#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CASZ1	54897	broad.mit.edu	37	1	10725565	10725565	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:10725565C>T	ENST00000377022.3	-	5	397	c.80G>A	c.(79-81)gGt>gAt	p.G27D	CASZ1_ENST00000478728.2_5'UTR|CASZ1_ENST00000344008.5_Missense_Mutation_p.G27D	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	27					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G27V(1)|p.G27D(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CTTCAGGCCACCCTTGCGTTT	0.692																																							uc001aro.2		NA																	2	Substitution - Missense(2)		lung(1)|prostate(1)	skin(1)	1						c.(79-81)GGT>GAT		castor homolog 1, zinc finger isoform a							14.0	17.0	16.0					1																	10725565		2135	4226	6361	SO:0001583	missense	54897				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr1:10725565C>T	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.80G>A	1.37:g.10725565C>T	ENSP00000366221:p.Gly27Asp		Somatic				CASZ1_uc001arp.1_Missense_Mutation_p.G27D|CASZ1_uc009vmx.2_Missense_Mutation_p.G51D	p.G27D	NM_001079843	NP_001073312	WXS	Illumina HiSeq	Unspecified	Q86V15	CASZ1_HUMAN	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)	5	400	-	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	27					Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	c.80G>A	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022778	0.93462	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	4.48	4.48	0.54585	.	0.000000	0.64402	D	0.000004	T	0.66915	0.2838	L	0.29908	0.895	0.53688	D	0.999974	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.72246	-0.4349	9	0.87932	D	0	-17.3102	17.5615	0.87909	0.0:1.0:0.0:0.0	.	51;27;27	B7Z1S3;Q86V15-2;Q86V15	.;.;CASZ1_HUMAN	D	27	.	ENSP00000339445:G27D	G	-	2	0	CASZ1	10648152	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.418000	0.80167	2.222000	0.72286	0.555000	0.69702	GGT		0.692	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766		2	1	0	0	0	0.004672	0	2	1				
AKR7A3	22977	broad.mit.edu	37	1	19610596	19610596	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:19610596T>A	ENST00000361640.4	-	6	1268	c.728A>T	c.(727-729)gAg>gTg	p.E243V		NM_012067.2	NP_036199.2	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	243					cellular aldehyde metabolic process (GO:0006081)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)	p.E243V(1)		NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)	13		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GGCAATGCCCTCAAAGTGGTG	0.647																																							uc001bbv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(727-729)GAG>GTG		aldo-keto reductase family 7, member A3							47.0	47.0	47.0					1																	19610596		2199	4300	6499	SO:0001583	missense	22977				cellular aldehyde metabolic process	cytosol	aldo-keto reductase (NADP) activity|electron carrier activity	g.chr1:19610596T>A	AF040639	CCDS193.1	1p36.13	2008-05-14			ENSG00000162482	ENSG00000162482		"""Aldo-keto reductases"""	390	protein-coding gene	gene with protein product		608477				10383892	Standard	NM_012067		Approved		uc001bbv.1	O95154	OTTHUMG00000002523	ENST00000361640.4:c.728A>T	1.37:g.19610596T>A	ENSP00000355377:p.Glu243Val		Somatic					p.E243V	NM_012067	NP_036199	WXS	Illumina HiSeq	Unspecified	O95154	ARK73_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	6	805	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	243					Q86SR4|Q8IVN6|Q8N5V6|Q8TAX1|Q9NUC3	Missense_Mutation	SNP	ENST00000361640.4	37	c.728A>T	CCDS193.1	.	.	.	.	.	.	.	.	.	.	.	12.65	2.002138	0.35320	.	.	ENSG00000162482	ENST00000361640	T	0.04970	3.52	3.96	3.96	0.45880	NADP-dependent oxidoreductase domain (3);	0.741807	0.13760	N	0.364635	T	0.09423	0.0232	L	0.52573	1.65	0.40659	D	0.982111	B	0.23490	0.086	B	0.30943	0.122	T	0.07271	-1.0781	10	0.72032	D	0.01	.	10.8557	0.46798	0.0:0.0:0.0:1.0	.	243	O95154	ARK73_HUMAN	V	243	ENSP00000355377:E243V	ENSP00000355377:E243V	E	-	2	0	AKR7A3	19483183	0.980000	0.34600	0.952000	0.39060	0.215000	0.24574	4.869000	0.63028	1.438000	0.47492	0.155000	0.16302	GAG		0.647	AKR7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007166.1	NM_012067		12	6	0	0	0	0.00245	0	12	6				
ARID1A	8289	broad.mit.edu	37	1	27106171	27106171	+	Nonsense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:27106171A>T	ENST00000324856.7	+	20	6153	c.5782A>T	c.(5782-5784)Aag>Tag	p.K1928*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.K1545*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.K256*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.K1711*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1928					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.K1928*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGATGGAGCTAAGAGTTCAGA	0.542			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		1	Substitution - Nonsense(1)		lung(1)	ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(5782-5784)AAG>TAG		AT rich interactive domain 1A isoform a							124.0	122.0	123.0					1																	27106171		2203	4300	6503	SO:0001587	stop_gained	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27106171A>T	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5782A>T	1.37:g.27106171A>T	ENSP00000320485:p.Lys1928*		Somatic				ARID1A_uc001bmu.1_Nonsense_Mutation_p.K1711*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.K774*|ARID1A_uc009vsm.1_Nonsense_Mutation_p.K256*|ARID1A_uc009vsn.1_Nonsense_Mutation_p.K170*	p.K1928*	NM_006015	NP_006006	WXS	Illumina HiSeq	Unspecified	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	20	6155	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	1928					D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	c.5782A>T	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	38|38	7.232613|7.232613	0.98154|0.98154	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|.	.|.	.|.	4.84|4.84	2.42|2.42	0.29668|0.29668	.|.	0.120773|.	0.53938|.	D|.	0.000041|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	-11.0804|-11.0804	9.1934|9.1934	0.37213|0.37213	0.7102:0.0:0.0:0.2898|0.7102:0.0:0.0:0.2898	.|.	.|.	.|.	.|.	X|L	1928;1711;1545;256|824	.|.	ENSP00000320485:K1928X|.	K|X	+|+	1|2	0|2	ARID1A|ARID1A	26978758|26978758	1.000000|1.000000	0.71417|0.71417	0.934000|0.934000	0.37439|0.37439	0.206000|0.206000	0.24218|0.24218	4.939000|4.939000	0.63526|0.63526	0.387000|0.387000	0.25024|0.25024	-0.669000|-0.669000	0.03829|0.03829	AAG|TAA		0.542	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		174	157	0	0	0	0.00361	0	174	157				
TMEM222	84065	broad.mit.edu	37	1	27658583	27658583	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:27658583A>T	ENST00000374076.4	+	3	340	c.302A>T	c.(301-303)aAg>aTg	p.K101M	TMEM222_ENST00000608611.1_Missense_Mutation_p.K68M	NM_032125.2	NP_115501.2	Q9H0R3	TM222_HUMAN	transmembrane protein 222	101				K -> E (in Ref. 5; BAD96362). {ECO:0000305}.		integral component of membrane (GO:0016021)		p.K101M(1)		biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						GCCTTTGGAAAGCCTGCCAAG	0.577																																							uc001bnr.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(301-303)AAG>ATG		transmembrane protein 222							158.0	140.0	146.0					1																	27658583		2203	4300	6503	SO:0001583	missense	84065					integral to membrane	protein binding	g.chr1:27658583A>T	AL136683	CCDS297.2	1p36.11	2008-07-07	2008-07-07	2008-07-07	ENSG00000186501	ENSG00000186501			25363	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 160"""	C1orf160		11230166	Standard	NM_032125		Approved	DKFZP564D0478	uc001bnr.4	Q9H0R3	OTTHUMG00000004410	ENST00000374076.4:c.302A>T	1.37:g.27658583A>T	ENSP00000363189:p.Lys101Met		Somatic				TMEM222_uc001bns.3_RNA|TMEM222_uc001bnt.3_RNA|TMEM222_uc001bnu.3_RNA	p.K101M	NM_032125	NP_115501	WXS	Illumina HiSeq	Unspecified	Q9H0R3	TM222_HUMAN			3	355	+			101	K -> E (in Ref. 5; BAD96362).		Cytoplasmic (Potential).		D3DPL6|Q53HD8|Q5FVE9	Missense_Mutation	SNP	ENST00000374076.4	37	c.302A>T	CCDS297.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	19.80|19.80	3.895178|3.895178	0.72639|0.72639	.|.	.|.	ENSG00000186501|ENSG00000186501	ENST00000374076;ENST00000374073;ENST00000498220|ENST00000466759;ENST00000464813	.|.	.|.	.|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.165188|0.165188	0.52532|0.52532	D|D	0.000067|0.000067	T|T	0.78097|0.78097	0.4230|0.4230	M|M	0.84219|0.84219	2.685|2.685	0.51012|0.51012	D|D	0.999908|0.999908	D|.	0.89917|.	1.0|.	D|.	0.71870|.	0.975|.	T|T	0.80185|0.80185	-0.1487|-0.1487	9|6	0.54805|.	T|.	0.06|.	-25.3852|-25.3852	15.3571|15.3571	0.74434|0.74434	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	101|.	Q9H0R3|.	TM222_HUMAN|.	M|N	101;68;67|82;73	.|.	ENSP00000363186:K68M|.	K|K	+|+	2|3	0|2	TMEM222|TMEM222	27531170|27531170	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.534000|3.534000	0.53568|0.53568	2.228000|2.228000	0.72767|0.72767	0.449000|0.449000	0.29647|0.29647	AAG|AAA		0.577	TMEM222-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000012809.2	NM_032125		82	72	0	0	0	0.00361	0	82	72				
PHACTR4	65979	broad.mit.edu	37	1	28807101	28807101	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:28807101G>A	ENST00000373839.3	+	9	2006	c.1745G>A	c.(1744-1746)gGa>gAa	p.G582E	PHACTR4_ENST00000493669.1_3'UTR|RNU6ATAC27P_ENST00000408289.1_RNA|PHACTR4_ENST00000373836.3_Missense_Mutation_p.G592E	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	582					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)	p.G592E(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		CACCAGATTGGAAACACACTG	0.413																																							uc001bpw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1744-1746)GGA>GAA		phosphatase and actin regulator 4 isoform 1							226.0	208.0	213.0					1																	28807101		2002	4171	6173	SO:0001583	missense	65979						actin binding|protein phosphatase inhibitor activity	g.chr1:28807101G>A	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1745G>A	1.37:g.28807101G>A	ENSP00000362945:p.Gly582Glu		Somatic				PHACTR4_uc001bpv.1_RNA|PHACTR4_uc001bpx.2_Missense_Mutation_p.G566E|PHACTR4_uc001bpy.2_Missense_Mutation_p.G592E	p.G582E	NM_001048183	NP_001041648	WXS	Illumina HiSeq	Unspecified	Q8IZ21	PHAR4_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)	9	2027	+		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)	582					A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	ENST00000373839.3	37	c.1745G>A	CCDS41293.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590659	0.86851	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.26660	1.72;1.72	5.62	5.62	0.85841	.	0.141783	0.64402	D	0.000006	T	0.49270	0.1547	M	0.64404	1.975	0.80722	D	1	P;D	0.89917	0.526;1.0	B;D	0.91635	0.413;0.999	T	0.21552	-1.0242	10	0.27082	T	0.32	-6.9848	18.6228	0.91327	0.0:0.0:1.0:0.0	.	592;582	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	E	582;592;581	ENSP00000362945:G582E;ENSP00000362942:G592E	ENSP00000362942:G592E	G	+	2	0	PHACTR4	28679688	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	7.913000	0.87471	2.643000	0.89663	0.579000	0.79373	GGA		0.413	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	NM_023923		69	258	0	0	0	0.00361	0	69	258				
DCDC2B	149069	broad.mit.edu	37	1	32678391	32678391	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:32678391G>A	ENST00000409358.1	+	6	711	c.711G>A	c.(709-711)caG>caA	p.Q237Q		NM_001099434.1	NP_001092904.1	A2VCK2	DCD2B_HUMAN	doublecortin domain containing 2B	237					intracellular signal transduction (GO:0035556)			p.Q237Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CCCACAGGCAGGGGGTAGGTG	0.557																																							uc001bun.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(709-711)CAG>CAA		doublecortin domain containing 2B							79.0	81.0	80.0					1																	32678391		2002	4166	6168	SO:0001819	synonymous_variant	149069				intracellular signal transduction			g.chr1:32678391G>A	BC128073	CCDS44100.1	1p35.1	2008-05-13			ENSG00000222046	ENSG00000222046			32576	protein-coding gene	gene with protein product							Standard	NM_001099434		Approved		uc001bun.2	A2VCK2	OTTHUMG00000005741	ENST00000409358.1:c.711G>A	1.37:g.32678391G>A			Somatic					p.Q237Q	NM_001099434	NP_001092904	WXS	Illumina HiSeq	Unspecified	A2VCK2	DCD2B_HUMAN			6	711	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)	237					B7ZBC6	Silent	SNP	ENST00000409358.1	37	c.711G>A	CCDS44100.1																																																																																				0.557	DCDC2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328293.1	XM_940631		12	44	0	0	0	0.004007	0	12	44				
AK2	204	broad.mit.edu	37	1	33478994	33478994	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:33478994C>T	ENST00000373449.2	-	6	549	c.508G>A	c.(508-510)Gaa>Aaa	p.E170K	AK2_ENST00000354858.6_Missense_Mutation_p.E170K|AK2_ENST00000467905.1_Missense_Mutation_p.E170K|AK2_ENST00000491241.1_5'Flank|RP1-117O3.2_ENST00000427524.1_RNA|AK2_ENST00000548033.1_Missense_Mutation_p.E128K|AK2_ENST00000480134.1_3'UTR	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2									p.E170K(2)		kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				ATCAAGGGTTCCCCGGTGATC	0.473																																							uc001bwp.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(508-510)GAA>AAA		adenylate kinase 2 isoform a							50.0	47.0	48.0					1																	33478994		2203	4300	6503	SO:0001583	missense	204				nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding	g.chr1:33478994C>T	U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.508G>A	1.37:g.33478994C>T	ENSP00000362548:p.Glu170Lys		Somatic				uc001bwn.2_Intron|AK2_uc001bwo.1_Missense_Mutation_p.E170K|AK2_uc010ohq.1_Missense_Mutation_p.E162K|AK2_uc009vud.1_Missense_Mutation_p.E128K|AK2_uc010ohr.1_Missense_Mutation_p.E122K|AK2_uc001bwq.1_Missense_Mutation_p.E122K	p.E170K	NM_001625	NP_001616	WXS	Illumina HiSeq	Unspecified	P54819	KAD2_HUMAN			6	550	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)	170						Missense_Mutation	SNP	ENST00000373449.2	37	c.508G>A	CCDS373.1	.	.	.	.	.	.	.	.	.	.	C	36	5.736151	0.96865	.	.	ENSG00000004455	ENST00000373449;ENST00000548033;ENST00000467905;ENST00000354858;ENST00000398192	T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15	5.17	5.17	0.71159	Adenylate kinase, active site lid domain (1);	0.000000	0.85682	D	0.000000	D	0.91643	0.7359	H	0.96365	3.81	0.80722	D	1	D;P;D;D	0.64830	0.992;0.956;0.994;0.992	P;P;P;P	0.62649	0.846;0.718;0.905;0.846	D	0.93853	0.7147	10	0.87932	D	0	-28.0908	19.5674	0.95401	0.0:1.0:0.0:0.0	.	162;128;170;170	P54819-5;F8VY04;P54819;P54819-2	.;.;KAD2_HUMAN;.	K	170;128;170;170;170	ENSP00000362548:E170K;ENSP00000449003:E128K;ENSP00000447082:E170K;ENSP00000346921:E170K	ENSP00000346921:E170K	E	-	1	0	AK2	33251581	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.786000	0.85741	2.793000	0.96121	0.563000	0.77884	GAA		0.473	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011884.1	NM_001625		8	18	0	0	0	0.006214	0	8	18				
SPATA6	54558	broad.mit.edu	37	1	48850997	48850997	+	Missense_Mutation	SNP	C	C	A	rs562916912	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:48850997C>A	ENST00000371847.3	-	9	1057	c.893G>T	c.(892-894)cGa>cTa	p.R298L	SPATA6_ENST00000371843.3_Missense_Mutation_p.R298L|SPATA6_ENST00000396199.3_Missense_Mutation_p.R226L	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	298					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)		p.R298L(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						ATCCTTGGGTCGGCAGCAGCC	0.299																																							uc001crr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(892-894)CGA>CTA		spermatogenesis associated 6 precursor							76.0	75.0	75.0					1																	48850997		2203	4295	6498	SO:0001583	missense	54558				cell differentiation|multicellular organismal development|spermatogenesis	extracellular region		g.chr1:48850997C>A	AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.893G>T	1.37:g.48850997C>A	ENSP00000360913:p.Arg298Leu		Somatic				SPATA6_uc001crs.1_Missense_Mutation_p.R298L|SPATA6_uc010omv.1_Missense_Mutation_p.R284L	p.R298L	NM_019073	NP_061946	WXS	Illumina HiSeq	Unspecified	Q9NWH7	SPAT6_HUMAN			9	1058	-			298					Q5T3N7|Q8WUE6	Missense_Mutation	SNP	ENST00000371847.3	37	c.893G>T	CCDS551.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.974830	0.34848	.	.	ENSG00000132122	ENST00000371847;ENST00000371843;ENST00000396199;ENST00000371841	T;T;T;T	0.67345	2.54;1.64;2.52;-0.26	5.09	4.18	0.49190	.	0.506171	0.19696	N	0.108143	T	0.74275	0.3695	L	0.46157	1.445	0.37963	D	0.93302	B;D;D	0.67145	0.212;0.996;0.996	B;D;D	0.79108	0.127;0.992;0.992	T	0.77874	-0.2425	10	0.87932	D	0	.	9.9242	0.41483	0.0:0.9076:0.0:0.0924	.	226;298;298	B4DX17;Q9NWH7-2;Q9NWH7	.;.;SPAT6_HUMAN	L	298;298;226;139	ENSP00000360913:R298L;ENSP00000360909:R298L;ENSP00000379502:R226L;ENSP00000360907:R139L	ENSP00000360907:R139L	R	-	2	0	SPATA6	48623584	0.396000	0.25262	0.221000	0.23827	0.910000	0.53928	1.169000	0.31871	1.525000	0.49052	-0.234000	0.12200	CGA		0.299	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021347.1	NM_019073		9	40	1	0	0.006122	0.006122	0.00632127	9	40				
CC2D1B	200014	broad.mit.edu	37	1	52821917	52821917	+	Missense_Mutation	SNP	C	C	A	rs372005019		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:52821917C>A	ENST00000371586.2	-	18	2151	c.2013G>T	c.(2011-2013)caG>caT	p.Q671H	CC2D1B_ENST00000460261.1_5'UTR|CC2D1B_ENST00000438831.1_Missense_Mutation_p.Q46H|CC2D1B_ENST00000284376.3_Missense_Mutation_p.Q665H|RP11-155O18.6_ENST00000606527.1_RNA	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	671						nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.Q671H(1)		breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						GGCCCTGAGCCTGGGCCAGCT	0.567																																							uc001ctq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2011-2013)CAG>CAT		coiled-coil and C2 domain containing 1B							120.0	121.0	121.0					1																	52821917		2203	4300	6503	SO:0001583	missense	200014							g.chr1:52821917C>A	AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.2013G>T	1.37:g.52821917C>A	ENSP00000360642:p.Gln671His		Somatic				CC2D1B_uc001ctr.2_Missense_Mutation_p.Q211H|CC2D1B_uc001cts.2_Missense_Mutation_p.Q356H	p.Q671H	NM_032449	NP_115825	WXS	Illumina HiSeq	Unspecified	Q5T0F9	C2D1B_HUMAN			18	2151	-			671					Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	ENST00000371586.2	37	c.2013G>T	CCDS30714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.95|15.95	2.983063|2.983063	0.53827|0.53827	.|.	.|.	ENSG00000154222|ENSG00000154222	ENST00000371586;ENST00000284376;ENST00000371573;ENST00000438831|ENST00000438021;ENST00000450942	T;T;T|.	0.15017|.	2.46;2.46;2.46|.	5.09|5.09	2.01|2.01	0.26516|0.26516	.|.	0.062767|.	0.64402|.	D|.	0.000004|.	T|T	0.37972|0.37972	0.1023|0.1023	N|N	0.20401|0.20401	0.57|0.57	0.40400|0.40400	D|D	0.979634|0.979634	P;P;P|.	0.52061|.	0.916;0.95;0.916|.	P;P;P|.	0.56434|.	0.633;0.798;0.633|.	T|T	0.09885|0.09885	-1.0654|-1.0654	10|5	0.13108|.	T|.	0.6|.	-11.2546|-11.2546	7.8503|7.8503	0.29451|0.29451	0.0:0.633:0.0:0.367|0.0:0.633:0.0:0.367	.|.	451;665;671|.	Q5T0G1;Q5T0F9-2;Q5T0F9|.	.;.;C2D1B_HUMAN|.	H|M	671;665;579;46|452;585	ENSP00000360642:Q671H;ENSP00000284376:Q665H;ENSP00000406300:Q46H|.	ENSP00000284376:Q665H|.	Q|R	-|-	3|2	2|0	CC2D1B|CC2D1B	52594505|52594505	0.975000|0.975000	0.34042|0.34042	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	0.115000|0.115000	0.15540|0.15540	0.666000|0.666000	0.31087|0.31087	0.561000|0.561000	0.74099|0.74099	CAG|AGG		0.567	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022189.1	NM_032449		26	92	1	0	5.60225e-13	0.009535	6.89415e-13	26	92				
