#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PRAMEF2	65122	broad.mit.edu	37	1	12921604	12921604	+	Silent	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:12921604T>A	ENST00000240189.2	+	4	1482	c.1395T>A	c.(1393-1395)tcT>tcA	p.S465S		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	465					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CATCACCGTCTGAGGAACTGG	0.542																																							uc001aum.1		NA																	0					0						c.(1393-1395)TCT>TCA		PRAME family member 2							21.0	25.0	24.0					1																	12921604		2003	4131	6134	SO:0001819	synonymous_variant	65122							g.chr1:12921604T>A		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.1395T>A	1.37:g.12921604T>A			Somatic					p.S465S	NM_023014	NP_075390	WXS	Illumina HiSeq	Unspecified	O60811	PRAM2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	4	1482	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	465						Silent	SNP	ENST00000240189.2	37	c.1395T>A	CCDS149.1																																																																																				0.542	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014		13	25	0	0	0	0.008871	0	13	25				
ARID1A	8289	broad.mit.edu	37	1	27106648	27106648	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:27106648G>A	ENST00000324856.7	+	20	6630	c.6259G>A	c.(6259-6261)Gga>Aga	p.G2087R	ARID1A_ENST00000540690.1_Missense_Mutation_p.G415R|ARID1A_ENST00000457599.2_Missense_Mutation_p.G1870R|ARID1A_ENST00000374152.2_Missense_Mutation_p.G1704R	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2087			G -> R (found in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:22009941}.		androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.G2087R(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TGTCCTGGACGGACTCCTACA	0.592			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		1	Substitution - Missense(1)		breast(1)	ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(6259-6261)GGA>AGA		AT rich interactive domain 1A isoform a							89.0	88.0	88.0					1																	27106648		2203	4300	6503	SO:0001583	missense	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27106648G>A	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6259G>A	1.37:g.27106648G>A	ENSP00000320485:p.Gly2087Arg		Somatic				ARID1A_uc001bmu.1_Missense_Mutation_p.G1870R|ARID1A_uc001bmx.1_Missense_Mutation_p.G933R|ARID1A_uc009vsm.1_Missense_Mutation_p.G415R|ARID1A_uc009vsn.1_Missense_Mutation_p.G329R	p.G2087R	NM_006015	NP_006006	WXS	Illumina HiSeq	Unspecified	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	20	6632	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	2087			LXXLL.		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	c.6259G>A	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.30|18.30	3.594610|3.594610	0.66219|0.66219	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	T;T;T;T|.	0.56941|.	0.43;0.43;0.43;0.43|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	0.051909|.	0.85682|.	N|.	0.000000|.	D|D	0.82337|0.82337	0.5015|0.5015	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;1.0;1.0|.	T|T	0.83271|0.83271	-0.0043|-0.0043	10|5	0.87932|.	D|.	0|.	-4.2604|-4.2604	19.0485|19.0485	0.93032|0.93032	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1704;2087;1870|.	O14497-3;O14497;O14497-2|.	.;ARI1A_HUMAN;.|.	R|Q	2087;1870;1704;415|983	ENSP00000320485:G2087R;ENSP00000387636:G1870R;ENSP00000363267:G1704R;ENSP00000442437:G415R|.	ENSP00000320485:G2087R|.	G|R	+|+	1|2	0|0	ARID1A|ARID1A	26979235|26979235	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.997000|0.997000	0.91878|0.91878	9.413000|9.413000	0.97351|0.97351	2.814000|2.814000	0.96858|0.96858	0.585000|0.585000	0.79938|0.79938	GGA|CGG		0.592	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		32	38	0	0	0	0.009535	0	32	38				
ASB17	127247	broad.mit.edu	37	1	76397612	76397612	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:76397612A>G	ENST00000284142.6	-	1	504	c.365T>C	c.(364-366)gTt>gCt	p.V122A		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	122					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						TCTGTCTTGAACATAGTCTTT	0.343																																							uc001dhe.1		NA																	0				ovary(1)	1						c.(364-366)GTT>GCT		ankyrin repeat and SOCS box-containing 17							59.0	57.0	58.0					1																	76397612		2203	4299	6502	SO:0001583	missense	127247				intracellular signal transduction			g.chr1:76397612A>G	AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.365T>C	1.37:g.76397612A>G	ENSP00000284142:p.Val122Ala		Somatic				ASB17_uc001dhf.1_RNA	p.V122A	NM_080868	NP_543144	WXS	Illumina HiSeq	Unspecified	Q8WXJ9	ASB17_HUMAN			1	505	-			122					B1APB8|Q8N0X5	Missense_Mutation	SNP	ENST00000284142.6	37	c.365T>C	CCDS671.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.612372	0.46631	.	.	ENSG00000154007	ENST00000284142	T	0.73047	-0.71	5.97	4.84	0.62591	Ankyrin repeat-containing domain (1);	0.275088	0.25857	N	0.027841	T	0.35537	0.0935	N	0.19112	0.55	0.29659	N	0.843333	B	0.14012	0.009	B	0.09377	0.004	T	0.27905	-1.0060	10	0.72032	D	0.01	.	8.7655	0.34700	0.9147:0.0:0.0853:0.0	.	122	Q8WXJ9	ASB17_HUMAN	A	122	ENSP00000284142:V122A	ENSP00000284142:V122A	V	-	2	0	ASB17	76170200	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.586000	0.36611	1.077000	0.40990	0.533000	0.62120	GTT		0.343	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868		3	54	0	0	0	0.004672	0	3	54				
NBPF9	400818	broad.mit.edu	37	1	144815953	144815953	+	Missense_Mutation	SNP	A	A	G	rs199822480	byFrequency	TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:144815953A>G	ENST00000440491.2	+	4	550	c.550A>G	c.(550-552)Aat>Gat	p.N184D	NBPF9_ENST00000338347.4_Missense_Mutation_p.N184D|NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000281815.8_5'UTR	NM_001037675.2	NP_001032764.2	Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	442	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.N184D(2)		NS(2)|prostate(1)	3						CAACGATGACAATGAAGATGT	0.423													.|||	2409	0.48103	0.388	0.4496	5008	,	,		14195	0.755		0.4533	False		,,,				2504	0.3753						uc009wig.1		NA																	2	Substitution - Missense(2)		kidney(2)		0						c.(1324-1326)AAT>GAT		hypothetical protein LOC400818																																				SO:0001583	missense	400818					cytoplasm		g.chr1:144815953A>G		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000440491.2:c.550A>G	1.37:g.144815953A>G	ENSP00000390934:p.Asn184Asp		Somatic				NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.N442D|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF9_uc009wii.1_Missense_Mutation_p.N171D|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Missense_Mutation_p.N102D	p.N442D	NM_001037675	NP_001032764	WXS	Illumina HiSeq	Unspecified	Q3BBV1	NBPFK_HUMAN			12	1400	+			442			NBPF 2.			Missense_Mutation	SNP	ENST00000440491.2	37	c.1324A>G		.	.	.	.	.	.	.	.	.	.	.	0.004	-2.349402	0.00219	.	.	ENSG00000168614	ENST00000338347;ENST00000440491	T;T	0.02323	4.34;4.34	0.723	0.723	0.18231	DUF1220 (1);	.	.	.	.	T	0.00328	0.0010	.	.	.	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.42137	-0.9469	7	0.02654	T	1	.	3.2222	0.06720	0.3262:0.0:0.6738:0.0	.	442	Q3BBV1	NBPFK_HUMAN	D	184	ENSP00000342975:N184D;ENSP00000390934:N184D	ENSP00000342975:N184D	N	+	1	0	NBPF9	143527310	0.002000	0.14202	0.001000	0.08648	0.004000	0.04260	-1.711000	0.01886	-0.094000	0.12374	-1.032000	0.02404	AAT		0.423	NBPF9-203	KNOWN	basic	protein_coding	protein_coding		NM_001037675		16	249	0	0	0	0.004007	0	16	249				
MTMR11	10903	broad.mit.edu	37	1	149906417	149906417	+	Silent	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:149906417C>A	ENST00000439741.2	-	6	721	c.471G>T	c.(469-471)gtG>gtT	p.V157V	MTMR11_ENST00000369140.3_Silent_p.V85V|MTMR11_ENST00000361405.6_Silent_p.V157V|MTMR11_ENST00000406732.3_Silent_p.V129V|MTMR11_ENST00000492824.1_5'UTR	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	157							phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			TGGCCATGGTCACCTGCAGAG	0.493																																							uc001etl.3		NA																	0				central_nervous_system(1)	1						c.(469-471)GTG>GTT		myotubularin related protein 11 isoform a							113.0	90.0	98.0					1																	149906417		2203	4300	6503	SO:0001819	synonymous_variant	10903						phosphatase activity	g.chr1:149906417C>A	AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.471G>T	1.37:g.149906417C>A			Somatic				MTMR11_uc001etm.1_Silent_p.V85V|MTMR11_uc010pbm.1_Silent_p.V129V|MTMR11_uc010pbn.1_5'UTR	p.V157V	NM_001145862	NP_001139334	WXS	Illumina HiSeq	Unspecified	A4FU01	MTMRB_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		6	722	-	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		157					B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Silent	SNP	ENST00000439741.2	37	c.471G>T	CCDS53360.1																																																																																				0.493	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_181873		15	49	1	0	1.49906e-05	0.00245	1.62026e-05	15	49				
GON4L	54856	broad.mit.edu	37	1	155735478	155735478	+	Silent	SNP	G	G	A	rs200394500		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:155735478G>A	ENST00000368331.1	-	21	3834	c.3786C>T	c.(3784-3786)ttC>ttT	p.F1262F	GON4L_ENST00000437809.1_Silent_p.F1262F|GON4L_ENST00000361040.5_Silent_p.F1262F|GON4L_ENST00000271883.5_Silent_p.F1262F|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1262					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCACTTTCGGGAAAACAGTAG	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		20886	0.001		0.0	False		,,,				2504	0.0						uc001flz.2		NA																	0				ovary(3)	3						c.(3784-3786)TTC>TTT		gon-4-like isoform a							92.0	92.0	92.0					1																	155735478		2203	4300	6503	SO:0001819	synonymous_variant	54856				regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr1:155735478G>A	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.3786C>T	1.37:g.155735478G>A			Somatic				GON4L_uc009wrg.1_RNA|GON4L_uc001fly.1_Silent_p.F1262F|GON4L_uc009wrh.1_Silent_p.F1262F|GON4L_uc001fma.1_Silent_p.F1262F|GON4L_uc001fmb.3_Silent_p.F458F|GON4L_uc001fmc.2_Silent_p.F1262F|GON4L_uc001fmd.3_Silent_p.F1262F|GON4L_uc009wri.2_Silent_p.F848F	p.F1262F	NM_001037533	NP_001032622	WXS	Illumina HiSeq	Unspecified	Q3T8J9	GON4L_HUMAN			21	3883	-	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)		1262					B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37	c.3786C>T																																																																																					0.512	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292		9	110	0	0	0	0.004482	0	9	110				
PYHIN1	149628	broad.mit.edu	37	1	158909030	158909030	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:158909030C>T	ENST00000368140.1	+	4	817	c.572C>T	c.(571-573)tCa>tTa	p.S191L	PYHIN1_ENST00000392252.3_Missense_Mutation_p.S182L|PYHIN1_ENST00000368135.4_Missense_Mutation_p.S191L|PYHIN1_ENST00000368138.3_Missense_Mutation_p.S182L|PYHIN1_ENST00000392254.2_Missense_Mutation_p.S191L	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	191					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AACACTTCCTCAACTGAGGTA	0.498																																							uc001ftb.2		NA																	0				ovary(3)|pancreas(1)	4						c.(571-573)TCA>TTA		pyrin and HIN domain family, member 1 alpha 1							146.0	129.0	135.0					1																	158909030		2203	4300	6503	SO:0001583	missense	149628				cell cycle	nuclear speck		g.chr1:158909030C>T	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.572C>T	1.37:g.158909030C>T	ENSP00000357122:p.Ser191Leu		Somatic				PYHIN1_uc001fta.3_Missense_Mutation_p.S191L|PYHIN1_uc001ftc.2_Missense_Mutation_p.S182L|PYHIN1_uc001ftd.2_Missense_Mutation_p.S191L|PYHIN1_uc001fte.2_Missense_Mutation_p.S182L	p.S191L	NM_152501	NP_689714	WXS	Illumina HiSeq	Unspecified	Q6K0P9	IFIX_HUMAN			4	817	+	all_hematologic(112;0.0378)		191					Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	37	c.572C>T	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	C	8.992	0.977928	0.18812	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252;ENST00000368135	T;T;T;T;T	0.25749	3.44;3.45;3.47;3.47;1.78	2.31	-3.48	0.04739	.	.	.	.	.	T	0.05686	0.0149	L	0.39898	1.24	0.09310	N	1	B;B;B;B;B	0.23591	0.088;0.024;0.088;0.011;0.001	B;B;B;B;B	0.21151	0.033;0.022;0.033;0.009;0.007	T	0.38564	-0.9655	8	.	.	.	.	7.123	0.25456	0.0:0.449:0.0:0.551	.	182;191;182;191;191	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9;Q6K0P9-5	.;.;.;IFIX_HUMAN;.	L	191;182;191;182;191	ENSP00000357122:S191L;ENSP00000357120:S182L;ENSP00000376083:S191L;ENSP00000376082:S182L;ENSP00000357117:S191L	.	S	+	2	0	PYHIN1	157175654	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-1.162000	0.03141	-0.870000	0.04047	-0.253000	0.11424	TCA		0.498	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501		18	97	0	0	0	0.012319	0	18	97				
RXRG	6258	broad.mit.edu	37	1	165386317	165386317	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:165386317G>A	ENST00000359842.5	-	4	885	c.583C>T	c.(583-585)Cgc>Tgc	p.R195C	RXRG_ENST00000470566.1_5'UTR	NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	195					gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	TTCTGATAGCGACAGTACTGG	0.512																																							uc001gda.2		NA																	0					0						c.(583-585)CGC>TGC		retinoid X receptor, gamma isoform a	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)						113.0	100.0	104.0					1																	165386317		2203	4300	6503	SO:0001583	missense	6258				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr1:165386317G>A	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.583C>T	1.37:g.165386317G>A	ENSP00000352900:p.Arg195Cys		Somatic					p.R195C	NM_006917	NP_008848	WXS	Illumina HiSeq	Unspecified	P48443	RXRG_HUMAN			4	883	-	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)		195			NR C4-type.|Nuclear receptor.		A6NIP1|Q6IBU7	Missense_Mutation	SNP	ENST00000359842.5	37	c.583C>T	CCDS1248.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010739	0.93346	.	.	ENSG00000143171	ENST00000359842	D	0.98633	-5.04	4.96	4.96	0.65561	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.99718	0.9891	H	0.99981	5.195	0.80722	D	1.000000	D	0.89917	1.0	D	0.97110	1.0	D	0.96751	0.9554	9	0.87932	D	0	.	16.9732	0.86306	0.0:0.0:1.0:0.0	.	195	P48443	RXRG_HUMAN	C	195	ENSP00000352900:R195C	ENSP00000352900:R195C	R	-	1	0	RXRG	163652941	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.497000	0.81536	2.565000	0.86533	0.655000	0.94253	CGC		0.512	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2	NM_006917		18	63	0	0	0	0.00499	0	18	63				
F5	2153	broad.mit.edu	37	1	169511240	169511240	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:169511240G>A	ENST00000367797.3	-	13	3289	c.3088C>T	c.(3088-3090)Cga>Tga	p.R1030*	F5_ENST00000367796.3_Nonsense_Mutation_p.R1035*	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1030	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TTCTTTTTTCGTGTCTTAATG	0.408																																							uc001ggg.1		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	GRCh37	CM032892	F5	M		c.(3088-3090)CGA>TGA		coagulation factor V precursor	Drotrecogin alfa(DB00055)						188.0	197.0	194.0					1																	169511240		2203	4300	6503	SO:0001587	stop_gained	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169511240G>A	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3088C>T	1.37:g.169511240G>A	ENSP00000356771:p.Arg1030*		Somatic					p.R1030*	NM_000130	NP_000121	WXS	Illumina HiSeq	Unspecified	P12259	FA5_HUMAN			13	3233	-	all_hematologic(923;0.208)		1030			B.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Nonsense_Mutation	SNP	ENST00000367797.3	37	c.3088C>T	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	42	9.275703	0.99122	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	.	.	.	5.81	5.81	0.92471	.	0.248475	0.31427	N	0.007670	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3835	15.6368	0.76961	0.0:0.0:1.0:0.0	.	.	.	.	X	1030;1035	.	ENSP00000356770:R1035X	R	-	1	2	F5	167777864	1.000000	0.71417	1.000000	0.80357	0.406000	0.30931	4.220000	0.58567	2.763000	0.94921	0.567000	0.79289	CGA		0.408	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		103	200	0	0	0	0.01441	0	103	200				
MROH9	80133	broad.mit.edu	37	1	170928657	170928657	+	Silent	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:170928657C>A	ENST00000367758.3	+	5	306	c.207C>A	c.(205-207)tcC>tcA	p.S69S	MROH9_ENST00000367759.4_Silent_p.S69S	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	69																	TAGAGTCATCCTTTGGAATGC	0.353																																							uc001ghg.2		NA																	0				pancreas(1)	1						c.(205-207)TCC>TCA		hypothetical protein LOC80133 isoform 2							121.0	111.0	114.0					1																	170928657		1848	4109	5957	SO:0001819	synonymous_variant	80133						binding	g.chr1:170928657C>A	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.207C>A	1.37:g.170928657C>A			Somatic				C1orf129_uc009wvy.2_5'UTR|C1orf129_uc010plz.1_Silent_p.S69S	p.S69S	NM_025063	NP_079339	WXS	Illumina HiSeq	Unspecified	Q5TGP6	CA129_HUMAN			5	337	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		69					A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Silent	SNP	ENST00000367758.3	37	c.207C>A	CCDS41436.1																																																																																				0.353	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063		8	70	1	0	1.12685e-05	0.004482	1.22316e-05	8	70				
FMO1	2326	broad.mit.edu	37	1	171251200	171251200	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:171251200A>G	ENST00000354841.4	+	6	1042	c.911A>G	c.(910-912)aAa>aGa	p.K304R	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Missense_Mutation_p.K241R|FMO1_ENST00000367750.3_Missense_Mutation_p.K304R	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	304					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	CCAAGCATAAAAGAGGTAAAG	0.403																																							uc009wvz.2		NA																	0				skin(1)	1						c.(910-912)AAA>AGA		flavin containing monooxygenase 1							97.0	90.0	92.0					1																	171251200		2203	4300	6503	SO:0001583	missense	2326				NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding	g.chr1:171251200A>G	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.911A>G	1.37:g.171251200A>G	ENSP00000346901:p.Lys304Arg		Somatic				FMO1_uc010pme.1_Missense_Mutation_p.K241R|FMO1_uc001ghl.2_Missense_Mutation_p.K304R|FMO1_uc001ghm.2_Missense_Mutation_p.K304R|FMO1_uc001ghn.2_Missense_Mutation_p.K304R	p.K304R	NM_002021	NP_002012	WXS	Illumina HiSeq	Unspecified	Q01740	FMO1_HUMAN			7	1047	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		304					A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	c.911A>G	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	A	8.340	0.828399	0.16749	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.55588	0.51;0.51;0.51	5.94	4.83	0.62350	.	0.254546	0.38605	N	0.001630	T	0.49047	0.1534	L	0.58354	1.805	0.09310	N	1	D;B;D	0.63046	0.992;0.353;0.96	D;B;P	0.65573	0.936;0.413;0.859	T	0.45644	-0.9247	10	0.39692	T	0.17	-12.113	8.1113	0.30916	0.8449:0.0:0.1551:0.0	.	241;304;304	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	R	304;241;304	ENSP00000356724:K304R;ENSP00000385543:K241R;ENSP00000346901:K304R	ENSP00000346901:K304R	K	+	2	0	FMO1	169517824	1.000000	0.71417	0.783000	0.31826	0.155000	0.21991	3.357000	0.52277	1.095000	0.41419	0.528000	0.53228	AAA		0.403	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021		20	77	0	0	0	0.007413	0	20	77				
MYOC	4653	broad.mit.edu	37	1	171605171	171605171	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:171605171C>T	ENST00000037502.6	-	3	1480	c.1409G>A	c.(1408-1410)cGc>cAc	p.R470H		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	470	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.		R -> C (in GLC1A). {ECO:0000269|PubMed:12442283}.|R -> H. {ECO:0000269|PubMed:10980537}.		bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					GTACTTATAGCGGTTCTTGAA	0.488																																							uc001ghu.2		NA																	0				lung(1)	1						c.(1408-1410)CGC>CAC		myocilin precursor							203.0	178.0	186.0					1																	171605171		2203	4300	6503	SO:0001583	missense	4653				anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity	g.chr1:171605171C>T	BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.1409G>A	1.37:g.171605171C>T	ENSP00000037502:p.Arg470His		Somatic				MYOC_uc010pmk.1_Missense_Mutation_p.R412H	p.R470H	NM_000261	NP_000252	WXS	Illumina HiSeq	Unspecified	Q99972	MYOC_HUMAN			3	1431	-	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)		470		R -> C (in GLC1A).|R -> H.	Olfactomedin-like.		B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	ENST00000037502.6	37	c.1409G>A	CCDS1297.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255453	0.39896	.	.	ENSG00000034971	ENST00000037502;ENST00000357746;ENST00000536591	D	0.89810	-2.57	5.08	0.414	0.16406	Olfactomedin-like (3);	0.440976	0.27437	N	0.019369	T	0.77850	0.4192	M	0.83603	2.65	0.31601	N	0.652749	B;B	0.27997	0.101;0.197	B;B	0.22601	0.029;0.04	T	0.68277	-0.5451	10	0.62326	D	0.03	.	4.148	0.10225	0.1586:0.4566:0.0:0.3848	.	412;470	B4DV44;Q99972	.;MYOC_HUMAN	H	470;423;403	ENSP00000037502:R470H	ENSP00000037502:R470H	R	-	2	0	MYOC	169871794	0.001000	0.12720	0.891000	0.34965	0.993000	0.82548	-0.136000	0.10405	0.241000	0.21283	0.484000	0.47621	CGC		0.488	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261		6	114	0	0	0	0.001168	0	6	114				
PAPPA2	60676	broad.mit.edu	37	1	176709310	176709310	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:176709310G>T	ENST00000367662.3	+	14	5293	c.4129G>T	c.(4129-4131)Ggg>Tgg	p.G1377W		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1377					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G1377W(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						AGAGGACGAGGGGCAGAATCA	0.478																																							uc001gkz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(4129-4131)GGG>TGG		pappalysin 2 isoform 1							81.0	79.0	79.0					1																	176709310		1976	4158	6134	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176709310G>T	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4129G>T	1.37:g.176709310G>T	ENSP00000356634:p.Gly1377Trp		Somatic				PAPPA2_uc009www.2_RNA	p.G1377W	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			14	5293	+			1377					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.4129G>T	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533619	0.27387	.	.	ENSG00000116183	ENST00000367662	T	0.01665	4.7	5.3	4.39	0.52855	.	0.568163	0.19155	N	0.121350	T	0.05960	0.0155	M	0.65975	2.015	0.80722	D	1	D	0.63046	0.992	P	0.54965	0.765	T	0.41963	-0.9479	10	0.37606	T	0.19	-11.2648	12.0776	0.53653	0.0807:0.0:0.9193:0.0	.	1377	Q9BXP8	PAPP2_HUMAN	W	1377	ENSP00000356634:G1377W	ENSP00000356634:G1377W	G	+	1	0	PAPPA2	174975933	1.000000	0.71417	0.032000	0.17829	0.056000	0.15407	2.684000	0.46951	1.233000	0.43693	-0.150000	0.13652	GGG		0.478	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			18	34	1	0	6.94344e-10	0.006122	8.47901e-10	18	34				
KLHL12	59349	broad.mit.edu	37	1	202863732	202863732	+	Silent	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:202863732C>T	ENST00000367261.3	-	9	1499	c.1281G>A	c.(1279-1281)gtG>gtA	p.V427V	KLHL12_ENST00000367259.1_Silent_p.V160V|KLHL12_ENST00000435533.3_Silent_p.V465V	NM_021633.2	NP_067646.1	Q53G59	KLH12_HUMAN	kelch-like family member 12	427	Interaction with DVL3.				COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|protein monoubiquitination (GO:0006513)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|ER to Golgi transport vesicle (GO:0030134)|Golgi membrane (GO:0000139)				NS(3)|breast(2)|endometrium(1)|large_intestine(1)|lung(6)|stomach(1)	14			BRCA - Breast invasive adenocarcinoma(75;0.166)			GACAGTAGATCACTCCACTGG	0.512																																							uc001gyo.1		NA																	0					0						c.(1279-1281)GTG>GTA		kelch-like 12							134.0	134.0	134.0					1																	202863732		2203	4300	6503	SO:0001819	synonymous_variant	59349				Wnt receptor signaling pathway		protein binding	g.chr1:202863732C>T	AF190900	CCDS1429.1	1q32.1	2013-01-30	2013-01-30		ENSG00000117153	ENSG00000117153		"""Kelch-like"", ""BTB/POZ domain containing"""	19360	protein-coding gene	gene with protein product		614522	"""kelch-like 12 (Drosophila)"""			12477932	Standard	NM_021633		Approved	C3IP1	uc001gyo.1	Q53G59	OTTHUMG00000041385	ENST00000367261.3:c.1281G>A	1.37:g.202863732C>T			Somatic				KLHL12_uc001gym.1_Silent_p.V160V|KLHL12_uc001gyn.1_Silent_p.V277V|KLHL12_uc010pqc.1_Silent_p.V465V|KLHL12_uc009xah.1_Silent_p.V326V	p.V427V	NM_021633	NP_067646	WXS	Illumina HiSeq	Unspecified	Q53G59	KLH12_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.166)		9	1481	-			427			Kelch 4.|Interaction with DVL3.		A6NEN8|B7Z7B8|Q9HBX5	Silent	SNP	ENST00000367261.3	37	c.1281G>A	CCDS1429.1																																																																																				0.512	KLHL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099151.1	NM_021633		53	157	0	0	0	0.01441	0	53	157				
OR2G2	81470	broad.mit.edu	37	1	247752427	247752427	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:247752427G>T	ENST00000320065.1	+	1	766	c.766G>T	c.(766-768)Gga>Tga	p.G256*	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			catcttttatggaaccatcat	0.493																																							uc010pyy.1		NA																	0					0						c.(766-768)GGA>TGA		olfactory receptor, family 2, subfamily G,							138.0	123.0	128.0					1																	247752427		2203	4300	6503	SO:0001587	stop_gained	81470				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247752427G>T	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.766G>T	1.37:g.247752427G>T	ENSP00000326349:p.Gly256*		Somatic					p.G256*	NM_001001915	NP_001001915	WXS	Illumina HiSeq	Unspecified	Q8NGZ5	OR2G2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	766	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		256			Helical; Name=6; (Potential).		Q5JQT2|Q6IEZ0	Nonsense_Mutation	SNP	ENST00000320065.1	37	c.766G>T	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255030	0.39896	.	.	ENSG00000177489	ENST00000320065	.	.	.	4.29	4.29	0.51040	.	0.000000	0.36555	U	0.002534	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.3294	0.66545	0.0:0.0:1.0:0.0	.	.	.	.	X	256	.	ENSP00000326349:G256X	G	+	1	0	OR2G2	245819050	0.001000	0.12720	0.997000	0.53966	0.131000	0.20780	0.559000	0.23485	2.206000	0.71126	0.591000	0.81541	GGA		0.493	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1			57	82	1	0	3.53049e-34	0.01441	5.03789e-34	57	82				
OR6F1	343169	broad.mit.edu	37	1	247875472	247875472	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:247875472C>A	ENST00000302084.2	-	1	633	c.586G>T	c.(586-588)Gag>Tag	p.E196*	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GCCACAAGCTCTACTGCCTGT	0.532																																							uc001idj.1		NA																	0					0						c.(586-588)GAG>TAG		olfactory receptor, family 6, subfamily F,							117.0	106.0	110.0					1																	247875472		2203	4300	6503	SO:0001587	stop_gained	343169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247875472C>A	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.586G>T	1.37:g.247875472C>A	ENSP00000305640:p.Glu196*		Somatic					p.E196*	NM_001005286	NP_001005286	WXS	Illumina HiSeq	Unspecified	Q8NGZ6	OR6F1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	586	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		196			Extracellular (Potential).		B2RNV6|Q6IF02|Q96R39	Nonsense_Mutation	SNP	ENST00000302084.2	37	c.586G>T	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.611284	0.28712	.	.	ENSG00000169214	ENST00000302084	.	.	.	3.72	3.72	0.42706	.	0.000000	0.44097	D	0.000498	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-26.6593	7.2663	0.26232	0.0:0.8787:0.0:0.1213	.	.	.	.	X	196	.	ENSP00000305640:E196X	E	-	1	0	OR6F1	245942095	0.000000	0.05858	0.077000	0.20336	0.071000	0.16799	0.716000	0.25836	2.057000	0.61298	0.591000	0.81541	GAG		0.532	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286		59	95	1	0	3.89483e-19	0.01441	5.34749e-19	59	95				
OR1C1	26188	broad.mit.edu	37	1	247921189	247921189	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:247921189T>C	ENST00000408896.2	-	1	793	c.520A>G	c.(520-522)Atc>Gtc	p.I174V		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	174					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			AAATGATGGATGATATTGGAG	0.478																																							uc010pza.1		NA																	0				skin(1)	1						c.(520-522)ATC>GTC		olfactory receptor, family 1, subfamily C,							67.0	67.0	67.0					1																	247921189		2116	4242	6358	SO:0001583	missense	26188				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247921189T>C	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.520A>G	1.37:g.247921189T>C	ENSP00000386138:p.Ile174Val		Somatic					p.I174V	NM_012353	NP_036485	WXS	Illumina HiSeq	Unspecified	Q15619	OR1C1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	520	-	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	174			Extracellular (Potential).		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	37	c.520A>G	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	T	14.23	2.472892	0.43942	.	.	ENSG00000221888	ENST00000408896	T	0.00179	8.61	3.19	2.0	0.26442	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00328	0.0010	L	0.49513	1.565	0.09310	N	0.999991	P	0.41080	0.737	P	0.55303	0.773	T	0.45483	-0.9258	9	0.56958	D	0.05	.	7.5126	0.27583	0.0:0.1176:0.0:0.8824	.	174	Q15619	OR1C1_HUMAN	V	174	ENSP00000386138:I174V	ENSP00000386138:I174V	I	-	1	0	OR1C1	245987812	0.000000	0.05858	0.967000	0.41034	0.971000	0.66376	-0.333000	0.07894	0.403000	0.25479	0.473000	0.43528	ATC		0.478	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1			15	18	0	0	0	0.004007	0	15	18				
OR2W3	343171	broad.mit.edu	37	1	248059229	248059229	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:248059229T>A	ENST00000360358.3	+	1	341	c.341T>A	c.(340-342)cTt>cAt	p.L114H	OR2W3_ENST00000537741.1_Missense_Mutation_p.L114H	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAGTGCCTGCTTCTGGCTGTC	0.567																																							uc001idp.1		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(340-342)CTT>CAT		olfactory receptor, family 2, subfamily W,							126.0	99.0	108.0					1																	248059229		2203	4300	6503	SO:0001583	missense	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248059229T>A	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.341T>A	1.37:g.248059229T>A	ENSP00000353516:p.Leu114His		Somatic				OR2W3_uc010pzb.1_Missense_Mutation_p.L114H	p.L114H	NM_001001957	NP_001001957	WXS	Illumina HiSeq	Unspecified	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	610	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		114			Helical; Name=3; (Potential).		Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	c.341T>A	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	T	18.34	3.601592	0.66445	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.03717	3.83;3.83	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.121727	0.37483	N	0.002069	T	0.33702	0.0872	H	0.99058	4.415	0.38513	D	0.948529	D	0.89917	1.0	D	0.79108	0.992	T	0.62101	-0.6925	10	0.87932	D	0	.	15.0464	0.71830	0.0:0.0:0.0:1.0	.	114	Q7Z3T1	OR2W3_HUMAN	H	114	ENSP00000445853:L114H;ENSP00000353516:L114H	ENSP00000353516:L114H	L	+	2	0	OR2W3	246125852	0.387000	0.25188	0.999000	0.59377	0.867000	0.49689	3.508000	0.53378	2.224000	0.72417	0.491000	0.48974	CTT		0.567	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		29	69	0	0	0	0.008361	0	29	69				
OR2L2	26246	broad.mit.edu	37	1	248201902	248201902	+	Silent	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr1:248201902G>T	ENST00000366479.2	+	1	429	c.333G>T	c.(331-333)ggG>ggT	p.G111G	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TTGCAGAAGGGCTGCTCCTGA	0.418																																							uc001idw.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(331-333)GGG>GGT		olfactory receptor, family 2, subfamily L,							135.0	125.0	128.0					1																	248201902		2203	4300	6503	SO:0001819	synonymous_variant	26246				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248201902G>T	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.333G>T	1.37:g.248201902G>T			Somatic				OR2L13_uc001ids.2_Intron	p.G111G	NM_001004686	NP_001004686	WXS	Illumina HiSeq	Unspecified	Q8NH16	OR2L2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	429	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		111			Helical; Name=3; (Potential).		Q2M3T5	Silent	SNP	ENST00000366479.2	37	c.333G>T	CCDS31103.1																																																																																				0.418	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686		50	180	1	0	2.52991e-16	0.01441	3.38209e-16	50	180				
KIAA1462	57608	broad.mit.edu	37	10	30318595	30318595	+	Missense_Mutation	SNP	T	T	G	rs146919048	byFrequency	TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr10:30318595T>G	ENST00000375377.1	-	3	583	c.482A>C	c.(481-483)gAg>gCg	p.E161A		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	161					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						CATCACATGCTCTGACCTTCC	0.567																																							uc001iux.2		NA																	0				ovary(4)	4						c.(481-483)GAG>GCG		hypothetical protein LOC57608							293.0	288.0	290.0					10																	30318595		2092	4223	6315	SO:0001583	missense	57608							g.chr10:30318595T>G	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.482A>C	10.37:g.30318595T>G	ENSP00000364526:p.Glu161Ala		Somatic				KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.E23A|KIAA1462_uc009xle.1_Missense_Mutation_p.E161A	p.E161A	NM_020848	NP_065899	WXS	Illumina HiSeq	Unspecified	Q9P266	K1462_HUMAN			2	541	-			161					Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	37	c.482A>C	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.919459	0.73098	.	.	ENSG00000165757	ENST00000375377	T	0.20069	2.1	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000001	T	0.43831	0.1265	M	0.71581	2.175	0.54753	D	0.999988	D	0.89917	1.0	D	0.72982	0.979	T	0.38802	-0.9644	10	0.62326	D	0.03	-35.5121	11.5938	0.50962	0.0:0.0715:0.0:0.9285	.	161	Q9P266	K1462_HUMAN	A	161	ENSP00000364526:E161A	ENSP00000364526:E161A	E	-	2	0	KIAA1462	30358601	1.000000	0.71417	0.715000	0.30552	0.780000	0.44128	3.847000	0.55895	2.110000	0.64415	0.533000	0.62120	GAG		0.567	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848		11	310	0	0	0	0.008291	0	11	310				
FRMPD2	143162	broad.mit.edu	37	10	49448430	49448431	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr10:49448430_49448431CC>TA	ENST00000374201.3	-	6	974_975	c.672_673GG>TA	c.(670-675)caGGcc>caTAcc	p.224_225QA>HT	FRMPD2_ENST00000407470.4_Missense_Mutation_p.193_194QA>HT|FRMPD2_ENST00000305531.3_Missense_Mutation_p.200_201QA>HT	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	224					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CACTCCGGGGCCTGTGCCGCTG	0.579																																							uc001jgi.2		NA																	0				large_intestine(1)	1						c.(670-675)CAGGCC>CATACC		FERM and PDZ domain containing 2 isoform 3																																				SO:0001583	missense	143162				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding	g.chr10:49448430_49448431CC>TA	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.672_673delinsTA	10.37:g.49448430_49448431delinsTA	ENSP00000363317:p.Q224_A225delinsHT		Somatic				FRMPD2_uc001jgh.2_Missense_Mutation_p.193_194QA>HT|FRMPD2_uc001jgj.2_Missense_Mutation_p.202_203QA>HT	p.224_225QA>HT	NM_001018071	NP_001018081	WXS	Illumina HiSeq	Unspecified	Q68DX3	FRPD2_HUMAN		Kidney(211;0.201)	6	779_780	-			224_225					B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	DNP	ENST00000374201.3	37	c.672_673GG>TA	CCDS31195.1																																																																																				0.579	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428		7	49	0	0	0	0.004672	0	7	49				
ABCC2	1244	broad.mit.edu	37	10	101564028	101564028	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr10:101564028C>G	ENST00000370449.4	+	10	1575	c.1462C>G	c.(1462-1464)Cag>Gag	p.Q488E		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	488	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TAAGACCATTCAGGTAAAGAA	0.418																																							uc001kqf.2		NA																	0				ovary(1)	1						c.(1462-1464)CAG>GAG		ATP-binding cassette, sub-family C (CFTR/MRP),	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)						124.0	120.0	121.0					10																	101564028		2203	4300	6503	SO:0001583	missense	1244					apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity	g.chr10:101564028C>G	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.1462C>G	10.37:g.101564028C>G	ENSP00000359478:p.Gln488Glu		Somatic					p.Q488E	NM_000392	NP_000383	WXS	Illumina HiSeq	Unspecified	Q92887	MRP2_HUMAN		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	10	1601	+		Colorectal(252;0.234)	488			Cytoplasmic (By similarity).|ABC transmembrane type-1 1.		B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	c.1462C>G	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376979	0.82682	.	.	ENSG00000023839	ENST00000370449	D	0.89552	-2.53	5.41	5.41	0.78517	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.93651	0.7972	M	0.89534	3.04	0.80722	D	1	P	0.40066	0.701	P	0.47015	0.534	D	0.94193	0.7443	10	0.62326	D	0.03	-15.3723	19.5424	0.95280	0.0:1.0:0.0:0.0	.	488	Q92887	MRP2_HUMAN	E	488	ENSP00000359478:Q488E	ENSP00000359478:Q488E	Q	+	1	0	ABCC2	101554018	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	5.740000	0.68629	2.706000	0.92434	0.561000	0.74099	CAG		0.418	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392		26	59	0	0	0	0.003954	0	26	59				
C10orf2	56652	broad.mit.edu	37	10	102753043	102753043	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr10:102753043G>T	ENST00000311916.2	+	5	2016	c.1831G>T	c.(1831-1833)Gat>Tat	p.D611Y	C10orf2_ENST00000370228.1_3'UTR|C10orf2_ENST00000473656.1_3'UTR	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	611	SF4 helicase. {ECO:0000255|PROSITE- ProRule:PRU00596}.				cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		GAACCGCTTTGATGGAGATGT	0.527																																							uc001ksf.2		NA																	0				ovary(1)	1						c.(1831-1833)GAT>TAT		twinkle isoform A							183.0	188.0	186.0					10																	102753043		2203	4300	6503	SO:0001583	missense	56652				cell death|mitochondrial DNA replication|protein hexamerization|protein homooligomerization|transcription from mitochondrial promoter	mitochondrial nucleoid	5'-3' DNA helicase activity|ATP binding|protease binding|single-stranded DNA binding	g.chr10:102753043G>T	AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.1831G>T	10.37:g.102753043G>T	ENSP00000309595:p.Asp611Tyr		Somatic				C10orf2_uc001ksg.2_3'UTR|C10orf2_uc001ksi.2_3'UTR|C10orf2_uc010qpv.1_Missense_Mutation_p.D157Y|C10orf2_uc001ksh.2_RNA	p.D611Y	NM_021830	NP_068602	WXS	Illumina HiSeq	Unspecified	Q96RR1	PEO1_HUMAN		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)	5	2506	+		Colorectal(252;0.122)|all_hematologic(284;0.152)	611			SF4 helicase.		B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Missense_Mutation	SNP	ENST00000311916.2	37	c.1831G>T	CCDS7506.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.896630	0.91962	.	.	ENSG00000107815	ENST00000311916	D	0.94138	-3.36	5.7	5.7	0.88788	DNA helicase, DnaB-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93390	0.7892	M	0.63843	1.955	0.80722	D	1	P	0.49961	0.93	P	0.48166	0.569	D	0.91188	0.4981	10	0.16896	T	0.51	-23.3762	18.8118	0.92061	0.0:0.0:1.0:0.0	.	611	Q96RR1	PEO1_HUMAN	Y	611	ENSP00000309595:D611Y	ENSP00000309595:D611Y	D	+	1	0	C10orf2	102743033	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.488000	0.97947	2.695000	0.91970	0.455000	0.32223	GAT		0.527	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049886.1	NM_021830		48	140	1	0	6.4308e-24	0.01441	9.07458e-24	48	140				
ADD3	120	broad.mit.edu	37	10	111878980	111878980	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr10:111878980G>T	ENST00000356080.4	+	7	1096	c.729G>T	c.(727-729)atG>atT	p.M243I	ADD3_ENST00000360162.3_Missense_Mutation_p.M243I|ADD3_ENST00000277900.8_Missense_Mutation_p.M243I	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	243						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		TATCCTCCATGAAATGTGGGA	0.408																																							uc001kyt.3		NA																	0				ovary(2)|skin(2)|large_intestine(1)	5						c.(727-729)ATG>ATT		adducin 3 (gamma) isoform a							91.0	83.0	86.0					10																	111878980		2203	4300	6503	SO:0001583	missense	120					cytoskeleton	actin binding|calmodulin binding|metal ion binding|structural constituent of cytoskeleton	g.chr10:111878980G>T	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.729G>T	10.37:g.111878980G>T	ENSP00000348381:p.Met243Ile		Somatic				ADD3_uc001kys.3_Missense_Mutation_p.M243I|ADD3_uc001kyu.2_Missense_Mutation_p.M243I|ADD3_uc001kyv.2_Missense_Mutation_p.M243I|ADD3_uc001kyw.2_Missense_Mutation_p.M243I	p.M243I	NM_016824	NP_058432	WXS	Illumina HiSeq	Unspecified	Q9UEY8	ADDG_HUMAN		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)	8	1043	+		Breast(234;0.052)|Lung NSC(174;0.223)	243					D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	37	c.729G>T	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937295	0.92458	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.21031	2.03;2.03;2.03	6.17	6.17	0.99709	Class II aldolase/adducin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.35508	0.0934	M	0.68952	2.095	0.80722	D	1	B;P	0.45126	0.437;0.851	B;P	0.45794	0.241;0.493	T	0.03608	-1.1020	10	0.72032	D	0.01	-22.1459	20.8794	0.99867	0.0:0.0:1.0:0.0	.	243;243	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	I	243	ENSP00000353286:M243I;ENSP00000348381:M243I;ENSP00000277900:M243I	ENSP00000277900:M243I	M	+	3	0	ADD3	111868970	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.675000	0.98638	2.941000	0.99782	0.655000	0.94253	ATG		0.408	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903		18	53	1	0	1.45105e-14	0.006122	1.90967e-14	18	53				
BAG3	9531	broad.mit.edu	37	10	121431866	121431866	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr10:121431866C>T	ENST00000369085.3	+	3	913	c.607C>T	c.(607-609)Cgg>Tgg	p.R203W		NM_004281.3	NP_004272.2	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	203					brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of apoptotic process (GO:0043066)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|Z disc (GO:0030018)				endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(5)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	20		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		CCAGCTCCCGCGGGGGTACAT	0.652																																							uc001lem.2		NA																	0				ovary(2)	2						c.(607-609)CGG>TGG		BCL2-associated athanogene 3							56.0	56.0	56.0					10																	121431866		2203	4300	6503	SO:0001583	missense	9531				anti-apoptosis|apoptosis|protein folding	cytosol		g.chr10:121431866C>T	AF095193	CCDS7615.1	10q25.2-q26.2	2014-09-17			ENSG00000151929	ENSG00000151929			939	protein-coding gene	gene with protein product		603883				9873016, 18094623	Standard	XM_005270287		Approved		uc001lem.3	O95817	OTTHUMG00000019155	ENST00000369085.3:c.607C>T	10.37:g.121431866C>T	ENSP00000358081:p.Arg203Trp		Somatic				BAG3_uc001lel.2_Missense_Mutation_p.R203W	p.R203W	NM_004281	NP_004272	WXS	Illumina HiSeq	Unspecified	O95817	BAG3_HUMAN		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)	3	913	+		Lung NSC(174;0.109)|all_lung(145;0.142)	203					A8K5L8|Q3B763|Q9NT20|Q9P120	Missense_Mutation	SNP	ENST00000369085.3	37	c.607C>T	CCDS7615.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.587953	0.86851	.	.	ENSG00000151929	ENST00000369085;ENST00000450186	T;T	0.79352	-1.16;-1.26	6.17	5.25	0.73442	.	0.109139	0.64402	D	0.000007	D	0.87517	0.6197	M	0.69823	2.125	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89005	0.3424	10	0.87932	D	0	-25.7732	16.5537	0.84479	0.1352:0.8648:0.0:0.0	.	203;203	O95817;Q53GY1	BAG3_HUMAN;.	W	203;145	ENSP00000358081:R203W;ENSP00000410036:R145W	ENSP00000358081:R203W	R	+	1	2	BAG3	121421856	0.995000	0.38212	0.994000	0.49952	0.832000	0.47134	3.066000	0.50002	1.564000	0.49628	0.655000	0.94253	CGG		0.652	BAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050662.1	NM_004281		14	67	0	0	0	0.001855	0	14	67				
TRPM5	29850	broad.mit.edu	37	11	2432639	2432639	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:2432639C>T	ENST00000155858.6	-	18	2733	c.2725G>A	c.(2725-2727)Gtg>Atg	p.V909M	TRPM5_ENST00000452833.1_Missense_Mutation_p.V911M|TRPM5_ENST00000528453.1_Missense_Mutation_p.V909M|TRPM5_ENST00000533060.1_Missense_Mutation_p.V909M	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CGGTAGAGCACCCGGCGGAAG	0.632																																					NSCLC(1;49 61 17205 18850 43201)	NSCLC(1;49 61 17205 18850 43201)	uc001lwm.3		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(2725-2727)GTG>ATG		transient receptor potential cation channel,							33.0	36.0	35.0					11																	2432639		2199	4297	6496	SO:0001583	missense	29850					integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity	g.chr11:2432639C>T	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2725G>A	11.37:g.2432639C>T	ENSP00000155858:p.Val909Met		Somatic				TRPM5_uc010qxl.1_Missense_Mutation_p.V909M|TRPM5_uc009ydn.2_Missense_Mutation_p.V911M	p.V909M	NM_014555	NP_055370	WXS	Illumina HiSeq	Unspecified	Q9NZQ8	TRPM5_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)	18	2734	-		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)	909			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000155858.6	37	c.2725G>A	CCDS31340.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259060	0.80246	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	3.89	3.89	0.44902	Ion transport (1);	0.071081	0.56097	D	0.000028	T	0.72070	0.3415	L	0.43757	1.38	0.42632	D	0.993385	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.979;0.979;0.993	T	0.76664	-0.2876	10	0.87932	D	0	-25.502	15.2605	0.73617	0.0:1.0:0.0:0.0	.	909;911;909	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	M	903;909;911;909;909	ENSP00000434383:V903M;ENSP00000155858:V909M;ENSP00000387965:V911M;ENSP00000434121:V909M;ENSP00000436809:V909M	ENSP00000155858:V909M	V	-	1	0	TRPM5	2389215	1.000000	0.71417	0.956000	0.39512	0.948000	0.59901	7.407000	0.80029	1.928000	0.55862	0.561000	0.74099	GTG		0.632	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555		15	30	0	0	0	0.00245	0	15	30				
