSP00000410513:R132L;ENSP00000390265:R132L;ENSP00000391075:R132L	ENSP00000260985:R132L	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			11	54	1	0	1.15088e-07	0.004007	1.52965e-07	11	54				
ABCA12	26154	broad.mit.edu	37	2	215851332	215851332	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:215851332A>C	ENST00000272895.7	-	28	4316	c.4097T>G	c.(4096-4098)cTg>cGg	p.L1366R	ABCA12_ENST00000389661.4_Missense_Mutation_p.L1048R	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1366	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATAAAAGTTCAGATTGAGGTT	0.428																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(4096-4098)CTG>CGG		ATP-binding cassette, sub-family A, member 12							86.0	81.0	82.0					2																	215851332		2203	4300	6503	SO:0001583	missense	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215851332A>C	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4097T>G	2.37:g.215851332A>C	ENSP00000272895:p.Leu1366Arg		Somatic				ABCA12_uc002vev.2_Missense_Mutation_p.L1048R|ABCA12_uc010zjn.1_Missense_Mutation_p.L293R	p.L1366R	NM_173076	NP_775099	WXS	Illumina HiSeq	Unspecified	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	28	4317	-		Renal(323;0.127)	1366			ABC transporter 1.		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	c.4097T>G	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220435	0.79464	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.95412	-3.7;-3.7	5.74	5.74	0.90152	ABC transporter-like (1);	0.000000	0.51477	D	0.000083	D	0.98573	0.9523	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.987;0.997	D	0.99768	1.1023	10	0.87932	D	0	.	16.0292	0.80564	1.0:0.0:0.0:0.0	.	1366;1048	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	R	1366;1048	ENSP00000272895:L1366R;ENSP00000374312:L1048R	ENSP00000272895:L1366R	L	-	2	0	ABCA12	215559577	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.476000	0.81055	2.187000	0.69744	0.533000	0.62120	CTG		0.428	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		7	54	0	0	0	0.006214	0	7	54				
CXCR2	3579	broad.mit.edu	37	2	218999803	218999803	+	Silent	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:218999803C>A	ENST00000318507.2	+	3	706	c.279C>A	c.(277-279)gcC>gcA	p.A93A		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	93					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						TAGCCTTGGCCGACCTACTCT	0.572																																							uc002vgz.1		NA																	0				lung(1)|breast(1)	2						c.(277-279)GCC>GCA		interleukin 8 receptor beta							136.0	130.0	132.0					2																	218999803		2203	4300	6503	SO:0001819	synonymous_variant	3579				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular defense response|dendritic cell chemotaxis|inflammatory response|neutrophil activation|neutrophil chemotaxis|positive regulation of cell proliferation	cell surface|integral to plasma membrane|mast cell granule	interleukin-8 receptor activity	g.chr2:218999803C>A	U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.279C>A	2.37:g.218999803C>A			Somatic				CXCR2_uc002vha.1_Silent_p.A93A|CXCR2_uc002vhb.1_Silent_p.A93A	p.A93A	NM_001557	NP_001548	WXS	Illumina HiSeq	Unspecified	P25025	CXCR2_HUMAN			4	504	+			93			Helical; Name=2; (Potential).		Q8IUZ1|Q9P2T6|Q9P2T7	Silent	SNP	ENST00000318507.2	37	c.279C>A	CCDS2408.1																																																																																				0.572	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256772.2	NM_001557		26	107	1	0	8.58068e-18	0.007291	1.40777e-17	26	107				
COL4A4	1286	broad.mit.edu	37	2	227945211	227945211	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:227945211C>A	ENST00000396625.3	-	24	1958	c.1751G>T	c.(1750-1752)gGa>gTa	p.G584V	COL4A4_ENST00000329662.7_Missense_Mutation_p.G584V	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	584	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ACCATGTGATCCTGGCTGCCC	0.473																																							uc010zlt.1		NA																	0				ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11						c.(1750-1752)GGA>GTA		alpha 4 type IV collagen precursor							124.0	124.0	124.0					2																	227945211		1853	4096	5949	SO:0001583	missense	1286				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding	g.chr2:227945211C>A		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.1751G>T	2.37:g.227945211C>A	ENSP00000379866:p.Gly584Val		Somatic					p.G584V	NM_000092	NP_000083	WXS	Illumina HiSeq	Unspecified	P53420	CO4A4_HUMAN		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)	24	2405	-		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)	584			Triple-helical region.		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	c.1751G>T	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.896425	0.52121	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.99637	-6.29;-6.29	5.91	5.91	0.95273	.	.	.	.	.	D	0.99829	0.9923	H	0.98487	4.245	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96934	0.9683	9	0.87932	D	0	.	18.0694	0.89400	0.0:1.0:0.0:0.0	.	584	P53420	CO4A4_HUMAN	V	584	ENSP00000379866:G584V;ENSP00000328553:G584V	ENSP00000328553:G584V	G	-	2	0	COL4A4	227653455	0.961000	0.32948	0.586000	0.28679	0.133000	0.20885	4.607000	0.61133	2.813000	0.96785	0.655000	0.94253	GGA		0.473	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092		29	101	1	0	0.000339439	0.002096	0.000396012	29	101				
KIF1A	547	broad.mit.edu	37	2	241685265	241685265	+	Silent	SNP	C	C	A	rs374238759		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:241685265C>A	ENST00000320389.7	-	29	3119	c.2961G>T	c.(2959-2961)ctG>ctT	p.L987L	KIF1A_ENST00000498729.2_Silent_p.L1088L	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	987					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGGCAGCATCCAGGGGCCCAT	0.622																																							uc002vzy.2		NA																	0				lung(1)	1						c.(2959-2961)CTG>CTT		axonal transport of synaptic vesicles							31.0	36.0	34.0					2																	241685265		1953	4157	6110	SO:0001819	synonymous_variant	547				anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity	g.chr2:241685265C>A	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2961G>T	2.37:g.241685265C>A			Somatic				KIF1A_uc010fzk.2_Silent_p.L1088L|KIF1A_uc002vzz.1_Silent_p.L1088L	p.L987L	NM_004321	NP_004312	WXS	Illumina HiSeq	Unspecified	Q12756	KIF1A_HUMAN		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)	29	3107	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	987					B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Silent	SNP	ENST00000320389.7	37	c.2961G>T	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	0.832	-0.744925	0.03065	.	.	ENSG00000130294	ENST00000415042	.	.	.	4.17	3.27	0.37495	.	.	.	.	.	T	0.56124	0.1964	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49854	-0.8895	4	.	.	.	.	7.572	0.27913	0.0:0.7284:0.0:0.2716	.	.	.	.	L	114	.	.	W	-	2	0	KIF1A	241333938	1.000000	0.71417	0.992000	0.48379	0.076000	0.17211	1.033000	0.30191	0.709000	0.31976	0.313000	0.20887	TGG		0.622	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483		5	11	1	0	1.6384e-10	0.001984	2.3566e-10	5	11				
FRG1B	284802	broad.mit.edu	37	20	29628283	29628283	+	Silent	SNP	G	G	C	rs200164543		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr20:29628283G>C	ENST00000278882.3	+	6	665	c.285G>C	c.(283-285)ggG>ggC	p.G95G	FRG1B_ENST00000358464.4_Silent_p.G95G|FRG1B_ENST00000439954.2_Silent_p.G100G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95								p.G95G(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGAAGCAGGGGACATAGAAG	0.378																																							uc010ztl.1		NA																	4	Substitution - coding silent(4)		urinary_tract(2)|kidney(2)		0						c.(193-195)GGG>GGC		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001819	synonymous_variant	284802							g.chr20:29628283G>C			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.285G>C	20.37:g.29628283G>C			Somatic				FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Silent_p.G17G	p.G65G			WXS	Illumina HiSeq	Unspecified					3	227	+								C4AME5	Silent	SNP	ENST00000278882.3	37	c.195G>C																																																																																					0.378	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		4	73	0	0	0	0.004482	0	4	73				
BPIFB3	359710	broad.mit.edu	37	20	31644416	31644416	+	Silent	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr20:31644416C>A	ENST00000375494.3	+	2	193	c.193C>A	c.(193-195)Cgg>Agg	p.R65R	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	65	Leu-rich.				innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										AGCTGTGAACCGGGGCCTCTT	0.607																																							uc002wym.1		NA																	0				ovary(4)	4						c.(193-195)CGG>AGG		antimicrobial peptide RYA3 precursor							89.0	91.0	91.0					20																	31644416		2203	4300	6503	SO:0001819	synonymous_variant	359710				innate immune response	cytoplasm|extracellular region	lipid binding|protein binding	g.chr20:31644416C>A	AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.193C>A	20.37:g.31644416C>A			Somatic					p.R65R	NM_182658	NP_872599	WXS	Illumina HiSeq	Unspecified	P59826	LPLC3_HUMAN			2	193	+			65			Leu-rich.		Q5TDX7	Silent	SNP	ENST00000375494.3	37	c.193C>A	CCDS13212.1																																																																																				0.607	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658		18	50	1	0	1.01871e-10	0.008871	1.47878e-10	18	50				
DHX35	60625	broad.mit.edu	37	20	37597733	37597733	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr20:37597733G>A	ENST00000252011.3	+	2	83	c.50G>A	c.(49-51)gGg>gAg	p.G17E	DHX35_ENST00000373323.4_Missense_Mutation_p.G17E|DHX35_ENST00000373325.2_Missense_Mutation_p.G17E	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	17					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				GGTACAGAGGGGCCAGGTGTA	0.403																																							uc002xjh.2		NA																	0				lung(1)|kidney(1)|skin(1)	3						c.(49-51)GGG>GAG		DEAH (Asp-Glu-Ala-His) box polypeptide 35							68.0	57.0	61.0					20																	37597733		2203	4300	6503	SO:0001583	missense	60625					catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr20:37597733G>A	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.50G>A	20.37:g.37597733G>A	ENSP00000252011:p.Gly17Glu		Somatic				DHX35_uc010zwa.1_5'UTR|DHX35_uc010zwb.1_5'UTR|DHX35_uc010zwc.1_Missense_Mutation_p.G17E	p.G17E	NM_021931	NP_068750	WXS	Illumina HiSeq	Unspecified	Q9H5Z1	DHX35_HUMAN			2	61	+		Myeloproliferative disorder(115;0.00878)	17					A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Missense_Mutation	SNP	ENST00000252011.3	37	c.50G>A	CCDS13310.1	.	.	.	.	.	.	.	.	.	.	G	9.289	1.050173	0.19827	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000441485	T;T;T;T	0.08984	4.22;4.3;4.2;3.03	5.57	5.57	0.84162	.	0.257365	0.45606	D	0.000346	T	0.05181	0.0138	N	0.03608	-0.345	0.52501	D	0.999955	P;B	0.34977	0.478;0.146	B;B	0.33254	0.16;0.038	T	0.52939	-0.8508	10	0.40728	T	0.16	.	18.3223	0.90242	0.0:0.0:1.0:0.0	.	17;17	F5GXM6;Q9H5Z1	.;DHX35_HUMAN	E	17;17;17;13	ENSP00000362422:G17E;ENSP00000252011:G17E;ENSP00000362420:G17E;ENSP00000414630:G13E	ENSP00000252011:G17E	G	+	2	0	DHX35	37031147	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.826000	0.62715	2.617000	0.88574	0.655000	0.94253	GGG		0.403	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931		4	25	0	0	0	0.000248	0	4	25				
TMPRSS15	5651	broad.mit.edu	37	21	19698813	19698813	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr21:19698813G>T	ENST00000284885.3	-	16	1890	c.1857C>A	c.(1855-1857)aaC>aaA	p.N619K		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	619	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CCAACACATCGTTAGTGATGA	0.448																																							uc002ykw.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(1855-1857)AAC>AAA		enterokinase precursor							232.0	192.0	206.0					21																	19698813		2203	4300	6503	SO:0001583	missense	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19698813G>T		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1857C>A	21.37:g.19698813G>T	ENSP00000284885:p.Asn619Lys		Somatic					p.N619K	NM_002772	NP_002763	WXS	Illumina HiSeq	Unspecified	P98073	ENTK_HUMAN			16	1888	-			619			Extracellular (Potential).|CUB 2.		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.1857C>A	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548774	0.45383	.	.	ENSG00000154646	ENST00000284885	T	0.20463	2.07	5.27	-2.34	0.06704	CUB (5);	0.243242	0.39341	N	0.001398	T	0.21468	0.0517	L	0.60067	1.865	0.09310	N	0.999999	P	0.47484	0.896	P	0.45856	0.495	T	0.15665	-1.0429	9	.	.	.	.	10.5355	0.45002	0.5649:0.0:0.4351:0.0	.	619	P98073	ENTK_HUMAN	K	619	ENSP00000284885:N619K	.	N	-	3	2	TMPRSS15	18620684	0.041000	0.20044	0.000000	0.03702	0.010000	0.07245	0.319000	0.19522	-0.773000	0.04596	-0.142000	0.14014	AAC		0.448	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		31	81	1	0	1.22384e-17	0.002836	1.99745e-17	31	81				
APP	351	broad.mit.edu	37	21	27327992	27327992	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr21:27327992G>A	ENST00000346798.3	-	12	1569	c.1536C>T	c.(1534-1536)ttC>ttT	p.F512F	APP_ENST00000357903.3_Silent_p.F493F|APP_ENST00000440126.3_Silent_p.F488F|APP_ENST00000348990.5_Silent_p.F437F|APP_ENST00000358918.3_Silent_p.F512F|APP_ENST00000439274.2_Silent_p.F456F|APP_ENST00000354192.3_Silent_p.F381F|APP_ENST00000448388.2_Silent_p.F402F|APP_ENST00000359726.3_Silent_p.F456F	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	512	Heparin-binding.				adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)	p.F512F(2)		endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				GCACATGCTCGAAATGCTTTA	0.493																																							uc002ylz.2		NA																	2	Substitution - coding silent(2)		large_intestine(2)	ovary(1)	1						c.(1534-1536)TTC>TTT		amyloid beta A4 protein isoform a precursor							217.0	169.0	185.0					21																	27327992		2203	4300	6503	SO:0001819	synonymous_variant	351				adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity	g.chr21:27327992G>A	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1536C>T	21.37:g.27327992G>A			Somatic				APP_uc011acg.1_Silent_p.F20F|APP_uc010glk.2_Silent_p.F488F|APP_uc002yma.2_Silent_p.F493F|APP_uc011ach.1_Silent_p.F456F|APP_uc002ymb.2_Silent_p.F437F|APP_uc010glj.2_Silent_p.F381F|APP_uc011aci.1_Silent_p.F402F	p.F512F	NM_000484	NP_000475	WXS	Illumina HiSeq	Unspecified	P05067	A4_HUMAN			12	1736	-		Breast(209;0.00295)	512			Heparin-binding.|Extracellular (Potential).		B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Silent	SNP	ENST00000346798.3	37	c.1536C>T	CCDS13576.1	.	.	.	.	.	.	.	.	.	.	G	5.958	0.360705	0.11296	.	.	ENSG00000142192	ENST00000448850	.	.	.	5.45	0.505	0.16953	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.1801	9.3162	0.37934	0.5085:0.0:0.4915:0.0	.	.	.	.	X	415	.	.	R	-	1	2	APP	26249863	0.984000	0.35163	1.000000	0.80357	0.467000	0.32768	0.330000	0.19715	0.182000	0.20032	-0.302000	0.09304	CGA		0.493	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484		26	40	0	0	0	0.00632	0	26	40				
KCNJ6	3763	broad.mit.edu	37	21	39086663	39086663	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr21:39086663G>T	ENST00000609713.1	-	3	1386	c.797C>A	c.(796-798)aCg>aAg	p.T266K	KCNJ6_ENST00000288309.6_Missense_Mutation_p.T266K|KCNJ6-IT1_ENST00000435001.1_RNA	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	266					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	GTCATCCCCCGTGTAATACCC	0.507																																					Pancreas(48;379 1118 2936 19024 28214)	Pancreas(48;379 1118 2936 19024 28214)	uc011aej.1		NA																	0				skin(1)	1						c.(796-798)ACG>AAG		potassium inwardly-rectifying channel J6	Halothane(DB01159)						127.0	130.0	129.0					21																	39086663		1928	4147	6075	SO:0001583	missense	3763				synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr21:39086663G>T	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.797C>A	21.37:g.39086663G>T	ENSP00000477437:p.Thr266Lys		Somatic				KCNJ6_uc002ywo.2_Missense_Mutation_p.T266K	p.T266K	NM_002240	NP_002231	WXS	Illumina HiSeq	Unspecified	P48051	IRK6_HUMAN			3	850	-			266			Cytoplasmic (By similarity).		Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	37	c.797C>A	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933993	0.73442	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.91792	-2.91;-2.91	6.17	6.17	0.99709	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.95306	0.8477	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.91197	0.4988	10	0.08179	T	0.78	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	266	P48051	IRK6_HUMAN	K	266	ENSP00000383330:T266K;ENSP00000288309:T266K	ENSP00000288309:T266K	T	-	2	0	KCNJ6	38008533	1.000000	0.71417	0.980000	0.43619	0.964000	0.63967	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	ACG		0.507	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240		29	70	1	0	1.06647e-15	0.003755	1.69666e-15	29	70				
SERPIND1	3053	broad.mit.edu	37	22	21140420	21140420	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr22:21140420G>T	ENST00000215727.5	+	4	1575	c.1292G>T	c.(1291-1293)aGg>aTg	p.R431M	PI4KA_ENST00000572273.1_Intron|SERPIND1_ENST00000406799.1_Missense_Mutation_p.R431M|PI4KA_ENST00000466162.1_Intron|PI4KA_ENST00000255882.6_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	431					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	TCAGACCAAAGGATCGCCATC	0.562																																							uc002ztb.1		NA																	0					0						c.(1291-1293)AGG>ATG		heparin cofactor II precursor	Ardeparin(DB00407)						206.0	172.0	183.0					22																	21140420		2203	4300	6503	SO:0001583	missense	3053				blood coagulation|chemotaxis|regulation of proteolysis	extracellular region	heparin binding|serine-type endopeptidase inhibitor activity	g.chr22:21140420G>T	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.1292G>T	22.37:g.21140420G>T	ENSP00000215727:p.Arg431Met		Somatic				PI4KA_uc002zsz.3_Intron|SERPIND1_uc002ztc.2_Missense_Mutation_p.R459M	p.R431M	NM_000185	NP_000176	WXS	Illumina HiSeq	Unspecified	P05546	HEP2_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		4	1359	+	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	431					B2RAI1|D3DX34|Q6IBZ5	Missense_Mutation	SNP	ENST00000215727.5	37	c.1292G>T	CCDS13783.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267389	0.40095	.	.	ENSG00000099937	ENST00000215727;ENST00000406799	D;D	0.87966	-2.32;-2.32	5.19	0.288	0.15719	Serpin domain (3);	0.375794	0.34725	N	0.003733	T	0.81654	0.4868	L	0.35593	1.075	0.09310	N	1	P;P	0.44578	0.838;0.838	P;P	0.46796	0.527;0.527	T	0.74244	-0.3728	10	0.62326	D	0.03	.	8.9088	0.35541	0.622:0.0:0.378:0.0	.	431;431	Q8IVC0;P05546	.;HEP2_HUMAN	M	431	ENSP00000215727:R431M;ENSP00000384050:R431M	ENSP00000215727:R431M	R	+	2	0	SERPIND1	19470420	0.708000	0.27876	0.052000	0.19188	0.926000	0.56050	2.349000	0.44054	0.049000	0.15920	0.591000	0.81541	AGG		0.562	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185		9	111	1	0	0.000673444	0.008291	0.000768605	9	111				
MYO18B	84700	broad.mit.edu	37	22	26294422	26294422	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr22:26294422A>G	ENST00000407587.2	+	29	4989	c.4820A>G	c.(4819-4821)cAg>cGg	p.Q1607R	CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000608507.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000597614.2_RNA|CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000600903.1_RNA|CTA-125H2.2_ENST00000595093.1_RNA|CTA-125H2.2_ENST00000594856.1_RNA|CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.Q1606R|CTA-125H2.2_ENST00000609157.1_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.Q1606R|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000596813.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1606	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GAGAAGAAGCAGAAGAAGTGA	0.522																																							uc003abz.1		NA																	0				ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(4816-4818)CAG>CGG		myosin XVIIIB							114.0	113.0	114.0					22																	26294422		2071	4202	6273	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26294422A>G	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4820A>G	22.37:g.26294422A>G	ENSP00000386096:p.Gln1607Arg		Somatic				MYO18B_uc003aca.1_Missense_Mutation_p.Q1487R|MYO18B_uc010guy.1_Missense_Mutation_p.Q1488R|MYO18B_uc010guz.1_Missense_Mutation_p.Q1486R|MYO18B_uc011aka.1_Missense_Mutation_p.Q760R|MYO18B_uc011akb.1_Missense_Mutation_p.Q1119R	p.Q1606R	NM_032608	NP_115997	WXS	Illumina HiSeq	Unspecified	Q8IUG5	MY18B_HUMAN			29	5067	+			1606			Potential.|Tail.		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.4817A>G		.	.	.	.	.	.	.	.	.	.	A	24.3	4.516859	0.85495	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;T	0.86956	-2.19;-2.19;-1.12	5.9	5.9	0.94986	.	0.076957	0.53938	D	0.000058	D	0.93138	0.7815	M	0.81497	2.545	0.47153	D	0.999331	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.74674	0.984;0.964;0.961;0.984	D	0.93361	0.6727	10	0.52906	T	0.07	.	14.2804	0.66208	1.0:0.0:0.0:0.0	.	1119;1606;1607;1606	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	R	1606;1606;1607	ENSP00000441229:Q1606R;ENSP00000334563:Q1606R;ENSP00000386096:Q1607R	ENSP00000334563:Q1606R	Q	+	2	0	MYO18B	24624422	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.521000	0.90569	2.257000	0.74773	0.533000	0.62120	CAG		0.522	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		8	80	0	0	0	0.006214	0	8	80				
MCM5	4174	broad.mit.edu	37	22	35817363	35817363	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr22:35817363C>T	ENST00000216122.4	+	15	2039	c.1885C>T	c.(1885-1887)Cag>Tag	p.Q629*	MCM5_ENST00000382011.5_Nonsense_Mutation_p.Q586*	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	629					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						GATGAAGCTGCAGCCCTTCGC	0.622																																							uc003anu.3		NA																	0				ovary(1)	1						c.(1885-1887)CAG>TAG		minichromosome maintenance complex component 5							86.0	80.0	82.0					22																	35817363		2203	4300	6503	SO:0001587	stop_gained	4174				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding	g.chr22:35817363C>T		CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.1885C>T	22.37:g.35817363C>T	ENSP00000216122:p.Gln629*		Somatic				MCM5_uc010gwr.2_Nonsense_Mutation_p.Q438*|MCM5_uc003anv.3_Nonsense_Mutation_p.Q586*|MCM5_uc003anw.1_Nonsense_Mutation_p.Q413*	p.Q629*	NM_006739	NP_006730	WXS	Illumina HiSeq	Unspecified	P33992	MCM5_HUMAN			15	1979	+			629					O60785|Q14578|Q9BTJ4|Q9BWL8	Nonsense_Mutation	SNP	ENST00000216122.4	37	c.1885C>T	CCDS13915.1	.	.	.	.	.	.	.	.	.	.	C	41	8.906463	0.98998	.	.	ENSG00000100297	ENST00000216122;ENST00000382011	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-26.0526	20.0826	0.97783	0.0:1.0:0.0:0.0	.	.	.	.	X	629;586	.	ENSP00000216122:Q629X	Q	+	1	0	MCM5	34147363	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.254000	0.78329	2.746000	0.94184	0.655000	0.94253	CAG		0.622	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3			16	67	0	0	0	0.00499	0	16	67				
ATP2B2	491	broad.mit.edu	37	3	10381930	10381930	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:10381930C>A	ENST00000352432.4	-	20	3302	c.3233G>T	c.(3232-3234)gGc>gTc	p.G1078V	ATP2B2_ENST00000397077.1_Missense_Mutation_p.G1033V|ATP2B2_ENST00000383800.4_Missense_Mutation_p.G1033V|ATP2B2_ENST00000360273.2_Missense_Mutation_p.G1078V|ATP2B2_ENST00000343816.4_Missense_Mutation_p.G1064V			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	1078					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						ACTTACCTGGCCCCAAACGAG	0.572																																					Ovarian(125;1619 1709 15675 19819 38835)	Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(3232-3234)GGC>GTC		plasma membrane calcium ATPase 2 isoform 1							87.0	74.0	79.0					3																	10381930		2203	4300	6503	SO:0001583	missense	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10381930C>A	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.3233G>T	3.37:g.10381930C>A	ENSP00000324172:p.Gly1078Val		Somatic				ATP2B2_uc003bvv.2_Missense_Mutation_p.G1033V|ATP2B2_uc003bvw.2_Missense_Mutation_p.G1033V|ATP2B2_uc010hdo.2_Missense_Mutation_p.G783V	p.G1078V	NM_001001331	NP_001001331	WXS	Illumina HiSeq	Unspecified	Q01814	AT2B2_HUMAN			21	3672	-			1078			Helical; (Potential).		O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	c.3233G>T	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274164	0.80580	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000429937;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74;-3.74;-3.74	4.18	4.18	0.49190	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98448	0.9483	H	0.96111	3.77	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.91635	0.999;0.976;0.978	D	0.99854	1.1075	10	0.87932	D	0	-19.6625	16.1192	0.81329	0.0:1.0:0.0:0.0	.	1013;1045;1078	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	V	1078;1033;1033;1078;1064;1013;267;934;1078	ENSP00000324172:G1078V;ENSP00000373311:G1033V;ENSP00000380267:G1033V;ENSP00000353414:G1078V;ENSP00000344677:G1064V;ENSP00000414854:G934V	ENSP00000342954:G1078V	G	-	2	0	ATP2B2	10356930	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.553000	0.82203	1.881000	0.54492	0.563000	0.77884	GGC		0.572	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		6	42	1	0	1.76689e-08	0.006214	2.39901e-08	6	42				
ANKRD28	23243	broad.mit.edu	37	3	15762612	15762612	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:15762612C>T	ENST00000399451.2	-	8	1083	c.716G>A	c.(715-717)gGa>gAa	p.G239E	ANKRD28_ENST00000497037.1_5'UTR|ANKRD28_ENST00000383777.1_Missense_Mutation_p.G272E	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28	239						nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						AGGTGTATTTCCATAGGCATT	0.338																																							uc003caj.1		NA																	0				breast(1)	1						c.(715-717)GGA>GAA		ankyrin repeat domain 28							282.0	272.0	275.0					3																	15762612		1863	4094	5957	SO:0001583	missense	23243					nucleoplasm	protein binding	g.chr3:15762612C>T	AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.716G>A	3.37:g.15762612C>T	ENSP00000382379:p.Gly239Glu		Somatic				ANKRD28_uc003cai.1_Missense_Mutation_p.G85E|ANKRD28_uc011avz.1_Missense_Mutation_p.G85E|ANKRD28_uc003cak.1_RNA|ANKRD28_uc011awa.1_RNA|ANKRD28_uc003cal.1_Missense_Mutation_p.G269E|ANKRD28_uc003cam.2_Missense_Mutation_p.G272E	p.G239E	NM_015199	NP_056014	WXS	Illumina HiSeq	Unspecified	O15084	ANR28_HUMAN			8	859	-			239			ANK 7.		B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Missense_Mutation	SNP	ENST00000399451.2	37	c.716G>A	CCDS46769.1	.	.	.	.	.	.	.	.	.	.	C	35	5.424644	0.96111	.	.	ENSG00000206560	ENST00000399451;ENST00000383777;ENST00000412318	T;T;T	0.22134	1.97;1.97;1.97	6.03	6.03	0.97812	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.55986	0.1955	M	0.87617	2.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.58618	-0.7605	10	0.62326	D	0.03	.	20.5753	0.99366	0.0:1.0:0.0:0.0	.	272;269;239	O15084-1;O15084-4;O15084	.;.;ANR28_HUMAN	E	239;272;239	ENSP00000382379:G239E;ENSP00000373287:G272E;ENSP00000397341:G239E	ENSP00000373287:G272E	G	-	2	0	ANKRD28	15737616	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.868000	0.98415	0.557000	0.71058	GGA		0.338	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339758.1	NM_015199		17	195	0	0	0	0.007413	0	17	195				