LRRC40	55631	broad.mit.edu	37	1	70652948	70652948	+	Splice_Site	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:70652948C>A	ENST00000370952.3	-	3	486	c.407G>T	c.(406-408)aGc>aTc	p.S136I		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	136						membrane (GO:0016020)		p.S136I(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						TAATTTTTACCTGACATTAAG	0.249																																							uc001der.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(406-408)AGC>ATC		leucine rich repeat containing 40							56.0	60.0	59.0					1																	70652948		2197	4288	6485	SO:0001630	splice_region_variant	55631							g.chr1:70652948C>A		CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.407+1G>T	1.37:g.70652948C>A			Somatic					p.S136I	NM_017768	NP_060238	WXS	Illumina HiSeq	Unspecified	Q9H9A6	LRC40_HUMAN			3	459	-			136			LRR 3.		Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	SNP	ENST00000370952.3	37	c.407G>T	CCDS646.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.652466	0.88056	.	.	ENSG00000066557	ENST00000370952	T	0.62105	0.05	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.82305	0.5008	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.84776	0.0770	9	.	.	.	.	19.7061	0.96072	0.0:1.0:0.0:0.0	.	136	Q9H9A6	LRC40_HUMAN	I	136	ENSP00000359990:S136I	.	S	-	2	0	LRRC40	70425536	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.156000	0.71840	2.741000	0.93983	0.655000	0.94253	AGC		0.249	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025914.1	NM_017768	Missense_Mutation	15	9	1	0	5.03518e-11	0.007413	5.98977e-11	15	9				
MCOLN2	255231	broad.mit.edu	37	1	85418191	85418191	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:85418191C>A	ENST00000370608.3	-	5	655	c.588G>T	c.(586-588)caG>caT	p.Q196H	MCOLN2_ENST00000284027.5_Missense_Mutation_p.Q168H|MCOLN2_ENST00000531325.1_5'UTR	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	196					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q196H(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		TGGAGAGGTCCTGAAGGTCTA	0.388																																							uc001dkm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(586-588)CAG>CAT		mucolipin 2							74.0	78.0	77.0					1																	85418191		2203	4300	6503	SO:0001583	missense	255231					integral to membrane	ion channel activity	g.chr1:85418191C>A	AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.588G>T	1.37:g.85418191C>A	ENSP00000359640:p.Gln196His		Somatic				MCOLN2_uc001dkn.2_RNA	p.Q196H	NM_153259	NP_694991	WXS	Illumina HiSeq	Unspecified	Q8IZK6	MCLN2_HUMAN		all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)	5	829	-			196					A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	ENST00000370608.3	37	c.588G>T	CCDS30762.1	.	.	.	.	.	.	.	.	.	.	C	9.601	1.128673	0.21041	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.52526	0.66;0.66	5.1	1.68	0.24146	.	0.301485	0.36167	N	0.002755	T	0.23492	0.0568	M	0.62723	1.935	0.09310	N	1	P	0.38642	0.641	B	0.34824	0.19	T	0.06481	-1.0824	10	0.51188	T	0.08	-31.9342	10.0634	0.42288	0.0:0.715:0.0:0.285	.	196	Q8IZK6	MCLN2_HUMAN	H	196;168	ENSP00000359640:Q196H;ENSP00000284027:Q168H	ENSP00000284027:Q168H	Q	-	3	2	MCOLN2	85190779	0.001000	0.12720	0.034000	0.17996	0.038000	0.13279	0.443000	0.21644	0.651000	0.30788	0.655000	0.94253	CAG		0.388	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259		59	35	1	0	3.41413e-29	0.00361	4.9105e-29	59	35				
HSP90B3P	343477	broad.mit.edu	37	1	92109180	92109180	+	IGR	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:92109180G>T								CDC7 (117859 upstream) : TGFBR3 (36721 downstream)																							GTGTGCTTTGGTGGCCAGCCA	0.473																																							uc010osx.1		NA																	0					0						c.(1207-1209)GTG>TTG		SubName: Full=cDNA FLJ58812, highly similar to Endoplasmin (Heat shock protein 90kDa beta member 1);																																				SO:0001628	intergenic_variant	343477							g.chr1:92109180G>T																													1.37:g.92109180G>T			Somatic					p.V403L	NR_003130		WXS	Illumina HiSeq	Unspecified					3	1207	+									Missense_Mutation	SNP		37	c.1207G>T																																																																																				0	0.473									33	17	1	0	4.67007e-22	0.00874	6.42556e-22	33	17				
COL11A1	1301	broad.mit.edu	37	1	103471410	103471410	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:103471410C>A	ENST00000370096.3	-	18	2141	c.1829G>T	c.(1828-1830)gGt>gTt	p.G610V	COL11A1_ENST00000358392.2_Missense_Mutation_p.G622V|COL11A1_ENST00000512756.1_Missense_Mutation_p.G494V|COL11A1_ENST00000353414.4_Missense_Mutation_p.G571V|COL11A1_ENST00000461720.1_5'UTR	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	610	Collagen-like 3.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.G622V(1)|p.G610V(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACCTTTGTCACCTGGCAGACC	0.363																																							uc001dul.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(1828-1830)GGT>GTT		alpha 1 type XI collagen isoform A							92.0	99.0	97.0					1																	103471410		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103471410C>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1829G>T	1.37:g.103471410C>A	ENSP00000359114:p.Gly610Val		Somatic				COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.G622V|COL11A1_uc001dun.2_Missense_Mutation_p.G571V|COL11A1_uc009weh.2_Missense_Mutation_p.G494V	p.G610V	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	18	2147	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	610			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.1829G>T	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864940	0.91511	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.99186	-5.53;-5.53;-5.53;-5.53	5.73	5.73	0.89815	.	0.054889	0.64402	D	0.000001	D	0.99677	0.9879	H	0.97918	4.105	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97601	1.0123	10	0.87932	D	0	.	19.8959	0.96958	0.0:1.0:0.0:0.0	.	494;571;622;610	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	V	610;622;571;494	ENSP00000359114:G610V;ENSP00000351163:G622V;ENSP00000302551:G571V;ENSP00000426533:G494V	ENSP00000302551:G571V	G	-	2	0	COL11A1	103243998	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.362000	0.79507	2.704000	0.92352	0.655000	0.94253	GGT		0.363	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		74	58	1	0	8.2166e-39	0.00361	1.29247e-38	74	58				
VAV3	10451	broad.mit.edu	37	1	108315358	108315358	+	Splice_Site	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:108315358G>T	ENST00000370056.4	-	5	828	c.554C>A	c.(553-555)cCc>cAc	p.P185H	VAV3_ENST00000527011.1_Splice_Site_p.P185H|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000371846.4_Splice_Site_p.P120H	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	185					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.P185H(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		AAGTCCTACGGGCTGATGTGC	0.348																																							uc001dvk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(2)|breast(2)	9						c.(553-555)CCC>CAC		vav 3 guanine nucleotide exchange factor isoform							142.0	131.0	135.0					1																	108315358		2203	4300	6503	SO:0001630	splice_region_variant	10451				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity	g.chr1:108315358G>T	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.555+1C>A	1.37:g.108315358G>T			Somatic				VAV3_uc010ouw.1_Missense_Mutation_p.P185H|VAV3_uc001dvl.1_Missense_Mutation_p.P9H|VAV3_uc010oux.1_Missense_Mutation_p.P185H	p.P185H	NM_006113	NP_006104	WXS	Illumina HiSeq	Unspecified	Q9UKW4	VAV3_HUMAN		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)	5	608	-		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)	185					B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	c.554C>A	CCDS785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.275226|4.275226	0.80580|0.80580	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846|ENST00000490388	T;T;T|T	0.59224|0.59502	0.28;0.28;1.17|0.26	5.92|5.92	3.01|3.01	0.34805|0.34805	Dbl homology (DH) domain (1);Calponin homology domain (1);|.	0.483859|0.483859	0.23185|0.23185	N|N	0.050976|0.050976	T|T	0.28466|0.28466	0.0704|0.0704	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	1|1	B;B;B;P|.	0.49783|.	0.051;0.051;0.088;0.928|.	B;B;B;P|.	0.50970|.	0.16;0.208;0.031;0.655|.	T|T	0.25537|0.25537	-1.0129|-1.0129	10|8	0.56958|0.10636	D|T	0.05|0.68	.|.	5.3724|5.3724	0.16146|0.16146	0.1504:0.0:0.5615:0.2881|0.1504:0.0:0.5615:0.2881	.|.	185;185;120;185|.	B7ZLR1;E9PQ97;B4DHL6;Q9UKW4|.	.;.;.;VAV3_HUMAN|.	H|T	185;185;120|180	ENSP00000359073:P185H;ENSP00000432540:P185H;ENSP00000360912:P120H|ENSP00000433559:P180T	ENSP00000359073:P185H|ENSP00000433559:P180T	P|P	-|-	2|1	0|0	VAV3|VAV3	108116881|108116881	0.904000|0.904000	0.30761|0.30761	0.045000|0.045000	0.18777|0.18777	0.893000|0.893000	0.52053|0.52053	2.369000|2.369000	0.44231|0.44231	0.819000|0.819000	0.34492|0.34492	0.655000|0.655000	0.94253|0.94253	CCC|CCA		0.348	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	Missense_Mutation	62	23	1	0	6.20203e-27	0.00361	8.76575e-27	62	23				
NBPF7	343505	broad.mit.edu	37	1	120381810	120381810	+	IGR	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:120381810G>A								REG4 (27527 upstream) : ADAM30 (54345 downstream)														p.L279L(1)									AGGTTACCCAGAAGAATGTTT	0.388																																							uc010oxk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(835-837)CTG>TTG		hypothetical protein LOC343505							136.0	136.0	136.0					1																	120381810		2090	4237	6327	SO:0001628	intergenic_variant	343505					cytoplasm		g.chr1:120381810G>A																													1.37:g.120381810G>A			Somatic					p.L279L	NM_001047980	NP_001041445	WXS	Illumina HiSeq	Unspecified	P0C2Y1	NBPF7_HUMAN		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)	5	1456	-	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)	279			NBPF 1.			Silent	SNP		37	c.835C>T																																																																																				0	0.388									6	205	0	0	0	0.001984	0	6	205				
NBPF7	343505	broad.mit.edu	37	1	120381813	120381813	+	IGR	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:120381813G>A								REG4 (27530 upstream) : ADAM30 (54342 downstream)														p.L278F(1)									TTACCCAGAAGAATGTTTAGA	0.388																																							uc010oxk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(832-834)CTT>TTT		hypothetical protein LOC343505							140.0	141.0	141.0					1																	120381813		2101	4240	6341	SO:0001628	intergenic_variant	343505					cytoplasm		g.chr1:120381813G>A																													1.37:g.120381813G>A			Somatic					p.L278F	NM_001047980	NP_001041445	WXS	Illumina HiSeq	Unspecified	P0C2Y1	NBPF7_HUMAN		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)	5	1453	-	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)	278			NBPF 1.			Missense_Mutation	SNP		37	c.832C>T																																																																																				0	0.388									7	227	0	0	0	0.004482	0	7	227				
PIP5K1A	8394	broad.mit.edu	37	1	151171540	151171540	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:151171540C>T	ENST00000368888.4	+	1	490	c.68C>T	c.(67-69)tCc>tTc	p.S23F	PIP5K1A_ENST00000441902.2_Missense_Mutation_p.S23F|PIP5K1A_ENST00000409426.1_Missense_Mutation_p.S23F|PIP5K1A_ENST00000368890.4_Missense_Mutation_p.S23F	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	23					actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)	p.S23F(1)|p.S23C(1)		breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCGGTCCCTTCCTGTACCTTG	0.627																																					Pancreas(80;36 1443 2325 16095 21302)	Pancreas(80;36 1443 2325 16095 21302)	uc001exj.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(67-69)TCC>TTC		phosphatidylinositol-4-phosphate 5-kinase, type							89.0	95.0	93.0					1																	151171540		2203	4300	6503	SO:0001583	missense	8394				phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding	g.chr1:151171540C>T	U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.68C>T	1.37:g.151171540C>T	ENSP00000357883:p.Ser23Phe		Somatic				PIP5K1A_uc001exi.2_Missense_Mutation_p.S23F|PIP5K1A_uc010pcu.1_Missense_Mutation_p.S23F|PIP5K1A_uc001exk.2_Missense_Mutation_p.S23F	p.S23F	NM_001135638	NP_001129110	WXS	Illumina HiSeq	Unspecified	Q99755	PI51A_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)		1	520	+	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		23					A8K4Q0|B4DIN0|Q99754|Q99756	Missense_Mutation	SNP	ENST00000368888.4	37	c.68C>T	CCDS44219.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333434	0.24167	.	.	ENSG00000143398	ENST00000349792;ENST00000409426;ENST00000441902;ENST00000368890;ENST00000424999;ENST00000368888	T;T;T;T;T	0.33865	1.61;1.62;1.39;1.4;1.67	4.46	2.42	0.29668	.	1.555910	0.03354	N	0.196657	T	0.13457	0.0326	N	0.22421	0.69	0.18873	N	0.999986	P;B;B;B	0.36315	0.547;0.115;0.07;0.115	B;B;B;B	0.35470	0.203;0.124;0.058;0.124	T	0.30031	-0.9992	10	0.62326	D	0.03	.	10.6923	0.45877	0.0:0.6264:0.3736:0.0	.	23;23;23;23	Q99755-4;Q99755-2;Q99755;Q99755-3	.;.;PI51A_HUMAN;.	F	23	ENSP00000271663:S23F;ENSP00000386432:S23F;ENSP00000415648:S23F;ENSP00000357885:S23F;ENSP00000357883:S23F	ENSP00000271663:S23F	S	+	2	0	PIP5K1A	149438164	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	0.290000	0.18975	1.069000	0.40788	0.462000	0.41574	TCC		0.627	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034425.2	NM_003557		24	17	0	0	0	0.004656	0	24	17				
FLG	2312	broad.mit.edu	37	1	152285860	152285860	+	Missense_Mutation	SNP	C	C	T	rs145828067	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:152285860C>T	ENST00000368799.1	-	3	1537	c.1502G>A	c.(1501-1503)cGa>cAa	p.R501Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	501	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R501Q(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAGCTGTCTCGTGCCTGCTC	0.612									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(1501-1503)CGA>CAA		filaggrin		C	GLN/ARG	2,4404		0,2,2201	303.0	288.0	293.0		1502	-7.1	0.0	1	dbSNP_134	293	2,8598		0,2,4298	no	missense	FLG	NM_002016.1	43	0,4,6499	TT,TC,CC		0.0233,0.0454,0.0308	probably-damaging	501/4062	152285860	4,13002	2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152285860C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1502G>A	1.37:g.152285860C>T	ENSP00000357789:p.Arg501Gln		Somatic				uc001ezv.2_5'Flank	p.R501Q	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1538	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		501			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.1502G>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	4.507	0.094105	0.08632	4.54E-4	2.33E-4	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.01665	4.7	3.54	-7.08	0.01558	.	.	.	.	.	T	0.00328	0.0010	L	0.43152	1.355	0.09310	N	1	P	0.38129	0.619	B	0.32805	0.153	T	0.36432	-0.9748	9	0.07482	T	0.82	.	7.0258	0.24940	0.0773:0.5764:0.1528:0.1935	.	501	P20930	FILA_HUMAN	Q	501;33	ENSP00000357789:R501Q	ENSP00000357789:R501Q	R	-	2	0	FLG	150552484	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.875000	0.01634	-4.283000	0.00059	-0.458000	0.05436	CGA		0.612	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		10	300	0	0	0	0.000978	0	10	300				
FLG2	388698	broad.mit.edu	37	1	152329021	152329021	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:152329021G>A	ENST00000388718.5	-	3	1313	c.1241C>T	c.(1240-1242)tCc>tTc	p.S414F	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	414	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S414F(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCACATTTGGAAAATTCATT	0.423																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(1240-1242)TCC>TTC		filaggrin family member 2							119.0	119.0	119.0					1																	152329021		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152329021G>A	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1241C>T	1.37:g.152329021G>A	ENSP00000373370:p.Ser414Phe		Somatic				uc001ezv.2_Intron	p.S414F	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1314	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		414			Ser-rich.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.1241C>T	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207148	0.39003	.	.	ENSG00000143520	ENST00000388718	T	0.19806	2.12	4.15	4.15	0.48705	.	.	.	.	.	T	0.27134	0.0665	L	0.55481	1.735	0.21627	N	0.99962	D	0.89917	1.0	D	0.70716	0.97	T	0.02933	-1.1092	9	0.66056	D	0.02	-5.7435	11.7789	0.52001	0.0:0.0:1.0:0.0	.	414	Q5D862	FILA2_HUMAN	F	414	ENSP00000373370:S414F	ENSP00000373370:S414F	S	-	2	0	FLG2	150595645	0.296000	0.24398	0.461000	0.27105	0.061000	0.15899	3.045000	0.49838	2.149000	0.67028	0.462000	0.41574	TCC		0.423	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		45	158	0	0	0	0.00361	0	45	158				
LCE2C	353140	broad.mit.edu	37	1	152648744	152648744	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:152648744C>A	ENST00000368783.1	+	2	308	c.253C>A	c.(253-255)Cgg>Agg	p.R85R	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	85	Cys-rich.				keratinization (GO:0031424)			p.R85W(2)|p.R85R(1)		endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCACCGGCGCCGGCACCAGAG	0.682																																							uc001fah.2		NA																	3	Substitution - Missense(2)|Substitution - coding silent(1)		lung(1)|large_intestine(1)|prostate(1)		0						c.(253-255)CGG>AGG		late cornified envelope 2C							34.0	43.0	40.0					1																	152648744		2201	4297	6498	SO:0001819	synonymous_variant	353140				keratinization			g.chr1:152648744C>A		CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.253C>A	1.37:g.152648744C>A			Somatic					p.R85R	NM_178429	NP_848516	WXS	Illumina HiSeq	Unspecified	Q5TA81	LCE2C_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	308	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		85			Cys-rich.			Silent	SNP	ENST00000368783.1	37	c.253C>A	CCDS1019.1																																																																																				0.682	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034509.1	NM_178429		11	12	1	0	4.96729e-08	0.008871	5.62762e-08	11	12				