NAV2	89797	broad.mit.edu	37	11	20113762	20113762	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:20113762A>G	ENST00000396087.3	+	31	5939	c.5840A>G	c.(5839-5841)gAg>gGg	p.E1947G	NAV2_ENST00000360655.4_Missense_Mutation_p.E1824G|NAV2_ENST00000527559.2_Missense_Mutation_p.E1876G|NAV2_ENST00000540292.1_Missense_Mutation_p.E1878G|NAV2_ENST00000396085.1_Missense_Mutation_p.E1891G|NAV2_ENST00000533917.1_Missense_Mutation_p.E952G|NAV2_ENST00000311043.8_Missense_Mutation_p.E952G|NAV2_ENST00000349880.4_Missense_Mutation_p.E1888G	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1947					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						AGTGAAATAGAGAAGCTGAAA	0.498																																							uc001mpr.3		NA																	0				skin(4)|ovary(1)|pancreas(1)	6						c.(5671-5673)GAG>GGG		neuron navigator 2 isoform 1							66.0	70.0	69.0					11																	20113762		2203	4300	6503	SO:0001583	missense	89797					nucleus	ATP binding|helicase activity	g.chr11:20113762A>G	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.5840A>G	11.37:g.20113762A>G	ENSP00000379396:p.Glu1947Gly		Somatic				NAV2_uc001mpp.2_Missense_Mutation_p.E1824G|NAV2_uc009yhx.2_Missense_Mutation_p.E952G|NAV2_uc009yhz.2_Missense_Mutation_p.E533G|NAV2_uc001mpu.2_Missense_Mutation_p.E326G	p.E1891G	NM_182964	NP_892009	WXS	Illumina HiSeq	Unspecified	Q8IVL1	NAV2_HUMAN			28	6033	+			1947			Potential.		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	ENST00000396087.3	37	c.5672A>G	CCDS58126.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.540917	0.85917	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000311043	T;T;T;T;T;T;T;T	0.32753	1.44;1.54;1.54;1.58;1.48;1.48;3.06;3.06	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000002	T	0.55242	0.1908	M	0.68317	2.08	0.80722	D	1	D;D;D;D	0.89917	1.0;0.991;1.0;0.999	D;P;D;D	0.97110	0.999;0.889;1.0;0.993	T	0.52328	-0.8590	9	.	.	.	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	1891;952;1888;1824	A7E2D6;Q8IVL1-5;Q8IVL1-3;Q8IVL1-4	.;.;.;.	G	1824;1891;1888;1947;1876;1878;952;952	ENSP00000353871:E1824G;ENSP00000379394:E1891G;ENSP00000309577:E1888G;ENSP00000379396:E1947G;ENSP00000435395:E1876G;ENSP00000443489:E1878G;ENSP00000437316:E952G;ENSP00000312169:E952G	.	E	+	2	0	NAV2	20070338	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	GAG		0.498	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117		33	69	0	0	0	0.003271	0	33	69				
OR5D13	390142	broad.mit.edu	37	11	55541676	55541676	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:55541676G>C	ENST00000361760.1	+	1	763	c.763G>C	c.(763-765)Gga>Cga	p.G255R		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				TATCTTCCATGGAACTATCCT	0.443																																							uc010ril.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(763-765)GGA>CGA		olfactory receptor, family 5, subfamily D,							128.0	106.0	114.0					11																	55541676		2200	4296	6496	SO:0001583	missense	390142				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55541676G>C	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.763G>C	11.37:g.55541676G>C	ENSP00000354800:p.Gly255Arg		Somatic					p.G255R	NM_001001967	NP_001001967	WXS	Illumina HiSeq	Unspecified	Q8NGL4	OR5DD_HUMAN			1	763	+		all_epithelial(135;0.196)	255			Helical; Name=6; (Potential).		Q6IF68|Q6IFC9	Missense_Mutation	SNP	ENST00000361760.1	37	c.763G>C	CCDS31507.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040411	0.35989	.	.	ENSG00000198877	ENST00000361760	T	0.39056	1.1	3.82	3.82	0.43975	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34268	U	0.004105	T	0.69043	0.3067	H	0.97051	3.93	0.09310	N	0.999996	P	0.45768	0.866	P	0.56434	0.798	T	0.66156	-0.5994	10	0.72032	D	0.01	-3.0499	9.7012	0.40187	0.1075:0.0:0.8925:0.0	.	255	Q8NGL4	OR5DD_HUMAN	R	255	ENSP00000354800:G255R	ENSP00000354800:G255R	G	+	1	0	OR5D13	55298252	0.002000	0.14202	0.867000	0.34043	0.250000	0.25880	0.511000	0.22739	1.886000	0.54624	0.486000	0.48141	GGA		0.443	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967		23	52	0	0	0	0.014323	0	23	52				
OR5I1	10798	broad.mit.edu	37	11	55703583	55703583	+	Silent	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:55703583C>A	ENST00000301532.3	-	1	293	c.294G>T	c.(292-294)ggG>ggT	p.G98G		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	98					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G98G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GCAGGGCACACCCATAATAGG	0.418																																							uc010ris.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(292-294)GGG>GGT		olfactory receptor, family 5, subfamily I,							40.0	41.0	41.0					11																	55703583		2200	4294	6494	SO:0001819	synonymous_variant	10798				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55703583C>A	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.294G>T	11.37:g.55703583C>A			Somatic					p.G98G	NM_006637	NP_006628	WXS	Illumina HiSeq	Unspecified	Q13606	OR5I1_HUMAN			1	294	-			98			Extracellular (Potential).		Q6IEU4	Silent	SNP	ENST00000301532.3	37	c.294G>T	CCDS7949.1																																																																																				0.418	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637		7	35	1	0	5.18039e-06	0.00308	5.72095e-06	7	35				
OR8J3	81168	broad.mit.edu	37	11	55905192	55905192	+	Start_Codon_SNP	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:55905192C>T	ENST00000301529.1	-	1	2	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	1						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					TTTCAGGAGCCATGTCAGAGT	0.428																																							uc010riz.1		NA																	0				skin(2)	2						c.(1-3)ATG>ATA		olfactory receptor, family 8, subfamily J,							66.0	71.0	69.0					11																	55905192		2201	4296	6497	SO:0001582	initiator_codon_variant	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55905192C>T		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.3G>A	11.37:g.55905192C>T	ENSP00000301529:p.Met1Ile		Somatic					p.M1I	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	3	-	Esophageal squamous(21;0.00693)		1			Extracellular (Potential).		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	c.3G>A	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063078	0.36373	.	.	ENSG00000167822	ENST00000301529	T	0.01369	4.97	2.55	2.55	0.30701	.	0.000000	0.85682	D	0.000000	T	0.01940	0.0061	.	.	.	0.80722	D	1	B	0.17667	0.023	B	0.21151	0.033	T	0.54576	-0.8273	9	0.87932	D	0	.	13.8181	0.63303	0.0:1.0:0.0:0.0	.	1	Q8NGG0	OR8J3_HUMAN	I	1	ENSP00000301529:M1I	ENSP00000301529:M1I	M	-	3	0	OR8J3	55661768	0.795000	0.28851	0.385000	0.26158	0.149000	0.21700	0.993000	0.29680	1.356000	0.45884	0.289000	0.19496	ATG		0.428	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064	Missense_Mutation	27	53	0	0	0	0.004656	0	27	53				
OR8K5	219453	broad.mit.edu	37	11	55927495	55927495	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:55927495T>A	ENST00000313447.1	-	1	298	c.299A>T	c.(298-300)cAg>cTg	p.Q100L		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				GAATGCCAGCTGTGCAGCACA	0.408																																							uc010rja.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(298-300)CAG>CTG		olfactory receptor, family 8, subfamily K,							95.0	94.0	94.0					11																	55927495		2201	4296	6497	SO:0001583	missense	219453				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55927495T>A	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.299A>T	11.37:g.55927495T>A	ENSP00000323853:p.Gln100Leu		Somatic					p.Q100L	NM_001004058	NP_001004058	WXS	Illumina HiSeq	Unspecified	Q8NH50	OR8K5_HUMAN			1	299	-	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)	100			Helical; Name=3; (Potential).		Q6IFB5	Missense_Mutation	SNP	ENST00000313447.1	37	c.299A>T	CCDS31521.1	.	.	.	.	.	.	.	.	.	.	T	19.91	3.914577	0.72983	.	.	ENSG00000181752	ENST00000313447	T	0.00470	7.2	3.88	3.88	0.44766	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000057	T	0.01661	0.0053	H	0.95539	3.685	0.43494	D	0.995735	D	0.59767	0.986	P	0.55455	0.776	T	0.33523	-0.9865	10	0.87932	D	0	.	12.368	0.55240	0.0:0.0:0.0:1.0	.	100	Q8NH50	OR8K5_HUMAN	L	100	ENSP00000323853:Q100L	ENSP00000323853:Q100L	Q	-	2	0	OR8K5	55684071	1.000000	0.71417	0.931000	0.37212	0.678000	0.39670	5.078000	0.64425	1.750000	0.51863	0.462000	0.41574	CAG		0.408	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058		24	104	0	0	0	0.00333	0	24	104				
FAM111A	63901	broad.mit.edu	37	11	58920495	58920495	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:58920495G>T	ENST00000528737.1	+	5	4172	c.1354G>T	c.(1354-1356)Gta>Tta	p.V452L	FAM111A_ENST00000361723.3_Missense_Mutation_p.V452L|FAM111A_ENST00000420244.1_Missense_Mutation_p.V452L|FAM111A_ENST00000531147.1_Missense_Mutation_p.V452L|FAM111A_ENST00000533703.1_Missense_Mutation_p.V452L			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	452	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				TGGACAACAAGTACCTATGGA	0.368																																							uc010rkp.1		NA																	0				ovary(3)	3						c.(1354-1356)GTA>TTA		hypothetical protein LOC63901							90.0	93.0	92.0					11																	58920495		2201	4295	6496	SO:0001583	missense	63901				proteolysis		serine-type endopeptidase activity	g.chr11:58920495G>T	AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1354G>T	11.37:g.58920495G>T	ENSP00000434435:p.Val452Leu		Somatic				FAM111A_uc010rkq.1_Missense_Mutation_p.V452L|FAM111A_uc010rkr.1_Missense_Mutation_p.V452L|FAM111A_uc001nno.2_Missense_Mutation_p.V452L|FAM111A_uc001nnp.2_Missense_Mutation_p.V452L|FAM111A_uc001nnq.2_Missense_Mutation_p.V452L	p.V452L	NM_001142521	NP_001135993	WXS	Illumina HiSeq	Unspecified	Q96PZ2	F111A_HUMAN			5	1581	+		all_epithelial(135;0.139)	452					A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	ENST00000528737.1	37	c.1354G>T	CCDS7973.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075832	0.36662	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.04	3.17	0.36434	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.398641	0.22790	N	0.055608	T	0.36441	0.0967	L	0.43923	1.385	0.09310	N	1	P	0.48503	0.911	P	0.49752	0.621	T	0.10847	-1.0612	10	0.23891	T	0.37	-16.4892	4.1429	0.10201	0.1871:0.0:0.6269:0.1859	.	452	Q96PZ2	F111A_HUMAN	L	452	ENSP00000434435:V452L;ENSP00000406683:V452L;ENSP00000355264:V452L;ENSP00000433154:V452L;ENSP00000431631:V452L	ENSP00000355264:V452L	V	+	1	0	FAM111A	58677071	0.000000	0.05858	0.008000	0.14137	0.132000	0.20833	-0.648000	0.05391	1.493000	0.48517	0.655000	0.94253	GTA		0.368	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393975.1	NM_022074		18	65	1	0	3.52763e-06	0.00499	3.91274e-06	18	65				
PPP2R5B	5526	broad.mit.edu	37	11	64694295	64694295	+	Missense_Mutation	SNP	G	G	C	rs201085110		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:64694295G>C	ENST00000164133.2	+	3	933	c.311G>C	c.(310-312)cGg>cCg	p.R104P		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	104					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						GAGGTGAAGCGGGCAGCCCTC	0.632																																							uc001oby.2		NA																	0				ovary(2)	2						c.(310-312)CGG>CCG		beta isoform of regulatory subunit B56, protein							124.0	115.0	118.0					11																	64694295		2201	4297	6498	SO:0001583	missense	5526				signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity	g.chr11:64694295G>C	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.311G>C	11.37:g.64694295G>C	ENSP00000164133:p.Arg104Pro		Somatic				PPP2R5B_uc001obz.2_Missense_Mutation_p.R104P	p.R104P	NM_006244	NP_006235	WXS	Illumina HiSeq	Unspecified	Q15173	2A5B_HUMAN			3	896	+			104					Q13853	Missense_Mutation	SNP	ENST00000164133.2	37	c.311G>C	CCDS8085.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.012498	0.93346	.	.	ENSG00000068971	ENST00000526559;ENST00000164133;ENST00000359279;ENST00000532850;ENST00000527441	.	.	.	3.94	3.94	0.45596	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86920	0.6049	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90951	0.4805	9	0.87932	D	0	-27.4831	14.2826	0.66224	0.0:0.0:1.0:0.0	.	104	Q15173	2A5B_HUMAN	P	104;104;131;18;104	.	ENSP00000164133:R104P	R	+	2	0	PPP2R5B	64450871	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.024000	0.93689	2.485000	0.83878	0.655000	0.94253	CGG		0.632	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244		19	74	0	0	0	0.007413	0	19	74				
PITPNM1	9600	broad.mit.edu	37	11	67263770	67263770	+	Silent	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:67263770C>G	ENST00000534749.1	-	14	2384	c.2196G>C	c.(2194-2196)gcG>gcC	p.A732A	PITPNM1_ENST00000436757.2_Silent_p.A731A|PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000356404.3_Silent_p.A732A			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	732	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						AGGGGTCAGCCGCGTGGAAGA	0.642																																					GBM(28;144 709 4607 5525)	GBM(28;144 709 4607 5525)	uc001olx.2		NA																	0				lung(2)|central_nervous_system(1)	3						c.(2194-2196)GCG>GCC		phosphatidylinositol transfer protein,							50.0	46.0	48.0					11																	67263770		2200	4294	6494	SO:0001819	synonymous_variant	9600				brain development|lipid metabolic process|phototransduction|protein transport	cleavage furrow|endoplasmic reticulum membrane|Golgi cisterna membrane|lipid particle|membrane fraction|midbody	metal ion binding|phosphatidylinositol transporter activity	g.chr11:67263770C>G	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2196G>C	11.37:g.67263770C>G			Somatic				PITPNM1_uc001olw.2_Silent_p.A14A|PITPNM1_uc001oly.2_Silent_p.A732A|PITPNM1_uc001olz.2_Silent_p.A731A	p.A732A	NM_004910	NP_004901	WXS	Illumina HiSeq	Unspecified	O00562	PITM1_HUMAN			14	2385	-			732			DDHD.		A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	ENST00000534749.1	37	c.2196G>C	CCDS31620.1																																																																																				0.642	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910		17	51	0	0	0	0.00499	0	17	51				
GPR83	10888	broad.mit.edu	37	11	94129565	94129565	+	Splice_Site	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:94129565C>A	ENST00000243673.2	-	2	684	c.513G>T	c.(511-513)caG>caT	p.Q171H	GPR83_ENST00000539203.2_Intron	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	171					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GTGCCCTCACCTGGTGGCGAT	0.547																																							uc001pet.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(511-513)CAG>CAT		G protein-coupled receptor 83 precursor							135.0	102.0	113.0					11																	94129565		2201	4298	6499	SO:0001630	splice_region_variant	10888					integral to membrane|plasma membrane	neuropeptide Y receptor activity	g.chr11:94129565C>A	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.513+1G>T	11.37:g.94129565C>A			Somatic					p.Q171H	NM_016540	NP_057624	WXS	Illumina HiSeq	Unspecified	Q9NYM4	GPR83_HUMAN			2	685	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)	171			Cytoplasmic (Potential).		B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	ENST00000243673.2	37	c.513G>T	CCDS8297.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.053166	0.75960	.	.	ENSG00000123901	ENST00000243673	T	0.37058	1.22	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.250650	0.41712	D	0.000830	T	0.54902	0.1887	L	0.53249	1.67	0.80722	D	1	P	0.50943	0.94	D	0.63793	0.918	T	0.47623	-0.9103	9	.	.	.	.	18.245	0.89982	0.0:1.0:0.0:0.0	.	171	Q9NYM4	GPR83_HUMAN	H	171	ENSP00000243673:Q171H	.	Q	-	3	2	GPR83	93769213	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	5.879000	0.69690	2.554000	0.86153	0.555000	0.69702	CAG		0.547	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396232.1	NM_016540	Missense_Mutation	23	59	1	0	1.96895e-08	0.00278	2.35902e-08	23	59				
CLDN25	644672	broad.mit.edu	37	11	113650992	113650992	+	Silent	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:113650992C>A	ENST00000453129.2	+	1	524	c.475C>A	c.(475-477)Cgg>Agg	p.R159R		NM_001101389.1	NP_001094859.1	C9JDP6	CLD25_HUMAN	claudin 25	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			large_intestine(1)|lung(6)|ovary(1)|urinary_tract(2)	10						CATCATACCTCGGTGGGAGTT	0.577																																							uc009yyw.1		NA																	0					0						c.(475-477)CGG>AGG		claudin 25							77.0	81.0	80.0					11																	113650992		1974	4140	6114	SO:0001819	synonymous_variant	644672					integral to membrane|tight junction	structural molecule activity	g.chr11:113650992C>A		CCDS44736.1	11q23.2	2009-09-22			ENSG00000228607	ENSG00000228607			37218	protein-coding gene	gene with protein product							Standard	NM_001101389		Approved		uc009yyw.1	C9JDP6	OTTHUMG00000168193	ENST00000453129.2:c.475C>A	11.37:g.113650992C>A			Somatic					p.R159R	NM_001101389	NP_001094859	WXS	Illumina HiSeq	Unspecified	C9JDP6	CLD25_HUMAN			1	475	+			159			Extracellular (Potential).			Silent	SNP	ENST00000453129.2	37	c.475C>A	CCDS44736.1																																																																																				0.577	CLDN25-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398706.1	NM_001101389		9	37	1	0	3.09899e-07	0.004482	3.54569e-07	9	37				
PCSK7	9159	broad.mit.edu	37	11	117100519	117100519	+	Silent	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:117100519G>A	ENST00000320934.3	-	3	672	c.42C>T	c.(40-42)ccC>ccT	p.P14P	RNF214_ENST00000531287.1_5'Flank|RNF214_ENST00000531452.1_5'Flank	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	14					peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		GCAGGCCCAGGGGGGCATCCA	0.587			T	IGH@	MLCLS																																		uc001pqr.2		NA		Dom	yes		11	11q23.3	9159	T	proprotein convertase subtilisin/kexin type 7			L	IGH@		MLCLS		0					0						c.(40-42)CCC>CCT		proprotein convertase subtilisin/kexin type 7							12.0	15.0	14.0					11																	117100519		2196	4287	6483	SO:0001819	synonymous_variant	9159				peptide hormone processing	integral to Golgi membrane	serine-type endopeptidase activity	g.chr11:117100519G>A	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.42C>T	11.37:g.117100519G>A			Somatic				RNF214_uc001pqt.2_5'Flank|RNF214_uc001pqu.2_5'Flank|RNF214_uc010rxf.1_5'Flank	p.P14P	NM_004716	NP_004707	WXS	Illumina HiSeq	Unspecified	Q16549	PCSK7_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)	3	243	-	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	14					B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Silent	SNP	ENST00000320934.3	37	c.42C>T	CCDS8382.1																																																																																				0.587	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2	NM_004716		3	21	0	0	0	0.004672	0	3	21				
OR10G7	390265	broad.mit.edu	37	11	123909361	123909361	+	Silent	SNP	G	G	A	rs201535662		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:123909361G>A	ENST00000330487.5	-	1	356	c.348C>T	c.(346-348)gtC>gtT	p.V116V		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CATAGGACATGACTGTGTAGA	0.572																																							uc001pzq.1		NA																	0				ovary(2)	2						c.(346-348)GTC>GTT		olfactory receptor, family 10, subfamily G,							133.0	114.0	120.0					11																	123909361		2200	4299	6499	SO:0001819	synonymous_variant	390265				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123909361G>A	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.348C>T	11.37:g.123909361G>A			Somatic					p.V116V	NM_001004463	NP_001004463	WXS	Illumina HiSeq	Unspecified	Q8NGN6	O10G7_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	348	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	116			Helical; Name=3; (Potential).		Q6IFE8	Silent	SNP	ENST00000330487.5	37	c.348C>T	CCDS31705.1																																																																																				0.572	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463		48	99	0	0	0	0.01441	0	48	99				
PRDM10	56980	broad.mit.edu	37	11	129814722	129814722	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr11:129814722C>T	ENST00000360871.3	-	6	937	c.706G>A	c.(706-708)Gtg>Atg	p.V236M	PRDM10_ENST00000528746.1_Missense_Mutation_p.V210M|PRDM10_ENST00000526082.1_Missense_Mutation_p.V150M|PRDM10_ENST00000304538.6_Missense_Mutation_p.V150M|PRDM10_ENST00000423662.2_Missense_Mutation_p.V150M|PRDM10_ENST00000358825.5_Missense_Mutation_p.V236M	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	236	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		GGCCCCTCCACGGGGCCAAAC	0.592																																							uc001qfm.2		NA																	0				pancreas(1)	1						c.(706-708)GTG>ATG		PR domain containing 10 isoform 1							59.0	64.0	62.0					11																	129814722		2201	4297	6498	SO:0001583	missense	56980				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:129814722C>T	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.706G>A	11.37:g.129814722C>T	ENSP00000354118:p.Val236Met		Somatic				PRDM10_uc001qfj.2_Missense_Mutation_p.V150M|PRDM10_uc001qfk.2_Missense_Mutation_p.V150M|PRDM10_uc001qfl.2_Missense_Mutation_p.V150M|PRDM10_uc010sbx.1_Missense_Mutation_p.V150M|PRDM10_uc001qfn.2_Missense_Mutation_p.V236M|PRDM10_uc009zct.1_Missense_Mutation_p.V268M	p.V236M	NM_020228	NP_064613	WXS	Illumina HiSeq	Unspecified	Q9NQV6	PRD10_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)	6	938	-	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	236			SET.		B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	c.706G>A	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.090577	0.76756	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082	T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000001	T	0.50684	0.1630	N	0.19112	0.55	0.38845	D	0.956159	D;D;D;D;D;D;D	0.89917	0.999;0.991;0.999;0.984;1.0;0.999;0.999	P;P;P;B;P;P;P	0.62089	0.793;0.454;0.856;0.335;0.898;0.856;0.856	T	0.57602	-0.7783	10	0.72032	D	0.01	-21.6384	14.0053	0.64459	0.1513:0.8487:0.0:0.0	.	150;236;236;236;150;150;150	B7ZL72;Q9NQV6-4;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;.;PRD10_HUMAN;.;.;.	M	236;150;236;150;210;150	ENSP00000351686:V236M;ENSP00000302669:V150M;ENSP00000354118:V236M;ENSP00000398431:V150M;ENSP00000431262:V210M;ENSP00000432237:V150M	ENSP00000302669:V150M	V	-	1	0	PRDM10	129319932	0.997000	0.39634	0.983000	0.44433	0.911000	0.54048	3.503000	0.53340	2.585000	0.87301	0.644000	0.83932	GTG		0.592	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437		16	117	0	0	0	0.003163	0	16	117				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		10	12	1	0	2.17888e-05	0.006214	2.34506e-05	10	12				
KRT74	121391	broad.mit.edu	37	12	52962144	52962144	+	Silent	SNP	G	G	A	rs185121430		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:52962144G>A	ENST00000305620.2	-	7	1211	c.1164C>T	c.(1162-1164)gaC>gaT	p.D388D	KRT74_ENST00000549343.1_Silent_p.D402D	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	388	Coil 2.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)			kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		GCTGCTCAGCGTCAGCGATGG	0.577													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19493	0.0		0.0	False		,,,				2504	0.0						uc001sap.1		NA																	0				ovary(1)|skin(1)	2						c.(1162-1164)GAC>GAT		keratin 6 irs4							49.0	45.0	46.0					12																	52962144		2203	4300	6503	SO:0001819	synonymous_variant	121391					keratin filament	structural molecule activity	g.chr12:52962144G>A	BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.1164C>T	12.37:g.52962144G>A			Somatic					p.D388D	NM_175053	NP_778223	WXS	Illumina HiSeq	Unspecified	Q7RTS7	K2C74_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.191)	7	1212	-			388			Rod.|Coil 2.		B5MD61|Q86Y45	Silent	SNP	ENST00000305620.2	37	c.1164C>T	CCDS8832.1																																																																																				0.577	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405324.1	NM_175053		5	34	0	0	0	0.000602	0	5	34				
SDR9C7	121214	broad.mit.edu	37	12	57328041	57328041	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:57328041G>A	ENST00000293502.1	-	1	148	c.5C>T	c.(4-6)gCg>gTg	p.A2V		NM_148897.2	NP_683695.1	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C, member 7	2					oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	retinol dehydrogenase activity (GO:0004745)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)	7						TGTGAGGGCCGCCATAGGGCA	0.542																																							uc010sqw.1		NA																	0				central_nervous_system(1)	1						c.(4-6)GCG>GTG		short chain dehydrogenase/reductase family 9C,							40.0	40.0	40.0					12																	57328041		2203	4300	6503	SO:0001583	missense	121214					cytoplasm	binding|oxidoreductase activity	g.chr12:57328041G>A	AY044434	CCDS8926.1	12q13.3	2014-09-04			ENSG00000170426	ENSG00000170426	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29958	protein-coding gene	gene with protein product		609769				12234675, 19027726	Standard	NM_148897		Approved	SDR-O, RDHS	uc010sqw.2	Q8NEX9	OTTHUMG00000171004	ENST00000293502.1:c.5C>T	12.37:g.57328041G>A	ENSP00000293502:p.Ala2Val		Somatic					p.A2V	NM_148897	NP_683695	WXS	Illumina HiSeq	Unspecified	Q8NEX9	DR9C7_HUMAN			1	5	-			2					B3KVB4	Missense_Mutation	SNP	ENST00000293502.1	37	c.5C>T	CCDS8926.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041993	0.35989	.	.	ENSG00000170426	ENST00000293502	D	0.89415	-2.51	5.18	3.26	0.37387	.	0.343834	0.23750	N	0.044928	T	0.74612	0.3739	N	0.05078	-0.115	0.36721	D	0.881183	B	0.11235	0.004	B	0.09377	0.004	T	0.70868	-0.4755	10	0.27785	T	0.31	.	9.912	0.41411	0.0:0.1493:0.6958:0.1548	.	2	Q8NEX9	DR9C7_HUMAN	V	2	ENSP00000293502:A2V	ENSP00000293502:A2V	A	-	2	0	SDR9C7	55614308	0.985000	0.35326	0.832000	0.32986	0.165000	0.22458	1.909000	0.39917	1.402000	0.46780	0.655000	0.94253	GCG		0.542	SDR9C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411211.1	NM_148897		3	51	0	0	0	0.004672	0	3	51				
LRP1	4035	broad.mit.edu	37	12	57573898	57573898	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:57573898T>G	ENST00000243077.3	+	31	5676	c.5210T>G	c.(5209-5211)cTc>cGc	p.L1737R		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1737					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CGCACCCTGCTCTTCAGTGGC	0.612																																							uc001snd.2		NA																	0				ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(5209-5211)CTC>CGC		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						133.0	130.0	131.0					12																	57573898		2203	4300	6503	SO:0001583	missense	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57573898T>G	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5210T>G	12.37:g.57573898T>G	ENSP00000243077:p.Leu1737Arg		Somatic					p.L1737R	NM_002332	NP_002323	WXS	Illumina HiSeq	Unspecified	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	31	5676	+			1737			LDL-receptor class B 15.|Extracellular (Potential).		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	c.5210T>G	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.715585	0.68844	.	.	ENSG00000123384	ENST00000243077	D	0.92446	-3.04	4.87	4.87	0.63330	Six-bladed beta-propeller, TolB-like (1);	0.094037	0.43260	D	0.000583	D	0.96312	0.8797	M	0.91459	3.21	0.80722	D	1	D	0.65815	0.995	D	0.63597	0.916	D	0.97093	0.9792	10	0.87932	D	0	.	13.5905	0.61957	0.0:0.0:0.0:1.0	.	1737	Q07954	LRP1_HUMAN	R	1737	ENSP00000243077:L1737R	ENSP00000243077:L1737R	L	+	2	0	LRP1	55860165	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.833000	0.86765	2.037000	0.60232	0.533000	0.62120	CTC		0.612	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		54	145	0	0	0	0.01441	0	54	145				
LGR5	8549	broad.mit.edu	37	12	71946940	71946940	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:71946940T>G	ENST00000266674.5	+	5	827	c.516T>G	c.(514-516)aaT>aaG	p.N172K	LGR5_ENST00000540815.2_Missense_Mutation_p.N172K|LGR5_ENST00000536515.1_Intron			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	172					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TGGATGACAATGCGTTAACAG	0.507																																							uc001swl.2		NA																	0				lung(4)|skin(3)|ovary(1)|pancreas(1)	9						c.(514-516)AAT>AAG		leucine-rich repeat-containing G protein-coupled							116.0	111.0	112.0					12																	71946940		2203	4300	6503	SO:0001583	missense	8549					integral to plasma membrane	protein-hormone receptor activity	g.chr12:71946940T>G	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.516T>G	12.37:g.71946940T>G	ENSP00000266674:p.Asn172Lys		Somatic				LGR5_uc001swm.2_Missense_Mutation_p.N172K|LGR5_uc001swn.1_RNA	p.N172K	NM_003667	NP_003658	WXS	Illumina HiSeq	Unspecified	O75473	LGR5_HUMAN			5	564	+			172			Extracellular (Potential).|LRR 5.		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	ENST00000266674.5	37	c.516T>G	CCDS9000.1	.	.	.	.	.	.	.	.	.	.	T	19.90	3.912162	0.72983	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000540815	T;T	0.44083	0.93;0.93	5.67	-0.968	0.10313	.	0.000000	0.64402	D	0.000001	T	0.72566	0.3476	H	0.97682	4.055	0.45733	D	0.998638	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.77151	-0.2693	10	0.87932	D	0	.	12.0947	0.53748	0.0:0.419:0.0:0.581	.	172;172	O75473-2;O75473	.;LGR5_HUMAN	K	172	ENSP00000266674:N172K;ENSP00000441035:N172K	ENSP00000266674:N172K	N	+	3	2	LGR5	70233207	0.914000	0.31030	0.223000	0.23860	0.988000	0.76386	0.134000	0.15932	-0.487000	0.06735	-0.132000	0.14878	AAT		0.507	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667		14	89	0	0	0	0.00245	0	14	89				
PPP1R12A	4659	broad.mit.edu	37	12	80266692	80266692	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:80266692C>A	ENST00000450142.2	-	2	530	c.264G>T	c.(262-264)atG>atT	p.M88I	PPP1R12A_ENST00000261207.5_Missense_Mutation_p.M88I|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.M88I|PPP1R12A_ENST00000546369.1_Start_Codon_SNP_p.M1I|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.M88I	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	88					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						GAAACTTCACCATATCAACAT	0.333																																							uc001syz.2		NA																	0				ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(262-264)ATG>ATT		protein phosphatase 1, regulatory (inhibitor)							91.0	84.0	86.0					12																	80266692		1873	4147	6020	SO:0001583	missense	4659					contractile fiber	protein binding|signal transducer activity	g.chr12:80266692C>A	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.264G>T	12.37:g.80266692C>A	ENSP00000389168:p.Met88Ile		Somatic				PPP1R12A_uc010suc.1_Missense_Mutation_p.M1I|PPP1R12A_uc001sza.2_Missense_Mutation_p.M88I|PPP1R12A_uc010sud.1_Missense_Mutation_p.M88I|PPP1R12A_uc001szb.2_Missense_Mutation_p.M88I|PPP1R12A_uc001szc.2_Missense_Mutation_p.M88I	p.M88I	NM_002480	NP_002471	WXS	Illumina HiSeq	Unspecified	O14974	MYPT1_HUMAN			2	531	-			88			ANK 2.		B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	37	c.264G>T	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785634	0.90282	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000550510	T;T;T;T;T;T;T	0.63096	0.15;0.15;0.15;0.96;0.15;-0.02;0.09	5.02	5.02	0.67125	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.53965	0.1829	N	0.00890	-1.11	0.80722	D	1	D;B;D;P	0.58268	0.982;0.029;0.962;0.94	D;B;D;D	0.68765	0.939;0.146;0.96;0.917	T	0.76069	-0.3094	10	0.72032	D	0.01	.	18.7121	0.91661	0.0:1.0:0.0:0.0	.	88;88;88;88	F8W8Q6;O14974-2;O14974-3;O14974	.;.;.;MYPT1_HUMAN	I	88;88;88;88;88;88;88;1;88;88;16	ENSP00000261207:M88I;ENSP00000389168:M88I;ENSP00000416769:M88I;ENSP00000449514:M1I;ENSP00000446855:M88I;ENSP00000446816:M88I;ENSP00000447338:M16I	ENSP00000261207:M88I	M	-	3	0	PPP1R12A	78790823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.478000	0.83669	0.585000	0.79938	ATG		0.333	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480		12	21	1	0	3.07112e-06	0.010729	3.4364e-06	12	21				
APAF1	317	broad.mit.edu	37	12	99042414	99042414	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:99042414A>T	ENST00000551964.1	+	3	885	c.149A>T	c.(148-150)cAg>cTg	p.Q50L	APAF1_ENST00000339433.3_Missense_Mutation_p.Q50L|APAF1_ENST00000357310.1_Missense_Mutation_p.Q50L|APAF1_ENST00000549007.1_Missense_Mutation_p.Q50L|APAF1_ENST00000547743.1_Missense_Mutation_p.Q50L|APAF1_ENST00000547045.1_Missense_Mutation_p.Q50L|APAF1_ENST00000550527.1_Missense_Mutation_p.Q50L|APAF1_ENST00000359972.2_Missense_Mutation_p.Q50L|APAF1_ENST00000333991.1_Missense_Mutation_p.Q50L|APAF1_ENST00000552268.1_Missense_Mutation_p.Q50L	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	50	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	CCCACTCAACAGCAAAGAGCA	0.303																																							uc001tfz.2		NA																	0				ovary(2)|lung(1)	3						c.(148-150)CAG>CTG		apoptotic peptidase activating factor 1 isoform	Adenosine triphosphate(DB00171)						70.0	68.0	69.0					12																	99042414		2203	4300	6503	SO:0001583	missense	317				activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding	g.chr12:99042414A>T	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.149A>T	12.37:g.99042414A>T	ENSP00000448165:p.Gln50Leu		Somatic				APAF1_uc001tfy.2_Missense_Mutation_p.Q50L|APAF1_uc001tga.2_Missense_Mutation_p.Q50L|APAF1_uc001tgb.2_Missense_Mutation_p.Q50L|APAF1_uc001tgc.2_Missense_Mutation_p.Q50L	p.Q50L	NM_181861	NP_863651	WXS	Illumina HiSeq	Unspecified	O14727	APAF_HUMAN			3	726	+			50			CARD.		B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	37	c.149A>T	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	A	8.714	0.912764	0.17907	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000333991;ENST00000547743;ENST00000552268;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11;2.11;2.11;2.11;2.11	5.79	1.85	0.25348	DEATH-like (2);Caspase Recruitment (2);	0.536017	0.22318	N	0.061660	T	0.11367	0.0277	L	0.38175	1.15	0.22330	N	0.9992	B;B;B;B;B	0.17038	0.001;0.0;0.001;0.0;0.02	B;B;B;B;B	0.12156	0.005;0.001;0.005;0.002;0.007	T	0.36335	-0.9752	10	0.08599	T	0.76	-0.9154	3.3581	0.07176	0.4948:0.0:0.242:0.2632	.	50;50;50;50;50	O14727-6;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	L	50	ENSP00000448165:Q50L;ENSP00000353059:Q50L;ENSP00000349862:Q50L;ENSP00000341830:Q50L;ENSP00000334558:Q50L;ENSP00000450175:Q50L;ENSP00000448826:Q50L;ENSP00000448449:Q50L;ENSP00000449791:Q50L;ENSP00000448161:Q50L	ENSP00000334558:Q50L	Q	+	2	0	APAF1	97566545	0.994000	0.37717	0.447000	0.26932	0.380000	0.30137	0.693000	0.25497	0.047000	0.15862	0.533000	0.62120	CAG		0.303	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1		22	53	0	0	0	0.012319	0	22	53				
UTP20	27340	broad.mit.edu	37	12	101732712	101732712	+	Silent	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:101732712T>C	ENST00000261637.4	+	31	4164	c.3990T>C	c.(3988-3990)agT>agC	p.S1330S		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1330					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						CACAAGTCAGTAAAGAGCTTG	0.323																																							uc001tia.1		NA																	0				ovary(2)|breast(2)	4						c.(3988-3990)AGT>AGC		down-regulated in metastasis							65.0	68.0	67.0					12																	101732712		2203	4299	6502	SO:0001819	synonymous_variant	27340				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding	g.chr12:101732712T>C	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3990T>C	12.37:g.101732712T>C			Somatic					p.S1330S	NM_014503	NP_055318	WXS	Illumina HiSeq	Unspecified	O75691	UTP20_HUMAN			31	4146	+			1330					Q9H3H4	Silent	SNP	ENST00000261637.4	37	c.3990T>C	CCDS9081.1																																																																																				0.323	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503		16	39	0	0	0	0.003163	0	16	39				
SLC41A2	84102	broad.mit.edu	37	12	105198953	105198953	+	Nonsense_Mutation	SNP	G	G	A	rs540046926		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:105198953G>A	ENST00000258538.3	-	10	1826	c.1699C>T	c.(1699-1701)Cga>Tga	p.R567*	SLC41A2_ENST00000549713.1_5'UTR	NM_032148.3	NP_115524.3	Q96JW4	S41A2_HUMAN	solute carrier family 41 (magnesium transporter), member 2	567					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	22						TCTCCATCTCGATCTCCAATA	0.418																																					Esophageal Squamous(195;176 2919 4272 35572)	Esophageal Squamous(195;176 2919 4272 35572)	uc001tla.2		NA																	0				ovary(1)|skin(1)	2						c.(1699-1701)CGA>TGA		solute carrier family 41, member 2							207.0	216.0	213.0					12																	105198953		2203	4300	6503	SO:0001587	stop_gained	84102					integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity	g.chr12:105198953G>A	BC036734	CCDS9100.2	12q24.11	2013-07-17	2013-07-17		ENSG00000136052	ENSG00000136052		"""Solute carriers"""	31045	protein-coding gene	gene with protein product		610802	"""solute carrier family 41, member 2"""				Standard	NM_032148		Approved	DKFZP434K0427	uc001tla.3	Q96JW4	OTTHUMG00000156965	ENST00000258538.3:c.1699C>T	12.37:g.105198953G>A	ENSP00000258538:p.Arg567*		Somatic					p.R567*	NM_032148	NP_115524	WXS	Illumina HiSeq	Unspecified	Q96JW4	S41A2_HUMAN			10	1866	-			567			Cytoplasmic.		Q3KP68|Q9H0E5	Nonsense_Mutation	SNP	ENST00000258538.3	37	c.1699C>T	CCDS9100.2	.	.	.	.	.	.	.	.	.	.	G	37	6.470550	0.97594	.	.	ENSG00000136052	ENST00000258538	.	.	.	5.66	3.74	0.42951	.	0.136001	0.47852	D	0.000209	.	.	.	.	.	.	0.37776	D	0.926837	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.1696	13.9326	0.64006	0.0:0.0:0.4927:0.5073	.	.	.	.	X	567	.	ENSP00000258538:R567X	R	-	1	2	SLC41A2	103723083	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.056000	0.57448	1.345000	0.45676	0.585000	0.79938	CGA		0.418	SLC41A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346850.3	NM_032148		24	294	0	0	0	0.003954	0	24	294				
TBX3	6926	broad.mit.edu	37	12	115114207	115114207	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:115114207T>C	ENST00000257566.3	-	6	1399	c.1010A>G	c.(1009-1011)gAt>gGt	p.D337G	TBX3_ENST00000349155.2_Missense_Mutation_p.D317G	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	337					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		GGAGGACTCATCAGAGGTCCC	0.512																																							uc001tvt.1		NA																	0				ovary(2)|skin(1)	3						c.(1009-1011)GAT>GGT		T-box 3 protein isoform 2							166.0	150.0	155.0					12																	115114207		2203	4300	6503	SO:0001583	missense	6926				anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding	g.chr12:115114207T>C	BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.1010A>G	12.37:g.115114207T>C	ENSP00000257566:p.Asp337Gly		Somatic				TBX3_uc001tvu.1_Missense_Mutation_p.D317G	p.D337G	NM_016569	NP_057653	WXS	Illumina HiSeq	Unspecified	O15119	TBX3_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0574)	6	1974	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		337					Q8TB20|Q9UKF8	Missense_Mutation	SNP	ENST00000257566.3	37	c.1010A>G	CCDS9176.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.204883	0.58234	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.90504	-2.68;-2.62	4.99	4.99	0.66335	Transcription factor, T-box, region of unknown function (1);	0.355962	0.30911	N	0.008637	D	0.93680	0.7981	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.83275	0.996;0.996	D	0.93337	0.6706	10	0.44086	T	0.13	.	13.8553	0.63522	0.0:0.0:0.0:1.0	.	317;337	O15119-2;O15119	.;TBX3_HUMAN	G	317;337;337	ENSP00000257567:D317G;ENSP00000257566:D337G	ENSP00000257566:D337G	D	-	2	0	TBX3	113598590	1.000000	0.71417	0.155000	0.22561	0.153000	0.21895	7.417000	0.80156	1.862000	0.54008	0.533000	0.62120	GAT		0.512	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404947.2	NM_016569, NM_005996		35	67	0	0	0	0.004878	0	35	67				
CIT	11113	broad.mit.edu	37	12	120156087	120156087	+	Silent	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:120156087C>T	ENST00000261833.7	-	31	4057	c.4005G>A	c.(4003-4005)ccG>ccA	p.P1335P	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Silent_p.P1377P	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1335					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GGCTGGATGGCGGGGCCAGCA	0.572																																							uc001txi.1		NA																	0				ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10						c.(4003-4005)CCG>CCA		citron							39.0	44.0	42.0					12																	120156087		2203	4300	6503	SO:0001819	synonymous_variant	11113				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity	g.chr12:120156087C>T	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.4005G>A	12.37:g.120156087C>T			Somatic				CIT_uc001txh.1_Silent_p.P854P|CIT_uc001txj.1_Silent_p.P1377P	p.P1335P	NM_007174	NP_009105	WXS	Illumina HiSeq	Unspecified	O14578	CTRO_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.211)	31	4058	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)	1335					Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	37	c.4005G>A	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.424268	0.25639	.	.	ENSG00000122966	ENST00000392520	.	.	.	5.74	-2.7	0.06004	.	.	.	.	.	T	0.52256	0.1723	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49184	-0.8966	4	.	.	.	.	8.5255	0.33302	0.1647:0.145:0.0:0.6903	.	.	.	.	H	948	.	.	R	-	2	0	CIT	118640470	0.009000	0.17119	0.940000	0.37924	0.983000	0.72400	-1.257000	0.02866	-0.354000	0.08212	-0.140000	0.14226	CGC		0.572	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174		3	45	0	0	0	0.004672	0	3	45				
CLIP1	6249	broad.mit.edu	37	12	122826024	122826024	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:122826024T>C	ENST00000540338.1	-	10	1768	c.1727A>G	c.(1726-1728)cAt>cGt	p.H576R	CLIP1_ENST00000545889.1_Missense_Mutation_p.H266R|CLIP1_ENST00000361654.4_Missense_Mutation_p.H530R|CLIP1_ENST00000537178.1_Missense_Mutation_p.H530R|CLIP1_ENST00000358808.2_Missense_Mutation_p.H565R|CLIP1_ENST00000302528.7_Missense_Mutation_p.H565R			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	576					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GGCTCCAAAATGCTCCTTCAG	0.443																																							uc001ucg.1		NA																	0				ovary(2)|breast(1)	3						c.(1726-1728)CAT>CGT		restin isoform a							168.0	183.0	178.0					12																	122826024		2203	4300	6503	SO:0001583	missense	6249				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding	g.chr12:122826024T>C		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.1727A>G	12.37:g.122826024T>C	ENSP00000439093:p.His576Arg		Somatic				CLIP1_uc001uch.1_Missense_Mutation_p.H565R|CLIP1_uc001uci.1_Missense_Mutation_p.H530R|CLIP1_uc001ucj.1_Missense_Mutation_p.H266R|CLIP1_uc009zxo.1_Missense_Mutation_p.H132R	p.H576R	NM_002956	NP_002947	WXS	Illumina HiSeq	Unspecified	P30622	CLIP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)	10	1833	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		576			Potential.		A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	37	c.1727A>G	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.336593	0.24253	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304	T;T;T;T;T;T	0.60797	2.81;0.77;0.77;0.84;0.81;0.16	5.25	2.62	0.31277	.	0.350727	0.30781	N	0.008900	T	0.29945	0.0749	N	0.04508	-0.205	0.23243	N	0.998058	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.15407	-1.0438	10	0.20519	T	0.43	-5.7199	9.1436	0.36919	0.0:0.197:0.0:0.803	.	266;530;565;576	F5H0N7;P30622-2;P30622-1;P30622	.;.;.;CLIP1_HUMAN	R	266;565;565;410;530;576;499	ENSP00000438743:H266R;ENSP00000303585:H565R;ENSP00000351665:H565R;ENSP00000445531:H530R;ENSP00000439093:H576R;ENSP00000437786:H499R	ENSP00000303585:H565R	H	-	2	0	CLIP1	121391977	0.236000	0.23804	0.405000	0.26409	0.973000	0.67179	1.595000	0.36708	0.942000	0.37525	0.459000	0.35465	CAT		0.443	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956		51	270	0	0	0	0.01441	0	51	270				
GPR133	283383	broad.mit.edu	37	12	131498749	131498749	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr12:131498749C>T	ENST00000261654.5	+	13	1896	c.1337C>T	c.(1336-1338)gCg>gTg	p.A446V	GPR133_ENST00000535015.1_Missense_Mutation_p.A478V|GPR133_ENST00000376682.4_Missense_Mutation_p.A132V	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	446					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCAAGGATCGCGGAGGCCATG	0.587																																							uc001uit.3		NA																	0				pancreas(5)|ovary(3)|skin(2)	10						c.(1336-1338)GCG>GTG		G protein-coupled receptor 133 precursor							96.0	84.0	88.0					12																	131498749		2203	4300	6503	SO:0001583	missense	283383				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:131498749C>T	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1337C>T	12.37:g.131498749C>T	ENSP00000261654:p.Ala446Val		Somatic				GPR133_uc010tbm.1_Missense_Mutation_p.A478V	p.A446V	NM_198827	NP_942122	WXS	Illumina HiSeq	Unspecified	Q6QNK2	GP133_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)	13	1896	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		446			Extracellular (Potential).		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	c.1337C>T	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	c	12.58	1.980784	0.34942	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000545900;ENST00000376682	T;T;T	0.43688	0.95;0.94;0.95	4.43	3.52	0.40303	.	0.642937	0.15993	N	0.234703	T	0.32526	0.0832	L	0.53249	1.67	0.09310	N	0.999992	B;B	0.33120	0.342;0.398	B;B	0.19391	0.025;0.025	T	0.20538	-1.0272	10	0.44086	T	0.13	.	8.8773	0.35354	0.0:0.8878:0.0:0.1122	.	478;446	B7ZLF7;Q6QNK2	.;GP133_HUMAN	V	446;478;142;132	ENSP00000261654:A446V;ENSP00000444425:A478V;ENSP00000365872:A132V	ENSP00000261654:A446V	A	+	2	0	GPR133	130064702	0.002000	0.14202	0.008000	0.14137	0.008000	0.06430	1.699000	0.37804	2.183000	0.69458	0.645000	0.84053	GCG		0.587	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827		9	51	0	0	0	0.008291	0	9	51				
AMER2	219287	broad.mit.edu	37	13	25743844	25743844	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr13:25743844T>A	ENST00000515384.1	-	1	2581	c.1914A>T	c.(1912-1914)aaA>aaT	p.K638N	AMER2_ENST00000357816.2_Missense_Mutation_p.K519N|AMER2_ENST00000381853.3_Missense_Mutation_p.K519N			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	638					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)										AAACCGGGATTTTTGTTCTGG	0.552																																							uc001uqb.2		NA																	0				ovary(2)|large_intestine(1)|lung(1)	4						c.(1912-1914)AAA>AAT		hypothetical protein LOC219287 isoform 1							96.0	95.0	96.0					13																	25743844		2203	4300	6503	SO:0001583	missense	219287							g.chr13:25743844T>A	AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1914A>T	13.37:g.25743844T>A	ENSP00000426528:p.Lys638Asn		Somatic				FAM123A_uc001uqa.2_Missense_Mutation_p.K519N|FAM123A_uc001uqc.2_Missense_Mutation_p.K519N	p.K638N	NM_152704	NP_689917	WXS	Illumina HiSeq	Unspecified	Q8N7J2	F123A_HUMAN		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)	1	2014	-		Lung SC(185;0.0225)|Breast(139;0.0602)	638					Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	ENST00000515384.1	37	c.1914A>T	CCDS53859.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.167949	0.78339	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	T;T;T	0.34275	1.43;1.43;1.37	5.97	5.97	0.96955	.	0.051113	0.85682	D	0.000000	T	0.48333	0.1494	L	0.27053	0.805	0.51767	D	0.999932	D;D	0.89917	1.0;1.0	D;D	0.79108	0.982;0.992	T	0.50866	-0.8777	10	0.72032	D	0.01	-2.9794	15.6316	0.76912	0.0:0.0:0.0:1.0	.	638;519	Q8N7J2;Q8N7J2-2	F123A_HUMAN;.	N	519;519;638	ENSP00000350469:K519N;ENSP00000371277:K519N;ENSP00000426528:K638N	ENSP00000350469:K519N	K	-	3	2	FAM123A	24641844	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.937000	0.48979	2.288000	0.76882	0.533000	0.62120	AAA		0.552	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704		28	97	0	0	0	0.005443	0	28	97				
ATP8A2	51761	broad.mit.edu	37	13	26116088	26116088	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr13:26116088G>T	ENST00000381655.2	+	9	825	c.683G>T	c.(682-684)cGt>cTt	p.R228L	ATP8A2_ENST00000255283.8_Missense_Mutation_p.R188L	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	188					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ATGCAAACACGTGAAGTTCTG	0.433																																							uc001uqk.2		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(682-684)CGT>CTT		ATPase, aminophospholipid transporter-like,							111.0	106.0	108.0					13																	26116088		1898	4119	6017	SO:0001583	missense	51761				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:26116088G>T	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.683G>T	13.37:g.26116088G>T	ENSP00000371070:p.Arg228Leu		Somatic				ATP8A2_uc010tdi.1_Missense_Mutation_p.R188L|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc001uql.1_Missense_Mutation_p.R188L	p.R228L	NM_016529	NP_057613	WXS	Illumina HiSeq	Unspecified	Q9NTI2	AT8A2_HUMAN		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)	9	825	+		Breast(139;0.0201)|Lung SC(185;0.0225)	188			Cytoplasmic (Potential).		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	c.683G>T	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	G	7.638	0.680355	0.14907	.	.	ENSG00000132932	ENST00000381655;ENST00000255283	T;T	0.76316	-1.01;-1.01	5.24	5.24	0.73138	ATPase, P-type, ATPase-associated domain (1);	0.199518	0.47852	D	0.000208	T	0.54679	0.1873	N	0.02721	-0.515	0.37937	D	0.932203	B;B;B	0.11235	0.001;0.004;0.001	B;B;B	0.15484	0.01;0.013;0.01	T	0.55982	-0.8054	10	0.26408	T	0.33	.	12.538	0.56152	0.0767:0.0:0.9233:0.0	.	188;188;188	B7Z880;Q9NTI2-3;Q9NTI2	.;.;AT8A2_HUMAN	L	228;188	ENSP00000371070:R228L;ENSP00000255283:R188L	ENSP00000255283:R188L	R	+	2	0	ATP8A2	25014088	1.000000	0.71417	0.294000	0.24946	0.006000	0.05464	5.067000	0.64357	2.599000	0.87857	0.643000	0.83706	CGT		0.433	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529		20	68	1	0	0.00887093	0.008871	0.00912233	20	68				