CYP8B1	1582	broad.mit.edu	37	3	42917206	42917206	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:42917206G>T	ENST00000316161.4	-	1	427	c.103C>A	c.(103-105)Ctg>Atg	p.L35M	CYP8B1_ENST00000437102.1_Missense_Mutation_p.L35M|RP11-141M3.5_ENST00000471537.1_RNA|KRBOX1_ENST00000426937.1_Intron	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	35					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		CCCTTGTCCAGAGGGGGCTCC	0.582																																							uc003cmh.2		NA																	0				ovary(2)	2						c.(103-105)CTG>ATG		cytochrome P450, family 8, subfamily B,							46.0	46.0	46.0					3																	42917206		2202	4300	6502	SO:0001583	missense	1582				bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity|electron carrier activity|heme binding|oxygen binding|sterol 12-alpha-hydroxylase activity	g.chr3:42917206G>T	AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.103C>A	3.37:g.42917206G>T	ENSP00000318867:p.Leu35Met		Somatic				CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Missense_Mutation_p.L35M	p.L35M	NM_004391	NP_004382	WXS	Illumina HiSeq	Unspecified	Q9UNU6	CP8B1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)	1	428	-			35					B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	37	c.103C>A	CCDS2707.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.322754	0.60634	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.01335	5.0;5.0	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000003	T	0.08846	0.0219	M	0.85945	2.785	0.46654	D	0.999141	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.00050	-1.2196	10	0.87932	D	0	-15.5713	11.1275	0.48328	0.0891:0.0:0.9109:0.0	.	35;35	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	M	35	ENSP00000404499:L35M;ENSP00000318867:L35M	ENSP00000318867:L35M	L	-	1	2	CYP8B1	42892210	0.998000	0.40836	1.000000	0.80357	0.915000	0.54546	2.667000	0.46808	2.553000	0.86117	0.561000	0.74099	CTG		0.582	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	NM_004391		8	38	1	0	1.12685e-05	0.004482	1.40856e-05	8	38				
SEMA3B	7869	broad.mit.edu	37	3	50313211	50313211	+	RNA	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:50313211C>T	ENST00000418948.1	+	0	2015							Q13214	SEM3B_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B						axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			central_nervous_system(2)|kidney(1)|lung(2)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GAGTGTGAGCCCCGCTCGCTG	0.657																																							uc003cyu.2		NA																	0				lung(2)|central_nervous_system(2)|kidney(1)|skin(1)	6						c.(1780-1782)CCC>CTC		semaphorin 3B isoform 1 precursor							26.0	29.0	28.0					3																	50313211		1996	4163	6159			7869				axon guidance|cell-cell signaling	endoplasmic reticulum|extracellular region|membrane	receptor activity	g.chr3:50313211C>T	U28369	CCDS74941.1	3p21.3	2013-01-11			ENSG00000012171	ENSG00000012171		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10724	protein-coding gene	gene with protein product		601281		SEMAA		7748561, 8633026	Standard	NM_004636		Approved	SemA, semaV, LUCA-1, sema5	uc003cyu.3	Q13214	OTTHUMG00000156970		3.37:g.50313211C>T			Somatic				SEMA3B_uc003cyt.2_Missense_Mutation_p.P593L|SEMA3B_uc003cyv.2_Missense_Mutation_p.P481L|SEMA3B_uc003cyw.2_Missense_Mutation_p.P317L|SEMA3B_uc010hli.2_Missense_Mutation_p.P486L|SEMA3B_uc003cyx.2_Missense_Mutation_p.P480L|SEMA3B_uc003cyy.2_Missense_Mutation_p.P251L|SEMA3B_uc011bdo.1_Missense_Mutation_p.P251L	p.P594L	NM_004636	NP_004627	WXS	Illumina HiSeq	Unspecified	Q13214	SEM3B_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)	18	2023	+			594			Ig-like C2-type.		Q6GU46|Q8TB71|Q8TDV7|Q93018|Q96GX0	Missense_Mutation	SNP	ENST00000418948.1	37	c.1781C>T		.	.	.	.	.	.	.	.	.	.	C	15.46	2.841000	0.51057	.	.	ENSG00000012171	ENST00000316347	.	.	.	4.82	4.82	0.62117	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.057260	0.64402	D	0.000001	T	0.75428	0.3848	.	.	.	.	.	.	P;D;P;P	0.58620	0.9;0.983;0.9;0.703	P;D;P;P	0.68483	0.659;0.958;0.659;0.493	T	0.76152	-0.3064	7	0.31617	T	0.26	.	15.3985	0.74816	0.0:1.0:0.0:0.0	.	593;343;593;594	Q13214-2;Q59FY7;F5H2H7;Q13214	.;.;.;SEM3B_HUMAN	L	593	.	ENSP00000446262:P593L	P	+	2	0	SEMA3B	50288215	0.913000	0.31002	1.000000	0.80357	0.621000	0.37620	4.641000	0.61375	2.229000	0.72834	0.563000	0.77884	CCC		0.657	SEMA3B-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000346890.2	NM_001005914		4	23	0	0	0	0.001168	0	4	23				
EAF2	55840	broad.mit.edu	37	3	121591442	121591442	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:121591442T>A	ENST00000273668.2	+	5	614	c.543T>A	c.(541-543)gaT>gaA	p.D181E	EAF2_ENST00000451944.2_Missense_Mutation_p.D181E	NM_018456.4	NP_060926.2	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	181	Necessary for transactivation activity.|Ser-rich.				apoptotic process (GO:0006915)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	ELL-EAF complex (GO:0032783)|transcription elongation factor complex (GO:0008023)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)	9				GBM - Glioblastoma multiforme(114;0.0972)		GTTCATCAGATTCCAAAAGTT	0.358																																					Esophageal Squamous(194;1942 2097 24663 29345 31866)	Esophageal Squamous(194;1942 2097 24663 29345 31866)	uc003een.2		NA																	0					0						c.(541-543)GAT>GAA		ELL associated factor 2							124.0	123.0	124.0					3																	121591442		2203	4300	6503	SO:0001583	missense	55840				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	protein binding	g.chr3:121591442T>A	AF517829	CCDS3006.1	3q21.1	2007-08-01			ENSG00000145088	ENSG00000145088			23115	protein-coding gene	gene with protein product		607659				12446457, 12907652	Standard	NM_018456		Approved	BM040, TRAITS, U19	uc003een.3	Q96CJ1	OTTHUMG00000159424	ENST00000273668.2:c.543T>A	3.37:g.121591442T>A	ENSP00000273668:p.Asp181Glu		Somatic				EAF2_uc003eeo.2_Missense_Mutation_p.D51E	p.D181E	NM_018456	NP_060926	WXS	Illumina HiSeq	Unspecified	Q96CJ1	EAF2_HUMAN		GBM - Glioblastoma multiforme(114;0.0972)	5	642	+			181			Ser-rich.|Necessary for transactivation activity.		Q9NZ82	Missense_Mutation	SNP	ENST00000273668.2	37	c.543T>A	CCDS3006.1	.	.	.	.	.	.	.	.	.	.	T	8.055	0.766800	0.15983	.	.	ENSG00000145088	ENST00000273668;ENST00000451944	.	.	.	4.75	3.52	0.40303	.	0.351395	0.31624	N	0.007335	T	0.29458	0.0734	N	0.20986	0.625	0.44976	D	0.997992	B	0.17465	0.022	B	0.14578	0.011	T	0.09840	-1.0656	9	0.09338	T	0.73	-13.1197	4.8014	0.13298	0.1946:0.0:0.1782:0.6271	.	181	Q96CJ1	EAF2_HUMAN	E	181	.	ENSP00000273668:D181E	D	+	3	2	EAF2	123074132	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	0.421000	0.21280	1.990000	0.58119	0.260000	0.18958	GAT		0.358	EAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355247.1	NM_018456		21	106	0	0	0	0.004656	0	21	106				
ALG1L	200810	broad.mit.edu	37	3	125652457	125652457	+	Missense_Mutation	SNP	C	C	T	rs373951263		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:125652457C>T	ENST00000340333.3	-	2	224	c.61G>A	c.(61-63)Gag>Aag	p.E21K		NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like	21							transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						GCTGGCCACTCGCGGAGATGC	0.622																																							uc003eig.1		NA																	0					0						c.(61-63)GAG>AAG		asparagine-linked glycosylation 1-like							23.0	22.0	23.0					3																	125652457		2203	4299	6502	SO:0001583	missense	200810						transferase activity, transferring glycosyl groups	g.chr3:125652457C>T	BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.61G>A	3.37:g.125652457C>T	ENSP00000340009:p.Glu21Lys		Somatic					p.E21K	NM_001015050	NP_001015050	WXS	Illumina HiSeq	Unspecified	Q6GMV1	ALG1L_HUMAN			2	225	-			21					D3DNA5	Missense_Mutation	SNP	ENST00000340333.3	37	c.61G>A	CCDS33840.1	.	.	.	.	.	.	.	.	.	.	.	8.409	0.843776	0.16963	.	.	ENSG00000189366	ENST00000340333	T	0.69806	-0.43	2.11	1.19	0.21007	.	0.318910	0.39274	N	0.001419	T	0.42154	0.1190	N	0.19112	0.55	0.19300	N	0.999978	B	0.23650	0.089	B	0.15484	0.013	T	0.15983	-1.0418	10	0.16420	T	0.52	-16.9029	6.4392	0.21841	0.0:0.831:0.0:0.169	.	21	Q6GMV1	ALG1L_HUMAN	K	21	ENSP00000340009:E21K	ENSP00000340009:E21K	E	-	1	0	ALG1L	127135147	0.100000	0.21855	0.233000	0.24025	0.019000	0.09904	0.949000	0.29109	0.215000	0.20761	0.162000	0.16502	GAG		0.622	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356347.1	NM_001015050		4	25	0	0	0	0.000602	0	4	25				
ALDH1L1	10840	broad.mit.edu	37	3	125854472	125854472	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:125854472C>A	ENST00000393434.2	-	12	1727	c.1378G>T	c.(1378-1380)Gac>Tac	p.D460Y	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.D460Y|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.D460Y|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.D470Y|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.D359Y	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	460	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	TTGTCGACGTCGGTGACTTGG	0.597																																							uc003eim.1		NA																	0				large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(1378-1380)GAC>TAC		aldehyde dehydrogenase 1 family, member L1	Tetrahydrofolic acid(DB00116)						126.0	103.0	110.0					3																	125854472		2203	4300	6503	SO:0001583	missense	10840				10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity	g.chr3:125854472C>A	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1378G>T	3.37:g.125854472C>A	ENSP00000377083:p.Asp460Tyr		Somatic				ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_Missense_Mutation_p.D359Y|ALDH1L1_uc003eio.2_Missense_Mutation_p.D162Y|ALDH1L1_uc010hsf.1_Missense_Mutation_p.D486Y	p.D460Y	NM_012190	NP_036322	WXS	Illumina HiSeq	Unspecified	O75891	AL1L1_HUMAN		GBM - Glioblastoma multiforme(114;0.0462)	12	1568	-			460			Aldehyde dehydrogenase.		B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	37	c.1378G>T	CCDS3034.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.646601	0.47258	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431	T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33	4.03	4.03	0.46877	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.123875	0.50627	D	0.000105	D	0.92672	0.7671	H	0.97051	3.93	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94754	0.7930	10	0.87932	D	0	.	14.0496	0.64727	0.0:1.0:0.0:0.0	.	359;512;460	E9PBX3;Q59G10;O75891	.;.;AL1L1_HUMAN	Y	470;460;359;460;460	ENSP00000273450:D470Y;ENSP00000420293:D460Y;ENSP00000395881:D359Y;ENSP00000377083:D460Y;ENSP00000377081:D460Y	ENSP00000273450:D470Y	D	-	1	0	ALDH1L1	127337162	1.000000	0.71417	0.384000	0.26145	0.029000	0.11900	6.715000	0.74697	2.261000	0.74972	0.305000	0.20034	GAC		0.597	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190		6	50	1	0	0.00198382	0.001984	0.00223979	6	50				
PLSCR4	57088	broad.mit.edu	37	3	145938688	145938688	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:145938688T>A	ENST00000354952.2	-	3	272	c.32A>T	c.(31-33)cAg>cTg	p.Q11L	PLSCR4_ENST00000446574.2_Missense_Mutation_p.Q11L|PLSCR4_ENST00000493382.1_Missense_Mutation_p.Q11L|PLSCR4_ENST00000383083.2_Missense_Mutation_p.Q11L|PLSCR4_ENST00000433593.2_5'UTR	NM_020353.2	NP_065086.2	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4	11	Proline-rich domain (PRD). {ECO:0000250}.				cellular response to lipopolysaccharide (GO:0071222)|phospholipid scrambling (GO:0017121)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|enzyme binding (GO:0019899)|phospholipid scramblase activity (GO:0017128)			kidney(1)|large_intestine(6)|lung(9)|urinary_tract(1)	17						ACCTGCAGGCTGTTCAGGGGC	0.403																																							uc010huy.2		NA																	0					0						c.(31-33)CAG>CTG		phospholipid scramblase 4 isoform a							102.0	91.0	95.0					3																	145938688		2203	4300	6503	SO:0001583	missense	57088				blood coagulation|phospholipid scrambling	integral to membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding	g.chr3:145938688T>A	AF199023	CCDS3133.1, CCDS54651.1	3q24	2008-07-18			ENSG00000114698	ENSG00000114698			16497	protein-coding gene	gene with protein product		607612				10930526	Standard	NM_020353		Approved		uc003evt.4	Q9NRQ2	OTTHUMG00000159415	ENST00000354952.2:c.32A>T	3.37:g.145938688T>A	ENSP00000347038:p.Gln11Leu		Somatic				PLSCR4_uc010huz.2_Missense_Mutation_p.Q11L|PLSCR4_uc003evt.3_Missense_Mutation_p.Q11L|PLSCR4_uc010hva.2_Missense_Mutation_p.Q11L|PLSCR4_uc003evu.3_5'UTR	p.Q11L	NM_001128305	NP_001121777	WXS	Illumina HiSeq	Unspecified	Q9NRQ2	PLS4_HUMAN			3	361	-			11			Cytoplasmic (By similarity).		A8K2E9|Q2TTR3|Q658L3|Q6ZR73|Q7Z505	Missense_Mutation	SNP	ENST00000354952.2	37	c.32A>T	CCDS3133.1	.	.	.	.	.	.	.	.	.	.	T	4.660	0.122661	0.08931	.	.	ENSG00000114698	ENST00000354952;ENST00000383083;ENST00000446574;ENST00000493382;ENST00000460350;ENST00000460885;ENST00000476202;ENST00000481701;ENST00000498625	T;T;T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28	4.73	3.49	0.39957	.	0.945625	0.08836	N	0.886535	T	0.30916	0.0780	L	0.44542	1.39	0.09310	N	1	B;B	0.27498	0.18;0.18	B;B	0.24848	0.056;0.035	T	0.16541	-1.0399	10	0.54805	T	0.06	.	7.9981	0.30280	0.0:0.0:0.2075:0.7925	.	11;11	E9PHR9;Q9NRQ2	.;PLS4_HUMAN	L	11	ENSP00000347038:Q11L;ENSP00000372561:Q11L;ENSP00000399315:Q11L;ENSP00000419040:Q11L;ENSP00000417896:Q11L;ENSP00000420385:Q11L;ENSP00000418173:Q11L;ENSP00000418419:Q11L;ENSP00000417248:Q11L	ENSP00000347038:Q11L	Q	-	2	0	PLSCR4	147421378	0.005000	0.15991	0.032000	0.17829	0.061000	0.15899	0.280000	0.18790	2.101000	0.63845	0.519000	0.50382	CAG		0.403	PLSCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355172.1	NM_020353		6	20	0	0	0	0.001984	0	6	20				
ZIC1	7545	broad.mit.edu	37	3	147128206	147128206	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:147128206C>T	ENST00000282928.4	+	1	1036	c.307C>T	c.(307-309)Cgc>Tgc	p.R103C		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	103					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						CTTTCTGTTCCGCAACCGGGG	0.697																																							uc003ewe.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(307-309)CGC>TGC		zinc finger protein of the cerebellum 1							13.0	16.0	15.0					3																	147128206		2062	4236	6298	SO:0001583	missense	7545				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:147128206C>T	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.307C>T	3.37:g.147128206C>T	ENSP00000282928:p.Arg103Cys		Somatic					p.R103C	NM_003412	NP_003403	WXS	Illumina HiSeq	Unspecified	Q15915	ZIC1_HUMAN			1	1026	+			103					Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	37	c.307C>T	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237149	0.58886	.	.	ENSG00000152977	ENST00000282928	D	0.88741	-2.42	4.17	4.17	0.49024	.	0.000000	0.85682	D	0.000000	D	0.93785	0.8013	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.66351	0.943	D	0.94890	0.8047	10	0.87932	D	0	.	16.4617	0.84056	0.0:1.0:0.0:0.0	.	103	Q15915	ZIC1_HUMAN	C	103	ENSP00000282928:R103C	ENSP00000282928:R103C	R	+	1	0	ZIC1	148610896	1.000000	0.71417	1.000000	0.80357	0.601000	0.36947	4.679000	0.61649	1.878000	0.54408	0.542000	0.68232	CGC		0.697	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412		4	28	0	0	0	0.000248	0	4	28				
GPR171	29909	broad.mit.edu	37	3	150917131	150917131	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:150917131C>G	ENST00000309180.5	-	3	273	c.43G>C	c.(43-45)Gag>Cag	p.E15Q	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	NM_013308.3	NP_037440.3	O14626	GP171_HUMAN	G protein-coupled receptor 171	15					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(4)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	15			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTGAATGGCTCCAGATCTTTA	0.348																																							uc003eyq.3		NA																	0					0						c.(43-45)GAG>CAG		G protein-coupled receptor 171							45.0	48.0	47.0					3																	150917131		2203	4300	6503	SO:0001583	missense	29909					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr3:150917131C>G	AF002986	CCDS3155.1	3q25.1	2012-08-21			ENSG00000174946	ENSG00000174946		"""GPCR / Class A : Orphans"""	30057	protein-coding gene	gene with protein product	"""platelet activating receptor homolog"""					9370294	Standard	NM_013308		Approved	H963	uc003eyq.4	O14626	OTTHUMG00000159861	ENST00000309180.5:c.43G>C	3.37:g.150917131C>G	ENSP00000308479:p.Glu15Gln		Somatic				MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	p.E15Q	NM_013308	NP_037440	WXS	Illumina HiSeq	Unspecified	O14626	GP171_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		3	283	-			15			Extracellular (Potential).		D3DNJ4|Q8IV06	Missense_Mutation	SNP	ENST00000309180.5	37	c.43G>C	CCDS3155.1	.	.	.	.	.	.	.	.	.	.	C	7.053	0.564805	0.13498	.	.	ENSG00000174946	ENST00000309180;ENST00000480322	T	0.36699	1.24	5.54	5.54	0.83059	.	0.260464	0.36444	N	0.002598	T	0.30947	0.0781	N	0.08118	0	0.36044	D	0.840323	D	0.63880	0.993	P	0.53954	0.738	T	0.31779	-0.9931	10	0.25751	T	0.34	-15.479	15.0354	0.71741	0.0:0.8584:0.1416:0.0	.	15	O14626	GP171_HUMAN	Q	15	ENSP00000308479:E15Q	ENSP00000308479:E15Q	E	-	1	0	GPR171	152399821	1.000000	0.71417	0.992000	0.48379	0.118000	0.20060	2.167000	0.42415	2.607000	0.88179	0.655000	0.94253	GAG		0.348	GPR171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357793.1	NM_013308		7	31	0	0	0	0.00308	0	7	31				
SI	6476	broad.mit.edu	37	3	164754207	164754207	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:164754207C>A	ENST00000264382.3	-	22	2547	c.2485G>T	c.(2485-2487)Gac>Tac	p.D829Y		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	829	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CAGAAAAAGTCTCCTTTGGCT	0.348										HNSCC(35;0.089)																													uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(2485-2487)GAC>TAC		sucrase-isomaltase	Acarbose(DB00284)						115.0	119.0	118.0					3																	164754207		2203	4300	6503	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164754207C>A	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.2485G>T	3.37:g.164754207C>A	ENSP00000264382:p.Asp829Tyr	HNSCC(35;0.089)	Somatic					p.D829Y	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			22	2547	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	829			Lumenal.|Isomaltase.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.2485G>T	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.012828	0.54468	.	.	ENSG00000090402	ENST00000264382	D	0.89485	-2.52	4.52	4.52	0.55395	.	0.171814	0.50627	D	0.000109	D	0.89350	0.6690	M	0.63428	1.95	0.39591	D	0.969584	D	0.60160	0.987	P	0.49361	0.608	D	0.90965	0.4815	10	0.87932	D	0	.	12.4054	0.55436	0.0:0.8298:0.1702:0.0	.	829	P14410	SUIS_HUMAN	Y	829	ENSP00000264382:D829Y	ENSP00000264382:D829Y	D	-	1	0	SI	166236901	0.999000	0.42202	1.000000	0.80357	0.634000	0.38068	3.096000	0.50243	2.484000	0.83849	0.650000	0.86243	GAC		0.348	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		9	38	1	0	2.80697e-09	0.000978	3.94731e-09	9	38				
WDR49	151790	broad.mit.edu	37	3	167240120	167240120	+	Silent	SNP	T	T	C	rs539214987	byFrequency	TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:167240120T>C	ENST00000308378.3	-	12	2006	c.1701A>G	c.(1699-1701)aaA>aaG	p.K567K	WDR49_ENST00000479765.1_Intron|WDR49_ENST00000453925.2_Silent_p.K532K|WDR49_ENST00000476376.1_Silent_p.K392K	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	567										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						TTGAGTCATCTTTGTTTTTCT	0.318													T|||	2	0.000399361	0.0	0.0	5008	,	,		16911	0.0		0.0	False		,,,				2504	0.002						uc003fev.1		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(1699-1701)AAA>AAG		WD repeat domain 49							101.0	103.0	103.0					3																	167240120		2201	4300	6501	SO:0001819	synonymous_variant	151790							g.chr3:167240120T>C	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.1701A>G	3.37:g.167240120T>C			Somatic				WDR49_uc003feu.1_Silent_p.K392K|WDR49_uc011bpd.1_Silent_p.K532K|WDR49_uc003few.1_Intron	p.K567K	NM_178824	NP_849146	WXS	Illumina HiSeq	Unspecified	Q8IV35	WDR49_HUMAN			12	2007	-			567					Q8N297	Silent	SNP	ENST00000308378.3	37	c.1701A>G	CCDS3201.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.828074	0.00584	.	.	ENSG00000174776	ENST00000472600	T	0.43688	0.94	4.71	2.28	0.28536	.	1.109980	0.06707	N	0.772403	T	0.37679	0.1012	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.38478	-0.9659	7	0.59425	D	0.04	.	4.0965	0.09993	0.18:0.099:0.0:0.721	.	.	.	.	R	544	ENSP00000419130:K544R	ENSP00000419130:K544R	K	-	2	0	WDR49	168722814	0.077000	0.21312	0.023000	0.16930	0.015000	0.08874	1.014000	0.29950	0.255000	0.21593	-0.336000	0.08194	AAG		0.318	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824		3	31	0	0	0	0.000602	0	3	31				
ADIPOQ	9370	broad.mit.edu	37	3	186572221	186572221	+	Missense_Mutation	SNP	C	C	T	rs200546423		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:186572221C>T	ENST00000412955.2	+	3	604	c.463C>T	c.(463-465)Cct>Tct	p.P155S	ADIPOQ_ENST00000444204.2_Missense_Mutation_p.P155S|ADIPOQ-AS1_ENST00000422718.1_RNA|ADIPOQ_ENST00000320741.2_Missense_Mutation_p.P155S			Q15848	ADIPO_HUMAN	adiponectin, C1Q and collagen domain containing	155	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				adiponectin-activated signaling pathway (GO:0033211)|brown fat cell differentiation (GO:0050873)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to insulin stimulus (GO:0032869)|circadian rhythm (GO:0007623)|detection of oxidative stress (GO:0070994)|fatty acid beta-oxidation (GO:0006635)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|low-density lipoprotein particle clearance (GO:0034383)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of hormone secretion (GO:0046888)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular protein transport (GO:0090317)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metanephric mesenchymal cell migration (GO:2000590)|negative regulation of phagocytosis (GO:0050765)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of receptor binding (GO:1900121)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of synaptic transmission (GO:0050805)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|positive regulation of blood pressure (GO:0045777)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of metanephric glomerular visceral epithelial cell development (GO:2000478)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myeloid cell apoptotic process (GO:0033034)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal albumin absorption (GO:2000534)|positive regulation of signal transduction (GO:0009967)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|regulation of glucose metabolic process (GO:0010906)|response to activity (GO:0014823)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to linoleic acid (GO:0070543)|response to nutrient (GO:0007584)|response to sucrose (GO:0009744)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|sialic acid binding (GO:0033691)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(2)	16	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		CTGCAACATTCCTGGGCTGTA	0.443																																							uc003fra.2		NA																	0				ovary(1)	1						c.(463-465)CCT>TCT		adiponectin precursor							188.0	166.0	173.0					3																	186572221		2203	4300	6503	SO:0001583	missense	9370				brown fat cell differentiation|cellular response to drug|cellular response to insulin stimulus|detection of oxidative stress|fatty acid beta-oxidation|generation of precursor metabolites and energy|glucose homeostasis|glucose metabolic process|low-density lipoprotein particle clearance|negative regulation of blood pressure|negative regulation of DNA biosynthetic process|negative regulation of ERK1 and ERK2 cascade|negative regulation of eukaryotic cell surface binding|negative regulation of fat cell differentiation|negative regulation of gluconeogenesis|negative regulation of granulocyte differentiation|negative regulation of heterotypic cell-cell adhesion|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of intracellular protein transport|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|negative regulation of macrophage differentiation|negative regulation of MAP kinase activity|negative regulation of phagocytosis|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein autophosphorylation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of synaptic transmission|negative regulation of transcription, DNA-dependent|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|positive regulation of cAMP-dependent protein kinase activity|positive regulation of cholesterol efflux|positive regulation of fatty acid metabolic process|positive regulation of glucose import|positive regulation of glycogen (starch) synthase activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of metanephric glomerular visceral epithelial cell development|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myeloid cell apoptosis|positive regulation of protein kinase A signaling cascade|positive regulation of renal albumin absorption|protein homooligomerization|protein localization in plasma membrane|response to glucose stimulus|response to tumor necrosis factor	collagen|endoplasmic reticulum|extracellular space	cytokine activity|eukaryotic cell surface binding|hormone activity|protein homodimerization activity	g.chr3:186572221C>T	D45371	CCDS3284.1	3q27	2013-02-26	2005-01-24	2005-01-27	ENSG00000181092	ENSG00000181092		"""Endogenous ligands"""	13633	protein-coding gene	gene with protein product	"""adipose most abundant gene transcript 1"", ""adiponectin precursor"""	605441	"""adipocyte, C1Q and collagen domain containing"""	ACDC		7592907, 8631877	Standard	NM_001177800		Approved	ACRP30, AdipoQ, apM1, GBP28, adiponectin	uc003fra.3	Q15848	OTTHUMG00000156521	ENST00000412955.2:c.463C>T	3.37:g.186572221C>T	ENSP00000405611:p.Pro155Ser		Somatic				ADIPOQ_uc010hyy.2_Missense_Mutation_p.P155S	p.P155S	NM_004797	NP_004788	WXS	Illumina HiSeq	Unspecified	Q15848	ADIPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)	3	547	+	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		155			C1q.		Q58EX9	Missense_Mutation	SNP	ENST00000412955.2	37	c.463C>T	CCDS3284.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721646	0.68959	.	.	ENSG00000181092	ENST00000412955;ENST00000320741;ENST00000444204	T;T;T	0.39406	1.08;1.08;1.08	5.25	5.25	0.73442	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.141108	0.47852	D	0.000220	T	0.63896	0.2550	M	0.80332	2.49	0.49915	D	0.999835	D	0.89917	1.0	D	0.72338	0.977	T	0.66496	-0.5909	10	0.56958	D	0.05	.	11.7557	0.51874	0.176:0.824:0.0:0.0	.	155	Q15848	ADIPO_HUMAN	S	155	ENSP00000405611:P155S;ENSP00000320709:P155S;ENSP00000389814:P155S	ENSP00000320709:P155S	P	+	1	0	ADIPOQ	188054915	0.705000	0.27846	1.000000	0.80357	0.996000	0.88848	1.519000	0.35888	2.631000	0.89168	0.561000	0.74099	CCT		0.443	ADIPOQ-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344490.2	NM_004797		8	66	0	0	0	0.008291	0	8	66				