ILF2	3608	broad.mit.edu	37	1	153640105	153640105	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:153640105G>A	ENST00000361891.4	-	6	445	c.320C>T	c.(319-321)tCc>tTc	p.S107F	ILF2_ENST00000368681.1_Missense_Mutation_p.S107F	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	107	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)	p.S107F(1)		cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTTTTTATAGGATCCCACCTG	0.448																																							uc001fcr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(319-321)TCC>TTC		interleukin enhancer binding factor 2							308.0	288.0	295.0					1																	153640105		2203	4300	6503	SO:0001583	missense	3608				immune response|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|ribonucleoprotein complex	ATP binding|DNA binding|double-stranded RNA binding|protein binding|transferase activity	g.chr1:153640105G>A	U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.320C>T	1.37:g.153640105G>A	ENSP00000355011:p.Ser107Phe		Somatic				ILF2_uc010pdy.1_Missense_Mutation_p.S69F|ILF2_uc009wok.2_Missense_Mutation_p.S107F|ILF2_uc009wol.1_Missense_Mutation_p.S69F	p.S107F	NM_004515	NP_004506	WXS	Illumina HiSeq	Unspecified	Q12905	ILF2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		6	401	-	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		107			DZF.		A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	Missense_Mutation	SNP	ENST00000361891.4	37	c.320C>T	CCDS1050.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459801	0.84317	.	.	ENSG00000143621	ENST00000361891;ENST00000368684;ENST00000368681	T;T;T	0.36699	1.24;1.24;1.24	4.89	4.89	0.63831	DZF (2);2-5-oligoadenylate synthetase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58032	0.2094	M	0.87827	2.91	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.74348	0.977;0.972;0.983	T	0.66674	-0.5864	10	0.66056	D	0.02	-8.172	15.5565	0.76200	0.0:0.0:1.0:0.0	.	69;107;107	B4DY09;F4ZW62;Q12905	.;.;ILF2_HUMAN	F	107;69;107	ENSP00000355011:S107F;ENSP00000357673:S69F;ENSP00000357670:S107F	ENSP00000355011:S107F	S	-	2	0	ILF2	151906729	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	8.533000	0.90617	2.243000	0.73865	0.655000	0.94253	TCC		0.448	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090040.1	NM_004515		31	384	0	0	0	0.002522	0	31	384				
INSRR	3645	broad.mit.edu	37	1	156812834	156812834	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:156812834C>A	ENST00000368195.3	-	17	3484	c.3088G>T	c.(3088-3090)Gaa>Taa	p.E1030*	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1030	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E1030*(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACAGAAGCTTCCTTGAGGAAC	0.527																																							uc010pht.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20						c.(3088-3090)GAA>TAA		insulin receptor-related receptor precursor							79.0	77.0	78.0					1																	156812834		2203	4300	6503	SO:0001587	stop_gained	3645				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity	g.chr1:156812834C>A	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3088G>T	1.37:g.156812834C>A	ENSP00000357178:p.Glu1030*		Somatic				NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	p.E1030*	NM_014215	NP_055030	WXS	Illumina HiSeq	Unspecified	P14616	INSRR_HUMAN			17	3342	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		1030			Cytoplasmic (Potential).|Protein kinase.		O60724|Q5VZS3	Nonsense_Mutation	SNP	ENST00000368195.3	37	c.3088G>T	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	45	11.493233	0.99568	.	.	ENSG00000027644	ENST00000368195	.	.	.	5.04	5.04	0.67666	.	0.000000	0.49305	D	0.000147	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.1135	0.86682	0.0:1.0:0.0:0.0	.	.	.	.	X	1030	.	ENSP00000357178:E1030X	E	-	1	0	INSRR	155079458	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.616000	0.83018	2.622000	0.88805	0.655000	0.94253	GAA		0.527	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		42	48	1	0	1.0096e-33	0.00361	1.51308e-33	42	48				
FCRL5	83416	broad.mit.edu	37	1	157516811	157516811	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:157516811C>A	ENST00000361835.3	-	3	386	c.229G>T	c.(229-231)Gtt>Ttt	p.V77F	FCRL5_ENST00000368189.3_Missense_Mutation_p.V77F|FCRL5_ENST00000368191.3_Intron|FCRL5_ENST00000356953.4_Missense_Mutation_p.V77F|FCRL5_ENST00000368190.3_Missense_Mutation_p.V77F|FCRL5_ENST00000368188.2_Missense_Mutation_p.V77F	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	77	Ig-like C2-type 1.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.V77F(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GATTCCTGAACCTCAAGGATA	0.483																																							uc001fqu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|central_nervous_system(1)	6						c.(229-231)GTT>TTT		Fc receptor-like 5							101.0	105.0	104.0					1																	157516811		2203	4300	6503	SO:0001583	missense	83416					integral to membrane|plasma membrane	receptor activity	g.chr1:157516811C>A	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.229G>T	1.37:g.157516811C>A	ENSP00000354691:p.Val77Phe		Somatic				FCRL5_uc009wsm.2_Missense_Mutation_p.V77F|FCRL5_uc010phv.1_Missense_Mutation_p.V77F|FCRL5_uc010phw.1_Intron|FCRL5_uc001fqv.1_Missense_Mutation_p.V77F|FCRL5_uc010phx.1_5'UTR	p.V77F	NM_031281	NP_112571	WXS	Illumina HiSeq	Unspecified	Q96RD9	FCRL5_HUMAN			3	387	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)	77			Extracellular (Potential).|Ig-like C2-type 1.		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	c.229G>T	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	C	15.21	2.765490	0.49574	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368189;ENST00000368188	T;T;T;T;T	0.13657	2.57;2.57;2.57;2.57;2.57	5.01	3.04	0.35103	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.19644	0.0472	M	0.78344	2.41	0.09310	N	1	D;P;D;P	0.89917	0.995;0.621;1.0;0.521	D;P;D;P	0.74674	0.974;0.593;0.984;0.579	T	0.04522	-1.0945	9	0.48119	T	0.1	.	7.1656	0.25689	0.0:0.732:0.1712:0.0968	.	77;77;77;77	Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;FCRL5_HUMAN	F	77	ENSP00000354691:V77F;ENSP00000349434:V77F;ENSP00000357173:V77F;ENSP00000357172:V77F;ENSP00000357171:V77F	ENSP00000349434:V77F	V	-	1	0	FCRL5	155783435	0.006000	0.16342	0.001000	0.08648	0.009000	0.06853	1.918000	0.40006	1.062000	0.40625	0.650000	0.86243	GTT		0.483	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		21	34	1	0	0.000229342	0.001882	0.000242508	21	34				
OR6N1	128372	broad.mit.edu	37	1	158736093	158736093	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:158736093C>T	ENST00000335094.2	-	1	399	c.380G>A	c.(379-381)tGc>tAc	p.C127Y		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C127Y(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					GAGGGGCCGGCAGATGGCTAA	0.522																																							uc010piq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(379-381)TGC>TAC		olfactory receptor, family 6, subfamily N,							42.0	47.0	46.0					1																	158736093		2203	4300	6503	SO:0001583	missense	128372				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158736093C>T	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.380G>A	1.37:g.158736093C>T	ENSP00000335535:p.Cys127Tyr		Somatic					p.C127Y	NM_001005185	NP_001005185	WXS	Illumina HiSeq	Unspecified	Q8NGY5	OR6N1_HUMAN			1	380	-	all_hematologic(112;0.0378)		127			Cytoplasmic (Potential).		Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	c.380G>A	CCDS30905.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256182	0.80246	.	.	ENSG00000197403	ENST00000335094	T	0.02158	4.42	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000109	T	0.12646	0.0307	M	0.91406	3.205	0.54753	D	0.999989	D	0.89917	1.0	D	0.87578	0.998	T	0.01232	-1.1411	10	0.87932	D	0	-19.4864	17.4367	0.87554	0.0:1.0:0.0:0.0	.	127	Q8NGY5	OR6N1_HUMAN	Y	127	ENSP00000335535:C127Y	ENSP00000335535:C127Y	C	-	2	0	OR6N1	157002717	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	5.631000	0.67812	2.623000	0.88846	0.655000	0.94253	TGC		0.522	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185		47	46	0	0	0	0.00361	0	47	46				
IFI16	3428	broad.mit.edu	37	1	159021844	159021844	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:159021844C>A	ENST00000295809.7	+	10	2296	c.2041C>A	c.(2041-2043)Caa>Aaa	p.Q681K	IFI16_ENST00000340979.6_Missense_Mutation_p.Q569K|IFI16_ENST00000430894.2_Missense_Mutation_p.Q629K|IFI16_ENST00000368132.3_Missense_Mutation_p.Q625K|IFI16_ENST00000368131.4_Missense_Mutation_p.Q625K|IFI16_ENST00000448393.2_Missense_Mutation_p.Q569K|IFI16_ENST00000359709.3_Missense_Mutation_p.Q625K			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	681	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.Q625K(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					GCTTTGCTCACAAACTAAAGG	0.398																																							uc001ftg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1873-1875)CAA>AAA		interferon, gamma-inducible protein 16							62.0	66.0	65.0					1																	159021844		2203	4300	6503	SO:0001583	missense	3428				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding	g.chr1:159021844C>A	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.2041C>A	1.37:g.159021844C>A	ENSP00000295809:p.Gln681Lys		Somatic				IFI16_uc010pis.1_Missense_Mutation_p.Q625K|IFI16_uc001fth.2_Missense_Mutation_p.Q168K|IFI16_uc010pit.1_Missense_Mutation_p.Q224K	p.Q625K	NM_005531	NP_005522	WXS	Illumina HiSeq	Unspecified	Q16666	IF16_HUMAN			9	2163	+	all_hematologic(112;0.0429)		681			HIN-200 2.		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37	c.1873C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.79|14.79	2.639838|2.639838	0.47153|0.47153	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000448393|ENST00000359709;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	.|T;T;T;T;T	.|0.14640	.|2.49;2.49;2.49;2.49;2.49	4.85|4.85	0.26|0.26	0.15588|0.15588	.|.	.|.	.|.	.|.	.|.	T|T	0.04998|0.04998	0.0134|0.0134	L|L	0.60455|0.60455	1.87|1.87	0.09310|0.09310	N|N	1|1	.|P;B;P	.|0.38110	.|0.458;0.283;0.618	.|B;B;B	.|0.36534	.|0.131;0.022;0.227	T|T	0.30563|0.30563	-0.9974|-0.9974	5|9	.|0.39692	.|T	.|0.17	.|.	7.5299|7.5299	0.27677|0.27677	0.2899:0.3473:0.3628:0.0|0.2899:0.3473:0.3628:0.0	.|.	.|629;569;625	.|E7EPR3;Q16666-3;Q16666-2	.|.;.;.	Q|K	389|310;681;569;625;625;629	.|ENSP00000295809:Q681K;ENSP00000342741:Q569K;ENSP00000357113:Q625K;ENSP00000357114:Q625K;ENSP00000394935:Q629K	.|ENSP00000295809:Q681K	H|Q	+|+	3|1	2|0	IFI16|IFI16	157288468|157288468	0.013000|0.013000	0.17824|0.17824	0.004000|0.004000	0.12327|0.12327	0.004000|0.004000	0.04260|0.04260	0.430000|0.430000	0.21428|0.21428	0.160000|0.160000	0.19432|0.19432	-0.243000|-0.243000	0.11985|0.11985	CAC|CAA		0.398	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531		4	28	1	0	1.23904e-05	0.000602	1.34249e-05	4	28				
CADM3	57863	broad.mit.edu	37	1	159163301	159163301	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:159163301C>A	ENST00000368125.4	+	4	628	c.471C>A	c.(469-471)agC>agA	p.S157R	CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Missense_Mutation_p.S191R	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	157	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.S191R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CTTCTGGGAGCAAGCCTGCAG	0.512																																							uc001ftl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(469-471)AGC>AGA		cell adhesion molecule 3 isoform 2							87.0	85.0	85.0					1																	159163301		2203	4300	6503	SO:0001583	missense	57863				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity	g.chr1:159163301C>A	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.471C>A	1.37:g.159163301C>A	ENSP00000357107:p.Ser157Arg		Somatic				CADM3_uc009wsx.1_Missense_Mutation_p.S191R|CADM3_uc009wsy.1_Missense_Mutation_p.S157R|CADM3_uc001ftk.2_Missense_Mutation_p.S191R	p.S157R	NM_001127173	NP_001120645	WXS	Illumina HiSeq	Unspecified	Q8N126	CADM3_HUMAN			4	613	+	all_hematologic(112;0.0429)		157			Ig-like C2-type 1.|Extracellular (Potential).		Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	37	c.471C>A	CCDS44251.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956195	0.73902	.	.	ENSG00000162706	ENST00000368124;ENST00000368125;ENST00000416746	T;T;T	0.78126	-1.15;-1.15;-1.15	5.13	3.27	0.37495	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86986	0.6065	M	0.93375	3.41	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.996;0.998;0.974	D	0.88178	0.2869	10	0.72032	D	0.01	.	9.6834	0.40082	0.0:0.8479:0.0:0.1521	.	157;157;191	Q8N126-3;Q8N126;Q8N126-2	.;CADM3_HUMAN;.	R	191;157;157	ENSP00000357106:S191R;ENSP00000357107:S157R;ENSP00000387802:S157R	ENSP00000357106:S191R	S	+	3	2	CADM3	157429925	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.078000	0.41567	0.749000	0.32854	0.655000	0.94253	AGC		0.512	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189		26	37	1	0	4.4194e-11	0.002836	5.26822e-11	26	37				
ATP1A2	477	broad.mit.edu	37	1	160100252	160100252	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:160100252G>T	ENST00000361216.3	+	13	1781	c.1692G>T	c.(1690-1692)cgG>cgT	p.R564R	ATP1A2_ENST00000392233.3_Silent_p.R564R	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	564					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.R564R(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			AGTTTCCTCGGGGCTTCAAAT	0.552																																							uc001fvc.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)|ovary(2)|skin(2)	7						c.(1690-1692)CGG>CGT		Na+/K+ -ATPase alpha 2 subunit proprotein							75.0	75.0	75.0					1																	160100252		2203	4300	6503	SO:0001819	synonymous_variant	477				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160100252G>T	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1692G>T	1.37:g.160100252G>T			Somatic				ATP1A2_uc001fvb.2_Silent_p.R564R|ATP1A2_uc001fvd.2_Silent_p.R300R|ATP1A2_uc009wtg.1_Silent_p.R252R	p.R564R	NM_000702	NP_000693	WXS	Illumina HiSeq	Unspecified	P50993	AT1A2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)		13	1824	+	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		564			Cytoplasmic (Potential).		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Silent	SNP	ENST00000361216.3	37	c.1692G>T	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	G	9.721	1.159631	0.21454	.	.	ENSG00000018625	ENST00000447527	.	.	.	4.6	-3.35	0.04928	.	.	.	.	.	T	0.22003	0.0530	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36841	-0.9731	4	.	.	.	.	1.8111	0.03090	0.153:0.3304:0.263:0.2536	.	.	.	.	V	275	.	.	G	+	2	0	ATP1A2	158366876	0.000000	0.05858	0.989000	0.46669	0.993000	0.82548	-1.276000	0.02815	-0.477000	0.06832	0.505000	0.49811	GGG		0.552	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702		36	37	1	0	2.01872e-29	0.00361	2.91082e-29	36	37				
F5	2153	broad.mit.edu	37	1	169513566	169513566	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:169513566C>T	ENST00000367797.3	-	12	2144	c.1943G>A	c.(1942-1944)gGa>gAa	p.G648E	F5_ENST00000367796.3_Missense_Mutation_p.G653E	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	648	F5/8 type A 2.|Plastocyanin-like 4.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.G648E(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CACAGATTCTCCACGCATGGG	0.478																																							uc001ggg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(1942-1944)GGA>GAA		coagulation factor V precursor	Drotrecogin alfa(DB00055)						85.0	76.0	79.0					1																	169513566		2203	4300	6503	SO:0001583	missense	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169513566C>T	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.1943G>A	1.37:g.169513566C>T	ENSP00000356771:p.Gly648Glu		Somatic					p.G648E	NM_000130	NP_000121	WXS	Illumina HiSeq	Unspecified	P12259	FA5_HUMAN			12	2088	-	all_hematologic(923;0.208)		648			Plastocyanin-like 4.|F5/8 type A 2.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	c.1943G>A	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	C	32	5.134351	0.94517	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.99758	-6.65;-6.65	5.72	5.72	0.89469	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99819	0.9920	M	0.85542	2.76	0.39039	D	0.960081	D	0.89917	1.0	D	0.91635	0.999	D	0.97414	1.0004	9	0.72032	D	0.01	-17.9247	19.8807	0.96899	0.0:1.0:0.0:0.0	.	648	P12259	FA5_HUMAN	E	648;653	ENSP00000356771:G648E;ENSP00000356770:G653E	ENSP00000356770:G653E	G	-	2	0	F5	167780190	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.411000	0.80078	2.698000	0.92095	0.655000	0.94253	GGA		0.478	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		54	229	0	0	0	0.00361	0	54	229				
METTL18	92342	broad.mit.edu	37	1	169762027	169762027	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:169762027C>A	ENST00000310392.4	-	2	1163	c.810G>T	c.(808-810)tgG>tgT	p.W270C	C1orf112_ENST00000359326.4_5'Flank|C1orf112_ENST00000456684.1_5'Flank|METTL18_ENST00000303469.2_Missense_Mutation_p.W270C|C1orf112_ENST00000498289.1_Intron|C1orf112_ENST00000286031.6_5'Flank|C1orf112_ENST00000413811.2_5'Flank	NM_033418.2	NP_219486.1	O95568	MET18_HUMAN	methyltransferase like 18	270						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)	p.W270C(1)		kidney(1)|large_intestine(3)|lung(4)	8						AAAACTCAGACCACTCACCAG	0.328																																							uc001ggn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(808-810)TGG>TGT		hypothetical protein MGC9084							75.0	79.0	78.0					1																	169762027		2199	4299	6498	SO:0001583	missense	92342					cytoplasm	protein methyltransferase activity	g.chr1:169762027C>A	AL035369	CCDS1284.1	1q24.2	2013-10-11	2011-03-02	2011-03-02	ENSG00000171806	ENSG00000171806			28793	protein-coding gene	gene with protein product	"""histidine protein methyltransferase 1"""	615255	"""chromosome 1 open reading frame 156"""	C1orf156		20864530	Standard	NM_033418		Approved	MGC9084, AsTP2, HPM1	uc001ggn.4	O95568	OTTHUMG00000035813	ENST00000310392.4:c.810G>T	1.37:g.169762027C>A	ENSP00000307975:p.Trp270Cys		Somatic				C1orf112_uc001ggj.2_Intron|C1orf112_uc001ggo.2_5'Flank|uc010plt.1_5'Flank|C1orf112_uc001ggp.2_5'Flank|C1orf112_uc001ggq.2_5'Flank|C1orf112_uc009wvt.2_5'Flank	p.W270C	NM_033418	NP_219486	WXS	Illumina HiSeq	Unspecified	O95568	MET18_HUMAN			2	1088	-	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		270					B2R9T5	Missense_Mutation	SNP	ENST00000310392.4	37	c.810G>T	CCDS1284.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.001350	0.74818	.	.	ENSG00000171806	ENST00000310392;ENST00000303469	T;T	0.21191	2.02;2.02	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.53753	0.1816	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62685	-0.6802	10	0.87932	D	0	-7.8338	19.4432	0.94831	0.0:1.0:0.0:0.0	.	270	O95568	MET18_HUMAN	C	270	ENSP00000307975:W270C;ENSP00000307077:W270C	ENSP00000307077:W270C	W	-	3	0	METTL18	168028651	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	TGG		0.328	METTL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087109.1	NM_033418		41	45	1	0	8.69298e-16	0.006999	1.09574e-15	41	45				