MTUS2	23281	broad.mit.edu	37	13	29598883	29598883	+	Silent	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr13:29598883G>T	ENST00000431530.3	+	1	136	c.78G>T	c.(76-78)cgG>cgT	p.R26R		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	16						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTCAGTTGCGGGACAACAGAA	0.458																																							uc001usl.3		NA																	0					0						c.(76-78)CGG>CGT		hypothetical protein LOC23281 isoform a							76.0	73.0	74.0					13																	29598883		1919	4135	6054	SO:0001819	synonymous_variant	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:29598883G>T	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.78G>T	13.37:g.29598883G>T			Somatic					p.R26R	NM_001033602	NP_001028774	WXS	Illumina HiSeq	Unspecified	Q5JR59	MTUS2_HUMAN			1	136	+			16					A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000431530.3	37	c.78G>T	CCDS45022.1																																																																																				0.458	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		24	58	1	0	9.95505e-16	0.014323	1.32387e-15	24	58				
TEX26	122046	broad.mit.edu	37	13	31513846	31513847	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr13:31513846_31513847GG>TT	ENST00000380473.3	+	2	90_91	c.77_78GG>TT	c.(76-78)tGG>tTT	p.W26F		NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	26																	GACCCCAACTGGGATTCCTATG	0.356																																							uc001uti.2		NA																	0				ovary(2)|skin(1)	3						c.(76-78)TGG>TTT		hypothetical protein LOC122046																																				SO:0001583	missense	122046							g.chr13:31513846_31513847GG>TT	BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	Exception_encountered	13.37:g.31513846_31513847delinsTT	ENSP00000369840:p.Trp26Phe		Somatic					p.W26F	NM_152325	NP_689538	WXS	Illumina HiSeq	Unspecified	Q8N6G2	CM026_HUMAN		all cancers(112;0.0176)|Epithelial(112;0.0768)|OV - Ovarian serous cystadenocarcinoma(117;0.0852)	2	96_97	+		Lung SC(185;0.0281)	26						Missense_Mutation	DNP	ENST00000380473.3	37	c.77_78GG>TT	CCDS9339.1																																																																																				0.356	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325		11	49	0	0	0	0.004672	0	11	49				
MTRF1	9617	broad.mit.edu	37	13	41827091	41827091	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr13:41827091T>C	ENST00000379480.4	-	4	683	c.583A>G	c.(583-585)Act>Gct	p.T195A	MTRF1_ENST00000239852.6_5'UTR|MTRF1_ENST00000379477.1_Missense_Mutation_p.T195A|MTRF1_ENST00000430347.2_Missense_Mutation_p.T208A	NM_004294.2	NP_004285.2	O75570	RF1M_HUMAN	mitochondrial translational release factor 1	195					regulation of translational termination (GO:0006449)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)			breast(1)|endometrium(4)|large_intestine(3)|lung(6)	14		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		TGACCTCCAGTAGTCCTTCCA	0.313																																							uc001uxx.2		NA																	0					0						c.(583-585)ACT>GCT		mitochondrial translational release factor 1							58.0	56.0	57.0					13																	41827091		2203	4300	6503	SO:0001583	missense	9617				regulation of translational termination	mitochondrion	translation release factor activity, codon specific	g.chr13:41827091T>C	AF072934	CCDS9378.1	13q14.1-q14.3	2008-07-18			ENSG00000120662	ENSG00000120662			7469	protein-coding gene	gene with protein product	"""mitochontrial peptide chain release factor 1"""	604601				9838146, 10773675	Standard	NM_004294		Approved	RF1, MTTRF1, MGC47721	uc001uxy.3	O75570	OTTHUMG00000016790	ENST00000379480.4:c.583A>G	13.37:g.41827091T>C	ENSP00000368793:p.Thr195Ala		Somatic				MTRF1_uc001uxy.2_Missense_Mutation_p.T195A|MTRF1_uc001uxz.2_Missense_Mutation_p.T31A|MTRF1_uc010tff.1_Missense_Mutation_p.T208A|MTRF1_uc001uyc.1_Missense_Mutation_p.T195A	p.T195A	NM_004294	NP_004285	WXS	Illumina HiSeq	Unspecified	O75570	RF1M_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)	6	1053	-		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)	195					B4DG01|Q5T6Y5|Q8IUQ6	Missense_Mutation	SNP	ENST00000379480.4	37	c.583A>G	CCDS9378.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.402775	0.62288	.	.	ENSG00000120662	ENST00000379480;ENST00000379477;ENST00000430347;ENST00000452359	T;T;T;T	0.38077	1.16;1.16;1.16;1.16	5.88	5.88	0.94601	Peptide chain release factor (2);	0.000000	0.85682	D	0.000000	T	0.51278	0.1665	L	0.43757	1.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.37526	-0.9702	10	0.20046	T	0.44	-19.8953	16.259	0.82532	0.0:0.0:0.0:1.0	.	208;195	B4DG01;O75570	.;RF1M_HUMAN	A	195;195;208;195	ENSP00000368793:T195A;ENSP00000368790:T195A;ENSP00000400031:T208A;ENSP00000399279:T195A	ENSP00000368790:T195A	T	-	1	0	MTRF1	40725091	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	6.911000	0.75746	2.245000	0.73994	0.482000	0.46254	ACT		0.313	MTRF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044666.3	NM_004294		18	36	0	0	0	0.006122	0	18	36				
TNFSF11	8600	broad.mit.edu	37	13	43155388	43155388	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr13:43155388T>A	ENST00000239849.6	+	2	497	c.346T>A	c.(346-348)Tgt>Agt	p.C116S	TNFSF11_ENST00000358545.2_Missense_Mutation_p.C43S|TNFSF11_ENST00000405262.2_Missense_Mutation_p.C43S|TNFSF11_ENST00000398795.2_Missense_Mutation_p.C43S|TNFSF11_ENST00000544862.1_Missense_Mutation_p.C43S			O14788	TNF11_HUMAN	tumor necrosis factor (ligand) superfamily, member 11	116					activation of JUN kinase activity (GO:0007257)|bone resorption (GO:0045453)|calcium ion homeostasis (GO:0055074)|cytokine-mediated signaling pathway (GO:0019221)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|monocyte chemotaxis (GO:0002548)|organ morphogenesis (GO:0009887)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of bone resorption (GO:0045780)|positive regulation of corticotropin-releasing hormone secretion (GO:0051466)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast development (GO:2001206)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	cytokine activity (GO:0005125)|tumor necrosis factor receptor binding (GO:0005164)|tumor necrosis factor receptor superfamily binding (GO:0032813)			kidney(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	10		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)	Denosumab(DB06643)|Lenalidomide(DB00480)	ACCTGATTCATGTAGGAGAAT	0.403																																							uc001uyu.2		NA																	0					0						c.(346-348)TGT>AGT		tumor necrosis factor ligand superfamily, member							68.0	67.0	68.0					13																	43155388		2203	4300	6503	SO:0001583	missense	8600				immune response|monocyte chemotaxis|osteoclast differentiation|positive regulation of bone resorption|positive regulation of corticotropin-releasing hormone secretion|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of homotypic cell-cell adhesion|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell activation	cytoplasm|extracellular space|integral to plasma membrane	cytokine activity|receptor activity|tumor necrosis factor receptor binding	g.chr13:43155388T>A	AF013171	CCDS9384.1, CCDS9385.1	13q14	2008-02-05			ENSG00000120659	ENSG00000120659		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11926	protein-coding gene	gene with protein product		602642				9312132, 9367155	Standard	NM_003701		Approved	TRANCE, RANKL, OPGL, ODF, CD254	uc001uyu.2	O14788	OTTHUMG00000016807	ENST00000239849.6:c.346T>A	13.37:g.43155388T>A	ENSP00000239849:p.Cys116Ser		Somatic				TNFSF11_uc001uyt.2_Missense_Mutation_p.C43S	p.C116S	NM_003701	NP_003692	WXS	Illumina HiSeq	Unspecified	O14788	TNF11_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)	2	495	+		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)	116			Extracellular (Potential).		O14723|Q96Q17|Q9P2Q3	Missense_Mutation	SNP	ENST00000239849.6	37	c.346T>A	CCDS9384.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.168015	0.78339	.	.	ENSG00000120659	ENST00000358545;ENST00000405262;ENST00000239849;ENST00000398795;ENST00000544862	D;D;D;D;D	0.97529	-3.81;-3.81;-4.42;-3.81;-3.81	5.45	5.45	0.79879	.	0.107081	0.64402	D	0.000005	D	0.98036	0.9353	M	0.70275	2.135	0.53005	D	0.999961	D	0.76494	0.999	D	0.80764	0.994	D	0.98858	1.0761	10	0.72032	D	0.01	-16.9341	14.3838	0.66929	0.0:0.0:0.0:1.0	.	116	O14788	TNF11_HUMAN	S	43;43;116;43;43	ENSP00000351347:C43S;ENSP00000384042:C43S;ENSP00000239849:C116S;ENSP00000381775:C43S;ENSP00000444913:C43S	ENSP00000239849:C116S	C	+	1	0	TNFSF11	42053388	1.000000	0.71417	0.955000	0.39395	0.945000	0.59286	4.799000	0.62517	2.190000	0.69967	0.482000	0.46254	TGT		0.403	TNFSF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044702.2			18	64	0	0	0	0.007413	0	18	64				
MYCBP2	23077	broad.mit.edu	37	13	77670506	77670506	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr13:77670506C>A	ENST00000544440.2	-	57	9798	c.9781G>T	c.(9781-9783)Gta>Tta	p.V3261L	MYCBP2_ENST00000407578.2_Missense_Mutation_p.V3299L|MYCBP2_ENST00000357337.6_Missense_Mutation_p.V3261L|MYCBP2_ENST00000482517.1_5'Flank|MYCBP2-AS1_ENST00000593933.1_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CGATCACATACCAGATACCAA	0.438																																							uc001vkf.2		NA																	0				ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(9781-9783)GTA>TTA		MYC binding protein 2							189.0	157.0	168.0					13																	77670506		2203	4300	6503	SO:0001583	missense	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77670506C>A	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.9781G>T	13.37:g.77670506C>A	ENSP00000444596:p.Val3261Leu		Somatic				MYCBP2_uc010aev.2_Missense_Mutation_p.V2665L	p.V3261L	NM_015057	NP_055872	WXS	Illumina HiSeq	Unspecified	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	58	9872	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	3261						Missense_Mutation	SNP	ENST00000544440.2	37	c.9781G>T		.	.	.	.	.	.	.	.	.	.	C	12.59	1.983870	0.35036	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.21932	1.98;1.98;1.98	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.11836	0.0288	N	0.04880	-0.145	0.58432	D	0.999998	B	0.34290	0.447	B	0.34180	0.177	T	0.16012	-1.0417	10	0.09590	T	0.72	.	19.2193	0.93790	0.0:1.0:0.0:0.0	.	3261	O75592	MYCB2_HUMAN	L	3261;3299;3261	ENSP00000349892:V3261L;ENSP00000384288:V3299L;ENSP00000444596:V3261L	ENSP00000349892:V3261L	V	-	1	0	MYCBP2	76568507	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.089000	0.71384	2.524000	0.85096	0.655000	0.94253	GTA		0.438	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		44	132	1	0	2.13384e-23	0.01441	2.99445e-23	44	132				
HS6ST3	266722	broad.mit.edu	37	13	97485168	97485168	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr13:97485168C>G	ENST00000376705.2	+	2	1156	c.1132C>G	c.(1132-1134)Cag>Gag	p.Q378E		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	378					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					CCCCTTCACACAGTTCAACAT	0.498																																							uc001vmw.2		NA																	0				ovary(1)|skin(1)	2						c.(1132-1134)CAG>GAG		heparan sulfate 6-O-sulfotransferase 3							99.0	96.0	97.0					13																	97485168		2203	4300	6503	SO:0001583	missense	266722					integral to membrane	sulfotransferase activity	g.chr13:97485168C>G	AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.1132C>G	13.37:g.97485168C>G	ENSP00000365895:p.Gln378Glu		Somatic					p.Q378E	NM_153456	NP_703157	WXS	Illumina HiSeq	Unspecified	Q8IZP7	H6ST3_HUMAN			2	1156	+	all_neural(89;0.0878)|Medulloblastoma(90;0.163)		378			Lumenal (Potential).		Q5W0L0|Q68CW6	Missense_Mutation	SNP	ENST00000376705.2	37	c.1132C>G	CCDS9481.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.289464	0.80914	.	.	ENSG00000185352	ENST00000376705	T	0.74737	-0.87	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.86008	0.5830	M	0.67625	2.065	0.80722	D	1	D	0.63046	0.992	D	0.76071	0.987	D	0.85180	0.1003	10	0.54805	T	0.06	-28.8745	20.3057	0.98631	0.0:1.0:0.0:0.0	.	378	Q8IZP7	H6ST3_HUMAN	E	378	ENSP00000365895:Q378E	ENSP00000365895:Q378E	Q	+	1	0	HS6ST3	96283169	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	7.814000	0.86154	2.791000	0.96007	0.655000	0.94253	CAG		0.498	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045517.2	NM_153456		27	81	0	0	0	0.003954	0	27	81				
SSTR1	6751	broad.mit.edu	37	14	38679155	38679155	+	Silent	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr14:38679155C>T	ENST00000267377.2	+	3	1178	c.561C>T	c.(559-561)ctC>ctT	p.L187L		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	187					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	TATCGCTGCTCGTCATCCTGC	0.662																																							uc001wul.1		NA																	0				central_nervous_system(3)|ovary(1)|lung(1)	5						c.(559-561)CTC>CTT		somatostatin receptor 1	Octreotide(DB00104)						89.0	85.0	87.0					14																	38679155		2203	4300	6503	SO:0001819	synonymous_variant	6751				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity	g.chr14:38679155C>T		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.561C>T	14.37:g.38679155C>T			Somatic				SSTR1_uc010amu.1_Intron	p.L187L	NM_001049	NP_001040	WXS	Illumina HiSeq	Unspecified	P30872	SSR1_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	3	1178	+	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		187			Helical; Name=4; (Potential).			Silent	SNP	ENST00000267377.2	37	c.561C>T	CCDS9666.1																																																																																				0.662	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2			10	38	0	0	0	0.010729	0	10	38				
DDHD1	80821	broad.mit.edu	37	14	53529739	53529739	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr14:53529739T>G	ENST00000323669.5	-	7	1687	c.1688A>C	c.(1687-1689)gAa>gCa	p.E563A	DDHD1_ENST00000395606.1_Missense_Mutation_p.E570A|DDHD1_ENST00000357758.3_Missense_Mutation_p.E563A	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	563					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					CAACTCTTCTTCCTTTTGCAG	0.383																																							uc001xai.2		NA																	0				ovary(2)	2						c.(1687-1689)GAA>GCA		DDHD domain containing 1 isoform c							160.0	148.0	152.0					14																	53529739		2203	4300	6503	SO:0001583	missense	80821				lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding	g.chr14:53529739T>G	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.1688A>C	14.37:g.53529739T>G	ENSP00000327104:p.Glu563Ala		Somatic				DDHD1_uc001xaj.2_Missense_Mutation_p.E570A|DDHD1_uc001xah.2_Missense_Mutation_p.E563A|DDHD1_uc001xag.2_Missense_Mutation_p.E145A|DDHD1_uc001xak.1_5'Flank	p.E563A	NM_001160148	NP_001153620	WXS	Illumina HiSeq	Unspecified	Q8NEL9	DDHD1_HUMAN			7	1918	-	Breast(41;0.037)		563					G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	c.1688A>C	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	T	13.96	2.391626	0.42410	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	T;T;T	0.43294	0.95;0.95;0.95	5.47	5.47	0.80525	.	0.125642	0.64402	D	0.000015	T	0.33614	0.0869	N	0.14661	0.345	0.43531	D	0.995819	P;P;P	0.49358	0.923;0.874;0.842	P;B;P	0.48952	0.596;0.374;0.491	T	0.07927	-1.0747	10	0.15066	T	0.55	-16.9282	14.7181	0.69286	0.0:0.0:0.0:1.0	.	570;563;563	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	A	563;570;563;434	ENSP00000327104:E563A;ENSP00000378970:E570A;ENSP00000350401:E563A	ENSP00000327104:E563A	E	-	2	0	DDHD1	52599489	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	4.943000	0.63554	2.052000	0.61016	0.477000	0.44152	GAA		0.383	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1			48	114	0	0	0	0.01441	0	48	114				
SLC8A3	6547	broad.mit.edu	37	14	70634960	70634960	+	Silent	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr14:70634960C>A	ENST00000381269.2	-	2	933	c.180G>T	c.(178-180)ctG>ctT	p.L60L	SLC8A3_ENST00000357887.3_Silent_p.L60L|SLC8A3_ENST00000534137.1_Silent_p.L60L|SLC8A3_ENST00000528359.1_Silent_p.L60L|SLC8A3_ENST00000356921.2_Silent_p.L60L	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	60					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ACCAGATTGGCAGGATGACAC	0.552																																							uc001xly.2		NA																	0				skin(3)|ovary(2)|breast(2)	7						c.(178-180)CTG>CTT		solute carrier family 8 (sodium/calcium							72.0	61.0	65.0					14																	70634960		2203	4300	6503	SO:0001819	synonymous_variant	6547				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding	g.chr14:70634960C>A	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.180G>T	14.37:g.70634960C>A			Somatic				SLC8A3_uc001xlw.2_Silent_p.L60L|SLC8A3_uc001xlx.2_Silent_p.L60L|SLC8A3_uc001xlz.2_Silent_p.L60L|SLC8A3_uc010ara.2_RNA	p.L60L	NM_183002	NP_892114	WXS	Illumina HiSeq	Unspecified	P57103	NAC3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)	2	934	-			60			Extracellular (Potential).		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	c.180G>T	CCDS35498.1																																																																																				0.552	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			13	24	1	0	0.000151284	0.001855	0.000160779	13	24				
ADAM21P1	145241	broad.mit.edu	37	14	70713288	70713288	+	RNA	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr14:70713288T>A	ENST00000530196.1	-	0	1230					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GTATTCATGATGCAACCTCTT	0.428																																							uc010ttg.1		NA																	0					0						c.(580-582)ATC>TTC		SubName: Full=ADAM21-like protein;																																						145241							g.chr14:70713288T>A			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713288T>A			Somatic					p.I194F	NR_003951		WXS	Illumina HiSeq	Unspecified					1	1231	-									Missense_Mutation	SNP	ENST00000530196.1	37	c.580A>T																																																																																					0.428	ADAM21P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000390451.1	NG_002467		45	208	0	0	0	0.013114	0	45	208				
PCNX	22990	broad.mit.edu	37	14	71485796	71485796	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr14:71485796C>G	ENST00000304743.2	+	12	3513	c.3067C>G	c.(3067-3069)Ctt>Gtt	p.L1023V	PCNX_ENST00000238570.5_Missense_Mutation_p.L1023V|PCNX_ENST00000439984.3_Missense_Mutation_p.L912V	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1023						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GGGATCTATTCTTCTCATACA	0.433																																							uc001xmo.2		NA																	0				ovary(1)	1						c.(3067-3069)CTT>GTT		pecanex-like 1							196.0	177.0	183.0					14																	71485796		2203	4300	6503	SO:0001583	missense	22990					integral to membrane		g.chr14:71485796C>G	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.3067C>G	14.37:g.71485796C>G	ENSP00000304192:p.Leu1023Val		Somatic				PCNX_uc010are.1_Missense_Mutation_p.L912V|PCNX_uc010arf.1_5'UTR	p.L1023V	NM_014982	NP_055797	WXS	Illumina HiSeq	Unspecified	Q96RV3	PCX1_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)	12	3513	+			1023			Helical; (Potential).		B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	c.3067C>G	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.017642|4.017642	0.75161|0.75161	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000554691|ENST00000304743;ENST00000238570;ENST00000439984	.|T;T;T	.|0.68903	.|-0.36;-0.36;-0.36	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78091|0.78091	0.4229|0.4229	L|L	0.48986|0.48986	1.54|1.54	0.80722|0.80722	D|D	1|1	.|B;D	.|0.69078	.|0.402;0.997	.|B;D	.|0.72625	.|0.119;0.978	T|T	0.73981|0.73981	-0.3811|-0.3811	5|10	.|0.30854	.|T	.|0.27	.|.	19.5026|19.5026	0.95103|0.95103	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|912;1023	.|B2RTR6;Q96RV3	.|.;PCX1_HUMAN	L|V	81|1023;1023;912	.|ENSP00000304192:L1023V;ENSP00000238570:L1023V;ENSP00000396617:L912V	.|ENSP00000238570:L1023V	F|L	+|+	3|1	2|0	PCNX|PCNX	70555549|70555549	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.776000|7.776000	0.85560|0.85560	2.612000|2.612000	0.88384|0.88384	0.655000|0.655000	0.94253|0.94253	TTC|CTT		0.433	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982		41	121	0	0	0	0.007835	0	41	121				
ASB2	51676	broad.mit.edu	37	14	94417386	94417386	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr14:94417386T>C	ENST00000315988.4	-	4	1183	c.695A>G	c.(694-696)cAg>cGg	p.Q232R	ASB2_ENST00000556337.1_Intron|ASB2_ENST00000555019.1_Missense_Mutation_p.Q280R|MIR4506_ENST00000584693.1_RNA	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	232					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		CTGTCCACTCTGGGCGGCCAC	0.587																																							uc001ycc.1		NA																	0		p.Q232H(1)		ovary(1)|pancreas(1)	2						c.(694-696)CAG>CGG		ankyrin repeat and SOCS box-containing protein							161.0	150.0	154.0					14																	94417386		2203	4300	6503	SO:0001583	missense	51676				intracellular signal transduction			g.chr14:94417386T>C	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.695A>G	14.37:g.94417386T>C	ENSP00000320675:p.Gln232Arg		Somatic				ASB2_uc001ycd.2_Missense_Mutation_p.Q280R|ASB2_uc001yce.1_Missense_Mutation_p.Q178R	p.Q232R	NM_016150	NP_057234	WXS	Illumina HiSeq	Unspecified	Q96Q27	ASB2_HUMAN		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)	4	1184	-		all_cancers(154;0.13)	232			ANK 6.		B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	c.695A>G	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.327520	0.81690	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507;ENST00000556062	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.0	5.62	5.62	0.85841	Ankyrin repeat-containing domain (3);	0.056743	0.64402	D	0.000001	T	0.49253	0.1546	N	0.10782	0.045	0.47094	D	0.999317	P;P;B	0.43231	0.684;0.801;0.426	B;B;B	0.43990	0.422;0.438;0.422	T	0.54443	-0.8293	10	0.40728	T	0.16	-22.1794	15.8384	0.78818	0.0:0.0:0.0:1.0	.	248;280;232	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	R	280;248;232;178;178;126	ENSP00000451575:Q280R;ENSP00000320675:Q232R;ENSP00000450940:Q178R;ENSP00000451694:Q126R	ENSP00000320675:Q232R	Q	-	2	0	ASB2	93487139	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	6.258000	0.72487	2.137000	0.66172	0.459000	0.35465	CAG		0.587	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1			82	199	0	0	0	0.01441	0	82	199				
GOLGA6L6	727832	broad.mit.edu	37	15	20743796	20743796	+	Silent	SNP	C	C	T	rs200673320		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr15:20743796C>T	ENST00000427390.2	-	4	498	c.408G>A	c.(406-408)acG>acA	p.T136T		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	136								p.T136T(1)		NS(3)|endometrium(4)|kidney(1)|skin(3)	11						TTTTCTGACACGTAAGGATTC	0.493																																							uc001ytk.2		NA																	1	Substitution - coding silent(1)		endometrium(1)		0						c.(406-408)ACG>ACA		golgi autoantigen, golgin subfamily a, 6-like 6							31.0	8.0	19.0					15																	20743796		336	402	738	SO:0001819	synonymous_variant	727832							g.chr15:20743796C>T	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.408G>A	15.37:g.20743796C>T			Somatic					p.T136T	NM_001145004	NP_001138476	WXS	Illumina HiSeq	Unspecified	A8MZA4	GG6L6_HUMAN			4	499	-			136			Potential.		D3YTC0	Silent	SNP	ENST00000427390.2	37	c.408G>A	CCDS45184.1																																																																																				0.493	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414660.3	NM_001145004		4	47	0	0	0	0.009096	0	4	47				
HERC2	8924	broad.mit.edu	37	15	28460848	28460848	+	Silent	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr15:28460848G>A	ENST00000261609.7	-	39	6237	c.6129C>T	c.(6127-6129)ctC>ctT	p.L2043L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCGGGGAGCTGAGGGCGCCGC	0.632																																							uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(6127-6129)CTC>CTT		hect domain and RLD 2							30.0	28.0	29.0					15																	28460848		2203	4300	6503	SO:0001819	synonymous_variant	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28460848G>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6129C>T	15.37:g.28460848G>A			Somatic					p.L2043L	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	39	6235	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	2043						Silent	SNP	ENST00000261609.7	37	c.6129C>T	CCDS10021.1																																																																																				0.632	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		13	26	0	0	0	0.001855	0	13	26				
CHRFAM7A	89832	broad.mit.edu	37	15	30664536	30664536	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr15:30664536C>A	ENST00000299847.2	-	7	790	c.337G>T	c.(337-339)Ggc>Tgc	p.G113C	CHRFAM7A_ENST00000397827.3_Missense_Mutation_p.G22C|CHRFAM7A_ENST00000401522.3_Missense_Mutation_p.G22C|CHRFAM7A_ENST00000567722.1_5'Flank	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	113						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		CTCCTCTTGCCGGGGATTCCT	0.488																																							uc001zdt.1		NA																	0				skin(1)	1						c.(337-339)GGC>TGC		CHRNA7-FAM7A fusion isoform 1							30.0	32.0	31.0					15																	30664536		1566	3466	5032	SO:0001583	missense	89832					integral to membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity	g.chr15:30664536C>A	AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.337G>T	15.37:g.30664536C>A	ENSP00000299847:p.Gly113Cys		Somatic				DKFZP434L187_uc001zds.2_Intron|CHRFAM7A_uc001zdu.1_Missense_Mutation_p.G22C|CHRFAM7A_uc010azn.2_Missense_Mutation_p.G22C	p.G113C	NM_139320	NP_647536	WXS	Illumina HiSeq	Unspecified	Q494W8	CRFM7_HUMAN		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)	7	903	-		all_lung(180;3.42e-11)|Breast(32;0.000153)	113					A8KAB9	Missense_Mutation	SNP	ENST00000299847.2	37	c.337G>T	CCDS32184.1	.	.	.	.	.	.	.	.	.	.	.	13.34	2.207824	0.39003	.	.	ENSG00000166664	ENST00000299847;ENST00000397827;ENST00000401522	T;T;T	0.79247	-1.25;-1.25;-1.25	2.73	2.73	0.32206	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.85427	0.5694	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86744	0.1956	10	0.87932	D	0	.	11.6814	0.51458	0.0:1.0:0.0:0.0	.	113	Q494W8	CRFM7_HUMAN	C	113;22;22	ENSP00000299847:G113C;ENSP00000380927:G22C;ENSP00000385389:G22C	ENSP00000299847:G113C	G	-	1	0	CHRFAM7A	28451828	0.992000	0.36948	0.402000	0.26371	0.166000	0.22503	6.999000	0.76283	1.475000	0.48197	0.398000	0.26397	GGC		0.488	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430700.1	NM_148911		5	11	1	0	2.74318e-10	0.006214	3.38237e-10	5	11				
SHC4	399694	broad.mit.edu	37	15	49255125	49255125	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr15:49255125A>G	ENST00000332408.4	-	1	516	c.88T>C	c.(88-90)Tac>Cac	p.Y30H		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	30	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		AAGCGGCTGTACTTGGCCCTG	0.652																																							uc001zxb.1		NA																	0				ovary(3)|pancreas(2)	5						c.(88-90)TAC>CAC		rai-like protein							69.0	75.0	73.0					15																	49255125		2195	4293	6488	SO:0001583	missense	399694				intracellular signal transduction	cell junction|postsynaptic membrane		g.chr15:49255125A>G	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.88T>C	15.37:g.49255125A>G	ENSP00000329668:p.Tyr30His		Somatic					p.Y30H	NM_203349	NP_976224	WXS	Illumina HiSeq	Unspecified	Q6S5L8	SHC4_HUMAN		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)	1	517	-		all_lung(180;0.00466)	30			CH2.		Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	c.88T>C	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	A	18.29	3.591759	0.66219	.	.	ENSG00000185634	ENST00000332408	T	0.59638	0.25	4.63	2.29	0.28610	.	0.000000	0.53938	D	0.000053	T	0.68568	0.3015	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66280	-0.5963	10	0.87932	D	0	-4.2651	6.2819	0.21011	0.7802:0.0:0.0784:0.1414	.	30	Q6S5L8	SHC4_HUMAN	H	30	ENSP00000329668:Y30H	ENSP00000329668:Y30H	Y	-	1	0	SHC4	47042417	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.719000	0.84751	0.290000	0.22444	0.533000	0.62120	TAC		0.652	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349		36	86	0	0	0	0.007835	0	36	86				
FAM227B	196951	broad.mit.edu	37	15	49800505	49800505	+	Silent	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr15:49800505C>G	ENST00000299338.6	-	11	1218	c.915G>C	c.(913-915)ctG>ctC	p.L305L	FAM227B_ENST00000561064.1_Silent_p.L271L	NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	305																	AGAGTTCTTTCAGTTTCCAGT	0.318																																							uc001zxl.2		NA																	0				ovary(1)	1						c.(913-915)CTG>CTC		hypothetical protein LOC196951							141.0	137.0	138.0					15																	49800505		2196	4295	6491	SO:0001819	synonymous_variant	196951							g.chr15:49800505C>G		CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.915G>C	15.37:g.49800505C>G			Somatic				C15orf33_uc001zxm.2_Silent_p.L271L	p.L305L	NM_152647	NP_689860	WXS	Illumina HiSeq	Unspecified	Q96M60	CO033_HUMAN		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)	11	1209	-		all_lung(180;0.00187)	305					Q86WS2	Silent	SNP	ENST00000299338.6	37	c.915G>C	CCDS32237.1																																																																																				0.318	FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417872.1	NM_152647		26	69	0	0	0	0.00632	0	26	69				
ATP8B4	79895	broad.mit.edu	37	15	50168535	50168535	+	Silent	SNP	A	A	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr15:50168535A>T	ENST00000284509.6	-	25	3108	c.2967T>A	c.(2965-2967)gcT>gcA	p.A989A	ATP8B4_ENST00000559829.1_Silent_p.A989A	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	989						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		ACTGGTAGTCAGCAATATGTT	0.468																																							uc001zxu.2		NA																	0				skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.(2965-2967)GCT>GCA		ATPase class I type 8B member 4							131.0	111.0	118.0					15																	50168535		2196	4295	6491	SO:0001819	synonymous_variant	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50168535A>T	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.2967T>A	15.37:g.50168535A>T			Somatic				ATP8B4_uc010ber.2_Silent_p.A862A|ATP8B4_uc010ufd.1_Silent_p.A799A|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_5'UTR	p.A989A	NM_024837	NP_079113	WXS	Illumina HiSeq	Unspecified	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	25	3109	-		all_lung(180;0.00183)	989			Extracellular (Potential).		Q9H727	Silent	SNP	ENST00000284509.6	37	c.2967T>A	CCDS32238.1																																																																																				0.468	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		12	54	0	0	0	0.010729	0	12	54				
LRRC49	54839	broad.mit.edu	37	15	71185957	71185957	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr15:71185957C>T	ENST00000260382.5	+	2	343	c.83C>T	c.(82-84)tCa>tTa	p.S28L	LRRC49_ENST00000443425.2_5'UTR|THAP10_ENST00000249861.4_5'Flank|LRRC49_ENST00000560369.1_Missense_Mutation_p.S28L|LRRC49_ENST00000544974.2_Missense_Mutation_p.S18L|LRRC49_ENST00000560691.1_5'Flank	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	28				S -> L (in Ref. 1; BAG53933). {ECO:0000305}.		cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						ATTCAAACATCATCGCTTCCT	0.294																																							uc002asw.2		NA																	0				ovary(1)	1						c.(82-84)TCA>TTA		leucine rich repeat containing 49							75.0	77.0	76.0					15																	71185957		2199	4293	6492	SO:0001583	missense	54839					cytoplasm|microtubule		g.chr15:71185957C>T		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.83C>T	15.37:g.71185957C>T	ENSP00000260382:p.Ser28Leu		Somatic				LRRC49_uc002asu.2_Missense_Mutation_p.S18L|LRRC49_uc002asx.2_5'UTR|LRRC49_uc010ukf.1_Missense_Mutation_p.S28L|LRRC49_uc002asy.2_5'Flank|LRRC49_uc002asz.2_5'Flank|THAP10_uc002asv.2_5'Flank	p.S28L	NM_017691	NP_060161	WXS	Illumina HiSeq	Unspecified	Q8IUZ0	LRC49_HUMAN			2	330	+			28					B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	ENST00000260382.5	37	c.83C>T	CCDS32282.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573169	0.86542	.	.	ENSG00000137821	ENST00000544974;ENST00000260382	T;T	0.34859	1.35;1.34	5.7	5.7	0.88788	.	0.233958	0.30235	N	0.010095	T	0.31167	0.0788	N	0.24115	0.695	0.80722	D	1	D;D;B	0.53151	0.958;0.958;0.328	P;P;B	0.45232	0.474;0.474;0.124	T	0.05517	-1.0880	10	0.54805	T	0.06	-9.8309	15.3482	0.74359	0.0:1.0:0.0:0.0	.	28;28;18	B7Z366;Q8IUZ0;F5H1J4	.;LRC49_HUMAN;.	L	18;28	ENSP00000439600:S18L;ENSP00000260382:S28L	ENSP00000260382:S28L	S	+	2	0	LRRC49	68973011	0.992000	0.36948	0.986000	0.45419	0.981000	0.71138	4.108000	0.57817	2.705000	0.92388	0.650000	0.86243	TCA		0.294	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417209.3	NM_017691		12	47	0	0	0	0.00245	0	12	47				
MPI	4351	broad.mit.edu	37	15	75185067	75185067	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr15:75185067G>C	ENST00000352410.4	+	4	478	c.411G>C	c.(409-411)gaG>gaC	p.E137D	MPI_ENST00000563422.1_Missense_Mutation_p.E137D|MPI_ENST00000564003.1_Missense_Mutation_p.E87D|MPI_ENST00000323744.6_Missense_Mutation_p.E137D|MPI_ENST00000562606.1_Missense_Mutation_p.E117D|MPI_ENST00000565576.1_Missense_Mutation_p.E137D|MPI_ENST00000563786.1_Missense_Mutation_p.E117D|MPI_ENST00000535694.1_Missense_Mutation_p.E87D|MPI_ENST00000566377.1_Missense_Mutation_p.E137D			P34949	MPI_HUMAN	mannose phosphate isomerase	137					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	mannose-6-phosphate isomerase activity (GO:0004476)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						ACAAGCCAGAGATGGCCATTG	0.587																																							uc002azc.1		NA																	0				ovary(2)	2						c.(409-411)GAG>GAC		mannose-6- phosphate isomerase							70.0	65.0	66.0					15																	75185067		2197	4295	6492	SO:0001583	missense	4351				dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	mannose-6-phosphate isomerase activity|zinc ion binding	g.chr15:75185067G>C		CCDS10272.1, CCDS73756.1, CCDS73757.1, CCDS73758.1	15q24.1	2013-09-19			ENSG00000178802	ENSG00000178802	5.3.1.8		7216	protein-coding gene	gene with protein product	"""mannose-6-phosphate isomerase"""	154550					Standard	NM_002435		Approved		uc002azc.1	P34949	OTTHUMG00000142826	ENST00000352410.4:c.411G>C	15.37:g.75185067G>C	ENSP00000318318:p.Glu137Asp		Somatic				MPI_uc010ulv.1_Missense_Mutation_p.E137D|MPI_uc010ulw.1_Missense_Mutation_p.E87D|MPI_uc002azd.1_Missense_Mutation_p.E137D|MPI_uc010ulx.1_Missense_Mutation_p.E87D|MPI_uc002aze.1_Missense_Mutation_p.E137D	p.E137D	NM_002435	NP_002426	WXS	Illumina HiSeq	Unspecified	P34949	MPI_HUMAN			4	416	+			137				Zinc (By similarity).	A8K8K9|Q96AB0	Missense_Mutation	SNP	ENST00000352410.4	37	c.411G>C	CCDS10272.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.579929	0.86645	.	.	ENSG00000178802	ENST00000352410;ENST00000535694;ENST00000379693;ENST00000323744	D;D;D	0.98585	-5.01;-5.01;-5.01	5.53	3.64	0.41730	Cupin, RmlC-type (1);RmlC-like jelly roll fold (1);Phosphomannose isomerase, type I, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99284	0.9750	H	0.98901	4.365	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0	D	0.98156	1.0444	10	0.72032	D	0.01	.	8.1576	0.31178	0.2475:0.0:0.7525:0.0	.	87;137;137;117;137	B4DYB8;B4DFC4;P34949-2;Q8NHZ6;P34949	.;.;.;.;MPI_HUMAN	D	137;87;117;137	ENSP00000318318:E137D;ENSP00000440447:E87D;ENSP00000318192:E137D	ENSP00000318192:E137D	E	+	3	2	MPI	72972120	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.458000	0.35223	0.679000	0.31345	0.585000	0.79938	GAG		0.587	MPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286418.4			3	51	0	0	0	0.004672	0	3	51				
IL16	3603	broad.mit.edu	37	15	81575082	81575082	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr15:81575082T>A	ENST00000302987.4	+	8	1184	c.1184T>A	c.(1183-1185)cTg>cAg	p.L395Q	IL16_ENST00000394660.2_Missense_Mutation_p.L395Q			Q14005	IL16_HUMAN	interleukin 16	395	Interaction with GRIN2A.|PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						GTGGCGCACCTGGACGGACGT	0.547																																							uc002bgh.3		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(1183-1185)CTG>CAG		interleukin 16 isoform 2							176.0	183.0	181.0					15																	81575082		2137	4247	6384	SO:0001583	missense	3603				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity	g.chr15:81575082T>A	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.1184T>A	15.37:g.81575082T>A	ENSP00000302935:p.Leu395Gln		Somatic				IL16_uc002bgc.2_RNA|IL16_uc010blq.1_Missense_Mutation_p.L395Q|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.L437Q|IL16_uc002bgg.2_Missense_Mutation_p.L395Q|IL16_uc002bgi.1_5'UTR	p.L395Q	NM_172217	NP_757366	WXS	Illumina HiSeq	Unspecified	Q14005	IL16_HUMAN			9	1560	+			395			PDZ 2.|Interaction with GRIN2A.		A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	c.1184T>A	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.373634	0.61624	.	.	ENSG00000172349	ENST00000394655;ENST00000394660;ENST00000355368;ENST00000302987	T;T	0.16897	2.31;2.31	5.46	5.46	0.80206	PDZ/DHR/GLGF (3);	0.000000	0.34986	N	0.003536	T	0.26738	0.0654	N	0.25647	0.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.946;0.976	T	0.05115	-1.0905	10	0.14656	T	0.56	.	15.5247	0.75894	0.0:0.0:0.0:1.0	.	395;395	Q14005;Q14005-2	IL16_HUMAN;.	Q	395;395;227;395	ENSP00000378155:L395Q;ENSP00000302935:L395Q	ENSP00000302935:L395Q	L	+	2	0	IL16	79362137	1.000000	0.71417	0.986000	0.45419	0.566000	0.35808	6.957000	0.76019	2.067000	0.61834	0.482000	0.46254	CTG		0.547	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217		43	207	0	0	0	0.01441	0	43	207				
SOX8	30812	broad.mit.edu	37	16	1035178	1035178	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr16:1035178G>A	ENST00000293894.3	+	3	1248	c.1133G>A	c.(1132-1134)gGc>gAc	p.G378D		NM_014587.3	NP_055402.2	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	378					adipose tissue development (GO:0060612)|astrocyte fate commitment (GO:0060018)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|enteric nervous system development (GO:0048484)|fat cell differentiation (GO:0045444)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of gliogenesis (GO:0014015)|positive regulation of kidney development (GO:0090184)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone levels (GO:0010817)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|ureter morphogenesis (GO:0072197)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|lung(5)|prostate(2)|skin(1)	10		Hepatocellular(780;0.00308)				cccTTCGCCGGCTCACAGGGC	0.726																																							uc002ckn.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1132-1134)GGC>GAC		SRY (sex determining region Y)-box 8							11.0	13.0	12.0					16																	1035178		2184	4264	6448	SO:0001583	missense	30812				adipose tissue development|enteric nervous system development|fat cell differentiation|in utero embryonic development|metanephric nephron tubule formation|morphogenesis of a branching epithelium|negative regulation of apoptosis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|neural crest cell migration|oligodendrocyte differentiation|osteoblast differentiation|peripheral nervous system development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of gliogenesis|positive regulation of osteoblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone levels|renal vesicle induction|retinal rod cell differentiation|Sertoli cell development|signal transduction|spermatogenesis|ureter morphogenesis	cytoplasm|nucleus		g.chr16:1035178G>A	AF164104	CCDS10428.1	16p13.3	2008-05-23			ENSG00000005513	ENSG00000005513		"""SRY (sex determining region Y)-boxes"""	11203	protein-coding gene	gene with protein product		605923				10662550, 10684944	Standard	NM_014587		Approved		uc002ckn.3	P57073	OTTHUMG00000122101	ENST00000293894.3:c.1133G>A	16.37:g.1035178G>A	ENSP00000293894:p.Gly378Asp		Somatic					p.G378D	NM_014587	NP_055402	WXS	Illumina HiSeq	Unspecified	P57073	SOX8_HUMAN			3	1248	+		Hepatocellular(780;0.00308)	378					Q9NZW2	Missense_Mutation	SNP	ENST00000293894.3	37	c.1133G>A	CCDS10428.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369109	0.24771	.	.	ENSG00000005513	ENST00000293894	D	0.96885	-4.16	4.18	4.18	0.49190	.	0.185631	0.56097	D	0.000027	D	0.93112	0.7807	L	0.29908	0.895	0.28188	N	0.927862	B	0.27068	0.167	B	0.29524	0.103	D	0.89305	0.3629	10	0.62326	D	0.03	.	15.7173	0.77677	0.0:0.0:1.0:0.0	.	378	P57073	SOX8_HUMAN	D	378	ENSP00000293894:G378D	ENSP00000293894:G378D	G	+	2	0	SOX8	975179	0.345000	0.24835	0.026000	0.17262	0.001000	0.01503	3.440000	0.52886	2.175000	0.68902	0.555000	0.69702	GGC		0.726	SOX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242867.1			3	28	0	0	0	0.004672	0	3	28				
ZDHHC1	29800	broad.mit.edu	37	16	67428917	67428917	+	Silent	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr16:67428917C>A	ENST00000348579.2	-	10	1559	c.1218G>T	c.(1216-1218)cgG>cgT	p.R406R	TPPP3_ENST00000290942.5_5'Flank|TPPP3_ENST00000562206.1_5'Flank|ZDHHC1_ENST00000566075.1_5'UTR|TPPP3_ENST00000393957.2_5'Flank	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	406					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		GACGCCGGATCCGAGGTCTCA	0.632																																							uc010vjm.1		NA																	0					0						c.(1216-1218)CGG>CGT		zinc finger, DHHC-type containing 1							19.0	24.0	22.0					16																	67428917		2195	4299	6494	SO:0001819	synonymous_variant	29800					integral to membrane	DNA binding|zinc ion binding	g.chr16:67428917C>A	U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.1218G>T	16.37:g.67428917C>A			Somatic				TPPP3_uc002eta.2_5'Flank|TPPP3_uc002etb.2_5'Flank	p.R406R	NM_013304	NP_037436	WXS	Illumina HiSeq	Unspecified	Q8WTX9	ZDHC1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)	10	1522	-		Ovarian(137;0.223)	406					O15461	Silent	SNP	ENST00000348579.2	37	c.1218G>T	CCDS10836.1																																																																																				0.632	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268845.1	NM_013304		4	20	1	0	0.00909568	0.009096	0.00931574	4	20				
TSR1	55720	broad.mit.edu	37	17	2239378	2239378	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:2239378C>A	ENST00000301364.5	-	2	1233	c.154G>T	c.(154-156)Gac>Tac	p.D52Y	SGSM2_ENST00000574563.1_5'Flank|TSR1_ENST00000576112.2_Missense_Mutation_p.D52Y|SGSM2_ENST00000426855.2_5'Flank|SGSM2_ENST00000268989.3_5'Flank	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	52					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						TGCCTCTGGTCGACTCTGCTG	0.567																																							uc002fuj.2		NA																	0				ovary(1)	1						c.(154-156)GAC>TAC		TSR1, 20S rRNA accumulation							137.0	128.0	131.0					17																	2239378		2203	4300	6503	SO:0001583	missense	55720				ribosome assembly	nucleolus	protein binding	g.chr17:2239378C>A	AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.154G>T	17.37:g.2239378C>A	ENSP00000301364:p.Asp52Tyr		Somatic				SGSM2_uc002fum.3_5'Flank|SGSM2_uc010vqw.1_5'Flank|SGSM2_uc002fun.3_5'Flank	p.D52Y	NM_018128	NP_060598	WXS	Illumina HiSeq	Unspecified	Q2NL82	TSR1_HUMAN			2	1111	-			52					Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	ENST00000301364.5	37	c.154G>T	CCDS32525.1	.	.	.	.	.	.	.	.	.	.	C	35	5.446672	0.96205	.	.	ENSG00000167721	ENST00000301364	T	0.46063	0.88	5.73	5.73	0.89815	.	0.088834	0.85682	D	0.000000	T	0.66218	0.2767	M	0.78637	2.42	0.80722	D	1	D	0.71674	0.998	D	0.65443	0.935	T	0.67764	-0.5586	10	0.66056	D	0.02	-18.7516	18.8232	0.92106	0.0:1.0:0.0:0.0	.	52	Q2NL82	TSR1_HUMAN	Y	52	ENSP00000301364:D52Y	ENSP00000301364:D52Y	D	-	1	0	TSR1	2186128	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	6.265000	0.72534	2.861000	0.98227	0.655000	0.94253	GAC		0.567	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438180.2	NM_018128		31	87	1	0	7.63091e-17	0.007835	1.02553e-16	31	87				
SGSM2	9905	broad.mit.edu	37	17	2274591	2274591	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:2274591C>T	ENST00000426855.2	+	12	1499	c.1324C>T	c.(1324-1326)Ccc>Tcc	p.P442S	SGSM2_ENST00000574563.1_Missense_Mutation_p.P442S|SGSM2_ENST00000268989.3_Missense_Mutation_p.P487S	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	442					late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		GGGCTTTGGGCCCAGCCTGCC	0.662																																							uc002fun.3		NA																	0					0						c.(1324-1326)CCC>TCC		RUN and TBC1 domain containing 1 isoform 2							32.0	30.0	30.0					17																	2274591		2202	4299	6501	SO:0001583	missense	9905					intracellular	Rab GTPase activator activity	g.chr17:2274591C>T	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.1324C>T	17.37:g.2274591C>T	ENSP00000415107:p.Pro442Ser		Somatic				SGSM2_uc002fum.3_Missense_Mutation_p.P487S|SGSM2_uc010vqw.1_Missense_Mutation_p.P442S|SGSM2_uc002fuo.2_Missense_Mutation_p.P30S	p.P442S	NM_001098509	NP_001091979	WXS	Illumina HiSeq	Unspecified	O43147	SGSM2_HUMAN		Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)	12	1499	+			442					A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Missense_Mutation	SNP	ENST00000426855.2	37	c.1324C>T	CCDS45570.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.645869	0.47258	.	.	ENSG00000141258	ENST00000268989;ENST00000426855	T;T	0.11495	2.77;2.77	5.39	5.39	0.77823	.	0.448728	0.26411	N	0.024526	T	0.12347	0.0300	L	0.48362	1.52	0.39962	D	0.97467	P;P;B;P	0.45531	0.673;0.86;0.078;0.775	B;P;B;B	0.44561	0.231;0.453;0.021;0.306	T	0.12760	-1.0535	10	0.12430	T	0.62	-3.5575	13.2486	0.60039	0.0:0.7319:0.2681:0.0	.	442;30;442;487	O43147-5;O43147-3;O43147;O43147-2	.;.;SGSM2_HUMAN;.	S	487;442	ENSP00000268989:P487S;ENSP00000415107:P442S	ENSP00000268989:P487S	P	+	1	0	SGSM2	2221341	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	4.575000	0.60908	2.557000	0.86248	0.558000	0.71614	CCC		0.662	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853		15	25	0	0	0	0.003163	0	15	25				