SLIT2	9353	broad.mit.edu	37	4	20469408	20469408	+	Silent	SNP	A	A	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:20469408A>T	ENST00000504154.1	+	5	681	c.429A>T	c.(427-429)ccA>ccT	p.P143P	SLIT2_ENST00000503837.1_Silent_p.P143P|SLIT2_ENST00000273739.5_Silent_p.P143P|SLIT2_ENST00000503823.1_Silent_p.P143P	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	143					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AGGCAATCCCAAGGAAAGCTT	0.274																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(427-429)CCA>CCT		slit homolog 2 precursor							33.0	36.0	35.0					4																	20469408		2203	4300	6503	SO:0001819	synonymous_variant	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20469408A>T	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.429A>T	4.37:g.20469408A>T			Somatic				SLIT2_uc003gps.1_Silent_p.P143P	p.P143P	NM_004787	NP_004778	WXS	Illumina HiSeq	Unspecified	O94813	SLIT2_HUMAN			5	633	+			143			LRR 4.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	c.429A>T	CCDS3426.1																																																																																				0.274	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			5	21	0	0	0	0.001168	0	5	21				
AASDH	132949	broad.mit.edu	37	4	57215650	57215650	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:57215650T>A	ENST00000205214.6	-	11	2447	c.2267A>T	c.(2266-2268)cAt>cTt	p.H756L	AASDH_ENST00000513376.1_Missense_Mutation_p.H656L|AASDH_ENST00000434343.2_Missense_Mutation_p.H271L|AASDH_ENST00000502617.1_Missense_Mutation_p.H756L|AASDH_ENST00000602986.1_Missense_Mutation_p.H603L|AASDH_ENST00000451613.1_Missense_Mutation_p.H756L	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	756					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				CCACCTCACATGTAACTCCAT	0.433																																							uc003hbn.2		NA																	0				ovary(4)	4						c.(2266-2268)CAT>CTT		aminoadipate-semialdehyde dehydrogenase							148.0	137.0	141.0					4																	57215650		2203	4300	6503	SO:0001583	missense	132949				fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding	g.chr4:57215650T>A	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.2267A>T	4.37:g.57215650T>A	ENSP00000205214:p.His756Leu		Somatic				AASDH_uc010ihb.2_Missense_Mutation_p.H271L|AASDH_uc011caa.1_Missense_Mutation_p.H603L|AASDH_uc003hbo.2_Missense_Mutation_p.H656L|AASDH_uc011cab.1_Missense_Mutation_p.H271L|AASDH_uc010ihc.2_Missense_Mutation_p.H756L|AASDH_uc003hbp.2_Missense_Mutation_p.H756L	p.H756L	NM_181806	NP_861522	WXS	Illumina HiSeq	Unspecified	Q4L235	ACSF4_HUMAN			11	2420	-	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)	756					A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	ENST00000205214.6	37	c.2267A>T	CCDS3504.1	.	.	.	.	.	.	.	.	.	.	T	0.189	-1.054628	0.01965	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000434343;ENST00000451613;ENST00000503808;ENST00000502617	T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46	6.05	-1.73	0.08081	Quinonprotein alcohol dehydrogenase-like (2);	0.703019	0.15694	N	0.249295	T	0.31857	0.0810	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.26935	0.164;0.029;0.029;0.036	B;B;B;B	0.24006	0.047;0.033;0.033;0.05	T	0.09729	-1.0661	10	0.39692	T	0.17	0.265	7.5727	0.27918	0.0:0.3807:0.1178:0.5015	.	603;756;756;756	E9PH98;Q4L235-4;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	L	756;656;271;756;603;756	ENSP00000205214:H756L;ENSP00000423760:H656L;ENSP00000392158:H271L;ENSP00000409656:H756L;ENSP00000421171:H756L	ENSP00000205214:H756L	H	-	2	0	AASDH	56910407	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.318000	0.19504	-0.794000	0.04468	-0.417000	0.06048	CAT		0.433	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806		14	81	0	0	0	0.003163	0	14	81				
EPHA5	2044	broad.mit.edu	37	4	66242723	66242724	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:66242723_66242724GG>CT	ENST00000273854.3	-	9	2448_2449	c.1848_1849CC>AG	c.(1846-1851)agCCta>agAGta	p.616_617SL>RV	EPHA5_ENST00000354839.4_Intron|EPHA5_ENST00000511294.1_Missense_Mutation_p.617_618SL>RV|EPHA5_ENST00000432638.2_Missense_Mutation_p.453_454SL>RV	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	616				S -> I (in Ref. 1; CAA64700). {ECO:0000305}.	axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AACCATATTAGGCTTGGATGGG	0.47										TSP Lung(17;0.13)																													uc003hcy.2		NA																	0				lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(1846-1851)AGCCTA>AGAGTA		ephrin receptor EphA5 isoform a precursor																																				SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66242723_66242724GG>CT	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1848_1849delinsCT	4.37:g.66242723_66242724delinsCT	ENSP00000273854:p.S616_L617delinsRV	TSP Lung(17;0.13)	Somatic				EPHA5_uc003hcx.2_Missense_Mutation_p.548_549SL>RV|EPHA5_uc003hcz.2_Intron|EPHA5_uc011cah.1_Missense_Mutation_p.617_618SL>RV|EPHA5_uc011cai.1_Intron|EPHA5_uc003hda.2_Missense_Mutation_p.617_618SL>RV	p.616_617SL>RV	NM_004439	NP_004430	WXS	Illumina HiSeq	Unspecified	P54756	EPHA5_HUMAN			9	2041_2042	-			616_617			Cytoplasmic (Potential).		Q7Z3F2	Missense_Mutation	DNP	ENST00000273854.3	37	c.1848_1849CC>AG	CCDS3513.1																																																																																				0.470	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		3	23	0	0	0	0.004672	0	3	23				
ARHGAP24	83478	broad.mit.edu	37	4	86491764	86491764	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:86491764G>T	ENST00000395184.1	+	2	536	c.70G>T	c.(70-72)Ggg>Tgg	p.G24W	ARHGAP24_ENST00000503995.1_Missense_Mutation_p.G24W|ARHGAP24_ENST00000506421.1_3'UTR	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	24	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		CATCAAGTGTGGGTGGCTGAG	0.488																																							uc003hpk.2		NA																	0					0						c.(70-72)GGG>TGG		Rho GTPase activating protein 24 isoform 1							106.0	89.0	94.0					4																	86491764		2203	4300	6503	SO:0001583	missense	83478				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding	g.chr4:86491764G>T	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.70G>T	4.37:g.86491764G>T	ENSP00000378611:p.Gly24Trp		Somatic				ARHGAP24_uc003hpi.1_Missense_Mutation_p.G24W|ARHGAP24_uc003hpj.2_Missense_Mutation_p.G24W	p.G24W	NM_001025616	NP_001020787	WXS	Illumina HiSeq	Unspecified	Q8N264	RHG24_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000571)	2	519	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	24			PH.		Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	37	c.70G>T	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	G	32	5.140523	0.94560	.	.	ENSG00000138639	ENST00000395184;ENST00000503995	T;T	0.74209	-0.82;-0.82	5.81	5.81	0.92471	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.93093	0.7801	H	0.99535	4.615	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95671	0.8723	10	0.87932	D	0	.	19.6776	0.95943	0.0:0.0:1.0:0.0	.	24;24;169	Q8N264;Q8N264-4;Q8N264-5	RHG24_HUMAN;.;.	W	24	ENSP00000378611:G24W;ENSP00000423206:G24W	ENSP00000378611:G24W	G	+	1	0	ARHGAP24	86710788	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.795000	0.99099	2.746000	0.94184	0.655000	0.94253	GGG		0.488	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305		7	44	1	0	0.00307968	0.00308	0.00346464	7	44				
HSP90AB3P	3327	broad.mit.edu	37	4	88815044	88815044	+	IGR	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:88815044C>A								MEPE (47075 upstream) : SPP1 (81774 downstream)																							ACCACATGATCAAGCTAGGTC	0.527																																							uc010iko.1		NA																	0					NA						c.(1669-1671)ATC>ATA		SubName: Full=Heat shock protein 90kDa alpha (Cytosolic), class B member 1, isoform CRA_a; SubName: Full=cDNA, FLJ92550, Homo sapiens heat shock 90kDa protein 1, beta (HSPCB), mRNA;																																				SO:0001628	intergenic_variant	0							g.chr4:88815044C>A																													4.37:g.88815044C>A			Somatic					p.I557I			WXS	Illumina HiSeq	Unspecified					4	1671	+									Silent	SNP		37	c.1671C>A																																																																																				0	0.527									40	160	1	0	1.22674e-20	0.00874	2.04457e-20	40	160				
KIAA1109	84162	broad.mit.edu	37	4	123175486	123175486	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:123175486C>G	ENST00000264501.4	+	38	6432	c.6059C>G	c.(6058-6060)aCa>aGa	p.T2020R	KIAA1109_ENST00000455637.1_Missense_Mutation_p.T2020R|KIAA1109_ENST00000388738.3_Missense_Mutation_p.T2020R			Q2LD37	K1109_HUMAN	KIAA1109	2020					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGATCTCACACACATGCATTT	0.323																																							uc003ieh.2		NA																	0				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(6058-6060)ACA>AGA		fragile site-associated protein							89.0	80.0	82.0					4																	123175486		1822	4080	5902	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123175486C>G	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.6059C>G	4.37:g.123175486C>G	ENSP00000264501:p.Thr2020Arg		Somatic				KIAA1109_uc003iel.1_5'Flank|KIAA1109_uc003iek.2_Missense_Mutation_p.T639R	p.T2020R	NM_015312	NP_056127	WXS	Illumina HiSeq	Unspecified	Q2LD37	K1109_HUMAN			36	6104	+			2020					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.6059C>G	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.558|8.558	0.877106|0.877106	0.17395|0.17395	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000446180|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.21734	.|2.57;2.57;1.99	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.468690	.|0.16342	.|U	.|0.218640	T|T	0.18800|0.18800	0.0451|0.0451	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B	.|0.21905	.|0.062;0.01	.|B;B	.|0.28139	.|0.086;0.039	T|T	0.29212|0.29212	-1.0019|-1.0019	5|10	.|0.62326	.|D	.|0.03	.|.	19.6126|19.6126	0.95616|0.95616	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2019;2020	.|Q2LD37-2;Q2LD37	.|.;K1109_HUMAN	D|R	593|2020	.|ENSP00000264501:T2020R;ENSP00000373390:T2020R;ENSP00000389925:T2020R	.|ENSP00000264501:T2020R	H|T	+|+	1|2	0|0	KIAA1109|KIAA1109	123394936|123394936	0.749000|0.749000	0.28305|0.28305	0.050000|0.050000	0.19076|0.19076	0.361000|0.361000	0.29550|0.29550	5.716000|5.716000	0.68437|0.68437	2.630000|2.630000	0.89119|0.89119	0.591000|0.591000	0.81541|0.81541	CAC|ACA		0.323	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		8	34	0	0	0	0.006214	0	8	34				
ADAD1	132612	broad.mit.edu	37	4	123329128	123329128	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:123329128G>T	ENST00000296513.2	+	8	975	c.790G>T	c.(790-792)Gat>Tat	p.D264Y	ADAD1_ENST00000388725.2_Missense_Mutation_p.D246Y|ADAD1_ENST00000388724.2_Missense_Mutation_p.D264Y	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	264	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						CATTAAGCCAGATGGAAGAGT	0.378																																							uc003ieo.2		NA																	0					0						c.(790-792)GAT>TAT		adenosine deaminase domain containing 1							119.0	109.0	113.0					4																	123329128		2203	4300	6503	SO:0001583	missense	132612				multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding	g.chr4:123329128G>T	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.790G>T	4.37:g.123329128G>T	ENSP00000296513:p.Asp264Tyr		Somatic				ADAD1_uc003iep.2_Missense_Mutation_p.D264Y|ADAD1_uc003ieq.2_Missense_Mutation_p.D246Y	p.D264Y	NM_139243	NP_640336	WXS	Illumina HiSeq	Unspecified	Q96M93	ADAD1_HUMAN			8	1022	+			264			A to I editase.		A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	ENST00000296513.2	37	c.790G>T	CCDS34058.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.386651	0.61956	.	.	ENSG00000164113	ENST00000296513;ENST00000388724;ENST00000388725	D;D;D	0.93859	-3.3;-3.3;-3.3	5.83	-0.688	0.11317	Adenosine deaminase/editase (3);	0.514138	0.21783	N	0.069166	D	0.90752	0.7097	M	0.68317	2.08	0.25129	N	0.990585	B;P	0.39480	0.435;0.675	B;B	0.41571	0.248;0.36	D	0.84599	0.0671	10	0.66056	D	0.02	-10.7264	7.8367	0.29374	0.2408:0.0:0.6038:0.1555	.	264;264	Q96M93-2;Q96M93	.;ADAD1_HUMAN	Y	264;264;246	ENSP00000296513:D264Y;ENSP00000373376:D264Y;ENSP00000373377:D246Y	ENSP00000296513:D264Y	D	+	1	0	ADAD1	123548578	0.074000	0.21230	0.990000	0.47175	0.967000	0.64934	0.438000	0.21559	-0.071000	0.12886	-0.294000	0.09567	GAT		0.378	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243		12	65	1	0	9.31168e-06	0.001855	1.17327e-05	12	65				
PCDH10	57575	broad.mit.edu	37	4	134073431	134073431	+	Silent	SNP	A	A	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:134073431A>G	ENST00000264360.5	+	1	2962	c.2136A>G	c.(2134-2136)ctA>ctG	p.L712L		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	712					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		AAACCTCGCTAGACCTCACCC	0.662																																							uc003iha.2		NA																	0				ovary(2)	2						c.(2134-2136)CTA>CTG		protocadherin 10 isoform 1 precursor							84.0	98.0	93.0					4																	134073431		2203	4300	6503	SO:0001819	synonymous_variant	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134073431A>G	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2136A>G	4.37:g.134073431A>G			Somatic				PCDH10_uc003igz.2_Silent_p.L712L	p.L712L	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	2962	+			712			Extracellular (Potential).		Q4W5F6|Q96SF0	Silent	SNP	ENST00000264360.5	37	c.2136A>G	CCDS34063.1																																																																																				0.662	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		10	64	0	0	0	0.001368	0	10	64				
NPY2R	4887	broad.mit.edu	37	4	156135716	156135716	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:156135716G>T	ENST00000329476.3	+	2	1114	c.625G>T	c.(625-627)Ggc>Tgc	p.G209C	NPY2R_ENST00000506608.1_Missense_Mutation_p.G209C	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	209				G -> A (in Ref. 4; AAB07760). {ECO:0000305}.	adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	AAAGTGGCCTGGCGAGGAGAA	0.488																																							uc003ioq.2		NA																	0				lung(2)|skin(1)	3						c.(625-627)GGC>TGC		neuropeptide Y receptor Y2							121.0	123.0	123.0					4																	156135716		2203	4300	6503	SO:0001583	missense	4887				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity	g.chr4:156135716G>T	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.625G>T	4.37:g.156135716G>T	ENSP00000332591:p.Gly209Cys		Somatic				NPY2R_uc003ior.2_Missense_Mutation_p.G209C	p.G209C	NM_000910	NP_000901	WXS	Illumina HiSeq	Unspecified	P49146	NPY2R_HUMAN			2	1120	+	all_hematologic(180;0.24)	Renal(120;0.0854)	209	G -> A (in Ref. 4; AAB07760).		Extracellular (Potential).		Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	37	c.625G>T	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	G	17.52	3.409621	0.62399	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.37411	1.2;1.2	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.157768	0.44285	D	0.000474	T	0.53384	0.1793	L	0.60012	1.86	0.45118	D	0.99813	D	0.63880	0.993	P	0.57204	0.815	T	0.51880	-0.8649	10	0.59425	D	0.04	.	18.9139	0.92496	0.0:0.0:1.0:0.0	.	209	P49146	NPY2R_HUMAN	C	209	ENSP00000332591:G209C;ENSP00000426366:G209C	ENSP00000332591:G209C	G	+	1	0	NPY2R	156355166	0.997000	0.39634	0.383000	0.26132	0.616000	0.37450	4.267000	0.58877	2.709000	0.92574	0.643000	0.83706	GGC		0.488	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910		25	110	1	0	2.08457e-15	0.002096	3.28319e-15	25	110				
MARCH1	55016	broad.mit.edu	37	4	165118535	165118535	+	Intron	SNP	T	T	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr4:165118535T>G	ENST00000503008.1	-	2	864				MARCH1_ENST00000508725.1_Intron|MARCH1_ENST00000514618.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GCTCTTGAGGTTTTCTAACTG	0.423																																							uc011cjk.1		NA																	0					0						c.(328-330)AAC>ACC		acidic nuclear phosphoprotein 32C							153.0	156.0	155.0					4																	165118535		2203	4300	6503	SO:0001627	intron_variant	23520							g.chr4:165118535T>G	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-85721A>C	4.37:g.165118535T>G			Somatic				MARCH1_uc003iqs.1_Intron	p.N110T	NM_012403	NP_036535	WXS	Illumina HiSeq	Unspecified	O43423	AN32C_HUMAN		KIRC - Kidney renal clear cell carcinoma(143;0.242)	1	329	-	all_hematologic(180;0.203)	Prostate(90;0.0138)|Melanoma(52;0.18)|all_neural(102;0.223)	110					D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	c.329A>C	CCDS54814.1																																																																																				0.423	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923		18	60	0	0	0	0.008871	0	18	60				
MED10	84246	broad.mit.edu	37	5	6374488	6374488	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:6374488C>A	ENST00000255764.3	-	3	368	c.258G>T	c.(256-258)gaG>gaT	p.E86D		NM_032286.2	NP_115662.2	Q9BTT4	MED10_HUMAN	mediator complex subunit 10	86					gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)			kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|urinary_tract(1)	5						CTAGAGCCCTCTCCAGGCACT	0.423																																							uc003jdo.2		NA																	0				ovary(1)	1						c.(256-258)GAG>GAT		mediator complex subunit 10							197.0	190.0	192.0					5																	6374488		2203	4300	6503	SO:0001583	missense	84246				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		g.chr5:6374488C>A		CCDS34134.1	5p15.31	2008-02-05	2007-07-30		ENSG00000133398	ENSG00000133398			28760	protein-coding gene	gene with protein product	"""NUT2 homolog (S. cerevisiae)"""	612382	"""mediator of RNA polymerase II transcription, subunit 10 homolog (NUT2, S. cerevisiae)"""			15657623, 15175163	Standard	NM_032286		Approved	TRG20, L6, MGC5309, NUT2	uc003jdo.3	Q9BTT4	OTTHUMG00000161682	ENST00000255764.3:c.258G>T	5.37:g.6374488C>A	ENSP00000255764:p.Glu86Asp		Somatic					p.E86D	NM_032286	NP_115662	WXS	Illumina HiSeq	Unspecified	Q9BTT4	MED10_HUMAN			3	301	-			86					C6G491	Missense_Mutation	SNP	ENST00000255764.3	37	c.258G>T	CCDS34134.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688284	0.68271	.	.	ENSG00000133398	ENST00000255764	.	.	.	6.07	3.34	0.38264	.	0.000000	0.85682	D	0.000000	T	0.67692	0.2920	L	0.58354	1.805	0.80722	D	1	D	0.63046	0.992	D	0.74348	0.983	T	0.63292	-0.6670	9	0.38643	T	0.18	-39.798	9.0929	0.36621	0.0:0.7208:0.0:0.2792	.	86	Q9BTT4	MED10_HUMAN	D	86	.	ENSP00000255764:E86D	E	-	3	2	MED10	6427488	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.897000	0.28390	0.446000	0.26666	0.655000	0.94253	GAG		0.423	MED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365714.1	NM_032286		60	72	1	0	2.84776e-26	0.00361	4.84888e-26	60	72				
PRDM9	56979	broad.mit.edu	37	5	23522423	23522423	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:23522423G>A	ENST00000296682.3	+	7	701	c.519G>A	c.(517-519)aaG>aaA	p.K173K		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	173					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AACTCAGGAAGAAGGAGACTG	0.428										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(517-519)AAG>AAA		PR domain containing 9							138.0	141.0	140.0					5																	23522423		1898	4136	6034	SO:0001819	synonymous_variant	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23522423G>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.519G>A	5.37:g.23522423G>A		HNSCC(3;0.000094)	Somatic					p.K173K	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			7	701	+			173					B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	c.519G>A	CCDS43307.1																																																																																				0.428	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		39	80	0	0	0	0.003214	0	39	80				
CDH6	1004	broad.mit.edu	37	5	31267710	31267710	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:31267710A>C	ENST00000265071.2	+	2	395	c.130A>C	c.(130-132)Agc>Cgc	p.S44R	CDH6_ENST00000514738.1_5'UTR|RP11-152K4.2_ENST00000523584.1_RNA	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	44					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CTCTGGAAACAGCAAAAATGA	0.488																																							uc003jhe.1		NA																	0				ovary(4)|skin(2)|large_intestine(1)	7						c.(130-132)AGC>CGC		cadherin 6, type 2 preproprotein							107.0	114.0	112.0					5																	31267710		2203	4300	6503	SO:0001583	missense	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31267710A>C	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.130A>C	5.37:g.31267710A>C	ENSP00000265071:p.Ser44Arg		Somatic				CDH6_uc003jhd.1_Missense_Mutation_p.S44R	p.S44R	NM_004932	NP_004923	WXS	Illumina HiSeq	Unspecified	P55285	CADH6_HUMAN			2	456	+			44					A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	37	c.130A>C	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	A	14.24	2.475340	0.43942	.	.	ENSG00000113361	ENST00000265071	T	0.57595	0.39	5.8	4.57	0.56435	.	0.180445	0.64402	D	0.000008	T	0.39784	0.1091	L	0.31420	0.93	0.35654	D	0.812025	B;B	0.30146	0.177;0.27	B;B	0.29598	0.104;0.091	T	0.50406	-0.8832	10	0.32370	T	0.25	.	12.6728	0.56876	0.8624:0.1376:0.0:0.0	.	44;44	P55285;P55285-2	CADH6_HUMAN;.	R	44	ENSP00000265071:S44R	ENSP00000265071:S44R	S	+	1	0	CDH6	31303467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.109000	0.41863	2.219000	0.72066	0.533000	0.62120	AGC		0.488	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		29	36	0	0	0	0.002096	0	29	36				
PAIP1	10605	broad.mit.edu	37	5	43535667	43535667	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:43535667C>G	ENST00000306846.3	-	7	1280	c.1048G>C	c.(1048-1050)Gaa>Caa	p.E350Q	PAIP1_ENST00000436644.2_Missense_Mutation_p.E271Q|PAIP1_ENST00000514514.1_Missense_Mutation_p.E271Q|PAIP1_ENST00000338972.4_Missense_Mutation_p.E238Q	NM_006451.4|NM_182789.3	NP_006442.2|NP_877590.1	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	350	MIF4G.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	RNA binding (GO:0003723)|translation activator activity (GO:0008494)			endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Lung NSC(6;2.07e-05)					ACAACGTTTTCAATTCTCTGA	0.348																																							uc003job.2		NA																	0				ovary(1)	1						c.(1048-1050)GAA>CAA		poly(A) binding protein interacting protein 1							122.0	117.0	119.0					5																	43535667		2202	4299	6501	SO:0001583	missense	10605				mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity	g.chr5:43535667C>G	AF013758	CCDS3947.1, CCDS3948.1, CCDS47204.1	5p12	2008-02-05			ENSG00000172239	ENSG00000172239			16945	protein-coding gene	gene with protein product		605184				9548260, 11230166	Standard	NM_006451		Approved		uc003job.3	Q9H074	OTTHUMG00000096960	ENST00000306846.3:c.1048G>C	5.37:g.43535667C>G	ENSP00000302768:p.Glu350Gln		Somatic				PAIP1_uc003joa.2_Missense_Mutation_p.E271Q|PAIP1_uc010ivp.2_Missense_Mutation_p.E271Q|PAIP1_uc010ivo.2_RNA|PAIP1_uc003joc.2_Missense_Mutation_p.E238Q	p.E350Q	NM_006451	NP_006442	WXS	Illumina HiSeq	Unspecified	Q9H074	PAIP1_HUMAN			7	1295	-	Lung NSC(6;2.07e-05)		350			MIF4G.		A6NKV8|O60455|Q96B61|Q9BS63	Missense_Mutation	SNP	ENST00000306846.3	37	c.1048G>C	CCDS3947.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097284	0.76870	.	.	ENSG00000172239	ENST00000306846;ENST00000436644;ENST00000338972;ENST00000514514	T;T;T;T	0.19938	2.11;2.11;2.11;2.11	5.68	5.68	0.88126	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	L	0.43757	1.38	0.58432	D	0.999998	P;P;P	0.46912	0.875;0.886;0.848	B;B;B	0.42995	0.364;0.404;0.133	T	0.00692	-1.1607	10	0.35671	T	0.21	-15.1232	17.5749	0.87946	0.0:1.0:0.0:0.0	.	271;350;271	D6REB4;Q9H074;Q9H074-2	.;PAIP1_HUMAN;.	Q	350;271;238;271	ENSP00000302768:E350Q;ENSP00000387729:E271Q;ENSP00000339622:E238Q;ENSP00000425084:E271Q	ENSP00000302768:E350Q	E	-	1	0	PAIP1	43571424	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.087000	0.71362	2.674000	0.91012	0.650000	0.86243	GAA		0.348	PAIP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214024.1	NM_006451		11	18	0	0	0	0.001855	0	11	18				
SKIV2L2	23517	broad.mit.edu	37	5	54649077	54649077	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:54649077G>T	ENST00000230640.5	+	14	1767	c.1513G>T	c.(1513-1515)Gat>Tat	p.D505Y	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.D404Y	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	505	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				CCGCAAATTTGATGGGAAGGA	0.338																																					Melanoma(2;92 134 23744 29976 33782)	Melanoma(2;92 134 23744 29976 33782)	uc003jpy.3		NA																	0				ovary(1)|skin(1)	2						c.(1513-1515)GAT>TAT		superkiller viralicidic activity 2-like 2							81.0	87.0	85.0					5																	54649077		2203	4300	6503	SO:0001583	missense	23517				maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr5:54649077G>T	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1513G>T	5.37:g.54649077G>T	ENSP00000230640:p.Asp505Tyr		Somatic				SKIV2L2_uc011cqi.1_Missense_Mutation_p.D404Y	p.D505Y	NM_015360	NP_056175	WXS	Illumina HiSeq	Unspecified	P42285	SK2L2_HUMAN			14	1779	+		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)	505			Helicase C-terminal.		Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	37	c.1513G>T	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	G	31	5.072700	0.93950	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.72615	-0.67;-0.67	6.16	6.16	0.99307	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.88254	0.6387	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88941	0.3380	10	0.87932	D	0	-12.2081	20.8598	0.99761	0.0:0.0:1.0:0.0	.	404;505	F5H7E2;P42285	.;SK2L2_HUMAN	Y	505;404	ENSP00000230640:D505Y;ENSP00000442583:D404Y	ENSP00000230640:D505Y	D	+	1	0	SKIV2L2	54684834	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.489000	0.97949	2.937000	0.99478	0.650000	0.86243	GAT		0.338	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1			22	42	1	0	6.44725e-10	0.002299	9.1071e-10	22	42				