TNN	63923	broad.mit.edu	37	1	175086125	175086125	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:175086125G>T	ENST00000239462.4	+	10	2283	c.2170G>T	c.(2170-2172)Gcc>Tcc	p.A724S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	724	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.A724S(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AGAGAATATGGCCACTGTCTC	0.537																																							uc001gkl.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2170-2172)GCC>TCC		tenascin N precursor							60.0	68.0	65.0					1																	175086125		2202	4299	6501	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175086125G>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2170G>T	1.37:g.175086125G>T	ENSP00000239462:p.Ala724Ser		Somatic					p.A724S	NM_022093	NP_071376	WXS	Illumina HiSeq	Unspecified	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	10	2283	+		Breast(1374;0.000962)	724			Fibronectin type-III 6.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2170G>T	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.797992	0.50208	.	.	ENSG00000120332	ENST00000239462	T	0.56103	0.48	5.37	5.37	0.77165	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.282500	0.35936	N	0.002893	T	0.76644	0.4016	M	0.92649	3.33	0.22001	N	0.999425	D	0.56287	0.975	P	0.58928	0.848	T	0.73658	-0.3913	10	0.72032	D	0.01	.	17.2488	0.87035	0.0:0.0:1.0:0.0	.	724	Q9UQP3	TENN_HUMAN	S	724	ENSP00000239462:A724S	ENSP00000239462:A724S	A	+	1	0	TNN	173352748	0.058000	0.20735	0.676000	0.29932	0.050000	0.14768	2.315000	0.43752	2.677000	0.91161	0.655000	0.94253	GCC		0.537	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		54	65	1	0	7.92265e-33	0.00361	1.17808e-32	54	65				
SEC16B	89866	broad.mit.edu	37	1	177901902	177901902	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:177901902C>A	ENST00000308284.6	-	23	2952	c.2863G>T	c.(2863-2865)Ggc>Tgc	p.G955C	SEC16B_ENST00000495165.1_5'UTR|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	955					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)		p.G956C(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						AGTGAGAGGCCCAGGCCAGCC	0.587																																							uc001gli.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(2863-2865)GGC>TGC		leucine zipper transcription regulator 2							48.0	60.0	56.0					1																	177901902		2009	4155	6164	SO:0001583	missense	89866				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane		g.chr1:177901902C>A	AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2863G>T	1.37:g.177901902C>A	ENSP00000308339:p.Gly955Cys		Somatic				SEC16B_uc001glk.1_Missense_Mutation_p.G632C|SEC16B_uc009wwy.1_Intron|SEC16B_uc001glh.1_Missense_Mutation_p.G615C|SEC16B_uc009wwz.1_Missense_Mutation_p.G614C|SEC16B_uc001glj.1_Missense_Mutation_p.G956C	p.G955C	NM_033127	NP_149118	WXS	Illumina HiSeq	Unspecified	Q96JE7	SC16B_HUMAN			23	2953	-			955					A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	37	c.2863G>T	CCDS44281.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.617742	0.46736	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.16457	2.34	4.39	1.19	0.21007	.	1.358980	0.04428	N	0.368707	T	0.29749	0.0743	L	0.51422	1.61	0.09310	N	1	D;D;D	0.71674	0.998;0.992;0.997	P;P;P	0.58013	0.831;0.671;0.831	T	0.11641	-1.0579	10	0.54805	T	0.06	-0.7714	6.0924	0.20001	0.0:0.6259:0.0:0.3741	.	956;955;652	B1AM08;Q96JE7;Q96PW0	.;SC16B_HUMAN;.	C	955;640;671	ENSP00000308339:G955C	ENSP00000239472:G671C	G	-	1	0	AL359075.1	176168525	0.047000	0.20315	0.002000	0.10522	0.063000	0.16089	0.191000	0.17076	0.138000	0.18790	0.563000	0.77884	GGC		0.587	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127		19	13	1	0	2.52088e-20	0.00278	3.37892e-20	19	13				
ABL2	27	broad.mit.edu	37	1	179076967	179076967	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:179076967G>A	ENST00000502732.1	-	12	3638	c.3435C>T	c.(3433-3435)ctC>ctT	p.L1145L	ABL2_ENST00000504405.1_Silent_p.L1006L|ABL2_ENST00000507173.1_Silent_p.L1021L|ABL2_ENST00000344730.3_Silent_p.L1027L|ABL2_ENST00000367623.4_Silent_p.L1124L|ABL2_ENST00000512653.1_Silent_p.L1130L|ABL2_ENST00000511413.1_Silent_p.L1042L|ABL2_ENST00000408940.3_Silent_p.L1109L	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	1145	F-actin-binding. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)	p.L1145L(1)|p.L1109L(1)		breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	CCTGCAGGCTGAGTTCCAGTT	0.507			T	ETV6	AML																																		uc001gmj.3		NA		Dom	yes		1	1q24-q25	27	T	v-abl Abelson murine leukemia viral oncogene homolog 2			L	ETV6		AML		2	Substitution - coding silent(2)		lung(2)	lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14						c.(3433-3435)CTC>CTT		arg tyrosine kinase isoform b	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)						69.0	71.0	70.0					1																	179076967		2203	4300	6503	SO:0001819	synonymous_variant	27				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr1:179076967G>A	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.3435C>T	1.37:g.179076967G>A			Somatic				ABL2_uc010pnf.1_Silent_p.L1042L|ABL2_uc010png.1_Silent_p.L1021L|ABL2_uc010pnh.1_Silent_p.L1124L|ABL2_uc001gmg.3_Silent_p.L1027L|ABL2_uc001gmi.3_Silent_p.L1130L|ABL2_uc001gmh.3_Silent_p.L1109L|ABL2_uc010pne.1_Silent_p.L1006L	p.L1145L	NM_007314	NP_009298	WXS	Illumina HiSeq	Unspecified	P42684	ABL2_HUMAN			12	3722	-			1145			F-actin-binding (By similarity).		A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Silent	SNP	ENST00000502732.1	37	c.3435C>T	CCDS30947.1																																																																																				0.507	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158		4	46	0	0	0	0.009096	0	4	46				
ABL2	27	broad.mit.edu	37	1	179079508	179079508	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:179079508C>A	ENST00000502732.1	-	11	1937	c.1734G>T	c.(1732-1734)aaG>aaT	p.K578N	ABL2_ENST00000504405.1_Missense_Mutation_p.K542N|ABL2_ENST00000507173.1_Missense_Mutation_p.K557N|ABL2_ENST00000344730.3_Missense_Mutation_p.K563N|ABL2_ENST00000367623.4_Missense_Mutation_p.K557N|ABL2_ENST00000512653.1_Missense_Mutation_p.K563N|ABL2_ENST00000511413.1_Missense_Mutation_p.K578N|ABL2_ENST00000408940.3_Missense_Mutation_p.K542N	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	578					actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)	p.K542N(1)|p.K578N(1)		breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	GTGTCCGAGTCTTGGAAGGAA	0.522			T	ETV6	AML																																		uc001gmj.3		NA		Dom	yes		1	1q24-q25	27	T	v-abl Abelson murine leukemia viral oncogene homolog 2			L	ETV6		AML		2	Substitution - Missense(2)		lung(2)	lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14						c.(1732-1734)AAG>AAT		arg tyrosine kinase isoform b	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)						195.0	192.0	193.0					1																	179079508		2203	4300	6503	SO:0001583	missense	27				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr1:179079508C>A	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.1734G>T	1.37:g.179079508C>A	ENSP00000427562:p.Lys578Asn		Somatic				ABL2_uc010pnf.1_Missense_Mutation_p.K578N|ABL2_uc010png.1_Missense_Mutation_p.K557N|ABL2_uc010pnh.1_Missense_Mutation_p.K557N|ABL2_uc001gmg.3_Missense_Mutation_p.K563N|ABL2_uc001gmi.3_Missense_Mutation_p.K563N|ABL2_uc001gmh.3_Missense_Mutation_p.K542N|ABL2_uc010pne.1_Missense_Mutation_p.K542N	p.K578N	NM_007314	NP_009298	WXS	Illumina HiSeq	Unspecified	P42684	ABL2_HUMAN			11	2021	-			578					A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	37	c.1734G>T	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964346	0.74131	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413	T;T;T;T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48	5.91	5.0	0.66597	.	0.111701	0.39210	N	0.001425	T	0.31104	0.0786	L	0.58810	1.83	0.80722	D	1	P;D;D;P;P;D;P;P	0.89917	0.928;0.984;0.984;0.712;0.922;1.0;0.768;0.537	B;P;P;P;P;D;P;B	0.83275	0.44;0.839;0.888;0.45;0.667;0.996;0.517;0.395	T	0.02751	-1.1115	10	0.87932	D	0	.	9.6246	0.39743	0.0:0.7848:0.0:0.2152	.	557;557;578;542;578;563;542;563	P42684-6;P42684-7;P42684-5;P42684-4;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;ABL2_HUMAN;.;.;.	N	578;542;563;563;542;557;557;578	ENSP00000427562:K578N;ENSP00000386152:K542N;ENSP00000339209:K563N;ENSP00000423578:K563N;ENSP00000426831:K542N;ENSP00000356595:K557N;ENSP00000423413:K557N;ENSP00000424697:K578N	ENSP00000339209:K563N	K	-	3	2	ABL2	177346131	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.890000	0.28295	1.500000	0.48636	0.655000	0.94253	AAG		0.522	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158		69	164	1	0	4.8811e-34	0.00361	7.3733e-34	69	164				
CACNA1E	777	broad.mit.edu	37	1	181684527	181684527	+	Splice_Site	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:181684527G>T	ENST00000367573.2	+	9	1225	c.1225G>T	c.(1225-1227)Gtg>Ttg	p.V409L	CACNA1E_ENST00000367567.4_Splice_Site_p.V16L|CACNA1E_ENST00000367570.1_Splice_Site_p.V409L|CACNA1E_ENST00000360108.3_Splice_Site_p.V409L|CACNA1E_ENST00000526775.1_Splice_Site_p.V409L|CACNA1E_ENST00000357570.5_Splice_Site_p.V360L|CACNA1E_ENST00000358338.5_Splice_Site_p.V360L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	409					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.V409L(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CGCCTTAGAAGGTAAGGAAAT	0.383																																							uc001gow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(1225-1227)GTG>TTG		calcium channel, voltage-dependent, R type,							55.0	53.0	53.0					1																	181684527		1858	4114	5972	SO:0001630	splice_region_variant	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181684527G>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1225+1G>T	1.37:g.181684527G>T			Somatic				CACNA1E_uc009wxs.2_Missense_Mutation_p.V316L	p.V409L	NM_000721	NP_000712	WXS	Illumina HiSeq	Unspecified	Q15878	CAC1E_HUMAN			9	1390	+			409			Cytoplasmic (Potential).		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.1225G>T	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	31	5.065262	0.93898	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D;D	0.96685	-3.07;-3.07;-3.07;-3.07;-3.07;-4.09;-3.07;-3.07	5.36	5.36	0.76844	.	0.584918	0.17291	N	0.179625	D	0.97037	0.9032	L	0.41710	1.295	0.80722	D	1	D;D	0.61697	0.99;0.99	D;D	0.73380	0.98;0.98	D	0.96361	0.9266	10	0.37606	T	0.19	.	19.0518	0.93050	0.0:0.0:1.0:0.0	.	409;409	Q15878-2;Q15878-3	.;.	L	409;409;409;360;360;16;409;409	ENSP00000432038:V409L;ENSP00000356542:V409L;ENSP00000434814:V409L;ENSP00000350183:V360L;ENSP00000351101:V360L;ENSP00000356539:V16L;ENSP00000353222:V409L;ENSP00000356545:V409L	ENSP00000350183:V360L	V	+	1	0	CACNA1E	179951150	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	8.620000	0.90943	2.673000	0.90976	0.650000	0.86243	GTG		0.383	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	Missense_Mutation	6	28	1	0	0.000157383	0.00308	0.000167037	6	28				
GLRX2	51022	broad.mit.edu	37	1	193066850	193066850	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:193066850G>T	ENST00000367439.3	-	3	272	c.224C>A	c.(223-225)aCa>aAa	p.T75K	GLRX2_ENST00000367440.3_Missense_Mutation_p.T76K|GLRX2_ENST00000472197.1_5'UTR	NM_197962.2	NP_932066.1	Q9NS18	GLRX2_HUMAN	glutaredoxin 2	75	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|DNA protection (GO:0042262)|glutathione metabolic process (GO:0006749)|protein folding (GO:0006457)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|response to hydrogen peroxide (GO:0042542)|response to organic substance (GO:0010033)|response to redox state (GO:0051775)|response to temperature stimulus (GO:0009266)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	2 iron, 2 sulfur cluster binding (GO:0051537)|arsenate reductase (glutaredoxin) activity (GO:0008794)|electron carrier activity (GO:0009055)|glutathione disulfide oxidoreductase activity (GO:0015038)|metal ion binding (GO:0046872)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)	p.T76K(1)		breast(1)|large_intestine(1)|lung(3)	5					Glutathione(DB00143)	AGAACAGGATGTTTTTGAGAA	0.313																																							uc001gsz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(223-225)ACA>AAA		glutaredoxin 2 isoform 2	Glutathione(DB00143)						92.0	86.0	88.0					1																	193066850		2203	4300	6503	SO:0001583	missense	51022				apoptosis|cell differentiation|cell redox homeostasis|DNA protection|electron transport chain|glutathione metabolic process|protein thiol-disulfide exchange|regulation of signal transduction|regulation of transcription, DNA-dependent|response to hydrogen peroxide|response to organic substance|response to redox state|response to temperature stimulus|transport	mitochondrion|nucleus	2 iron, 2 sulfur cluster binding|arsenate reductase (glutaredoxin) activity|electron carrier activity|glutathione disulfide oxidoreductase activity|metal ion binding|protein disulfide oxidoreductase activity	g.chr1:193066850G>T	AF132495	CCDS1380.1, CCDS1381.1	1q31.2	2012-09-20			ENSG00000023572	ENSG00000023572			16065	protein-coding gene	gene with protein product	"""bA101E13.1 (GRX2 glutaredoxin (thioltransferase) 2)"""	606820				11297543	Standard	NM_016066		Approved	GRX2, bA101E13.1	uc001gsz.2	Q9NS18	OTTHUMG00000035677	ENST00000367439.3:c.224C>A	1.37:g.193066850G>T	ENSP00000356409:p.Thr75Lys		Somatic				GLRX2_uc001gta.1_Missense_Mutation_p.T76K	p.T75K	NM_197962	NP_932066	WXS	Illumina HiSeq	Unspecified	Q9NS18	GLRX2_HUMAN			3	268	-			75			Glutaredoxin.		Q3LR69|Q7L1N7|Q96JC0|Q9Y3D4	Missense_Mutation	SNP	ENST00000367439.3	37	c.224C>A	CCDS1381.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681069	0.88542	.	.	ENSG00000023572	ENST00000367439;ENST00000367440	T;T	0.29142	1.58;1.58	6.03	6.03	0.97812	Glutaredoxin subgroup (1);Glutaredoxin (2);Glutaredoxin, eukaryotic/virial (1);Thioredoxin-like fold (2);	0.089407	0.85682	D	0.000000	T	0.55114	0.1900	M	0.84585	2.705	0.58432	D	0.999999	D;D	0.63046	0.992;0.982	P;P	0.52793	0.709;0.693	T	0.61033	-0.7144	10	0.87932	D	0	-30.7119	20.1519	0.98089	0.0:0.0:1.0:0.0	.	76;75	Q9NS18-2;Q9NS18	.;GLRX2_HUMAN	K	75;76	ENSP00000356409:T75K;ENSP00000356410:T76K	ENSP00000356409:T75K	T	-	2	0	GLRX2	191333473	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.400000	0.79949	2.861000	0.98227	0.655000	0.94253	ACA		0.313	GLRX2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086699.1	NM_016066		5	16	1	0	6.5536e-12	0.00308	7.92819e-12	5	16				
PIK3C2B	5287	broad.mit.edu	37	1	204394057	204394057	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:204394057G>A	ENST00000367187.3	-	34	5384	c.4828C>T	c.(4828-4830)Cgc>Tgc	p.R1610C	RP11-739N20.2_ENST00000443515.1_RNA|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.R1582C	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1610					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)	p.R1610C(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TCTCGCAGGCGGATGTTCACC	0.637																																							uc001haw.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7						c.(4828-4830)CGC>TGC		phosphoinositide-3-kinase, class 2 beta							81.0	68.0	72.0					1																	204394057		2203	4300	6503	SO:0001583	missense	5287				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding	g.chr1:204394057G>A	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4828C>T	1.37:g.204394057G>A	ENSP00000356155:p.Arg1610Cys		Somatic				PIK3C2B_uc010pqv.1_Missense_Mutation_p.R1582C	p.R1610C	NM_002646	NP_002637	WXS	Illumina HiSeq	Unspecified	O00750	P3C2B_HUMAN	GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)		34	5307	-	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		1610					O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	c.4828C>T	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.557578	0.45590	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.79352	-1.26;-1.26	5.26	4.34	0.51931	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.404480	0.27262	N	0.020175	T	0.61438	0.2347	N	0.19112	0.55	0.39157	D	0.962335	B;B	0.22480	0.07;0.005	B;B	0.18561	0.022;0.001	T	0.61262	-0.7098	10	0.42905	T	0.14	.	8.8453	0.35166	0.0793:0.0:0.7699:0.1508	.	1582;1610	F5GWN5;O00750	.;P3C2B_HUMAN	C	1610;1582	ENSP00000356155:R1610C;ENSP00000400561:R1582C	ENSP00000356155:R1610C	R	-	1	0	PIK3C2B	202660680	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.499000	0.45372	2.465000	0.83290	0.655000	0.94253	CGC		0.637	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646		30	33	0	0	0	0.005524	0	30	33				
EIF2D	1939	broad.mit.edu	37	1	206784620	206784620	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:206784620G>A	ENST00000271764.2	-	2	372	c.164C>T	c.(163-165)gCt>gTt	p.A55V	EIF2D_ENST00000367114.3_Missense_Mutation_p.A55V	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	55					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						CCCTTTGTGAGCATACAACTT	0.473																																							uc001heh.2		NA																	0					0						c.(163-165)GCT>GTT		ligatin							156.0	132.0	140.0					1																	206784620		2203	4300	6503	SO:0001583	missense	1939				intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity	g.chr1:206784620G>A	BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.164C>T	1.37:g.206784620G>A	ENSP00000271764:p.Ala55Val		Somatic				LGTN_uc009xbw.2_Missense_Mutation_p.A55V|LGTN_uc010prw.1_Missense_Mutation_p.A55V	p.A55V	NM_006893	NP_008824	WXS	Illumina HiSeq	Unspecified	P41214	EIF2D_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.166)		2	373	-	Breast(84;0.183)		55					Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	ENST00000271764.2	37	c.164C>T	CCDS1465.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736540	0.69304	.	.	ENSG00000143486	ENST00000367114;ENST00000271764;ENST00000367111;ENST00000437518	T;T;T	0.52754	0.65;0.65;0.65	5.99	5.07	0.68467	.	0.156823	0.56097	N	0.000029	T	0.49915	0.1585	M	0.73598	2.24	0.46564	D	0.999103	B;B;B	0.11235	0.004;0.004;0.001	B;B;B	0.16289	0.009;0.015;0.009	T	0.47649	-0.9101	10	0.39692	T	0.17	-19.2714	14.4967	0.67694	0.0717:0.0:0.9283:0.0	.	55;55;55	B4DGD2;P41214-2;P41214	.;.;EIF2D_HUMAN	V	55	ENSP00000356081:A55V;ENSP00000271764:A55V;ENSP00000394685:A55V	ENSP00000271764:A55V	A	-	2	0	EIF2D	204851243	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.180000	0.58296	1.530000	0.49136	0.552000	0.68991	GCT		0.473	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1	NM_006893		38	149	0	0	0	0.005524	0	38	149				