OR1D2	4991	broad.mit.edu	37	17	2995442	2995442	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:2995442C>T	ENST00000331459.1	-	1	848	c.849G>A	c.(847-849)atG>atA	p.M283I		NM_002548.2	NP_002539.2	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D, member 2	283					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|protein import into nucleus, translocation (GO:0000060)|sensory perception of smell (GO:0007608)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(10)|ovary(1)	15						AGGGATTCATCATGGGTGTCA	0.473																																							uc010vrb.1		NA																	0				ovary(1)	1						c.(847-849)ATG>ATA		olfactory receptor, family 1, subfamily D,							135.0	127.0	130.0					17																	2995442		2203	4300	6503	SO:0001583	missense	4991				cellular component movement|chemotaxis|protein import into nucleus, translocation|sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity	g.chr17:2995442C>T	U04678	CCDS11019.1	17p13.3	2012-08-09			ENSG00000184166	ENSG00000184166		"""GPCR / Class A : Olfactory receptors"""	8183	protein-coding gene	gene with protein product		164342		OLFR1		1370859, 1840504	Standard	NM_002548		Approved	OR17-4	uc010vrb.2	P34982	OTTHUMG00000090619	ENST00000331459.1:c.849G>A	17.37:g.2995442C>T	ENSP00000327585:p.Met283Ile		Somatic					p.M283I	NM_002548	NP_002539	WXS	Illumina HiSeq	Unspecified	P34982	OR1D2_HUMAN			1	849	-			283			Helical; Name=7; (Potential).		Q6IFL8|Q96RA4|Q9UM78	Missense_Mutation	SNP	ENST00000331459.1	37	c.849G>A	CCDS11019.1	.	.	.	.	.	.	.	.	.	.	c	14.71	2.617459	0.46736	.	.	ENSG00000184166	ENST00000331459	T	0.37411	1.2	3.21	3.21	0.36854	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.50888	0.1642	M	0.80746	2.51	0.09310	N	0.999999	D	0.55172	0.97	P	0.53102	0.718	T	0.42816	-0.9429	9	0.87932	D	0	.	9.0967	0.36642	0.0:0.6185:0.3815:0.0	.	283	P34982	OR1D2_HUMAN	I	283	ENSP00000327585:M283I	ENSP00000327585:M283I	M	-	3	0	OR1D2	2942192	0.227000	0.23707	1.000000	0.80357	0.931000	0.56810	1.353000	0.34045	1.606000	0.50161	0.543000	0.68304	ATG		0.473	OR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207207.1	NM_002548		23	69	0	0	0	0.012319	0	23	69				
ASGR2	433	broad.mit.edu	37	17	7012167	7012167	+	Silent	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:7012167G>A	ENST00000380952.2	-	3	429	c.165C>T	c.(163-165)tcC>tcT	p.S55S	ASGR2_ENST00000446679.2_Silent_p.S36S|ASGR2_ENST00000355035.5_Silent_p.S55S|ASGR2_ENST00000254850.7_Silent_p.S36S	NM_001181.4|NM_001201352.1|NM_080912.3	NP_001172|NP_001188281.1|NP_550434	P07307	ASGR2_HUMAN	asialoglycoprotein receptor 2	55					bone mineralization (GO:0030282)|cell surface receptor signaling pathway (GO:0007166)|glycoprotein metabolic process (GO:0009100)|lipid homeostasis (GO:0055088)|receptor-mediated endocytosis (GO:0006898)|regulation of protein stability (GO:0031647)	integral component of membrane (GO:0016021)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|skin(3)|stomach(4)	18					Antihemophilic Factor(DB00025)	AGCAGACCATGGAGCAGAGAC	0.647																																							uc002gep.3		NA																	0				ovary(1)	1						c.(163-165)TCC>TCT		asialoglycoprotein receptor 2 isoform a	Antihemophilic Factor(DB00025)						53.0	41.0	45.0					17																	7012167		2203	4300	6503	SO:0001819	synonymous_variant	433				cell surface receptor linked signaling pathway|endocytosis	focal adhesion|integral to membrane|nucleolus	asialoglycoprotein receptor activity|protein binding|sugar binding	g.chr17:7012167G>A	M11025	CCDS11088.1, CCDS32544.1, CCDS45598.1	17p	2011-08-30			ENSG00000161944	ENSG00000161944		"""C-type lectin domain containing"""	743	protein-coding gene	gene with protein product		108361				3863106	Standard	NM_080912		Approved	CLEC4H2	uc002ger.3	P07307	OTTHUMG00000102158	ENST00000380952.2:c.165C>T	17.37:g.7012167G>A			Somatic				ASGR2_uc010vtk.1_5'Flank|ASGR2_uc002gem.1_5'UTR|ASGR2_uc002gen.1_Silent_p.S36S|ASGR2_uc002geo.1_Silent_p.S55S|ASGR2_uc002ger.3_Silent_p.S55S|ASGR2_uc002geq.3_Silent_p.S36S|ASGR2_uc010clw.2_Silent_p.S36S|ASGR2_uc010vtl.1_RNA	p.S55S	NM_001181	NP_001172	WXS	Illumina HiSeq	Unspecified	P07307	ASGR2_HUMAN			3	430	-			55			Cytoplasmic (Potential).		A6NLV8|A8MT12|D3DTM9|D3DTN0|O00448|Q03969	Silent	SNP	ENST00000380952.2	37	c.165C>T	CCDS32544.1																																																																																				0.647	ASGR2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000220003.1	NM_080914		6	3	0	0	0	0.001168	0	6	3				
ELP5	23587	broad.mit.edu	37	17	7155866	7155866	+	Silent	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:7155866G>A	ENST00000396628.2	+	1	262	c.45G>A	c.(43-45)ttG>ttA	p.L15L	ELP5_ENST00000574255.1_Silent_p.L15L|ELP5_ENST00000574993.1_Silent_p.L15L|RP1-4G17.5_ENST00000577138.1_Intron|CTDNEP1_ENST00000318988.6_5'Flank|CTDNEP1_ENST00000572043.1_5'Flank|ELP5_ENST00000396627.2_Silent_p.L15L|CTDNEP1_ENST00000574322.1_5'Flank|CTDNEP1_ENST00000573600.1_5'Flank|ELP5_ENST00000573657.1_Silent_p.L15L|ELP5_ENST00000356683.2_Silent_p.L15L|ELP5_ENST00000354429.2_Silent_p.L15L	NM_203414.1	NP_981959.1	Q8TE02	ELP5_HUMAN	elongator acetyltransferase complex subunit 5	15					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Elongator holoenzyme complex (GO:0033588)|nucleus (GO:0005634)											GACGCGAGTTGGAGATGTTGG	0.701																																							uc002gfg.1		NA																	0					0						c.(43-45)TTG>TTA		S-phase 2 protein isoform 4							59.0	52.0	54.0					17																	7155866		2203	4300	6503	SO:0001819	synonymous_variant	23587				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding	g.chr17:7155866G>A	BC002762	CCDS11094.1, CCDS11095.1	17p13.1	2012-08-14	2012-08-08	2012-08-08	ENSG00000170291	ENSG00000170291		"""Elongator acetyltransferase complex subunits"""	30617	protein-coding gene	gene with protein product	"""dermal papilla derived protein 6"", ""S-phase 2 protein"""	615019	"""chromosome 17 open reading frame 81"""	C17orf81		22854966	Standard	NM_203415		Approved	DERP6	uc002gfi.1	Q8TE02	OTTHUMG00000177974	ENST00000396628.2:c.45G>A	17.37:g.7155866G>A			Somatic				DULLARD_uc002gfd.2_5'Flank|DULLARD_uc002gfe.2_5'Flank|DULLARD_uc002gff.2_5'Flank|DULLARD_uc002gfc.2_5'Flank|C17orf81_uc002gfj.2_Silent_p.L15L|C17orf81_uc010cmb.2_Silent_p.L15L|C17orf81_uc002gfh.1_Silent_p.L15L|C17orf81_uc002gfi.1_Silent_p.L15L|C17orf81_uc002gfk.1_Silent_p.L15L|C17orf81_uc002gfl.1_Silent_p.L15L	p.L15L	NM_203415	NP_981960	WXS	Illumina HiSeq	Unspecified	Q8TE02	DERP6_HUMAN			2	152	+			15					A8K1M5|D3DTN9|Q659B6|Q7Z2T4|Q8TDR9|Q9BUB2|Q9Y2Q4	Silent	SNP	ENST00000396628.2	37	c.45G>A	CCDS11094.1																																																																																				0.701	ELP5-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440111.1	NM_015362		7	15	0	0	0	0.00308	0	7	15				
NOS2	4843	broad.mit.edu	37	17	26086080	26086080	+	Missense_Mutation	SNP	G	G	A	rs200470759		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:26086080G>A	ENST00000313735.6	-	26	3414	c.3181C>T	c.(3181-3183)Cgg>Tgg	p.R1061W		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	1061					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	AGCTGCTGCCGCAGGATGTCC	0.622													.|||	1	0.000199681	0.0008	0.0	5008	,	,		19212	0.0		0.0	False		,,,				2504	0.0						uc002gzu.2		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(3181-3183)CGG>TGG		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)						19.0	19.0	19.0					17																	26086080		2200	4297	6497	SO:0001583	missense	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26086080G>A	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.3181C>T	17.37:g.26086080G>A	ENSP00000327251:p.Arg1061Trp		Somatic					p.R1061W	NM_000625	NP_000616	WXS	Illumina HiSeq	Unspecified	P35228	NOS2_HUMAN			26	3445	-			1061					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	c.3181C>T	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.465409	0.63513	.	.	ENSG00000007171	ENST00000313735;ENST00000379105	D	0.86865	-2.18	4.34	2.14	0.27477	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.642001	0.13763	N	0.364472	D	0.89677	0.6784	L	0.49513	1.565	0.26185	N	0.979674	D	0.76494	0.999	D	0.63192	0.912	T	0.81380	-0.0959	10	0.62326	D	0.03	.	11.7947	0.52093	0.0:0.0:0.5671:0.4329	.	1061	P35228	NOS2_HUMAN	W	1061;1022	ENSP00000327251:R1061W	ENSP00000327251:R1061W	R	-	1	2	NOS2	23110207	0.984000	0.35163	0.997000	0.53966	0.993000	0.82548	1.988000	0.40697	0.939000	0.37446	0.462000	0.41574	CGG		0.622	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		8	17	0	0	0	0.004482	0	8	17				
SARM1	23098	broad.mit.edu	37	17	26712168	26712168	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:26712168A>T	ENST00000457710.3	+	5	1873	c.1402A>T	c.(1402-1404)Acc>Tcc	p.T468S	SARM1_ENST00000379061.4_3'UTR	NM_015077.2	NP_055892.2	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	502	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of apoptotic process (GO:0042981)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron death (GO:1901214)|response to glucose (GO:0009749)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of mitochondrial outer membrane (GO:0031315)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|synapse (GO:0045202)				cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CCGCCAGTACACCTACGGCCT	0.672																																							uc010crl.1		NA																	0					0						c.(1504-1506)ACC>TCC		sterile alpha and TIR motif containing 1																																				SO:0001583	missense	23098				innate immune response	cytoplasm|intrinsic to membrane	binding|transmembrane receptor activity	g.chr17:26712168A>T	AB011096		17q11	2013-01-10			ENSG00000004139	ENSG00000004139		"""Sterile alpha motif (SAM) domain containing"""	17074	protein-coding gene	gene with protein product		607732				9628581	Standard	NM_015077		Approved	SARM, SAMD2, KIAA0524	uc010crl.1	Q6SZW1	OTTHUMG00000132499	ENST00000457710.3:c.1402A>T	17.37:g.26712168A>T	ENSP00000406738:p.Thr468Ser		Somatic				SARM1_uc010waj.1_RNA|SARM1_uc002hbe.1_Missense_Mutation_p.T46S	p.T502S	NM_015077	NP_055892	WXS	Illumina HiSeq	Unspecified	Q6SZW1	SARM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	8	1571	+	all_lung(13;0.000533)|Lung NSC(42;0.00171)		502			SAM 2.		O60277|Q7LGG3|Q9NXY5	Missense_Mutation	SNP	ENST00000457710.3	37	c.1504A>T		.	.	.	.	.	.	.	.	.	.	A	17.81	3.479661	0.63849	.	.	ENSG00000004139	ENST00000457710;ENST00000003834	.	.	.	5.49	5.49	0.81192	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.85682	D	0.000000	T	0.80270	0.4592	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.83367	0.0005	8	0.87932	D	0	-29.7136	15.5867	0.76489	1.0:0.0:0.0:0.0	.	502	Q6SZW1	SARM1_HUMAN	S	500;468	.	ENSP00000003834:T468S	T	+	1	0	SARM1	23736295	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.273000	0.95719	2.069000	0.61940	0.533000	0.62120	ACC		0.672	SARM1-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000255679.3	NM_015077		7	29	0	0	0	0.001984	0	7	29				
PIGS	94005	broad.mit.edu	37	17	26888589	26888589	+	Missense_Mutation	SNP	C	C	T	rs138187632		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:26888589C>T	ENST00000308360.7	-	6	902	c.527G>A	c.(526-528)cGg>cAg	p.R176Q	PIGS_ENST00000465444.1_5'UTR|PIGS_ENST00000543734.1_Missense_Mutation_p.R115Q|PIGS_ENST00000395346.2_Missense_Mutation_p.R168Q	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	176					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					AAAGGCCTCCCGGTGCATTAT	0.572																																							uc002hbo.2		NA																	0				breast(2)|urinary_tract(1)|kidney(1)	4						c.(526-528)CGG>CAG		phosphatidylinositol glycan anchor biosynthesis,		C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	72.0	57.0	62.0		527	3.9	1.0	17	dbSNP_134	62	0,8600		0,0,4300	no	missense	PIGS	NM_033198.3	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	176/556	26888589	1,13005	2203	4300	6503	SO:0001583	missense	94005				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding	g.chr17:26888589C>T		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.527G>A	17.37:g.26888589C>T	ENSP00000309430:p.Arg176Gln		Somatic				PIGS_uc002hbn.2_Missense_Mutation_p.R168Q|PIGS_uc010wap.1_Missense_Mutation_p.R115Q	p.R176Q	NM_033198	NP_149975	WXS	Illumina HiSeq	Unspecified	Q96S52	PIGS_HUMAN			6	900	-	Lung NSC(42;0.00431)		176			Lumenal (Potential).		Q6UVX6	Missense_Mutation	SNP	ENST00000308360.7	37	c.527G>A	CCDS11235.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.343535	0.41498	2.27E-4	0.0	ENSG00000087111	ENST00000395346;ENST00000308360;ENST00000543734	T;T;T	0.41065	1.01;1.01;1.01	5.87	3.88	0.44766	.	0.436377	0.27460	N	0.019273	T	0.23014	0.0556	N	0.22421	0.69	0.27238	N	0.95922	B;B	0.26363	0.147;0.121	B;B	0.15052	0.012;0.007	T	0.12426	-1.0548	10	0.14656	T	0.56	-10.1767	7.8511	0.29455	0.0:0.8195:0.0:0.1805	.	176;168	Q96S52;Q96S52-2	PIGS_HUMAN;.	Q	168;176;115	ENSP00000378755:R168Q;ENSP00000309430:R176Q;ENSP00000438447:R115Q	ENSP00000309430:R176Q	R	-	2	0	PIGS	23912716	0.943000	0.32029	1.000000	0.80357	0.968000	0.65278	0.485000	0.22324	1.486000	0.48398	0.655000	0.94253	CGG		0.572	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198		11	17	0	0	0	0.010729	0	11	17				
KRT32	3882	broad.mit.edu	37	17	39619225	39619225	+	Silent	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:39619225G>T	ENST00000225899.3	-	6	1177	c.1074C>A	c.(1072-1074)atC>atA	p.I358I		NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	358	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				CAACGTTGGTGATCATGCACT	0.632																																							uc002hwr.2		NA																	0					0						c.(1072-1074)ATC>ATA		keratin 32							79.0	78.0	78.0					17																	39619225		2203	4300	6503	SO:0001819	synonymous_variant	3882				epidermis development	intermediate filament	protein binding|structural molecule activity	g.chr17:39619225G>T	X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.1074C>A	17.37:g.39619225G>T			Somatic					p.I358I	NM_002278	NP_002269	WXS	Illumina HiSeq	Unspecified	Q14532	K1H2_HUMAN			6	1135	-		Breast(137;0.000812)	358			Coil 2.|Rod.			Silent	SNP	ENST00000225899.3	37	c.1074C>A	CCDS11393.1																																																																																				0.632	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257293.1	NM_002278		31	80	1	0	1.55811e-20	0.008361	2.16262e-20	31	80				
RPS6KB1	6198	broad.mit.edu	37	17	58018242	58018242	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:58018242C>G	ENST00000225577.4	+	13	1186	c.1165C>G	c.(1165-1167)Cag>Gag	p.Q389E	RPS6KB1_ENST00000443572.2_Missense_Mutation_p.Q366E|RPS6KB1_ENST00000406116.3_Missense_Mutation_p.Q389E|RP11-178C3.1_ENST00000591035.1_5'Flank|RPS6KB1_ENST00000393021.3_Missense_Mutation_p.Q336E	NM_001272042.1|NM_001272044.1|NM_001272060.1|NM_003161.2	NP_001258971.1|NP_001258973.1|NP_001258989.1|NP_003152.1	P23443	KS6B1_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 1	389	AGC-kinase C-terminal.				aging (GO:0007568)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell development (GO:0007281)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue growth (GO:0048633)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of glucose import (GO:0046324)|response to drug (GO:0042493)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to leucine (GO:0043201)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to testosterone (GO:0033574)|response to toxic substance (GO:0009636)|response to tumor necrosis factor (GO:0034612)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)			GTTTACACGTCAGACACCTGT	0.358																																							uc002ixy.2		NA																	0				large_intestine(1)	1						c.(1165-1167)CAG>GAG		ribosomal protein S6 kinase, 70kDa, polypeptide							65.0	72.0	70.0					17																	58018242		1346	2282	3628	SO:0001583	missense	6198				apoptosis|G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|negative regulation of apoptosis|phosphatidylinositol-mediated signaling|positive regulation of mitotic cell cycle|positive regulation of translational initiation|TOR signaling cascade	cell junction|cytoplasm|cytosol|mitochondrial outer membrane|nucleus|nucleus|synapse|synaptosome	ATP binding|protein binding|protein kinase activity	g.chr17:58018242C>G	M60724	CCDS11621.1, CCDS62271.1, CCDS62272.1, CCDS62273.1	17q23.1	2011-04-05	2002-08-29		ENSG00000108443	ENSG00000108443			10436	protein-coding gene	gene with protein product		608938	"""ribosomal protein S6 kinase, 70kD, polypeptide 1"""	STK14A		1922062	Standard	NM_003161		Approved	S6K1, p70(S6K)-alpha, PS6K	uc002ixy.4	P23443	OTTHUMG00000150642	ENST00000225577.4:c.1165C>G	17.37:g.58018242C>G	ENSP00000225577:p.Gln389Glu		Somatic				RPS6KB1_uc010ddj.1_Missense_Mutation_p.Q389E|RPS6KB1_uc010wom.1_Missense_Mutation_p.Q336E|RPS6KB1_uc010won.1_Missense_Mutation_p.Q366E|RPS6KB1_uc010woo.1_Missense_Mutation_p.Q324E	p.Q389E	NM_003161	NP_003152	WXS	Illumina HiSeq	Unspecified	P23443	KS6B1_HUMAN	Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)		13	1268	+	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		389			AGC-kinase C-terminal.		B2R779|B4DLT4|B4DTG1|E7ESB8|F6UYM1|Q7Z721	Missense_Mutation	SNP	ENST00000225577.4	37	c.1165C>G	CCDS11621.1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875030	0.72180	.	.	ENSG00000108443	ENST00000443572;ENST00000406116;ENST00000225577;ENST00000393021	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.4	5.4	0.78164	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.34948	0.0915	N	0.10645	0.015	0.80722	D	1	B;B;B	0.31503	0.326;0.099;0.037	B;B;B	0.35073	0.195;0.085;0.05	T	0.29671	-1.0004	10	0.46703	T	0.11	.	19.2548	0.93941	0.0:1.0:0.0:0.0	.	366;389;389	F6UYM1;Q7Z721;P23443	.;.;KS6B1_HUMAN	E	366;389;389;336	ENSP00000441993:Q366E;ENSP00000384335:Q389E;ENSP00000225577:Q389E;ENSP00000376744:Q336E	ENSP00000225577:Q389E	Q	+	1	0	RPS6KB1	55373024	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.447000	0.80620	2.549000	0.85964	0.644000	0.83932	CAG		0.358	RPS6KB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319324.1	NM_003161		20	85	0	0	0	0.00333	0	20	85				
APOH	350	broad.mit.edu	37	17	64208278	64208278	+	Silent	SNP	A	A	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:64208278A>C	ENST00000205948.6	-	8	1048	c.1011T>G	c.(1009-1011)acT>acG	p.T337T		NM_000042.2	NP_000033.2	P02749	APOH_HUMAN	apolipoprotein H (beta-2-glycoprotein I)	337	Sushi-like.				blood coagulation, intrinsic pathway (GO:0007597)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|plasminogen activation (GO:0031639)|positive regulation of blood coagulation (GO:0030194)|positive regulation of lipoprotein lipase activity (GO:0051006)|regulation of fibrinolysis (GO:0051917)|triglyceride metabolic process (GO:0006641)|triglyceride transport (GO:0034197)	cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipid binding (GO:0005543)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			CGGATGCATCAGTTTTCCAAA	0.358																																					Melanoma(155;624 1882 16869 48804 51309)	Melanoma(155;624 1882 16869 48804 51309)	uc002jfn.3		NA																	0					0						c.(1009-1011)ACT>ACG		apolipoprotein H precursor							100.0	101.0	100.0					17																	64208278		2203	4300	6503	SO:0001819	synonymous_variant	350				blood coagulation, intrinsic pathway|negative regulation of angiogenesis|negative regulation of blood coagulation|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of myeloid cell apoptosis|negative regulation of smooth muscle cell apoptosis|plasminogen activation|positive regulation of lipoprotein lipase activity|triglyceride metabolic process|triglyceride transport	cell surface|chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	eukaryotic cell surface binding|glycoprotein binding|heparin binding|lipoprotein lipase activator activity|phospholipid binding	g.chr17:64208278A>C		CCDS11663.1	17q24.2	2013-01-24				ENSG00000091583		"""Apolipoproteins"""	616	protein-coding gene	gene with protein product	"""beta-2-glycoprotein I"""	138700		B2G1		1582254	Standard	NM_000042		Approved	BG	uc002jfn.4	P02749		ENST00000205948.6:c.1011T>G	17.37:g.64208278A>C			Somatic					p.T337T	NM_000042	NP_000033	WXS	Illumina HiSeq	Unspecified	P02749	APOH_HUMAN	BRCA - Breast invasive adenocarcinoma(6;9.74e-08)		8	1070	-			337			Sushi-like.		B2R9M3|Q9UCN7	Silent	SNP	ENST00000205948.6	37	c.1011T>G	CCDS11663.1																																																																																				0.358	APOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446926.1	NM_000042		9	65	0	0	0	0.004482	0	9	65				
H3F3B	3021	broad.mit.edu	37	17	73780814	73780814	+	Intron	SNP	C	C	T	rs377217779		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:73780814C>T	ENST00000586607.1	-	1	111				UNK_ENST00000589666.1_5'Flank|MIR4738_ENST00000579134.1_RNA|UNK_ENST00000293218.3_Silent_p.D27D			P84243	H33_HUMAN	H3 histone, family 3B (H3.3B)						blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)	p.D27E(2)		large_intestine(1)|lung(4)|ovary(2)|skin(1)	8	all_cancers(13;1.5e-07)		all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCCAGCCGGACATAGAACCAC	0.642																																							uc002jpm.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(79-81)GAC>GAT		zinc finger CCCH-type domain containing 5		C		0,3818		0,0,1909	29.0	36.0	33.0			-4.8	0.0	17		33	1,8261		0,1,4130	no	near-gene-5				0,1,6039	TT,TC,CC		0.0121,0.0,0.0083			73780814	1,12079	1909	4131	6040	SO:0001627	intron_variant	85451						nucleic acid binding|zinc ion binding	g.chr17:73780814C>T	Z48950	CCDS11729.1	17q25.1	2011-06-01			ENSG00000132475	ENSG00000132475		"""Histones / Replication-independent"""	4765	protein-coding gene	gene with protein product		601058				8586426	Standard	NM_005324		Approved	H3.3B	uc002jpl.3	P84243		ENST00000586607.1:c.9+642G>A	17.37:g.73780814C>T			Somatic				UNK_uc002jpn.2_RNA|UNK_uc002jpo.2_RNA	p.D27D	NM_001080419	NP_001073888	WXS	Illumina HiSeq	Unspecified	Q9C0B0	UNK_HUMAN	all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)		2	81	+			Error:Variant_position_missing_in_Q9C0B0_after_alignment					P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Silent	SNP	ENST00000586607.1	37	c.81C>T	CCDS11729.1																																																																																				0.642	H3F3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448507.1	NM_005324		11	22	0	0	0	0.001855	0	11	22				
PRPSAP1	5635	broad.mit.edu	37	17	74328494	74328494	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:74328494C>A	ENST00000446526.3	-	4	758	c.313G>T	c.(313-315)Gag>Tag	p.E105*	PRPSAP1_ENST00000324684.4_Nonsense_Mutation_p.E2*	NM_002766.2	NP_002757.2	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 1	76					negative regulation of kinase activity (GO:0033673)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17						ATGAGCAACTCCATCACAGCT	0.428																																							uc010wta.1		NA																	0				ovary(1)	1						c.(313-315)GAG>TAG		phosphoribosyl pyrophosphate							152.0	129.0	137.0					17																	74328494		2203	4300	6503	SO:0001587	stop_gained	5635				nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity	g.chr17:74328494C>A	D61391	CCDS11743.2	17q24-q25	2008-07-18			ENSG00000161542	ENSG00000161542			9466	protein-coding gene	gene with protein product		601249				8660991	Standard	NM_002766		Approved	PAP39	uc010wta.1	Q14558	OTTHUMG00000155969	ENST00000446526.3:c.313G>T	17.37:g.74328494C>A	ENSP00000414624:p.Glu105*		Somatic				PRPSAP1_uc010wtb.1_Nonsense_Mutation_p.E2*	p.E105*	NM_002766	NP_002757	WXS	Illumina HiSeq	Unspecified	Q14558	KPRA_HUMAN			4	759	-			76					B2R6M4|Q96H06	Nonsense_Mutation	SNP	ENST00000446526.3	37	c.313G>T	CCDS11743.2	.	.	.	.	.	.	.	.	.	.	C	37	6.022146	0.97211	.	.	ENSG00000161542	ENST00000446526;ENST00000324684;ENST00000435555;ENST00000436498;ENST00000423915;ENST00000442767	.	.	.	4.97	4.97	0.65823	.	0.088452	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.4239	0.90602	0.0:1.0:0.0:0.0	.	.	.	.	X	105;2;2;2;2;63	.	ENSP00000314973:E2X	E	-	1	0	PRPSAP1	71840089	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.616000	0.83018	2.579000	0.87056	0.655000	0.94253	GAG		0.428	PRPSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342480.2	NM_002766		22	79	1	0	1.28384e-07	0.012319	1.49585e-07	22	79				
FN3KRP	79672	broad.mit.edu	37	17	80676808	80676808	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr17:80676808G>T	ENST00000269373.6	+	2	241	c.168G>T	c.(166-168)atG>atT	p.M56I	FN3KRP_ENST00000535965.1_Missense_Mutation_p.M6I|RP11-388C12.1_ENST00000574471.1_lincRNA	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	56							kinase activity (GO:0016301)			breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			AAGGTGAGATGGCAAGTTTAA	0.502																																							uc002kfu.2		NA																	0					0						c.(166-168)ATG>ATT		fructosamine 3 kinase related protein							100.0	95.0	97.0					17																	80676808		2203	4300	6503	SO:0001583	missense	79672						kinase activity	g.chr17:80676808G>T	AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.168G>T	17.37:g.80676808G>T	ENSP00000269373:p.Met56Ile		Somatic				FN3KRP_uc010wvr.1_Missense_Mutation_p.M6I	p.M56I	NM_024619	NP_078895	WXS	Illumina HiSeq	Unspecified	Q9HA64	KT3K_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)		2	218	+	Breast(20;0.000523)|all_neural(118;0.0952)		56					Q969F4|Q9H0U7	Missense_Mutation	SNP	ENST00000269373.6	37	c.168G>T	CCDS11817.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122665	0.56613	.	.	ENSG00000141560	ENST00000269373;ENST00000535965	T;T	0.44881	0.91;0.91	5.73	5.73	0.89815	Protein kinase-like domain (1);	0.108090	0.85682	D	0.000000	T	0.38532	0.1044	L	0.38175	1.15	0.58432	D	0.999999	B	0.15719	0.014	B	0.25759	0.063	T	0.13388	-1.0511	10	0.19147	T	0.46	-27.2727	19.9002	0.96983	0.0:0.0:1.0:0.0	.	56	Q9HA64	KT3K_HUMAN	I	56;6	ENSP00000269373:M56I;ENSP00000444994:M6I	ENSP00000269373:M56I	M	+	3	0	FN3KRP	78270097	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.184000	0.72008	2.709000	0.92574	0.655000	0.94253	ATG		0.502	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439219.1	NM_024619		51	88	1	0	2.59344e-38	0.01441	3.74281e-38	51	88				
ASXL3	80816	broad.mit.edu	37	18	31318469	31318469	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr18:31318469G>T	ENST00000269197.5	+	11	1101	c.1101G>T	c.(1099-1101)gaG>gaT	p.E367D		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGTCAAGAGAGGAATCTGTGA	0.433																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(1099-1101)GAG>GAT		additional sex combs like 3							55.0	55.0	55.0					18																	31318469		1899	4123	6022	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31318469G>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1101G>T	18.37:g.31318469G>T	ENSP00000269197:p.Glu367Asp		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.E74D	p.E367D	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			11	1156	+			367					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.1101G>T	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524896	0.27299	.	.	ENSG00000141431	ENST00000269197	T	0.19394	2.15	5.01	2.15	0.27550	.	1.066560	0.07381	N	0.887509	T	0.16769	0.0403	L	0.34521	1.04	0.34098	D	0.661563	B	0.20550	0.046	B	0.22601	0.04	T	0.23440	-1.0188	10	0.54805	T	0.06	.	5.3885	0.16231	0.3696:0.0:0.4969:0.1335	.	367	Q9C0F0	ASXL3_HUMAN	D	367	ENSP00000269197:E367D	ENSP00000269197:E367D	E	+	3	2	ASXL3	29572467	0.997000	0.39634	0.998000	0.56505	0.982000	0.71751	0.294000	0.19047	0.612000	0.30071	0.591000	0.81541	GAG		0.433	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			7	11	1	0	0.00307968	0.00308	0.0032059	7	11				
DTNA	1837	broad.mit.edu	37	18	32407563	32407563	+	Silent	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr18:32407563C>G	ENST00000399113.3	+	10	1017	c.1017C>G	c.(1015-1017)ccC>ccG	p.P339P	DTNA_ENST00000315456.6_Silent_p.P339P|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000597674.1_Silent_p.P18P|DTNA_ENST00000601125.1_Silent_p.P18P|DTNA_ENST00000269191.6_Silent_p.P339P|DTNA_ENST00000269190.7_Silent_p.P340P|DTNA_ENST00000598142.1_Silent_p.P339P|DTNA_ENST00000399121.5_Silent_p.P336P|DTNA_ENST00000399097.3_Silent_p.P18P|DTNA_ENST00000444659.1_Silent_p.P339P|DTNA_ENST00000556414.3_Silent_p.P18P|DTNA_ENST00000269192.7_Silent_p.P18P|DTNA_ENST00000598334.1_Silent_p.P336P|DTNA_ENST00000595022.1_Silent_p.P336P|DTNA_ENST00000283365.9_Silent_p.P339P|DTNA_ENST00000591182.1_Silent_p.P18P|DTNA_ENST00000598774.1_Silent_p.P339P|DTNA_ENST00000599844.1_Silent_p.P18P|DTNA_ENST00000348997.5_Silent_p.P336P|DTNA_ENST00000597599.1_Silent_p.P336P|DTNA_ENST00000554864.3_Silent_p.P336P			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	339					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						TTAGGCCTCCCAGACCTGTAA	0.438																																							uc010dmn.1		NA																	0					0						c.(1015-1017)CCC>CCG		dystrobrevin alpha isoform 1							150.0	140.0	144.0					18																	32407563		2203	4300	6503	SO:0001819	synonymous_variant	1837				neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding	g.chr18:32407563C>G	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1017C>G	18.37:g.32407563C>G			Somatic				DTNA_uc002kxu.2_Silent_p.P339P|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Silent_p.P339P|DTNA_uc002kxw.2_Silent_p.P339P|DTNA_uc002kxx.2_Silent_p.P336P|DTNA_uc010dmj.2_Silent_p.P336P|DTNA_uc002kxz.2_Silent_p.P336P|DTNA_uc002kxy.2_Silent_p.P336P|DTNA_uc010dmk.1_Intron|DTNA_uc010dml.2_Silent_p.P336P|DTNA_uc002kyb.3_Silent_p.P336P|DTNA_uc010dmm.2_Silent_p.P339P|DTNA_uc010xby.1_Silent_p.P86P|DTNA_uc010dmo.2_Silent_p.P18P|DTNA_uc002kyd.3_Silent_p.P18P|DTNA_uc010xbz.1_Silent_p.P18P|DTNA_uc010xca.1_Silent_p.P18P|DTNA_uc002kye.2_Silent_p.P18P	p.P339P	NM_001390	NP_001381	WXS	Illumina HiSeq	Unspecified	Q9Y4J8	DTNA_HUMAN			10	1018	+			339					A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Silent	SNP	ENST00000399113.3	37	c.1017C>G	CCDS59311.1																																																																																				0.438	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390		21	109	0	0	0	0.00278	0	21	109				
ZNF532	55205	broad.mit.edu	37	18	56651465	56651465	+	Missense_Mutation	SNP	G	G	A	rs142104041		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr18:56651465G>A	ENST00000336078.4	+	11	4449	c.3673G>A	c.(3673-3675)Gta>Ata	p.V1225I	ZNF532_ENST00000588956.1_3'UTR|ZNF532_ENST00000591808.1_Missense_Mutation_p.V1225I|ZNF532_ENST00000591083.1_Missense_Mutation_p.V1225I|ZNF532_ENST00000591230.1_Missense_Mutation_p.V1225I|ZNF532_ENST00000589288.1_Missense_Mutation_p.V1225I	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CCTCTTCATCGTACACAAGTT	0.532																																							uc002lho.2		NA																	0				breast(1)|skin(1)	2						c.(3673-3675)GTA>ATA		zinc finger protein 532		G	ILE/VAL	0,4400		0,0,2200	45.0	43.0	44.0		3673	5.8	1.0	18	dbSNP_134	44	1,8583		0,1,4291	no	missense	ZNF532	NM_018181.4	29	0,1,6491	AA,AG,GG		0.0116,0.0,0.0077	benign	1225/1302	56651465	1,12983	2200	4292	6492	SO:0001583	missense	55205				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:56651465G>A	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.3673G>A	18.37:g.56651465G>A	ENSP00000338217:p.Val1225Ile		Somatic				ZNF532_uc002lhp.2_Missense_Mutation_p.V1223I|ZNF532_uc010xeg.1_Missense_Mutation_p.V1223I|ZNF532_uc002lhr.2_Missense_Mutation_p.V1223I|ZNF532_uc002lhs.2_Missense_Mutation_p.V1223I|ZNF532_uc010xeh.1_Missense_Mutation_p.V313I	p.V1225I	NM_018181	NP_060651	WXS	Illumina HiSeq	Unspecified	Q9HCE3	ZN532_HUMAN			11	4220	+			1225			C2H2-type 11.		Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	c.3673G>A	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.271426	0.80469	0.0	1.16E-4	ENSG00000074657	ENST00000336078	T	0.01767	4.65	5.84	5.84	0.93424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.08358	0.0208	L	0.46614	1.455	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.77557	0.979;0.99	T	0.07404	-1.0774	10	0.52906	T	0.07	-15.0897	19.7382	0.96215	0.0:0.0:1.0:0.0	.	1225;1225	B3KXW2;Q9HCE3	.;ZN532_HUMAN	I	1225	ENSP00000338217:V1225I	ENSP00000338217:V1225I	V	+	1	0	ZNF532	54802445	1.000000	0.71417	1.000000	0.80357	0.519000	0.34347	9.824000	0.99380	2.769000	0.95229	0.561000	0.74099	GTA		0.532	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181		11	38	0	0	0	0.013537	0	11	38				
SERPINB11	89778	broad.mit.edu	37	18	61377489	61377489	+	RNA	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr18:61377489G>T	ENST00000382749.5	+	0	307				SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000538847.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				GAGCTGAACAGTAACAACATA	0.438																																					Ovarian(27;496 784 5942 8975 23930)	Ovarian(27;496 784 5942 8975 23930)	uc002ljk.3		NA																	0				breast(1)	1						c.(61-63)AGT>ATT		serpin peptidase inhibitor, clade B, member 11							116.0	108.0	110.0					18																	61377489		1936	4150	6086			89778				regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity	g.chr18:61377489G>T			18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61377489G>T			Somatic				SERPINB11_uc010xes.1_5'UTR|SERPINB11_uc010dqd.2_5'UTR|SERPINB11_uc002ljj.3_5'UTR|SERPINB11_uc010dqe.2_5'UTR|SERPINB11_uc010dqf.2_Missense_Mutation_p.S21I	p.S21I	NM_080475	NP_536723	WXS	Illumina HiSeq	Unspecified	Q96P15	SPB11_HUMAN			2	124	+		Esophageal squamous(42;0.129)	21					A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	ENST00000382749.5	37	c.62G>T		.	.	.	.	.	.	.	.	.	.	G	11.12	1.543788	0.27563	.	.	ENSG00000206072	ENST00000544088;ENST00000538847	D;D	0.84660	-1.88;-1.88	5.14	-2.85	0.05734	Serpin domain (3);	0.518330	0.17700	N	0.164967	D	0.86121	0.5857	M	0.76433	2.335	0.19775	N	0.999951	P;P	0.51147	0.826;0.942	B;P	0.55455	0.341;0.776	T	0.78443	-0.2202	10	0.66056	D	0.02	.	5.781	0.18306	0.4667:0.2518:0.2815:0.0	.	21;21	F5GY69;Q96P15	.;SPB11_HUMAN	I	21	ENSP00000441497:S21I;ENSP00000440795:S21I	ENSP00000421854:S21I	S	+	2	0	SERPINB11	59528469	0.000000	0.05858	0.033000	0.17914	0.158000	0.22134	-0.211000	0.09332	-0.469000	0.06911	-0.878000	0.02970	AGT		0.438	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000207392.3	NM_080475		15	17	1	0	3.27435e-08	0.00245	3.90463e-08	15	17				
LRRC8E	80131	broad.mit.edu	37	19	7963879	7963879	+	Missense_Mutation	SNP	G	G	A	rs535423786		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:7963879G>A	ENST00000306708.6	+	3	573	c.472G>A	c.(472-474)Gac>Aac	p.D158N	AC010336.1_ENST00000539278.1_3'UTR	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	158					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						CAAGTGTTTCGACTCTCCATG	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18483	0.0		0.0	False		,,,				2504	0.0						uc002mir.2		NA																	0				lung(1)|pancreas(1)	2						c.(472-474)GAC>AAC		leucine rich repeat containing 8 family, member							95.0	97.0	96.0					19																	7963879		2203	4300	6503	SO:0001583	missense	80131					integral to membrane		g.chr19:7963879G>A		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.472G>A	19.37:g.7963879G>A	ENSP00000306524:p.Asp158Asn		Somatic					p.D158N	NM_025061	NP_079337	WXS	Illumina HiSeq	Unspecified	Q6NSJ5	LRC8E_HUMAN			3	573	+			158					B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Missense_Mutation	SNP	ENST00000306708.6	37	c.472G>A	CCDS12189.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338371	0.81911	.	.	ENSG00000171017	ENST00000306708	T	0.34859	1.34	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.59280	0.2182	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61491	-0.7052	10	0.87932	D	0	.	16.2508	0.82485	0.0:0.0:1.0:0.0	.	158	Q6NSJ5	LRC8E_HUMAN	N	158	ENSP00000306524:D158N	ENSP00000306524:D158N	D	+	1	0	LRRC8E	7869879	1.000000	0.71417	0.496000	0.27539	0.868000	0.49771	9.646000	0.98474	2.709000	0.92574	0.655000	0.94253	GAC		0.577	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061		6	121	0	0	0	0.001168	0	6	121				
MUC16	94025	broad.mit.edu	37	19	9011464	9011464	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:9011464C>T	ENST00000397910.4	-	36	38972	c.38769G>A	c.(38767-38769)atG>atA	p.M12923I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12925	SEA 6. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGATGGCATCCATTCCAGTGG	0.537																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(38767-38769)ATG>ATA		mucin 16							146.0	131.0	136.0					19																	9011464		1929	4134	6063	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9011464C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38769G>A	19.37:g.9011464C>T	ENSP00000381008:p.Met12923Ile		Somatic				MUC16_uc010xki.1_Intron	p.M12923I	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			36	38973	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.38769G>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	6.639	0.486412	0.12641	.	.	ENSG00000181143	ENST00000397910;ENST00000441155	T	0.28255	1.62	2.94	0.259	0.15583	.	.	.	.	.	T	0.31544	0.0800	M	0.80183	2.485	.	.	.	B	0.09022	0.002	B	0.12156	0.007	T	0.37197	-0.9716	8	0.87932	D	0	-10.4038	3.817	0.08819	0.2653:0.5758:0.0:0.1589	.	12923	B5ME49	.	I	12923;76	ENSP00000381008:M12923I	ENSP00000381008:M12923I	M	-	3	0	MUC16	8872464	0.239000	0.23836	0.026000	0.17262	0.025000	0.11179	-0.093000	0.11111	-0.057000	0.13199	0.305000	0.20034	ATG		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		15	130	0	0	0	0.006122	0	15	130				
ZNF676	163223	broad.mit.edu	37	19	22363587	22363587	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:22363587C>G	ENST00000397121.2	-	3	1249	c.932G>C	c.(931-933)tGt>tCt	p.C311S		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ACATTCTTCACACTTGTAGGG	0.443																																							uc002nqs.1		NA																	0					0						c.(931-933)TGT>TCT		zinc finger protein 676							66.0	68.0	67.0					19																	22363587		2096	4237	6333	SO:0001583	missense	163223				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22363587C>G	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.932G>C	19.37:g.22363587C>G	ENSP00000380310:p.Cys311Ser		Somatic					p.C311S	NM_001001411	NP_001001411	WXS	Illumina HiSeq	Unspecified	Q8N7Q3	ZN676_HUMAN			3	1250	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)	311			C2H2-type 6.		A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	c.932G>C	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	12.89	2.072618	0.36566	.	.	ENSG00000196109	ENST00000397121	D	0.85171	-1.95	0.85	-0.442	0.12253	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92459	0.7606	M	0.93808	3.46	0.09310	N	0.999997	D	0.76494	0.999	D	0.85130	0.997	T	0.82067	-0.0641	9	0.87932	D	0	.	6.0827	0.19950	0.0:0.7575:0.0:0.2425	.	311	Q8N7Q3	ZN676_HUMAN	S	311	ENSP00000380310:C311S	ENSP00000380310:C311S	C	-	2	0	ZNF676	22155427	0.986000	0.35501	0.033000	0.17914	0.033000	0.12548	3.692000	0.54727	0.192000	0.20272	0.195000	0.17529	TGT		0.443	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411		5	99	0	0	0	0.00308	0	5	99				
PLEKHF1	79156	broad.mit.edu	37	19	30165102	30165102	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:30165102G>A	ENST00000436066.3	+	2	822	c.356G>A	c.(355-357)cGc>cAc	p.R119H	PLEKHF1_ENST00000592810.1_Missense_Mutation_p.R119H	NM_024310.4	NP_077286.3	Q96S99	PKHF1_HUMAN	pleckstrin homology domain containing, family F (with FYVE domain) member 1	119	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic process (GO:0006915)|endosome organization (GO:0007032)|positive regulation of autophagy (GO:0010508)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein localization to plasma membrane (GO:0072659)|vesicle organization (GO:0016050)	endosome membrane (GO:0010008)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(1)|lung(3)|ovary(1)|prostate(1)	6	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			GCTACGGAGCGCCAGGAATGG	0.667																																							uc002nsh.3		NA																	0					0						c.(355-357)CGC>CAC		apoptosis-inducing protein D							37.0	38.0	38.0					19																	30165102		2203	4300	6503	SO:0001583	missense	79156				apoptosis	lysosome|nucleus|perinuclear region of cytoplasm	metal ion binding	g.chr19:30165102G>A	AF434818	CCDS12417.1	19q11	2013-01-10				ENSG00000166289		"""Zinc fingers, FYVE domain containing"", ""Pleckstrin homology (PH) domain containing"""	20764	protein-coding gene	gene with protein product		615200					Standard	NM_024310		Approved	APPD, MGC4090, PHAFIN1, ZFYVE15	uc002nsh.4	Q96S99		ENST00000436066.3:c.356G>A	19.37:g.30165102G>A	ENSP00000389787:p.Arg119His		Somatic				PLEKHF1_uc002nsi.3_Missense_Mutation_p.R204H	p.R119H	NM_024310	NP_077286	WXS	Illumina HiSeq	Unspecified	Q96S99	PKHF1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)		2	458	+	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		119			PH.		Q96K11|Q9BUB9	Missense_Mutation	SNP	ENST00000436066.3	37	c.356G>A	CCDS12417.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387649	0.82902	.	.	ENSG00000166289	ENST00000436066	T	0.78126	-1.15	5.32	4.29	0.51040	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.094804	0.64402	D	0.000002	D	0.87410	0.6170	M	0.81682	2.555	0.43574	D	0.9959	D;D	0.89917	1.0;1.0	D;D	0.73380	0.97;0.98	D	0.88879	0.3338	10	0.87932	D	0	0.0685	13.2551	0.60074	0.0771:0.0:0.9229:0.0	.	204;119	B4DWN9;Q96S99	.;PKHF1_HUMAN	H	119	ENSP00000389787:R119H	ENSP00000389787:R119H	R	+	2	0	PLEKHF1	34856942	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.198000	0.72106	1.244000	0.43870	0.561000	0.74099	CGC		0.667	PLEKHF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459323.1	NM_024310		4	41	0	0	0	0.009096	0	4	41				
ZNF536	9745	broad.mit.edu	37	19	30935517	30935517	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:30935517T>G	ENST00000355537.3	+	2	1195	c.1048T>G	c.(1048-1050)Tgc>Ggc	p.C350G		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	350					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CTGCGAGGTGTGCGGTCAGGT	0.652																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(1048-1050)TGC>GGC		zinc finger protein 536							100.0	110.0	106.0					19																	30935517		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30935517T>G		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1048T>G	19.37:g.30935517T>G	ENSP00000347730:p.Cys350Gly		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.C350G	p.C350G	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			2	1186	+	Esophageal squamous(110;0.0834)		350			C2H2-type 5.		A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.1048T>G	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065057	0.55432	.	.	ENSG00000198597	ENST00000355537	D	0.99974	-10.2	5.59	5.59	0.84812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.99981	0.9994	H	0.95043	3.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97370	0.9975	10	0.87932	D	0	-21.7484	15.7424	0.77910	0.0:0.0:0.0:1.0	.	350;350	A7E228;O15090	.;ZN536_HUMAN	G	350	ENSP00000347730:C350G	ENSP00000347730:C350G	C	+	1	0	ZNF536	35627357	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.009000	0.88606	2.125000	0.65367	0.402000	0.26972	TGC		0.652	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		56	150	0	0	0	0.01441	0	56	150				
DPY19L3	147991	broad.mit.edu	37	19	32923654	32923654	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:32923654G>C	ENST00000342179.5	+	4	485	c.270G>C	c.(268-270)gaG>gaC	p.E90D	DPY19L3_ENST00000586987.1_Missense_Mutation_p.E90D|DPY19L3_ENST00000392250.2_Missense_Mutation_p.E90D	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	90						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					TCAGAACAGAGTGTGGCCTGT	0.408																																							uc002ntg.2		NA																	0				ovary(4)	4						c.(268-270)GAG>GAC		dpy-19-like 3							104.0	89.0	94.0					19																	32923654		2203	4300	6503	SO:0001583	missense	147991					integral to membrane		g.chr19:32923654G>C		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.270G>C	19.37:g.32923654G>C	ENSP00000344937:p.Glu90Asp		Somatic				DPY19L3_uc002nth.1_Missense_Mutation_p.E90D	p.E90D	NM_207325	NP_997208	WXS	Illumina HiSeq	Unspecified	Q6ZPD9	D19L3_HUMAN			4	446	+	Esophageal squamous(110;0.162)		90					Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	37	c.270G>C	CCDS12422.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.46|12.46	1.944808|1.944808	0.34283|0.34283	.|.	.|.	ENSG00000178904|ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179|ENST00000392248	T;T|.	0.66099|.	-0.19;-0.19|.	5.84|5.84	1.2|1.2	0.21068|0.21068	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63954|0.63954	0.2555|0.2555	M|M	0.64630|0.64630	1.985|1.985	0.42507|0.42507	D|D	0.992952|0.992952	D|.	0.56287|.	0.975|.	D|.	0.68192|.	0.956|.	T|T	0.65018|0.65018	-0.6270|-0.6270	10|6	0.35671|0.87932	T|D	0.21|0	-20.3738|-20.3738	10.7961|10.7961	0.46461|0.46461	0.6609:0.0:0.3391:0.0|0.6609:0.0:0.3391:0.0	.|.	90|.	Q6ZPD9|.	D19L3_HUMAN|.	D|T	90|90	ENSP00000376081:E90D;ENSP00000344937:E90D|.	ENSP00000315672:E90D|ENSP00000376079:S90T	E|S	+|+	3|2	2|0	DPY19L3|DPY19L3	37615494|37615494	0.999000|0.999000	0.42202|0.42202	0.997000|0.997000	0.53966|0.53966	0.671000|0.671000	0.39405|0.39405	0.877000|0.877000	0.28106|0.28106	0.124000|0.124000	0.18369|0.18369	-0.229000|-0.229000	0.12294|0.12294	GAG|AGT		0.408	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325		15	60	0	0	0	0.007413	0	15	60				
PEPD	5184	broad.mit.edu	37	19	33980911	33980911	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:33980911C>A	ENST00000244137.7	-	6	527	c.494G>T	c.(493-495)gGc>gTc	p.G165V	PEPD_ENST00000436370.3_Missense_Mutation_p.G101V|PEPD_ENST00000397032.4_Missense_Mutation_p.G165V	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	165					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					CTTGCTGATGCCGTCAAAGGA	0.612																																							uc002nur.3		NA																	0				ovary(2)	2						c.(493-495)GGC>GTC		prolidase isoform 1							27.0	33.0	31.0					19																	33980911		2051	4183	6234	SO:0001583	missense	5184				cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity	g.chr19:33980911C>A	BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.494G>T	19.37:g.33980911C>A	ENSP00000244137:p.Gly165Val		Somatic				PEPD_uc010xrr.1_Missense_Mutation_p.G165V|PEPD_uc010xrs.1_Missense_Mutation_p.G101V	p.G165V	NM_000285	NP_000276	WXS	Illumina HiSeq	Unspecified	P12955	PEPD_HUMAN			6	629	-	Esophageal squamous(110;0.137)		165					A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Missense_Mutation	SNP	ENST00000244137.7	37	c.494G>T	CCDS42544.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.269891	0.59540	.	.	ENSG00000124299	ENST00000244137;ENST00000397032;ENST00000436370	T;T;T	0.79653	-1.01;-1.12;-1.29	4.35	3.31	0.37934	.	0.100584	0.64402	D	0.000002	D	0.86636	0.5980	M	0.88640	2.97	0.80722	D	1	D;P;P	0.57571	0.98;0.57;0.913	P;B;P	0.54312	0.748;0.439;0.572	D	0.87023	0.2130	10	0.87932	D	0	-23.9603	8.508	0.33199	0.0:0.8887:0.0:0.1113	.	101;165;165	E9PCE8;A8MX47;P12955	.;.;PEPD_HUMAN	V	165;165;101	ENSP00000244137:G165V;ENSP00000380226:G165V;ENSP00000391890:G101V	ENSP00000244137:G165V	G	-	2	0	PEPD	38672751	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	2.552000	0.45828	0.968000	0.38212	0.561000	0.74099	GGC		0.612	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3	NM_000285		5	18	1	0	5.9392e-07	0.001168	6.73463e-07	5	18				
ZNF382	84911	broad.mit.edu	37	19	37100919	37100919	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:37100919G>T	ENST00000292928.2	+	3	216	c.103G>T	c.(103-105)Gtg>Ttg	p.V35L	ZNF382_ENST00000435416.1_Missense_Mutation_p.V35L|ZNF382_ENST00000423582.1_Intron|ZNF382_ENST00000439428.1_Missense_Mutation_p.V34L	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	35	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.|Mediates interaction with TRIM28. {ECO:0000250}.|Represses transcription. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TTACAGGGATGTGATGTTGGA	0.463																																							uc002oek.2		NA																	0					0						c.(103-105)GTG>TTG		zinc finger protein 382							167.0	152.0	157.0					19																	37100919		2203	4300	6503	SO:0001583	missense	84911				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37100919G>T	AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.103G>T	19.37:g.37100919G>T	ENSP00000292928:p.Val35Leu		Somatic				ZNF382_uc010efa.2_Intron|ZNF382_uc010efb.2_Missense_Mutation_p.V34L|ZNF382_uc002oel.2_Missense_Mutation_p.V35L	p.V35L	NM_032825	NP_116214	WXS	Illumina HiSeq	Unspecified	Q96SR6	ZN382_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		3	216	+	Esophageal squamous(110;0.198)		35			Mediates interaction with TRIM28 (By similarity).|KRAB.|Represses transcription (By similarity).		A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Missense_Mutation	SNP	ENST00000292928.2	37	c.103G>T	CCDS33004.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.375236	0.82682	.	.	ENSG00000161298	ENST00000292928;ENST00000439428;ENST00000435416	T;T;T	0.03801	3.8;3.8;3.8	4.58	4.58	0.56647	Krueppel-associated box (4);	0.000000	0.38663	N	0.001609	T	0.35307	0.0927	H	0.98629	4.285	0.34247	D	0.67828	D;D;D	0.63046	0.99;0.99;0.992	D;D;D	0.76071	0.978;0.978;0.987	T	0.65804	-0.6079	10	0.72032	D	0.01	.	13.0617	0.59010	0.0:0.0:1.0:0.0	.	34;35;35	Q96SR6-2;Q96SR6-3;Q96SR6	.;.;ZN382_HUMAN	L	35;34;35	ENSP00000292928:V35L;ENSP00000407593:V34L;ENSP00000410113:V35L	ENSP00000292928:V35L	V	+	1	0	ZNF382	41792759	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	3.771000	0.55318	2.531000	0.85337	0.563000	0.77884	GTG		0.463	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825		16	72	1	0	2.31682e-05	0.003163	2.48301e-05	16	72				