IL13	3596	broad.mit.edu	37	5	131995902	131995902	+	Silent	SNP	C	C	A	rs78628956		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:131995902C>A	ENST00000304506.3	+	4	383	c.369C>A	c.(367-369)atC>atA	p.I123I	IL13_ENST00000468334.1_3'UTR|AC004041.2_ENST00000435042.1_RNA	NM_002188.2	NP_002179.2	P35225	IL13_HUMAN	interleukin 13	123					cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|cellular response to cytokine stimulus (GO:0071345)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of lung ciliated cell differentiation (GO:1901247)|negative regulation of transforming growth factor beta production (GO:0071635)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of connective tissue growth factor production (GO:0032723)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of lung goblet cell differentiation (GO:1901251)|positive regulation of macrophage activation (GO:0043032)|positive regulation of pancreatic stellate cell proliferation (GO:2000231)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat6 protein (GO:0042526)|regulation of proton transport (GO:0010155)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			large_intestine(1)|lung(1)|ovary(1)|skin(3)	6		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACACCAAAATCGAGGTGGCCC	0.483																																							uc003kxj.1		NA																	0				ovary(1)|skin(1)	2						c.(367-369)ATC>ATA		interleukin 13 precursor							90.0	83.0	85.0					5																	131995902		2203	4300	6503	SO:0001819	synonymous_variant	3596				cellular component movement|immune response|inflammatory response|signal transduction	extracellular space|soluble fraction	cytokine activity	g.chr5:131995902C>A	U31120	CCDS4157.1	5q31	2011-07-14			ENSG00000169194	ENSG00000169194		"""Interleukins and interleukin receptors"""	5973	protein-coding gene	gene with protein product	"""allergic rhinitis"", ""Bronchial hyperresponsiveness-1 (bronchial asthma)"""	147683					Standard	NM_002188		Approved	P600, IL-13, ALRH, BHR1, MGC116786, MGC116788, MGC116789	uc003kxj.1	P35225	OTTHUMG00000059723	ENST00000304506.3:c.369C>A	5.37:g.131995902C>A			Somatic					p.I123I	NM_002188	NP_002179	WXS	Illumina HiSeq	Unspecified	P35225	IL13_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		4	383	+		all_cancers(142;0.0751)|Breast(839;0.198)	123					O43644|Q4VB52|Q9UDC7	Silent	SNP	ENST00000304506.3	37	c.369C>A	CCDS4157.1																																																																																				0.483	IL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132782.1	NM_002188		3	37	1	0	0.004672	0.004672	0.00518197	3	37				
SPOCK1	6695	broad.mit.edu	37	5	136324183	136324183	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:136324183T>A	ENST00000394945.1	-	8	1025	c.856A>T	c.(856-858)Aac>Tac	p.N286Y	SPOCK1_ENST00000282223.7_Missense_Mutation_p.N286Y|SPOCK1_ENST00000509978.1_5'UTR	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	286					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCACACGAGTTGAAAAGAGGC	0.498																																							uc003lbo.2		NA																	0				ovary(1)	1						c.(856-858)AAC>TAC		sparc/osteonectin, cwcv and kazal-like domains							174.0	167.0	169.0					5																	136324183		2203	4300	6503	SO:0001583	missense	6695				cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding	g.chr5:136324183T>A	AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.856A>T	5.37:g.136324183T>A	ENSP00000378401:p.Asn286Tyr		Somatic				SPOCK1_uc003lbp.2_Missense_Mutation_p.N286Y	p.N286Y	NM_004598	NP_004589	WXS	Illumina HiSeq	Unspecified	Q08629	TICN1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		7	1047	-			286					B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	ENST00000394945.1	37	c.856A>T	CCDS4191.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.441037	0.83993	.	.	ENSG00000152377	ENST00000394945;ENST00000282223	T;T	0.63255	-0.03;-0.03	6.06	6.06	0.98353	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.80539	0.4642	M	0.80183	2.485	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.83078	-0.0139	10	0.87932	D	0	.	15.7966	0.78416	0.0:0.0:0.0:1.0	.	286	Q08629	TICN1_HUMAN	Y	286	ENSP00000378401:N286Y;ENSP00000282223:N286Y	ENSP00000282223:N286Y	N	-	1	0	SPOCK1	136352082	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.286000	0.72665	2.315000	0.78130	0.533000	0.62120	AAC		0.498	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1	NM_004598		6	93	0	0	0	0.001984	0	6	93				
TMCO6	55374	broad.mit.edu	37	5	140023455	140023455	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:140023455C>A	ENST00000394671.3	+	9	1110	c.1009C>A	c.(1009-1011)Cgt>Agt	p.R337S	TMCO6_ENST00000252100.6_Missense_Mutation_p.R343S|TMCO6_ENST00000537378.1_Missense_Mutation_p.R97S|NDUFA2_ENST00000510680.1_Intron	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	337					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGAGATGAGCGTGTTGTGGC	0.537																																							uc003lgl.2		NA																	0					0						c.(1009-1011)CGT>AGT		transmembrane and coiled-coil domains 6							92.0	104.0	100.0					5																	140023455		2102	4247	6349	SO:0001583	missense	55374				protein import into nucleus	cytoplasm|nuclear pore	binding|protein transporter activity	g.chr5:140023455C>A	BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.1009C>A	5.37:g.140023455C>A	ENSP00000378166:p.Arg337Ser		Somatic				TMCO6_uc003lgm.2_Missense_Mutation_p.R343S|TMCO6_uc010jft.2_Missense_Mutation_p.R97S|TMCO6_uc003lgn.2_Missense_Mutation_p.R228S|TMCO6_uc003lgo.2_Missense_Mutation_p.R97S	p.R337S	NM_018502	NP_060972	WXS	Illumina HiSeq	Unspecified	Q96DC7	TMCO6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		9	1110	+			337					Q9BUU0|Q9P198	Missense_Mutation	SNP	ENST00000394671.3	37	c.1009C>A	CCDS4233.2	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619819	0.66787	.	.	ENSG00000113119	ENST00000394671;ENST00000537378;ENST00000252100	T;T;T	0.46819	1.59;0.86;1.59	5.52	4.6	0.57074	Armadillo-like helical (1);Armadillo-type fold (1);	0.057581	0.64402	D	0.000002	T	0.57770	0.2076	L	0.36672	1.1	0.54753	D	0.999988	D;D	0.76494	0.999;0.999	D;D	0.70487	0.969;0.969	T	0.59679	-0.7409	10	0.62326	D	0.03	-9.7797	14.7846	0.69793	0.145:0.855:0.0:0.0	.	343;337	Q96DC7-2;Q96DC7	.;TMCO6_HUMAN	S	337;97;343	ENSP00000378166:R337S;ENSP00000444474:R97S;ENSP00000252100:R343S	ENSP00000252100:R343S	R	+	1	0	TMCO6	140003639	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	3.358000	0.52284	2.609000	0.88269	0.462000	0.41574	CGT		0.537	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251666.2	NM_018502		23	32	1	0	1.66031e-10	0.003954	2.37726e-10	23	32				
PCDHA8	56140	broad.mit.edu	37	5	140222139	140222139	+	Silent	SNP	C	C	T	rs147149527	byFrequency	TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:140222139C>T	ENST00000531613.1	+	1	1233	c.1233C>T	c.(1231-1233)agC>agT	p.S411S	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.S411S|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGGACAGCGCCCTGGACC	0.627													.|||	6	0.00119808	0.0	0.0043	5008	,	,		16950	0.001		0.0	False		,,,				2504	0.002						uc003lhs.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1231-1233)AGC>AGT		protocadherin alpha 8 isoform 1 precursor		C	,,,,,,,,,,	2,4402	4.2+/-10.8	0,2,2200	130.0	113.0	118.0		,,,,,,,1233,,,1233	1.7	0.8	5	dbSNP_134	118	9,8569	4.3+/-15.6	1,7,4281	no	intron,intron,intron,intron,intron,intron,intron,coding-synonymous,intron,intron,coding-synonymous	PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031856.1	,,,,,,,,,,	1,9,6481	TT,TC,CC		0.1049,0.0454,0.0847	,,,,,,,,,,	,,,,,,,411/951,,,411/815	140222139	11,12971	2202	4289	6491	SO:0001819	synonymous_variant	56140				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140222139C>T	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1233C>T	5.37:g.140222139C>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.S411S	p.S411S	NM_018911	NP_061734	WXS	Illumina HiSeq	Unspecified	Q9Y5H6	PCDA8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1233	+			411			Cadherin 4.|Extracellular (Potential).		B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	c.1233C>T	CCDS54919.1																																																																																				0.627	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911		6	216	0	0	0	0.007291	0	6	216				
PCDHGB3	56102	broad.mit.edu	37	5	140752183	140752183	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:140752183C>A	ENST00000576222.1	+	1	2353	c.2222C>A	c.(2221-2223)cCc>cAc	p.P741H	PCDHGA6_ENST00000517434.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	741					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGTTCTCCCCACCTACAGC	0.498																																							uc003ljw.1		NA																	0					0						c.(2221-2223)CCC>CAC		protocadherin gamma subfamily B, 3 isoform 1							95.0	97.0	97.0					5																	140752183		2045	4210	6255	SO:0001583	missense	56102				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140752183C>A	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2222C>A	5.37:g.140752183C>A	ENSP00000461862:p.Pro741His		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Missense_Mutation_p.P741H|PCDHGA6_uc011dau.1_5'Flank	p.P741H	NM_018924	NP_061747	WXS	Illumina HiSeq	Unspecified	Q9Y5G1	PCDGF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2222	+			741			Cytoplasmic (Potential).		A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	c.2222C>A	CCDS58980.1																																																																																				0.498	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		13	40	1	0	3.27435e-08	0.00245	4.38903e-08	13	40				
GALNT10	55568	broad.mit.edu	37	5	153783767	153783767	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:153783767C>G	ENST00000297107.6	+	8	1297	c.1160C>G	c.(1159-1161)gCc>gGc	p.A387G	GALNT10_ENST00000377657.3_Missense_Mutation_p.A58G|SAP30L-AS1_ENST00000519727.1_RNA|SAP30L-AS1_ENST00000524264.1_RNA|GALNT10_ENST00000519544.1_3'UTR|GALNT10_ENST00000377661.2_Missense_Mutation_p.A325G	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	387					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			GTCAGCCTGGCCCGGGTAAGG	0.617																																							uc003lvh.2		NA																	0				skin(2)	2						c.(1159-1161)GCC>GGC		GalNAc transferase 10 isoform a							50.0	44.0	46.0					5																	153783767		2203	4300	6503	SO:0001583	missense	55568					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr5:153783767C>G	AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.1160C>G	5.37:g.153783767C>G	ENSP00000297107:p.Ala387Gly		Somatic				GALNT10_uc010jic.2_RNA|GALNT10_uc010jid.2_Missense_Mutation_p.A228G|uc003lvi.2_Intron|GALNT10_uc003lvj.2_Missense_Mutation_p.A58G	p.A387G	NM_198321	NP_938080	WXS	Illumina HiSeq	Unspecified	Q86SR1	GLT10_HUMAN	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)		8	1292	+	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	387			Lumenal (Potential).		B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Missense_Mutation	SNP	ENST00000297107.6	37	c.1160C>G	CCDS4325.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379786	0.82682	.	.	ENSG00000164574	ENST00000297107;ENST00000377661;ENST00000377657	T;T;T	0.65364	-0.15;-0.15;0.25	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.68732	0.3033	L	0.28458	0.855	0.58432	D	0.999999	D;B;B	0.64830	0.994;0.001;0.036	D;B;B	0.68765	0.96;0.002;0.015	T	0.63363	-0.6654	10	0.21014	T	0.42	.	18.8284	0.92127	0.0:1.0:0.0:0.0	.	325;58;387	Q86SR1-2;D6R8Y1;Q86SR1	.;.;GLT10_HUMAN	G	387;325;58	ENSP00000297107:A387G;ENSP00000366889:A325G;ENSP00000366885:A58G	ENSP00000297107:A387G	A	+	2	0	GALNT10	153763960	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.635000	0.83286	2.533000	0.85409	0.561000	0.74099	GCC		0.617	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	NM_198321		9	7	0	0	0	0.006214	0	9	7				
SLIT3	6586	broad.mit.edu	37	5	168233578	168233578	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr5:168233578G>T	ENST00000519560.1	-	9	1227	c.808C>A	c.(808-810)Ccc>Acc	p.P270T	SLIT3_ENST00000404867.3_Missense_Mutation_p.P270T|SLIT3_ENST00000332966.8_Missense_Mutation_p.P270T	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	270					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGGATGGGGGCTCCGAGTGG	0.572																																					Ovarian(29;311 847 10864 17279 24903)	Ovarian(29;311 847 10864 17279 24903)	uc003mab.2		NA																	0				ovary(3)|skin(1)	4						c.(808-810)CCC>ACC		slit homolog 3 precursor							61.0	59.0	60.0					5																	168233578		2203	4300	6503	SO:0001583	missense	6586				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	g.chr5:168233578G>T	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.808C>A	5.37:g.168233578G>T	ENSP00000430333:p.Pro270Thr		Somatic				SLIT3_uc010jjg.2_Missense_Mutation_p.P270T|SLIT3_uc010jji.2_Missense_Mutation_p.P270T|SLIT3_uc003mac.1_Missense_Mutation_p.P67T	p.P270T	NM_003062	NP_003053	WXS	Illumina HiSeq	Unspecified	O75094	SLIT3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		9	1228	-	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	270					A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	c.808C>A	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	8.548	0.874762	0.17395	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.75938	-0.98;-0.97;-0.97	5.52	0.586	0.17434	.	0.591382	0.19457	N	0.113799	T	0.59689	0.2212	L	0.43152	1.355	0.54753	D	0.999983	B;B;B	0.27971	0.196;0.0;0.0	B;B;B	0.26202	0.067;0.002;0.001	T	0.39820	-0.9595	10	0.19147	T	0.46	.	7.2949	0.26387	0.2045:0.2669:0.5286:0.0	.	270;270;270	O75094-2;O75094-3;O75094	.;.;SLIT3_HUMAN	T	270	ENSP00000430333:P270T;ENSP00000332164:P270T;ENSP00000384890:P270T	ENSP00000332164:P270T	P	-	1	0	SLIT3	168166156	1.000000	0.71417	0.508000	0.27688	0.898000	0.52572	2.598000	0.46223	-0.188000	0.10499	-0.136000	0.14681	CCC		0.572	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062		6	75	1	0	0.000157383	0.00308	0.000184984	6	75				
RIPK1	8737	broad.mit.edu	37	6	3083425	3083425	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr6:3083425C>T	ENST00000259808.4	+	5	864	c.566C>T	c.(565-567)aCc>aTc	p.T189I	RIPK1_ENST00000541791.1_Missense_Mutation_p.T143I|RIPK1_ENST00000380409.2_Missense_Mutation_p.T189I|RIPK1_ENST00000479389.1_3'UTR			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				AATGGCGGCACCCTCTACTAC	0.522																																							uc010jni.2		NA																	0				large_intestine(3)|lung(1)|skin(1)	5						c.(565-567)ACC>ATC		receptor (TNFRSF)-interacting serine-threonine							120.0	102.0	108.0					6																	3083425		2203	4300	6503	SO:0001583	missense	8737				activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity	g.chr6:3083425C>T	U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.566C>T	6.37:g.3083425C>T	ENSP00000259808:p.Thr189Ile		Somatic				RIPK1_uc003muv.3_Missense_Mutation_p.T26I|RIPK1_uc003muw.3_Missense_Mutation_p.T124I|RIPK1_uc011dhs.1_Missense_Mutation_p.T143I|RIPK1_uc003mux.2_Missense_Mutation_p.T189I	p.T189I	NM_003804	NP_003795	WXS	Illumina HiSeq	Unspecified	Q13546	RIPK1_HUMAN			5	798	+	Ovarian(93;0.0386)	all_hematologic(90;0.0895)	189			Protein kinase.		A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	ENST00000259808.4	37	c.566C>T	CCDS4482.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927247	0.92389	.	.	ENSG00000137275	ENST00000259808;ENST00000541791;ENST00000380409	T;T;T	0.76839	-1.05;-0.61;-1.05	5.86	5.86	0.93980	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90758	0.7099	M	0.93016	3.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91913	0.5541	10	0.87932	D	0	-28.6913	20.1931	0.98233	0.0:1.0:0.0:0.0	.	143;189	Q13546-2;Q13546	.;RIPK1_HUMAN	I	189;143;189	ENSP00000259808:T189I;ENSP00000442294:T143I;ENSP00000369773:T189I	ENSP00000259808:T189I	T	+	2	0	RIPK1	3028424	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	5.657000	0.67996	2.771000	0.95319	0.563000	0.77884	ACC		0.522	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039659.2	NM_003804		10	56	0	0	0	0.008291	0	10	56				
PRPF4B	8899	broad.mit.edu	37	6	4037669	4037669	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr6:4037669G>C	ENST00000337659.6	+	3	1377	c.1277G>C	c.(1276-1278)aGa>aCa	p.R426T	PRPF4B_ENST00000538861.1_Missense_Mutation_p.R412T	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	426	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				AGACGTGAAAGATCAAAAGAT	0.408																																							uc003mvv.2		NA																	0				breast(5)	5						c.(1276-1278)AGA>ACA		serine/threonine-protein kinase PRP4K							86.0	78.0	81.0					6																	4037669		2203	4300	6503	SO:0001583	missense	8899					catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:4037669G>C	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1277G>C	6.37:g.4037669G>C	ENSP00000337194:p.Arg426Thr		Somatic				PRPF4B_uc003mvw.2_RNA|PRPF4B_uc011dhv.1_RNA	p.R426T	NM_003913	NP_003904	WXS	Illumina HiSeq	Unspecified	Q13523	PRP4B_HUMAN			3	1368	+	Ovarian(93;0.0925)	all_hematologic(90;0.0895)	426			Arg/Lys-rich (basic).		A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	ENST00000337659.6	37	c.1277G>C	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780830	0.90195	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.71817	-0.59;-0.6	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.76821	0.4041	M	0.61703	1.905	0.58432	D	0.999999	D	0.54601	0.967	P	0.60789	0.879	T	0.76963	-0.2764	10	0.46703	T	0.11	.	18.4736	0.90783	0.0:0.0:1.0:0.0	.	426	Q13523	PRP4B_HUMAN	T	426;412	ENSP00000337194:R426T;ENSP00000439331:R412T	ENSP00000337194:R426T	R	+	2	0	PRPF4B	3982668	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.221000	0.65272	2.407000	0.81776	0.650000	0.86243	AGA		0.408	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2			3	48	0	0	0	0.001984	0	3	48				
PGBD1	84547	broad.mit.edu	37	6	28269741	28269741	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr6:28269741A>T	ENST00000405948.2	+	7	2530	c.2110A>T	c.(2110-2112)Ata>Tta	p.I704L	PGBD1_ENST00000259883.3_Missense_Mutation_p.I704L	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	704						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						TGCTGTGGGCATAGAACCAGT	0.403																																							uc003nky.2		NA																	0				ovary(4)	4						c.(2110-2112)ATA>TTA		piggyBac transposable element derived 1							173.0	167.0	169.0					6																	28269741		2203	4300	6503	SO:0001583	missense	84547				viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity	g.chr6:28269741A>T	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.2110A>T	6.37:g.28269741A>T	ENSP00000385213:p.Ile704Leu		Somatic				PGBD1_uc003nkz.2_Missense_Mutation_p.I704L	p.I704L	NM_032507	NP_115896	WXS	Illumina HiSeq	Unspecified	Q96JS3	PGBD1_HUMAN			7	2480	+			704					Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	c.2110A>T	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	A	17.92	3.506375	0.64410	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.01359	4.98;4.98	4.1	4.1	0.47936	.	0.113640	0.33092	N	0.005291	T	0.01730	0.0055	M	0.64997	1.995	0.25806	N	0.984451	P	0.43633	0.813	P	0.57152	0.814	T	0.51180	-0.8738	10	0.20046	T	0.44	-26.9759	9.6904	0.40125	1.0:0.0:0.0:0.0	.	704	Q96JS3	PGBD1_HUMAN	L	704	ENSP00000385213:I704L;ENSP00000259883:I704L	ENSP00000259883:I704L	I	+	1	0	PGBD1	28377720	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	2.874000	0.48483	1.854000	0.53819	0.482000	0.46254	ATA		0.403	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2			19	132	0	0	0	0.002299	0	19	132				
EHMT2	10919	broad.mit.edu	37	6	31848493	31848493	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr6:31848493C>T	ENST00000375537.4	-	27	3415	c.3409G>A	c.(3409-3411)Gcc>Acc	p.A1137T	EHMT2_ENST00000375530.4_Missense_Mutation_p.A1103T|SLC44A4_ENST00000375562.4_5'Flank|SLC44A4_ENST00000465707.1_5'Flank|EHMT2_ENST00000375528.4_Missense_Mutation_p.A1160T|EHMT2_ENST00000395728.3_Missense_Mutation_p.A1194T|EHMT2_ENST00000480912.1_5'UTR|SLC44A4_ENST00000229729.6_5'Flank	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	1137	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						CTGAAGAAGGCGATGCGTGGA	0.582																																							uc003nxz.1		NA																	0				ovary(1)	1						c.(3409-3411)GCC>ACC		euchromatic histone-lysine N-methyltransferase 2							121.0	106.0	111.0					6																	31848493		2203	4300	6503	SO:0001583	missense	10919				DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding	g.chr6:31848493C>T	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.3409G>A	6.37:g.31848493C>T	ENSP00000364687:p.Ala1137Thr		Somatic				EHMT2_uc003nxv.1_Missense_Mutation_p.A176T|EHMT2_uc003nxw.1_Missense_Mutation_p.A176T|EHMT2_uc003nxx.1_Missense_Mutation_p.A335T|EHMT2_uc003nxy.1_Missense_Mutation_p.A935T|EHMT2_uc011don.1_Missense_Mutation_p.A1160T|EHMT2_uc003nya.1_Missense_Mutation_p.A1103T|SLC44A4_uc010jti.2_5'Flank|SLC44A4_uc011dom.1_5'Flank	p.A1137T	NM_006709	NP_006700	WXS	Illumina HiSeq	Unspecified	Q96KQ7	EHMT2_HUMAN			27	3419	-			1137			SET.		B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	c.3409G>A	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902842	0.92035	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67	4.21	4.21	0.49690	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.95617	0.8575	M	0.89715	3.055	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.99;0.99;0.996;0.998	D	0.96353	0.9260	10	0.87932	D	0	.	15.8428	0.78864	0.0:1.0:0.0:0.0	.	1160;1103;1137;958	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	T	1194;1160;1103;1137;958	ENSP00000379078:A1194T;ENSP00000364678:A1160T;ENSP00000364680:A1103T;ENSP00000364687:A1137T	ENSP00000364678:A1160T	A	-	1	0	EHMT2	31956472	1.000000	0.71417	0.990000	0.47175	0.900000	0.52787	7.194000	0.77789	2.355000	0.79922	0.561000	0.74099	GCC		0.582	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709		4	56	0	0	0	0.000602	0	4	56				
C6orf106	64771	broad.mit.edu	37	6	34614502	34614502	+	Silent	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr6:34614502C>G	ENST00000374023.3	-	3	630	c.387G>C	c.(385-387)gtG>gtC	p.V129V	C6orf106_ENST00000374021.1_Silent_p.V55V|C6orf106_ENST00000374026.3_Intron	NM_024294.2	NP_077270.1	Q9H6K1	CF106_HUMAN	chromosome 6 open reading frame 106	129										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10						ATCTCACCATCACCATGTTCA	0.517																																							uc003ojr.2		NA																	0				skin(2)|ovary(1)	3						c.(385-387)GTG>GTC		chromosome 6 open reading frame 106 isoform a							196.0	185.0	189.0					6																	34614502		2203	4300	6503	SO:0001819	synonymous_variant	64771							g.chr6:34614502C>G	AF052106	CCDS4795.1, CCDS4796.1	6p21.31	2012-01-27			ENSG00000196821	ENSG00000196821			21215	protein-coding gene	gene with protein product		612217					Standard	XM_005249298		Approved	FLJ22195, dJ391O22.4	uc003ojr.2	Q9H6K1	OTTHUMG00000014553	ENST00000374023.3:c.387G>C	6.37:g.34614502C>G			Somatic				C6orf106_uc003ojs.2_Intron	p.V129V	NM_024294	NP_077270	WXS	Illumina HiSeq	Unspecified	Q9H6K1	CF106_HUMAN			3	632	-			129					B2R8K7|Q5VV77|Q96MG5|Q9BUR9	Silent	SNP	ENST00000374023.3	37	c.387G>C	CCDS4796.1																																																																																				0.517	C6orf106-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040251.1	NM_022758		38	156	0	0	0	0.002222	0	38	156				
FBXL4	26235	broad.mit.edu	37	6	99374724	99374724	+	Silent	SNP	G	G	A	rs267601175		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr6:99374724G>A	ENST00000369244.2	-	4	569	c.141C>T	c.(139-141)ctC>ctT	p.L47L	FBXL4_ENST00000229971.1_Silent_p.L47L	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	47					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		CCTCTGCATTGAGAGGGGAAG	0.438																																							uc003ppf.1		NA																	0				skin(2)	2						c.(139-141)CTC>CTT		F-box and leucine-rich repeat protein 4							240.0	215.0	224.0					6																	99374724		2203	4300	6503	SO:0001819	synonymous_variant	26235				ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex		g.chr6:99374724G>A	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.141C>T	6.37:g.99374724G>A			Somatic				FBXL4_uc003ppg.1_Silent_p.L47L|FBXL4_uc003pph.1_5'UTR	p.L47L	NM_012160	NP_036292	WXS	Illumina HiSeq	Unspecified	Q9UKA2	FBXL4_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0413)	3	499	-		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)	47					B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Silent	SNP	ENST00000369244.2	37	c.141C>T	CCDS5041.1																																																																																				0.438	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2			27	99	0	0	0	0.002096	0	27	99				
SYNE1	23345	broad.mit.edu	37	6	152685991	152685991	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr6:152685991C>A	ENST00000367255.5	-	63	10737	c.10136G>T	c.(10135-10137)cGt>cTt	p.R3379L	SYNE1_ENST00000423061.1_Missense_Mutation_p.R3386L|SYNE1_ENST00000448038.1_Missense_Mutation_p.R3386L|SYNE1_ENST00000341594.5_Missense_Mutation_p.R3418L|SYNE1_ENST00000265368.4_Missense_Mutation_p.R3379L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3379					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTTTTACAACGAATCCCTGC	0.468										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(10135-10137)CGT>CTT		spectrin repeat containing, nuclear envelope 1							118.0	117.0	117.0					6																	152685991		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152685991C>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10136G>T	6.37:g.152685991C>A	ENSP00000356224:p.Arg3379Leu	HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Missense_Mutation_p.R3386L|SYNE1_uc003qou.3_Missense_Mutation_p.R3379L|SYNE1_uc010kja.1_Missense_Mutation_p.R84L	p.R3379L	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	63	10738	-		Ovarian(120;0.0955)	3379			Spectrin 7.|HAT 6.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.10136G>T	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174945	0.57692	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.52526	1.37;1.37;1.37;1.37;0.66	5.28	5.28	0.74379	.	0.113007	0.41396	D	0.000892	T	0.29749	0.0743	L	0.47716	1.5	0.80722	D	1	P;P;P;D	0.53151	0.93;0.93;0.93;0.958	B;B;B;P	0.47299	0.341;0.341;0.341;0.543	T	0.14337	-1.0476	10	0.32370	T	0.25	.	6.8796	0.24166	0.0:0.785:0.0:0.215	.	3379;3379;3379;3386	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	L	3379;3386;3379;3386;3418	ENSP00000356224:R3379L;ENSP00000396024:R3386L;ENSP00000265368:R3379L;ENSP00000390975:R3386L;ENSP00000341887:R3418L	ENSP00000265368:R3379L	R	-	2	0	SYNE1	152727684	1.000000	0.71417	0.804000	0.32291	0.973000	0.67179	3.774000	0.55341	2.466000	0.83321	0.655000	0.94253	CGT		0.468	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		12	32	1	0	0.00010058	0.001368	0.000120466	12	32				