PROX1	5629	broad.mit.edu	37	1	214170382	214170382	+	Silent	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:214170382G>C	ENST00000366958.4	+	2	1112	c.504G>C	c.(502-504)cgG>cgC	p.R168R	PROX1_ENST00000435016.1_Silent_p.R168R|PROX1_ENST00000498508.2_Silent_p.R168R|PROX1_ENST00000261454.4_Silent_p.R168R	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	168					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.R168R(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		AGCGCGCCCGGGTTGAGAATA	0.532																																							uc001hkh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6						c.(502-504)CGG>CGC		prospero homeobox 1							57.0	63.0	61.0					1																	214170382		2203	4300	6503	SO:0001819	synonymous_variant	5629				aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding	g.chr1:214170382G>C	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.504G>C	1.37:g.214170382G>C			Somatic				PROX1_uc001hkg.1_Silent_p.R168R	p.R168R	NM_002763	NP_002754	WXS	Illumina HiSeq	Unspecified	Q92786	PROX1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)	2	776	+			168					A6NK29|A8K2B1|Q5SW76|Q8TB91	Silent	SNP	ENST00000366958.4	37	c.504G>C	CCDS31021.1																																																																																				0.532	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763		14	58	0	0	0	0.010504	0	14	58				
KCNK2	3776	broad.mit.edu	37	1	215345403	215345403	+	Missense_Mutation	SNP	T	T	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:215345403T>G	ENST00000444842.2	+	5	850	c.700T>G	c.(700-702)Tgt>Ggt	p.C234G	KCNK2_ENST00000391895.2_Missense_Mutation_p.C230G|KCNK2_ENST00000391894.2_Missense_Mutation_p.C219G	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	234					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.C234G(1)|p.C219G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	ACTATTTGGCTGTGTACTCTT	0.393																																							uc001hkq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(700-702)TGT>GGT		potassium channel, subfamily K, member 2 isoform	Dofetilide(DB00204)						164.0	139.0	147.0					1																	215345403		2203	4300	6503	SO:0001583	missense	3776						outward rectifier potassium channel activity	g.chr1:215345403T>G	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.700T>G	1.37:g.215345403T>G	ENSP00000394033:p.Cys234Gly		Somatic				KCNK2_uc001hko.2_Missense_Mutation_p.C230G|KCNK2_uc009xdm.2_Intron|KCNK2_uc001hkp.2_RNA|KCNK2_uc010pua.1_RNA|KCNK2_uc001hkr.3_Missense_Mutation_p.C219G	p.C234G	NM_001017425	NP_001017425	WXS	Illumina HiSeq	Unspecified	O95069	KCNK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	5	869	+			234			Helical; (Potential).		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	c.700T>G	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.480966	0.84747	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.30448	1.53;1.53;1.53	5.68	5.68	0.88126	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.62672	0.2447	M	0.89095	3.005	0.80722	D	1	D;D;D	0.89917	0.998;0.997;1.0	D;D;D	0.91635	0.976;0.978;0.999	T	0.68941	-0.5276	10	0.52906	T	0.07	.	15.9802	0.80102	0.0:0.0:0.0:1.0	.	219;234;230	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	G	230;219;234	ENSP00000375765:C230G;ENSP00000375764:C219G;ENSP00000394033:C234G	ENSP00000375764:C219G	C	+	1	0	KCNK2	213412026	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.040000	0.89188	2.170000	0.68504	0.456000	0.33151	TGT		0.393	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217		94	140	0	0	0	0.00361	0	94	140				
KCTD3	51133	broad.mit.edu	37	1	215792515	215792515	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:215792515G>T	ENST00000259154.4	+	17	2062	c.1768G>T	c.(1768-1770)Gaa>Taa	p.E590*	KCTD3_ENST00000495537.1_3'UTR	NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	590					protein homooligomerization (GO:0051260)			p.E590*(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TCCAACCGAAGAAGAGCTACT	0.403																																							uc001hks.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(1768-1770)GAA>TAA		potassium channel tetramerisation domain							116.0	117.0	117.0					1																	215792515		2203	4300	6503	SO:0001587	stop_gained	51133					voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr1:215792515G>T	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.1768G>T	1.37:g.215792515G>T	ENSP00000259154:p.Glu590*		Somatic				KCTD3_uc001hkt.2_Nonsense_Mutation_p.E588*|KCTD3_uc010pub.1_Nonsense_Mutation_p.E488*|KCTD3_uc009xdn.2_Nonsense_Mutation_p.E314*	p.E590*	NM_016121	NP_057205	WXS	Illumina HiSeq	Unspecified	Q9Y597	KCTD3_HUMAN		all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)	17	2062	+			590					A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Nonsense_Mutation	SNP	ENST00000259154.4	37	c.1768G>T	CCDS1515.1	.	.	.	.	.	.	.	.	.	.	G	39	7.348906	0.98228	.	.	ENSG00000136636	ENST00000259154	.	.	.	5.51	1.53	0.23141	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-20.3	10.3657	0.44021	0.2687:0.0:0.7313:0.0	.	.	.	.	X	590	.	ENSP00000259154:E590X	E	+	1	0	KCTD3	213859138	1.000000	0.71417	0.330000	0.25442	0.568000	0.35870	6.419000	0.73345	0.298000	0.22638	0.585000	0.79938	GAA		0.403	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121		51	157	1	0	2.5401e-28	0.00361	3.64421e-28	51	157				
DISP1	84976	broad.mit.edu	37	1	223177391	223177391	+	Silent	SNP	G	G	A	rs138904556		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:223177391G>A	ENST00000284476.6	+	8	2816	c.2652G>A	c.(2650-2652)gaG>gaA	p.E884E		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	884					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)	p.E884E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		ACAAGCAAGAGATTTTTGAAC	0.488																																							uc001hnu.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2650-2652)GAG>GAA		dispatched A							59.0	63.0	61.0					1																	223177391		2203	4300	6503	SO:0001819	synonymous_variant	84976				diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity	g.chr1:223177391G>A	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2652G>A	1.37:g.223177391G>A			Somatic					p.E884E	NM_032890	NP_116279	WXS	Illumina HiSeq	Unspecified	Q96F81	DISP1_HUMAN		GBM - Glioblastoma multiforme(131;0.102)	8	2799	+			884					Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Silent	SNP	ENST00000284476.6	37	c.2652G>A	CCDS1536.1																																																																																				0.488	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890		13	51	0	0	0	0.00499	0	13	51				
DISP1	84976	broad.mit.edu	37	1	223177398	223177398	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:223177398G>A	ENST00000284476.6	+	8	2823	c.2659G>A	c.(2659-2661)Gaa>Aaa	p.E887K		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	887					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)	p.E887K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		AGAGATTTTTGAACTGTGCAT	0.478																																							uc001hnu.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2659-2661)GAA>AAA		dispatched A							59.0	63.0	62.0					1																	223177398		2203	4300	6503	SO:0001583	missense	84976				diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity	g.chr1:223177398G>A	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2659G>A	1.37:g.223177398G>A	ENSP00000284476:p.Glu887Lys		Somatic					p.E887K	NM_032890	NP_116279	WXS	Illumina HiSeq	Unspecified	Q96F81	DISP1_HUMAN		GBM - Glioblastoma multiforme(131;0.102)	8	2806	+			887					Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	37	c.2659G>A	CCDS1536.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216281	0.58452	.	.	ENSG00000154309	ENST00000284476	D	0.92495	-3.05	5.22	5.22	0.72569	.	0.043698	0.85682	N	0.000000	D	0.86159	0.5866	L	0.31065	0.9	0.80722	D	1	B	0.33212	0.402	B	0.26864	0.074	D	0.83786	0.0228	10	0.14252	T	0.57	-27.9691	19.1414	0.93448	0.0:0.0:1.0:0.0	.	887	Q96F81	DISP1_HUMAN	K	887	ENSP00000284476:E887K	ENSP00000284476:E887K	E	+	1	0	DISP1	221244021	1.000000	0.71417	0.673000	0.29887	0.993000	0.82548	7.826000	0.86716	2.606000	0.88127	0.561000	0.74099	GAA		0.478	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890		12	50	0	0	0	0.004007	0	12	50				
GNPAT	8443	broad.mit.edu	37	1	231403468	231403468	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:231403468C>T	ENST00000366647.4	+	9	1267	c.1098C>T	c.(1096-1098)gtC>gtT	p.V366V	GNPAT_ENST00000366646.3_Silent_p.V305V	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	366					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)	p.V366V(2)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				ATGCCTTTGTCACTGAAGTTG	0.433																																							uc001hup.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|breast(1)	4						c.(1096-1098)GTC>GTT		glyceronephosphate O-acyltransferase							123.0	119.0	120.0					1																	231403468		2203	4300	6503	SO:0001819	synonymous_variant	8443				ether lipid biosynthetic process|fatty acid metabolic process|organ morphogenesis	peroxisomal matrix|peroxisomal membrane	glycerone-phosphate O-acyltransferase activity	g.chr1:231403468C>T	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1098C>T	1.37:g.231403468C>T			Somatic				GNPAT_uc009xfp.2_Silent_p.V305V	p.V366V	NM_014236	NP_055051	WXS	Illumina HiSeq	Unspecified	O15228	GNPAT_HUMAN			9	1304	+	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)	366					B4DNM9|Q5TBH7|Q9BWC2	Silent	SNP	ENST00000366647.4	37	c.1098C>T	CCDS1592.1																																																																																				0.433	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1			15	172	0	0	0	0.008871	0	15	172				
LYST	1130	broad.mit.edu	37	1	235909776	235909776	+	Missense_Mutation	SNP	C	C	T	rs147536126	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:235909776C>T	ENST00000389794.3	-	29	8006	c.7832G>A	c.(7831-7833)cGt>cAt	p.R2611H	LYST_ENST00000389793.2_Missense_Mutation_p.R2611H			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2611					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.R2611H(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGCCACTGAACGCATTTTCAT	0.408																																							uc001hxj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(4)|central_nervous_system(2)	12						c.(7831-7833)CGT>CAT		lysosomal trafficking regulator		C	HIS/ARG	0,4406		0,0,2203	110.0	89.0	96.0		7832	5.5	1.0	1	dbSNP_134	96	2,8598	2.2+/-6.3	0,2,4298	yes	missense	LYST	NM_000081.2	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	2611/3802	235909776	2,13004	2203	4300	6503	SO:0001583	missense	1130	Chediak-Higashsyndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235909776C>T	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.7832G>A	1.37:g.235909776C>T	ENSP00000374444:p.Arg2611His		Somatic				LYST_uc009xga.1_Missense_Mutation_p.R247H	p.R2611H	NM_000081	NP_000072	WXS	Illumina HiSeq	Unspecified	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		29	8007	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	2611					O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	c.7832G>A	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041983	0.93685	0.0	2.33E-4	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.74526	-0.85;-0.85	5.5	5.5	0.81552	.	0.091917	0.85682	N	0.000000	D	0.86037	0.5837	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.86936	0.2076	10	0.72032	D	0.01	.	19.392	0.94587	0.0:1.0:0.0:0.0	.	2611	Q99698	LYST_HUMAN	H	2611	ENSP00000374444:R2611H;ENSP00000374443:R2611H	ENSP00000374443:R2611H	R	-	2	0	LYST	233976399	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	7.420000	0.80191	2.580000	0.87095	0.591000	0.81541	CGT		0.408	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			35	42	0	0	0	0.00623	0	35	42				
ACTN2	88	broad.mit.edu	37	1	236882306	236882306	+	Silent	SNP	C	C	T	rs539250948		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:236882306C>T	ENST00000366578.4	+	3	520	c.354C>T	c.(352-354)ggC>ggT	p.G118G	ACTN2_ENST00000542672.1_Silent_p.G118G|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	118	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.G118G(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TGTCCATTGGCGCTGAAGGTG	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		19533	0.0		0.001	False		,,,				2504	0.0						uc001hyf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(1)	5						c.(352-354)GGC>GGT		actinin, alpha 2							129.0	124.0	126.0					1																	236882306		2203	4300	6503	SO:0001819	synonymous_variant	88				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding	g.chr1:236882306C>T	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.354C>T	1.37:g.236882306C>T			Somatic				ACTN2_uc001hyg.2_5'UTR|ACTN2_uc009xgi.1_Silent_p.G118G	p.G118G	NM_001103	NP_001094	WXS	Illumina HiSeq	Unspecified	P35609	ACTN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00168)		3	558	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	118			CH 1.|Actin-binding.		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	ENST00000366578.4	37	c.354C>T	CCDS1613.1																																																																																				0.512	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103		14	22	0	0	0	0.001882	0	14	22				
RYR2	6262	broad.mit.edu	37	1	237664075	237664075	+	Silent	SNP	T	T	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:237664075T>C	ENST00000366574.2	+	21	2585	c.2268T>C	c.(2266-2268)agT>agC	p.S756S	RYR2_ENST00000360064.6_Silent_p.S754S|RYR2_ENST00000542537.1_Silent_p.S740S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	756	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.S754S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGTCATCAGTTGCTGTTTAG	0.413																																							uc001hyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(2266-2268)AGT>AGC		cardiac muscle ryanodine receptor							300.0	283.0	288.0					1																	237664075		1924	4135	6059	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237664075T>C	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2268T>C	1.37:g.237664075T>C			Somatic					p.S756S	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		21	2388	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	756			Cytoplasmic (By similarity).|B30.2/SPRY 1.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.2268T>C	CCDS55691.1																																																																																				0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		172	484	0	0	0	0.00361	0	172	484				
NLRP3	114548	broad.mit.edu	37	1	247597423	247597423	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:247597423C>A	ENST00000336119.3	+	5	3092	c.2346C>A	c.(2344-2346)ctC>ctA	p.L782L	NLRP3_ENST00000391827.2_Silent_p.L725L|NLRP3_ENST00000348069.2_Silent_p.L725L|NLRP3_ENST00000366496.2_Silent_p.L782L|NLRP3_ENST00000391828.3_Silent_p.L782L|NLRP3_ENST00000366497.2_Silent_p.L782L	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	782					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.L782L(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GCTGTGGCCTCTCGCATGAGT	0.562																																							uc001icr.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(2344-2346)CTC>CTA		NLR family, pyrin domain containing 3 isoform a							136.0	128.0	131.0					1																	247597423		2203	4300	6503	SO:0001819	synonymous_variant	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247597423C>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2346C>A	1.37:g.247597423C>A			Somatic				NLRP3_uc001ics.2_Silent_p.L782L|NLRP3_uc001icu.2_Silent_p.L782L|NLRP3_uc001icw.2_Silent_p.L725L|NLRP3_uc001icv.2_Silent_p.L725L|NLRP3_uc010pyw.1_Intron	p.L782L	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		7	2484	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	782			LRR 2.		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	37	c.2346C>A	CCDS1632.1																																																																																				0.562	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		73	200	1	0	6.79372e-55	0.00361	1.1477e-54	73	200				
OR2G2	81470	broad.mit.edu	37	1	247752207	247752207	+	Silent	SNP	C	C	T	rs146695930	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:247752207C>T	ENST00000320065.1	+	1	546	c.546C>T	c.(544-546)tgC>tgT	p.C182C	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C182C(2)		endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATTTCATCTGCGAGGTCCCTG	0.537																																							uc010pyy.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(544-546)TGC>TGT		olfactory receptor, family 2, subfamily G,		T		1,4405	826.1+/-416.6	0,1,2202	176.0	169.0	171.0		546	2.0	1.0	1	dbSNP_134	171	2,8598	819.2+/-406.8	0,2,4298	no	coding-synonymous	OR2G2	NM_001001915.1		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		182/318	247752207	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	81470				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247752207C>T	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.546C>T	1.37:g.247752207C>T			Somatic					p.C182C	NM_001001915	NP_001001915	WXS	Illumina HiSeq	Unspecified	Q8NGZ5	OR2G2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	546	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		182			Extracellular (Potential).		Q5JQT2|Q6IEZ0	Silent	SNP	ENST00000320065.1	37	c.546C>T	CCDS31092.1																																																																																				0.537	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1			92	273	0	0	0	0.00361	0	92	273				