LILRB2	10288	broad.mit.edu	37	19	54780767	54780767	+	Silent	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:54780767C>A	ENST00000391749.4	-	10	1648	c.1377G>T	c.(1375-1377)ctG>ctT	p.L459L	LILRB2_ENST00000391746.1_Silent_p.L459L|LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000314446.5_Silent_p.L458L|LILRB2_ENST00000391748.1_Silent_p.L458L|LILRB2_ENST00000434421.1_Silent_p.L343L	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	459					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCACAACCCCCAGGTGCCTTC	0.572																																							uc002qfb.2		NA																	0				skin(1)	1						c.(1375-1377)CTG>CTT		leukocyte immunoglobulin-like receptor,							165.0	112.0	130.0					19																	54780767		2203	4300	6503	SO:0001819	synonymous_variant	10288				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity	g.chr19:54780767C>A	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.1377G>T	19.37:g.54780767C>A			Somatic				LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Silent_p.L459L|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Silent_p.L458L|LILRB2_uc010yet.1_Silent_p.L343L	p.L459L	NM_005874	NP_005865	WXS	Illumina HiSeq	Unspecified	Q8N423	LIRB2_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	10	1643	-	Ovarian(34;0.19)		459			Extracellular (Potential).		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Silent	SNP	ENST00000391749.4	37	c.1377G>T	CCDS12886.1																																																																																				0.572	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			18	33	1	0	3.52763e-06	0.00499	3.91274e-06	18	33				
NLRP11	204801	broad.mit.edu	37	19	56307481	56307481	+	Silent	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:56307481G>T	ENST00000589093.1	-	6	2400	c.2307C>A	c.(2305-2307)gcC>gcA	p.A769A	NLRP11_ENST00000443188.1_Silent_p.A769A|NLRP11_ENST00000589824.2_Silent_p.A715A|NLRP11_ENST00000360133.3_Silent_p.A715A|NLRP11_ENST00000592953.1_Silent_p.A670A			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	769							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		GATGAAGCAAGGCATCACACA	0.483																																							uc010ygf.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(2305-2307)GCC>GCA		NLR family, pyrin domain containing 11							304.0	268.0	280.0					19																	56307481		2203	4300	6503	SO:0001819	synonymous_variant	204801						ATP binding	g.chr19:56307481G>T	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.2307C>A	19.37:g.56307481G>T			Somatic				NLRP11_uc002qlz.2_Silent_p.A616A|NLRP11_uc002qmb.2_Silent_p.A670A|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	p.A769A	NM_145007	NP_659444	WXS	Illumina HiSeq	Unspecified	P59045	NAL11_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	8	3018	-		Colorectal(82;0.0002)	769					C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Silent	SNP	ENST00000589093.1	37	c.2307C>A	CCDS12935.1																																																																																				0.483	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007		72	257	1	0	1.37693e-34	0.01441	1.97594e-34	72	257				
AURKC	6795	broad.mit.edu	37	19	57743553	57743553	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr19:57743553A>G	ENST00000302804.7	+	3	443	c.257A>G	c.(256-258)cAc>cGc	p.H86R	AURKC_ENST00000598785.1_Missense_Mutation_p.H52R|AURKC_ENST00000415300.2_Missense_Mutation_p.H67R|AURKC_ENST00000599062.1_Missense_Mutation_p.H83R|AURKC_ENST00000448930.1_Missense_Mutation_p.H52R	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	86	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		GGACTGGAGCACCAGCTGCGC	0.498																																							uc002qoe.2		NA																	0				lung(4)|ovary(2)	6						c.(256-258)CAC>CGC		aurora kinase C isoform 1							56.0	48.0	51.0					19																	57743553		2203	4300	6503	SO:0001583	missense	6795				cell cycle|cytokinesis	condensed chromosome|cytoplasm|midbody|spindle midzone	ATP binding|protein serine/threonine kinase activity	g.chr19:57743553A>G		CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.257A>G	19.37:g.57743553A>G	ENSP00000302898:p.His86Arg		Somatic				AURKC_uc002qoc.2_Missense_Mutation_p.H67R|AURKC_uc002qod.2_Missense_Mutation_p.H52R|AURKC_uc010etv.2_Missense_Mutation_p.H83R	p.H86R	NM_001015878	NP_001015878	WXS	Illumina HiSeq	Unspecified	Q9UQB9	AURKC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)	3	446	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	86			Protein kinase.		O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	ENST00000302804.7	37	c.257A>G	CCDS33128.1	.	.	.	.	.	.	.	.	.	.	A	12.53	1.966103	0.34659	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.63913	-0.07;-0.07;-0.07	3.45	3.45	0.39498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.051108	0.85682	D	0.000000	T	0.39036	0.1063	N	0.10685	0.025	0.58432	D	0.999999	B;B;B	0.24675	0.109;0.048;0.046	B;B;B	0.20767	0.031;0.015;0.017	T	0.33548	-0.9864	10	0.42905	T	0.14	-11.3451	10.5626	0.45154	1.0:0.0:0.0:0.0	.	83;86;67	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	R	67;52;86	ENSP00000407162:H67R;ENSP00000406798:H52R;ENSP00000302898:H86R	ENSP00000302898:H86R	H	+	2	0	AURKC	62435365	1.000000	0.71417	0.998000	0.56505	0.845000	0.48019	5.912000	0.69948	1.807000	0.52817	0.454000	0.30748	CAC		0.498	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465089.1	NM_003160		12	45	0	0	0	0.00245	0	12	45				
ROCK2	9475	broad.mit.edu	37	2	11355773	11355773	+	Splice_Site	SNP	T	T	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:11355773T>G	ENST00000315872.6	-	14	1910		c.e14-2		ROCK2_ENST00000401753.1_Splice_Site	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2						actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TAAGGTAATCTGAAATAATGC	0.299																																							uc002rbd.1		NA																	0				stomach(2)|skin(2)	4						c.e14-1		Rho-associated, coiled-coil containing protein							45.0	42.0	43.0					2																	11355773		1802	4066	5868	SO:0001630	splice_region_variant	9475				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity	g.chr2:11355773T>G	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.1462-2A>C	2.37:g.11355773T>G			Somatic					p.I488_splice	NM_004850	NP_004841	WXS	Illumina HiSeq	Unspecified	O75116	ROCK2_HUMAN		Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)	14	1911	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)							Q53QZ0|Q53SJ7|Q9UQN5	Splice_Site	SNP	ENST00000315872.6	37	c.1462_splice	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	T	19.83	3.899884	0.72754	.	.	ENSG00000134318	ENST00000315872;ENST00000401753	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0656	0.71992	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ROCK2	11273224	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.790000	0.85794	1.971000	0.57363	0.533000	0.62120	.		0.299	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3		Intron	11	30	0	0	0	0.008291	0	11	30				
RAD51AP2	729475	broad.mit.edu	37	2	17696895	17696895	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:17696895G>C	ENST00000399080.2	-	1	2811	c.2788C>G	c.(2788-2790)Caa>Gaa	p.Q930E		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	930										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GTTTCAAATTGATGATTAATA	0.313																																							uc002rcl.1		NA																	0				ovary(1)	1						c.(2788-2790)CAA>GAA		RAD51 associated protein 2							39.0	40.0	40.0					2																	17696895		1808	4067	5875	SO:0001583	missense	729475							g.chr2:17696895G>C	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2788C>G	2.37:g.17696895G>C	ENSP00000382030:p.Gln930Glu		Somatic				RAD51AP2_uc010exn.1_Missense_Mutation_p.Q921E	p.Q930E	NM_001099218	NP_001092688	WXS	Illumina HiSeq	Unspecified	Q09MP3	R51A2_HUMAN			1	2812	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)		930						Missense_Mutation	SNP	ENST00000399080.2	37	c.2788C>G	CCDS42656.1	.	.	.	.	.	.	.	.	.	.	G	7.752	0.703542	0.15172	.	.	ENSG00000214842	ENST00000399080	T	0.27402	1.67	5.62	4.63	0.57726	.	.	.	.	.	T	0.20820	0.0501	L	0.29908	0.895	0.09310	N	1	P	0.38597	0.639	B	0.33890	0.172	T	0.11941	-1.0567	9	0.87932	D	0	0.3045	7.9581	0.30055	0.0:0.1372:0.5796:0.2832	.	930	Q09MP3	R51A2_HUMAN	E	930	ENSP00000382030:Q930E	ENSP00000382030:Q930E	Q	-	1	0	RAD51AP2	17560376	0.122000	0.22280	0.480000	0.27341	0.091000	0.18340	1.748000	0.38308	2.809000	0.96659	0.655000	0.94253	CAA		0.313	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218		20	45	0	0	0	0.007413	0	20	45				
PUM2	23369	broad.mit.edu	37	2	20483205	20483205	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:20483205C>A	ENST00000361078.2	-	10	1356	c.1334G>T	c.(1333-1335)gGt>gTt	p.G445V	PUM2_ENST00000403432.1_Missense_Mutation_p.G445V|PUM2_ENST00000536417.1_Missense_Mutation_p.G389V|PUM2_ENST00000338086.5_Missense_Mutation_p.G445V|PUM2_ENST00000319801.5_Missense_Mutation_p.G445V			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	445	Ala-rich.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACTAAGGCACCAGTCTGATC	0.418																																							uc002rds.1		NA																	0				ovary(1)	1						c.(1333-1335)GGT>GTT		pumilio homolog 2							96.0	94.0	95.0					2																	20483205		2203	4300	6503	SO:0001583	missense	23369				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding	g.chr2:20483205C>A	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.1334G>T	2.37:g.20483205C>A	ENSP00000354370:p.Gly445Val		Somatic				PUM2_uc002rdt.1_Missense_Mutation_p.G445V|PUM2_uc002rdr.2_Missense_Mutation_p.G384V|PUM2_uc010yjy.1_Missense_Mutation_p.G445V|PUM2_uc002rdu.1_Missense_Mutation_p.G445V|PUM2_uc010yjz.1_Missense_Mutation_p.G384V	p.G445V	NM_015317	NP_056132	WXS	Illumina HiSeq	Unspecified	Q8TB72	PUM2_HUMAN			10	1357	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		445			Ala-rich.		B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	37	c.1334G>T		.	.	.	.	.	.	.	.	.	.	C	28.3	4.909303	0.92107	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	T;T;T;T;T;T	0.40476	1.45;1.82;1.34;1.03;1.45;1.44	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.66396	0.2785	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	T	0.63422	-0.6641	10	0.56958	D	0.05	-14.7426	20.8598	0.99761	0.0:1.0:0.0:0.0	.	389;445;445	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	V	445;445;445;336;445;389	ENSP00000338173:G445V;ENSP00000354370:G445V;ENSP00000326746:G445V;ENSP00000409905:G336V;ENSP00000385992:G445V;ENSP00000440093:G389V	ENSP00000326746:G445V	G	-	2	0	PUM2	20346686	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GGT		0.418	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317		24	60	1	0	1.75199e-13	0.007291	2.27043e-13	24	60				
APOB	338	broad.mit.edu	37	2	21250797	21250797	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:21250797C>A	ENST00000233242.1	-	14	2097	c.1970G>T	c.(1969-1971)gGg>gTg	p.G657V	APOB_ENST00000399256.4_Missense_Mutation_p.G657V	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	657	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATAAGATTCCCTTCTATTTT	0.413																																							uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(1969-1971)GGG>GTG		apolipoprotein B precursor	Atorvastatin(DB01076)						124.0	129.0	127.0					2																	21250797		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21250797C>A	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1970G>T	2.37:g.21250797C>A	ENSP00000233242:p.Gly657Val		Somatic					p.G657V	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			14	2098	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		657			Vitellogenin.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.1970G>T	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.110087	0.77210	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.16196	2.36;2.36	5.74	4.81	0.61882	Vitellinogen, open beta-sheet, subdomain 1 (1);Lipid transport protein, beta-sheet shell (1);Lipid transport protein, N-terminal (1);Vitellinogen, open beta-sheet (1);	0.134560	0.50627	D	0.000102	T	0.43500	0.1250	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	T	0.36986	-0.9725	10	0.72032	D	0.01	.	15.1187	0.72426	0.0:0.7436:0.2564:0.0	.	657	P04114	APOB_HUMAN	V	657	ENSP00000233242:G657V;ENSP00000382200:G657V	ENSP00000233242:G657V	G	-	2	0	APOB	21104302	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	4.249000	0.58766	2.884000	0.98904	0.655000	0.94253	GGG		0.413	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			12	110	1	0	0.00185496	0.001855	0.00194694	12	110				
LHCGR	3973	broad.mit.edu	37	2	48950765	48950765	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:48950765T>C	ENST00000294954.7	-	5	475	c.454A>G	c.(454-456)Att>Gtt	p.I152V	LHCGR_ENST00000405626.1_Missense_Mutation_p.I152V|LHCGR_ENST00000403273.1_Missense_Mutation_p.I152V|LHCGR_ENST00000344775.3_Missense_Mutation_p.I152V|LHCGR_ENST00000401907.1_Missense_Mutation_p.I152V|STON1-GTF2A1L_ENST00000402114.2_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	152			I -> T (in LHR; reveals a marked impairment of human chorionic gonadotropin binding and signal transduction). {ECO:0000269|PubMed:19551906}.		activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	ACTTACAGAATGAAATTTGAT	0.383																																							uc002rwu.3		NA																	0				ovary(3)|lung(2)|breast(2)|skin(1)	8						c.(454-456)ATT>GTT		luteinizing hormone/choriogonadotropin receptor	Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)						135.0	129.0	131.0					2																	48950765		2203	4300	6503	SO:0001583	missense	3973	Familial_Male-Limited_Precocious_Puberty			male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity	g.chr2:48950765T>C		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.454A>G	2.37:g.48950765T>C	ENSP00000294954:p.Ile152Val		Somatic				GTF2A1L_uc002rwt.2_Intron|LHCGR_uc002rwv.2_RNA	p.I152V	NM_000233	NP_000224	WXS	Illumina HiSeq	Unspecified	P22888	LSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		5	524	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	152		I -> T (in LHR; reveals a marked impairment of human chorionic gonadotropin binding and signal transduction).	Extracellular (Potential).|LRR 3.		Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	c.454A>G	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	T	19.78	3.892021	0.72524	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907;ENST00000428232	D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.92	5.92	0.95590	.	0.098704	0.64402	D	0.000002	D	0.89560	0.6750	M	0.62266	1.93	0.58432	D	0.999998	D	0.55800	0.973	D	0.75484	0.986	D	0.88943	0.3381	9	.	.	.	.	15.5593	0.76229	0.0:0.0:0.0:1.0	.	152	P22888	LSHR_HUMAN	V	152;152;152;152;152;118	ENSP00000344301:I152V;ENSP00000294954:I152V;ENSP00000386033:I152V;ENSP00000385847:I152V;ENSP00000385406:I152V;ENSP00000403748:I118V	.	I	-	1	0	LHCGR	48804269	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.620000	0.36976	2.277000	0.76020	0.528000	0.53228	ATT		0.383	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3		28	81	0	0	0	0.009535	0	28	81				
EXOC6B	23233	broad.mit.edu	37	2	72562091	72562091	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:72562091G>T	ENST00000272427.6	-	20	2311	c.2181C>A	c.(2179-2181)ttC>ttA	p.F727L	EXOC6B_ENST00000490919.1_5'UTR	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	727					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						TCAAGTCGATGAAGGCCAACT	0.458																																							uc010fep.2		NA																	0				central_nervous_system(2)	2						c.(2179-2181)TTC>TTA		SEC15-like 2							92.0	94.0	94.0					2																	72562091		1905	4123	6028	SO:0001583	missense	23233				protein transport|vesicle docking involved in exocytosis	exocyst		g.chr2:72562091G>T	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.2181C>A	2.37:g.72562091G>T	ENSP00000272427:p.Phe727Leu		Somatic					p.F727L	NM_015189	NP_056004	WXS	Illumina HiSeq	Unspecified	Q9Y2D4	EXC6B_HUMAN			20	2319	-			727					B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	37	c.2181C>A	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669337	0.47677	.	.	ENSG00000144036	ENST00000272427	T	0.38887	1.11	5.98	5.98	0.97165	.	.	.	.	.	T	0.66752	0.2821	M	0.82056	2.57	0.80722	D	1	D	0.53885	0.963	D	0.69824	0.966	T	0.60469	-0.7257	9	0.24483	T	0.36	.	18.993	0.92801	0.0:0.0:1.0:0.0	.	727	Q9Y2D4	EXC6B_HUMAN	L	727	ENSP00000272427:F727L	ENSP00000272427:F727L	F	-	3	2	EXOC6B	72415599	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.508000	0.98000	2.839000	0.97877	0.650000	0.86243	TTC		0.458	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570		27	78	1	0	2.14196e-07	0.007291	2.48428e-07	27	78				
SFXN5	94097	broad.mit.edu	37	2	73172187	73172187	+	Silent	SNP	C	C	A	rs147845998		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:73172187C>A	ENST00000272433.2	-	14	1117	c.987G>T	c.(985-987)acG>acT	p.T329T	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_3'UTR	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	329					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						TCCGGCTGCTCGTGGCCTGGG	0.602																																							uc002siq.2		NA																	0				ovary(1)	1						c.(985-987)ACG>ACT		sideroflexin 5							68.0	50.0	56.0					2																	73172187		2203	4300	6503	SO:0001819	synonymous_variant	94097				iron ion homeostasis	integral to membrane	cation transmembrane transporter activity	g.chr2:73172187C>A	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.987G>T	2.37:g.73172187C>A			Somatic				SFXN5_uc002sio.2_Silent_p.T221T|SFXN5_uc010yrc.1_Silent_p.T178T|SFXN5_uc002sip.2_RNA|SFXN5_uc010fet.2_3'UTR|SFXN5_uc010fer.2_RNA|SFXN5_uc010feq.2_Silent_p.T111T|SFXN5_uc010fes.2_3'UTR	p.T329T	NM_144579	NP_653180	WXS	Illumina HiSeq	Unspecified	Q8TD22	SFXN5_HUMAN			14	1118	-			329					A8K116|Q494Y3|Q53T29	Silent	SNP	ENST00000272433.2	37	c.987G>T	CCDS1922.1	.	.	.	.	.	.	.	.	.	.	C	6.956	0.546222	0.13312	.	.	ENSG00000144040	ENST00000411783	.	.	.	5.5	-11.0	0.00169	.	.	.	.	.	.	.	.	.	.	.	0.37347	D	0.91063	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.3529	9.4021	0.38440	0.0598:0.074:0.3926:0.4736	.	.	.	.	X	241	.	.	E	-	1	0	SFXN5	73025695	0.000000	0.05858	0.003000	0.11579	0.894000	0.52154	-3.957000	0.00325	-5.502000	0.00013	-0.672000	0.03802	GAG		0.602	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251991.1	NM_144579		8	22	1	0	3.09899e-07	0.004482	3.54569e-07	8	22				
SLC9A2	6549	broad.mit.edu	37	2	103317539	103317539	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:103317539T>C	ENST00000233969.2	+	8	1739	c.1597T>C	c.(1597-1599)Ttt>Ctt	p.F533L	SLC9A2_ENST00000469286.1_3'UTR	NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	533					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						GTTTAAGAAGTTTGATGATAA	0.294																																							uc002tca.2		NA																	0				central_nervous_system(3)|skin(3)|breast(2)	8						c.(1597-1599)TTT>CTT		solute carrier family 9 (sodium/hydrogen							33.0	35.0	34.0					2																	103317539		2182	4290	6472	SO:0001583	missense	6549					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity	g.chr2:103317539T>C		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1597T>C	2.37:g.103317539T>C	ENSP00000233969:p.Phe533Leu		Somatic					p.F533L	NM_003048	NP_003039	WXS	Illumina HiSeq	Unspecified	Q9UBY0	SL9A2_HUMAN			8	1739	+			533			Cytoplasmic (Potential).		B2RMS2	Missense_Mutation	SNP	ENST00000233969.2	37	c.1597T>C	CCDS2062.1	.	.	.	.	.	.	.	.	.	.	T	18.75	3.691384	0.68271	.	.	ENSG00000115616	ENST00000233969	T	0.59906	0.23	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.58779	0.2146	M	0.71036	2.16	0.53005	D	0.999967	B	0.18863	0.031	B	0.14023	0.01	T	0.57100	-0.7869	10	0.45353	T	0.12	.	15.7353	0.77837	0.0:0.0:0.0:1.0	.	533	Q9UBY0	SL9A2_HUMAN	L	533	ENSP00000233969:F533L	ENSP00000233969:F533L	F	+	1	0	SLC9A2	102683971	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	6.440000	0.73435	2.121000	0.65114	0.383000	0.25322	TTT		0.294	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2			9	47	0	0	0	0.004482	0	9	47				
ST6GAL2	84620	broad.mit.edu	37	2	107460224	107460224	+	Silent	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:107460224C>A	ENST00000409382.3	-	2	820	c.210G>T	c.(208-210)ccG>ccT	p.P70P	ST6GAL2_ENST00000361686.4_Silent_p.P70P|ST6GAL2_ENST00000409087.3_Silent_p.P70P|AC016994.2_ENST00000425419.1_RNA	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	70					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						GGCCCCCAGGCGGGGAGGGCT	0.706																																							uc002tdq.2		NA																	0				pancreas(6)|ovary(4)|skin(1)	11						c.(208-210)CCG>CCT		ST6 beta-galactosamide							14.0	18.0	17.0					2																	107460224		2157	4231	6388	SO:0001819	synonymous_variant	84620				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	g.chr2:107460224C>A	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.210G>T	2.37:g.107460224C>A			Somatic				ST6GAL2_uc002tdr.2_Silent_p.P70P|ST6GAL2_uc002tds.3_Silent_p.P70P	p.P70P	NM_001142351	NP_001135823	WXS	Illumina HiSeq	Unspecified	Q96JF0	SIAT2_HUMAN			2	329	-			70			Lumenal (Potential).		D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Silent	SNP	ENST00000409382.3	37	c.210G>T	CCDS2073.1																																																																																				0.706	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		16	34	1	0	1.52009e-12	0.003163	1.94022e-12	16	34				
SULT1C3	442038	broad.mit.edu	37	2	108863744	108863744	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:108863744T>C	ENST00000329106.2	+	1	94	c.94T>C	c.(94-96)Tca>Cca	p.S32P	SULT1C3_ENST00000376700.1_Missense_Mutation_p.S32P	NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3	32					sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						GTTGATATTATCAAAAGAATG	0.393																																							uc010ywo.1		NA																	0				skin(1)	1						c.(94-96)TCA>CCA		sulfotransferase family, cytosolic, 1C, member							96.0	105.0	102.0					2																	108863744		2203	4300	6503	SO:0001583	missense	442038					cytoplasm	alcohol sulfotransferase activity	g.chr2:108863744T>C	BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.94T>C	2.37:g.108863744T>C	ENSP00000333310:p.Ser32Pro		Somatic					p.S32P	NM_001008743	NP_001008743	WXS	Illumina HiSeq	Unspecified	Q6IMI6	ST1C3_HUMAN			1	94	+			32					Q6IMI5	Missense_Mutation	SNP	ENST00000329106.2	37	c.94T>C	CCDS33267.1	.	.	.	.	.	.	.	.	.	.	T	8.906	0.957528	0.18507	.	.	ENSG00000196228	ENST00000329106;ENST00000376700	T;T	0.01745	4.66;4.66	3.99	-6.03	0.02185	.	2.480800	0.02364	N	0.077176	T	0.01387	0.0045	N	0.08118	0	0.09310	N	1	B	0.31435	0.323	B	0.29663	0.105	T	0.35871	-0.9771	10	0.49607	T	0.09	.	12.9883	0.58604	0.1888:0.0:0.0:0.8112	.	32	Q6IMI6	ST1C3_HUMAN	P	32	ENSP00000333310:S32P;ENSP00000365890:S32P	ENSP00000333310:S32P	S	+	1	0	SULT1C3	108230176	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.500000	0.06405	-1.758000	0.01315	-3.488000	0.00034	TCA		0.393	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330255.1	NM_001008743		31	108	0	0	0	0.009535	0	31	108				
EDAR	10913	broad.mit.edu	37	2	109547447	109547447	+	Silent	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:109547447C>G	ENST00000258443.2	-	2	454	c.24G>C	c.(22-24)acG>acC	p.T8T	EDAR_ENST00000376651.1_Silent_p.T8T|EDAR_ENST00000409271.1_Silent_p.T8T	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	8					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						AGGGCGTCTGCGTGCAGTCCC	0.627																																							uc002teq.3		NA																	0				skin(1)	1						c.(22-24)ACG>ACC		ectodysplasin A receptor precursor							84.0	82.0	82.0					2																	109547447		2203	4300	6503	SO:0001819	synonymous_variant	10913				apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity	g.chr2:109547447C>G	AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.24G>C	2.37:g.109547447C>G			Somatic				EDAR_uc010fjn.2_Silent_p.T8T|EDAR_uc010yws.1_Silent_p.T8T	p.T8T	NM_022336	NP_071731	WXS	Illumina HiSeq	Unspecified	Q9UNE0	EDAR_HUMAN			2	455	-			8					B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Silent	SNP	ENST00000258443.2	37	c.24G>C	CCDS2081.1																																																																																				0.627	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253595.1			30	92	0	0	0	0.010818	0	30	92				
WASH2P	375260	broad.mit.edu	37	2	114357557	114357557	+	RNA	SNP	A	A	G	rs377652994		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:114357557A>G	ENST00000538033.2	+	0	2800							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GCCTACTTCTAGTGAAACTGG	0.567																																							uc010yxx.1		NA																	0					0						c.(382-384)TAG>CAG		SubName: Full=DEAD/H box polypeptide 11 like 2;																																						84771							g.chr2:114357557A>G			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114357557A>G			Somatic					p.*128Q			WXS	Illumina HiSeq	Unspecified					3	709	-									Nonstop_Mutation	SNP	ENST00000538033.2	37	c.382T>C																																																																																					0.567	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene	OTTHUMT00000467782.1	NM_198943		2	12	0	0	0	0.004672	0	2	12				
CCDC148	130940	broad.mit.edu	37	2	159170350	159170350	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:159170350T>C	ENST00000283233.5	-	8	1134	c.821A>G	c.(820-822)tAc>tGc	p.Y274C	CCDC148_ENST00000536771.1_Missense_Mutation_p.Y188C|CCDC148_ENST00000409187.1_Missense_Mutation_p.Y283C	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	274										endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						ATCTCCAGGGTACTGATCCAA	0.393																																							uc002tzq.2		NA																	0				ovary(2)	2						c.(820-822)TAC>TGC		coiled-coil domain containing 148							112.0	112.0	112.0					2																	159170350		2203	4300	6503	SO:0001583	missense	130940							g.chr2:159170350T>C		CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.821A>G	2.37:g.159170350T>C	ENSP00000283233:p.Tyr274Cys		Somatic				CCDC148_uc002tzr.2_Missense_Mutation_p.Y122C|CCDC148_uc010foh.2_5'UTR|CCDC148_uc010foi.1_Missense_Mutation_p.Y221C|CCDC148_uc010foj.1_Missense_Mutation_p.Y122C|CCDC148_uc010fok.1_Missense_Mutation_p.Y188C	p.Y274C	NM_138803	NP_620158	WXS	Illumina HiSeq	Unspecified	Q8NFR7	CC148_HUMAN			8	1084	-			274					F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Missense_Mutation	SNP	ENST00000283233.5	37	c.821A>G	CCDS33304.1	.	.	.	.	.	.	.	.	.	.	T	16.68	3.190083	0.58017	.	.	ENSG00000153237	ENST00000283233;ENST00000375617;ENST00000409187;ENST00000536771	T;T;T	0.64438	0.14;0.13;-0.1	5.35	5.35	0.76521	.	.	.	.	.	T	0.77864	0.4194	M	0.74881	2.28	0.39024	D	0.959793	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.991;0.999;0.999;0.987;0.992	T	0.81263	-0.1012	9	0.56958	D	0.05	-11.3532	13.2892	0.60262	0.0:0.0:0.0:1.0	.	188;122;122;283;274	F5H839;C9JR76;Q8NFR7-2;B8ZZV3;Q8NFR7	.;.;.;.;CC148_HUMAN	C	274;122;283;188	ENSP00000283233:Y274C;ENSP00000386674:Y283C;ENSP00000443740:Y188C	ENSP00000283233:Y274C	Y	-	2	0	CCDC148	158878596	1.000000	0.71417	1.000000	0.80357	0.611000	0.37282	5.514000	0.67043	2.037000	0.60232	0.460000	0.39030	TAC		0.393	CCDC148-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333270.1	NM_138803		24	52	0	0	0	0.003954	0	24	52				
BAZ2B	29994	broad.mit.edu	37	2	160189181	160189181	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:160189181C>T	ENST00000392783.2	-	34	6308	c.5813G>A	c.(5812-5814)cGa>cAa	p.R1938Q	BAZ2B_ENST00000355831.2_Missense_Mutation_p.R1904Q|BAZ2B_ENST00000343439.5_Missense_Mutation_p.R1838Q|BAZ2B_ENST00000392782.1_Missense_Mutation_p.R1902Q	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1938					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						ATCTCCCTTTCGACAGATTTG	0.368																																							uc002uao.2		NA																	0				ovary(3)|skin(1)	4						c.(5812-5814)CGA>CAA		bromodomain adjacent to zinc finger domain, 2B							86.0	78.0	81.0					2																	160189181		1851	4090	5941	SO:0001583	missense	29994				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr2:160189181C>T	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.5813G>A	2.37:g.160189181C>T	ENSP00000376534:p.Arg1938Gln		Somatic				BAZ2B_uc002uap.2_Missense_Mutation_p.R1902Q	p.R1938Q	NM_013450	NP_038478	WXS	Illumina HiSeq	Unspecified	Q9UIF8	BAZ2B_HUMAN			34	6165	-			1938			PHD-type.		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	c.5813G>A	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	14.23	2.472454	0.43942	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32	5.36	5.36	0.76844	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.30519	U	0.009459	D	0.85635	0.5742	L	0.48642	1.525	0.52099	D	0.999945	P;P	0.50369	0.614;0.934	B;B	0.42798	0.107;0.398	D	0.87264	0.2281	10	0.59425	D	0.04	-7.3891	19.0705	0.93134	0.0:1.0:0.0:0.0	.	1902;1938	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	Q	1902;1938;1904;1838	ENSP00000376533:R1902Q;ENSP00000376534:R1938Q;ENSP00000348087:R1904Q;ENSP00000339670:R1838Q	ENSP00000339670:R1838Q	R	-	2	0	BAZ2B	159897427	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.699000	0.68310	2.524000	0.85096	0.650000	0.86243	CGA		0.368	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			23	66	0	0	0	0.003954	0	23	66				
TTN	7273	broad.mit.edu	37	2	179451529	179451529	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:179451529G>T	ENST00000591111.1	-	258	59400	c.59176C>A	c.(59176-59178)Ccg>Acg	p.P19726T	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P21367T|TTN_ENST00000342992.6_Missense_Mutation_p.P18799T|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P12494T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P12427T|TTN_ENST00000460472.2_Missense_Mutation_p.P12302T			Q8WZ42	TITIN_HUMAN	titin	19726					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGGGATCCGGCTCACCTAGA	0.413																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(56395-56397)CCG>ACG		titin isoform N2-A							160.0	158.0	159.0					2																	179451529		1863	4103	5966	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179451529G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.59176C>A	2.37:g.179451529G>T	ENSP00000465570:p.Pro19726Thr		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P12494T|TTN_uc010zfi.1_Missense_Mutation_p.P12427T|TTN_uc010zfj.1_Missense_Mutation_p.P12302T	p.P18799T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		257	56619	-			19726					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.56395C>A		.	.	.	.	.	.	.	.	.	.	G	19.88	3.909875	0.72983	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	6.06	6.06	0.98353	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87034	0.6077	H	0.96333	3.805	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.997	D	0.89856	0.4013	9	0.87932	D	0	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	12302;12427;12494;19726	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	18799;12302;12494;12427;12300	ENSP00000343764:P18799T;ENSP00000434586:P12302T;ENSP00000340554:P12494T;ENSP00000352154:P12427T	ENSP00000340554:P12494T	P	-	1	0	TTN	179159775	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	9.807000	0.99171	2.879000	0.98667	0.650000	0.86243	CCG		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		24	83	1	0	4.4004e-07	0.00333	5.01212e-07	24	83				
SAG	6295	broad.mit.edu	37	2	234238223	234238223	+	Splice_Site	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:234238223G>T	ENST00000409110.1	+	9	963	c.733G>T	c.(733-735)Gtg>Ttg	p.V245L	SAG_ENST00000449594.2_Splice_Site_p.V111L	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	245					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		TAAAGCATTCGGTAGGACCTT	0.468																																							uc002vuh.2		NA																	0				ovary(1)	1						c.(733-735)GTG>TTG		S-arrestin							71.0	70.0	71.0					2																	234238223		1883	4116	5999	SO:0001630	splice_region_variant	6295				rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway		protein phosphatase inhibitor activity	g.chr2:234238223G>T		CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.733+1G>T	2.37:g.234238223G>T			Somatic				SAG_uc010zmq.1_Missense_Mutation_p.V111L	p.V245L	NM_000541	NP_000532	WXS	Illumina HiSeq	Unspecified	P10523	ARRS_HUMAN		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)	9	1121	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)	245					A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	ENST00000409110.1	37	c.733G>T	CCDS46545.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.734607	0.89482	.	.	ENSG00000130561	ENST00000252857;ENST00000409110;ENST00000449594	T;T	0.04360	3.64;3.64	4.7	4.7	0.59300	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.28764	0.0713	M	0.90595	3.13	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.80764	0.994;0.994	T	0.21415	-1.0246	10	0.87932	D	0	-31.9466	18.1951	0.89818	0.0:0.0:1.0:0.0	.	111;245	B7Z7L5;P10523	.;ARRS_HUMAN	L	245;245;111	ENSP00000386444:V245L;ENSP00000392889:V111L	ENSP00000252857:V245L	V	+	1	0	SAG	233902962	1.000000	0.71417	0.914000	0.36105	0.742000	0.42306	9.294000	0.96088	2.590000	0.87494	0.561000	0.74099	GTG		0.468	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330126.1	NM_000541	Missense_Mutation	16	19	1	0	6.31663e-08	0.003163	7.46243e-08	16	19				
UGT1A9	54600	broad.mit.edu	37	2	234580839	234580839	+	Missense_Mutation	SNP	G	G	C	rs570830637		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:234580839G>C	ENST00000354728.4	+	1	341	c.259G>C	c.(259-261)Gac>Cac	p.D87H	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Missense_Mutation_p.D87H			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	87					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	GGAGGATCTGGACCGGGAGTT	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		20973	0.0		0.0	False		,,,				2504	0.001						uc002vus.2		NA																	0				ovary(3)|breast(1)|skin(1)	5						c.(259-261)GAC>CAC		UDP glycosyltransferase 1 family, polypeptide A9	Entacapone(DB00494)|Etodolac(DB00749)|Indomethacin(DB00328)|Irinotecan(DB00762)|Mycophenolic acid(DB01024)|Oxyphenonium(DB00219)|Propofol(DB00818)|Sorafenib(DB00398)						103.0	99.0	100.0					2																	234580839		2203	4300	6503	SO:0001583	missense	54600				drug metabolic process|flavone metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding	g.chr2:234580839G>C	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.259G>C	2.37:g.234580839G>C	ENSP00000346768:p.Asp87His		Somatic				UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Missense_Mutation_p.D87H	p.D87H	NM_021027	NP_066307	WXS	Illumina HiSeq	Unspecified	O60656	UD19_HUMAN		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	1	296	+		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)	87					B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	37	c.259G>C	CCDS2505.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256208	0.39896	.	.	ENSG00000241119	ENST00000354728	T	0.60424	0.19	3.45	-1.78	0.07957	.	.	.	.	.	T	0.58148	0.2102	L	0.31752	0.955	0.09310	N	1	P;P	0.37955	0.612;0.612	P;P	0.57846	0.828;0.828	T	0.58142	-0.7688	9	0.87932	D	0	.	5.9434	0.19205	0.4039:0.1337:0.4625:0.0	.	87;87	Q5DSZ5;O60656	.;UD19_HUMAN	H	87	ENSP00000346768:D87H	ENSP00000346768:D87H	D	+	1	0	UGT1A9	234245578	0.001000	0.12720	0.005000	0.12908	0.069000	0.16628	0.040000	0.13905	-0.362000	0.08113	0.446000	0.29264	GAC		0.418	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027		40	55	0	0	0	0.00623	0	40	55				
HJURP	55355	broad.mit.edu	37	2	234750291	234750291	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr2:234750291C>T	ENST00000411486.2	-	8	1200	c.1135G>A	c.(1135-1137)Gtg>Atg	p.V379M	HJURP_ENST00000432087.1_Missense_Mutation_p.V325M|HJURP_ENST00000441687.1_Missense_Mutation_p.V294M|HJURP_ENST00000434039.1_5'Flank	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	379					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		GAGGGTGTCACTTTGCGCTCC	0.368																																							uc002vvg.2		NA																	0				ovary(1)	1						c.(1135-1137)GTG>ATG		Holliday junction recognition protein							87.0	89.0	88.0					2																	234750291		2203	4300	6503	SO:0001583	missense	55355				cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding	g.chr2:234750291C>T		CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1135G>A	2.37:g.234750291C>T	ENSP00000414109:p.Val379Met		Somatic				HJURP_uc010znd.1_Missense_Mutation_p.V318M|HJURP_uc010zne.1_Missense_Mutation_p.V287M	p.V379M	NM_018410	NP_060880	WXS	Illumina HiSeq	Unspecified	Q8NCD3	HJURP_HUMAN		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)	8	1201	-		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)	379					A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	ENST00000411486.2	37	c.1135G>A	CCDS33406.1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.148382	0.37923	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	4.2	-2.29	0.06805	Holliday junction recognition protein, HJURP (1);	1.675020	0.03294	N	0.188005	T	0.33235	0.0856	N	0.25647	0.755	0.09310	N	1	B;B;B	0.30727	0.248;0.248;0.292	B;B;B	0.36244	0.14;0.14;0.22	T	0.11941	-1.0567	10	0.34782	T	0.22	0.4759	1.0995	0.01680	0.1406:0.3183:0.2754:0.2658	.	294;325;379	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	M	379;325;294;294	ENSP00000414109:V379M;ENSP00000407208:V325M;ENSP00000401944:V294M;ENSP00000393253:V294M	ENSP00000414109:V379M	V	-	1	0	HJURP	234415030	0.000000	0.05858	0.000000	0.03702	0.209000	0.24338	-0.646000	0.05403	-0.483000	0.06772	0.655000	0.94253	GTG		0.368	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130996.6	NM_018410		26	62	0	0	0	0.003954	0	26	62				
BTBD3	22903	broad.mit.edu	37	20	11900381	11900381	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr20:11900381G>T	ENST00000405977.1	+	4	1058	c.433G>T	c.(433-435)Ggg>Tgg	p.G145W	BTBD3_ENST00000254977.3_Missense_Mutation_p.G84W|BTBD3_ENST00000488503.1_3'UTR|BTBD3_ENST00000399006.2_Missense_Mutation_p.G84W|RP4-742J24.2_ENST00000439529.1_RNA|BTBD3_ENST00000378226.2_Missense_Mutation_p.G145W	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	145	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						TTTAGCTGTTGGGAGCTCTGT	0.408																																							uc002wnz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(433-435)GGG>TGG		BTB/POZ domain containing protein 3 isoform a							140.0	133.0	135.0					20																	11900381		2203	4300	6503	SO:0001583	missense	22903							g.chr20:11900381G>T	AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.433G>T	20.37:g.11900381G>T	ENSP00000384545:p.Gly145Trp		Somatic				BTBD3_uc002wny.2_Missense_Mutation_p.G84W|BTBD3_uc002woa.2_Missense_Mutation_p.G84W|BTBD3_uc010zrf.1_5'UTR|BTBD3_uc010zrg.1_5'UTR|BTBD3_uc010zrh.1_5'UTR	p.G145W	NM_014962	NP_055777	WXS	Illumina HiSeq	Unspecified	Q9Y2F9	BTBD3_HUMAN			3	792	+			145			BTB.		D3DW19|Q5JY73	Missense_Mutation	SNP	ENST00000405977.1	37	c.433G>T	CCDS13113.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637642	0.67130	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000422390;ENST00000378226;ENST00000455911;ENST00000430557	T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	6.0	6.0	0.97389	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.85159	0.5633	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86347	0.1708	10	0.72032	D	0.01	.	19.4827	0.95016	0.0:0.0:1.0:0.0	.	145	Q9Y2F9	BTBD3_HUMAN	W	84;84;145;84;145;34;34	ENSP00000254977:G84W;ENSP00000381971:G84W;ENSP00000384545:G145W;ENSP00000397809:G84W;ENSP00000367471:G145W;ENSP00000408817:G34W;ENSP00000404582:G34W	ENSP00000254977:G84W	G	+	1	0	BTBD3	11848381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.846000	0.97976	0.650000	0.86243	GGG		0.408	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078021.3			29	79	1	0	1.75199e-13	0.007291	2.27043e-13	29	79				
DSTN	11034	broad.mit.edu	37	20	17581671	17581671	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr20:17581671G>C	ENST00000246069.7	+	2	638	c.292G>C	c.(292-294)Gag>Cag	p.E98Q	DSTN_ENST00000474024.1_Missense_Mutation_p.E81Q	NM_006870.3	NP_006861.1	P60981	DEST_HUMAN	destrin (actin depolymerizing factor)	98	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament depolymerization (GO:0030042)|actin filament severing (GO:0051014)|actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|positive regulation of actin filament depolymerization (GO:0030836)	actin cytoskeleton (GO:0015629)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(5)|lung(8)|skin(1)	15						CAGAAAAGAAGAGTTGATGTT	0.368																																							uc002wpr.2		NA																	0				large_intestine(1)|skin(1)	2						c.(292-294)GAG>CAG		destrin isoform a							68.0	68.0	68.0					20																	17581671		2203	4300	6503	SO:0001583	missense	11034				actin filament severing|actin polymerization or depolymerization		actin binding	g.chr20:17581671G>C	S65738	CCDS13127.1, CCDS46580.1	20p12.1	2010-08-20			ENSG00000125868	ENSG00000125868			15750	protein-coding gene	gene with protein product		609114				8399167, 2156828	Standard	NM_006870		Approved	ADF, ACTDP	uc002wpr.3	P60981	OTTHUMG00000031947	ENST00000246069.7:c.292G>C	20.37:g.17581671G>C	ENSP00000246069:p.Glu98Gln		Somatic				DSTN_uc002wpq.2_Missense_Mutation_p.E81Q|DSTN_uc010gck.2_Missense_Mutation_p.E81Q	p.E98Q	NM_006870	NP_006861	WXS	Illumina HiSeq	Unspecified	P60981	DEST_HUMAN			2	547	+			98			ADF-H.		B2R6N2|B4DYA6|P18282|Q5W166|Q6IAW2	Missense_Mutation	SNP	ENST00000246069.7	37	c.292G>C	CCDS13127.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338424	0.60963	.	.	ENSG00000125868	ENST00000246069;ENST00000543261	T;T	0.35789	1.29;1.29	5.65	5.65	0.86999	Actin-binding, cofilin/tropomyosin type (3);	0.044156	0.85682	D	0.000000	T	0.35008	0.0917	L	0.42245	1.32	0.58432	D	0.999998	B	0.27882	0.192	B	0.23150	0.044	T	0.10941	-1.0608	10	0.59425	D	0.04	-22.2443	18.716	0.91675	0.0:0.0:1.0:0.0	.	98	P60981	DEST_HUMAN	Q	98;81	ENSP00000246069:E98Q;ENSP00000444808:E81Q	ENSP00000246069:E98Q	E	+	1	0	DSTN	17529671	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.771000	0.98977	2.681000	0.91329	0.563000	0.77884	GAG		0.368	DSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078131.6	NM_001011546		17	78	0	0	0	0.00499	0	17	78				
SCP2D1	140856	broad.mit.edu	37	20	18794596	18794596	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr20:18794596C>A	ENST00000377428.2	+	1	227	c.137C>A	c.(136-138)cCa>cAa	p.P46Q	C20orf78_ENST00000463425.1_5'Flank|C20orf78_ENST00000278779.4_Intron	NM_178483.2	NP_848578.1	Q9UJQ7	SCP2D_HUMAN	SCP2 sterol-binding domain containing 1	46	SCP2.																GAGAGCTTCCCAGTGTTTCAG	0.507																																							uc002wrk.2		NA																	0				skin(3)	3						c.(136-138)CCA>CAA		hypothetical protein LOC140856							103.0	93.0	97.0					20																	18794596		2203	4300	6503	SO:0001583	missense	140856						sterol binding	g.chr20:18794596C>A	AL035563	CCDS13139.1	20p11.23	2012-10-29	2012-10-29	2012-10-29	ENSG00000132631	ENSG00000132631			16211	protein-coding gene	gene with protein product	"""sterol carrier protein 2-like protein"""		"""chromosome 20 open reading frame 79"""	C20orf79		16501878	Standard	NM_178483		Approved	dJ1068E13.2, HSD22	uc002wrk.3	Q9UJQ7	OTTHUMG00000031983	ENST00000377428.2:c.137C>A	20.37:g.18794596C>A	ENSP00000366645:p.Pro46Gln		Somatic				uc002wrj.1_Intron	p.P46Q	NM_178483	NP_848578	WXS	Illumina HiSeq	Unspecified	Q9UJQ7	CT079_HUMAN			1	227	+			46			SCP2.		Q548A4	Missense_Mutation	SNP	ENST00000377428.2	37	c.137C>A	CCDS13139.1	.	.	.	.	.	.	.	.	.	.	C	1.275	-0.612054	0.03690	.	.	ENSG00000132631	ENST00000377428	T	0.21361	2.01	5.85	-6.32	0.01995	SCP2 sterol-binding domain (1);	1.529150	0.03707	N	0.249642	T	0.08313	0.0207	N	0.05383	-0.06	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21008	-1.0258	10	0.29301	T	0.29	6.329	2.6594	0.05021	0.22:0.1451:0.1093:0.5256	.	46	Q9UJQ7	CT079_HUMAN	Q	46	ENSP00000366645:P46Q	ENSP00000366645:P46Q	P	+	2	0	C20orf79	18742596	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.333000	0.19768	-1.018000	0.03363	-0.470000	0.05040	CCA		0.507	SCP2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078193.1	NM_178483		23	38	1	0	2.89027e-11	0.014323	3.61639e-11	23	38				
CDH22	64405	broad.mit.edu	37	20	44839089	44839089	+	Silent	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr20:44839089C>G	ENST00000372262.3	-	6	1543	c.1143G>C	c.(1141-1143)gtG>gtC	p.V381V	CDH22_ENST00000474438.1_5'UTR|CDH22_ENST00000537909.1_Silent_p.V381V	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	381	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CGGCCACGCGCACGATCGCCT	0.716																																							uc002xrm.2		NA																	0				ovary(4)|skin(1)	5						c.(1141-1143)GTG>GTC		cadherin 22 precursor							19.0	19.0	19.0					20																	44839089		2198	4293	6491	SO:0001819	synonymous_variant	64405				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr20:44839089C>G	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1143G>C	20.37:g.44839089C>G			Somatic				CDH22_uc010ghk.1_Silent_p.V381V|CDH22_uc002xrn.1_Silent_p.V132V	p.V381V	NM_021248	NP_067071	WXS	Illumina HiSeq	Unspecified	Q9UJ99	CAD22_HUMAN			6	1544	-		Myeloproliferative disorder(115;0.0122)	381			Extracellular (Potential).|Cadherin 3.		B9EGK7|O43205	Silent	SNP	ENST00000372262.3	37	c.1143G>C	CCDS13395.1																																																																																				0.716	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248		3	14	0	0	0	0.004672	0	3	14				
ZNF217	7764	broad.mit.edu	37	20	52199100	52199100	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr20:52199100C>A	ENST00000371471.2	-	2	691	c.266G>T	c.(265-267)cGg>cTg	p.R89L	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Missense_Mutation_p.R89L			O75362	ZN217_HUMAN	zinc finger protein 217	89					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GAGGGTAGGCCGGTGTTGCAT	0.463																																							uc002xwq.3		NA																	0				skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6						c.(265-267)CGG>CTG		zinc finger protein 217							141.0	137.0	138.0					20																	52199100		2203	4300	6503	SO:0001583	missense	7764				negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:52199100C>A	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.266G>T	20.37:g.52199100C>A	ENSP00000360526:p.Arg89Leu		Somatic				ZNF217_uc010gij.1_Missense_Mutation_p.R81L	p.R89L	NM_006526	NP_006517	WXS	Illumina HiSeq	Unspecified	O75362	ZN217_HUMAN	BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)		1	537	-	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		89					E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	c.266G>T	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.716079	0.68844	.	.	ENSG00000171940	ENST00000371471;ENST00000302342;ENST00000431687	T;T	0.09538	2.97;2.97	5.79	5.79	0.91817	.	0.159546	0.43579	D	0.000560	T	0.32734	0.0839	M	0.63843	1.955	0.48040	D	0.999573	D	0.89917	1.0	D	0.69654	0.965	T	0.00695	-1.1606	10	0.87932	D	0	-34.1656	19.635	0.95728	0.0:1.0:0.0:0.0	.	89	O75362	ZN217_HUMAN	L	89	ENSP00000360526:R89L;ENSP00000304308:R89L	ENSP00000304308:R89L	R	-	2	0	ZNF217	51632507	1.000000	0.71417	1.000000	0.80357	0.352000	0.29268	3.011000	0.49567	2.733000	0.93635	0.655000	0.94253	CGG		0.463	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526		40	127	1	0	4.32679e-17	0.006999	5.84577e-17	40	127				