C6orf118	168090	broad.mit.edu	37	6	165715076	165715076	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr6:165715076G>T	ENST00000230301.8	-	2	755	c.735C>A	c.(733-735)caC>caA	p.H245Q	C6orf118_ENST00000543069.1_Missense_Mutation_p.H141Q	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	245										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		GCTTTCTCTCGTGGCCCGCGG	0.602																																							uc003qum.3		NA																	0					0						c.(733-735)CAC>CAA		hypothetical protein LOC168090							51.0	53.0	52.0					6																	165715076		2203	4300	6503	SO:0001583	missense	168090							g.chr6:165715076G>T		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.735C>A	6.37:g.165715076G>T	ENSP00000230301:p.His245Gln		Somatic				C6orf118_uc011egi.1_RNA	p.H245Q	NM_144980	NP_659417	WXS	Illumina HiSeq	Unspecified	Q5T5N4	CF118_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)	2	771	-		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)	245					Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	37	c.735C>A	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809608	0.50421	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.12984	2.63;2.63	4.92	-3.96	0.04106	.	0.373191	0.26112	N	0.026268	T	0.13543	0.0328	L	0.58810	1.83	0.26992	N	0.965113	D	0.76494	0.999	D	0.67548	0.952	T	0.06373	-1.0830	10	0.62326	D	0.03	-16.3539	11.8152	0.52207	0.5189:0.0:0.4811:0.0	.	245	Q5T5N4	CF118_HUMAN	Q	245;141	ENSP00000230301:H245Q;ENSP00000439288:H141Q	ENSP00000230301:H245Q	H	-	3	2	C6orf118	165635066	0.511000	0.26179	0.227000	0.23927	0.032000	0.12392	-0.347000	0.07750	-0.863000	0.04084	-0.216000	0.12614	CAC		0.602	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980		10	49	1	0	6.40141e-05	0.000978	7.7855e-05	10	49				
CARD11	84433	broad.mit.edu	37	7	2985479	2985479	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:2985479G>T	ENST00000396946.4	-	4	735	c.332C>A	c.(331-333)cCc>cAc	p.P111H	AC004906.3_ENST00000423194.1_RNA	NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	111					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TCTCCGAGTGGGCTCTTTCCC	0.493			Mis		DLBCL																																		uc003smv.2		NA		Dom	yes		7	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50						c.(331-333)CCC>CAC		caspase recruitment domain family, member 11							201.0	196.0	198.0					7																	2985479		2203	4300	6503	SO:0001583	missense	84433				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	g.chr7:2985479G>T	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.332C>A	7.37:g.2985479G>T	ENSP00000380150:p.Pro111His		Somatic					p.P111H	NM_032415	NP_115791	WXS	Illumina HiSeq	Unspecified	Q9BXL7	CAR11_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)	4	736	-		Ovarian(82;0.0115)	111					A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	c.332C>A	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	27.2	4.809174	0.90707	.	.	ENSG00000198286	ENST00000396946	T	0.26810	1.71	5.32	5.32	0.75619	DEATH-like (2);	0.000000	0.85682	D	0.000000	T	0.53174	0.1780	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56245	-0.8011	10	0.87932	D	0	-33.8288	19.0362	0.92980	0.0:0.0:1.0:0.0	.	111	Q9BXL7	CAR11_HUMAN	H	111	ENSP00000380150:P111H	ENSP00000380150:P111H	P	-	2	0	CARD11	2952005	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.287000	0.95975	2.495000	0.84180	0.655000	0.94253	CCC		0.493	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		27	170	1	0	3.1745e-13	0.008361	4.85421e-13	27	170				
CCDC129	223075	broad.mit.edu	37	7	31682641	31682641	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:31682641G>T	ENST00000407970.3	+	11	1695	c.1657G>T	c.(1657-1659)Gtc>Ttc	p.V553F	CCDC129_ENST00000451887.2_Missense_Mutation_p.V579F|CCDC129_ENST00000319386.3_Missense_Mutation_p.V405F|CCDC129_ENST00000409210.1_Missense_Mutation_p.V461F	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	553										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						TGAGTATGAGGTCACCAGACC	0.547																																							uc003tcj.1		NA																	0					0						c.(1657-1659)GTC>TTC		coiled-coil domain containing 129							144.0	140.0	141.0					7																	31682641		2203	4300	6503	SO:0001583	missense	223075							g.chr7:31682641G>T	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1657G>T	7.37:g.31682641G>T	ENSP00000384416:p.Val553Phe		Somatic				CCDC129_uc011kad.1_Missense_Mutation_p.V563F|CCDC129_uc003tci.1_Missense_Mutation_p.V404F|CCDC129_uc011kae.1_Missense_Mutation_p.V579F|CCDC129_uc003tck.1_Missense_Mutation_p.V461F	p.V553F	NM_194300	NP_919276	WXS	Illumina HiSeq	Unspecified	Q6ZRS4	CC129_HUMAN			11	2650	+			553					A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	37	c.1657G>T	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810296	0.50421	.	.	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T	0.19806	2.12;2.38;2.37;2.13	5.49	2.74	0.32292	.	1.869730	0.02638	N	0.105091	T	0.31136	0.0787	L	0.43152	1.355	0.09310	N	1	D;P;P;D	0.61080	0.989;0.662;0.662;0.989	P;P;P;P	0.52066	0.689;0.487;0.487;0.558	T	0.10847	-1.0612	10	0.56958	D	0.05	-14.1455	7.5838	0.27980	0.2665:0.0:0.7335:0.0	.	579;563;553;405	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	F	405;553;579;563;461	ENSP00000313062:V405F;ENSP00000384416:V553F;ENSP00000395835:V579F;ENSP00000387214:V461F	ENSP00000313062:V405F	V	+	1	0	CCDC129	31649166	0.009000	0.17119	0.001000	0.08648	0.002000	0.02628	0.808000	0.27154	0.301000	0.22738	-0.218000	0.12543	GTC		0.547	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300		32	118	1	0	4.62619e-21	0.004289	7.79278e-21	32	118				
SEMA3A	10371	broad.mit.edu	37	7	83739879	83739879	+	Silent	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:83739879T>A	ENST00000265362.4	-	4	674	c.360A>T	c.(358-360)gtA>gtT	p.V120V	SEMA3A_ENST00000436949.1_Silent_p.V120V	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	120	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						ATGCCTTAAGTACCTTGATGA	0.428																																							uc003uhz.2		NA																	0				ovary(2)|breast(1)|kidney(1)	4						c.(358-360)GTA>GTT		semaphorin 3A precursor							137.0	126.0	129.0					7																	83739879		2203	4300	6503	SO:0001819	synonymous_variant	10371				axon guidance	extracellular region|membrane	receptor activity	g.chr7:83739879T>A	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.360A>T	7.37:g.83739879T>A			Somatic					p.V120V	NM_006080	NP_006071	WXS	Illumina HiSeq	Unspecified	Q14563	SEM3A_HUMAN			4	675	-			120			Sema.			Silent	SNP	ENST00000265362.4	37	c.360A>T	CCDS5599.1																																																																																				0.428	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080		13	58	0	0	0	0.004007	0	13	58				
DLX6	1750	broad.mit.edu	37	7	96639143	96639143	+	Silent	SNP	T	T	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:96639143T>C	ENST00000518156.2	+	3	1096	c.666T>C	c.(664-666)ttT>ttC	p.F222F	DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6_ENST00000493273.2_3'UTR|DLX6-AS1_ENST00000452769.2_RNA|DLX6_ENST00000007660.5_Silent_p.F194F|DLX6_ENST00000555308.1_Silent_p.F94F			P56179	DLX6_HUMAN	distal-less homeobox 6	104					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GCTCTAAGTTTAAGAAACTGC	0.542																																							uc003uom.2		NA																	0				ovary(2)	2						c.(580-582)TTT>TTC		distal-less homeobox 6							89.0	89.0	89.0					7																	96639143		2040	4204	6244	SO:0001819	synonymous_variant	1750				nervous system development|skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:96639143T>C		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.666T>C	7.37:g.96639143T>C			Somatic				DLX6AS_uc003uol.2_Intron|DLX6AS_uc010lfo.1_Intron	p.F194F	NM_005222	NP_005213	WXS	Illumina HiSeq	Unspecified	P56179	DLX6_HUMAN			4	582	+	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)		104			Homeobox.		A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Silent	SNP	ENST00000518156.2	37	c.582T>C	CCDS47647.2																																																																																				0.542	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334373.4	NM_005222		8	43	0	0	0	0.004482	0	8	43				
SRRT	51593	broad.mit.edu	37	7	100481745	100481745	+	Silent	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:100481745G>C	ENST00000347433.4	+	6	800	c.642G>C	c.(640-642)cgG>cgC	p.R214R	SRRT_ENST00000432932.1_Silent_p.R214R|SRRT_ENST00000388793.4_Silent_p.R214R|SRRT_ENST00000457580.2_Silent_p.R214R			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	214					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						AGGAGGCCCGGGGGGCCCTGC	0.557																																							uc003uwy.2		NA																	0				ovary(2)	2						c.(640-642)CGG>CGC		arsenate resistance protein 2 isoform a							53.0	56.0	55.0					7																	100481745		2203	4300	6503	SO:0001819	synonymous_variant	51593				cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding	g.chr7:100481745G>C		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.642G>C	7.37:g.100481745G>C			Somatic				SRRT_uc010lhl.1_Silent_p.R214R|SRRT_uc003uxa.2_Silent_p.R214R|SRRT_uc003uwz.2_Silent_p.R214R	p.R214R	NM_015908	NP_056992	WXS	Illumina HiSeq	Unspecified	Q9BXP5	SRRT_HUMAN			7	910	+			214					A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Silent	SNP	ENST00000347433.4	37	c.642G>C	CCDS34709.1																																																																																				0.557	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908		11	49	0	0	0	0.001368	0	11	49				
GCC1	79571	broad.mit.edu	37	7	127222755	127222755	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:127222755C>T	ENST00000321407.2	-	2	2065	c.1641G>A	c.(1639-1641)caG>caA	p.Q547Q	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	547					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CATCAGCCTCCTGCTGGTGTT	0.622																																							uc003vma.2		NA																	0				ovary(2)	2						c.(1639-1641)CAG>CAA		Golgi coiled-coil protein 1							41.0	44.0	43.0					7																	127222755		2203	4299	6502	SO:0001819	synonymous_variant	79571					Golgi membrane|plasma membrane	protein binding	g.chr7:127222755C>T	AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.1641G>A	7.37:g.127222755C>T			Somatic					p.Q547Q	NM_024523	NP_078799	WXS	Illumina HiSeq	Unspecified	Q96CN9	GCC1_HUMAN			2	2059	-			547			Potential.		Q9H6N7	Silent	SNP	ENST00000321407.2	37	c.1641G>A	CCDS5796.1																																																																																				0.622	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523		9	54	0	0	0	0.008291	0	9	54				
SSMEM1	136263	broad.mit.edu	37	7	129855958	129855958	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:129855958G>T	ENST00000297819.3	+	3	434	c.383G>T	c.(382-384)cGa>cTa	p.R128L		NM_145268.3	NP_660311.1	Q8WWF3	SSMM1_HUMAN	serine-rich single-pass membrane protein 1	128						integral component of membrane (GO:0016021)											GAACAAAGACGAGCCAGGCGC	0.483																																							uc003vpp.2		NA																	0					0						c.(382-384)CGA>CTA		hypothetical protein LOC136263							101.0	95.0	97.0					7																	129855958		2203	4300	6503	SO:0001583	missense	136263					integral to membrane		g.chr7:129855958G>T	AK097635	CCDS5816.1	7q32.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000165120	ENSG00000165120			29580	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 45"""	C7orf45		12477932	Standard	NM_145268		Approved	FLJ40316	uc003vpp.3	Q8WWF3	OTTHUMG00000157844	ENST00000297819.3:c.383G>T	7.37:g.129855958G>T	ENSP00000297819:p.Arg128Leu		Somatic					p.R128L	NM_145268	NP_660311	WXS	Illumina HiSeq	Unspecified	Q8WWF3	CG045_HUMAN			3	430	+	Melanoma(18;0.0435)		128						Missense_Mutation	SNP	ENST00000297819.3	37	c.383G>T	CCDS5816.1	.	.	.	.	.	.	.	.	.	.	g	12.14	1.849918	0.32699	.	.	ENSG00000165120	ENST00000297819	T	0.54675	0.56	5.84	4.06	0.47325	.	0.425333	0.20341	N	0.094226	T	0.67655	0.2916	M	0.69823	2.125	0.22933	N	0.998542	D	0.89917	1.0	D	0.76071	0.987	T	0.58561	-0.7615	10	0.72032	D	0.01	-5.2359	8.3018	0.32019	0.2395:0.0:0.7605:0.0	.	128	Q8WWF3	CG045_HUMAN	L	128	ENSP00000297819:R128L	ENSP00000297819:R128L	R	+	2	0	C7orf45	129643194	1.000000	0.71417	0.676000	0.29932	0.011000	0.07611	1.743000	0.38258	0.850000	0.35239	-0.930000	0.02707	CGA		0.483	SSMEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349768.1	NM_145268		6	31	1	0	5.18039e-06	0.00308	6.55351e-06	6	31				
PLXNA4	91584	broad.mit.edu	37	7	131887528	131887528	+	Silent	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:131887528G>A	ENST00000359827.3	-	12	3425	c.2463C>T	c.(2461-2463)ttC>ttT	p.F821F	PLXNA4_ENST00000321063.4_Silent_p.F821F			Q9HCM2	PLXA4_HUMAN	plexin A4	821	PSI 3.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AGCCACATGCGAAGTCTGGGT	0.637																																							uc003vra.3		NA																	0				ovary(1)	1						c.(2461-2463)TTC>TTT		plexin A4 isoform 1							23.0	26.0	25.0					7																	131887528		2135	4261	6396	SO:0001819	synonymous_variant	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131887528G>A	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2463C>T	7.37:g.131887528G>A			Somatic					p.F821F	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			12	2692	-			821			PSI 3.|Extracellular (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	c.2463C>T	CCDS43646.1																																																																																				0.637	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		6	17	0	0	0	0.001168	0	6	17				
PRSS3P2	154754	broad.mit.edu	37	7	142480037	142480037	+	RNA	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:142480037T>A	ENST00000603901.1	+	0	169					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										CAGCGAACAGTGGGTGGTGTC	0.587																																							uc011ksq.1		NA																	0					0						c.(169-171)TGG>AGG		SubName: Full=Protease, serine, 3; Flags: Fragment;							62.0	49.0	53.0					7																	142480037		692	1591	2283			154754							g.chr7:142480037T>A			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142480037T>A			Somatic				uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_RNA|uc003wan.1_Intron|TRY6_uc011kso.1_RNA|TRY6_uc011ksr.1_RNA	p.W57R	NR_001296		WXS	Illumina HiSeq	Unspecified					2	252	+									Missense_Mutation	SNP	ENST00000603901.1	37	c.169T>A																																																																																					0.587	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470000.1	NR_001296		14	77	0	0	0	0.00499	0	14	77				
TRBV30	28557	broad.mit.edu	37	7	142510289	142510289	+	RNA	SNP	T	T	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr7:142510289T>C	ENST00000417977.2	-	0	428									T cell receptor beta variable 30 (gene/pseudogene)																		GGCACAGAGATAGAAGCCAGA	0.567																																							uc003wbp.2		NA																	0					NA						c.(316-318)TAT>TGT		SubName: Full=V_segment translation product; Flags: Fragment;							29.0	33.0	32.0					7																	142510289		1960	4158	6118			0							g.chr7:142510289T>C	L36092		7q34	2012-02-07	2008-09-12		ENSG00000237254	ENSG00000237254		"""T cell receptors / TRB locus"""	12214	other	T cell receptor gene			"""T cell receptor beta variable 30"""			8650574	Standard	NG_001333		Approved	TCRBV20S1A1N2, TCRBV30S1			OTTHUMG00000158907		7.37:g.142510289T>C			Somatic					p.Y106C			WXS	Illumina HiSeq	Unspecified					2	429	-									Missense_Mutation	SNP	ENST00000417977.2	37	c.317A>G																																																																																					0.567	TRBV30-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000352519.1	NG_001333		3	19	0	0	0	0.001984	0	3	19				
RHOBTB2	23221	broad.mit.edu	37	8	22865579	22865579	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr8:22865579G>A	ENST00000251822.6	+	6	2112	c.1575G>A	c.(1573-1575)atG>atA	p.M525I	RP11-875O11.1_ENST00000523884.1_RNA|RHOBTB2_ENST00000522948.1_Missense_Mutation_p.M532I|RHOBTB2_ENST00000519685.1_Missense_Mutation_p.M547I|RP11-875O11.1_ENST00000502083.2_RNA	NM_015178.2	NP_055993.2	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2	525	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	31		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		GTGACTGGATGGCTGCCATGT	0.557																																							uc003xcq.2		NA																	0				ovary(1)|lung(1)	2						c.(1573-1575)ATG>ATA		Rho-related BTB domain containing 2 isoform 3							63.0	64.0	64.0					8																	22865579		2203	4300	6503	SO:0001583	missense	23221				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding	g.chr8:22865579G>A	AF315385	CCDS6034.1, CCDS55210.1, CCDS55211.1	8p21.2	2013-01-08			ENSG00000008853	ENSG00000008853		"""BTB/POZ domain containing"""	18756	protein-coding gene	gene with protein product		607352				11222756	Standard	NM_001160036		Approved	KIAA0717, DBC2	uc011kzp.1	Q9BYZ6	OTTHUMG00000097827	ENST00000251822.6:c.1575G>A	8.37:g.22865579G>A	ENSP00000251822:p.Met525Ile		Somatic				RHOBTB2_uc003xcp.2_Missense_Mutation_p.M547I|RHOBTB2_uc011kzp.1_Missense_Mutation_p.M532I|uc003xcr.2_RNA	p.M525I	NM_015178	NP_055993	WXS	Illumina HiSeq	Unspecified	Q9BYZ6	RHBT2_HUMAN		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)	6	2112	+		Prostate(55;0.0513)|Breast(100;0.214)	525			BTB 2.		A8K9Z8|D3DSR8|E9PBU2|E9PEI7|O94825|Q8N4A8|Q9BZK6	Missense_Mutation	SNP	ENST00000251822.6	37	c.1575G>A	CCDS6034.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.579346	0.86645	.	.	ENSG00000008853	ENST00000519685;ENST00000522948;ENST00000251822	T;T;T	0.70164	-0.46;-0.46;-0.46	4.56	4.56	0.56223	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.074969	0.85682	D	0.000000	T	0.72614	0.3482	M	0.83118	2.625	0.80722	D	1	P;P;P	0.44281	0.831;0.831;0.831	B;B;B	0.43194	0.411;0.411;0.411	T	0.79997	-0.1567	10	0.87932	D;D	0;0	.	16.0802	0.81001	0.0:0.0:1.0:0.0	.	532;525;547	E9PEI7;Q9BYZ6;E9PBU2	.;RHBT2_HUMAN;.	I	547;532;525	ENSP00000427926:M547I;ENSP00000429141:M532I;ENSP00000251822:M525I	ENSP00000251822:M525I;ENSP00000251822:M525I	M	+	3	0	RHOBTB2	22921524	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.791000	0.85805	2.337000	0.79520	0.655000	0.94253	ATG		0.557	RHOBTB2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215101.2			8	53	0	0	0	0.00308	0	8	53				
SLCO5A1	81796	broad.mit.edu	37	8	70744391	70744391	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr8:70744391C>A	ENST00000260126.4	-	2	1224	c.518G>T	c.(517-519)tGc>tTc	p.C173F	SLCO5A1_ENST00000528658.1_5'UTR|RP11-159H10.3_ENST00000501104.2_RNA|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.C173F|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.C173F|RP11-159H10.3_ENST00000533300.1_RNA|RP11-159H10.3_ENST00000528800.2_RNA	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GATGTCAAAGCAGCTGACCAG	0.612																																							uc003xyl.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(517-519)TGC>TTC		solute carrier organic anion transporter family,							51.0	57.0	55.0					8																	70744391		2203	4300	6503	SO:0001583	missense	81796					integral to membrane|plasma membrane	transporter activity	g.chr8:70744391C>A	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.518G>T	8.37:g.70744391C>A	ENSP00000260126:p.Cys173Phe		Somatic				SLCO5A1_uc010lzb.2_Missense_Mutation_p.C173F|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Missense_Mutation_p.C173F|SLCO5A1_uc010lzc.2_Missense_Mutation_p.C173F	p.C173F	NM_030958	NP_112220	WXS	Illumina HiSeq	Unspecified	Q9H2Y9	SO5A1_HUMAN	Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)		2	1225	-	Breast(64;0.0654)		173			Helical; Name=2; (Potential).		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	c.518G>T	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781192	0.90282	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.58210	0.35;0.35;0.35	5.71	5.71	0.89125	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.58192	0.2105	N	0.17248	0.465	0.80722	D	1	P;D;D;D	0.76494	0.642;0.999;0.998;0.997	P;D;D;D	0.80764	0.603;0.994;0.982;0.953	T	0.52990	-0.8501	10	0.18710	T	0.47	.	19.8632	0.96793	0.0:1.0:0.0:0.0	.	173;173;173;173	B4DR09;E9PKK5;Q9H2Y9;G3V1C0	.;.;SO5A1_HUMAN;.	F	173	ENSP00000260126:C173F;ENSP00000434422:C173F;ENSP00000431611:C173F	ENSP00000260126:C173F	C	-	2	0	SLCO5A1	70906945	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.814000	0.86154	2.704000	0.92352	0.561000	0.74099	TGC		0.612	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958		8	41	1	0	1.12685e-05	0.004482	1.40856e-05	8	41				
TRPA1	8989	broad.mit.edu	37	8	72975766	72975766	+	Missense_Mutation	SNP	C	C	G	rs569148037		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr8:72975766C>G	ENST00000262209.4	-	5	800	c.593G>C	c.(592-594)gGa>gCa	p.G198A		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	198					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	AGGGAAACATCCCCATTTATT	0.363																																							uc003xza.2		NA																	0				ovary(4)|lung(1)|kidney(1)	6						c.(592-594)GGA>GCA		ankyrin-like protein 1	Menthol(DB00825)						105.0	101.0	102.0					8																	72975766		2203	4300	6503	SO:0001583	missense	8989					integral to plasma membrane		g.chr8:72975766C>G	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.593G>C	8.37:g.72975766C>G	ENSP00000262209:p.Gly198Ala		Somatic					p.G198A	NM_007332	NP_015628	WXS	Illumina HiSeq	Unspecified	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		5	768	-			198			ANK 5.|Cytoplasmic (Potential).		A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	c.593G>C	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119309	0.77323	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.63417	-0.04;1.65	5.62	3.83	0.44106	Ankyrin repeat-containing domain (3);	0.193747	0.56097	D	0.000039	T	0.66703	0.2816	M	0.76574	2.34	0.52099	D	0.99994	P	0.46020	0.871	P	0.46320	0.512	T	0.70554	-0.4840	10	0.87932	D	0	-6.4704	12.1253	0.53913	0.0:0.8594:0.0:0.1406	.	198	O75762	TRPA1_HUMAN	A	50;198	ENSP00000428151:G50A;ENSP00000262209:G198A	ENSP00000262209:G198A	G	-	2	0	TRPA1	73138320	1.000000	0.71417	0.967000	0.41034	0.975000	0.68041	3.718000	0.54919	0.847000	0.35167	0.650000	0.86243	GGA		0.363	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		15	34	0	0	0	0.008871	0	15	34				
ZFHX4	79776	broad.mit.edu	37	8	77761908	77761908	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr8:77761908A>G	ENST00000521891.2	+	8	4254	c.3806A>G	c.(3805-3807)cAc>cGc	p.H1269R	ZFHX4_ENST00000455469.2_Missense_Mutation_p.H1224R|ZFHX4_ENST00000518282.1_Missense_Mutation_p.H1243R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.H1224R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACGCATTTGCACAGTGTGTCT	0.463										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(3670-3672)CAC>CGC		zinc finger homeodomain 4							84.0	78.0	80.0					8																	77761908		2047	4210	6257	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77761908A>G		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3806A>G	8.37:g.77761908A>G	ENSP00000430497:p.His1269Arg	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.H1269R|ZFHX4_uc003yaw.1_Missense_Mutation_p.H1224R	p.H1224R	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		8	4058	+			1224			C2H2-type 9.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.3671A>G	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	14.84	2.654962	0.47467	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.69040	-0.37;0.02;-0.04;-0.33	4.38	3.2	0.36748	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.44483	U	0.000445	T	0.80325	0.4602	M	0.84585	2.705	0.58432	D	0.999999	D;D;D	0.69078	0.995;0.994;0.997	P;P;D	0.63793	0.829;0.857;0.918	T	0.82327	-0.0512	10	0.87932	D	0	.	11.3219	0.49428	0.8472:0.1528:0.0:0.0	.	1224;1224;1269	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	R	1269;1269;1224;1224;1243	ENSP00000430497:H1269R;ENSP00000399605:H1224R;ENSP00000050961:H1224R;ENSP00000430848:H1243R	ENSP00000050961:H1224R	H	+	2	0	ZFHX4	77924463	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.087000	0.94110	0.798000	0.33994	0.454000	0.30748	CAC		0.463	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		6	27	0	0	0	0.00308	0	6	27				
ZFAND1	79752	broad.mit.edu	37	8	82626195	82626195	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr8:82626195C>T	ENST00000220669.5	-	6	456	c.438G>A	c.(436-438)atG>atA	p.M146I	ZFAND1_ENST00000521287.1_Missense_Mutation_p.M39I|ZFAND1_ENST00000519523.1_Missense_Mutation_p.M146I|ZFAND1_ENST00000521895.1_Missense_Mutation_p.M39I|ZFAND1_ENST00000523096.1_Missense_Mutation_p.M146I|ZFAND1_ENST00000522520.1_Missense_Mutation_p.M39I|ZFAND1_ENST00000517588.1_Missense_Mutation_p.M39I	NM_024699.2	NP_078975.2	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	146							zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						TCTTTAATTTCATCAATGCAA	0.353																																							uc003ycj.1		NA																	0				ovary(1)	1						c.(436-438)ATG>ATA		zinc finger, AN1-type domain 1							197.0	170.0	179.0					8																	82626195		2203	4300	6503	SO:0001583	missense	79752						zinc ion binding	g.chr8:82626195C>T		CCDS6232.1, CCDS55250.1, CCDS55251.1	8q21.13	2006-07-07						"""Zinc fingers, AN1-type domain containing"""	25858	protein-coding gene	gene with protein product						12477932	Standard	NM_024699		Approved	FLJ14007	uc003ycj.2	Q8TCF1		ENST00000220669.5:c.438G>A	8.37:g.82626195C>T	ENSP00000220669:p.Met146Ile		Somatic				ZFAND1_uc010lzx.1_Missense_Mutation_p.M146I|ZFAND1_uc003yck.1_Missense_Mutation_p.M39I	p.M146I	NM_024699	NP_078975	WXS	Illumina HiSeq	Unspecified	Q8TCF1	ZFAN1_HUMAN			6	452	-			146					E5RIG0|E5RJ99|Q658R7|Q6IA32|Q6PGQ6|Q9H810	Missense_Mutation	SNP	ENST00000220669.5	37	c.438G>A	CCDS6232.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980758	0.74474	.	.	ENSG00000104231	ENST00000523096;ENST00000220669;ENST00000522520;ENST00000521895;ENST00000521287;ENST00000520635;ENST00000517588;ENST00000519523;ENST00000520604;ENST00000523361;ENST00000517450;ENST00000521742;ENST00000518419;ENST00000520076	.	.	.	5.78	5.78	0.91487	.	0.038355	0.85682	D	0.000000	T	0.74435	0.3716	M	0.81497	2.545	0.80722	D	1	P;P	0.52577	0.954;0.732	P;B	0.50136	0.632;0.425	T	0.75825	-0.3181	9	0.46703	T	0.11	.	20.0044	0.97430	0.0:1.0:0.0:0.0	.	146;146	E5RIG0;Q8TCF1	.;ZFAN1_HUMAN	I	146;146;39;39;39;39;39;146;39;39;39;39;39;39	.	ENSP00000220669:M146I	M	-	3	0	ZFAND1	82788750	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.355000	0.66046	2.714000	0.92807	0.650000	0.86243	ATG		0.353	ZFAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379739.1	NM_024699		3	51	0	0	0	0.000248	0	3	51				