OR2M4	26245	broad.mit.edu	37	1	248402554	248402554	+	Silent	SNP	T	T	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:248402554T>C	ENST00000306687.1	+	1	324	c.324T>C	c.(322-324)ctT>ctC	p.L108L		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	108					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L108L(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TGTCCCTGCTTGGAGCTGAAT	0.463																																							uc010pzh.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(322-324)CTT>CTC		olfactory receptor, family 2, subfamily M,							151.0	122.0	132.0					1																	248402554		2203	4300	6503	SO:0001819	synonymous_variant	26245				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248402554T>C	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.324T>C	1.37:g.248402554T>C			Somatic					p.L108L	NM_017504	NP_059974	WXS	Illumina HiSeq	Unspecified	Q96R27	OR2M4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	324	+	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		108			Helical; Name=3; (Potential).		Q15611|Q8NG82	Silent	SNP	ENST00000306687.1	37	c.324T>C	CCDS31108.1																																																																																				0.463	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504		56	88	0	0	0	0.00361	0	56	88				
ITIH5	80760	broad.mit.edu	37	10	7659106	7659106	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:7659106G>T	ENST00000256861.6	-	6	870	c.792C>A	c.(790-792)gtC>gtA	p.V264V	ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000446830.2_Silent_p.V46V|ITIH5_ENST00000298441.6_Silent_p.V50V|ITIH5_ENST00000397146.2_Silent_p.V264V|ITIH5_ENST00000397145.2_Silent_p.V264V	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	264					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V264V(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GTTCTCTATTGACGTCATATC	0.403																																							uc001ijq.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(2)	4						c.(790-792)GTC>GTA		inter-alpha trypsin inhibitor heavy chain							195.0	175.0	182.0					10																	7659106		2203	4300	6503	SO:0001819	synonymous_variant	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7659106G>T			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.792C>A	10.37:g.7659106G>T			Somatic				ITIH5_uc001ijp.2_Silent_p.V50V|ITIH5_uc001ijr.1_Silent_p.V264V	p.V264V	NM_030569	NP_085046	WXS	Illumina HiSeq	Unspecified	Q86UX2	ITIH5_HUMAN			6	871	-			264					Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37	c.792C>A																																																																																					0.403	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		131	331	1	0	8.9487e-115	0.00361	1.60683e-114	131	331				
OLAH	55301	broad.mit.edu	37	10	15106469	15106469	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:15106469C>A	ENST00000378228.3	+	5	624	c.370C>A	c.(370-372)Cat>Aat	p.H124N	OLAH_ENST00000378217.3_Missense_Mutation_p.H177N	NM_001039702.2	NP_001034791.1	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase	124					fatty acid biosynthetic process (GO:0006633)		myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)	p.H177N(1)		endometrium(2)|large_intestine(1)|lung(14)|stomach(1)	18						AGAACCATTGCATTTATTTTT	0.373																																							uc001inu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)CAT>AAT		oleoyl-ACP hydrolase isoform 2							158.0	136.0	144.0					10																	15106469		2203	4300	6503	SO:0001583	missense	55301				fatty acid biosynthetic process		myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity	g.chr10:15106469C>A	AK001844	CCDS7106.1, CCDS31152.1	10p13	2010-11-23	2006-07-07	2006-07-07	ENSG00000152463	ENSG00000152463	3.1.2.14		25625	protein-coding gene	gene with protein product			"""thioesterase domain containing 1"""	THEDC1			Standard	NM_018324		Approved	FLJ11106, SAST	uc001inu.2	Q9NV23	OTTHUMG00000017724	ENST00000378228.3:c.370C>A	10.37:g.15106469C>A	ENSP00000367473:p.His124Asn		Somatic				ACBD7_uc010qby.1_Intron|OLAH_uc001int.2_Missense_Mutation_p.H177N	p.H124N	NM_001039702	NP_001034791	WXS	Illumina HiSeq	Unspecified	Q9NV23	SAST_HUMAN			5	624	+			124					Q5VUB6|Q9NUW1	Missense_Mutation	SNP	ENST00000378228.3	37	c.370C>A	CCDS31152.1	.	.	.	.	.	.	.	.	.	.	c	15.02	2.710181	0.48517	.	.	ENSG00000152463	ENST00000428897;ENST00000429028;ENST00000378228;ENST00000378217	.	.	.	4.01	3.1	0.35709	Thioesterase (1);	0.000000	0.85682	D	0.000000	T	0.68869	0.3048	M	0.89353	3.025	0.21740	N	0.999564	D;D	0.89917	1.0;0.995	D;D	0.85130	0.997;0.919	T	0.60840	-0.7183	9	0.28530	T	0.3	-6.1914	10.8603	0.46823	0.0:0.9045:0.0:0.0955	.	124;177	Q9NV23;Q9NV23-2	SAST_HUMAN;.	N	124;124;124;177	.	ENSP00000367462:H177N	H	+	1	0	OLAH	15146475	0.449000	0.25689	0.004000	0.12327	0.114000	0.19823	2.100000	0.41777	1.012000	0.39366	0.650000	0.86243	CAT		0.373	OLAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046964.1	NM_018324		24	79	1	0	1.13719e-10	0.008361	1.3416e-10	24	79				
ARMC3	219681	broad.mit.edu	37	10	23257283	23257283	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:23257283C>A	ENST00000298032.5	+	8	865	c.781C>A	c.(781-783)Ctt>Att	p.L261I	ARMC3_ENST00000409983.3_Missense_Mutation_p.L261I|ARMC3_ENST00000376528.4_De_novo_Start_OutOfFrame|ARMC3_ENST00000409049.3_Missense_Mutation_p.L261I	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	261						extracellular vesicular exosome (GO:0070062)		p.L261I(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AGCCAATTGCCTTGAAGACAT	0.358																																							uc001irm.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(781-783)CTT>ATT		armadillo repeat containing 3							77.0	76.0	76.0					10																	23257283		2203	4300	6503	SO:0001583	missense	219681						binding	g.chr10:23257283C>A	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.781C>A	10.37:g.23257283C>A	ENSP00000298032:p.Leu261Ile		Somatic				ARMC3_uc010qcv.1_Missense_Mutation_p.L261I|ARMC3_uc010qcw.1_5'UTR	p.L261I	NM_173081	NP_775104	WXS	Illumina HiSeq	Unspecified	Q5W041	ARMC3_HUMAN			8	864	+			261			ARM 6.		A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	c.781C>A	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.296916	0.40594	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049	T;T;T	0.49139	0.79;0.79;1.38	5.78	4.87	0.63330	Armadillo-like helical (1);Armadillo-type fold (1);	0.131866	0.52532	N	0.000061	T	0.58133	0.2101	M	0.78801	2.425	0.80722	D	1	B;B	0.25486	0.127;0.107	B;B	0.36989	0.238;0.079	T	0.60777	-0.7196	10	0.52906	T	0.07	-5.4489	16.5442	0.84410	0.1318:0.8682:0.0:0.0	.	261;261	Q5W041-4;Q5W041	.;ARMC3_HUMAN	I	261;261;197;261	ENSP00000298032:L261I;ENSP00000386943:L261I;ENSP00000387288:L261I	ENSP00000298032:L261I	L	+	1	0	ARMC3	23297289	1.000000	0.71417	0.996000	0.52242	0.351000	0.29236	3.668000	0.54554	1.570000	0.49709	0.655000	0.94253	CTT		0.358	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081		109	225	1	0	4.30233e-46	0.00361	6.99895e-46	109	225				
ARHGAP12	94134	broad.mit.edu	37	10	32197269	32197269	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:32197269T>A	ENST00000344936.2	-	3	749	c.515A>T	c.(514-516)aAt>aTt	p.N172I	ARHGAP12_ENST00000375245.4_Missense_Mutation_p.N172I|ARHGAP12_ENST00000375250.5_Missense_Mutation_p.N172I|ARHGAP12_ENST00000396144.4_Missense_Mutation_p.N172I|ARHGAP12_ENST00000311380.4_Missense_Mutation_p.N172I	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	172					morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.N172I(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				GCGTGTCCTATTCTGGCTGGA	0.443																																							uc001ivz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(514-516)AAT>ATT		Rho GTPase activating protein 12							130.0	123.0	125.0					10																	32197269		2203	4300	6503	SO:0001583	missense	94134				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr10:32197269T>A	AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.515A>T	10.37:g.32197269T>A	ENSP00000345808:p.Asn172Ile		Somatic				ARHGAP12_uc001ivy.1_Missense_Mutation_p.N170I|ARHGAP12_uc009xls.2_Missense_Mutation_p.N170I|ARHGAP12_uc001iwb.1_Missense_Mutation_p.N170I|ARHGAP12_uc001iwc.1_Missense_Mutation_p.N170I|ARHGAP12_uc009xlq.1_Missense_Mutation_p.N170I|ARHGAP12_uc001iwd.1_Missense_Mutation_p.N170I|ARHGAP12_uc009xlr.1_Missense_Mutation_p.N170I	p.N172I	NM_018287	NP_060757	WXS	Illumina HiSeq	Unspecified	Q8IWW6	RHG12_HUMAN			3	785	-		Prostate(175;0.0199)	172					B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	ENST00000344936.2	37	c.515A>T	CCDS7170.1	.	.	.	.	.	.	.	.	.	.	T	12.51	1.959622	0.34565	.	.	ENSG00000165322	ENST00000311380;ENST00000375250;ENST00000344936;ENST00000396144;ENST00000375245	T;T;T;T;T	0.07908	3.21;3.15;3.21;3.21;3.21	5.84	0.739	0.18324	.	0.589122	0.18847	N	0.129516	T	0.03651	0.0104	N	0.08118	0	0.09310	N	0.999993	B;B;P;B;B;P	0.34462	0.013;0.037;0.454;0.121;0.022;0.454	B;B;B;B;B;B	0.36244	0.02;0.019;0.22;0.051;0.019;0.22	T	0.33803	-0.9854	10	0.66056	D	0.02	.	2.132	0.03752	0.1231:0.2142:0.1144:0.5483	.	172;172;172;172;172;172	Q1RLN5;B3KR88;Q8IWW6-2;Q504X1;Q8IWW6;Q8IWW6-3	.;.;.;.;RHG12_HUMAN;.	I	172	ENSP00000310984:N172I;ENSP00000364399:N172I;ENSP00000345808:N172I;ENSP00000379448:N172I;ENSP00000364394:N172I	ENSP00000310984:N172I	N	-	2	0	ARHGAP12	32237275	0.136000	0.22515	0.991000	0.47740	0.986000	0.74619	0.349000	0.20055	0.486000	0.27676	-0.250000	0.11733	AAT		0.443	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047465.1			133	247	0	0	0	0.00361	0	133	247				
ANKRD30A	91074	broad.mit.edu	37	10	37430752	37430752	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:37430752G>T	ENST00000602533.1	+	7	858	c.759G>T	c.(757-759)ttG>ttT	p.L253F	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.L253F|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.L253F			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	309					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L253F(2)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CTGCACCCTTGGTGGAAAGAA	0.502																																							uc001iza.1		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(7)|breast(1)|skin(1)	9						c.(757-759)TTG>TTT		ankyrin repeat domain 30A							50.0	51.0	51.0					10																	37430752		1871	4109	5980	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37430752G>T	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.759G>T	10.37:g.37430752G>T	ENSP00000473551:p.Leu253Phe		Somatic					p.L253F	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			7	858	+			309					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.759G>T		.	.	.	.	.	.	.	.	.	.	.	10.08	1.253271	0.22965	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.06687	3.27;3.27	0.548	0.548	0.17208	.	.	.	.	.	T	0.08537	0.0212	N	0.24115	0.695	0.09310	N	1	P	0.44006	0.824	P	0.48704	0.587	T	0.34403	-0.9830	8	0.45353	T	0.12	.	.	.	.	.	309	Q9BXX3	AN30A_HUMAN	F	253	ENSP00000354432:L253F;ENSP00000363792:L253F	ENSP00000354432:L253F	L	+	3	2	ANKRD30A	37470758	0.842000	0.29525	0.016000	0.15963	0.052000	0.14988	0.332000	0.19751	0.568000	0.29311	0.280000	0.19369	TTG		0.502	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		22	27	1	0	6.12954e-19	0.004656	8.02744e-19	22	27				
GDF2	2658	broad.mit.edu	37	10	48413794	48413794	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:48413794G>T	ENST00000249598.1	-	2	1233	c.1074C>A	c.(1072-1074)ggC>ggA	p.G358G		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	358					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.G358G(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						AGAAGCAGCCGCCCTTACACT	0.572																																							uc001jfa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1072-1074)GGC>GGA		growth differentiation factor 2 precursor							111.0	97.0	102.0					10																	48413794		2203	4300	6503	SO:0001819	synonymous_variant	2658				activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr10:48413794G>T	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.1074C>A	10.37:g.48413794G>T			Somatic					p.G358G	NM_016204	NP_057288	WXS	Illumina HiSeq	Unspecified	Q9UK05	GDF2_HUMAN			2	1237	-			358					Q5VSQ9|Q9Y571	Silent	SNP	ENST00000249598.1	37	c.1074C>A	CCDS7219.1																																																																																				0.572	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204		17	11	1	0	5.26018e-13	0.001882	6.48717e-13	17	11				
FRMPD2	143162	broad.mit.edu	37	10	49393636	49393636	+	Silent	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:49393636A>T	ENST00000374201.3	-	18	2621	c.2319T>A	c.(2317-2319)atT>atA	p.I773I	FRMPD2_ENST00000407470.4_Silent_p.I741I|FRMPD2_ENST00000305531.3_Silent_p.I748I	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	773					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.I773I(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		TCACACGTACAATTTCTCGGC	0.498																																							uc001jgi.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(2317-2319)ATT>ATA		FERM and PDZ domain containing 2 isoform 3							190.0	165.0	174.0					10																	49393636		2203	4300	6503	SO:0001819	synonymous_variant	143162				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding	g.chr10:49393636A>T	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2319T>A	10.37:g.49393636A>T			Somatic				FRMPD2_uc001jgh.2_Silent_p.I741I|FRMPD2_uc001jgj.2_Silent_p.I751I	p.I773I	NM_001018071	NP_001018081	WXS	Illumina HiSeq	Unspecified	Q68DX3	FRPD2_HUMAN		Kidney(211;0.201)	18	2426	-			773					B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	ENST00000374201.3	37	c.2319T>A	CCDS31195.1																																																																																				0.498	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428		40	70	0	0	0	0.003214	0	40	70				
CHAT	1103	broad.mit.edu	37	10	50870742	50870742	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:50870742G>C	ENST00000337653.2	+	14	2044	c.1891G>C	c.(1891-1893)Gcc>Ccc	p.A631P	CHAT_ENST00000395559.2_Missense_Mutation_p.A513P|CHAT_ENST00000395562.2_Missense_Mutation_p.A549P|CHAT_ENST00000455728.2_Missense_Mutation_p.A513P|CHAT_ENST00000351556.3_Missense_Mutation_p.A513P|CHAT_ENST00000339797.1_Missense_Mutation_p.A513P	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	631					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)	p.A631P(1)		central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	GCGGGAGCTGGCCCGGGCCAT	0.587																																							uc001jhz.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)	3						c.(1891-1893)GCC>CCC		choline acetyltransferase isoform 2	Choline(DB00122)						128.0	123.0	125.0					10																	50870742		2203	4300	6503	SO:0001583	missense	1103				neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity	g.chr10:50870742G>C	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1891G>C	10.37:g.50870742G>C	ENSP00000337103:p.Ala631Pro		Somatic				CHAT_uc001jhv.1_Missense_Mutation_p.A513P|CHAT_uc001jhx.1_Missense_Mutation_p.A513P|CHAT_uc001jhy.1_Missense_Mutation_p.A513P|CHAT_uc001jia.2_Missense_Mutation_p.A513P|CHAT_uc010qgs.1_Missense_Mutation_p.A513P	p.A631P	NM_020549	NP_065574	WXS	Illumina HiSeq	Unspecified	P28329	CLAT_HUMAN		GBM - Glioblastoma multiforme(2;0.000585)	14	2044	+		all_neural(218;0.107)	631					A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	ENST00000337653.2	37	c.1891G>C	CCDS7232.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692472	0.88735	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	D;D;D;D;D;D	0.97114	-4.25;-4.25;-4.25;-4.25;-4.25;-4.25	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.98836	0.9607	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.99581	1.0973	10	0.87932	D	0	-25.6531	19.5169	0.95169	0.0:0.0:1.0:0.0	.	513;631	F8W8I2;P28329	.;CLAT_HUMAN	P	513;513;513;631;549;513	ENSP00000343486:A513P;ENSP00000345878:A513P;ENSP00000378926:A513P;ENSP00000337103:A631P;ENSP00000378929:A549P;ENSP00000390521:A513P	ENSP00000337103:A631P	A	+	1	0	CHAT	50540748	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	6.624000	0.74243	2.631000	0.89168	0.655000	0.94253	GCC		0.587	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549		76	95	0	0	0	0.00361	0	76	95				
PCDH15	65217	broad.mit.edu	37	10	55721550	55721550	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:55721550G>T	ENST00000320301.6	-	22	3365	c.2971C>A	c.(2971-2973)Cga>Aga	p.R991R	PCDH15_ENST00000395438.1_Silent_p.R991R|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395430.1_Silent_p.R991R|PCDH15_ENST00000395433.1_Silent_p.R969R|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000361849.3_Silent_p.R991R|PCDH15_ENST00000395432.2_Silent_p.R954R|PCDH15_ENST00000395445.1_Silent_p.R998R|PCDH15_ENST00000414778.1_Silent_p.R996R|PCDH15_ENST00000437009.1_Silent_p.R920R|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373965.2_Silent_p.R998R|PCDH15_ENST00000409834.1_Silent_p.R602R	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	991	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.R991R(2)|p.R996R(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AGATTGACTCGTGTTATTACT	0.348										HNSCC(58;0.16)																													uc001jju.1		NA																	4	Substitution - coding silent(4)		lung(4)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13	GRCh37	CM064158	PCDH15	M		c.(2971-2973)CGA>AGA		protocadherin 15 isoform CD1-4 precursor							121.0	120.0	120.0					10																	55721550		2203	4299	6502	SO:0001819	synonymous_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55721550G>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2971C>A	10.37:g.55721550G>T		HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Silent_p.R996R|PCDH15_uc010qhr.1_Silent_p.R991R|PCDH15_uc010qhs.1_Silent_p.R1003R|PCDH15_uc010qht.1_Silent_p.R998R|PCDH15_uc010qhu.1_Silent_p.R991R|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Silent_p.R991R|PCDH15_uc010qhw.1_Silent_p.R954R|PCDH15_uc010qhx.1_Silent_p.R920R|PCDH15_uc010qhy.1_Silent_p.R996R|PCDH15_uc010qhz.1_Silent_p.R991R|PCDH15_uc010qia.1_Silent_p.R969R|PCDH15_uc010qib.1_Silent_p.R969R	p.R991R	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			22	3366	-		Melanoma(3;0.117)|Lung SC(717;0.238)	991			Extracellular (Potential).|Cadherin 9.		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	c.2971C>A	CCDS7248.1																																																																																				0.348	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		22	110	1	0	6.12954e-19	0.004656	8.02744e-19	22	110				