OGFR	11054	broad.mit.edu	37	20	61444194	61444194	+	Silent	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr20:61444194G>A	ENST00000290291.6	+	7	1252	c.1227G>A	c.(1225-1227)aaG>aaA	p.K409K	OGFR_ENST00000370461.1_Silent_p.K357K	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	409					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					AGGTGGAGAAGATCGCTCTGA	0.652																																							uc002ydj.2		NA																	0					0						c.(1225-1227)AAG>AAA		opioid growth factor receptor							40.0	45.0	43.0					20																	61444194		2201	4299	6500	SO:0001819	synonymous_variant	11054				regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity	g.chr20:61444194G>A	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1227G>A	20.37:g.61444194G>A			Somatic				OGFR_uc002ydk.2_Silent_p.K392K|OGFR_uc002ydl.2_Silent_p.K357K|uc011aam.1_3'UTR	p.K409K	NM_007346	NP_031372	WXS	Illumina HiSeq	Unspecified	Q9NZT2	OGFR_HUMAN			7	1262	+	Breast(26;3.65e-08)		409					O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	37	c.1227G>A	CCDS13504.1																																																																																				0.652	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1			11	40	0	0	0	0.010729	0	11	40				
PDE9A	5152	broad.mit.edu	37	21	44182290	44182290	+	Missense_Mutation	SNP	G	G	A	rs201884723		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr21:44182290G>A	ENST00000291539.6	+	14	1243	c.1183G>A	c.(1183-1185)Gag>Aag	p.E395K	PDE9A_ENST00000398227.3_Missense_Mutation_p.E235K|PDE9A_ENST00000335512.4_Missense_Mutation_p.E335K|PDE9A_ENST00000328862.6_Missense_Mutation_p.E369K|PDE9A_ENST00000398224.3_Missense_Mutation_p.E268K|PDE9A_ENST00000335440.6_Missense_Mutation_p.E293K|PDE9A_ENST00000539837.1_Missense_Mutation_p.E267K|PDE9A_ENST00000398229.3_Missense_Mutation_p.E261K|PDE9A_ENST00000398232.3_Missense_Mutation_p.E328K|PDE9A_ENST00000380328.2_Missense_Mutation_p.E342K|PDE9A_ENST00000349112.3_Missense_Mutation_p.E267K|PDE9A_ENST00000398234.3_Missense_Mutation_p.E294K|PDE9A_ENST00000398236.3_Missense_Mutation_p.E309K|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000398225.3_Missense_Mutation_p.E354K	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	395	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)	p.E395K(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	GATCCTCGCCGAGCCTGAGTG	0.612																																							uc002zbm.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)|skin(1)	2						c.(1183-1185)GAG>AAG		phosphodiesterase 9A isoform a		G	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	0,4406		0,0,2203	141.0	110.0	121.0		1003,802,799,1024,880,562,562,925,703,532,781,877,562,532,982,1060,1105,562,562,1183	3.3	0.2	21		121	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	PDE9A	NM_001001567.1,NM_001001568.1,NM_001001569.1,NM_001001570.1,NM_001001571.1,NM_001001572.1,NM_001001573.1,NM_001001574.1,NM_001001575.1,NM_001001576.1,NM_001001577.1,NM_001001578.1,NM_001001579.1,NM_001001580.1,NM_001001581.1,NM_001001582.1,NM_001001583.1,NM_001001584.2,NM_001001585.1,NM_002606.2	56,56,56,56,56,56,56,56,56,56,56,56,56,56,56,56,56,56,56,56	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	335/534,268/467,267/466,342/541,294/493,188/387,188/387,309/508,235/434,178/377,261/460,293/492,188/387,178/377,328/527,354/553,369/568,188/387,188/387,395/594	44182290	2,13004	2203	4300	6503	SO:0001583	missense	5152				platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding	g.chr21:44182290G>A	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.1183G>A	21.37:g.44182290G>A	ENSP00000291539:p.Glu395Lys		Somatic				PDE9A_uc002zbn.2_Missense_Mutation_p.E268K|PDE9A_uc002zbo.2_Missense_Mutation_p.E342K|PDE9A_uc002zbp.2_Missense_Mutation_p.E188K|PDE9A_uc002zbq.2_Missense_Mutation_p.E293K|PDE9A_uc002zbs.2_Missense_Mutation_p.E188K|PDE9A_uc002zbr.2_Missense_Mutation_p.E188K|PDE9A_uc002zbt.2_Missense_Mutation_p.E267K|PDE9A_uc002zbu.2_Missense_Mutation_p.E261K|PDE9A_uc002zbv.2_Missense_Mutation_p.E235K|PDE9A_uc002zbw.2_Missense_Mutation_p.E178K|PDE9A_uc002zbx.2_Missense_Mutation_p.E335K|PDE9A_uc002zby.2_Missense_Mutation_p.E178K|PDE9A_uc002zbz.2_Missense_Mutation_p.E287K|PDE9A_uc002zca.2_Missense_Mutation_p.E354K|PDE9A_uc002zcb.2_Missense_Mutation_p.E369K|PDE9A_uc002zcc.2_Missense_Mutation_p.E294K|PDE9A_uc002zcd.2_Missense_Mutation_p.E309K|PDE9A_uc002zce.2_Missense_Mutation_p.E328K|PDE9A_uc002zcf.2_Missense_Mutation_p.E188K|PDE9A_uc002zcg.2_Missense_Mutation_p.E188K|PDE9A_uc002zch.2_Missense_Mutation_p.E178K|PDE9A_uc010gpf.1_Missense_Mutation_p.E188K	p.E395K	NM_002606	NP_002597	WXS	Illumina HiSeq	Unspecified	O76083	PDE9A_HUMAN			14	1246	+			395			Catalytic (By similarity).		B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Missense_Mutation	SNP	ENST00000291539.6	37	c.1183G>A	CCDS13690.1	.	.	.	.	.	.	.	.	.	.	G	9.070	0.996713	0.19043	0.0	2.33E-4	ENSG00000160191	ENST00000335512;ENST00000539837;ENST00000291539;ENST00000380328;ENST00000398232;ENST00000398234;ENST00000398236;ENST00000328862;ENST00000335440;ENST00000398225;ENST00000398229;ENST00000398227;ENST00000349112;ENST00000398224	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51	5.15	3.27	0.37495	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.420899	0.26136	N	0.026129	T	0.54013	0.1832	N	0.01624	-0.795	0.22888	N	0.998601	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.17465	0.0;0.016;0.001;0.001;0.009;0.01;0.002;0.001;0.0;0.001;0.001;0.001;0.002;0.002;0.001;0.022	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.10450	0.001;0.003;0.001;0.001;0.003;0.002;0.001;0.001;0.001;0.001;0.0;0.002;0.003;0.002;0.001;0.005	T	0.41698	-0.9494	10	0.21014	T	0.42	.	11.5488	0.50708	0.1422:0.7247:0.133:0.0	.	267;328;309;294;369;354;287;335;178;235;261;267;293;342;268;395	F5GWD0;O76083-13;O76083-8;O76083-6;O76083-15;O76083-14;O76083-16;O76083-2;O76083-10;O76083-9;O76083-11;O76083-4;O76083-12;O76083-5;O76083-3;O76083	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;PDE9A_HUMAN	K	335;267;395;342;328;294;309;369;293;354;261;235;267;268	ENSP00000335242:E335K;ENSP00000441899:E267K;ENSP00000291539:E395K;ENSP00000369685:E342K;ENSP00000381287:E328K;ENSP00000381289:E294K;ENSP00000381291:E309K;ENSP00000328699:E369K;ENSP00000335365:E293K;ENSP00000381281:E354K;ENSP00000381285:E261K;ENSP00000381283:E235K;ENSP00000344730:E267K;ENSP00000381280:E268K	ENSP00000291539:E395K	E	+	1	0	PDE9A	43055359	0.961000	0.32948	0.232000	0.24009	0.469000	0.32828	3.586000	0.53950	0.517000	0.28361	-0.265000	0.10407	GAG		0.612	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1			18	89	0	0	0	0.00499	0	18	89				
COL6A2	1292	broad.mit.edu	37	21	47546443	47546443	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr21:47546443C>T	ENST00000300527.4	+	27	2553	c.2449C>T	c.(2449-2451)Ccc>Tcc	p.P817S	COL6A2_ENST00000310645.5_Missense_Mutation_p.P817S|COL6A2_ENST00000397763.1_Missense_Mutation_p.P817S|COL6A2_ENST00000357838.4_Missense_Mutation_p.P817S|COL6A2_ENST00000409416.1_Missense_Mutation_p.P817S	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	817	Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCCAGACCTTCCCTGCCAAAC	0.652																																							uc002zia.1		NA																	0				central_nervous_system(7)|ovary(1)	8						c.(2449-2451)CCC>TCC		alpha 2 type VI collagen isoform 2C2 precursor							74.0	72.0	72.0					21																	47546443		2203	4300	6503	SO:0001583	missense	1292				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	g.chr21:47546443C>T	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2449C>T	21.37:g.47546443C>T	ENSP00000300527:p.Pro817Ser		Somatic				COL6A2_uc002zhy.1_Missense_Mutation_p.P817S|COL6A2_uc002zhz.1_Missense_Mutation_p.P817S|COL6A2_uc002zib.1_Missense_Mutation_p.P223S|COL6A2_uc002zic.1_5'UTR	p.P817S	NM_001849	NP_001840	WXS	Illumina HiSeq	Unspecified	P12110	CO6A2_HUMAN		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	27	2531	+	Breast(49;0.245)		817			Nonhelical region.		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	c.2449C>T	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652101	0.47362	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	T;D;D;D;D	0.89415	-1.11;-2.5;-2.51;-2.51;-2.5	3.91	3.91	0.45181	.	0.000000	0.85682	U	0.000000	D	0.89952	0.6864	L	0.29908	0.895	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.993;0.985	D;P;P	0.76071	0.987;0.805;0.689	D	0.87621	0.2510	10	0.21014	T	0.42	-12.368	15.897	0.79341	0.0:1.0:0.0:0.0	.	817;817;817	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	S	817	ENSP00000300527:P817S;ENSP00000350497:P817S;ENSP00000312529:P817S;ENSP00000387115:P817S;ENSP00000380870:P817S	ENSP00000300527:P817S	P	+	1	0	COL6A2	46370871	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	6.858000	0.75461	1.702000	0.51228	0.491000	0.48974	CCC		0.652	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			91	71	0	0	0	0.01441	0	91	71				
MCM3AP	8888	broad.mit.edu	37	21	47671503	47671503	+	Silent	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr21:47671503C>T	ENST00000397708.1	-	21	4484	c.4230G>A	c.(4228-4230)tcG>tcA	p.S1410S	MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000590829.1_RNA|AP001469.9_ENST00000430259.1_RNA|AP001469.9_ENST00000447037.1_RNA|MCM3AP_ENST00000291688.1_Silent_p.S1410S|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1410					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AGTTGAAAAGCGAAAGCGTCT	0.398																																							uc002zir.1		NA																	0				large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						c.(4228-4230)TCG>TCA		minichromosome maintenance complex component 3							102.0	91.0	95.0					21																	47671503		2203	4300	6503	SO:0001819	synonymous_variant	8888				DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding	g.chr21:47671503C>T	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4230G>A	21.37:g.47671503C>T			Somatic				MCM3APAS_uc002zim.2_RNA|MCM3APAS_uc002zin.2_3'UTR|MCM3AP_uc002zip.1_Silent_p.S151S|MCM3AP_uc002ziq.1_Silent_p.S337S|MCM3APAS_uc002zis.1_RNA	p.S1410S	NM_003906	NP_003897	WXS	Illumina HiSeq	Unspecified	O60318	MCM3A_HUMAN			20	4266	-	Breast(49;0.112)		1410					C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	37	c.4230G>A	CCDS13734.1																																																																																				0.398	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906		4	102	0	0	0	0.009096	0	4	102				
PCNT	5116	broad.mit.edu	37	21	47769710	47769710	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr21:47769710G>C	ENST00000359568.5	+	8	1427	c.1320G>C	c.(1318-1320)gaG>gaC	p.E440D	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	440	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGTTCAAAGAGAGCGAGAAAG	0.443																																							uc002zji.3		NA																	0				ovary(4)|breast(2)|pancreas(2)	8						c.(1318-1320)GAG>GAC		pericentrin							81.0	82.0	82.0					21																	47769710		2203	4300	6503	SO:0001583	missense	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47769710G>C	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1320G>C	21.37:g.47769710G>C	ENSP00000352572:p.Glu440Asp		Somatic				PCNT_uc002zjj.2_Missense_Mutation_p.E322D|PCNT_uc010gqk.1_RNA	p.E440D	NM_006031	NP_006022	WXS	Illumina HiSeq	Unspecified	O95613	PCNT_HUMAN			8	1427	+	Breast(49;0.112)		440			Glu-rich.|Potential.		O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	c.1320G>C	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.841719	0.32513	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.24723	1.84	3.98	-7.52	0.01341	.	1.475580	0.04981	N	0.465648	T	0.14184	0.0343	N	0.25890	0.77	0.09310	N	1	B;B	0.17667	0.023;0.014	B;B	0.17433	0.018;0.008	T	0.25606	-1.0127	10	0.17832	T	0.49	.	7.8967	0.29710	0.4397:0.1217:0.4386:0.0	.	322;440	O95613-2;O95613	.;PCNT_HUMAN	D	440;427	ENSP00000352572:E440D	ENSP00000338675:E427D	E	+	3	2	PCNT	46594138	0.861000	0.29849	0.000000	0.03702	0.032000	0.12392	-0.088000	0.11198	-1.324000	0.02272	-0.414000	0.06135	GAG		0.443	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		18	132	0	0	0	0.00499	0	18	132				
MPPED1	758	broad.mit.edu	37	22	43898607	43898607	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr22:43898607C>T	ENST00000417669.2	+	6	1276	c.832C>T	c.(832-834)Cgg>Tgg	p.R278W	MPPED1_ENST00000439548.1_Missense_Mutation_p.R120W|MPPED1_ENST00000443721.1_Missense_Mutation_p.R278W|MPPED1_ENST00000542779.1_Missense_Mutation_p.R278W|MPPED1_ENST00000414469.2_Missense_Mutation_p.R172W|MPPED1_ENST00000538182.1_Missense_Mutation_p.R311W			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	278							hydrolase activity (GO:0016787)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				CGTCCAGCCGCGGTTACATGT	0.627																																							uc011apv.1		NA																	0					0						c.(832-834)CGG>TGG		metallophosphoesterase domain containing 1							76.0	88.0	84.0					22																	43898607		2189	4298	6487	SO:0001583	missense	758						hydrolase activity	g.chr22:43898607C>T	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.832C>T	22.37:g.43898607C>T	ENSP00000388137:p.Arg278Trp		Somatic				MPPED1_uc011apw.1_Missense_Mutation_p.R172W|MPPED1_uc011apx.1_Missense_Mutation_p.R120W|MPPED1_uc011apy.1_Missense_Mutation_p.R278W|MPPED1_uc011apz.1_Missense_Mutation_p.R311W	p.R278W	NM_001044370	NP_001037835	WXS	Illumina HiSeq	Unspecified	O15442	MPPD1_HUMAN			6	1055	+		all_neural(38;0.0244)|Ovarian(80;0.0694)	278					A8K159|B7Z2S9|Q8N361	Missense_Mutation	SNP	ENST00000417669.2	37	c.832C>T	CCDS46723.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869632	0.33069	.	.	ENSG00000186732	ENST00000417669;ENST00000443721;ENST00000545165;ENST00000414469;ENST00000439548;ENST00000542779;ENST00000538182	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	4.38	-1.1	0.09872	Metallophosphoesterase domain (1);	.	.	.	.	T	0.57844	0.2081	M	0.75085	2.285	0.36904	D	0.890532	D;D	0.76494	0.999;0.999	P;P	0.60682	0.878;0.873	T	0.69499	-0.5129	9	0.59425	D	0.04	.	14.5117	0.67791	0.6125:0.3875:0.0:0.0	.	311;278	B7Z2S9;O15442	.;MPPD1_HUMAN	W	278;278;256;172;120;278;311	ENSP00000388137:R278W;ENSP00000400686:R278W;ENSP00000388245:R172W;ENSP00000390379:R120W;ENSP00000444532:R278W;ENSP00000438335:R311W	ENSP00000388245:R172W	R	+	1	2	MPPED1	42229936	0.986000	0.35501	0.731000	0.30826	0.004000	0.04260	2.491000	0.45303	0.038000	0.15604	-0.771000	0.03389	CGG		0.627	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318938.2	NM_001044370		34	73	0	0	0	0.005524	0	34	73				
KIAA0930	23313	broad.mit.edu	37	22	45599789	45599789	+	Silent	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr22:45599789G>A	ENST00000336156.5	-	6	659	c.594C>T	c.(592-594)ttC>ttT	p.F198F	KIAA0930_ENST00000474515.1_5'Flank|MIR1249_ENST00000408671.1_RNA|KIAA0930_ENST00000251993.7_Silent_p.F203F|KIAA0930_ENST00000391627.2_Silent_p.F164F|KIAA0930_ENST00000443310.3_Silent_p.F180F	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	198										endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						TGACCCCCTGGAACGTGTTGG	0.587																																							uc003bfx.1		NA																	0					0						c.(592-594)TTC>TTT		hypothetical protein LOC23313 isoform b							276.0	188.0	218.0					22																	45599789		2203	4300	6503	SO:0001819	synonymous_variant	23313						protein binding	g.chr22:45599789G>A	AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.594C>T	22.37:g.45599789G>A			Somatic				C22orf9_uc010gzw.1_Silent_p.F50F|C22orf9_uc003bfv.1_Silent_p.F207F|C22orf9_uc003bfw.1_Silent_p.F203F|C22orf9_uc010gzx.2_Silent_p.F180F|MIR1249_hsa-mir-1249|MI0006384_5'Flank	p.F198F	NM_001009880	NP_001009880	WXS	Illumina HiSeq	Unspecified	Q6ICG6	K0930_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)	6	660	-		Ovarian(80;0.00965)|all_neural(38;0.0244)	198					B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Silent	SNP	ENST00000336156.5	37	c.594C>T	CCDS33665.1																																																																																				0.587	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321975.2	NM_001009880		16	41	0	0	0	0.004007	0	16	41				
PLXNB2	23654	broad.mit.edu	37	22	50721182	50721182	+	Missense_Mutation	SNP	T	T	G	rs202201273		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr22:50721182T>G	ENST00000449103.1	-	18	3085	c.2945A>C	c.(2944-2946)aAc>aCc	p.N982T	PLXNB2_ENST00000359337.4_Missense_Mutation_p.N982T|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	982					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CAGTACGGGGTTTTCGCGGTA	0.677																																							uc003bkv.3		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(2944-2946)AAC>ACC		plexin B2 precursor							26.0	32.0	30.0					22																	50721182		1942	4112	6054	SO:0001583	missense	23654				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity	g.chr22:50721182T>G		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2945A>C	22.37:g.50721182T>G	ENSP00000409171:p.Asn982Thr		Somatic				PLXNB2_uc003bkt.1_5'Flank|PLXNB2_uc003bku.1_5'Flank	p.N982T	NM_012401	NP_036533	WXS	Illumina HiSeq	Unspecified	O15031	PLXB2_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	18	3051	-		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	982			Extracellular (Potential).		A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	c.2945A>C	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.988286	0.53934	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000427829	T;T	0.58358	0.34;0.34	3.66	3.66	0.41972	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000028	T	0.70894	0.3276	M	0.83118	2.625	0.49915	D	0.999834	D	0.89917	1.0	D	0.74348	0.983	T	0.74604	-0.3610	10	0.66056	D	0.02	.	10.2948	0.43618	0.0:0.0:0.0:1.0	.	982	O15031	PLXB2_HUMAN	T	982;982;43	ENSP00000409171:N982T;ENSP00000352288:N982T	ENSP00000352288:N982T	N	-	2	0	PLXNB2	49063309	0.627000	0.27129	0.865000	0.33974	0.141000	0.21300	2.111000	0.41883	1.546000	0.49388	0.260000	0.18958	AAC		0.677	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401		5	14	0	0	0	0.00308	0	5	14				
SCO2	9997	broad.mit.edu	37	22	50962824	50962824	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr22:50962824C>G	ENST00000543927.1	-	2	223	c.17G>C	c.(16-18)cGg>cCg	p.R6P	SCO2_ENST00000252785.3_Missense_Mutation_p.R6P|SCO2_ENST00000395693.3_Missense_Mutation_p.R6P|CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000535425.1_Missense_Mutation_p.R6P	NM_001169109.1	NP_001162580.1	O43819	SCO2_HUMAN	SCO2 cytochrome c oxidase assembly protein	6					cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|eye development (GO:0001654)|in utero embryonic development (GO:0001701)|muscle system process (GO:0003012)|oxidation-reduction process (GO:0055114)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			endometrium(1)|lung(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGTGGGGCTCCGAGTCAGCAG	0.637																																							uc003bma.2		NA																	0					0						c.(16-18)CGG>CCG		cytochrome oxidase deficient homolog 2							19.0	21.0	20.0					22																	50962824		2201	4291	6492	SO:0001583	missense	9997				cell redox homeostasis|cellular copper ion homeostasis|copper ion transport|oxidation-reduction process|respiratory chain complex IV assembly	mitochondrial inner membrane	copper ion binding	g.chr22:50962824C>G	AL021683	CCDS14095.1	22q13.33	2014-01-30	2012-10-15		ENSG00000130489	ENSG00000130489		"""Mitochondrial respiratory chain complex assembly factors"""	10604	protein-coding gene	gene with protein product		604272	"""SCO (cytochrome oxidase deficient, yeast) homolog 2"", ""SCO cytochrome oxidase deficient homolog 2 (yeast)"", ""myopia 6"""	MYP6		10218584, 16091356, 23643385	Standard	NM_005138		Approved	SCO1L	uc003bma.3	O43819	OTTHUMG00000150251	ENST00000543927.1:c.17G>C	22.37:g.50962824C>G	ENSP00000444433:p.Arg6Pro		Somatic				SCO2_uc003blz.3_Missense_Mutation_p.R6P	p.R6P	NM_005138	NP_005129	WXS	Illumina HiSeq	Unspecified	O43819	SCO2_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	2	193	-		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	6					Q3T1B5|Q9UK87	Missense_Mutation	SNP	ENST00000543927.1	37	c.17G>C	CCDS14095.1	.	.	.	.	.	.	.	.	.	.	C	8.303	0.820406	0.16678	.	.	ENSG00000130489	ENST00000395693;ENST00000543927;ENST00000535425;ENST00000252785;ENST00000439934;ENST00000423348	D;D;D;D;T;T	0.84589	-1.87;-1.87;-1.87;-1.87;-0.72;-0.72	3.58	-7.16	0.01516	.	0.757199	0.09625	N	0.777070	T	0.63977	0.2557	N	0.24115	0.695	0.09310	N	1	P	0.38582	0.638	B	0.33339	0.162	T	0.57877	-0.7735	10	0.28530	T	0.3	-1.7242	1.7755	0.03021	0.3139:0.1316:0.1003:0.4542	.	6	O43819	SCO2_HUMAN	P	6	ENSP00000379046:R6P;ENSP00000444433:R6P;ENSP00000444242:R6P;ENSP00000252785:R6P;ENSP00000415642:R6P;ENSP00000403570:R6P	ENSP00000252785:R6P	R	-	2	0	SCO2	49309690	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.807000	0.01734	-2.802000	0.00351	-0.140000	0.14226	CGG		0.637	SCO2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317091.1	NM_005138		3	42	0	0	0	0.004672	0	3	42				
CNTN4	152330	broad.mit.edu	37	3	2944582	2944582	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr3:2944582G>T	ENST00000397461.1	+	11	1484	c.1100G>T	c.(1099-1101)gGa>gTa	p.G367V	CNTN4_ENST00000397459.2_Missense_Mutation_p.G39V|CNTN4_ENST00000475817.1_3'UTR|CNTN4_ENST00000448906.2_Missense_Mutation_p.G39V|CNTN4_ENST00000427331.1_Missense_Mutation_p.G367V|CNTN4_ENST00000358480.3_Missense_Mutation_p.G148V|CNTN4_ENST00000418658.1_Missense_Mutation_p.G367V	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	367	Ig-like C2-type 4.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		ATTGAGCAAGGAACACTCAAC	0.363																																							uc003bpc.2		NA																	0				large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7						c.(1099-1101)GGA>GTA		contactin 4 isoform a precursor							82.0	77.0	78.0					3																	2944582		2203	4300	6503	SO:0001583	missense	152330				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding	g.chr3:2944582G>T	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.1100G>T	3.37:g.2944582G>T	ENSP00000380602:p.Gly367Val		Somatic				CNTN4_uc003bpb.1_Missense_Mutation_p.G39V|CNTN4_uc003bpd.1_Missense_Mutation_p.G367V|CNTN4_uc003bpe.2_Missense_Mutation_p.G39V|CNTN4_uc003bpf.2_Missense_Mutation_p.G39V	p.G367V	NM_175607	NP_783200	WXS	Illumina HiSeq	Unspecified	Q8IWV2	CNTN4_HUMAN		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)	11	1321	+		Ovarian(110;0.156)	367			Ig-like C2-type 4.		B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	37	c.1100G>T	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699850	0.88924	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906;ENST00000473845	T;T;T;T;T;T;T	0.66099	1.06;1.06;1.06;1.06;-0.19;-0.19;-0.19	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.82314	0.5010	M	0.83312	2.635	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.83586	0.0120	10	0.87932	D	0	.	20.2983	0.98569	0.0:0.0:1.0:0.0	.	367;367;367	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	V	367;367;367;148;39;39;45	ENSP00000396010:G367V;ENSP00000380602:G367V;ENSP00000413642:G367V;ENSP00000351267:G148V;ENSP00000380600:G39V;ENSP00000392077:G39V;ENSP00000422120:G45V	ENSP00000351267:G148V	G	+	2	0	CNTN4	2919582	1.000000	0.71417	0.966000	0.40874	0.995000	0.86356	9.230000	0.95299	2.802000	0.96397	0.655000	0.94253	GGA		0.363	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2			6	15	1	0	0.00116845	0.001168	0.00123147	6	15				
ATG7	10533	broad.mit.edu	37	3	11600212	11600212	+	IGR	SNP	C	C	G	rs147755206		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr3:11600212C>G	ENST00000354449.3	+	0	4959				VGLL4_ENST00000430365.2_Missense_Mutation_p.V237L|VGLL4_ENST00000273038.3_Missense_Mutation_p.V231L|VGLL4_ENST00000424529.2_Missense_Mutation_p.V147L|VGLL4_ENST00000451674.2_Missense_Mutation_p.V151L|VGLL4_ENST00000404339.1_Missense_Mutation_p.V236L|VGLL4_ENST00000413604.1_Missense_Mutation_p.V172L	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7						adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						GTGATGGACACGGAGTTGGGT	0.627																																							uc003bwf.2		NA																	0				ovary(1)	1						c.(691-693)GTG>CTG		vestigial like 4 isoform b			LEU/VAL,LEU/VAL,LEU/VAL,LEU/VAL	1,4405	2.1+/-5.4	0,1,2202	66.0	78.0	74.0		709,451,439,691	5.3	0.9	3	dbSNP_134	74	0,8600		0,0,4300	no	missense,missense,missense,missense	VGLL4	NM_001128219.1,NM_001128220.1,NM_001128221.1,NM_014667.2	32,32,32,32	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	benign,benign,benign,benign	237/297,151/211,147/207,231/291	11600212	1,13005	2203	4300	6503	SO:0001628	intergenic_variant	9686				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr3:11600212C>G	AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740		3.37:g.11600212C>G			Somatic				VGLL4_uc010hdx.1_Missense_Mutation_p.V237L|VGLL4_uc003bwg.2_Missense_Mutation_p.V236L|VGLL4_uc010hdv.1_Missense_Mutation_p.V147L|VGLL4_uc010hdw.1_Missense_Mutation_p.V151L|VGLL4_uc011aun.1_Missense_Mutation_p.V172L	p.V231L	NM_014667	NP_055482	WXS	Illumina HiSeq	Unspecified	Q14135	VGLL4_HUMAN		LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)	6	1057	-			231					B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	ENST00000354449.3	37	c.691G>C	CCDS2605.1	.	.	.	.	.	.	.	.	.	.	c	24.2	4.500901	0.85176	2.27E-4	0.0	ENSG00000144560	ENST00000273038;ENST00000413604;ENST00000451674;ENST00000424529;ENST00000430365;ENST00000404339	T;T;T	0.49432	0.78;0.83;0.81	5.27	5.27	0.74061	.	0.057660	0.64402	D	0.000002	T	0.64283	0.2584	L	0.50333	1.59	0.58432	D	0.999999	P;D;D;D;D	0.76494	0.682;0.999;0.999;0.999;0.999	B;D;D;D;D	0.81914	0.146;0.995;0.995;0.995;0.995	T	0.61118	-0.7127	10	0.37606	T	0.19	-26.9851	18.8719	0.92319	0.0:1.0:0.0:0.0	.	237;151;147;236;231	G5E9M7;Q14135-6;Q14135-5;G5E9F4;Q14135	.;.;.;.;VGLL4_HUMAN	L	231;172;151;147;237;236	ENSP00000273038:V231L;ENSP00000404251:V237L;ENSP00000384705:V236L	ENSP00000273038:V231L	V	-	1	0	VGLL4	11575212	1.000000	0.71417	0.944000	0.38274	0.842000	0.47809	4.839000	0.62810	2.468000	0.83385	0.558000	0.71614	GTG		0.627	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251951.3	NM_006395		42	63	0	0	0	0.010771	0	42	63				
CAMKV	79012	broad.mit.edu	37	3	49897103	49897103	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr3:49897103C>T	ENST00000477224.1	-	11	1632	c.1154G>A	c.(1153-1155)aGt>aAt	p.S385N	CAMKV_ENST00000467248.1_Missense_Mutation_p.S310N|CAMKV_ENST00000466940.1_Missense_Mutation_p.S311N|CAMKV_ENST00000488336.1_Missense_Mutation_p.S354N|CAMKV_ENST00000296471.7_Missense_Mutation_p.S357N|CAMKV_ENST00000498324.1_5'Flank|CAMKV_ENST00000463537.1_Missense_Mutation_p.V317M			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	385	Ala-rich.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TGGGGTGGCACTACGGTCTGC	0.627																																							uc003cxt.1		NA																	0				ovary(2)|lung(2)|large_intestine(2)|central_nervous_system(1)	7						c.(1153-1155)AGT>AAT		CaM kinase-like vesicle-associated							83.0	84.0	83.0					3																	49897103		2203	4300	6503	SO:0001583	missense	79012					cytoplasmic vesicle membrane|plasma membrane	ATP binding|protein serine/threonine kinase activity	g.chr3:49897103C>T	BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.1154G>A	3.37:g.49897103C>T	ENSP00000419195:p.Ser385Asn		Somatic				CAMKV_uc011bcy.1_Missense_Mutation_p.S310N|CAMKV_uc003cxv.1_Missense_Mutation_p.S357N|CAMKV_uc003cxw.1_Missense_Mutation_p.S217N|CAMKV_uc003cxx.1_Missense_Mutation_p.S217N|CAMKV_uc003cxu.2_Missense_Mutation_p.S354N|CAMKV_uc011bcz.1_Missense_Mutation_p.S317N|CAMKV_uc011bda.1_Missense_Mutation_p.S311N	p.S385N	NM_024046	NP_076951	WXS	Illumina HiSeq	Unspecified	Q8NCB2	CAMKV_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	11	1347	-			385			Ala-rich.		A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Missense_Mutation	SNP	ENST00000477224.1	37	c.1154G>A	CCDS33762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.59|14.59	2.579507|2.579507	0.46006|0.46006	.|.	.|.	ENSG00000164076|ENSG00000164076	ENST00000296471;ENST00000488336;ENST00000477224;ENST00000467248;ENST00000466940|ENST00000463537	T;T;T;T;T|T	0.70045|0.40225	0.4;-0.21;-0.23;-0.45;1.6|1.04	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	0.000000|.	0.49916|.	D|.	0.000129|.	T|T	0.44932|0.44932	0.1317|0.1317	L|L	0.27053|0.27053	0.805|0.805	0.44890|0.44890	D|D	0.997907|0.997907	P;D;P;P;P;P;P|.	0.59357|.	0.808;0.985;0.956;0.956;0.879;0.879;0.808|.	B;P;P;P;B;B;B|.	0.50537|.	0.112;0.643;0.549;0.549;0.304;0.173;0.16|.	T|T	0.37244|0.37244	-0.9714|-0.9714	10|7	0.52906|0.66056	T|D	0.07|0.02	.|.	15.9281|15.9281	0.79635|0.79635	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	311;317;385;310;357;354;385|.	E7ETR1;B4DMF2;B2RDF9;B4DM24;Q8NCB2-2;Q8NCB2-3;Q8NCB2|.	.;.;.;.;.;.;CAMKV_HUMAN|.	N|M	357;354;385;310;311|317	ENSP00000296471:S357N;ENSP00000418809:S354N;ENSP00000419195:S385N;ENSP00000420053:S310N;ENSP00000420724:S311N|ENSP00000417614:V317M	ENSP00000296471:S357N|ENSP00000417614:V317M	S|V	-|-	2|1	0|0	CAMKV|CAMKV	49872107|49872107	0.986000|0.986000	0.35501|0.35501	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	2.806000|2.806000	0.47947|0.47947	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	AGT|GTG		0.627	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350584.4	NM_024046		39	62	0	0	0	0.00623	0	39	62				
CLDND1	56650	broad.mit.edu	37	3	98235667	98235667	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr3:98235667G>C	ENST00000503004.1	-	5	1477	c.598C>G	c.(598-600)Cag>Gag	p.Q200E	CLDND1_ENST00000513287.1_Missense_Mutation_p.Q200E|CLDND1_ENST00000510545.1_Missense_Mutation_p.Q200E|CLDND1_ENST00000437922.1_Missense_Mutation_p.Q223E|CLDND1_ENST00000394181.2_Missense_Mutation_p.Q200E|CLDND1_ENST00000508503.1_5'UTR|CLDND1_ENST00000394185.2_Missense_Mutation_p.Q200E|CLDND1_ENST00000394180.2_Missense_Mutation_p.Q200E|CLDND1_ENST00000502288.1_Intron|CLDND1_ENST00000341181.6_Missense_Mutation_p.Q200E|CLDND1_ENST00000507874.1_Intron|CLDND1_ENST00000511081.1_Missense_Mutation_p.Q105E			Q9NY35	CLDN1_HUMAN	claudin domain containing 1	200						apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	9						TCTAGTTTCTGGTGGAGTAGT	0.448																																							uc003dsp.2		NA																	0				ovary(1)	1						c.(598-600)CAG>GAG		claudin domain containing 1 protein isoform a							130.0	114.0	119.0					3																	98235667		2203	4300	6503	SO:0001583	missense	56650					integral to membrane		g.chr3:98235667G>C	AF116664	CCDS2930.1, CCDS43116.1	3q12.1	2005-12-23	2005-12-23	2005-12-23		ENSG00000080822			1322	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 4"""	C3orf4			Standard	NM_001040181		Approved		uc003dst.3	Q9NY35		ENST00000503004.1:c.598C>G	3.37:g.98235667G>C	ENSP00000421226:p.Gln200Glu		Somatic				CLDND1_uc003dso.2_Intron|CLDND1_uc003dsq.2_Missense_Mutation_p.Q200E|CLDND1_uc003dss.2_Missense_Mutation_p.Q200E|CLDND1_uc003dsr.2_Missense_Mutation_p.Q105E|CLDND1_uc003dst.2_Missense_Mutation_p.Q223E|CLDND1_uc003dsu.2_Missense_Mutation_p.Q200E|CLDND1_uc003dsv.2_Missense_Mutation_p.Q200E	p.Q200E	NM_019895	NP_063948	WXS	Illumina HiSeq	Unspecified	Q9NY35	CLDN1_HUMAN			5	1478	-			200					B3KQR1|D3DN36|F2Z2D9|Q502Y8|Q6UVX2|Q9BUZ9|Q9NZZ5|Q9Y4S9	Missense_Mutation	SNP	ENST00000503004.1	37	c.598C>G	CCDS2930.1	.	.	.	.	.	.	.	.	.	.	G	1.028	-0.682713	0.03353	.	.	ENSG00000080822	ENST00000341181;ENST00000437922;ENST00000394180;ENST00000503004;ENST00000394185;ENST00000394181;ENST00000513873;ENST00000510545;ENST00000511081;ENST00000513287;ENST00000511667;ENST00000513452;ENST00000502299;ENST00000512147;ENST00000508902;ENST00000510541;ENST00000514537	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;1.57	5.93	5.05	0.67936	.	0.375074	0.29822	N	0.011113	T	0.45597	0.1350	N	0.14661	0.345	0.36420	D	0.864254	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.10450	0.005;0.005;0.005	T	0.46359	-0.9197	10	0.23891	T	0.37	-4.9519	14.9294	0.70903	0.0:0.1439:0.8561:0.0	.	200;105;200	D6RCR8;F2Z2D9;Q9NY35	.;.;CLDN1_HUMAN	E	200;223;200;200;200;200;56;200;105;200;178;200;200;85;200;85;200	ENSP00000340247:Q200E;ENSP00000388457:Q223E;ENSP00000377734:Q200E;ENSP00000421226:Q200E;ENSP00000377739:Q200E;ENSP00000377735:Q200E;ENSP00000423590:Q200E;ENSP00000424669:Q105E;ENSP00000426869:Q200E;ENSP00000423732:Q178E;ENSP00000425539:Q200E;ENSP00000420913:Q200E;ENSP00000427119:Q85E;ENSP00000421413:Q200E;ENSP00000424484:Q85E;ENSP00000423151:Q200E	ENSP00000340247:Q200E	Q	-	1	0	CLDND1	99718357	0.997000	0.39634	1.000000	0.80357	0.502000	0.33828	0.765000	0.26546	1.491000	0.48482	-0.176000	0.13171	CAG		0.448	CLDND1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359071.1	NM_019895		17	35	0	0	0	0.006122	0	17	35				
CD200R1	131450	broad.mit.edu	37	3	112643993	112643994	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr3:112643993_112643994GG>TT	ENST00000471858.1	-	5	979_980	c.747_748CC>AA	c.(745-750)atCCtt>atAAtt	p.L250I	CD200R1_ENST00000295863.4_Intron|CD200R1_ENST00000308611.3_Missense_Mutation_p.L273I	NM_170780.2	NP_740750.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	250					regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						ATAATAGTAAGGATGATATATG	0.307																																							uc003dzk.1		NA																	0				ovary(2)|pancreas(1)	3						c.(745-750)ATCCTT>ATAATT		CD200 receptor 1 isoform d																																				SO:0001583	missense	131450				interspecies interaction between organisms|regulation of immune response	extracellular region|integral to membrane|plasma membrane	receptor activity	g.chr3:112643993_112643994GG>TT	AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000471858.1:c.747_748delinsTT	3.37:g.112643993_112643994delinsTT	ENSP00000418928:p.Leu250Ile		Somatic				CD200R1_uc003dzj.1_Missense_Mutation_p.L273I|CD200R1_uc011bhx.1_Intron	p.L250I	NM_170780	NP_740750	WXS	Illumina HiSeq	Unspecified	Q8TD46	MO2R1_HUMAN			5	980_981	-			250			Helical; (Potential).		B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Missense_Mutation	DNP	ENST00000471858.1	37	c.747_748CC>AA	CCDS2970.1																																																																																				0.307	CD200R1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354467.1	NM_138806		10	38	0	0	0	0.004672	0	10	38				
MYLK	4638	broad.mit.edu	37	3	123452802	123452802	+	Silent	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr3:123452802C>T	ENST00000475616.1	-	7	1040	c.1041G>A	c.(1039-1041)ctG>ctA	p.L347L	MYLK_ENST00000359169.1_Silent_p.L347L|MYLK_ENST00000360304.3_Silent_p.L347L|MYLK_ENST00000346322.5_Silent_p.L347L|MYLK_ENST00000360772.3_Silent_p.L347L			Q15746	MYLK_HUMAN	myosin light chain kinase	347					actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TTGCGGCCTGCAGGGTGATGG	0.632																																							uc003ego.2		NA																	0				ovary(6)|skin(2)|stomach(1)	9						c.(1039-1041)CTG>CTA		myosin light chain kinase isoform 1							67.0	74.0	72.0					3																	123452802		2203	4300	6503	SO:0001819	synonymous_variant	4638				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity	g.chr3:123452802C>T	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.1041G>A	3.37:g.123452802C>T			Somatic				MYLK_uc011bjw.1_Silent_p.L347L|MYLK_uc003egp.2_Silent_p.L347L|MYLK_uc003egq.2_Silent_p.L347L|MYLK_uc003egr.2_Silent_p.L347L|MYLK_uc003egs.2_Silent_p.L171L	p.L347L	NM_053025	NP_444253	WXS	Illumina HiSeq	Unspecified	Q15746	MYLK_HUMAN		GBM - Glioblastoma multiforme(114;0.0736)	10	1323	-		Lung NSC(201;0.0496)	347					B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	ENST00000475616.1	37	c.1041G>A	CCDS46896.1																																																																																				0.632	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		36	111	0	0	0	0.01441	0	36	111				
PCOLCE2	26577	broad.mit.edu	37	3	142542444	142542444	+	Silent	SNP	G	G	A	rs374447626		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr3:142542444G>A	ENST00000295992.3	-	7	1185	c.879C>T	c.(877-879)acC>acT	p.T293T	PCOLCE2_ENST00000485766.1_Intron	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	293					positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						ACAAGGCCACGGTGGGTTTTA	0.363																																							uc003evd.2		NA																	0				ovary(2)|skin(1)	3						c.(877-879)ACC>ACT		procollagen C-endopeptidase enhancer 2		G		0,4406		0,0,2203	68.0	73.0	71.0		879	-10.8	0.0	3		71	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	PCOLCE2	NM_013363.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		293/416	142542444	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	26577					extracellular region	collagen binding|heparin binding|peptidase activator activity	g.chr3:142542444G>A	AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.879C>T	3.37:g.142542444G>A			Somatic					p.T293T	NM_013363	NP_037495	WXS	Illumina HiSeq	Unspecified	Q9UKZ9	PCOC2_HUMAN			7	1075	-			293					B2RCH9|D3DNG4|Q9BRH3	Silent	SNP	ENST00000295992.3	37	c.879C>T	CCDS3127.1																																																																																				0.363	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363		24	56	0	0	0	0.00333	0	24	56				
SI	6476	broad.mit.edu	37	3	164766974	164766975	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr3:164766974_164766975CC>AG	ENST00000264382.3	-	15	1717_1718	c.1655_1656GG>CT	c.(1654-1656)tGG>tCT	p.W552S		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	552	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.W552C(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ACTGTTTACCCCAGTTCTGCAC	0.337										HNSCC(35;0.089)																													uc003fei.2		NA																	1	Substitution - Missense(1)		NS(1)	ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(1654-1656)TGG>TCT		sucrase-isomaltase	Acarbose(DB00284)																																			SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164766974_164766975CC>AG	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1655_1656delinsAG	3.37:g.164766974_164766975delinsAG	ENSP00000264382:p.Trp552Ser	HNSCC(35;0.089)	Somatic					p.W552S	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			15	1717_1718	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	552			Lumenal.|Isomaltase.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	DNP	ENST00000264382.3	37	c.1655_1656GG>CT	CCDS3196.1																																																																																				0.337	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		14	55	0	0	0	0.004672	0	14	55				
YEATS2	55689	broad.mit.edu	37	3	183521783	183521783	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr3:183521783A>T	ENST00000305135.5	+	27	3786	c.3591A>T	c.(3589-3591)agA>agT	p.R1197S	AC131160.1_ENST00000401347.1_RNA|YEATS2-AS1_ENST00000425008.3_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	1197					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AGTGGCAAAGAGCAATGACAA	0.403																																							uc003fly.2		NA																	0				ovary(3)|large_intestine(1)	4						c.(3589-3591)AGA>AGT		YEATS domain containing 2							57.0	56.0	56.0					3																	183521783		1887	4119	6006	SO:0001583	missense	55689				histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding	g.chr3:183521783A>T	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3591A>T	3.37:g.183521783A>T	ENSP00000306983:p.Arg1197Ser		Somatic				uc003fma.1_3'UTR	p.R1197S	NM_018023	NP_060493	WXS	Illumina HiSeq	Unspecified	Q9ULM3	YETS2_HUMAN	all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		27	3786	+	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		1197					A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	c.3591A>T	CCDS43175.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.037252	0.75617	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	D	0.86562	-2.14	5.25	4.09	0.47781	.	0.000000	0.64402	D	0.000001	D	0.91805	0.7407	M	0.78637	2.42	0.52501	D	0.999959	D	0.76494	0.999	D	0.78314	0.991	D	0.90842	0.4724	10	0.87932	D	0	-26.5599	7.5208	0.27626	0.7833:0.1424:0.0744:0.0	.	1197	Q9ULM3	YETS2_HUMAN	S	1197	ENSP00000306983:R1197S	ENSP00000306983:R1197S	R	+	3	2	YEATS2	185004477	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.938000	0.40203	0.832000	0.34804	0.533000	0.62120	AGA		0.403	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023		29	63	0	0	0	0.008361	0	29	63				
JAKMIP1	152789	broad.mit.edu	37	4	6107526	6107526	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr4:6107526C>A	ENST00000282924.5	-	3	783	c.298G>T	c.(298-300)Gcg>Tcg	p.A100S	JAKMIP1_ENST00000409021.3_Missense_Mutation_p.A100S|JAKMIP1_ENST00000410077.2_Intron|JAKMIP1_ENST00000409371.3_Intron|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.A100S|JAKMIP1_ENST00000457227.2_Intron	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	100	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GCGGTGCGCGCCGCCTCCTGC	0.682																																							uc003giu.3		NA																	0				large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						c.(298-300)GCG>TCG		janus kinase and microtubule interacting protein							17.0	17.0	17.0					4																	6107526		2174	4254	6428	SO:0001583	missense	152789				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding	g.chr4:6107526C>A	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.298G>T	4.37:g.6107526C>A	ENSP00000282924:p.Ala100Ser		Somatic				JAKMIP1_uc010idb.1_Missense_Mutation_p.A100S|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Missense_Mutation_p.A100S|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Missense_Mutation_p.A100S|JAKMIP1_uc010ide.2_Missense_Mutation_p.A100S	p.A100S	NM_144720	NP_653321	WXS	Illumina HiSeq	Unspecified	Q96N16	JKIP1_HUMAN			3	574	-			100			Potential.|Mediates association with microtubules.		A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	c.298G>T	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	c	19.35	3.810499	0.70797	.	.	ENSG00000152969	ENST00000409021;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831	T;T;T	0.08546	3.08;3.08;3.08	4.44	4.44	0.53790	.	0.000000	0.64402	D	0.000007	T	0.17831	0.0428	L	0.41356	1.27	0.80722	D	1	D;D;D	0.76494	0.999;0.982;0.999	D;P;D	0.80764	0.994;0.765;0.994	T	0.06972	-1.0797	10	0.08381	T	0.77	.	16.4416	0.83903	0.0:1.0:0.0:0.0	.	100;100;100	F2Z2K5;Q96N16-2;Q96N16	.;.;JKIP1_HUMAN	S	100;100;100;39;100;100	ENSP00000386711:A100S;ENSP00000282924:A100S;ENSP00000386925:A100S	ENSP00000282924:A100S	A	-	1	0	JAKMIP1	6158427	0.984000	0.35163	0.995000	0.50966	0.991000	0.79684	2.655000	0.46707	2.162000	0.67917	0.479000	0.44913	GCG		0.682	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720		14	31	1	0	0.000151284	0.001855	0.000160779	14	31				
LIMCH1	22998	broad.mit.edu	37	4	41694357	41694357	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr4:41694357G>A	ENST00000313860.7	+	26	3236	c.3182G>A	c.(3181-3183)cGa>cAa	p.R1061Q	LIMCH1_ENST00000512820.1_Missense_Mutation_p.R1047Q|LIMCH1_ENST00000512632.1_Missense_Mutation_p.R958Q|LIMCH1_ENST00000381753.4_Missense_Mutation_p.R868Q|LIMCH1_ENST00000513024.1_Missense_Mutation_p.R888Q|LIMCH1_ENST00000511496.1_Missense_Mutation_p.R875Q|LIMCH1_ENST00000503057.1_Missense_Mutation_p.R1445Q|LIMCH1_ENST00000514096.1_Missense_Mutation_p.R875Q|LIMCH1_ENST00000512946.1_Missense_Mutation_p.R1035Q|LIMCH1_ENST00000509277.1_Missense_Mutation_p.R894Q|RP11-227F19.5_ENST00000506475.1_RNA|LIMCH1_ENST00000508501.1_Missense_Mutation_p.R1034Q|LIMCH1_ENST00000396595.3_Missense_Mutation_p.R880Q	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	1061	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						GTTAGGATTCGAAATGGTCTC	0.428																																							uc003gvu.3		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(3181-3183)CGA>CAA		LIM and calponin homology domains 1 isoform a							218.0	188.0	198.0					4																	41694357		2203	4300	6503	SO:0001583	missense	22998				actomyosin structure organization		actin binding|zinc ion binding	g.chr4:41694357G>A	AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.3182G>A	4.37:g.41694357G>A	ENSP00000316891:p.Arg1061Gln		Somatic				LIMCH1_uc003gvv.3_Missense_Mutation_p.R1035Q|LIMCH1_uc003gvw.3_Missense_Mutation_p.R1034Q|LIMCH1_uc003gvx.3_Missense_Mutation_p.R1047Q|LIMCH1_uc003gwe.3_Missense_Mutation_p.R958Q|LIMCH1_uc003gvy.3_Missense_Mutation_p.R863Q|LIMCH1_uc003gwa.3_Missense_Mutation_p.R875Q|LIMCH1_uc003gvz.3_Missense_Mutation_p.R1445Q|LIMCH1_uc011byu.1_Missense_Mutation_p.R894Q|LIMCH1_uc003gwc.3_Missense_Mutation_p.R880Q|LIMCH1_uc003gwd.3_Missense_Mutation_p.R868Q|LIMCH1_uc011byv.1_Missense_Mutation_p.R811Q|LIMCH1_uc011byw.1_Missense_Mutation_p.R334Q|LIMCH1_uc010ifv.2_5'Flank	p.R1061Q	NM_014988	NP_055803	WXS	Illumina HiSeq	Unspecified	Q9UPQ0	LIMC1_HUMAN			26	3236	+			1061			LIM zinc-binding.		A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	ENST00000313860.7	37	c.3182G>A	CCDS33977.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.86|18.86	3.713915|3.713915	0.68730|0.68730	.|.	.|.	ENSG00000064042|ENSG00000064042	ENST00000508466|ENST00000513024;ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820;ENST00000503057;ENST00000511496;ENST00000313875;ENST00000514096;ENST00000509277;ENST00000396595;ENST00000381753;ENST00000537405	.|D;D;D;D;D;D;D;D;D;D;D;D	.|0.87809	.|-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	4.99|4.99	4.13|4.13	0.48395|0.48395	.|Zinc finger, LIM-type (4);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.91978|0.91978	0.7459|0.7459	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.999;0.978;1.0;1.0;0.998;1.0;1.0;0.999;0.998;0.999	.|D;D;D;B;D;D;D;D;D;D;D;D	.|0.91635	.|0.997;0.999;0.993;0.442;0.999;0.999;0.991;0.991;0.999;0.995;0.991;0.993	D|D	0.92484|0.92484	0.5995|0.5995	5|10	.|0.87932	.|D	.|0	-9.1187|-9.1187	13.9268|13.9268	0.63968|0.63968	0.075:0.0:0.925:0.0|0.075:0.0:0.925:0.0	.|.	.|875;811;894;958;868;880;1445;888;1047;1034;1035;1061	.|E7EPK0;B7Z3G0;E9PDJ9;D6RD46;Q9UPQ0-9;Q9UPQ0-6;G5EA03;Q9UPQ0-5;Q9UPQ0-4;E9PHM7;Q9UPQ0-2;Q9UPQ0	.|.;.;.;.;.;.;.;.;.;.;.;LIMC1_HUMAN	K|Q	895|888;1034;1035;1061;958;1047;1445;875;1444;875;894;880;868;387	.|ENSP00000425222:R888Q;ENSP00000424825:R1034Q;ENSP00000424645:R1035Q;ENSP00000316891:R1061Q;ENSP00000427045:R958Q;ENSP00000424437:R1047Q;ENSP00000425631:R1445Q;ENSP00000421242:R875Q;ENSP00000426334:R875Q;ENSP00000422864:R894Q;ENSP00000379840:R880Q;ENSP00000371172:R868Q	.|ENSP00000316891:R1061Q	E|R	+|+	1|2	0|0	LIMCH1|LIMCH1	41389114|41389114	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.102000|0.102000	0.19082|0.19082	5.990000|5.990000	0.70595|0.70595	2.590000|2.590000	0.87494|0.87494	0.557000|0.557000	0.71058|0.71058	GAA|CGA		0.428	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	NM_014988		16	64	0	0	0	0.00499	0	16	64				