GLDC	2731	broad.mit.edu	37	9	6587243	6587243	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:6587243A>C	ENST00000321612.6	-	15	1898	c.1748T>G	c.(1747-1749)gTg>gGg	p.V583G		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	583					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	ATCCAGAGGCACAAAGGGGTG	0.383																																							uc003zkc.2		NA																	0				ovary(2)	2						c.(1747-1749)GTG>GGG		glycine dehydrogenase (decarboxylating)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)						98.0	91.0	93.0					9																	6587243		2203	4300	6503	SO:0001583	missense	2731				glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding	g.chr9:6587243A>C	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.1748T>G	9.37:g.6587243A>C	ENSP00000370737:p.Val583Gly		Somatic					p.V583G	NM_000170	NP_000161	WXS	Illumina HiSeq	Unspecified	P23378	GCSP_HUMAN		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	15	1941	-		Acute lymphoblastic leukemia(23;0.161)	583					Q2M2F8	Missense_Mutation	SNP	ENST00000321612.6	37	c.1748T>G	CCDS34987.1	.	.	.	.	.	.	.	.	.	.	A	19.17	3.775886	0.70107	.	.	ENSG00000178445	ENST00000321612	D	0.97772	-4.53	5.26	4.1	0.47936	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.98473	0.9491	M	0.85373	2.75	0.80722	D	1	D	0.59357	0.985	D	0.64506	0.926	D	0.98563	1.0642	10	0.72032	D	0.01	-11.4574	12.2442	0.54560	0.8576:0.1424:0.0:0.0	.	583	P23378	GCSP_HUMAN	G	583	ENSP00000370737:V583G	ENSP00000370737:V583G	V	-	2	0	GLDC	6577243	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.962000	0.93254	0.810000	0.34279	0.455000	0.32223	GTG		0.383	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170		11	53	0	0	0	0.00245	0	11	53				
FOCAD	54914	broad.mit.edu	37	9	20929593	20929593	+	Silent	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:20929593C>G	ENST00000380249.1	+	29	3679	c.3315C>G	c.(3313-3315)ctC>ctG	p.L1105L	FOCAD_ENST00000605086.1_Silent_p.L541L|FOCAD_ENST00000338382.6_Silent_p.L1105L	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1105						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											AAGAGAAACTCAGGTACAGTT	0.403																																							uc003zog.1		NA																	0				ovary(8)|breast(1)|kidney(1)	10						c.(3313-3315)CTC>CTG		hypothetical protein LOC54914							98.0	87.0	91.0					9																	20929593		2203	4300	6503	SO:0001819	synonymous_variant	54914					integral to membrane	binding	g.chr9:20929593C>G	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3315C>G	9.37:g.20929593C>G			Somatic				KIAA1797_uc003zoh.1_Silent_p.L541L	p.L1105L	NM_017794	NP_060264	WXS	Illumina HiSeq	Unspecified	Q5VW36	K1797_HUMAN		GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)	29	3678	+			1105					D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Silent	SNP	ENST00000380249.1	37	c.3315C>G	CCDS34993.1																																																																																				0.403	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794		5	51	0	0	0	0.001984	0	5	51				
SMU1	55234	broad.mit.edu	37	9	33053211	33053211	+	Silent	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:33053211G>C	ENST00000397149.3	-	10	1250	c.1200C>G	c.(1198-1200)gtC>gtG	p.V400V	SMU1_ENST00000536631.1_Silent_p.V239V	NM_018225.2	NP_060695.2	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)	400						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|lung(4)|ovary(2)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		TCACACTGTTGACGGTAATAT	0.443																																							uc003zsf.1		NA																	0				ovary(1)	1						c.(1198-1200)GTC>GTG		smu-1 suppressor of mec-8 and unc-52 homolog							153.0	140.0	144.0					9																	33053211		2203	4300	6503	SO:0001819	synonymous_variant	55234					cytoplasm|nucleus		g.chr9:33053211G>C	AK001667	CCDS6534.1	9p12	2013-01-10			ENSG00000122692	ENSG00000122692		"""WD repeat domain containing"""	18247	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 57"""					11438655, 11410362	Standard	NM_018225		Approved	SMU-1, FLJ10805, BWD, fSAP57	uc003zsf.1	Q2TAY7	OTTHUMG00000019757	ENST00000397149.3:c.1200C>G	9.37:g.33053211G>C			Somatic				SMU1_uc010mjo.1_Silent_p.V400V|SMU1_uc010mjp.1_Intron|SMU1_uc011lnu.1_Silent_p.V239V	p.V400V	NM_018225	NP_060695	WXS	Illumina HiSeq	Unspecified	Q2TAY7	SMU1_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)	10	1308	-			400			WD 5.		B4E3L0|Q9BU59|Q9HA96|Q9NVD1	Silent	SNP	ENST00000397149.3	37	c.1200C>G	CCDS6534.1																																																																																				0.443	SMU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052022.1	NM_018225		14	70	0	0	0	0.00245	0	14	70				
FRMPD1	22844	broad.mit.edu	37	9	37735585	37735585	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:37735585G>A	ENST00000539465.1	+	13	1848	c.1255G>A	c.(1255-1257)Gga>Aga	p.G419R	FRMPD1_ENST00000536622.1_Missense_Mutation_p.G241R|FRMPD1_ENST00000541302.1_Missense_Mutation_p.G288R|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.G419R			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	419	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CCTTCTAGTTGGAGCCAAGTA	0.443																																							uc004aag.1		NA																	0				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(1255-1257)GGA>AGA		FERM and PDZ domain containing 1							155.0	141.0	146.0					9																	37735585		2203	4300	6503	SO:0001583	missense	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37735585G>A	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1255G>A	9.37:g.37735585G>A	ENSP00000444411:p.Gly419Arg		Somatic				FRMPD1_uc004aah.1_Missense_Mutation_p.G419R|FRMPD1_uc011lqm.1_Missense_Mutation_p.G241R|FRMPD1_uc011lqn.1_Missense_Mutation_p.G288R	p.G419R	NM_014907	NP_055722	WXS	Illumina HiSeq	Unspecified	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	13	1299	+			419			FERM.		B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	c.1255G>A	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.014240	0.93404	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.74	5.74	0.90152	FERM domain (1);	0.000000	0.85682	D	0.000000	T	0.54919	0.1888	M	0.64567	1.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.976;0.996	T	0.54840	-0.8233	10	0.87932	D	0	-18.0434	17.4291	0.87534	0.0:0.0:1.0:0.0	.	288;419	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	R	419;419;241;288	ENSP00000366995:G419R;ENSP00000444411:G419R;ENSP00000437762:G241R;ENSP00000444804:G288R	ENSP00000366995:G419R	G	+	1	0	FRMPD1	37725585	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.415000	0.97375	2.724000	0.93272	0.655000	0.94253	GGA		0.443	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		12	65	0	0	0	0.00245	0	12	65				
TLE1	7088	broad.mit.edu	37	9	84208062	84208062	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:84208062C>T	ENST00000376499.3	-	15	2523	c.1459G>A	c.(1459-1461)Gtg>Atg	p.V487M		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	487					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						ACAGCGCACACCACCTCCCCG	0.637																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	uc004aly.2		NA																	0				ovary(1)|skin(1)	2						c.(1459-1461)GTG>ATG		transducin-like enhancer protein 1							139.0	130.0	133.0					9																	84208062		2203	4300	6503	SO:0001583	missense	7088				negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding	g.chr9:84208062C>T		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1459G>A	9.37:g.84208062C>T	ENSP00000365682:p.Val487Met		Somatic				TLE1_uc004alz.2_Missense_Mutation_p.V497M|TLE1_uc011lsr.1_Missense_Mutation_p.V472M|TLE1_uc004ama.1_Missense_Mutation_p.V486M	p.V487M	NM_005077	NP_005068	WXS	Illumina HiSeq	Unspecified	Q04724	TLE1_HUMAN			15	1900	-			487			WD 1.		A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	c.1459G>A	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	c	26.2	4.716574	0.89205	.	.	ENSG00000196781	ENST00000376499	T	0.16597	2.33	5.96	5.96	0.96718	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.50990	0.1648	M	0.88640	2.97	0.80722	D	1	P;D;P	0.67145	0.925;0.996;0.803	P;D;P	0.68039	0.652;0.955;0.657	T	0.56661	-0.7942	10	0.87932	D	0	-17.5086	20.422	0.99049	0.0:1.0:0.0:0.0	.	472;513;487	B4DEF9;Q59EF7;Q04724	.;.;TLE1_HUMAN	M	487	ENSP00000365682:V487M	ENSP00000365682:V487M	V	-	1	0	TLE1	83397882	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.816000	0.86201	2.832000	0.97577	0.655000	0.94253	GTG		0.637	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077		44	129	0	0	0	0.00361	0	44	129				
SPATA31E1	286234	broad.mit.edu	37	9	90501513	90501513	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:90501513A>G	ENST00000325643.5	+	4	2177	c.2111A>G	c.(2110-2112)gAc>gGc	p.D704G		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	704			D -> E (in dbSNP:rs4076794). {ECO:0000269|PubMed:14702039}.		cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGGTTCTCTGACAAGGGGTGC	0.597																																							uc004app.3		NA																	0				ovary(3)	3						c.(2110-2112)GAC>GGC		chromosome 9 open reading frame 79							50.0	64.0	59.0					9																	90501513		2203	4299	6502	SO:0001583	missense	286234					integral to membrane		g.chr9:90501513A>G	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2111A>G	9.37:g.90501513A>G	ENSP00000322640:p.Asp704Gly		Somatic				C9orf79_uc004apo.1_Missense_Mutation_p.D516G	p.D704G	NM_178828	NP_849150	WXS	Illumina HiSeq	Unspecified	Q6ZUB1	CI079_HUMAN			4	2146	+			704					B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	c.2111A>G	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	a	0.660	-0.806257	0.02819	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.06608	3.28	2.45	-4.32	0.03688	.	8.130670	0.00166	N	0.000000	T	0.02119	0.0066	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36601	-0.9741	10	0.16420	T	0.52	.	0.5555	0.00670	0.2601:0.3085:0.2371:0.1943	.	704;356	Q6ZUB1;Q8NA33	CI079_HUMAN;.	G	704;356	ENSP00000322640:D704G	ENSP00000322640:D704G	D	+	2	0	C9orf79	89691333	0.033000	0.19621	0.000000	0.03702	0.003000	0.03518	0.047000	0.14056	-1.126000	0.02929	-0.245000	0.11935	GAC		0.597	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828		19	44	0	0	0	0.001882	0	19	44				
SPTAN1	6709	broad.mit.edu	37	9	131390214	131390214	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:131390214C>G	ENST00000372731.4	+	50	6795	c.6685C>G	c.(6685-6687)Ctc>Gtc	p.L2229V	SPTAN1_ENST00000372739.3_Missense_Mutation_p.L2234V|SPTAN1_ENST00000358161.5_Intron	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	2229					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GACATACCTCCTCGATGGGTT	0.567																																					NSCLC(120;833 1744 2558 35612 37579)	NSCLC(120;833 1744 2558 35612 37579)	uc004bvl.3		NA																	0				breast(5)|ovary(4)|pancreas(1)	10						c.(6685-6687)CTC>GTC		spectrin, alpha, non-erythrocytic 1							401.0	380.0	387.0					9																	131390214		2203	4300	6503	SO:0001583	missense	6709				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton	g.chr9:131390214C>G	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.6685C>G	9.37:g.131390214C>G	ENSP00000361816:p.Leu2229Val		Somatic				SPTAN1_uc004bvm.3_Missense_Mutation_p.L2234V|SPTAN1_uc004bvn.3_Missense_Mutation_p.L2209V|SPTAN1_uc010mye.1_3'UTR|SPTAN1_uc010myf.1_Missense_Mutation_p.L58V|SPTAN1_uc004bvo.3_5'Flank	p.L2229V	NM_003127	NP_003118	WXS	Illumina HiSeq	Unspecified	Q13813	SPTA2_HUMAN			50	6798	+			2229			Spectrin 23.		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	c.6685C>G	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787317	0.49997	.	.	ENSG00000197694	ENST00000372731;ENST00000372739	T;T	0.51574	0.7;0.7	5.57	5.57	0.84162	.	.	.	.	.	T	0.67951	0.2948	M	0.72118	2.19	0.80722	D	1	B;D;D;B	0.56035	0.003;0.974;0.974;0.025	B;D;D;B	0.67725	0.026;0.953;0.953;0.015	T	0.68292	-0.5447	9	0.52906	T	0.07	.	17.7274	0.88369	0.0:1.0:0.0:0.0	.	1218;2209;2234;2229	Q9UG16;Q13813-3;Q13813-2;Q13813	.;.;.;SPTA2_HUMAN	V	2229;2234	ENSP00000361816:L2229V;ENSP00000361824:L2234V	ENSP00000361816:L2229V	L	+	1	0	SPTAN1	130430035	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	6.634000	0.74290	2.619000	0.88677	0.561000	0.74099	CTC		0.567	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		37	453	0	0	0	0.00623	0	37	453				
ZDHHC12	84885	broad.mit.edu	37	9	131484063	131484063	+	Missense_Mutation	SNP	G	G	T	rs113339803		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:131484063G>T	ENST00000372663.4	-	4	361	c.349C>A	c.(349-351)Cgc>Agc	p.R117S	RP11-545E17.3_ENST00000443631.1_RNA|ZDHHC12_ENST00000372667.5_Missense_Mutation_p.R131S|ZDHHC12_ENST00000372672.2_Missense_Mutation_p.R117S|ZDHHC12_ENST00000467312.1_5'UTR	NM_032799.4	NP_116188	Q96GR4	ZDH12_HUMAN	zinc finger, DHHC-type containing 12	117					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|ovary(2)|upper_aerodigestive_tract(1)	4						ACGCAACGGCGGCACTCACGG	0.662																																							uc004bvy.2		NA																	0					0						c.(349-351)CGC>AGC		zinc finger, DHHC domain containing 12							85.0	80.0	81.0					9																	131484063		2203	4300	6503	SO:0001583	missense	84885					integral to membrane	acyltransferase activity|zinc ion binding	g.chr9:131484063G>T	AK027430	CCDS6909.1	9q34.11	2008-02-05			ENSG00000160446	ENSG00000160446		"""Zinc fingers, DHHC-type"""	19159	protein-coding gene	gene with protein product							Standard	NM_032799		Approved	ZNF400, FLJ14524	uc004bvy.3	Q96GR4	OTTHUMG00000020756	ENST00000372663.4:c.349C>A	9.37:g.131484063G>T	ENSP00000361748:p.Arg117Ser		Somatic				ZDHHC12_uc004bvz.2_Missense_Mutation_p.R172S	p.R117S	NM_032799	NP_116188	WXS	Illumina HiSeq	Unspecified	Q96GR4	ZDH12_HUMAN			4	385	-			117			DHHC-type.		A6NH95|B2RE03|Q5T265|Q5T267|Q5T268|Q86VT5|Q96T09	Missense_Mutation	SNP	ENST00000372663.4	37	c.349C>A	CCDS6909.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223795	0.58668	.	.	ENSG00000160446	ENST00000372663;ENST00000372672;ENST00000372667;ENST00000372664;ENST00000452105;ENST00000406904	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	4.78	2.63	0.31362	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.453294	0.23760	N	0.044823	T	0.22126	0.0533	L	0.52823	1.66	0.29869	N	0.826985	P;B	0.38300	0.626;0.423	B;B	0.36289	0.221;0.165	T	0.13953	-1.0490	10	0.56958	D	0.05	.	8.0309	0.30465	0.0:0.1433:0.6432:0.2135	.	172;117	Q96GR4-3;Q96GR4	.;ZDH12_HUMAN	S	117;117;131;117;117;172	ENSP00000361748:R117S;ENSP00000361752:R131S;ENSP00000387587:R117S;ENSP00000384205:R172S	ENSP00000361748:R117S	R	-	1	0	ZDHHC12	130523884	0.998000	0.40836	0.997000	0.53966	0.989000	0.77384	3.088000	0.50175	0.950000	0.37743	0.462000	0.41574	CGC		0.662	ZDHHC12-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054484.1	NM_032799		19	75	1	0	2.27731e-05	0.001882	2.79125e-05	19	75				
PRRC2B	84726	broad.mit.edu	37	9	134308112	134308112	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:134308112C>G	ENST00000357304.4	+	2	279	c.224C>G	c.(223-225)cCc>cGc	p.P75R	PRRC2B_ENST00000458550.1_Missense_Mutation_p.P75R|PRRC2B_ENST00000405995.1_Missense_Mutation_p.P75R	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	75							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GGAAACGACCCCAACATCGTG	0.557																																							uc004can.3		NA																	0					0						c.(223-225)CCC>CGC		HLA-B associated transcript 2-like							101.0	108.0	106.0					9																	134308112		2041	4205	6246	SO:0001583	missense	84726						protein binding	g.chr9:134308112C>G	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.224C>G	9.37:g.134308112C>G	ENSP00000349856:p.Pro75Arg		Somatic				BAT2L1_uc004cam.1_Missense_Mutation_p.P75R	p.P75R	NM_013318	NP_037450	WXS	Illumina HiSeq	Unspecified	Q5JSZ5	PRC2B_HUMAN			2	279	+			75					O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	c.224C>G	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033696	0.93575	.	.	ENSG00000130723	ENST00000405995;ENST00000541684;ENST00000357304;ENST00000458550	T;T;T	0.31769	1.48;1.48;1.48	6.03	6.03	0.97812	BAT2, N-terminal (1);	0.000000	0.41605	U	0.000857	T	0.62332	0.2419	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64689	-0.6348	10	0.87932	D	0	-31.9955	19.545	0.95291	0.0:1.0:0.0:0.0	.	75	Q5JSZ5	PRC2B_HUMAN	R	75	ENSP00000384606:P75R;ENSP00000349856:P75R;ENSP00000398853:P75R	ENSP00000349856:P75R	P	+	2	0	PRRC2B	133297933	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	CCC		0.557	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				4	56	0	0	0	0.000248	0	4	56				
KCNT1	57582	broad.mit.edu	37	9	138651666	138651666	+	Silent	SNP	C	C	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr9:138651666C>G	ENST00000263604.3	+	11	939	c.939C>G	c.(937-939)gtC>gtG	p.V313V	KCNT1_ENST00000488444.2_Silent_p.V313V|KCNT1_ENST00000491806.2_Silent_p.V299V|KCNT1_ENST00000487664.1_Silent_p.V287V|KCNT1_ENST00000490355.2_Silent_p.V313V|KCNT1_ENST00000486577.2_Silent_p.V293V|KCNT1_ENST00000298480.5_Silent_p.V332V|KCNT1_ENST00000371757.2_Silent_p.V332V			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	313					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		TGCTGGTGGTCATCATGATCT	0.632																																							uc011mdq.1		NA																	0				large_intestine(2)|ovary(1)|pancreas(1)	4						c.(994-996)GTC>GTG		potassium channel, subfamily T, member 1							127.0	92.0	104.0					9																	138651666		2203	4300	6503	SO:0001819	synonymous_variant	57582					membrane	binding|calcium-activated potassium channel activity	g.chr9:138651666C>G	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.939C>G	9.37:g.138651666C>G			Somatic				KCNT1_uc011mdr.1_Silent_p.V159V|KCNT1_uc010nbf.2_Silent_p.V287V|KCNT1_uc004cgo.1_Silent_p.V81V	p.V332V	NM_020822	NP_065873	WXS	Illumina HiSeq	Unspecified	Q5JUK3	KCNT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)	11	1070	+		Myeloproliferative disorder(178;0.0821)	332					B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Silent	SNP	ENST00000263604.3	37	c.996C>G																																																																																					0.632	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822		5	27	0	0	0	0.001984	0	5	27				
ARSH	347527	broad.mit.edu	37	X	2947329	2947329	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:2947329G>T	ENST00000381130.2	+	8	1241	c.1241G>T	c.(1240-1242)aGg>aTg	p.R414M		NM_001011719.1	NP_001011719.1	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	414					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(3)|endometrium(8)|kidney(2)|large_intestine(6)|lung(13)|skin(1)|stomach(1)	34		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CTGGAAGGAAGGGCGTCCCAC	0.547																																							uc011mhj.1		NA																	0				lung(1)	1						c.(1240-1242)AGG>ATG		arylsulfatase family, member H							153.0	116.0	128.0					X																	2947329		2203	4300	6503	SO:0001583	missense	347527					integral to membrane	arylsulfatase activity|metal ion binding	g.chrX:2947329G>T	AY875940	CCDS35198.1	Xp22.33	2013-02-14	2006-03-07		ENSG00000205667	ENSG00000205667		"""Arylsulfatase family"""	32488	protein-coding gene	gene with protein product		300586	"""arylsulfatase H"""			16174644	Standard	NM_001011719		Approved		uc011mhj.2	Q5FYA8	OTTHUMG00000159612	ENST00000381130.2:c.1241G>T	X.37:g.2947329G>T	ENSP00000370522:p.Arg414Met		Somatic					p.R414M	NM_001011719	NP_001011719	WXS	Illumina HiSeq	Unspecified	Q5FYA8	ARSH_HUMAN			8	1241	+		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)	414						Missense_Mutation	SNP	ENST00000381130.2	37	c.1241G>T	CCDS35198.1	.	.	.	.	.	.	.	.	.	.	G	7.155	0.584514	0.13749	.	.	ENSG00000205667	ENST00000381130	D	0.93859	-3.3	3.5	0.604	0.17547	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.445719	0.22964	U	0.053504	D	0.92067	0.7486	L	0.57536	1.79	0.09310	N	1	P	0.40931	0.733	P	0.50860	0.652	D	0.85045	0.0925	10	0.59425	D	0.04	.	3.9912	0.09538	0.3948:0.3494:0.2557:0.0	.	414	Q5FYA8	ARSH_HUMAN	M	414	ENSP00000370522:R414M	ENSP00000370522:R414M	R	+	2	0	ARSH	2957329	0.000000	0.05858	0.001000	0.08648	0.204000	0.24138	-0.121000	0.10643	-0.019000	0.14055	-0.191000	0.12829	AGG		0.547	ARSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356489.1	NM_001011719		15	96	1	0	1.02788e-11	0.00499	1.51301e-11	15	96				
ATXN3L	92552	broad.mit.edu	37	X	13337344	13337344	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:13337344C>A	ENST00000380622.2	-	1	1174	c.710G>T	c.(709-711)cGc>cTc	p.R237L	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	237					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)	p.R237H(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						GGTTTCTTGGCGGCTTAGTTC	0.423																																							uc010ned.2		NA																	1	Substitution - Missense(1)	p.R237H(1)	ovary(1)	lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(709-711)CGC>CTC		ataxin 3-like							277.0	251.0	259.0					X																	13337344		1568	3582	5150	SO:0001583	missense	92552				protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity	g.chrX:13337344C>A		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.710G>T	X.37:g.13337344C>A	ENSP00000369996:p.Arg237Leu		Somatic					p.R237L	NM_001135995	NP_001129467	WXS	Illumina HiSeq	Unspecified	Q9H3M9	ATX3L_HUMAN			1	1175	-			237			UIM 1.		B2RNY8	Missense_Mutation	SNP	ENST00000380622.2	37	c.710G>T	CCDS48080.1	.	.	.	.	.	.	.	.	.	.	c	9.588	1.125505	0.20959	.	.	ENSG00000123594	ENST00000380622	T	0.19806	2.12	0.793	-1.59	0.08453	Ubiquitin interacting motif (3);	0.000000	0.85682	D	0.000000	T	0.18882	0.0453	L	0.47190	1.495	0.48632	D	0.999683	P	0.41498	0.752	P	0.46850	0.529	T	0.07195	-1.0785	10	0.59425	D	0.04	.	3.0549	0.06181	0.2508:0.5416:0.0:0.2076	.	237	Q9H3M9	ATX3L_HUMAN	L	237	ENSP00000369996:R237L	ENSP00000369996:R237L	R	-	2	0	ATXN3L	13247265	0.832000	0.29368	0.001000	0.08648	0.004000	0.04260	0.425000	0.21346	-0.985000	0.03503	-0.592000	0.04112	CGC		0.423	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995		37	208	1	0	1.59361e-14	0.006999	2.48508e-14	37	208				
RAI2	10742	broad.mit.edu	37	X	17818601	17818601	+	Silent	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:17818601G>T	ENST00000545871.1	-	3	1990	c.1530C>A	c.(1528-1530)tcC>tcA	p.S510S	RAI2_ENST00000331511.1_Silent_p.S510S|RAI2_ENST00000360011.1_Silent_p.S510S|RAI2_ENST00000415486.3_Silent_p.S460S|RAI2_ENST00000451717.1_Silent_p.S510S	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	510					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					GTATTTCCTGGGAGTTCACTT	0.403																																							uc004cyf.2		NA																	0				ovary(1)|breast(1)	2						c.(1528-1530)TCC>TCA		retinoic acid induced 2							276.0	293.0	287.0					X																	17818601		2203	4300	6503	SO:0001819	synonymous_variant	10742				embryo development			g.chrX:17818601G>T	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.1530C>A	X.37:g.17818601G>T			Somatic				RAI2_uc004cyg.2_Silent_p.S510S|RAI2_uc010nfa.2_Silent_p.S510S|RAI2_uc004cyh.3_Silent_p.S510S|RAI2_uc011miy.1_Silent_p.S460S	p.S510S	NM_021785	NP_068557	WXS	Illumina HiSeq	Unspecified	Q9Y5P3	RAI2_HUMAN			3	2100	-	Hepatocellular(33;0.183)		510					B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Silent	SNP	ENST00000545871.1	37	c.1530C>A	CCDS14183.1																																																																																				0.403	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1	NM_021785		54	277	1	0	1.07796e-43	0.00361	1.84541e-43	54	277				
PDHA1	5160	broad.mit.edu	37	X	19377734	19377734	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:19377734G>T	ENST00000422285.2	+	11	1241	c.1136G>T	c.(1135-1137)gGt>gTt	p.G379V	PDHA1_ENST00000545074.1_Missense_Mutation_p.G386V|PDHA1_ENST00000478795.1_3'UTR|PDHA1_ENST00000540249.1_Missense_Mutation_p.G348V|PDHA1_ENST00000379806.5_Missense_Mutation_p.G417V|MAP3K15_ENST00000518578.1_5'Flank|PDHA1_ENST00000379804.1_Missense_Mutation_p.G98V			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	379					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					GAAGTTCGTGGTGCCAATCAG	0.512																																							uc004czg.3		NA																	0				ovary(1)	1						c.(1135-1137)GGT>GTT		pyruvate dehydrogenase E1 alpha 1 precursor	NADH(DB00157)						103.0	86.0	92.0					X																	19377734		2203	4300	6503	SO:0001583	missense	5160				glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity	g.chrX:19377734G>T		CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.1136G>T	X.37:g.19377734G>T	ENSP00000394382:p.Gly379Val		Somatic				PDHA1_uc004czh.3_Missense_Mutation_p.G414V|PDHA1_uc011mjc.1_Missense_Mutation_p.G383V|PDHA1_uc011mjd.1_Missense_Mutation_p.G345V|PDHA1_uc010nfk.2_Missense_Mutation_p.G317V|PDHA1_uc010nfl.2_Missense_Mutation_p.G170V	p.G379V	NM_000284	NP_000275	WXS	Illumina HiSeq	Unspecified	P08559	ODPA_HUMAN			11	1281	+	Hepatocellular(33;0.183)		379					A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Missense_Mutation	SNP	ENST00000422285.2	37	c.1136G>T	CCDS14192.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917248	0.92249	.	.	ENSG00000131828	ENST00000379806;ENST00000545074;ENST00000540249;ENST00000422285;ENST00000379804	D;D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55;-2.55	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.95573	0.8561	M	0.88181	2.935	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.994;1.0;1.0;0.997;1.0	D	0.96067	0.9043	10	0.87932	D	0	-23.7651	18.9073	0.92467	0.0:0.0:1.0:0.0	.	348;386;379;417;379	B7Z3X5;B7Z3T7;B2R5P7;A5YVE9;P08559	.;.;.;.;ODPA_HUMAN	V	417;386;348;379;98	ENSP00000369134:G417V;ENSP00000438550:G386V;ENSP00000440761:G348V;ENSP00000394382:G379V;ENSP00000369132:G98V	ENSP00000369132:G98V	G	+	2	0	PDHA1	19287655	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.420000	0.97426	2.499000	0.84300	0.513000	0.50165	GGT		0.512	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055977.1			10	61	1	0	1.5842e-08	0.001855	2.1887e-08	10	61				