LRRTM3	347731	broad.mit.edu	37	10	68857382	68857382	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:68857382A>T	ENST00000361320.4	+	3	2152	c.1574A>T	c.(1573-1575)tAc>tTc	p.Y525F	LRRTM3_ENST00000485868.1_3'UTR|CTNNA3_ENST00000373744.4_Intron|CTNNA3_ENST00000433211.2_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	525					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.Y525F(2)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						TTTCTGGCATACGACCAGCCC	0.398																																							uc001jmz.1		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1573-1575)TAC>TTC		leucine rich repeat transmembrane neuronal 3							147.0	134.0	138.0					10																	68857382		2203	4299	6502	SO:0001583	missense	347731					integral to membrane		g.chr10:68857382A>T	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1574A>T	10.37:g.68857382A>T	ENSP00000355187:p.Tyr525Phe		Somatic				CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron	p.Y525F	NM_178011	NP_821079	WXS	Illumina HiSeq	Unspecified	Q86VH5	LRRT3_HUMAN			3	2124	+			525			Cytoplasmic (Potential).		A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	ENST00000361320.4	37	c.1574A>T	CCDS7270.1	.	.	.	.	.	.	.	.	.	.	A	18.22	3.575737	0.65878	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.75050	-0.9	5.92	5.92	0.95590	.	0.000000	0.44688	D	0.000435	T	0.61874	0.2382	N	0.19112	0.55	0.35576	D	0.805902	P	0.47762	0.9	B	0.42995	0.404	T	0.68269	-0.5453	10	0.23891	T	0.37	.	13.9014	0.63806	1.0:0.0:0.0:0.0	.	525	Q86VH5	LRRT3_HUMAN	F	525	ENSP00000355187:Y525F	ENSP00000355187:Y525F	Y	+	2	0	LRRTM3	68527388	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.568000	0.60857	2.277000	0.76020	0.528000	0.53228	TAC		0.398	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011		42	226	0	0	0	0.00361	0	42	226				
MYPN	84665	broad.mit.edu	37	10	69909858	69909858	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:69909858T>C	ENST00000358913.5	+	6	1795	c.1307T>C	c.(1306-1308)gTg>gCg	p.V436A	MYPN_ENST00000373675.3_Missense_Mutation_p.V436A|MYPN_ENST00000540630.1_Missense_Mutation_p.V436A|MYPN_ENST00000354393.2_Missense_Mutation_p.V161A	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	436	Ig-like 2.|Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.V436A(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GCAGCTCCTGTGTTTACAAAG	0.363																																							uc001jnm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1306-1308)GTG>GCG		myopalladin							121.0	123.0	122.0					10																	69909858		2203	4300	6503	SO:0001583	missense	84665					nucleus|sarcomere	actin binding	g.chr10:69909858T>C	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1307T>C	10.37:g.69909858T>C	ENSP00000351790:p.Val436Ala		Somatic				MYPN_uc001jnl.1_Missense_Mutation_p.V436A|MYPN_uc001jnn.3_Missense_Mutation_p.V161A|MYPN_uc001jno.3_Missense_Mutation_p.V436A|MYPN_uc001jnp.1_Missense_Mutation_p.V436A|MYPN_uc009xps.2_Missense_Mutation_p.V436A|MYPN_uc009xpt.2_Missense_Mutation_p.V436A|MYPN_uc010qit.1_Missense_Mutation_p.V142A|MYPN_uc010qiu.1_RNA	p.V436A	NM_032578	NP_115967	WXS	Illumina HiSeq	Unspecified	Q86TC9	MYPN_HUMAN			7	1492	+			436			Interaction with CARP.|Ig-like 2.		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	c.1307T>C	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.503529	0.85176	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630;ENST00000373675	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.53	5.53	0.82687	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.069293	0.56097	D	0.000025	T	0.76535	0.4001	L	0.47716	1.5	0.54753	D	0.999989	D;D;P;D	0.76494	0.996;0.997;0.933;0.999	D;D;P;D	0.80764	0.987;0.941;0.678;0.994	T	0.75348	-0.3349	9	.	.	.	.	15.9479	0.79806	0.0:0.0:0.0:1.0	.	436;436;161;436	F5GWA6;Q86TC9-3;Q86TC9-2;Q86TC9	.;.;.;MYPN_HUMAN	A	161;161;436;436;436	ENSP00000346369:V161A;ENSP00000351790:V436A;ENSP00000441668:V436A;ENSP00000362779:V436A	.	V	+	2	0	MYPN	69579864	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.185000	0.77714	2.225000	0.72522	0.482000	0.46254	GTG		0.363	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578		31	97	0	0	0	0.003271	0	31	97				
NODAL	4838	broad.mit.edu	37	10	72195389	72195389	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:72195389G>T	ENST00000287139.3	-	2	543	c.544C>A	c.(544-546)Ccg>Acg	p.P182T	AC022532.1_ENST00000420338.2_Silent_p.R112R	NM_018055.4	NP_060525.3	Q96S42	NODAL_HUMAN	nodal growth differentiation factor	182					axial mesodermal cell fate specification (GO:0048327)|brain development (GO:0007420)|cell migration involved in gastrulation (GO:0042074)|digestive tract morphogenesis (GO:0048546)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic pattern specification (GO:0009880)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endodermal cell differentiation (GO:0035987)|epiblast cell-extraembryonic ectoderm cell signaling involved in anterior/posterior axis specification (GO:0060802)|floor plate morphogenesis (GO:0033505)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|heart looping (GO:0001947)|inhibition of neuroepithelial cell differentiation (GO:0002085)|left lung morphogenesis (GO:0060460)|liver development (GO:0001889)|maternal placenta development (GO:0001893)|maternal process involved in parturition (GO:0060137)|mesendoderm development (GO:0048382)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of chorionic trophoblast cell proliferation (GO:1901383)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of trophoblast cell migration (GO:1901164)|neural fold formation (GO:0001842)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|placenta development (GO:0001890)|polarity specification of proximal/distal axis (GO:0010085)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gastrulation (GO:0010470)|regulation of stem cell maintenance (GO:2000036)|SMAD protein signal transduction (GO:0060395)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway involved in primitive streak formation (GO:0090010)|trophectodermal cellular morphogenesis (GO:0001831)|vasculature development (GO:0001944)	extracellular space (GO:0005615)	morphogen activity (GO:0016015)|type I activin receptor binding (GO:0070698)	p.P182T(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	15						GGGGGCCGCGGCCAGCACTCT	0.637																																							uc001jrc.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|kidney(1)	2						c.(544-546)CCG>ACG		nodal precursor							32.0	33.0	33.0					10																	72195389		2203	4300	6503	SO:0001583	missense	4838				growth	extracellular space	cytokine activity|growth factor activity	g.chr10:72195389G>T	BC033585	CCDS7304.1	10q22.1	2012-12-07	2012-12-07		ENSG00000156574	ENSG00000156574			7865	protein-coding gene	gene with protein product		601265	"""nodal, mouse, homolog"", ""nodal homolog (mouse)"""			9354794	Standard	NM_018055		Approved		uc001jrc.2	Q96S42	OTTHUMG00000018408	ENST00000287139.3:c.544C>A	10.37:g.72195389G>T	ENSP00000287139:p.Pro182Thr		Somatic					p.P182T	NM_018055	NP_060525	WXS	Illumina HiSeq	Unspecified	Q96S42	NODAL_HUMAN			2	586	-			182					Q2M3A5|Q8N4V3	Missense_Mutation	SNP	ENST00000287139.3	37	c.544C>A	CCDS7304.1	.	.	.	.	.	.	.	.	.	.	G	0.705	-0.789404	0.02884	.	.	ENSG00000156574	ENST00000287139;ENST00000414871	D;D	0.84298	-1.83;-1.83	5.88	4.98	0.66077	.	1.767130	0.02086	N	0.052743	T	0.72914	0.3520	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.60167	-0.7316	10	0.15066	T	0.55	.	8.4038	0.32603	0.0783:0.0:0.7659:0.1558	.	182	Q96S42	NODAL_HUMAN	T	182;127	ENSP00000287139:P182T;ENSP00000394468:P127T	ENSP00000287139:P182T	P	-	1	0	NODAL	71865395	0.470000	0.25854	0.628000	0.29241	0.031000	0.12232	3.655000	0.54460	2.782000	0.95742	0.655000	0.94253	CCG		0.637	NODAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048511.1	NM_018055		7	3	1	0	5.68852e-11	0.004482	6.75291e-11	7	3				
CDH23	64072	broad.mit.edu	37	10	73544838	73544838	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:73544838C>T	ENST00000224721.6	+	42	5713	c.5708C>T	c.(5707-5709)gCc>gTc	p.A1903V		NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	1898	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.A1903V(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CGCGAGCGGGCCTTCTTCATC	0.597																																							uc001jrx.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(5692-5694)GCC>GTC		cadherin-like 23 isoform 1 precursor							56.0	59.0	58.0					10																	73544838		2067	4198	6265	SO:0001583	missense	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73544838C>T	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.5708C>T	10.37:g.73544838C>T	ENSP00000224721:p.Ala1903Val		Somatic					p.A1898V	NM_022124	NP_071407	WXS	Illumina HiSeq	Unspecified	Q9H251	CAD23_HUMAN			41	6070	+			1898			Cadherin 18.|Extracellular (Potential).		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37	c.5693C>T		.	.	.	.	.	.	.	.	.	.	C	13.82	2.350952	0.41599	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	4.41	4.41	0.53225	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.56790	0.2009	N	0.17901	0.54	0.80722	D	1	P	0.45902	0.868	P	0.56648	0.803	T	0.51482	-0.8700	9	0.16896	T	0.51	.	17.3731	0.87384	0.0:1.0:0.0:0.0	.	1898	Q9H251	CAD23_HUMAN	V	1903;1898;1901	.	ENSP00000224721:A1903V	A	+	2	0	CDH23	73214844	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	6.019000	0.70818	2.167000	0.68274	0.305000	0.20034	GCC		0.597	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		17	26	0	0	0	0.00278	0	17	26				
CDH23	64072	broad.mit.edu	37	10	73550900	73550900	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:73550900G>T	ENST00000224721.6	+	46	6081	c.6076G>T	c.(6076-6078)Gtg>Ttg	p.V2026L		NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2021	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.V2026L(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						TGTGGTGACCGTGAGGTCAGG	0.622																																							uc001jrx.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(6061-6063)GTG>TTG		cadherin-like 23 isoform 1 precursor							33.0	37.0	35.0					10																	73550900		2173	4283	6456	SO:0001583	missense	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73550900G>T	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.6076G>T	10.37:g.73550900G>T	ENSP00000224721:p.Val2026Leu		Somatic					p.V2021L	NM_022124	NP_071407	WXS	Illumina HiSeq	Unspecified	Q9H251	CAD23_HUMAN			45	6438	+			2021			Cadherin 19.|Extracellular (Potential).		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37	c.6061G>T		.	.	.	.	.	.	.	.	.	.	G	18.28	3.589682	0.66105	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	5.91	5.91	0.95273	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.44705	0.1306	N	0.21142	0.635	0.80722	D	1	P	0.47604	0.898	P	0.44359	0.447	T	0.32025	-0.9922	9	0.35671	T	0.21	.	16.5383	0.84377	0.0:0.0:0.869:0.131	.	2021	Q9H251	CAD23_HUMAN	L	2026;2021;2024	.	ENSP00000224721:V2026L	V	+	1	0	CDH23	73220906	1.000000	0.71417	0.966000	0.40874	0.187000	0.23431	7.690000	0.84178	2.793000	0.96121	0.655000	0.94253	GTG		0.622	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		3	3	1	0	6.4e-05	0.004672	6.85629e-05	3	3				
LDB3	11155	broad.mit.edu	37	10	88478508	88478508	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:88478508A>T	ENST00000361373.4	+	11	1903	c.1882A>T	c.(1882-1884)Aca>Tca	p.T628S	LDB3_ENST00000458213.2_Missense_Mutation_p.T518S|LDB3_ENST00000352360.5_Missense_Mutation_p.T371S|LDB3_ENST00000429277.2_Missense_Mutation_p.T633S|LDB3_ENST00000263066.6_Missense_Mutation_p.T518S	NM_007078.2	NP_009009.1			LIM domain binding 3									p.T628S(1)|p.T633S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						CTTGAGACAGACATGGCACAC	0.577																																							uc001kdv.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1882-1884)ACA>TCA		LIM domain binding 3 isoform 1							115.0	104.0	108.0					10																	88478508		2203	4300	6503	SO:0001583	missense	11155					cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding	g.chr10:88478508A>T	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1882A>T	10.37:g.88478508A>T	ENSP00000355296:p.Thr628Ser		Somatic				LDB3_uc010qmm.1_Missense_Mutation_p.T633S|LDB3_uc001kdu.2_Missense_Mutation_p.T518S|LDB3_uc009xsz.2_Missense_Mutation_p.T257S|LDB3_uc009xta.1_Missense_Mutation_p.T7S	p.T628S	NM_007078	NP_009009	WXS	Illumina HiSeq	Unspecified	O75112	LDB3_HUMAN			11	1905	+			628			LIM zinc-binding 2.			Missense_Mutation	SNP	ENST00000361373.4	37	c.1882A>T	CCDS7377.1	.	.	.	.	.	.	.	.	.	.	A	31	5.087196	0.94100	.	.	ENSG00000122367	ENST00000539402;ENST00000429277;ENST00000458213;ENST00000352360;ENST00000263066;ENST00000361373	D;D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19;-2.19	5.49	5.49	0.81192	Zinc finger, LIM-type (5);	0.000000	0.33401	N	0.004945	D	0.90618	0.7058	L	0.42529	1.33	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.994;0.998;0.999;0.998	D;D;D;D;D	0.83275	0.996;0.991;0.987;0.994;0.994	D	0.89996	0.4111	10	0.38643	T	0.18	.	15.6132	0.76744	1.0:0.0:0.0:0.0	.	633;549;371;628;518	B4E3K3;B4DGP4;O75112-3;O75112;O75112-2	.;.;.;LDB3_HUMAN;.	S	549;633;518;371;518;628	ENSP00000401437:T633S;ENSP00000409148:T518S;ENSP00000263067:T371S;ENSP00000263066:T518S;ENSP00000355296:T628S	ENSP00000263066:T518S	T	+	1	0	LDB3	88468488	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	9.339000	0.96797	2.076000	0.62316	0.533000	0.62120	ACA		0.577	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2			34	53	0	0	0	0.009718	0	34	53				
SLC16A12	387700	broad.mit.edu	37	10	91198784	91198784	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:91198784G>A	ENST00000341233.4	-	6	905	c.515C>T	c.(514-516)tCc>tTc	p.S172F	SLC16A12_ENST00000371790.4_Missense_Mutation_p.S202F	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.S172F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						TCCCCGCCAGGAAAACTGTTC	0.498																																							uc001kgm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(514-516)TCC>TTC		solute carrier family 16 (monocarboxylic acid							95.0	92.0	93.0					10																	91198784		2203	4300	6503	SO:0001583	missense	387700					integral to membrane|plasma membrane	symporter activity	g.chr10:91198784G>A		CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.515C>T	10.37:g.91198784G>A	ENSP00000343022:p.Ser172Phe		Somatic				SLC16A12_uc001kgl.2_5'Flank	p.S172F	NM_213606	NP_998771	WXS	Illumina HiSeq	Unspecified	Q6ZSM3	MOT12_HUMAN			6	906	-			172			Cytoplasmic (Potential).		Q5M9M9|Q5T7J2|Q6ZV76	Missense_Mutation	SNP	ENST00000341233.4	37	c.515C>T		.	.	.	.	.	.	.	.	.	.	G	27.4	4.825372	0.90955	.	.	ENSG00000152779	ENST00000341233;ENST00000371790	D;D	0.82526	-1.62;-1.62	5.86	5.86	0.93980	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.92182	0.7521	M	0.82923	2.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92289	0.5840	10	0.87932	D	0	.	19.5509	0.95319	0.0:0.0:1.0:0.0	.	172	Q6ZSM3	MOT12_HUMAN	F	172;202	ENSP00000343022:S172F;ENSP00000360855:S202F	ENSP00000343022:S172F	S	-	2	0	SLC16A12	91188764	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.619000	0.74219	2.937000	0.99478	0.650000	0.86243	TCC		0.498	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_213606		15	177	0	0	0	0.006122	0	15	177				
PPP1R3C	5507	broad.mit.edu	37	10	93390364	93390364	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:93390364C>A	ENST00000238994.5	-	2	358	c.274G>T	c.(274-276)Ggc>Tgc	p.G92C		NM_005398.5	NP_005389.1			protein phosphatase 1, regulatory subunit 3C									p.G92C(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(1)	12		Colorectal(252;0.235)				AGAGAGAGGCCCTTGGAGTCA	0.478																																							uc001kho.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(274-276)GGC>TGC		protein phosphatase 1, regulatory (inhibitor)							127.0	126.0	127.0					10																	93390364		2203	4300	6503	SO:0001583	missense	5507						protein serine/threonine phosphatase activity	g.chr10:93390364C>A	Y18207	CCDS7416.1	10q23-q24	2012-04-17	2011-10-04	2001-08-01	ENSG00000119938	ENSG00000119938		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9293	protein-coding gene	gene with protein product	"""Phosphatase 1, regulatory inhibitor subunit 5"", ""protein targeting to glycogen"""	602999	"""protein phosphatase 1, regulatory (inhibitor) subunit 3C"""	PPP1R5		8985175	Standard	NM_005398		Approved	PTG	uc001kho.3	Q9UQK1	OTTHUMG00000018745	ENST00000238994.5:c.274G>T	10.37:g.93390364C>A	ENSP00000238994:p.Gly92Cys		Somatic					p.G92C	NM_005398	NP_005389	WXS	Illumina HiSeq	Unspecified	Q9UQK1	PPR3C_HUMAN			2	406	-		Colorectal(252;0.235)	92						Missense_Mutation	SNP	ENST00000238994.5	37	c.274G>T	CCDS7416.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188535	0.78789	.	.	ENSG00000119938	ENST00000238994;ENST00000438999	D	0.90197	-2.63	5.79	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.95758	0.8620	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96153	0.9109	10	0.87932	D	0	-27.8833	16.3014	0.82816	0.1327:0.8673:0.0:0.0	.	92	Q9UQK1	PPR3C_HUMAN	C	92	ENSP00000238994:G92C	ENSP00000238994:G92C	G	-	1	0	PPP1R3C	93380344	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.967000	0.70403	2.733000	0.93635	0.655000	0.94253	GGC		0.478	PPP1R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049372.1	NM_005398		21	85	1	0	3.83957e-06	0.00278	4.20805e-06	21	85				
PDCD11	22984	broad.mit.edu	37	10	105198552	105198552	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:105198552G>T	ENST00000369797.3	+	27	4106	c.4012G>T	c.(4012-4014)Ggt>Tgt	p.G1338C		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1338	S1 motif 12. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.G1338C(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CCAGCCACACGGTGTGTTCTT	0.552																																							uc001kwy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7						c.(4012-4014)GGT>TGT		programmed cell death 11							103.0	107.0	105.0					10																	105198552		2203	4300	6503	SO:0001583	missense	22984				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding	g.chr10:105198552G>T	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.4012G>T	10.37:g.105198552G>T	ENSP00000358812:p.Gly1338Cys		Somatic					p.G1338C	NM_014976	NP_055791	WXS	Illumina HiSeq	Unspecified	Q14690	RRP5_HUMAN		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)	27	4099	+		Colorectal(252;0.0747)|Breast(234;0.128)	1338			S1 motif 12.		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	c.4012G>T	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072611	0.76415	.	.	ENSG00000148843	ENST00000369797	T	0.27890	1.64	5.62	4.71	0.59529	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	0.044211	0.85682	D	0.000000	T	0.58337	0.2115	M	0.84082	2.675	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.65158	-0.6236	10	0.87932	D	0	-8.8946	13.623	0.62149	0.0753:0.0:0.9247:0.0	.	1338	Q14690	RRP5_HUMAN	C	1338	ENSP00000358812:G1338C	ENSP00000358812:G1338C	G	+	1	0	PDCD11	105188542	1.000000	0.71417	0.906000	0.35671	0.029000	0.11900	6.287000	0.72671	1.348000	0.45733	0.561000	0.74099	GGT		0.552	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			13	47	1	0	1.3612e-06	0.003163	1.51215e-06	13	47				