EXOC1	55763	broad.mit.edu	37	4	56770652	56770652	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr4:56770652G>T	ENST00000381295.2	+	19	3024	c.2676G>T	c.(2674-2676)caG>caT	p.Q892H	EXOC1_ENST00000349598.6_Missense_Mutation_p.Q877H|EXOC1_ENST00000346134.7_Missense_Mutation_p.Q892H	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	892					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					GCATTGCACAGTCCCACTAAA	0.388																																							uc003hbe.1		NA																	0				ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6						c.(2674-2676)CAG>CAT		exocyst complex component 1 isoform 1							141.0	127.0	132.0					4																	56770652		2203	4300	6503	SO:0001583	missense	55763				exocytosis|protein transport	exocyst	protein binding	g.chr4:56770652G>T	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.2676G>T	4.37:g.56770652G>T	ENSP00000370695:p.Gln892His		Somatic				EXOC1_uc003hbf.1_Missense_Mutation_p.Q892H|EXOC1_uc003hbg.1_Missense_Mutation_p.Q877H	p.Q892H	NM_018261	NP_060731	WXS	Illumina HiSeq	Unspecified	Q9NV70	EXOC1_HUMAN			19	2834	+	Glioma(25;0.08)|all_neural(26;0.101)		892					Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	37	c.2676G>T	CCDS3502.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.603802	0.66445	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.26	2.55	0.30701	.	0.000000	0.85682	D	0.000000	T	0.69540	0.3122	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.71870	0.975;0.948	T	0.68697	-0.5340	9	0.52906	T	0.07	.	10.2136	0.43156	0.2817:0.0:0.7183:0.0	.	877;892	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	H	892;892;877	.	ENSP00000326514:Q892H	Q	+	3	2	EXOC1	56465409	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.215000	0.42862	0.589000	0.29677	0.563000	0.77884	CAG		0.388	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261		22	72	1	0	1.10513e-12	0.014323	1.4177e-12	22	72				
GPRIN3	285513	broad.mit.edu	37	4	90170093	90170093	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr4:90170093G>A	ENST00000609438.1	-	2	1687	c.1169C>T	c.(1168-1170)cCa>cTa	p.P390L	GPRIN3_ENST00000333209.4_Missense_Mutation_p.P390L	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	390			P -> S (in dbSNP:rs11733183).							breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		GTGCACCTGTGGCATGATGCC	0.567																																							uc003hsm.1		NA																	0				ovary(3)	3						c.(1168-1170)CCA>CTA		G protein-regulated inducer of neurite outgrowth							75.0	76.0	76.0					4																	90170093		2203	4300	6503	SO:0001583	missense	285513							g.chr4:90170093G>A	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.1169C>T	4.37:g.90170093G>A	ENSP00000476603:p.Pro390Leu		Somatic					p.P390L	NM_198281	NP_938022	WXS	Illumina HiSeq	Unspecified	Q6ZVF9	GRIN3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)	2	1688	-		Hepatocellular(203;0.114)	390					Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	c.1169C>T	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.421006	0.62622	.	.	ENSG00000185477	ENST00000333209	T	0.12879	2.64	5.1	5.1	0.69264	.	0.000000	0.33691	N	0.004659	T	0.11580	0.0282	L	0.32530	0.975	0.18873	N	0.999983	P	0.40431	0.717	B	0.37198	0.243	T	0.19095	-1.0316	10	0.87932	D	0	-7.3872	12.361	0.55203	0.0796:0.0:0.9204:0.0	.	390	Q6ZVF9	GRIN3_HUMAN	L	390	ENSP00000328672:P390L	ENSP00000328672:P390L	P	-	2	0	GPRIN3	90389116	0.825000	0.29262	0.124000	0.21820	0.386000	0.30323	4.008000	0.57103	2.652000	0.90054	0.655000	0.94253	CCA		0.567	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281		38	86	0	0	0	0.005524	0	38	86				
SEC24D	9871	broad.mit.edu	37	4	119718857	119718857	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr4:119718857G>A	ENST00000280551.6	-	8	1260	c.1022C>T	c.(1021-1023)gCc>gTc	p.A341V	SEC24D_ENST00000379735.5_Missense_Mutation_p.A342V|SEC24D_ENST00000419654.2_5'UTR			O94855	SC24D_HUMAN	SEC24 family member D	341					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						AGGAATGGTGGCAAAGGGCTT	0.348																																							uc003ici.3		NA																	0					0						c.(1021-1023)GCC>GTC		Sec24-related protein D							109.0	99.0	102.0					4																	119718857		2203	4300	6503	SO:0001583	missense	9871				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding	g.chr4:119718857G>A	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1022C>T	4.37:g.119718857G>A	ENSP00000280551:p.Ala341Val		Somatic				SEC24D_uc003icj.3_Missense_Mutation_p.A342V|SEC24D_uc003icl.2_RNA|SEC24D_uc010imz.1_RNA|SEC24D_uc011cgg.1_RNA	p.A341V	NM_014822	NP_055637	WXS	Illumina HiSeq	Unspecified	O94855	SC24D_HUMAN			8	1294	-			341					Q8IYI7	Missense_Mutation	SNP	ENST00000280551.6	37	c.1022C>T	CCDS3710.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552076	0.86127	.	.	ENSG00000150961	ENST00000280551;ENST00000379735	T;T	0.28255	1.62;1.62	5.55	4.7	0.59300	.	0.104643	0.64402	D	0.000004	T	0.58495	0.2126	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.973;0.983	T	0.65833	-0.6072	10	0.87932	D	0	-20.9759	13.254	0.60068	0.078:0.0:0.922:0.0	.	342;341	O94855-2;O94855	.;SC24D_HUMAN	V	341;342	ENSP00000280551:A341V;ENSP00000369059:A342V	ENSP00000280551:A341V	A	-	2	0	SEC24D	119938305	1.000000	0.71417	0.966000	0.40874	0.996000	0.88848	7.398000	0.79919	1.343000	0.45638	0.655000	0.94253	GCC		0.348	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4			27	67	0	0	0	0.007291	0	27	67				
FBXW7	55294	broad.mit.edu	37	4	153332619	153332619	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr4:153332619C>A	ENST00000281708.4	-	2	1566	c.337G>T	c.(337-339)Gag>Tag	p.E113*	FBXW7_ENST00000603841.1_Nonsense_Mutation_p.E113*|FBXW7_ENST00000604872.1_Nonsense_Mutation_p.E113*|FBXW7_ENST00000603548.1_Nonsense_Mutation_p.E113*	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	113					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)			NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				tcctcctcctcatcctcctcA	0.423			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																		uc003ims.2		NA		Rec	yes		4	4q31.3	55294	Mis|N|D|F	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""			"""E, L"""			colorectal|endometrial|T-ALL		0				haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308						c.(337-339)GAG>TAG		F-box and WD repeat domain containing 7 isoform							291.0	226.0	248.0					4																	153332619		2203	4300	6503	SO:0001587	stop_gained	55294				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	g.chr4:153332619C>A	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.337G>T	4.37:g.153332619C>A	ENSP00000281708:p.Glu113*		Somatic				FBXW7_uc011cii.1_Nonsense_Mutation_p.E113*|FBXW7_uc003imt.2_Nonsense_Mutation_p.E113*|FBXW7_uc003imu.2_Nonsense_Mutation_p.E113*	p.E113*	NM_033632	NP_361014	WXS	Illumina HiSeq	Unspecified	Q969H0	FBXW7_HUMAN			2	486	-	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)	113					B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Nonsense_Mutation	SNP	ENST00000281708.4	37	c.337G>T	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688114	0.68271	.	.	ENSG00000109670	ENST00000281708	.	.	.	5.33	5.33	0.75918	.	0.162636	0.38005	N	0.001854	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	0.261	19.0346	0.92971	0.0:1.0:0.0:0.0	.	.	.	.	X	113	.	ENSP00000281708:E113X	E	-	1	0	FBXW7	153552069	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.677000	0.74503	2.504000	0.84457	0.650000	0.86243	GAG		0.423	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1			20	70	1	0	4.96729e-08	0.008871	5.89576e-08	20	70				
SLC12A7	10723	broad.mit.edu	37	5	1065452	1065452	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:1065452A>T	ENST00000264930.5	-	18	2426	c.2383T>A	c.(2383-2385)Tgg>Agg	p.W795R	MIR4635_ENST00000583759.1_RNA	NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	795					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GATGCGGGCCAGGCCATGAGC	0.657																																							uc003jbu.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(2383-2385)TGG>AGG		solute carrier family 12 (potassium/chloride	Potassium Chloride(DB00761)						66.0	66.0	66.0					5																	1065452		2203	4300	6503	SO:0001583	missense	10723				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity	g.chr5:1065452A>T	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.2383T>A	5.37:g.1065452A>T	ENSP00000264930:p.Trp795Arg		Somatic					p.W795R	NM_006598	NP_006589	WXS	Illumina HiSeq	Unspecified	Q9Y666	S12A7_HUMAN	Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		18	2449	-	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		795					A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	c.2383T>A	CCDS34129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	19.78|19.78	3.890691|3.890691	0.72524|0.72524	.|.	.|.	ENSG00000113504|ENSG00000113504	ENST00000513223|ENST00000264930	.|D	.|0.95171	.|-3.63	4.49|4.49	4.49|4.49	0.54785|0.54785	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97663|0.97663	0.9234|0.9234	M|M	0.93550|0.93550	3.43|3.43	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.72338	.|0.977	D|D	0.98415|0.98415	1.0574|1.0574	5|10	.|0.87932	.|D	.|0	.|.	12.5865|12.5865	0.56421|0.56421	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|795	.|Q9Y666	.|S12A7_HUMAN	Q|R	152|795	.|ENSP00000264930:W795R	.|ENSP00000264930:W795R	L|W	-|-	2|1	0|0	SLC12A7|SLC12A7	1118452|1118452	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.819000|0.819000	0.46315|0.46315	8.167000|8.167000	0.89668|0.89668	1.669000|1.669000	0.50854|0.50854	0.383000|0.383000	0.25322|0.25322	CTG|TGG		0.657	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598		24	57	0	0	0	0.014323	0	24	57				
DNAH5	1767	broad.mit.edu	37	5	13701495	13701495	+	Silent	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:13701495T>C	ENST00000265104.4	-	77	13493	c.13389A>G	c.(13387-13389)gaA>gaG	p.E4463E		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4463					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGCTGTTTCTTTCTATAAGTT	0.398									Kartagener syndrome																														uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(13387-13389)GAA>GAG		dynein, axonemal, heavy chain 5							83.0	91.0	89.0					5																	13701495		2203	4300	6503	SO:0001819	synonymous_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13701495T>C	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13389A>G	5.37:g.13701495T>C			Somatic				DNAH5_uc003jfc.2_Silent_p.E631E	p.E4463E	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			77	13431	-	Lung NSC(4;0.00476)		4463					Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	c.13389A>G	CCDS3882.1																																																																																				0.398	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		12	113	0	0	0	0.007413	0	12	113				
MAP1B	4131	broad.mit.edu	37	5	71493280	71493280	+	Silent	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:71493280T>C	ENST00000296755.7	+	5	4396	c.4098T>C	c.(4096-4098)agT>agC	p.S1366S		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1366					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TTGAATTCAGTGATGCCAAAG	0.443																																					Melanoma(17;367 822 11631 31730 47712)	Melanoma(17;367 822 11631 31730 47712)	uc003kbw.3		NA																	0				large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5						c.(4096-4098)AGT>AGC		microtubule-associated protein 1B							80.0	83.0	82.0					5																	71493280		2203	4300	6503	SO:0001819	synonymous_variant	4131					microtubule|microtubule associated complex	structural molecule activity	g.chr5:71493280T>C	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4098T>C	5.37:g.71493280T>C			Somatic				MAP1B_uc010iyw.1_Silent_p.S1383S|MAP1B_uc010iyx.1_Silent_p.S1240S|MAP1B_uc010iyy.1_Silent_p.S1240S	p.S1366S	NM_005909	NP_005900	WXS	Illumina HiSeq	Unspecified	P46821	MAP1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)	5	4339	+		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)	1366					A2BDK5	Silent	SNP	ENST00000296755.7	37	c.4098T>C	CCDS4012.1																																																																																				0.443	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909		21	61	0	0	0	0.004656	0	21	61				
POLR3G	10622	broad.mit.edu	37	5	89783891	89783891	+	Missense_Mutation	SNP	G	G	C	rs376243020	byFrequency	TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:89783891G>C	ENST00000399107.1	+	3	392	c.192G>C	c.(190-192)ttG>ttC	p.L64F	POLR3G_ENST00000504930.1_Missense_Mutation_p.L64F|POLR3G_ENST00000514483.1_Missense_Mutation_p.L64F	NM_006467.2	NP_006458.2	O15318	RPC7_HUMAN	polymerase (RNA) III (DNA directed) polypeptide G (32kD)	64					cell proliferation (GO:0008283)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	DNA-directed RNA polymerase activity (GO:0003899)			cervix(1)|endometrium(1)|kidney(2)|lung(4)|prostate(1)	9		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)		AACAGGAGTTGAGAGAAACAA	0.338																																							uc003kjq.2		NA																	0					0						c.(190-192)TTG>TTC		polymerase (RNA) III (DNA directed) polypeptide							108.0	99.0	102.0					5																	89783891		1833	4093	5926	SO:0001583	missense	10622				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA-directed RNA polymerase activity	g.chr5:89783891G>C	U93868	CCDS43337.1	5q14.3	2014-06-05			ENSG00000113356	ENSG00000113356		"""RNA polymerase subunits"""	30075	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006467		Approved	RPC32, RPC7	uc003kjq.3	O15318	OTTHUMG00000162809	ENST00000399107.1:c.192G>C	5.37:g.89783891G>C	ENSP00000382058:p.Leu64Phe		Somatic				POLR3G_uc011cuc.1_Missense_Mutation_p.L64F	p.L64F	NM_006467	NP_006458	WXS	Illumina HiSeq	Unspecified	O15318	RPC7_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)	3	392	+		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)	64					A8MTH0	Missense_Mutation	SNP	ENST00000399107.1	37	c.192G>C	CCDS43337.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.517826	0.27211	.	.	ENSG00000113356	ENST00000505345;ENST00000503373;ENST00000503973;ENST00000399107;ENST00000504930;ENST00000514483	.	.	.	5.7	3.73	0.42828	.	0.301244	0.34002	N	0.004350	T	0.30759	0.0775	N	0.04994	-0.135	0.36544	D	0.871465	B	0.22346	0.068	B	0.28011	0.085	T	0.23476	-1.0187	9	0.16896	T	0.51	-16.842	12.563	0.56293	0.0:0.0:0.658:0.3419	.	64	O15318	RPC7_HUMAN	F	64	.	ENSP00000382058:L64F	L	+	3	2	POLR3G	89819647	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.237000	0.32695	1.392000	0.46585	0.655000	0.94253	TTG		0.338	POLR3G-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370462.1	NM_006467		15	72	0	0	0	0.004007	0	15	72				
TTC37	9652	broad.mit.edu	37	5	94860190	94860190	+	Silent	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:94860190C>T	ENST00000358746.2	-	16	1729	c.1431G>A	c.(1429-1431)aaG>aaA	p.K477K		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	477						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						GGGTAAGAGCCTTTGTTTTAT	0.333																																							uc003klb.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1429-1431)AAG>AAA		tetratricopeptide repeat domain 37							135.0	137.0	136.0					5																	94860190		2203	4300	6503	SO:0001819	synonymous_variant	9652						binding	g.chr5:94860190C>T	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.1431G>A	5.37:g.94860190C>T			Somatic				TTC37_uc010jbf.1_Silent_p.K429K	p.K477K	NM_014639	NP_055454	WXS	Illumina HiSeq	Unspecified	Q6PGP7	TTC37_HUMAN			16	1701	-			477			TPR 7.		O15077|Q6PJI3	Silent	SNP	ENST00000358746.2	37	c.1431G>A	CCDS4072.1																																																																																				0.333	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639		12	51	0	0	0	0.010729	0	12	51				
CHSY3	337876	broad.mit.edu	37	5	129520888	129520888	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:129520888G>A	ENST00000305031.4	+	3	2411	c.2053G>A	c.(2053-2055)Gaa>Aaa	p.E685K		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	685					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		CCCCAAAGCAGAAATGACCCT	0.438																																							uc003kvd.2		NA																	0				ovary(2)|pancreas(1)	3						c.(2053-2055)GAA>AAA		chondroitin sulfate synthase 3							74.0	69.0	71.0					5																	129520888		2203	4300	6503	SO:0001583	missense	337876					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity	g.chr5:129520888G>A	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.2053G>A	5.37:g.129520888G>A	ENSP00000302629:p.Glu685Lys		Somatic					p.E685K	NM_175856	NP_787052	WXS	Illumina HiSeq	Unspecified	Q70JA7	CHSS3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)	3	2053	+		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	685			Lumenal (Potential).		B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	37	c.2053G>A	CCDS34223.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933203	0.52866	.	.	ENSG00000198108	ENST00000305031	T	0.15487	2.42	4.23	4.23	0.50019	.	0.219188	0.31566	N	0.007435	T	0.11452	0.0279	N	0.11927	0.2	0.58432	D	0.999998	B	0.20459	0.045	B	0.25759	0.063	T	0.16748	-1.0392	9	.	.	.	-2.8772	17.931	0.88998	0.0:0.0:1.0:0.0	.	685	Q70JA7	CHSS3_HUMAN	K	685	ENSP00000302629:E685K	.	E	+	1	0	CHSY3	129548787	1.000000	0.71417	0.985000	0.45067	0.951000	0.60555	9.601000	0.98297	2.630000	0.89119	0.650000	0.86243	GAA		0.438	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856		20	53	0	0	0	0.007413	0	20	53				
NRG2	9542	broad.mit.edu	37	5	139260463	139260463	+	Silent	SNP	C	C	A	rs111392314		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:139260463C>A	ENST00000361474.1	-	3	1193	c.969G>T	c.(967-969)cgG>cgT	p.R323R	NRG2_ENST00000518130.1_5'UTR|NRG2_ENST00000289409.4_Silent_p.R323R|NRG2_ENST00000394770.1_Silent_p.R323R|NRG2_ENST00000541337.1_Silent_p.R323R|NRG2_ENST00000289422.7_Silent_p.R323R|NRG2_ENST00000545385.1_Silent_p.R323R|NRG2_ENST00000340391.3_Silent_p.R120R|NRG2_ENST00000358522.3_Silent_p.R323R	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	323	Ig-like C2-type.				embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAGCCGGCCCCGGACGGTGT	0.637																																							uc003lex.1		NA																	0		p.R323W(1)		pancreas(2)|breast(2)|ovary(1)|skin(1)	6						c.(967-969)CGG>CGT		neuregulin 2 isoform 1							85.0	84.0	84.0					5																	139260463		2203	4300	6503	SO:0001819	synonymous_variant	9542				embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity	g.chr5:139260463C>A		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.969G>T	5.37:g.139260463C>A			Somatic				NRG2_uc003lev.1_Silent_p.R323R|NRG2_uc003lew.1_Silent_p.R323R|NRG2_uc003ley.1_Silent_p.R323R	p.R323R	NM_004883	NP_004874	WXS	Illumina HiSeq	Unspecified	O14511	NRG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		3	1194	-			323			Ig-like C2-type.|Extracellular (Potential).			Silent	SNP	ENST00000361474.1	37	c.969G>T	CCDS4217.1																																																																																				0.637	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982		26	55	1	0	1.66031e-10	0.003954	2.05716e-10	26	55				
PCDHA4	56144	broad.mit.edu	37	5	140188457	140188457	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:140188457C>T	ENST00000530339.1	+	1	1685	c.1685C>T	c.(1684-1686)gCg>gTg	p.A562V	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.A562V|PCDHA4_ENST00000512229.2_Missense_Mutation_p.A562V	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	562	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGACAACGCGCCAGCACTG	0.672																																							uc003lhi.2		NA																	0				ovary(4)|skin(2)	6						c.(1684-1686)GCG>GTG		protocadherin alpha 4 isoform 1 precursor							75.0	74.0	75.0					5																	140188457		2203	4298	6501	SO:0001583	missense	56144				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140188457C>T	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1685C>T	5.37:g.140188457C>T	ENSP00000435300:p.Ala562Val		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.A562V|PCDHA4_uc011daa.1_Missense_Mutation_p.A562V	p.A562V	NM_018907	NP_061730	WXS	Illumina HiSeq	Unspecified	Q9UN74	PCDA4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1786	+			562			Cadherin 5.|Extracellular (Potential).		O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	c.1685C>T	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	c	9.723	1.160265	0.21454	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.42513	0.97;0.97;0.97	4.22	2.43	0.29744	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.32328	U	0.006252	T	0.39545	0.1082	M	0.74467	2.265	0.25824	N	0.984254	P;P;P	0.37824	0.491;0.466;0.609	B;B;B	0.33846	0.171;0.082;0.152	T	0.31336	-0.9947	10	0.52906	T	0.07	.	10.1347	0.42699	0.0:0.8318:0.0:0.1682	.	562;562;562	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	V	562	ENSP00000423470:A562V;ENSP00000349344:A562V;ENSP00000435300:A562V	ENSP00000349344:A562V	A	+	2	0	PCDHA4	140168641	0.005000	0.15991	0.832000	0.32986	0.089000	0.18198	1.797000	0.38804	0.374000	0.24650	-0.224000	0.12420	GCG		0.672	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		27	62	0	0	0	0.004656	0	27	62				
PCDHB16	57717	broad.mit.edu	37	5	140563835	140563835	+	Silent	SNP	C	C	T	rs370851835	byFrequency	TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:140563835C>T	ENST00000361016.2	+	1	2856	c.1701C>T	c.(1699-1701)aaC>aaT	p.N567N		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	567					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCTGCAGAACGGCTCCGCGC	0.711													C|||	4	0.000798722	0.0008	0.0	5008	,	,		13955	0.0		0.002	False		,,,				2504	0.001						uc003liv.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1699-1701)AAC>AAT		protocadherin beta 16 precursor		C		2,3930		0,2,1964	14.0	17.0	16.0		1701	3.0	1.0	5		16	0,7806		0,0,3903	no	coding-synonymous	PCDHB16	NM_020957.1		0,2,5867	TT,TC,CC		0.0,0.0509,0.017		567/777	140563835	2,11736	1966	3903	5869	SO:0001819	synonymous_variant	57717				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140563835C>T	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1701C>T	5.37:g.140563835C>T			Somatic					p.N567N	NM_020957	NP_066008	WXS	Illumina HiSeq	Unspecified	Q9NRJ7	PCDBG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2856	+			567			Extracellular (Potential).		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	c.1701C>T	CCDS4251.1																																																																																				0.711	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		4	60	0	0	0	0.009096	0	4	60				
PCDHB13	56123	broad.mit.edu	37	5	140594323	140594323	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:140594323A>T	ENST00000341948.4	+	1	815	c.628A>T	c.(628-630)Agg>Tgg	p.R210W		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	210	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCTGAGCTCAGGTTAACACT	0.547																																							uc003lja.1		NA																	0				skin(2)|ovary(1)	3						c.(628-630)AGG>TGG		protocadherin beta 13 precursor							66.0	71.0	69.0					5																	140594323		2203	4295	6498	SO:0001583	missense	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140594323A>T	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.628A>T	5.37:g.140594323A>T	ENSP00000345491:p.Arg210Trp		Somatic					p.R210W	NM_018933	NP_061756	WXS	Illumina HiSeq	Unspecified	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	815	+			210			Cadherin 2.|Extracellular (Potential).		A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	c.628A>T	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	a	11.18	1.563569	0.27915	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.01787	4.64	3.51	0.636	0.17729	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.03220	0.0094	M	0.87971	2.92	0.09310	N	1	B	0.12630	0.006	B	0.16722	0.016	T	0.46005	-0.9222	9	0.56958	D	0.05	.	0.1522	0.00094	0.3401:0.2174:0.2304:0.2122	.	210	Q9Y5F0	PCDBD_HUMAN	W	210	ENSP00000345491:R210W	ENSP00000345491:R210W	R	+	1	2	PCDHB13	140574507	0.000000	0.05858	0.004000	0.12327	0.103000	0.19146	-1.596000	0.02091	0.347000	0.23924	-1.038000	0.02383	AGG		0.547	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		7	57	0	0	0	0.00308	0	7	57				
PCDHGB6	56100	broad.mit.edu	37	5	140788211	140788211	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:140788211G>T	ENST00000520790.1	+	1	442	c.442G>T	c.(442-444)Gct>Tct	p.A148S	PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	148	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTGCATCCGCTGGTACACG	0.333																																							uc003lkj.1		NA																	0					0						c.(442-444)GCT>TCT		protocadherin gamma subfamily B, 6 isoform 1							68.0	67.0	67.0					5																	140788211		1836	4101	5937	SO:0001583	missense	56100				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140788211G>T	AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.442G>T	5.37:g.140788211G>T	ENSP00000428603:p.Ala148Ser		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Missense_Mutation_p.A148S	p.A148S	NM_018926	NP_061749	WXS	Illumina HiSeq	Unspecified	Q9Y5F9	PCDGI_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	442	+			148			Extracellular (Potential).|Cadherin 2.		Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	37	c.442G>T	CCDS54929.1	.	.	.	.	.	.	.	.	.	.	g	11.92	1.783265	0.31593	.	.	ENSG00000253305	ENST00000520790	T	0.20598	2.06	5.16	-8.96	0.00761	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.08714	0.0216	N	0.11427	0.14	0.09310	N	1	B;B	0.13145	0.007;0.006	B;B	0.20184	0.026;0.028	T	0.41770	-0.9490	9	0.56958	D	0.05	.	6.4027	0.21648	0.2771:0.514:0.134:0.0749	.	148;148	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	S	148	ENSP00000428603:A148S	ENSP00000428603:A148S	A	+	1	0	PCDHGB6	140768395	0.000000	0.05858	0.000000	0.03702	0.919000	0.55068	-0.901000	0.04093	-1.591000	0.01621	-0.373000	0.07131	GCT		0.333	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926		11	44	1	0	9.05144e-12	0.001855	1.14381e-11	11	44				
PCDHGA11	56105	broad.mit.edu	37	5	140802012	140802012	+	Silent	SNP	A	A	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:140802012A>T	ENST00000398587.2	+	1	1251	c.1218A>T	c.(1216-1218)atA>atT	p.I406I	PCDHGB6_ENST00000520790.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Silent_p.I406I|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	406	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAAATTGATAACAAGCAGAG	0.413																																							uc003lkq.1		NA																	0					0						c.(1216-1218)ATA>ATT		protocadherin gamma subfamily A, 11 isoform 1							68.0	69.0	69.0					5																	140802012		1888	4112	6000	SO:0001819	synonymous_variant	56105				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140802012A>T	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1218A>T	5.37:g.140802012A>T			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Silent_p.I406I|PCDHGA11_uc003lkp.1_Silent_p.I406I	p.I406I	NM_018914	NP_061737	WXS	Illumina HiSeq	Unspecified	Q9Y5H2	PCDGB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1476	+			406			Extracellular (Potential).|Cadherin 4.		B7ZVY8|Q9Y5D8|Q9Y5D9	Silent	SNP	ENST00000398587.2	37	c.1218A>T	CCDS47294.1																																																																																				0.413	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914		11	67	0	0	0	0.008291	0	11	67				
PCDHGC4	56098	broad.mit.edu	37	5	140865903	140865903	+	Missense_Mutation	SNP	G	G	A	rs534793835	byFrequency	TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:140865903G>A	ENST00000306593.1	+	1	1163	c.1163G>A	c.(1162-1164)cGc>cAc	p.R388H	PCDHGB6_ENST00000520790.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGC5_ENST00000252087.1_5'Flank|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	388	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGAGCCTCCGCATTCCTGAC	0.557													G|||	3	0.000599042	0.0023	0.0	5008	,	,		19248	0.0		0.0	False		,,,				2504	0.0						uc003lky.1		NA																	0				ovary(4)	4						c.(1162-1164)CGC>CAC		protocadherin gamma subfamily C, 4 isoform 1							118.0	96.0	103.0					5																	140865903		2203	4300	6503	SO:0001583	missense	56098				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140865903G>A	AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.1163G>A	5.37:g.140865903G>A	ENSP00000306918:p.Arg388His		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc011dbb.1_Missense_Mutation_p.R388H|PCDHGC5_uc011dbc.1_5'Flank|PCDHGC5_uc003lla.1_5'Flank	p.R388H	NM_018928	NP_061751	WXS	Illumina HiSeq	Unspecified	Q9Y5F7	PCDGL_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1163	+			388			Cadherin 4.|Extracellular (Potential).		Q495T2|Q9Y5C3	Missense_Mutation	SNP	ENST00000306593.1	37	c.1163G>A	CCDS4262.1	.	.	.	.	.	.	.	.	.	.	G	9.629	1.135819	0.21123	.	.	ENSG00000242419	ENST00000306593	T	0.01787	4.64	5.01	5.01	0.66863	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01730	0.0055	L	0.28344	0.845	0.30795	N	0.740499	B;B	0.24317	0.101;0.025	B;B	0.25140	0.057;0.058	T	0.20306	-1.0279	9	0.41790	T	0.15	.	6.3766	0.21511	0.2177:0.0:0.7823:0.0	.	388;388	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	H	388	ENSP00000306918:R388H	ENSP00000306918:R388H	R	+	2	0	PCDHGC4	140846087	0.002000	0.14202	0.983000	0.44433	0.680000	0.39746	1.512000	0.35812	2.597000	0.87782	0.563000	0.77884	CGC		0.557	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928		15	46	0	0	0	0.003163	0	15	46				
GLRA1	2741	broad.mit.edu	37	5	151208514	151208514	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:151208514G>T	ENST00000455880.2	-	8	1313	c.1027C>A	c.(1027-1029)Ctc>Atc	p.L343I	GLRA1_ENST00000545569.1_Missense_Mutation_p.L260I|GLRA1_ENST00000274576.4_Missense_Mutation_p.L343I			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	343					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CTGAATCGGAGCAGCTCCTTA	0.473																																							uc003lut.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1027-1029)CTC>ATC		glycine receptor, alpha 1 isoform 1 precursor	Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						155.0	150.0	152.0					5																	151208514		2203	4300	6503	SO:0001583	missense	2741				muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity	g.chr5:151208514G>T		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.1027C>A	5.37:g.151208514G>T	ENSP00000411593:p.Leu343Ile		Somatic				GLRA1_uc003lur.2_Missense_Mutation_p.L343I|GLRA1_uc003lus.2_Missense_Mutation_p.L260I	p.L343I	NM_001146040	NP_001139512	WXS	Illumina HiSeq	Unspecified	P23415	GLRA1_HUMAN	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		8	1314	-		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	343			Cytoplasmic (Probable).		B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	37	c.1027C>A	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784387	0.49997	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	D;D;D	0.86694	-2.16;-1.77;-2.16	5.07	5.07	0.68467	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.31210	U	0.008046	T	0.82213	0.4988	N	0.25245	0.725	0.52501	D	0.999957	B;B;B	0.23540	0.028;0.087;0.006	B;B;B	0.30782	0.084;0.12;0.05	T	0.77542	-0.2549	10	0.35671	T	0.21	.	18.826	0.92119	0.0:0.0:1.0:0.0	.	343;260;343	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	I	343;343;260	ENSP00000274576:L343I;ENSP00000411593:L343I;ENSP00000445913:L260I	ENSP00000274576:L343I	L	-	1	0	GLRA1	151188707	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.326000	0.65875	2.524000	0.85096	0.650000	0.86243	CTC		0.473	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1			62	147	1	0	8.81991e-31	0.01441	1.25154e-30	62	147				
KIF4B	285643	broad.mit.edu	37	5	154394386	154394386	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr5:154394386A>G	ENST00000435029.4	+	1	1127	c.967A>G	c.(967-969)Aca>Gca	p.T323A		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	323	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCTAGAGGAAACATTAAGTAC	0.413																																							uc010jih.1		NA																	0				ovary(1)	1						c.(967-969)ACA>GCA		kinesin family member 4B							209.0	209.0	209.0					5																	154394386		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154394386A>G	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.967A>G	5.37:g.154394386A>G	ENSP00000387875:p.Thr323Ala		Somatic					p.T323A	NM_001099293	NP_001092763	WXS	Illumina HiSeq	Unspecified	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	1127	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	323			Kinesin-motor.			Missense_Mutation	SNP	ENST00000435029.4	37	c.967A>G	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	a	15.33	2.802521	0.50315	.	.	ENSG00000226650	ENST00000435029	D	0.83250	-1.7	1.48	1.48	0.22813	Kinesin, motor domain (3);	.	.	.	.	D	0.92004	0.7467	H	0.96833	3.89	0.80722	D	1	D	0.60575	0.988	D	0.65573	0.936	D	0.90772	0.4673	9	0.87932	D	0	.	6.9936	0.24769	1.0:0.0:0.0:0.0	.	323	Q2VIQ3	KIF4B_HUMAN	A	323	ENSP00000387875:T323A	ENSP00000387875:T323A	T	+	1	0	KIF4B	154374579	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	4.574000	0.60900	0.939000	0.37446	0.460000	0.39030	ACA		0.413	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			42	209	0	0	0	0.010771	0	42	209				
HIST1H3G	8355	broad.mit.edu	37	6	26271216	26271216	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr6:26271216C>A	ENST00000305910.3	-	1	396	c.397G>T	c.(397-399)Ggg>Tgg	p.G133W	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	133					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						GCTCTCTCCCCACGAATGCGG	0.493																																							uc003nhi.2		NA																	0					0						c.(397-399)GGG>TGG		H3 histone family, member H							65.0	68.0	67.0					6																	26271216		2203	4300	6503	SO:0001583	missense	8355				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26271216C>A	Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.397G>T	6.37:g.26271216C>A	ENSP00000439660:p.Gly133Trp		Somatic				uc003nhj.2_5'Flank|HIST1H2BI_uc003nhk.2_5'Flank	p.G133W	NM_003534	NP_003525	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	397	-			133					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000305910.3	37	c.397G>T	CCDS4602.1	.	.	.	.	.	.	.	.	.	.	.	17.41	3.382769	0.61845	.	.	ENSG00000256018	ENST00000305910	T	0.50548	0.74	4.42	4.42	0.53409	.	.	.	.	.	T	0.57917	0.2086	.	.	.	0.44477	D	0.997413	.	.	.	.	.	.	T	0.65220	-0.6221	6	0.87932	D	0	.	16.4001	0.83637	0.0:1.0:0.0:0.0	.	.	.	.	W	133	ENSP00000439660:G133W	ENSP00000439660:G133W	G	-	1	0	HIST1H3G	26379195	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.588000	0.82629	2.183000	0.69458	0.563000	0.77884	GGG		0.493	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040099.2	NM_003534		17	69	1	0	5.03518e-11	0.007413	6.2693e-11	17	69				
TRIM27	5987	broad.mit.edu	37	6	28872087	28872087	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr6:28872087C>A	ENST00000377199.3	-	8	1658	c.1302G>T	c.(1300-1302)caG>caT	p.Q434H	TRIM27_ENST00000377194.3_Intron	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	434	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						TCCCCACCCGCTGGAGCGGGG	0.532			T	RET	papillary thyroid																																		uc003nlr.2		NA		Dom	yes		6	6p22	5987	T	tripartite motif-containing 27			E	RET		papillary thyroid		0				ovary(1)	1						c.(1300-1302)CAG>CAT		ret finger protein							92.0	108.0	102.0					6																	28872087		1511	2709	4220	SO:0001583	missense	5987				cell proliferation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|protein trimerization|spermatogenesis|transcription, DNA-dependent	cytoplasm|integral to plasma membrane|membrane fraction|nuclear membrane|PML body	DNA binding|protein binding|transmembrane receptor protein tyrosine kinase activity|zinc ion binding	g.chr6:28872087C>A	Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.1302G>T	6.37:g.28872087C>A	ENSP00000366404:p.Gln434His		Somatic				TRIM27_uc003nls.2_Intron|TRIM27_uc003nlt.1_3'UTR	p.Q434H	NM_006510	NP_006501	WXS	Illumina HiSeq	Unspecified	P14373	TRI27_HUMAN			8	1661	-			434			B30.2/SPRY.		A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Missense_Mutation	SNP	ENST00000377199.3	37	c.1302G>T	CCDS4654.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.89|11.89	1.774036|1.774036	0.31411|0.31411	.|.	.|.	ENSG00000204713|ENSG00000204713	ENST00000414543|ENST00000377199	.|T	.|0.69435	.|-0.4	4.9|4.9	4.01|4.01	0.46588|0.46588	.|Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.|0.000000	.|0.50627	.|D	.|0.000101	T|T	0.44726|0.44726	0.1307|0.1307	N|N	0.03948|0.03948	-0.315|-0.315	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.68483	.|0.958	T|T	0.58589|0.58589	-0.7610|-0.7610	5|10	.|0.56958	.|D	.|0.05	.|.	5.9245|5.9245	0.19101|0.19101	0.189:0.7065:0.0:0.1045|0.189:0.7065:0.0:0.1045	.|.	.|434	.|P14373	.|TRI27_HUMAN	S|H	169|434	.|ENSP00000366404:Q434H	.|ENSP00000366404:Q434H	A|Q	-|-	1|3	0|2	TRIM27|TRIM27	28980066|28980066	0.000000|0.000000	0.05858|0.05858	1.000000|1.000000	0.80357|0.80357	0.575000|0.575000	0.36095|0.36095	-0.262000|-0.262000	0.08682|0.08682	1.330000|1.330000	0.45394|0.45394	0.655000|0.655000	0.94253|0.94253	GCG|CAG		0.532	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076442.2	NM_030950		44	112	1	0	5.37117e-13	0.01441	6.92527e-13	44	112				
CYB5R4	51167	broad.mit.edu	37	6	84630848	84630848	+	Silent	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr6:84630848T>C	ENST00000369681.5	+	8	752	c.612T>C	c.(610-612)ttT>ttC	p.F204F		NM_016230.3	NP_057314.2	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	204	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				cell development (GO:0048468)|detection of oxygen (GO:0003032)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NAD(P)H oxidase activity (GO:0016174)|NADPH-hemoprotein reductase activity (GO:0003958)|oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor (GO:0016653)			breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	23		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		ATGATTCCTTTAGAGCAGAAA	0.274																																					Esophageal Squamous(86;1289 1332 25971 40349 52675)	Esophageal Squamous(86;1289 1332 25971 40349 52675)	uc003pkf.2		NA																	0				breast(2)	2						c.(610-612)TTT>TTC		cytochrome b5 reductase 4							35.0	38.0	37.0					6																	84630848		2173	4282	6455	SO:0001819	synonymous_variant	51167				cell development|detection of oxygen|generation of precursor metabolites and energy|glucose homeostasis|insulin secretion|response to antibiotic|superoxide metabolic process	endoplasmic reticulum|perinuclear region of cytoplasm	cytochrome-b5 reductase activity|heme binding|NAD(P)H oxidase activity	g.chr6:84630848T>C	AF169803	CCDS5000.2	6q14.2	2012-09-19		2005-07-13	ENSG00000065615	ENSG00000065615	1.6.2.2		20147	protein-coding gene	gene with protein product		608343	"""NADPH cytochrome B5 oxidoreductase"""	NCB5OR		10611283	Standard	NM_016230		Approved	b5+b5R, dJ676J13.1	uc003pkf.3	Q7L1T6	OTTHUMG00000015118	ENST00000369681.5:c.612T>C	6.37:g.84630848T>C			Somatic					p.F204F	NM_016230	NP_057314	WXS	Illumina HiSeq	Unspecified	Q7L1T6	NB5R4_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0871)	8	744	+		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)	204			CS.		B1AEM2|Q5TGI9|Q9NUE4|Q9UHI9	Silent	SNP	ENST00000369681.5	37	c.612T>C	CCDS5000.2																																																																																				0.274	CYB5R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041362.4	NM_016230		11	12	0	0	0	0.010729	0	11	12				
AK9	221264	broad.mit.edu	37	6	109871392	109871392	+	Silent	SNP	G	G	A	rs138836954		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr6:109871392G>A	ENST00000424296.2	-	25	2941	c.2865C>T	c.(2863-2865)gcC>gcT	p.A955A	AK9_ENST00000341338.6_Silent_p.A34A|AK9_ENST00000355283.1_Silent_p.A34A	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	955					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										CTCGATACTTGGCTGCTTCTT	0.428																																							uc003ptn.2		NA																	0				ovary(1)	1						c.(2863-2865)GCC>GCT		adenylate kinase domain containing 1 isoform 1		G		1,4405	2.1+/-5.4	0,1,2202	165.0	162.0	163.0		2865	1.5	1.0	6	dbSNP_134	163	0,8600		0,0,4300	no	coding-synonymous	AKD1	NM_001145128.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		955/1912	109871392	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	221264				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity	g.chr6:109871392G>A	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.2865C>T	6.37:g.109871392G>A			Somatic				AKD1_uc011eat.1_Silent_p.A34A	p.A955A	NM_001145128	NP_001138600	WXS	Illumina HiSeq	Unspecified	Q5TCS8	AKD1_HUMAN			25	2942	-			955					A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Silent	SNP	ENST00000424296.2	37	c.2865C>T	CCDS55048.1																																																																																				0.428	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001145128		42	69	0	0	0	0.006999	0	42	69				
PDE10A	10846	broad.mit.edu	37	6	165808737	165808737	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr6:165808737C>A	ENST00000366882.1	-	16	1562	c.1408G>T	c.(1408-1410)Ggt>Tgt	p.G470C	PDE10A_ENST00000539869.2_Missense_Mutation_p.G480C|PDE10A_ENST00000354448.4_Missense_Mutation_p.G470C			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	470					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.G470C(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TCAAAAGGACCAATGTCAAAG	0.333																																					Esophageal Squamous(22;308 615 5753 12038 40624)	Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1408-1410)GGT>TGT		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						71.0	69.0	70.0					6																	165808737		2203	4300	6503	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165808737C>A	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1408G>T	6.37:g.165808737C>A	ENSP00000355847:p.Gly470Cys		Somatic				PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.G400C|PDE10A_uc003quo.2_Missense_Mutation_p.G480C	p.G470C	NM_006661	NP_006652	WXS	Illumina HiSeq	Unspecified	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	16	1649	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	470					Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.1408G>T		.	.	.	.	.	.	.	.	.	.	C	13.67	2.307017	0.40795	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.77489	-1.1;-1.1	5.57	4.59	0.56863	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.625761	0.17922	N	0.157444	T	0.47266	0.1436	N	0.22421	0.69	0.37586	D	0.919988	P;B	0.51653	0.947;0.063	B;B	0.41646	0.362;0.049	T	0.58031	-0.7708	10	0.46703	T	0.11	.	3.1601	0.06517	0.0:0.5137:0.2989:0.1874	.	480;470	Q9ULW9;Q9Y233	.;PDE10_HUMAN	C	470;498;480;470;469	ENSP00000355847:G470C;ENSP00000346435:G470C	ENSP00000341187:G480C	G	-	1	0	PDE10A	165728727	0.976000	0.34144	0.889000	0.34880	0.996000	0.88848	1.898000	0.39809	2.619000	0.88677	0.650000	0.86243	GGT		0.333	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			8	22	1	0	0.00448238	0.004482	0.00464704	8	22				
CBX3	11335	broad.mit.edu	37	7	26242643	26242643	+	Splice_Site	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:26242643G>A	ENST00000337620.4	+	2	452		c.e2+1		CBX3_ENST00000409747.1_Splice_Site|HNRNPA2B1_ENST00000354667.4_5'Flank|CBX3_ENST00000497498.1_Splice_Site|HNRNPA2B1_ENST00000356674.7_5'Flank|CBX3_ENST00000396386.2_Splice_Site	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3						chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)			endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						AACTACATTGGTAAGTTAATG	0.328																																							uc003sxt.2		NA																	0				ovary(1)	1						c.e2+1		chromobox homolog 3							88.0	92.0	91.0					7																	26242643		2202	4298	6500	SO:0001630	splice_region_variant	11335				chromatin remodeling|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome, centromeric region|nuclear centromeric heterochromatin|nuclear euchromatin|nuclear inner membrane|spindle	enzyme binding|protein domain specific binding	g.chr7:26242643G>A	U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.24+1G>A	7.37:g.26242643G>A			Somatic				HNRNPA2B1_uc003sxr.3_5'Flank|HNRNPA2B1_uc003sxs.3_5'Flank|CBX3_uc003sxu.2_Splice_Site_p.L8_splice|CBX3_uc003sxv.2_Splice_Site_p.L8_splice	p.L8_splice	NM_007276	NP_009207	WXS	Illumina HiSeq	Unspecified	Q13185	CBX3_HUMAN			2	135	+								Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Splice_Site	SNP	ENST00000337620.4	37	c.24_splice	CCDS5398.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041703	0.75732	.	.	ENSG00000122565	ENST00000337620;ENST00000396386;ENST00000456948;ENST00000409747	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6871	0.88259	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBX3	26209168	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.065000	0.71176	2.589000	0.87451	0.561000	0.74099	.		0.328	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214117.1	NM_007276	Intron	7	74	0	0	0	0.001984	0	7	74				
PPP1R17	10842	broad.mit.edu	37	7	31732113	31732113	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:31732113C>A	ENST00000342032.3	+	2	686	c.58C>A	c.(58-60)Cta>Ata	p.L20I	PPP1R17_ENST00000409146.3_Missense_Mutation_p.L20I	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	20					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)										ACTGGACAAGCTAGACCCTCG	0.488																																							uc003tcl.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(58-60)CTA>ATA		G-substrate isoform 1							115.0	99.0	105.0					7																	31732113		2203	4300	6503	SO:0001583	missense	10842				behavior|central nervous system development|intracellular protein kinase cascade|protein phosphorylation	soluble fraction		g.chr7:31732113C>A	AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.58C>A	7.37:g.31732113C>A	ENSP00000340125:p.Leu20Ile		Somatic				C7orf16_uc011kaf.1_Missense_Mutation_p.L20I	p.L20I	NM_006658	NP_006649	WXS	Illumina HiSeq	Unspecified	O96001	GSUB_HUMAN	GBM - Glioblastoma multiforme(11;0.216)		2	216	+			20					B4DE58|Q9UDQ0	Missense_Mutation	SNP	ENST00000342032.3	37	c.58C>A	CCDS5436.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627887	0.28978	.	.	ENSG00000106341	ENST00000342032;ENST00000409146	T;T	0.31769	1.48;1.5	6.16	4.37	0.52481	.	0.429652	0.21802	N	0.068909	T	0.43411	0.1246	L	0.51422	1.61	0.28616	N	0.908394	D;P	0.62365	0.991;0.949	P;P	0.59115	0.852;0.677	T	0.32295	-0.9912	10	0.37606	T	0.19	-7.7472	12.8092	0.57629	0.0:0.867:0.0:0.133	.	20;20	B4DE58;O96001	.;PPR17_HUMAN	I	20	ENSP00000340125:L20I;ENSP00000386459:L20I	ENSP00000340125:L20I	L	+	1	2	C7orf16	31698638	1.000000	0.71417	0.888000	0.34837	0.651000	0.38670	2.002000	0.40835	0.938000	0.37419	0.650000	0.86243	CTA		0.488	PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250498.1	NM_006658		18	37	1	0	9.16793e-09	0.00499	1.10363e-08	18	37				
NSUN5	55695	broad.mit.edu	37	7	72718748	72718748	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:72718748G>A	ENST00000252594.6	-	6	766	c.751C>T	c.(751-753)Caa>Taa	p.Q251*	NSUN5_ENST00000438747.2_Nonsense_Mutation_p.Q251*|NSUN5_ENST00000310326.8_Nonsense_Mutation_p.Q251*|NSUN5_ENST00000428206.1_Nonsense_Mutation_p.Q213*			Q96P11	NSUN5_HUMAN	NOP2/Sun domain family, member 5	251					rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Lung NSC(55;0.163)				ACTCACCCTTGGTTCTTCAGA	0.557																																							uc003txw.2		NA																	0					0						c.(751-753)CAA>TAA		NOL1/NOP2/Sun domain family, member 5 isoform 2							32.0	34.0	33.0					7																	72718748		2203	4298	6501	SO:0001587	stop_gained	55695						methyltransferase activity	g.chr7:72718748G>A	AF420249	CCDS5546.1, CCDS5547.1, CCDS55118.1, CCDS55119.1	7q11.23	2010-04-08	2009-11-23	2005-01-14	ENSG00000130305	ENSG00000130305		"""NOP2/Sun domain containing"""	16385	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 5A"""	615732	"""Williams Beuren syndrome chromosome region 20A"", ""NOL1/NOP2/Sun domain family, member 5"""	WBSCR20, WBSCR20A		11978965, 12073013	Standard	NM_148956		Approved	NOL1R, p120, (NOL1), FLJ10267, NSUN5A, Ynl022cL	uc011kev.2	Q96P11	OTTHUMG00000129869	ENST00000252594.6:c.751C>T	7.37:g.72718748G>A	ENSP00000252594:p.Gln251*		Somatic				FKBP6_uc003twz.2_Intron|NSUN5_uc003txv.2_Nonsense_Mutation_p.Q251*|NSUN5_uc003txx.2_Nonsense_Mutation_p.Q213*|NSUN5_uc011kev.1_Nonsense_Mutation_p.Q251*	p.Q251*	NM_018044	NP_060514	WXS	Illumina HiSeq	Unspecified	Q96P11	NSUN5_HUMAN			6	787	-		Lung NSC(55;0.163)	251					B3KX04|B4DP79|G3V0G9|Q6ZUI8|Q96HT9|Q9NW70	Nonsense_Mutation	SNP	ENST00000252594.6	37	c.751C>T	CCDS5547.1	.	.	.	.	.	.	.	.	.	.	G	37	6.406138	0.97542	.	.	ENSG00000130305	ENST00000428206;ENST00000252594;ENST00000438747;ENST00000310326	.	.	.	4.5	4.5	0.54988	.	0.147766	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	.	10.2248	0.43218	0.0:0.0:0.6867:0.3133	.	.	.	.	X	213;251;251;251	.	ENSP00000252594:Q251X	Q	-	1	0	NSUN5	72356684	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.271000	0.65553	2.347000	0.79759	0.485000	0.47835	CAA		0.557	NSUN5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252113.1	NM_148956		10	33	0	0	0	0.00245	0	10	33				