PHEX	5251	broad.mit.edu	37	X	22244559	22244559	+	Splice_Site	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:22244559G>A	ENST00000379374.4	+	19	2464		c.e19-1		PHEX_ENST00000537599.1_Splice_Site|PHEX_ENST00000535894.1_Splice_Site|PHEX_ENST00000418858.3_Splice_Site	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked						bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						CTTTCTGTTAGGTCAAGGGGA	0.393																																							uc004dah.2		NA																	0				ovary(2)|lung(1)	3						c.e19-1		phosphate-regulating neutral endopeptidase							112.0	108.0	109.0					X																	22244559		2203	4300	6503	SO:0001630	splice_region_variant	5251				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding	g.chrX:22244559G>A	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1900-1G>A	X.37:g.22244559G>A			Somatic				PHEX_uc011mjr.1_Splice_Site_p.V634_splice|PHEX_uc011mjs.1_Splice_Site_p.V537_splice	p.V634_splice	NM_000444	NP_000435	WXS	Illumina HiSeq	Unspecified	P78562	PHEX_HUMAN			19	2103	+								O00678|Q13646|Q2M325|Q93032|Q99827	Splice_Site	SNP	ENST00000379374.4	37	c.1900_splice	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.181522	0.57800	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3889	0.94570	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHEX	22154480	1.000000	0.71417	0.993000	0.49108	0.557000	0.35523	8.513000	0.90542	2.618000	0.88619	0.600000	0.82982	.		0.393	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	Intron	9	66	0	0	0	0.004482	0	9	66				
MAGEB4	4115	broad.mit.edu	37	X	30260717	30260717	+	Silent	SNP	T	T	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:30260717T>A	ENST00000378982.2	+	1	661	c.465T>A	c.(463-465)tcT>tcA	p.S155S	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	155	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GGAAAGTCTCTCAGCGCACGG	0.498																																							uc004dcb.2		NA																	0				ovary(1)	1						c.(463-465)TCT>TCA		melanoma antigen family B, 4							58.0	42.0	47.0					X																	30260717		2202	4300	6502	SO:0001819	synonymous_variant	4115							g.chrX:30260717T>A		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.465T>A	X.37:g.30260717T>A			Somatic				MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	p.S155S	NM_002367	NP_002358	WXS	Illumina HiSeq	Unspecified	O15481	MAGB4_HUMAN			1	549	+			155			MAGE.		B2R9G0|Q6FHH4|Q8IZ00	Silent	SNP	ENST00000378982.2	37	c.465T>A	CCDS14221.1																																																																																				0.498	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367		7	23	0	0	0	0.001984	0	7	23				
FAM47C	442444	broad.mit.edu	37	X	37026574	37026574	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:37026574G>A	ENST00000358047.3	+	1	143	c.91G>A	c.(91-93)Gcg>Acg	p.A31T		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	31										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CAAGTACTTCGCGAAGCGCAA	0.642																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(91-93)GCG>ACG		hypothetical protein LOC442444							27.0	25.0	26.0					X																	37026574		2202	4299	6501	SO:0001583	missense	442444							g.chrX:37026574G>A	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.91G>A	X.37:g.37026574G>A	ENSP00000367913:p.Ala31Thr		Somatic					p.A31T	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	105	+			31					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.91G>A	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364786	0.24684	.	.	ENSG00000198173	ENST00000358047	T	0.20069	2.1	0.462	-0.871	0.10642	.	.	.	.	.	T	0.13372	0.0324	L	0.39898	1.24	0.09310	N	1	P	0.44241	0.829	B	0.39706	0.307	T	0.19745	-1.0296	8	0.23302	T	0.38	.	.	.	.	.	31	Q5HY64	FA47C_HUMAN	T	31	ENSP00000367913:A31T	ENSP00000367913:A31T	A	+	1	0	FAM47C	36936495	0.001000	0.12720	0.002000	0.10522	0.005000	0.04900	-0.328000	0.07945	-0.487000	0.06735	-0.888000	0.02935	GCG		0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		5	23	0	0	0	0.000602	0	5	23				
FAM47C	442444	broad.mit.edu	37	X	37027156	37027156	+	Missense_Mutation	SNP	C	C	G	rs368685662		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:37027156C>G	ENST00000358047.3	+	1	725	c.673C>G	c.(673-675)Cag>Gag	p.Q225E		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	225										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TCTCCGCCCACAGCCTCCCAA	0.647																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(673-675)CAG>GAG		hypothetical protein LOC442444							41.0	41.0	41.0					X																	37027156		2202	4298	6500	SO:0001583	missense	442444							g.chrX:37027156C>G	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.673C>G	X.37:g.37027156C>G	ENSP00000367913:p.Gln225Glu		Somatic					p.Q225E	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	687	+			225					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.673C>G	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.683783	0.00101	.	.	ENSG00000198173	ENST00000358047	T	0.12672	2.66	0.96	0.96	0.19631	.	.	.	.	.	T	0.01870	0.0059	N	0.00114	-2.085	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37337	-0.9710	9	0.02654	T	1	.	2.8694	0.05611	0.2407:0.2933:0.466:0.0	.	225	Q5HY64	FA47C_HUMAN	E	225	ENSP00000367913:Q225E	ENSP00000367913:Q225E	Q	+	1	0	FAM47C	36937077	0.000000	0.05858	0.016000	0.15963	0.016000	0.09150	-3.060000	0.00624	-1.049000	0.03234	-1.043000	0.02367	CAG		0.647	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		6	62	0	0	0	0.001168	0	6	62				
USP9X	8239	broad.mit.edu	37	X	41089775	41089775	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:41089775C>A	ENST00000324545.8	+	44	8134	c.7501C>A	c.(7501-7503)Cca>Aca	p.P2501T	USP9X_ENST00000378308.2_Missense_Mutation_p.P2485T	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2501					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						CCAAGATGCTCCAGATGAACA	0.373																																					Ovarian(172;1807 2695 35459 49286)	Ovarian(172;1807 2695 35459 49286)	uc004dfb.2		NA																	0				lung(3)|breast(2)|ovary(1)	6						c.(7501-7503)CCA>ACA		ubiquitin specific protease 9, X-linked isoform							81.0	79.0	79.0					X																	41089775		2119	4265	6384	SO:0001583	missense	8239				BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity	g.chrX:41089775C>A	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.7501C>A	X.37:g.41089775C>A	ENSP00000316357:p.Pro2501Thr		Somatic				USP9X_uc004dfc.2_Missense_Mutation_p.P2485T	p.P2501T	NM_001039590	NP_001034679	WXS	Illumina HiSeq	Unspecified	Q93008	USP9X_HUMAN			44	8134	+			2501					O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	c.7501C>A	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.274372	0.23307	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.02863	4.18;4.13	5.28	5.28	0.74379	.	0.162448	0.56097	D	0.000031	T	0.02533	0.0077	N	0.14661	0.345	0.58432	D	0.999995	B;B	0.11235	0.004;0.002	B;B	0.14023	0.01;0.004	T	0.55108	-0.8192	10	0.12766	T	0.61	.	18.034	0.89293	0.0:1.0:0.0:0.0	.	2485;2501	Q93008-1;Q93008	.;USP9X_HUMAN	T	2485;2501	ENSP00000367558:P2485T;ENSP00000316357:P2501T	ENSP00000316357:P2501T	P	+	1	0	USP9X	40974719	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.170000	0.77587	2.193000	0.70182	0.468000	0.43344	CCA		0.373	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652		10	62	1	0	1.11149e-13	0.008291	1.71627e-13	10	62				
WDR13	64743	broad.mit.edu	37	X	48457261	48457261	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:48457261C>A	ENST00000218056.5	+	2	703	c.198C>A	c.(196-198)taC>taA	p.Y66*	WDR13_ENST00000492715.1_3'UTR|WDR13_ENST00000376729.5_Nonsense_Mutation_p.Y66*	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	66						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						GCCAGCGCTACGGGCCCCTCT	0.677																																							uc004dkh.1		NA																	0				ovary(2)	2						c.(196-198)TAC>TAA		WD repeat domain 13 protein							20.0	16.0	17.0					X																	48457261		2201	4299	6500	SO:0001587	stop_gained	64743					cytoplasm|nucleus		g.chrX:48457261C>A	AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.198C>A	X.37:g.48457261C>A	ENSP00000218056:p.Tyr66*		Somatic				WDR13_uc010nif.1_Intron|WDR13_uc004dki.1_5'UTR|WDR13_uc004dkj.1_Nonsense_Mutation_p.Y66*|WDR13_uc004dkk.1_5'UTR|WDR13_uc004dkl.3_5'UTR|WDR13_uc011mme.1_5'Flank	p.Y66*	NM_017883	NP_060353	WXS	Illumina HiSeq	Unspecified	Q9H1Z4	WDR13_HUMAN			3	345	+			66					Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Nonsense_Mutation	SNP	ENST00000218056.5	37	c.198C>A	CCDS14302.1	.	.	.	.	.	.	.	.	.	.	C	39	7.648811	0.98409	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	.	.	.	4.53	3.57	0.40892	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.2723	8.2642	0.31804	0.0:0.8666:0.0:0.1334	.	.	.	.	X	66	.	ENSP00000218056:Y66X	Y	+	3	2	WDR13	48342205	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.348000	0.52209	2.081000	0.62600	0.523000	0.50628	TAC		0.677	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2			7	28	1	0	0.000157383	0.00308	0.000184984	7	28				
WDR13	64743	broad.mit.edu	37	X	48460174	48460174	+	Silent	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:48460174G>T	ENST00000218056.5	+	6	1339	c.834G>T	c.(832-834)gtG>gtT	p.V278V	WDR13_ENST00000376729.5_Silent_p.V278V	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	278						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						CCCCACAGGTGGGGAACGCCA	0.587																																							uc004dkh.1		NA																	0				ovary(2)	2						c.(832-834)GTG>GTT		WD repeat domain 13 protein							57.0	43.0	48.0					X																	48460174		2203	4300	6503	SO:0001819	synonymous_variant	64743					cytoplasm|nucleus		g.chrX:48460174G>T	AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.834G>T	X.37:g.48460174G>T			Somatic				WDR13_uc010nif.1_Silent_p.V156V|WDR13_uc004dki.1_Silent_p.V186V|WDR13_uc004dkj.1_Silent_p.V278V|WDR13_uc004dkk.1_Silent_p.V186V|WDR13_uc004dkl.3_Silent_p.V186V	p.V278V	NM_017883	NP_060353	WXS	Illumina HiSeq	Unspecified	Q9H1Z4	WDR13_HUMAN			7	981	+			278					Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Silent	SNP	ENST00000218056.5	37	c.834G>T	CCDS14302.1																																																																																				0.587	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2			7	24	1	0	2.52707e-12	0.006214	3.77264e-12	7	24				
AKAP4	8852	broad.mit.edu	37	X	49955642	49955642	+	Silent	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:49955642G>T	ENST00000376056.2	-	6	2649	c.2499C>A	c.(2497-2499)gcC>gcA	p.A833A	AKAP4_ENST00000358526.2_Silent_p.A842A|AKAP4_ENST00000376064.3_Silent_p.A833A|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Silent_p.A459A					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					ACTGTTTCCTGGCCACCTTTC	0.532																																							uc004dow.1		NA																	0				kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8						c.(2524-2526)GCC>GCA		A-kinase anchor protein 4 isoform 1							192.0	149.0	163.0					X																	49955642		2203	4300	6503	SO:0001819	synonymous_variant	8852				cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding	g.chrX:49955642G>T	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.2499C>A	X.37:g.49955642G>T			Somatic				AKAP4_uc004dov.1_Silent_p.A459A|AKAP4_uc010njp.1_Silent_p.A664A|AKAP4_uc004dou.1_Silent_p.A833A	p.A842A	NM_003886	NP_003877	WXS	Illumina HiSeq	Unspecified	Q5JQC9	AKAP4_HUMAN			6	2650	-	Ovarian(276;0.236)		842						Silent	SNP	ENST00000376056.2	37	c.2526C>A	CCDS14330.1																																																																																				0.532	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886		22	44	1	0	3.62473e-10	0.001882	5.1432e-10	22	44				
DGKK	139189	broad.mit.edu	37	X	50213148	50213148	+	RNA	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:50213148G>T	ENST00000376025.2	-	0	589							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					ACATGGTGCTGGACTTGGACG	0.612																																							uc010njr.1		NA																	0				ovary(1)|kidney(1)	2						c.(529-531)CCA>CAA		diacylglycerol kinase kappa							36.0	36.0	36.0					X																	50213148		1967	4127	6094			139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50213148G>T	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50213148G>T			Somatic					p.P177Q	NM_001013742	NP_001013764	WXS	Illumina HiSeq	Unspecified	Q5KSL6	DGKK_HUMAN			1	590	-	Ovarian(276;0.236)		177			33 X 4 AA approximate tandem repeats of E-P-A-P.|33.		B2RP91	Missense_Mutation	SNP	ENST00000376025.2	37	c.530C>A																																																																																					0.612	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		4	21	1	0	0.000602214	0.000602	0.000694863	4	21				
ITIH6	347365	broad.mit.edu	37	X	54814955	54814955	+	Silent	SNP	A	A	G			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:54814955A>G	ENST00000218436.6	-	5	773	c.744T>C	c.(742-744)gtT>gtC	p.V248V	ITIH6_ENST00000498398.1_5'UTR	NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	248					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										CATCGTACTGAACCAGGAAGT	0.582																																							uc004dtj.2		NA																	0				lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(742-744)GTT>GTC		inter-alpha (globulin) inhibitor H5-like							166.0	99.0	121.0					X																	54814955		2203	4300	6503	SO:0001819	synonymous_variant	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54814955A>G	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.744T>C	X.37:g.54814955A>G			Somatic					p.V248V	NM_198510	NP_940912	WXS	Illumina HiSeq	Unspecified	Q6UXX5	ITH5L_HUMAN			5	774	-			248					A6NN03	Silent	SNP	ENST00000218436.6	37	c.744T>C	CCDS14361.1																																																																																				0.582	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		9	50	0	0	0	0.006214	0	9	50				
ATRX	546	broad.mit.edu	37	X	76938069	76938069	+	Silent	SNP	G	G	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:76938069G>C	ENST00000373344.5	-	9	2893	c.2679C>G	c.(2677-2679)ggC>ggG	p.G893G	ATRX_ENST00000395603.3_Silent_p.G855G|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	893					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TATCAACTGTGCCTTCTGCTG	0.423			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		1	Unknown(1)		bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(2677-2679)GGC>GGG		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						228.0	213.0	218.0					X																	76938069		2203	4296	6499	SO:0001819	synonymous_variant	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76938069G>C	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2679C>G	X.37:g.76938069G>C			Somatic				ATRX_uc004ecq.3_Silent_p.G855G|ATRX_uc004eco.3_Silent_p.G678G|ATRX_uc004ecr.2_Silent_p.G825G|ATRX_uc010nlx.1_Silent_p.G864G|ATRX_uc010nly.1_Silent_p.G838G	p.G893G	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			9	2911	-			893					D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	ENST00000373344.5	37	c.2679C>G	CCDS14434.1																																																																																				0.423	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		38	173	0	0	0	0.003214	0	38	173				
ATP7A	538	broad.mit.edu	37	X	77244097	77244097	+	Silent	SNP	T	T	C			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:77244097T>C	ENST00000341514.6	+	3	635	c.480T>C	c.(478-480)tgT>tgC	p.C160C	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Silent_p.C160C	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	160					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CAGGAGCTTGTGAAGATCATA	0.418																																							uc004ecx.3		NA																	0					0						c.(478-480)TGT>TGC		ATPase, Cu++ transporting, alpha polypeptide							127.0	122.0	124.0					X																	77244097		2203	4296	6499	SO:0001819	synonymous_variant	538				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity	g.chrX:77244097T>C	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.480T>C	X.37:g.77244097T>C			Somatic				ATP7A_uc004ecw.2_Silent_p.C160C	p.C160C	NM_000052	NP_000043	WXS	Illumina HiSeq	Unspecified	Q04656	ATP7A_HUMAN			3	640	+			160			Cytoplasmic (Potential).		B1AT72|O00227|O00745|Q9BYY8	Silent	SNP	ENST00000341514.6	37	c.480T>C	CCDS35339.1																																																																																				0.418	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052		17	99	0	0	0	0.008871	0	17	99				
BRWD3	254065	broad.mit.edu	37	X	79951432	79951433	+	Missense_Mutation	DNP	TT	TT	AA			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	TT	TT	-	-	TT	TT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:79951432_79951433TT>AA	ENST00000373275.4	-	27	3341_3342	c.3125_3126AA>TT	c.(3124-3126)gAA>gTT	p.E1042V	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1042					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TTTCTTTGGCTTCATTATAAAA	0.302																																							uc004edt.2		NA																	0				ovary(4)	4						c.(3124-3126)GAA>GTT		bromodomain and WD repeat domain containing 3																																				SO:0001583	missense	254065							g.chrX:79951432_79951433TT>AA		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.3125_3126delinsAA	X.37:g.79951432_79951433delinsAA	ENSP00000362372:p.Glu1042Val		Somatic				BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Missense_Mutation_p.E638V|BRWD3_uc004edp.2_Missense_Mutation_p.E871V|BRWD3_uc004edq.2_Missense_Mutation_p.E638V|BRWD3_uc010nmj.1_Missense_Mutation_p.E638V|BRWD3_uc004edr.2_Missense_Mutation_p.E712V|BRWD3_uc004eds.2_Missense_Mutation_p.E638V|BRWD3_uc004edu.2_Missense_Mutation_p.E712V|BRWD3_uc004edv.2_Missense_Mutation_p.E638V|BRWD3_uc004edw.2_Missense_Mutation_p.E638V|BRWD3_uc004edx.2_Missense_Mutation_p.E638V|BRWD3_uc004edy.2_Missense_Mutation_p.E638V|BRWD3_uc004edz.2_Missense_Mutation_p.E712V|BRWD3_uc004eea.2_Missense_Mutation_p.E712V|BRWD3_uc004eeb.2_Missense_Mutation_p.E638V	p.E1042V	NM_153252	NP_694984	WXS	Illumina HiSeq	Unspecified	Q6RI45	BRWD3_HUMAN			27	3388_3389	-			1042					C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	DNP	ENST00000373275.4	37	c.3125_3126AA>TT	CCDS14447.1																																																																																				0.302	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		8	26	0	0	0	0.004672	0	8	26				
KLHL4	56062	broad.mit.edu	37	X	86868949	86868949	+	Missense_Mutation	SNP	C	C	A	rs146051966	byFrequency	TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:86868949C>A	ENST00000373119.4	+	2	637	c.492C>A	c.(490-492)caC>caA	p.H164Q	KLHL4_ENST00000373114.4_Missense_Mutation_p.H164Q	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	164						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						TTATAAACCACGCAGAGCAAA	0.423																																							uc004efb.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(490-492)CAC>CAA		kelch-like 4 isoform 1							106.0	89.0	95.0					X																	86868949		2203	4299	6502	SO:0001583	missense	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86868949C>A	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.492C>A	X.37:g.86868949C>A	ENSP00000362211:p.His164Gln		Somatic				KLHL4_uc004efa.2_Missense_Mutation_p.H164Q	p.H164Q	NM_019117	NP_061990	WXS	Illumina HiSeq	Unspecified	Q9C0H6	KLHL4_HUMAN			2	674	+			164					B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	c.492C>A	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068702	0.36470	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.72615	-0.67;-0.67	5.16	-0.0541	0.13815	BTB/POZ fold (2);	0.240778	0.42682	D	0.000663	T	0.79173	0.4401	M	0.71581	2.175	0.58432	D	0.999997	D;D	0.89917	0.999;1.0	D;D	0.79784	0.983;0.993	T	0.77032	-0.2738	10	0.87932	D	0	.	9.1597	0.37014	0.0:0.3274:0.0:0.6726	.	164;164	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	Q	164	ENSP00000362211:H164Q;ENSP00000362206:H164Q	ENSP00000362206:H164Q	H	+	3	2	KLHL4	86755605	1.000000	0.71417	0.928000	0.36995	0.265000	0.26407	0.882000	0.28186	-0.104000	0.12154	-1.586000	0.00850	CAC		0.423	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			15	64	1	0	0.000308642	0.003163	0.000361421	15	64				
ARMCX2	9823	broad.mit.edu	37	X	100911668	100911668	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:100911668C>A	ENST00000328766.5	-	5	1360	c.907G>T	c.(907-909)Gaa>Taa	p.E303*	ARMCX2_ENST00000330154.2_Nonsense_Mutation_p.E303*|ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000356824.4_Nonsense_Mutation_p.E303*	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	303						integral component of membrane (GO:0016021)				NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						TCGTCTACTTCAACTTTGCTT	0.597																																							uc004eid.2		NA																	0				ovary(6)	6						c.(907-909)GAA>TAA		ALEX2 protein							135.0	147.0	143.0					X																	100911668		2203	4300	6503	SO:0001587	stop_gained	9823					integral to membrane	binding	g.chrX:100911668C>A	AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.907G>T	X.37:g.100911668C>A	ENSP00000331662:p.Glu303*		Somatic				ARMCX2_uc004eie.3_Nonsense_Mutation_p.E303*|ARMCX2_uc004eif.3_Nonsense_Mutation_p.E303*|ARMCX2_uc004eig.3_Nonsense_Mutation_p.E303*|ARMCX2_uc010nnt.2_Nonsense_Mutation_p.E303*	p.E303*	NM_177949	NP_808818	WXS	Illumina HiSeq	Unspecified	Q7L311	ARMX2_HUMAN			3	1262	-			303					O60267|Q5H9D9	Nonsense_Mutation	SNP	ENST00000328766.5	37	c.907G>T	CCDS14490.1	.	.	.	.	.	.	.	.	.	.	C	40	8.045544	0.98627	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824	.	.	.	4.32	4.32	0.51571	.	0.180162	0.27016	N	0.021345	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-6.9109	7.9356	0.29929	0.0:0.8798:0.0:0.1202	.	.	.	.	X	303	.	ENSP00000331662:E303X	E	-	1	0	ARMCX2	100798324	0.996000	0.38824	1.000000	0.80357	0.876000	0.50452	3.543000	0.53633	2.086000	0.62901	0.422000	0.28245	GAA		0.597	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782		24	100	1	0	9.22233e-05	0.004656	0.000110879	24	100				
BHLHB9	80823	broad.mit.edu	37	X	102005252	102005252	+	Silent	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:102005252C>A	ENST00000372735.1	+	4	1914	c.1329C>A	c.(1327-1329)gcC>gcA	p.A443A	BHLHB9_ENST00000447531.1_Silent_p.A443A|BHLHB9_ENST00000448867.1_Silent_p.A443A|BHLHB9_ENST00000361229.4_Silent_p.A443A|BHLHB9_ENST00000457056.1_Silent_p.A443A			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	443					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ACATTGTTGCCAATTACTTTT	0.363																																							uc010nog.2		NA																	0				ovary(2)	2						c.(1327-1329)GCC>GCA		basic helix-loop-helix domain containing, class							73.0	72.0	72.0					X																	102005252		2203	4300	6503	SO:0001819	synonymous_variant	80823					cytoplasm|nucleus	binding	g.chrX:102005252C>A	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.1329C>A	X.37:g.102005252C>A			Somatic				BHLHB9_uc011mrq.1_Silent_p.A443A|BHLHB9_uc011mrr.1_Silent_p.A443A|BHLHB9_uc011mrs.1_Silent_p.A443A|BHLHB9_uc011mrt.1_Silent_p.A443A|BHLHB9_uc004ejo.2_Silent_p.A443A|BHLHB9_uc011mru.1_Silent_p.A443A|BHLHB9_uc011mrv.1_Silent_p.A443A	p.A443A	NM_001142526	NP_001135998	WXS	Illumina HiSeq	Unspecified	Q6PI77	BHLH9_HUMAN			4	1900	+			443					Q9C0G2	Silent	SNP	ENST00000372735.1	37	c.1329C>A	CCDS14502.1																																																																																				0.363	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639		7	59	1	0	2.0095e-06	0.001984	2.56272e-06	7	59				
TMEM31	203562	broad.mit.edu	37	X	102968776	102968776	+	Silent	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:102968776C>A	ENST00000319560.6	+	3	548	c.357C>A	c.(355-357)atC>atA	p.I119I	GLRA4_ENST00000372617.4_Intron	NM_182541.2	NP_872347.2	Q5JXX7	TMM31_HUMAN	transmembrane protein 31	119						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						TGGAAAAGATCGGACTGCCCA	0.418																																							uc004elh.2		NA																	0					0						c.(355-357)ATC>ATA		transmembrane protein 31							191.0	143.0	159.0					X																	102968776		2203	4300	6503	SO:0001819	synonymous_variant	203562					integral to membrane		g.chrX:102968776C>A	BC029575	CCDS35359.1	Xq22.2	2008-02-05			ENSG00000179363	ENSG00000179363			28601	protein-coding gene	gene with protein product						12477932	Standard	NM_182541		Approved	MGC39655	uc004elh.3	Q5JXX7	OTTHUMG00000022109	ENST00000319560.6:c.357C>A	X.37:g.102968776C>A			Somatic				GLRA4_uc011mse.1_Intron	p.I119I	NM_182541	NP_872347	WXS	Illumina HiSeq	Unspecified	Q5JXX7	TMM31_HUMAN			3	548	+			119			Helical; (Potential).		Q8NHR4	Silent	SNP	ENST00000319560.6	37	c.357C>A	CCDS35359.1																																																																																				0.418	TMEM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057741.1	NM_182541		14	80	1	0	4.63292e-17	0.008871	7.48395e-17	14	80				
ZCCHC16	340595	broad.mit.edu	37	X	111698533	111698533	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:111698533C>T	ENST00000340433.2	+	1	807	c.577C>T	c.(577-579)Cag>Tag	p.Q193*		NM_001004308.2	NP_001004308.2	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	193							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.Q193K(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27						TGATCCCAACCAGGATGAAGA	0.473																																							uc004epo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(577-579)CAG>TAG		zinc finger, CCHC domain containing 16							120.0	102.0	108.0					X																	111698533		2203	4300	6503	SO:0001587	stop_gained	340595						nucleic acid binding|zinc ion binding	g.chrX:111698533C>T	AK128465	CCDS35369.1	Xq23	2008-05-02			ENSG00000187823	ENSG00000187823		"""Zinc fingers, CCHC domain containing"""	25214	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_001004308		Approved	Mart4, Mar4, FLJ46608	uc004epo.1	Q6ZR62	OTTHUMG00000159706	ENST00000340433.2:c.577C>T	X.37:g.111698533C>T	ENSP00000340590:p.Gln193*		Somatic					p.Q193*	NM_001004308	NP_001004308	WXS	Illumina HiSeq	Unspecified	Q6ZR62	ZCH16_HUMAN			3	1018	+			193					B2RPG1	Nonsense_Mutation	SNP	ENST00000340433.2	37	c.577C>T	CCDS35369.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987674	0.53934	.	.	ENSG00000187823	ENST00000340433	.	.	.	4.12	2.27	0.28462	.	0.473864	0.16720	N	0.202288	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	1.2561	4.614	0.12417	0.0:0.6523:0.2222:0.1255	.	.	.	.	X	193	.	ENSP00000340590:Q193X	Q	+	1	0	ZCCHC16	111585189	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-0.033000	0.12246	0.476000	0.27440	0.529000	0.55759	CAG		0.473	ZCCHC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356964.1	NM_001004308		19	76	0	0	0	0.001523	0	19	76				
IGSF1	3547	broad.mit.edu	37	X	130412049	130412049	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:130412049G>T	ENST00000361420.3	-	13	2180	c.2101C>A	c.(2101-2103)Ctc>Atc	p.L701I	IGSF1_ENST00000370910.1_Missense_Mutation_p.L692I|IGSF1_ENST00000370904.1_Missense_Mutation_p.L692I|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370903.3_Missense_Mutation_p.L706I			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	701	Ig-like C2-type 7.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TTGCACCGGAGTTGTAGTTCC	0.522																																							uc004ewd.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)	5						c.(2101-2103)CTC>ATC		immunoglobulin superfamily, member 1 isoform 1							85.0	76.0	79.0					X																	130412049		2203	4300	6503	SO:0001583	missense	3547				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding	g.chrX:130412049G>T	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.2101C>A	X.37:g.130412049G>T	ENSP00000355010:p.Leu701Ile		Somatic				IGSF1_uc004ewe.3_Missense_Mutation_p.L695I|IGSF1_uc004ewf.2_Missense_Mutation_p.L681I	p.L701I	NM_001555	NP_001546	WXS	Illumina HiSeq	Unspecified	Q8N6C5	IGSF1_HUMAN			13	2339	-			701			Extracellular (Potential).|Ig-like C2-type 7.		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	c.2101C>A	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.500244	0.01001	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.01474	4.85;4.85;4.85;4.85	4.72	2.08	0.27032	Immunoglobulin-like fold (1);	0.533387	0.15793	N	0.244322	T	0.01254	0.0041	N	0.11927	0.2	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.16289	0.001;0.015;0.002	T	0.47849	-0.9085	10	0.35671	T	0.21	.	7.7998	0.29168	0.0:0.0:0.43:0.57	.	692;145;701	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	I	692;701;692;706	ENSP00000359947:L692I;ENSP00000355010:L701I;ENSP00000359941:L692I;ENSP00000359940:L706I	ENSP00000355010:L701I	L	-	1	0	IGSF1	130239730	1.000000	0.71417	0.859000	0.33776	0.119000	0.20118	0.638000	0.24674	0.713000	0.32060	-0.339000	0.08088	CTC		0.522	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			27	109	1	0	5.91797e-21	0.002445	9.91574e-21	27	109				
FAM127C	441518	broad.mit.edu	37	X	134156229	134156229	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:134156229C>T	ENST00000391440.1	-	1	330	c.261G>A	c.(259-261)gaG>gaA	p.E87E		NM_001078173.1	NP_001071641.1	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	87										breast(1)|endometrium(2)|large_intestine(1)|lung(2)	6	Acute lymphoblastic leukemia(192;0.000127)					GGAGGGGGCTCTCCTTCTTGA	0.627																																							uc004eyc.1		NA																	0					0						c.(259-261)GAG>GAA		family with sequence similarity 127, member C							47.0	51.0	50.0					X																	134156229		2155	4242	6397	SO:0001819	synonymous_variant	441518							g.chrX:134156229C>T	BC048268	CCDS43996.1	Xq26.3	2014-05-16			ENSG00000212747	ENSG00000212747			33156	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078173		Approved	MAR8B, CXX1c	uc004eyc.1	Q17RB0	OTTHUMG00000022464	ENST00000391440.1:c.261G>A	X.37:g.134156229C>T			Somatic					p.E87E	NM_001078173	NP_001071641	WXS	Illumina HiSeq	Unspecified	Q17RB0	F127C_HUMAN			1	338	-	Acute lymphoblastic leukemia(192;0.000127)		87						Silent	SNP	ENST00000391440.1	37	c.261G>A	CCDS43996.1																																																																																				0.627	FAM127C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058389.2	NM_001078173		11	40	0	0	0	0.000978	0	11	40				
FAM127A	8933	broad.mit.edu	37	X	134166554	134166554	+	Silent	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:134166554G>T	ENST00000257013.7	+	1	222	c.141G>T	c.(139-141)acG>acT	p.T47T	FAM127A_ENST00000464369.1_3'UTR	NM_001078171.1	NP_001071639.1	O15255	CXX1_HUMAN	family with sequence similarity 127, member A	0						plasma membrane (GO:0005886)				endometrium(3)|urinary_tract(1)	4	Acute lymphoblastic leukemia(192;0.000127)					TCGTGCAGACGGGCTCCTACA	0.637																																							uc004eyd.2		NA																	0					0						c.(139-141)ACG>ACT		family with sequence similarity 127, member A							101.0	104.0	103.0					X																	134166554		2180	4257	6437	SO:0001819	synonymous_variant	8933							g.chrX:134166554G>T	Y13374	CCDS43997.1	Xq26	2014-05-16	2006-11-16	2006-11-16	ENSG00000134590	ENSG00000134590			2569	protein-coding gene	gene with protein product		300213	"""CAAX box 1"""	CXX1		9403077, 15716091, 16093683	Standard	NM_001078171		Approved	Mart8, Mar8, MAR8C	uc004eyd.3	A6ZKI3	OTTHUMG00000022465	ENST00000257013.7:c.141G>T	X.37:g.134166554G>T			Somatic				uc004eye.1_RNA	p.T47T	NM_001078171	NP_001071639	WXS	Illumina HiSeq	Unspecified	A6ZKI3	F127A_HUMAN			1	222	+	Acute lymphoblastic leukemia(192;0.000127)		47					Q6IBF1	Silent	SNP	ENST00000257013.7	37	c.141G>T	CCDS43997.1																																																																																				0.637	FAM127A-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058391.2	NM_001078171		16	71	1	0	1.96292e-10	0.001523	2.79783e-10	16	71				
BGN	633	broad.mit.edu	37	X	152772061	152772061	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:152772061C>T	ENST00000331595.4	+	5	826	c.640C>T	c.(640-642)Cgc>Tgc	p.R214C	BGN_ENST00000480756.1_3'UTR	NM_001711.4	NP_001702.1	P21810	PGS1_HUMAN	biglycan	214					blood vessel remodeling (GO:0001974)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|transport vesicle (GO:0030133)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|glycosaminoglycan binding (GO:0005539)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAACTACCTGCGCATCTCAGA	0.602													C|||	1	0.000264901	0.0	0.0	3775	,	,		13887	0.001		0.0	False		,,,				2504	0.0						uc004fhr.1		NA																	0				breast(2)	2						c.(640-642)CGC>TGC		biglycan preproprotein							111.0	93.0	99.0					X																	152772061		2203	4300	6503	SO:0001583	missense	633					proteinaceous extracellular matrix|transport vesicle	extracellular matrix structural constituent	g.chrX:152772061C>T	AK092954	CCDS14721.1	Xq28	2008-02-05			ENSG00000182492	ENSG00000182492		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1044	protein-coding gene	gene with protein product	"""biglycan proteoglycan"""	301870				1612609	Standard	NM_001711		Approved	DSPG1, SLRR1A	uc004fhr.2	P21810	OTTHUMG00000024205	ENST00000331595.4:c.640C>T	X.37:g.152772061C>T	ENSP00000327336:p.Arg214Cys		Somatic				BGN_uc004fhq.1_RNA	p.R214C	NM_001711	NP_001702	WXS	Illumina HiSeq	Unspecified	P21810	PGS1_HUMAN			5	812	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		214			LRR 6.		D3DWU3|P13247	Missense_Mutation	SNP	ENST00000331595.4	37	c.640C>T	CCDS14721.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196885	0.79015	.	.	ENSG00000182492	ENST00000331595;ENST00000431891;ENST00000370204;ENST00000430380	T;D;T	0.83837	0.36;-1.77;0.36	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.90940	0.7152	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92032	0.5634	10	0.87932	D	0	-26.5888	11.6358	0.51202	0.1782:0.8218:0.0:0.0	.	214	P21810	PGS1_HUMAN	C	214;231;153;153	ENSP00000327336:R214C;ENSP00000402525:R231C;ENSP00000359223:R153C	ENSP00000327336:R214C	R	+	1	0	BGN	152425255	0.993000	0.37304	1.000000	0.80357	0.995000	0.86356	0.984000	0.29565	2.079000	0.62486	0.529000	0.55759	CGC		0.602	BGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060981.1	NM_001711		7	62	0	0	0	0.004482	0	7	62				
NAA10	8260	broad.mit.edu	37	X	153197846	153197846	+	Silent	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:153197846C>T	ENST00000464845.1	-	5	582	c.264G>A	c.(262-264)caG>caA	p.Q88Q	NAA10_ENST00000370015.4_Silent_p.Q88Q|NAA10_ENST00000393712.3_Silent_p.Q88Q|NAA10_ENST00000370009.1_Silent_p.Q88Q|NAA10_ENST00000393710.3_5'UTR	NM_001256120.1|NM_003491.3	NP_001243049.1|NP_003482.1	P41227	NAA10_HUMAN	N(alpha)-acetyltransferase 10, NatA catalytic subunit	88	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				DNA packaging (GO:0006323)|internal protein amino acid acetylation (GO:0006475)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleolus (GO:0005730)|nucleus (GO:0005634)	N-acetyltransferase activity (GO:0008080)|peptide alpha-N-acetyltransferase activity (GO:0004596)			breast(1)|endometrium(3)|kidney(1)|lung(3)|ovary(1)|prostate(1)	10						CCATCAGTTTCTGAGCCAGAC	0.587																																					Ovarian(94;1099 1433 38814 45882 51063)	Ovarian(94;1099 1433 38814 45882 51063)	uc004fjm.1		NA																	0				ovary(1)	1						c.(262-264)CAG>CAA		alpha-N-acetyltransferase 1A							57.0	53.0	54.0					X																	153197846		2202	4300	6502	SO:0001819	synonymous_variant	8260				DNA packaging|internal protein amino acid acetylation|N-terminal protein amino acid acetylation	cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding	g.chrX:153197846C>T	BC000308	CCDS14737.1, CCDS59179.1	Xq28	2010-05-07	2010-01-14	2010-01-14	ENSG00000102030	ENSG00000102030	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	18704	protein-coding gene	gene with protein product		300013	"""ARD1 homolog, N-acetyltransferase (S. cerevisiae)"", ""ARD1 homolog A, N-acetyltransferase (S. cerevisiae)"""	ARD1, ARD1A		7981673, 19660095	Standard	NM_003491		Approved	DXS707, TE2	uc004fjm.2	P41227	OTTHUMG00000024225	ENST00000464845.1:c.264G>A	X.37:g.153197846C>T			Somatic				NAA10_uc004fjn.1_Silent_p.Q88Q|NAA10_uc011mzg.1_Silent_p.Q88Q	p.Q88Q	NM_003491	NP_003482	WXS	Illumina HiSeq	Unspecified	P41227	NAA10_HUMAN			5	375	-			88			N-acetyltransferase.		A6NM98	Silent	SNP	ENST00000464845.1	37	c.264G>A	CCDS14737.1																																																																																				0.587	NAA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061108.2	NM_003491		3	41	0	0	0	0.000602	0	3	41				
HCFC1	3054	broad.mit.edu	37	X	153220568	153220568	+	Silent	SNP	G	G	A	rs372258214		TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:153220568G>A	ENST00000310441.7	-	17	4248	c.3282C>T	c.(3280-3282)gcC>gcT	p.A1094A	HCFC1_ENST00000354233.3_Silent_p.A1025A|HCFC1_ENST00000369984.4_Silent_p.A1094A	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1094					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGTtggaggtggcggtggtgg	0.657																																							uc004fjp.2		NA																	0				ovary(2)	2						c.(3280-3282)GCC>GCT		host cell factor 1		G		1,3770		0,0,1,1600,570	34.0	42.0	39.0		3282	4.0	1.0	X		39	0,6675		0,0,0,2418,1839	no	coding-synonymous	HCFC1	NM_005334.2		0,0,1,4018,2409	AA,AG,A,GG,G		0.0,0.0265,0.0096		1094/2036	153220568	1,10445	2171	4257	6428	SO:0001819	synonymous_variant	3054				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chrX:153220568G>A		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.3282C>T	X.37:g.153220568G>A			Somatic					p.A1094A	NM_005334	NP_005325	WXS	Illumina HiSeq	Unspecified	P51610	HCFC1_HUMAN			17	3810	-	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		1094			HCF repeat 2.		Q6P4G5	Silent	SNP	ENST00000310441.7	37	c.3282C>T	CCDS44020.1																																																																																				0.657	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334		15	53	0	0	0	0.001882	0	15	53				
TKTL1	8277	broad.mit.edu	37	X	153551630	153551630	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:153551630C>A	ENST00000369915.3	+	9	1453	c.1264C>A	c.(1264-1266)Cca>Aca	p.P422T	TKTL1_ENST00000369912.2_Missense_Mutation_p.P366T|TKTL1_ENST00000217905.7_Missense_Mutation_p.P162T	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	422					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GATCTTCTACCCAACTGATGC	0.517																																							uc004fkg.2		NA																	0				ovary(3)|skin(1)	4						c.(1264-1266)CCA>ACA		transketolase-like 1 isoform a							181.0	134.0	150.0					X																	153551630		2203	4300	6503	SO:0001583	missense	8277				glucose catabolic process|thiamine metabolic process	cytoplasm|nucleus	metal ion binding|transketolase activity	g.chrX:153551630C>A	X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.1264C>A	X.37:g.153551630C>A	ENSP00000358931:p.Pro422Thr		Somatic				TKTL1_uc011mzl.1_Missense_Mutation_p.P416T|TKTL1_uc011mzm.1_Missense_Mutation_p.P218T|TKTL1_uc004fkh.2_Missense_Mutation_p.P366T	p.P422T	NM_012253	NP_036385	WXS	Illumina HiSeq	Unspecified	P51854	TKTL1_HUMAN			9	1450	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		422					A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	ENST00000369915.3	37	c.1264C>A	CCDS35448.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.108880	0.56398	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000217905;ENST00000369912	T;T;T	0.80738	-1.41;-1.41;-1.41	5.12	5.12	0.69794	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.91928	0.7444	M	0.92923	3.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	D	0.93639	0.6963	10	0.66056	D	0.02	-12.5867	16.2934	0.82760	0.0:1.0:0.0:0.0	.	162;416;422	B7Z7M4;B7Z7I0;P51854	.;.;TKTL1_HUMAN	T	422;366;162;366	ENSP00000358931:P422T;ENSP00000217905:P162T;ENSP00000358928:P366T	ENSP00000217905:P162T	P	+	1	0	TKTL1	153204824	1.000000	0.71417	0.999000	0.59377	0.029000	0.11900	7.115000	0.77110	2.366000	0.80165	0.436000	0.28706	CCA		0.517	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058923.1	NM_012253		21	81	1	0	3.28513e-13	0.003954	4.99911e-13	21	81				
F8	2157	broad.mit.edu	37	X	154158272	154158272	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:154158272G>T	ENST00000360256.4	-	14	3993	c.3793C>A	c.(3793-3795)Cca>Aca	p.P1265T		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1265	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TGAAGTACTGGAGCATATGCC	0.373																																							uc004fmt.2		NA																	0				ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(3793-3795)CCA>ACA		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						107.0	92.0	97.0					X																	154158272		2203	4299	6502	SO:0001583	missense	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154158272G>T	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3793C>A	X.37:g.154158272G>T	ENSP00000353393:p.Pro1265Thr		Somatic					p.P1265T	NM_000132	NP_000123	WXS	Illumina HiSeq	Unspecified	P00451	FA8_HUMAN			14	3964	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		1265			B.		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	c.3793C>A	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	g	0.524	-0.860662	0.02610	.	.	ENSG00000185010	ENST00000360256	D	0.99388	-5.81	5.0	2.01	0.26516	.	0.409046	0.20790	N	0.085634	D	0.97269	0.9107	M	0.66939	2.045	0.09310	N	1	P	0.35077	0.483	B	0.22386	0.039	D	0.93668	0.6987	10	0.56958	D	0.05	-1.4516	6.4518	0.21908	0.3681:0.0:0.6319:0.0	.	1265	P00451	FA8_HUMAN	T	1265	ENSP00000353393:P1265T	ENSP00000353393:P1265T	P	-	1	0	F8	153811466	0.004000	0.15560	0.001000	0.08648	0.099000	0.18886	0.185000	0.16958	-0.005000	0.14395	-0.468000	0.05107	CCA		0.373	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			9	44	1	0	1.76689e-08	0.006214	2.39901e-08	9	44				
WASH6P	653440	broad.mit.edu	37	X	155254961	155254961	+	RNA	SNP	C	C	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chrX:155254961C>T	ENST00000461007.1	+	0	3877				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.R453R(1)									CCTTTGCCCGCGTGTCAGACT	0.642																																							uc004fnx.3		NA																	1	Substitution - coding silent(1)		kidney(1)		NA						c.(715-717)CGC>CGT		WAS protein family homolog 1																																						0							g.chrX:155254961C>T	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254961C>T			Somatic					p.R239R	NM_182905	NP_878908	WXS	Illumina HiSeq	Unspecified					9	1171	+								A6NGF1|Q8N305	Silent	SNP	ENST00000461007.1	37	c.717C>T																																																																																					0.642	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1	NG_008380		7	12	0	0	0	0.00308	0	7	12				
NOL4	8715	broad.mit.edu	37	18	31709851	31709851	+	Frame_Shift_Del	DEL	T	T	-			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr18:31709851delT	ENST00000261592.5	-	2	695	c.398delA	c.(397-399)aagfs	p.K133fs	NOL4_ENST00000538587.1_Frame_Shift_Del_p.K59fs|NOL4_ENST00000535475.1_5'UTR|NOL4_ENST00000269185.4_Frame_Shift_Del_p.K19fs|NOL4_ENST00000589544.1_Frame_Shift_Del_p.K133fs	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	133						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						GTAAGTTCTCTTTTGTCCAGC	0.358																																							uc010dmi.2		NA																	0				ovary(3)	3						c.(397-399)AAGfs		nucleolar protein 4							137.0	118.0	125.0					18																	31709851		2203	4300	6503	SO:0001589	frameshift_variant	8715					nucleolus	RNA binding	g.chr18:31709851delT	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.398delA	18.37:g.31709851delT	ENSP00000261592:p.Lys133fs		Somatic				NOL4_uc002kxr.3_5'UTR|NOL4_uc010xbt.1_Frame_Shift_Del_p.K59fs|NOL4_uc010dmh.2_Frame_Shift_Del_p.K59fs|NOL4_uc010xbu.1_Frame_Shift_Del_p.K133fs|NOL4_uc002kxt.3_Frame_Shift_Del_p.K133fs|NOL4_uc010xbw.1_Frame_Shift_Del_p.K19fs	p.K133fs	NM_003787	NP_003778	WXS	Illumina HiSeq	Unspecified	O94818	NOL4_HUMAN			2	627	-			133					B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Frame_Shift_Del	DEL	ENST00000261592.5	37	c.398delA	CCDS11907.2																																																																																				0.358	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787		16	62	NA	NA	NA	NA	NA	16	62	---	---	---	---
FHOD3	80206	broad.mit.edu	37	18	34289064	34289064	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr18:34289064delC	ENST00000359247.4	+	14	1667	c.1667delC	c.(1666-1668)gccfs	p.A556fs	FHOD3_ENST00000257209.4_Frame_Shift_Del_p.A573fs|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000590592.1_Frame_Shift_Del_p.A748fs|FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000445677.1_Frame_Shift_Del_p.A535fs	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	556					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CCAGCAAGTGCCGGGGATCCT	0.537																																							uc002kzt.1		NA																	0				skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(1666-1668)GCCfs		formin homology 2 domain containing 3							90.0	107.0	101.0					18																	34289064		2203	4297	6500	SO:0001589	frameshift_variant	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34289064delC	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1667delC	18.37:g.34289064delC	ENSP00000352186:p.Ala556fs		Somatic				FHOD3_uc002kzr.1_Frame_Shift_Del_p.A556fs|FHOD3_uc002kzs.1_Frame_Shift_Del_p.A573fs|FHOD3_uc010dmz.1_Frame_Shift_Del_p.A288fs|FHOD3_uc010dna.1_5'UTR	p.A556fs	NM_025135	NP_079411	WXS	Illumina HiSeq	Unspecified	Q2V2M9	FHOD3_HUMAN			14	1764	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	556					A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Frame_Shift_Del	DEL	ENST00000359247.4	37	c.1667delC																																																																																					0.537	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		48	213	NA	NA	NA	NA	NA	48	213	---	---	---	---
ZNF761	388561	broad.mit.edu	37	19	53959847	53959847	+	RNA	DEL	G	G	-			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr19:53959847delG	ENST00000454407.1	+	0	2539							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		TAATGAGTGTGGCAAGAACTT	0.393																																							uc010eqp.2		NA																	0				ovary(1)	1						c.(2086-2088)GGCfs		zinc finger protein 761							103.0	105.0	104.0					19																	53959847		2203	4300	6503			388561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53959847delG	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959847delG			Somatic				ZNF761_uc010ydy.1_Frame_Shift_Del_p.G642fs|ZNF761_uc002qbt.1_Frame_Shift_Del_p.G642fs	p.G696fs	NM_001008401	NP_001008401	WXS	Illumina HiSeq	Unspecified	Q86XN6	ZN761_HUMAN		GBM - Glioblastoma multiforme(134;0.00786)	7	2544	+			696			C2H2-type 18.		Q6ZNB9	Frame_Shift_Del	DEL	ENST00000454407.1	37	c.2086delG																																																																																					0.393	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401		14	99	NA	NA	NA	NA	NA	14	99	---	---	---	---
NPHP1	4867	broad.mit.edu	37	2	110881617	110881625	+	In_Frame_Del	DEL	GGACTTCAG	GGACTTCAG	-			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	GGACTTCAG	GGACTTCAG	-	-	GGACTTCAG	GGACTTCAG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr2:110881617_110881625delGGACTTCAG	ENST00000393272.3	-	20	2039_2047	c.1942_1950delCTGAAGTCC	c.(1942-1950)ctgaagtccdel	p.LKS648del	NPHP1_ENST00000316534.4_In_Frame_Del_p.LKS649del|NPHP1_ENST00000417665.1_In_Frame_Del_p.LKS627del|NPHP1_ENST00000445609.2_In_Frame_Del_p.LKS593del|NPHP1_ENST00000355301.4_In_Frame_Del_p.LKS530del|AC013268.1_ENST00000390802.1_RNA	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	648					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						GGAGAAACGTGGACTTCAGGAACTCTTTG	0.459																																							uc002tfn.3		NA																	0				ovary(2)	2						c.(1942-1950)CTGAAGTCCdel		nephrocystin 1 isoform 2																																				SO:0001651	inframe_deletion	4867				actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity	g.chr2:110881617_110881625delGGACTTCAG	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.1942_1950delCTGAAGTCC	2.37:g.110881617_110881625delGGACTTCAG	ENSP00000376953:p.Leu648_Ser650del		Somatic				NPHP1_uc002tfm.3_In_Frame_Del_p.LKS593del|NPHP1_uc002tfl.3_In_Frame_Del_p.LKS649del|NPHP1_uc002tfo.3_In_Frame_Del_p.LKS530del|NPHP1_uc010ywx.1_In_Frame_Del_p.LKS592del	p.LKS648del	NM_207181	NP_997064	WXS	Illumina HiSeq	Unspecified	O15259	NPHP1_HUMAN			20	2036_2044	-			648_650					O14837	In_Frame_Del	DEL	ENST00000393272.3	37	c.1942_1950delCTGAAGTCC	CCDS46385.1																																																																																				0.459	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272		15	63	NA	NA	NA	NA	NA	15	63	---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1339578	1339579	+	Frame_Shift_Ins	INS	-	-	T			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:1339578_1339579insT	ENST00000446702.2	+	7	1291_1292	c.664_665insT	c.(664-666)atgfs	p.M222fs	CNTN6_ENST00000350110.2_Frame_Shift_Ins_p.M222fs|CNTN6_ENST00000539053.1_Frame_Shift_Ins_p.M150fs			Q9UQ52	CNTN6_HUMAN	contactin 6	222					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AACAGGTGTGATGGGGGAATAT	0.351																																							uc003boz.2		NA																	0				skin(3)|lung(2)|breast(2)|pancreas(1)	8						c.(664-666)ATGfs		contactin 6 precursor																																				SO:0001589	frameshift_variant	27255				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane		g.chr3:1339578_1339579insT	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.665dupT	3.37:g.1339579_1339579dupT	ENSP00000407822:p.Met222fs		Somatic				CNTN6_uc010hbo.2_Frame_Shift_Ins_p.M217fs|CNTN6_uc011asj.1_Frame_Shift_Ins_p.M150fs|CNTN6_uc003bpa.2_Frame_Shift_Ins_p.M222fs	p.M222fs	NM_014461	NP_055276	WXS	Illumina HiSeq	Unspecified	Q9UQ52	CNTN6_HUMAN		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)	7	931_932	+		all_cancers(2;0.000164)|all_epithelial(2;0.107)	222					Q2KHM2	Frame_Shift_Ins	INS	ENST00000446702.2	37	c.664_665insT	CCDS2557.1																																																																																				0.351	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461		19	69	NA	NA	NA	NA	NA	19	69	---	---	---	---
MKRN2	23609	broad.mit.edu	37	3	12623307	12623308	+	Splice_Site	INS	-	-	A			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr3:12623307_12623308insA	ENST00000170447.7	+	7	1106_1107	c.969_970insA	c.(970-972)aaa>Aaaa	p.K324fs	MKRN2_ENST00000411987.1_Splice_Site_p.K281fs|MKRN2_ENST00000448482.1_Splice_Site_p.K322fs	NM_001271707.1|NM_014160.3	NP_001258636.1|NP_054879.3	Q9H000	MKRN2_HUMAN	makorin ring finger protein 2	324					protein ubiquitination (GO:0016567)	intracellular (GO:0005622)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(3)	16						TGCTTTTCAGGAAAAAAGCCTG	0.52																																							uc003bxd.2		NA																	0					0						c.(967-972)GGGAAAfs		makorin ring finger protein 2																																				SO:0001630	splice_region_variant	23609					intracellular	ligase activity|nucleic acid binding|zinc ion binding	g.chr3:12623307_12623308insA		CCDS33702.1, CCDS63545.1	3p25	2008-08-13	2008-08-13		ENSG00000075975	ENSG00000075975		"""RING-type (C3HC4) zinc fingers"""	7113	protein-coding gene	gene with protein product		608426				11597136	Standard	NM_014160		Approved	RNF62, HSPC070	uc003bxd.4	Q9H000	OTTHUMG00000155371	ENST00000170447.7:c.969-1->A	3.37:g.12623313_12623313dupA			Somatic				MKRN2_uc003bxe.2_Frame_Shift_Ins_p.G321fs|MKRN2_uc011aus.1_Frame_Shift_Ins_p.G280fs	p.G323fs	NM_014160	NP_054879	WXS	Illumina HiSeq	Unspecified	Q9H000	MKRN2_HUMAN			7	1025_1026	+			323_324			C3H1-type 4.		A6NIA2|B3KRC5|B4DPR4|Q8N391|Q96BD4|Q9BUY2|Q9NRY1	Frame_Shift_Ins	INS	ENST00000170447.7	37	c.969_970insA	CCDS33702.1																																																																																				0.520	MKRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339679.1	NM_014160	Frame_Shift_Ins	7	49	NA	NA	NA	NA	NA	7	49	---	---	---	---
IGF2R	3482	broad.mit.edu	37	6	160464274	160464277	+	Frame_Shift_Del	DEL	AGGC	AGGC	-			TCGA-55-7911-01A-11D-2167-08	TCGA-55-7911-10A-01D-2167-08	AGGC	AGGC	-	-	AGGC	AGGC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	de6ded5a-1646-40fa-80a8-c916cef5dd94	c3cdccd4-e903-42d8-ac96-0a11e8fb9be4	g.chr6:160464274_160464277delAGGC	ENST00000356956.1	+	12	1723_1726	c.1575_1578delAGGC	c.(1573-1578)gaaggcfs	p.EG525fs		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	525					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TGCTGCAGGAAGGCAAGGCACGAG	0.505																																							uc003qta.2		NA																	0				ovary(3)	3						c.(1573-1578)GAAGGCfs		insulin-like growth factor 2 receptor precursor																																				SO:0001589	frameshift_variant	3482				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity	g.chr6:160464274_160464277delAGGC	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1575_1578delAGGC	6.37:g.160464274_160464277delAGGC	ENSP00000349437:p.Glu525fs		Somatic					p.E525fs	NM_000876	NP_000867	WXS	Illumina HiSeq	Unspecified	P11717	MPRI_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	12	1723_1726	+		Breast(66;0.000777)|Ovarian(120;0.0305)	525_526			4.|Lumenal (Potential).		Q7Z7G9|Q96PT5	Frame_Shift_Del	DEL	ENST00000356956.1	37	c.1575_1578delAGGC	CCDS5273.1																																																																																				0.505	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876		11	109	NA	NA	NA	NA	NA	11	109	---	---	---	---