CROT	54677	broad.mit.edu	37	7	87022269	87022269	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:87022269G>T	ENST00000331536.3	+	17	1789	c.1604G>T	c.(1603-1605)gGa>gTa	p.G535V	CROT_ENST00000419147.2_Missense_Mutation_p.G563V|CROT_ENST00000442291.1_Missense_Mutation_p.G535V	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	535	Poly-Gly.				carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	CACAGCGGAGGAGGTGGAAAT	0.383																																							uc003uit.2		NA																	0				ovary(2)|lung(1)	3						c.(1603-1605)GGA>GTA		peroxisomal carnitine O-octanoyltransferase	L-Carnitine(DB00583)						202.0	195.0	197.0					7																	87022269		2203	4300	6503	SO:0001583	missense	54677				fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity	g.chr7:87022269G>T		CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1604G>T	7.37:g.87022269G>T	ENSP00000331981:p.Gly535Val		Somatic				CROT_uc003uiu.2_Missense_Mutation_p.G563V	p.G535V	NM_021151	NP_066974	WXS	Illumina HiSeq	Unspecified	Q9UKG9	OCTC_HUMAN			17	1849	+	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		535			Poly-Gly.		A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	ENST00000331536.3	37	c.1604G>T	CCDS5604.1	.	.	.	.	.	.	.	.	.	.	G	31	5.077048	0.94000	.	.	ENSG00000005469	ENST00000419147;ENST00000331536;ENST00000442291	T;T;T	0.41758	0.99;0.99;0.99	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.72269	0.3439	M	0.91354	3.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68674	-0.5346	10	0.16896	T	0.51	-26.3603	20.8794	0.99867	0.0:0.0:1.0:0.0	.	563;535	E7EQF2;Q9UKG9	.;OCTC_HUMAN	V	563;535;535	ENSP00000413575:G563V;ENSP00000331981:G535V;ENSP00000411983:G535V	ENSP00000331981:G535V	G	+	2	0	CROT	86860205	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.859000	0.99545	2.941000	0.99782	0.655000	0.94253	GGA		0.383	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151		39	154	1	0	1.96642e-18	0.006999	2.67096e-18	39	154				
ZAN	7455	broad.mit.edu	37	7	100348417	100348417	+	RNA	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:100348417G>C	ENST00000348028.3	+	0	1584				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GAAGTCCTGCGGGGAGTCCCC	0.622																																							uc003uwj.2		NA																	0				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11						c.(1417-1419)GCG>GCC		zonadhesin isoform 3							32.0	34.0	33.0					7																	100348417		1954	4130	6084			7455				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane		g.chr7:100348417G>C	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100348417G>C			Somatic				ZAN_uc003uwk.2_Silent_p.A473A|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	p.A473A	NM_003386	NP_003377	WXS	Illumina HiSeq	Unspecified	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)		12	1584	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		473			MAM 3.|Extracellular (Potential).		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	ENST00000348028.3	37	c.1419G>C																																																																																					0.622	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		8	19	0	0	0	0.006214	0	8	19				
CTTNBP2	83992	broad.mit.edu	37	7	117417623	117417623	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:117417623T>A	ENST00000160373.3	-	8	2811	c.2720A>T	c.(2719-2721)aAc>aTc	p.N907I		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	907					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GTTGGCGTGGTTAATGAGGTC	0.498																																							uc003vjf.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(2719-2721)AAC>ATC		cortactin binding protein 2							138.0	121.0	127.0					7																	117417623		2203	4300	6503	SO:0001583	missense	83992							g.chr7:117417623T>A		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.2720A>T	7.37:g.117417623T>A	ENSP00000160373:p.Asn907Ile		Somatic					p.N907I	NM_033427	NP_219499	WXS	Illumina HiSeq	Unspecified	Q8WZ74	CTTB2_HUMAN		LUSC - Lung squamous cell carcinoma(290;0.133)	8	2812	-	Lung NSC(10;0.0018)|all_lung(10;0.002)		907					O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	c.2720A>T	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.89|18.89	3.719515|3.719515	0.68844|0.68844	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000160373|ENST00000446636	T|.	0.63417|.	-0.04|.	5.63|5.63	5.63|5.63	0.86233|0.86233	Ankyrin repeat-containing domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.87265|.	0.6134|.	H|H	0.95745|0.95745	3.715|3.715	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|.	0.91063|.	0.4887|.	10|.	0.87932|.	D|.	0|.	-0.3348|-0.3348	16.1251|16.1251	0.81386|0.81386	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	907|.	Q8WZ74|.	CTTB2_HUMAN|.	I|Y	907|394	ENSP00000160373:N907I|.	ENSP00000160373:N907I|.	N|X	-|-	2|3	0|2	CTTNBP2|CTTNBP2	117204859|117204859	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.409000|0.409000	0.31022|0.31022	7.302000|7.302000	0.78861|0.78861	2.261000|2.261000	0.74972|0.74972	0.528000|0.528000	0.53228|0.53228	AAC|TAA		0.498	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		16	57	0	0	0	0.010504	0	16	57				
IMPDH1	3614	broad.mit.edu	37	7	128040196	128040196	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:128040196C>A	ENST00000480861.1	-	6	634	c.557G>T	c.(556-558)gGt>gTt	p.G186V	IMPDH1_ENST00000338791.6_Missense_Mutation_p.G276V|IMPDH1_ENST00000348127.6_Missense_Mutation_p.G240V|IMPDH1_ENST00000470772.1_Missense_Mutation_p.G190V|IMPDH1_ENST00000496200.1_Missense_Mutation_p.G166V|IMPDH1_ENST00000419067.2_Missense_Mutation_p.G243V|IMPDH1_ENST00000378717.4_Missense_Mutation_p.G207V|IMPDH1_ENST00000354269.5_Missense_Mutation_p.G266V|IMPDH1_ENST00000343214.4_Missense_Mutation_p.G166V	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						CAACGTCACACCTGCTGGAGC	0.562																																							uc011kol.1		NA																	0				skin(2)|lung(1)|central_nervous_system(1)	4						c.(571-573)GGT>GTT		inosine monophosphate dehydrogenase 1 isoform e	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)|Ribavirin(DB00811)|Thioguanine(DB00352)						185.0	171.0	175.0					7																	128040196		2203	4300	6503	SO:0001583	missense	3614				GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	DNA binding|IMP dehydrogenase activity|metal ion binding	g.chr7:128040196C>A		CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.557G>T	7.37:g.128040196C>A	ENSP00000420185:p.Gly186Val		Somatic				IMPDH1_uc011kom.1_Missense_Mutation_p.G186V|IMPDH1_uc003vmt.2_Missense_Mutation_p.G166V|IMPDH1_uc003vmu.2_Missense_Mutation_p.G276V|IMPDH1_uc003vmw.2_Missense_Mutation_p.G266V|IMPDH1_uc011kon.1_Missense_Mutation_p.G243V|IMPDH1_uc003vmv.2_Missense_Mutation_p.G240V|IMPDH1_uc003vmx.2_Missense_Mutation_p.G199V|IMPDH1_uc003vmy.2_Missense_Mutation_p.G207V	p.G191V	NM_001142573	NP_001136045	WXS	Illumina HiSeq	Unspecified	P20839	IMDH1_HUMAN			6	678	-			191			CBS 2.			Missense_Mutation	SNP	ENST00000480861.1	37	c.572G>T	CCDS55161.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551855	0.86127	.	.	ENSG00000106348	ENST00000419067;ENST00000338791;ENST00000496200;ENST00000354269;ENST00000378717;ENST00000348127;ENST00000343214;ENST00000470772;ENST00000480861;ENST00000497868;ENST00000489263	D;D;D;D;D;D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23;-3.23	5.15	5.15	0.70609	Aldolase-type TIM barrel (1);Cystathionine beta-synthase, core (3);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.97368	0.9139	M	0.92122	3.275	0.80722	D	1	D;D;D;D;D;D;D;D	0.67145	0.996;0.976;0.996;0.958;0.996;0.98;0.984;0.97	D;D;D;D;D;P;P;D	0.73380	0.97;0.965;0.965;0.948;0.98;0.759;0.905;0.94	D	0.98331	1.0533	10	0.87932	D	0	-16.5595	16.1423	0.81534	0.0:1.0:0.0:0.0	.	243;186;191;207;266;240;276;166	C9JV30;B4DE09;P20839;E7EQS0;Q5H9Q6;P20839-3;A4D0Z6;P20839-2	.;.;IMDH1_HUMAN;.;.;.;.;.	V	243;276;166;266;207;240;166;190;186;207;182	ENSP00000399400:G243V;ENSP00000345096:G276V;ENSP00000420803:G166V;ENSP00000346219:G266V;ENSP00000367989:G207V;ENSP00000265385:G240V;ENSP00000342438:G166V;ENSP00000417296:G190V;ENSP00000420185:G186V;ENSP00000419609:G207V	ENSP00000345096:G276V	G	-	2	0	IMPDH1	127827432	1.000000	0.71417	0.964000	0.40570	0.968000	0.65278	5.724000	0.68500	2.409000	0.81822	0.561000	0.74099	GGT		0.562	IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000349462.1	NM_000883		44	179	1	0	4.64027e-19	0.01441	6.33671e-19	44	179				
TAS2R41	259287	broad.mit.edu	37	7	143175434	143175434	+	Missense_Mutation	SNP	C	C	G	rs377524079		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:143175434C>G	ENST00000408916.1	+	1	469	c.469C>G	c.(469-471)Caa>Gaa	p.Q157E	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	157					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					CCCTGTATATCAAGAATTTTT	0.443																																							uc003wdc.1		NA																	0				pancreas(1)|skin(1)	2						c.(469-471)CAA>GAA		taste receptor, type 2, member 41		C	GLU/GLN	0,3642		0,0,1821	43.0	43.0	43.0		469	3.9	0.0	7		43	1,8165		0,1,4082	no	missense	TAS2R41	NM_176883.2	29	0,1,5903	GG,GC,CC		0.0122,0.0,0.0085	benign	157/308	143175434	1,11807	1821	4083	5904	SO:0001583	missense	259287				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr7:143175434C>G	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.469C>G	7.37:g.143175434C>G	ENSP00000386201:p.Gln157Glu		Somatic				uc003wda.2_Intron	p.Q157E	NM_176883	NP_795364	WXS	Illumina HiSeq	Unspecified	P59536	T2R41_HUMAN			1	469	+	Melanoma(164;0.15)		157			Extracellular (Potential).		P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Missense_Mutation	SNP	ENST00000408916.1	37	c.469C>G	CCDS43663.1	.	.	.	.	.	.	.	.	.	.	C	6.086	0.384136	0.11524	0.0	1.22E-4	ENSG00000221855	ENST00000408916	T	0.36157	1.27	5.7	3.86	0.44501	.	0.339188	0.18964	U	0.126303	T	0.26340	0.0643	N	0.13003	0.285	0.09310	N	1	P	0.36438	0.553	B	0.42593	0.392	T	0.12889	-1.0530	10	0.32370	T	0.25	.	10.5789	0.45244	0.1447:0.7012:0.1541:0.0	.	157	P59536	T2R41_HUMAN	E	157	ENSP00000386201:Q157E	ENSP00000386201:Q157E	Q	+	1	0	TAS2R41	142885556	0.001000	0.12720	0.007000	0.13788	0.008000	0.06430	0.604000	0.24164	0.722000	0.32252	0.655000	0.94253	CAA		0.443	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1			12	46	0	0	0	0.001855	0	12	46				
OR2F2	135948	broad.mit.edu	37	7	143633211	143633211	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:143633211G>C	ENST00000408955.2	+	1	953	c.886G>C	c.(886-888)Gag>Cag	p.E296Q		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					AAGGAATAAAGAGGTGAAGGG	0.433																																							uc011ktv.1		NA																	0				ovary(3)|skin(1)	4						c.(886-888)GAG>CAG		olfactory receptor, family 2, subfamily F,							62.0	62.0	62.0					7																	143633211		2055	4254	6309	SO:0001583	missense	135948				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143633211G>C		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.886G>C	7.37:g.143633211G>C	ENSP00000386222:p.Glu296Gln		Somatic					p.E296Q	NM_001004685	NP_001004685	WXS	Illumina HiSeq	Unspecified	O95006	OR2F2_HUMAN			1	886	+	Melanoma(164;0.0903)		296			Cytoplasmic (Potential).		A4D2G0|Q6IFP8	Missense_Mutation	SNP	ENST00000408955.2	37	c.886G>C	CCDS43666.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711078	0.48517	.	.	ENSG00000221910	ENST00000408955	T	0.38240	1.15	3.78	2.86	0.33363	.	0.133844	0.33834	N	0.004503	T	0.36663	0.0975	L	0.33093	0.98	0.29199	N	0.875332	D	0.53462	0.96	P	0.52514	0.701	T	0.24835	-1.0149	10	0.87932	D	0	-14.8506	10.3271	0.43801	0.0:0.0:0.8017:0.1983	.	296	O95006	OR2F2_HUMAN	Q	296	ENSP00000386222:E296Q	ENSP00000386222:E296Q	E	+	1	0	OR2F2	143264144	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	5.735000	0.68587	0.888000	0.36160	0.491000	0.48974	GAG		0.433	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			16	56	0	0	0	0.006122	0	16	56				
OR2A25	392138	broad.mit.edu	37	7	143771421	143771421	+	Missense_Mutation	SNP	A	A	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr7:143771421A>C	ENST00000408898.2	+	1	147	c.109A>C	c.(109-111)Att>Ctt	p.I37L		NM_001004488.1	NP_001004488.1	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A, member 25	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(16)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	24	Melanoma(164;0.0783)					CTACATCTTCATTCTGTTGGG	0.522																																							uc011ktx.1		NA																	0					0						c.(109-111)ATT>CTT		olfactory receptor, family 2, subfamily A,							83.0	85.0	84.0					7																	143771421		2203	4300	6503	SO:0001583	missense	392138				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143771421A>C		CCDS43669.1	7q35	2012-08-09		2004-03-10	ENSG00000221933	ENSG00000221933		"""GPCR / Class A : Olfactory receptors"""	19562	protein-coding gene	gene with protein product				OR2A25P, OR2A27			Standard	NM_001004488		Approved		uc011ktx.2	A4D2G3	OTTHUMG00000158013	ENST00000408898.2:c.109A>C	7.37:g.143771421A>C	ENSP00000386167:p.Ile37Leu		Somatic					p.I37L	NM_001004488	NP_001004488	WXS	Illumina HiSeq	Unspecified	A4D2G3	O2A25_HUMAN			1	109	+	Melanoma(164;0.0783)		37			Helical; Name=1; (Potential).		B2RNC9	Missense_Mutation	SNP	ENST00000408898.2	37	c.109A>C	CCDS43669.1	.	.	.	.	.	.	.	.	.	.	A	10.44	1.351883	0.24512	.	.	ENSG00000221933	ENST00000408898	T	0.00569	6.52	4.88	4.88	0.63580	.	.	.	.	.	T	0.00875	0.0029	M	0.71036	2.16	0.20975	N	0.999811	B	0.02656	0.0	B	0.01281	0.0	T	0.37686	-0.9695	9	0.87932	D	0	-5.5322	12.4831	0.55856	1.0:0.0:0.0:0.0	.	37	A4D2G3	O2A25_HUMAN	L	37	ENSP00000386167:I37L	ENSP00000386167:I37L	I	+	1	0	OR2A25	143402354	0.025000	0.19082	0.936000	0.37596	0.012000	0.07955	2.438000	0.44837	2.047000	0.60756	0.460000	0.39030	ATT		0.522	OR2A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350000.1			35	78	0	0	0	0.013726	0	35	78				
NKAIN3	286183	broad.mit.edu	37	8	63492112	63492112	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:63492112G>C	ENST00000523211.1	+	2	201	c.69G>C	c.(67-69)gaG>gaC	p.E23D	NKAIN3_ENST00000328472.5_Missense_Mutation_p.E23D|NKAIN3_ENST00000519049.1_3'UTR	NM_173688.2	NP_775959.1	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(3)|large_intestine(2)|lung(8)	13	Breast(64;0.127)	Lung NSC(129;0.187)				CAGCATTAGAGAGGCAGATCT	0.383																																							uc010lyq.1		NA																	0					0						c.(67-69)GAG>GAC		Na+/K+ transporting ATPase interacting 3							169.0	163.0	165.0					8																	63492112		1854	4103	5957	SO:0001583	missense	286183					integral to membrane|plasma membrane		g.chr8:63492112G>C	AK096949	CCDS55239.1	8q12.3	2014-08-12	2007-10-04	2007-10-04	ENSG00000185942	ENSG00000185942		"""Na+/K+ transporting ATPase interacting"""	26829	protein-coding gene	gene with protein product		612872	"""family with sequence similarity 77, member D"""	FAM77D		17606467	Standard	NM_173688		Approved	FLJ39630	uc010lyq.1	Q8N8D7	OTTHUMG00000164361	ENST00000523211.1:c.69G>C	8.37:g.63492112G>C	ENSP00000429073:p.Glu23Asp		Somatic					p.E23D	NM_173688	NP_775959	WXS	Illumina HiSeq	Unspecified	Q8N8D7	NKAI3_HUMAN			2	201	+	Breast(64;0.127)	Lung NSC(129;0.187)	23						Missense_Mutation	SNP	ENST00000523211.1	37	c.69G>C	CCDS55239.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308835	0.40895	.	.	ENSG00000185942	ENST00000523211;ENST00000524201;ENST00000328472	T;T;T	0.17054	2.3;2.3;2.3	5.85	3.09	0.35607	.	0.000000	0.64402	D	0.000001	T	0.44623	0.1302	M	0.88105	2.93	0.44402	D	0.997313	D	0.76494	0.999	D	0.83275	0.996	T	0.47787	-0.9090	10	0.87932	D	0	-9.1767	9.7806	0.40645	0.2205:0.0:0.7795:0.0	.	23	Q8N8D7	NKAI3_HUMAN	D	23	ENSP00000429073:E23D;ENSP00000429393:E23D;ENSP00000333627:E23D	ENSP00000333627:E23D	E	+	3	2	NKAIN3	63654666	1.000000	0.71417	0.994000	0.49952	0.027000	0.11550	1.449000	0.35123	0.816000	0.34421	0.650000	0.86243	GAG		0.383	NKAIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378447.2	NM_173688		6	162	0	0	0	0.001984	0	6	162				
EYA1	2138	broad.mit.edu	37	8	72127907	72127907	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:72127907C>A	ENST00000340726.3	-	15	2056	c.1417G>T	c.(1417-1419)Gcc>Tcc	p.A473S	EYA1_ENST00000388741.2_Missense_Mutation_p.A439S|EYA1_ENST00000419131.1_Missense_Mutation_p.A438S|EYA1_ENST00000388742.4_Missense_Mutation_p.A473S|EYA1_ENST00000388740.3_Missense_Mutation_p.A440S|EYA1_ENST00000303824.7_Missense_Mutation_p.A467S|EYA1_ENST00000388743.2_Missense_Mutation_p.A472S	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	473					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			TCGGTCAGGGCTTCAATTTCG	0.542																																							uc003xys.3		NA																	0				ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5						c.(1417-1419)GCC>TCC		eyes absent 1 isoform b							86.0	79.0	82.0					8																	72127907		2203	4300	6503	SO:0001583	missense	2138				double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr8:72127907C>A	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.1417G>T	8.37:g.72127907C>A	ENSP00000342626:p.Ala473Ser		Somatic				EYA1_uc003xyr.3_Missense_Mutation_p.A438S|EYA1_uc003xyt.3_Missense_Mutation_p.A440S|EYA1_uc010lzf.2_Missense_Mutation_p.A400S|EYA1_uc003xyu.2_Missense_Mutation_p.A473S|EYA1_uc011lfe.1_Missense_Mutation_p.A467S|EYA1_uc003xyv.2_Missense_Mutation_p.A351S	p.A473S	NM_172058	NP_742055	WXS	Illumina HiSeq	Unspecified	Q99502	EYA1_HUMAN	Epithelial(68;0.0837)|all cancers(69;0.247)		14	1704	-	Breast(64;0.046)		473					A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	c.1417G>T	CCDS34906.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789535	0.70337	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69;-1.69;-1.69	4.54	4.54	0.55810	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.166496	0.51477	D	0.000081	T	0.76478	0.3993	L	0.31845	0.965	0.80722	D	1	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.12837	0.004;0.004;0.004;0.007;0.008	T	0.71424	-0.4597	10	0.33141	T	0.24	-12.4959	17.4999	0.87728	0.0:1.0:0.0:0.0	.	467;400;440;473;438	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	S	473;473;441;440;467;439;472;438	ENSP00000373394:A473S;ENSP00000342626:A473S;ENSP00000373392:A440S;ENSP00000303221:A467S;ENSP00000373393:A439S;ENSP00000373395:A472S;ENSP00000410176:A438S	ENSP00000303221:A467S	A	-	1	0	EYA1	72290461	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.568000	0.82369	2.343000	0.79666	0.561000	0.74099	GCC		0.542	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060		22	79	1	0	1.50039e-11	0.012319	1.88663e-11	22	79				
ZFHX4	79776	broad.mit.edu	37	8	77768313	77768313	+	Silent	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:77768313G>C	ENST00000521891.2	+	10	9604	c.9156G>C	c.(9154-9156)ccG>ccC	p.P3052P	ZFHX4_ENST00000518282.1_Silent_p.P3026P|ZFHX4_ENST00000050961.6_Silent_p.P3007P|ZFHX4_ENST00000455469.2_Silent_p.P3007P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3007	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.P3036P(2)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ACTTGGCTCCGACCACGGTTC	0.507										HNSCC(33;0.089)																													uc003yav.2		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(9019-9021)CCG>CCC		zinc finger homeodomain 4							102.0	102.0	102.0					8																	77768313		2006	4172	6178	SO:0001819	synonymous_variant	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77768313G>C		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9156G>C	8.37:g.77768313G>C		HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Silent_p.P3052P|ZFHX4_uc003yaw.1_Silent_p.P3007P	p.P3007P	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	9408	+			3007					G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	c.9021G>C	CCDS47878.2																																																																																				0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		12	149	0	0	0	0.00245	0	12	149				
CPQ	10404	broad.mit.edu	37	8	97797153	97797153	+	Missense_Mutation	SNP	G	G	T	rs369831003		TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:97797153G>T	ENST00000220763.5	+	2	238	c.28G>T	c.(28-30)Ggt>Tgt	p.G10C		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	10					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										CGCATTTTTCGGTGGTGTTCA	0.338																																							uc003yhw.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(28-30)GGT>TGT		plasma glutamate carboxypeptidase precursor							83.0	84.0	83.0					8																	97797153		2203	4300	6503	SO:0001583	missense	10404				peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity	g.chr8:97797153G>T	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.28G>T	8.37:g.97797153G>T	ENSP00000220763:p.Gly10Cys		Somatic				PGCP_uc010mbe.2_Missense_Mutation_p.G10C	p.G10C	NM_016134	NP_057218	WXS	Illumina HiSeq	Unspecified	Q9Y646	PGCP_HUMAN			2	194	+	Breast(36;1.86e-05)		10					B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	ENST00000220763.5	37	c.28G>T	CCDS6273.1	.	.	.	.	.	.	.	.	.	.	G	8.025	0.760387	0.15914	.	.	ENSG00000104324	ENST00000220763;ENST00000519900;ENST00000517742;ENST00000519484;ENST00000521142	T;T	0.44482	0.92;0.92	5.4	4.51	0.55191	.	0.411951	0.24267	N	0.040038	T	0.32556	0.0833	L	0.47716	1.5	0.09310	N	1	B;B	0.15719	0.014;0.008	B;B	0.18561	0.022;0.012	T	0.21348	-1.0248	10	0.38643	T	0.18	-2.1546	5.3545	0.16053	0.1232:0.0:0.6803:0.1965	.	10;10	B5MDX4;Q9Y646	.;PGCP_HUMAN	C	10	ENSP00000220763:G10C;ENSP00000429146:G10C	ENSP00000220763:G10C	G	+	1	0	AC010859.1	97866329	0.212000	0.23540	0.002000	0.10522	0.094000	0.18550	1.134000	0.31442	1.262000	0.44165	0.563000	0.77884	GGT		0.338	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379757.2	NM_016134		20	127	1	0	2.4624e-09	0.008871	2.99258e-09	20	127				
CPQ	10404	broad.mit.edu	37	8	97847327	97847327	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:97847327G>A	ENST00000220763.5	+	3	770	c.560G>A	c.(559-561)cGa>cAa	p.R187Q		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	187					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										GTGCAATACCGAACGCAGGGG	0.502																																							uc003yhw.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(559-561)CGA>CAA		plasma glutamate carboxypeptidase precursor							102.0	100.0	100.0					8																	97847327		2203	4300	6503	SO:0001583	missense	10404				peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity	g.chr8:97847327G>A	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.560G>A	8.37:g.97847327G>A	ENSP00000220763:p.Arg187Gln		Somatic				PGCP_uc010mbe.2_Missense_Mutation_p.R187Q	p.R187Q	NM_016134	NP_057218	WXS	Illumina HiSeq	Unspecified	Q9Y646	PGCP_HUMAN			3	726	+	Breast(36;1.86e-05)		187					B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	ENST00000220763.5	37	c.560G>A	CCDS6273.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.700351	0.68501	.	.	ENSG00000104324	ENST00000220763	T	0.59502	0.26	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.82213	0.4988	M	0.93106	3.38	0.47407	D	0.999411	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86104	0.1558	10	0.72032	D	0.01	-16.1306	17.8439	0.88724	0.0:0.0:1.0:0.0	.	187;187	B5MDX4;Q9Y646	.;PGCP_HUMAN	Q	187	ENSP00000220763:R187Q	ENSP00000220763:R187Q	R	+	2	0	AC010859.1	97916503	1.000000	0.71417	0.933000	0.37362	0.017000	0.09413	8.961000	0.93122	2.638000	0.89438	0.655000	0.94253	CGA		0.502	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379757.2	NM_016134		15	74	0	0	0	0.004007	0	15	74				
KCNS2	3788	broad.mit.edu	37	8	99441351	99441351	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:99441351C>A	ENST00000287042.4	+	2	1494	c.1144C>A	c.(1144-1146)Cca>Aca	p.P382T	KCNS2_ENST00000521839.1_Missense_Mutation_p.P382T	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	382					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			GGATGTGGTCCCAGGGACCAC	0.592																																					Pancreas(138;844 2489 9202 24627)	Pancreas(138;844 2489 9202 24627)	uc003yin.2		NA																	0				ovary(1)	1						c.(1144-1146)CCA>ACA		potassium voltage-gated channel,							95.0	89.0	91.0					8																	99441351		2203	4300	6503	SO:0001583	missense	3788					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr8:99441351C>A	AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.1144C>A	8.37:g.99441351C>A	ENSP00000287042:p.Pro382Thr		Somatic					p.P382T	NM_020697	NP_065748	WXS	Illumina HiSeq	Unspecified	Q9ULS6	KCNS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.0448)		2	1494	+	Breast(36;2.4e-06)		382					A8KAN1	Missense_Mutation	SNP	ENST00000287042.4	37	c.1144C>A	CCDS6279.1	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905269	0.72868	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	D;D	0.98835	-5.17;-5.17	6.07	6.07	0.98685	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99563	0.9843	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97983	1.0350	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	382	Q9ULS6	KCNS2_HUMAN	T	382	ENSP00000287042:P382T;ENSP00000430712:P382T	ENSP00000287042:P382T	P	+	1	0	KCNS2	99510527	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	CCA		0.592	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697		21	115	1	0	3.51602e-12	0.008871	4.46534e-12	21	115				
VPS13B	157680	broad.mit.edu	37	8	100866425	100866425	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:100866425C>T	ENST00000358544.2	+	56	10994	c.10883C>T	c.(10882-10884)gCg>gTg	p.A3628V	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.A3603V	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3628					protein transport (GO:0015031)			p.A3628V(1)|p.A3603V(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTCACCACTGCGAGGCAGCTT	0.557																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	2	Substitution - Missense(2)		large_intestine(2)	ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(10882-10884)GCG>GTG		vacuolar protein sorting 13B isoform 5							103.0	81.0	88.0					8																	100866425		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100866425C>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10883C>T	8.37:g.100866425C>T	ENSP00000351346:p.Ala3628Val		Somatic				VPS13B_uc003yiw.2_Missense_Mutation_p.A3603V	p.A3628V	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		56	10994	+	Breast(36;3.73e-07)		3628					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.10883C>T	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179101	0.78564	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.69685	-0.42;-0.42	5.5	4.61	0.57282	.	0.060595	0.64402	D	0.000005	T	0.71400	0.3335	L	0.49350	1.555	0.80722	D	1	D;D	0.69078	0.997;0.996	P;P	0.56514	0.8;0.699	T	0.67612	-0.5626	10	0.18276	T	0.48	.	16.1018	0.81178	0.0:0.8659:0.1341:0.0	.	3603;3628	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	V	3603;3628	ENSP00000349685:A3603V;ENSP00000351346:A3628V	ENSP00000349685:A3603V	A	+	2	0	VPS13B	100935601	1.000000	0.71417	0.696000	0.30242	0.875000	0.50365	5.548000	0.67255	1.264000	0.44198	0.650000	0.86243	GCG		0.557	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		14	59	0	0	0	0.001855	0	14	59				
RNF139	11236	broad.mit.edu	37	8	125487455	125487455	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:125487455C>A	ENST00000303545.3	+	1	477	c.105C>A	c.(103-105)gaC>gaA	p.D35E	RNF139-AS1_ENST00000499418.2_lincRNA	NM_007218.3	NP_009149.2			ring finger protein 139											breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(1)	20	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			ACATCATCGACGCCATCTTCA	0.637																																							uc003yrc.2		NA																	0				kidney(1)	1						c.(103-105)GAC>GAA		ring finger protein 139							78.0	81.0	80.0					8																	125487455		2203	4300	6503	SO:0001583	missense	11236	Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3			negative regulation of cell proliferation|regulation of protein ubiquitination	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr8:125487455C>A	AF064801	CCDS6350.1	8q24	2013-01-09			ENSG00000170881	ENSG00000170881		"""RING-type (C3HC4) zinc fingers"""	17023	protein-coding gene	gene with protein product		603046				9689122	Standard	NM_007218		Approved	TRC8, RCA1, HRCA1	uc003yrc.3	Q8WU17	OTTHUMG00000165072	ENST00000303545.3:c.105C>A	8.37:g.125487455C>A	ENSP00000304051:p.Asp35Glu		Somatic				uc003yrb.2_5'Flank	p.D35E	NM_007218	NP_009149	WXS	Illumina HiSeq	Unspecified	Q8WU17	RN139_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		1	448	+	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		35						Missense_Mutation	SNP	ENST00000303545.3	37	c.105C>A	CCDS6350.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038159	0.75617	.	.	ENSG00000170881	ENST00000303545	T	0.42900	0.96	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.60483	0.2272	M	0.63843	1.955	0.51767	D	0.999931	D	0.89917	1.0	D	0.91635	0.999	T	0.61898	-0.6968	10	0.51188	T	0.08	-9.2726	14.1222	0.65195	0.0:1.0:0.0:0.0	.	35	Q8WU17	RN139_HUMAN	E	35	ENSP00000304051:D35E	ENSP00000304051:D35E	D	+	3	2	RNF139	125556636	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	5.233000	0.65337	2.305000	0.77605	0.561000	0.74099	GAC		0.637	RNF139-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381692.1	NM_007218		9	105	1	0	1.58986e-06	0.008291	1.79478e-06	9	105				
PARP10	84875	broad.mit.edu	37	8	145057451	145057451	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:145057451G>A	ENST00000313028.7	-	8	2400	c.2306C>T	c.(2305-2307)aCc>aTc	p.T769I	PARP10_ENST00000525773.1_Missense_Mutation_p.T781I|PARP10_ENST00000524918.1_Missense_Mutation_p.T760I|PARP10_ENST00000533665.1_5'Flank	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	769	Myc binding.				negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACGGAGGATGGTGCAGTCACC	0.682																																							uc003zal.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)|pancreas(1)	6						c.(2305-2307)ACC>ATC		poly (ADP-ribose) polymerase family, member 10							29.0	29.0	29.0					8																	145057451		2202	4296	6498	SO:0001583	missense	84875					Golgi apparatus|nucleolus	NAD+ ADP-ribosyltransferase activity|nucleotide binding	g.chr8:145057451G>A	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.2306C>T	8.37:g.145057451G>A	ENSP00000325618:p.Thr769Ile		Somatic				PARP10_uc003zak.3_Missense_Mutation_p.T466I|PARP10_uc011lku.1_Missense_Mutation_p.T781I|PARP10_uc011lkv.1_Intron|PARP10_uc003zam.2_Missense_Mutation_p.T760I	p.T769I	NM_032789	NP_116178	WXS	Illumina HiSeq	Unspecified	Q53GL7	PAR10_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		8	2414	-	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		769			Myc binding.		Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	37	c.2306C>T	CCDS34960.1	.	.	.	.	.	.	.	.	.	.	G	6.387	0.439517	0.12104	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773	T;T;T	0.06528	3.29;3.3;3.29	4.96	2.12	0.27331	.	1.150150	0.06449	N	0.727403	T	0.03783	0.0107	N	0.12182	0.205	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.41734	-0.9492	10	0.06099	T	0.92	.	8.9372	0.35706	0.2519:0.0:0.7481:0.0	.	781;769	E9PNI7;Q53GL7	.;PAR10_HUMAN	I	760;475;769;781	ENSP00000431620:T760I;ENSP00000325618:T769I;ENSP00000434776:T781I	ENSP00000325618:T769I	T	-	2	0	PARP10	145129439	0.000000	0.05858	0.000000	0.03702	0.803000	0.45373	-0.047000	0.11963	0.138000	0.18790	0.546000	0.68486	ACC		0.682	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789		5	19	0	0	0	0.000602	0	5	19				
ZNF251	90987	broad.mit.edu	37	8	145948540	145948540	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr8:145948540T>A	ENST00000292562.7	-	5	780	c.505A>T	c.(505-507)Acc>Tcc	p.T169S	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		CTGCCCACGGTAGCTTCTGTT	0.448																																							uc003zdv.3		NA																	0					0						c.(505-507)ACC>TCC		zinc finger protein 251							100.0	100.0	100.0					8																	145948540		1824	4084	5908	SO:0001583	missense	90987				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:145948540T>A	AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.505A>T	8.37:g.145948540T>A	ENSP00000292562:p.Thr169Ser		Somatic					p.T169S	NM_138367	NP_612376	WXS	Illumina HiSeq	Unspecified	Q9BRH9	ZN251_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)	5	761	-	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		169					Q2M219	Missense_Mutation	SNP	ENST00000292562.7	37	c.505A>T	CCDS47944.1	.	.	.	.	.	.	.	.	.	.	T	0.795	-0.757488	0.03019	.	.	ENSG00000198169	ENST00000292562	T	0.06687	3.27	2.83	-3.88	0.04205	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B	0.17465	0.022	B	0.08055	0.003	T	0.46762	-0.9168	9	0.09590	T	0.72	.	4.0089	0.09613	0.0:0.3567:0.1834:0.4598	.	169	Q9BRH9	ZN251_HUMAN	S	169	ENSP00000292562:T169S	ENSP00000292562:T169S	T	-	1	0	ZNF251	145919349	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.262000	0.00535	-0.559000	0.06110	-0.376000	0.06991	ACC		0.448	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382541.1	NM_138367		26	95	0	0	0	0.005443	0	26	95				
FREM1	158326	broad.mit.edu	37	9	14776076	14776076	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr9:14776076C>A	ENST00000380880.3	-	25	5351	c.4568G>T	c.(4567-4569)gGc>gTc	p.G1523V	FREM1_ENST00000486223.1_5'Flank|FREM1_ENST00000380881.4_Missense_Mutation_p.G1524V|FREM1_ENST00000422223.2_Missense_Mutation_p.G1523V|FREM1_ENST00000380894.1_Missense_Mutation_p.G59V			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1523					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GGAAAGCAGGCCCACGGCCCC	0.607																																							uc003zlm.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(4567-4569)GGC>GTC		FRAS1 related extracellular matrix 1 precursor							116.0	127.0	123.0					9																	14776076		2015	4168	6183	SO:0001583	missense	158326				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding	g.chr9:14776076C>A	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.4568G>T	9.37:g.14776076C>A	ENSP00000370262:p.Gly1523Val		Somatic				FREM1_uc010mic.2_Intron|FREM1_uc003zlk.2_5'Flank|FREM1_uc003zll.2_Missense_Mutation_p.G59V	p.G1523V	NM_144966	NP_659403	WXS	Illumina HiSeq	Unspecified	Q5H8C1	FREM1_HUMAN		GBM - Glioblastoma multiforme(50;3.53e-06)	25	5158	-			1523			CSPG 11.		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	c.4568G>T	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	C	5.363	0.252258	0.10185	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880	T;T;T;T	0.76186	0.73;0.73;-1.0;0.73	6.16	4.07	0.47477	.	0.253032	0.40818	N	0.001004	T	0.46464	0.1394	N	0.05078	-0.115	0.21064	N	0.999795	B;B	0.09022	0.001;0.002	B;B	0.06405	0.002;0.002	T	0.09862	-1.0655	10	0.27082	T	0.32	-16.0622	3.6515	0.08205	0.28:0.3618:0.2828:0.0754	.	1523;59	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	V	1524;1523;59;1523	ENSP00000370263:G1524V;ENSP00000412940:G1523V;ENSP00000370278:G59V;ENSP00000370262:G1523V	ENSP00000370262:G1523V	G	-	2	0	FREM1	14766076	0.011000	0.17503	0.403000	0.26384	0.315000	0.28087	1.583000	0.36579	2.937000	0.99478	0.650000	0.86243	GGC		0.607	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		38	120	1	0	8.16277e-20	0.006999	1.12682e-19	38	120				
KLHL9	55958	broad.mit.edu	37	9	21334009	21334009	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr9:21334009G>C	ENST00000359039.4	-	1	1370	c.850C>G	c.(850-852)Cca>Gca	p.P284A	KLHL9_ENST00000537938.1_Missense_Mutation_p.P216A			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	284					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)				endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		TGCATCACTGGCTGCATATAT	0.423																																							uc003zoy.2		NA																	0				ovary(3)|skin(1)	4						c.(850-852)CCA>GCA		kelch-like 9							154.0	138.0	144.0					9																	21334009		2203	4300	6503	SO:0001583	missense	55958				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|midbody		g.chr9:21334009G>C	AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.850C>G	9.37:g.21334009G>C	ENSP00000351933:p.Pro284Ala		Somatic				KLHL9_uc003zow.2_Intron|KLHL9_uc003zox.2_RNA	p.P284A	NM_018847	NP_061335	WXS	Illumina HiSeq	Unspecified	Q9P2J3	KLHL9_HUMAN		Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)	1	1421	-			284					Q8TCQ2	Missense_Mutation	SNP	ENST00000359039.4	37	c.850C>G	CCDS6503.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.487978	0.44249	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	T;T	0.73047	-0.67;-0.71	5.37	5.37	0.77165	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.86793	0.6018	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87482	0.2421	10	0.44086	T	0.13	.	16.9779	0.86319	0.0:0.0:1.0:0.0	.	284	Q9P2J3	KLHL9_HUMAN	A	284;216	ENSP00000351933:P284A;ENSP00000437733:P216A	ENSP00000351933:P284A	P	-	1	0	KLHL9	21324009	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.764000	0.98949	2.688000	0.91661	0.650000	0.86243	CCA		0.423	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847		29	68	0	0	0	0.007291	0	29	68				
DCAF10	79269	broad.mit.edu	37	9	37857288	37857288	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr9:37857288T>A	ENST00000377724.3	+	5	1470	c.1105T>A	c.(1105-1107)Tgt>Agt	p.C369S	DCAF10_ENST00000242323.7_Intron|DCAF10_ENST00000483167.1_Intron|RP11-613M10.9_ENST00000540557.1_Intron	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	369	Ser-rich.				protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						TGGCTCACCTTGTCATCATAG	0.348																																							uc004aao.2		NA																	0				central_nervous_system(1)	1						c.(1105-1107)TGT>AGT		WD repeat domain 32							105.0	105.0	105.0					9																	37857288		2203	4300	6503	SO:0001583	missense	79269					CUL4 RING ubiquitin ligase complex		g.chr9:37857288T>A	BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.1105T>A	9.37:g.37857288T>A	ENSP00000366953:p.Cys369Ser		Somatic				DCAF10_uc010mlz.2_Missense_Mutation_p.C196S|DCAF10_uc004aap.2_Intron	p.C369S	NM_024345	NP_077321	WXS	Illumina HiSeq	Unspecified	Q5QP82	DCA10_HUMAN			5	1179	+			369			Ser-rich.		A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Missense_Mutation	SNP	ENST00000377724.3	37	c.1105T>A	CCDS6613.2	.	.	.	.	.	.	.	.	.	.	T	7.739	0.700779	0.15172	.	.	ENSG00000122741	ENST00000377724	T	0.68624	-0.34	6.08	6.08	0.98989	WD40 repeat-like-containing domain (1);	0.050216	0.85682	D	0.000000	T	0.50120	0.1597	N	0.22421	0.69	0.80722	D	1	B	0.21071	0.051	B	0.14023	0.01	T	0.48103	-0.9064	10	0.08381	T	0.77	.	14.5959	0.68407	0.0:0.0:0.0:1.0	.	369	Q5QP82	DCA10_HUMAN	S	369	ENSP00000366953:C369S	ENSP00000366953:C369S	C	+	1	0	DCAF10	37847288	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	2.795000	0.47861	2.333000	0.79357	0.533000	0.62120	TGT		0.348	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052485.2	NM_024345		36	146	0	0	0	0.00874	0	36	146				
ZBTB26	57684	broad.mit.edu	37	9	125681304	125681304	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chr9:125681304C>A	ENST00000373656.3	-	2	983	c.910G>T	c.(910-912)Ggc>Tgc	p.G304C	ZBTB26_ENST00000373654.1_Missense_Mutation_p.G304C	NM_020924.2	NP_065975.1	Q9HCK0	ZBT26_HUMAN	zinc finger and BTB domain containing 26	304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)	11						AAAGTCTTGCCGCAGAGTAGA	0.458																																							uc004bnj.2		NA																	0					0						c.(910-912)GGC>TGC		zinc finger and BTB domain containing 26							83.0	79.0	80.0					9																	125681304		2203	4300	6503	SO:0001583	missense	57684				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:125681304C>A	AB046792	CCDS6847.1	9q34.11	2013-01-08	2004-04-15	2004-04-16	ENSG00000171448	ENSG00000171448		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23383	protein-coding gene	gene with protein product			"""zinc finger protein 481"""	ZNF481			Standard	NM_020924		Approved		uc004bnk.3	Q9HCK0	OTTHUMG00000020627	ENST00000373656.3:c.910G>T	9.37:g.125681304C>A	ENSP00000362760:p.Gly304Cys		Somatic				ZBTB26_uc004bnk.2_Missense_Mutation_p.G304C	p.G304C	NM_020924	NP_065975	WXS	Illumina HiSeq	Unspecified	Q9HCK0	ZBT26_HUMAN			2	1122	-			304			C2H2-type 2.		B3KQ53|Q8WTR1	Missense_Mutation	SNP	ENST00000373656.3	37	c.910G>T	CCDS6847.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.208227	0.58343	.	.	ENSG00000171448	ENST00000373656;ENST00000373654	T;T	0.52057	0.68;0.68	5.85	4.95	0.65309	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.76399	0.3982	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83588	0.0121	10	0.87932	D	0	.	15.0643	0.71980	0.0:0.932:0.0:0.068	.	304	Q9HCK0	ZBT26_HUMAN	C	304	ENSP00000362760:G304C;ENSP00000362758:G304C	ENSP00000362758:G304C	G	-	1	0	ZBTB26	124721125	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.089000	0.71384	1.480000	0.48289	0.655000	0.94253	GGC		0.458	ZBTB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053960.1	NM_020924		36	50	1	0	1.06647e-15	0.003755	1.41085e-15	36	50				
CA5B	11238	broad.mit.edu	37	X	15800702	15800702	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chrX:15800702G>T	ENST00000318636.3	+	8	1005	c.869G>T	c.(868-870)cGc>cTc	p.R290L	CA5B_ENST00000454127.2_Missense_Mutation_p.R290L	NM_007220.3	NP_009151.1	Q8WTZ4	CA5BL_HUMAN	carbonic anhydrase VB, mitochondrial	0						mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|lung(3)|prostate(1)|stomach(2)	9	Hepatocellular(33;0.183)					CTGATGAATCGCACTGTTCGT	0.493																																							uc004cxe.2		NA																	0					0						c.(868-870)CGC>CTC		carbonic anhydrase VB, mitochondrial precursor							109.0	85.0	93.0					X																	15800702		2203	4300	6503	SO:0001583	missense	11238				one-carbon metabolic process	mitochondrion	carbonate dehydratase activity|zinc ion binding	g.chrX:15800702G>T	AB021660	CCDS14171.1	Xp22.1	2008-08-13			ENSG00000169239	ENSG00000169239		"""Carbonic anhydrases"""	1378	protein-coding gene	gene with protein product		300230				10409679	Standard	XM_005274442		Approved		uc004cxe.3	Q9Y2D0	OTTHUMG00000021183	ENST00000318636.3:c.869G>T	X.37:g.15800702G>T	ENSP00000314099:p.Arg290Leu		Somatic					p.R290L	NM_007220	NP_009151	WXS	Illumina HiSeq	Unspecified	Q9Y2D0	CAH5B_HUMAN			8	986	+	Hepatocellular(33;0.183)		290					A6NEZ4	Missense_Mutation	SNP	ENST00000318636.3	37	c.869G>T	CCDS14171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.322933	0.95708	.	.	ENSG00000169239	ENST00000318636;ENST00000454127	T;T	0.78595	-1.19;-1.19	5.9	5.9	0.94986	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.93006	0.7774	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95444	0.8528	10	0.87932	D	0	-13.5196	16.4647	0.84074	0.0:0.0:1.0:0.0	.	290	Q9Y2D0	CAH5B_HUMAN	L	290	ENSP00000314099:R290L;ENSP00000417021:R290L	ENSP00000314099:R290L	R	+	2	0	CA5B	15710623	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.977000	0.93446	2.495000	0.84180	0.544000	0.68410	CGC		0.493	CA5B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354933.1	NM_007220		8	26	1	0	1.06961e-07	0.00308	1.25779e-07	8	26				
KDM5C	8242	broad.mit.edu	37	X	53228025	53228025	+	Silent	SNP	C	C	A			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chrX:53228025C>A	ENST00000375401.3	-	16	2821	c.2289G>T	c.(2287-2289)ctG>ctT	p.L763L	KDM5C_ENST00000375383.3_Silent_p.L722L|KDM5C_ENST00000404049.3_Silent_p.L762L|KDM5C_ENST00000452825.3_Silent_p.L696L|KDM5C_ENST00000375379.3_Silent_p.L763L|KDM5C_ENST00000465402.1_5'Flank	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	763					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CCCGAACCTTCAGCTTATGCA	0.587			"""N, F, S"""		clear cell renal carcinoma																																		uc004drz.2		NA		Rec	yes		X	Xp11.22-p11.21	8242	N|F|S	lysine (K)-specific demethylase 5C (JARID1C)			E			clear cell renal carcinoma		0				kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						c.(2287-2289)CTG>CTT		jumonji, AT rich interactive domain 1C isoform							114.0	80.0	92.0					X																	53228025		2203	4300	6503	SO:0001819	synonymous_variant	8242				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	g.chrX:53228025C>A	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2289G>T	X.37:g.53228025C>A			Somatic				KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Silent_p.L696L|KDM5C_uc004dsa.2_Silent_p.L762L	p.L763L	NM_004187	NP_004178	WXS	Illumina HiSeq	Unspecified	P41229	KDM5C_HUMAN			16	2822	-			763					B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	ENST00000375401.3	37	c.2289G>T	CCDS14351.1																																																																																				0.587	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		9	56	1	0	3.09899e-07	0.004482	3.54569e-07	9	56				
GPR112	139378	broad.mit.edu	37	X	135432398	135432398	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7914-01A-11D-2167-08	TCGA-55-7914-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	59bffff6-361e-4517-b620-42bb23398b5c	7fc655ab-9a59-4b5b-9b79-a38e3138445d	g.chrX:135432398T>C	ENST00000394143.1	+	6	6824	c.6533T>C	c.(6532-6534)cTt>cCt	p.L2178P	GPR112_ENST00000287534.4_Missense_Mutation_p.L2115P|GPR112_ENST00000370652.1_Missense_Mutation_p.L2178P|GPR112_ENST00000412101.1_Missense_Mutation_p.L1973P|GPR112_ENST00000394141.1_Missense_Mutation_p.L1973P	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2178					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CTGGACTCCCTTCTAAATATA	0.428																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(6532-6534)CTT>CCT		G-protein coupled receptor 112							154.0	137.0	143.0					X																	135432398		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135432398T>C	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6533T>C	X.37:g.135432398T>C	ENSP00000377699:p.Leu2178Pro		Somatic				GPR112_uc010nsb.1_Missense_Mutation_p.L1973P|GPR112_uc010nsc.1_Missense_Mutation_p.L1945P	p.L2178P	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			6	6824	+	Acute lymphoblastic leukemia(192;0.000127)		2178			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.6533T>C	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	t	1.042	-0.678530	0.03378	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.35236	1.38;1.38;1.34;1.32;1.34	3.38	2.2	0.27929	.	.	.	.	.	T	0.22282	0.0537	L	0.27053	0.805	0.09310	N	1	B;B;B	0.21225	0.053;0.053;0.006	B;B;B	0.19391	0.025;0.025;0.003	T	0.21415	-1.0246	9	0.32370	T	0.25	.	4.7651	0.13128	0.0:0.153:0.0:0.847	.	2115;1973;2178	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	P	2178;2178;1973;2115;1973	ENSP00000377699:L2178P;ENSP00000359686:L2178P;ENSP00000416526:L1973P;ENSP00000287534:L2115P;ENSP00000377697:L1973P	ENSP00000287534:L2115P	L	+	2	0	GPR112	135260064	0.577000	0.26708	0.002000	0.10522	0.081000	0.17604	1.399000	0.34566	0.377000	0.24735	0.352000	0.21897	CTT		0.428	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			52	87	0	0	0	0.01441	0	52	87				