ADD3	120	broad.mit.edu	37	10	111872586	111872586	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:111872586C>T	ENST00000356080.4	+	3	614	c.247C>T	c.(247-249)Cac>Tac	p.H83Y	ADD3_ENST00000497125.1_3'UTR|ADD3_ENST00000277900.8_Missense_Mutation_p.H83Y|ADD3_ENST00000360162.3_Missense_Mutation_p.H83Y	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	83						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.H83Y(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GAAGAAAGGCCACAACCCAAC	0.418																																							uc001kyt.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|large_intestine(1)	5						c.(247-249)CAC>TAC		adducin 3 (gamma) isoform a							193.0	173.0	180.0					10																	111872586		2203	4300	6503	SO:0001583	missense	120					cytoskeleton	actin binding|calmodulin binding|metal ion binding|structural constituent of cytoskeleton	g.chr10:111872586C>T	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.247C>T	10.37:g.111872586C>T	ENSP00000348381:p.His83Tyr		Somatic				ADD3_uc001kys.3_Missense_Mutation_p.H83Y|ADD3_uc001kyu.2_Missense_Mutation_p.H83Y|ADD3_uc001kyv.2_Missense_Mutation_p.H83Y|ADD3_uc001kyw.2_Missense_Mutation_p.H83Y	p.H83Y	NM_016824	NP_058432	WXS	Illumina HiSeq	Unspecified	Q9UEY8	ADDG_HUMAN		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)	4	561	+		Breast(234;0.052)|Lung NSC(174;0.223)	83					D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	37	c.247C>T	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.626974	0.46840	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.04758	3.57;3.56;3.57	5.49	3.62	0.41486	.	0.128538	0.64402	D	0.000002	T	0.02230	0.0069	N	0.03608	-0.345	0.39355	D	0.96582	B;B	0.06786	0.0;0.001	B;B	0.10450	0.002;0.005	T	0.46414	-0.9193	10	0.52906	T	0.07	-5.3872	5.213	0.15327	0.2747:0.5599:0.0:0.1653	.	83;83	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	Y	83	ENSP00000353286:H83Y;ENSP00000348381:H83Y;ENSP00000277900:H83Y	ENSP00000277900:H83Y	H	+	1	0	ADD3	111862576	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	2.264000	0.43302	1.458000	0.47871	0.655000	0.94253	CAC		0.418	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903		70	69	0	0	0	0.00361	0	70	69				
AFAP1L2	84632	broad.mit.edu	37	10	116100464	116100464	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:116100464C>T	ENST00000304129.4	-	2	72	c.43G>A	c.(43-45)Gat>Aat	p.D15N	AFAP1L2_ENST00000545353.1_Missense_Mutation_p.D15N|AFAP1L2_ENST00000369271.3_Missense_Mutation_p.D15N			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	15					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)	p.D33N(1)|p.D15N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		AGGAAGTCATCCAACTCTGTC	0.547																																							uc001lbn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(43-45)GAT>AAT		KIAA1914 protein isoform 1							83.0	81.0	82.0					10																	116100464		2203	4300	6503	SO:0001583	missense	84632				inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding	g.chr10:116100464C>T	BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.43G>A	10.37:g.116100464C>T	ENSP00000303042:p.Asp15Asn		Somatic				AFAP1L2_uc001lbo.2_Missense_Mutation_p.D15N|AFAP1L2_uc010qse.1_Missense_Mutation_p.D15N|AFAP1L2_uc001lbp.2_Missense_Mutation_p.D15N|AFAP1L2_uc001lbr.1_Missense_Mutation_p.D15N	p.D15N	NM_001001936	NP_001001936	WXS	Illumina HiSeq	Unspecified	Q8N4X5	AF1L2_HUMAN		Epithelial(162;0.0219)|all cancers(201;0.0561)	2	344	-		Colorectal(252;0.175)|Breast(234;0.231)	15					A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Missense_Mutation	SNP	ENST00000304129.4	37	c.43G>A	CCDS31286.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.035095	0.35893	.	.	ENSG00000169129	ENST00000369271;ENST00000304129;ENST00000392974;ENST00000541919;ENST00000545353;ENST00000419268	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.01	5.01	0.66863	.	0.337566	0.31589	N	0.007399	T	0.33089	0.0851	N	0.24115	0.695	0.39249	D	0.963998	P;P;B;P;B	0.44195	0.828;0.736;0.026;0.493;0.361	B;B;B;B;B	0.39531	0.302;0.159;0.026;0.109;0.051	T	0.14172	-1.0482	10	0.15499	T	0.54	-6.8024	15.5913	0.76530	0.0:1.0:0.0:0.0	.	15;15;15;15;15	F5GZE1;B7Z2Q0;Q8N4X5-4;Q8N4X5-2;Q8N4X5	.;.;.;.;AF1L2_HUMAN	N	15;15;14;33;15;33	ENSP00000358276:D15N;ENSP00000303042:D15N;ENSP00000444511:D15N;ENSP00000396781:D33N	ENSP00000303042:D15N	D	-	1	0	AFAP1L2	116090454	1.000000	0.71417	0.995000	0.50966	0.896000	0.52359	5.223000	0.65283	2.469000	0.83416	0.655000	0.94253	GAT		0.547	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050462.1	NM_032550		5	60	0	0	0	0.000602	0	5	60				
GPR26	2849	broad.mit.edu	37	10	125447575	125447575	+	Missense_Mutation	SNP	T	T	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:125447575T>G	ENST00000284674.1	+	3	966	c.913T>G	c.(913-915)Tgc>Ggc	p.C305G		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	305					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.C305G(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				CCGCAAAAGCTGCAAGGAGAT	0.592																																							uc001lhh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(913-915)TGC>GGC		G protein-coupled receptor 26							73.0	65.0	68.0					10																	125447575		2203	4300	6503	SO:0001583	missense	2849				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:125447575T>G		CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.913T>G	10.37:g.125447575T>G	ENSP00000284674:p.Cys305Gly		Somatic					p.C305G	NM_153442	NP_703143	WXS	Illumina HiSeq	Unspecified	Q8NDV2	GPR26_HUMAN			3	966	+		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)	305			Cytoplasmic (Potential).		Q2M2E2	Missense_Mutation	SNP	ENST00000284674.1	37	c.913T>G	CCDS7636.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.056801	0.55325	.	.	ENSG00000154478	ENST00000284674	T	0.37058	1.22	5.59	5.59	0.84812	.	0.127037	0.56097	D	0.000038	T	0.28433	0.0703	L	0.29908	0.895	0.54753	D	0.999983	B	0.31817	0.341	B	0.23574	0.047	T	0.09574	-1.0668	10	0.87932	D	0	-17.4703	15.7444	0.77926	0.0:0.0:0.0:1.0	.	305	Q8NDV2	GPR26_HUMAN	G	305	ENSP00000284674:C305G	ENSP00000284674:C305G	C	+	1	0	GPR26	125437565	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.598000	0.82745	2.103000	0.63969	0.477000	0.44152	TGC		0.592	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050850.1			4	32	0	0	0	0.006214	0	4	32				
EBF3	253738	broad.mit.edu	37	10	131671816	131671816	+	Silent	SNP	G	G	T	rs150383257	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:131671816G>T	ENST00000355311.5	-	8	753	c.681C>A	c.(679-681)gcC>gcA	p.A227A	EBF3_ENST00000368648.3_Silent_p.A227A			Q9H4W6	COE3_HUMAN	early B-cell factor 3	227					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A227A(2)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TGTCTGACACGGCCAGCACGT	0.522																																							uc001lki.1		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)|pancreas(1)	2						c.(679-681)GCC>GCA		early B-cell factor 3							60.0	57.0	58.0					10																	131671816		2203	4300	6503	SO:0001819	synonymous_variant	253738				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding	g.chr10:131671816G>T		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.681C>A	10.37:g.131671816G>T			Somatic					p.A227A	NM_001005463	NP_001005463	WXS	Illumina HiSeq	Unspecified	Q9H4W6	COE3_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;0.00513)	8	740	-		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)	227					A0AUY1|Q5T6H9|Q9H4W5	Silent	SNP	ENST00000355311.5	37	c.681C>A																																																																																					0.522	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463		14	24	1	0	2.35188e-11	0.006122	2.81535e-11	14	24				
FRG2B	441581	broad.mit.edu	37	10	135440087	135440087	+	Nonsense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:135440087T>A	ENST00000425520.1	-	1	212	c.160A>T	c.(160-162)Aag>Tag	p.K54*	FRG2B_ENST00000443774.1_Nonsense_Mutation_p.K54*	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	54						nucleus (GO:0005634)		p.K54*(1)		endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TGTATGTGCTTCTCACTGGAA	0.488																																							uc010qvg.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(160-162)AAG>TAG		FSHD region gene 2 family, member B							34.0	37.0	36.0					10																	135440087		2193	4293	6486	SO:0001587	stop_gained	441581					nucleus		g.chr10:135440087T>A	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.160A>T	10.37:g.135440087T>A	ENSP00000401310:p.Lys54*		Somatic					p.K54*	NM_001080998	NP_001074467	WXS	Illumina HiSeq	Unspecified	Q96QU4	FRG2B_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	1	213	-		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	54					Q5VSQ1	Nonsense_Mutation	SNP	ENST00000425520.1	37	c.160A>T	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	12.25	1.881849	0.33255	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	.	.	.	0.109	0.109	0.14578	.	3.140850	0.01460	N	0.015821	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0222	.	.	.	.	.	.	.	X	54	.	ENSP00000401310:K54X	K	-	1	0	FRG2B	135290077	0.998000	0.40836	0.035000	0.18076	0.035000	0.12851	0.735000	0.26115	0.156000	0.19299	0.155000	0.16302	AAG		0.488	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998		15	21	0	0	0	0.001882	0	15	21				
SLC25A22	79751	broad.mit.edu	37	11	792399	792399	+	Missense_Mutation	SNP	C	C	A	rs201932343		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:792399C>A	ENST00000320230.5	-	8	1128	c.647G>T	c.(646-648)cGc>cTc	p.R216L	CEND1_ENST00000330106.4_5'Flank|CEND1_ENST00000524587.1_5'Flank|SLC25A22_ENST00000531214.1_Missense_Mutation_p.R216L	NM_001191061.1|NM_024698.5	NP_001177990.1|NP_078974.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22	216					L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.R216L(1)		endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGACGCCGGGCGGCCCAGCTG	0.662																																					Colon(93;848 1468 3270 23355 49636)	Colon(93;848 1468 3270 23355 49636)	uc001lri.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(646-648)CGC>CTC		mitochondrial glutamate carrier 1	L-Glutamic Acid(DB00142)						72.0	79.0	77.0					11																	792399		2203	4298	6501	SO:0001583	missense	79751					integral to membrane|mitochondrial inner membrane|nucleus	L-glutamate transmembrane transporter activity|protein binding|symporter activity	g.chr11:792399C>A	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310	ENST00000320230.5:c.647G>T	11.37:g.792399C>A	ENSP00000322020:p.Arg216Leu		Somatic				CEND1_uc001lrh.1_5'Flank|SLC25A22_uc009yci.2_Missense_Mutation_p.R216L|SLC25A22_uc001lrj.2_Missense_Mutation_p.R216L	p.R216L	NM_024698	NP_078974	WXS	Illumina HiSeq	Unspecified	Q9H936	GHC1_HUMAN		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	8	989	-		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	216					A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	ENST00000320230.5	37	c.647G>T	CCDS7715.1	.	.	.	.	.	.	.	.	.	.	C	0.503	-0.870061	0.02570	.	.	ENSG00000177542	ENST00000320230;ENST00000531214;ENST00000481290	T;T;T	0.76709	-1.04;-1.04;-1.04	3.77	-1.4	0.08968	Mitochondrial carrier domain (2);	0.270125	0.35838	N	0.002946	T	0.57257	0.2041	L	0.29908	0.895	0.26670	N	0.971759	B	0.02656	0.0	B	0.12156	0.007	T	0.34527	-0.9825	10	0.28530	T	0.3	-10.71	3.5884	0.07979	0.1743:0.3862:0.0:0.4395	.	216	Q9H936	GHC1_HUMAN	L	216;216;241	ENSP00000322020:R216L;ENSP00000437236:R216L;ENSP00000431829:R241L	ENSP00000322020:R216L	R	-	2	0	SLC25A22	782399	0.742000	0.28228	0.001000	0.08648	0.285000	0.27093	0.930000	0.28858	-0.356000	0.08187	0.508000	0.49915	CGC		0.662	SLC25A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257107.2			6	6	1	0	2.0095e-06	0.001984	2.22369e-06	6	6				
OR52A5	390054	broad.mit.edu	37	11	5153664	5153664	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:5153664G>T	ENST00000307388.1	-	1	208	c.209C>A	c.(208-210)gCc>gAc	p.A70D		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	70					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A70D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		AATGTCTGTGGCTGCCAACAT	0.363																																							uc010qyx.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|lung(1)|central_nervous_system(1)	4						c.(208-210)GCC>GAC		olfactory receptor, family 52, subfamily A,							72.0	71.0	71.0					11																	5153664		2201	4298	6499	SO:0001583	missense	390054				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5153664G>T	BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.209C>A	11.37:g.5153664G>T	ENSP00000303469:p.Ala70Asp		Somatic					p.A70D	NM_001005160	NP_001005160	WXS	Illumina HiSeq	Unspecified	Q9H2C5	O52A5_HUMAN		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)	1	209	-		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)	70			Helical; Name=2; (Potential).			Missense_Mutation	SNP	ENST00000307388.1	37	c.209C>A	CCDS31373.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.325114	0.24080	.	.	ENSG00000171944	ENST00000307388	T	0.00551	6.65	5.22	0.988	0.19796	GPCR, rhodopsin-like superfamily (1);	0.507715	0.16583	N	0.208135	T	0.01061	0.0035	M	0.82823	2.61	0.09310	N	1	P	0.41710	0.76	P	0.48141	0.568	T	0.39210	-0.9625	10	0.51188	T	0.08	.	5.0082	0.14298	0.3756:0.1539:0.4705:0.0	.	70	Q9H2C5	O52A5_HUMAN	D	70	ENSP00000303469:A70D	ENSP00000303469:A70D	A	-	2	0	OR52A5	5110240	0.000000	0.05858	0.739000	0.30968	0.034000	0.12701	0.391000	0.20784	0.076000	0.16826	-0.795000	0.03280	GCC		0.363	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142823.1	NM_001005160		35	87	1	0	1.02591e-13	0.002522	1.27346e-13	35	87				
OR52E4	390081	broad.mit.edu	37	11	5905527	5905527	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:5905527C>A	ENST00000316987.2	+	1	27	c.5C>A	c.(4-6)cCt>cAt	p.P2H		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P2H(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGAGAATGCCTTCTATCAAT	0.423																																							uc010qzs.1		NA																	1	Substitution - Missense(1)	p.P2S(1)	lung(1)	ovary(2)	2						c.(4-6)CCT>CAT		olfactory receptor, family 52, subfamily E,							144.0	143.0	143.0					11																	5905527		2201	4296	6497	SO:0001583	missense	390081				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5905527C>A	AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.5C>A	11.37:g.5905527C>A	ENSP00000321426:p.Pro2His		Somatic				TRIM5_uc001mbq.1_Intron	p.P2H	NM_001005165	NP_001005165	WXS	Illumina HiSeq	Unspecified	Q8NGH9	O52E4_HUMAN		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	5	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	2			Extracellular (Potential).		Q6IFG0	Missense_Mutation	SNP	ENST00000316987.2	37	c.5C>A	CCDS31401.1	.	.	.	.	.	.	.	.	.	.	C	3.021	-0.201791	0.06219	.	.	ENSG00000180974	ENST00000316987	T	0.38887	1.11	5.15	2.14	0.27477	.	0.608360	0.14518	N	0.314625	T	0.27629	0.0679	L	0.32530	0.975	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.25537	-1.0129	10	0.15499	T	0.54	.	7.711	0.28677	0.3346:0.5037:0.1617:0.0	.	2	Q8NGH9	O52E4_HUMAN	H	2	ENSP00000321426:P2H	ENSP00000321426:P2H	P	+	2	0	OR52E4	5862103	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.825000	0.27393	0.285000	0.22329	-0.165000	0.13383	CCT		0.423	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401146.1	NM_001005165		58	194	1	0	4.66136e-34	0.00361	7.06005e-34	58	194				
OR56A4	120793	broad.mit.edu	37	11	6023494	6023494	+	Silent	SNP	C	C	A	rs199866327		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:6023494C>A	ENST00000330728.4	-	1	930	c.885G>T	c.(883-885)acG>acT	p.T295T		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T295T(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGAACCACACGTGCTCAAGG	0.488																																							uc010qzv.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(883-885)ACG>ACT		olfactory receptor, family 56, subfamily A,							82.0	72.0	76.0					11																	6023494		2201	4296	6497	SO:0001819	synonymous_variant	120793				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6023494C>A	BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.885G>T	11.37:g.6023494C>A			Somatic					p.T295T	NM_001005179	NP_001005179	WXS	Illumina HiSeq	Unspecified	Q8NGH8	O56A4_HUMAN		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	885	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	243			Helical; Name=6; (Potential).		B9EH17	Silent	SNP	ENST00000330728.4	37	c.885G>T	CCDS31404.1																																																																																				0.488	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383756.2	NM_001005179		34	54	1	0	1.62957e-23	0.00874	2.25299e-23	34	54				
OR2AG1	144125	broad.mit.edu	37	11	6807144	6807144	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:6807144G>A	ENST00000307401.4	+	1	897	c.876G>A	c.(874-876)ctG>ctA	p.L292L		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L292L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TCTACAGCCTGAGGAATAAGG	0.512																																							uc001mer.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(874-876)CTG>CTA		olfactory receptor, family 2, subfamily AG,							99.0	90.0	93.0					11																	6807144		2201	4293	6494	SO:0001819	synonymous_variant	144125				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6807144G>A	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.876G>A	11.37:g.6807144G>A			Somatic					p.L292L	NM_001004489	NP_001004489	WXS	Illumina HiSeq	Unspecified	Q9H205	O2AG1_HUMAN		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	876	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)	292			Helical; Name=7; (Potential).		B9EKV7|Q6IFG7|Q96R26	Silent	SNP	ENST00000307401.4	37	c.876G>A	CCDS31414.1																																																																																				0.512	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489		5	109	0	0	0	0.00308	0	5	109				
OR5P3	120066	broad.mit.edu	37	11	7846682	7846682	+	Missense_Mutation	SNP	C	C	A	rs200018758	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:7846682C>A	ENST00000328375.1	-	1	837	c.838G>T	c.(838-840)Gtg>Ttg	p.V280L	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153445.1	NP_703146.1	Q8WZ94	OR5P3_HUMAN	olfactory receptor, family 5, subfamily P, member 3	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V280L(1)		autonomic_ganglia(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	15				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GGAATCACCACGGTGTAGAAC	0.453																																							uc010rbg.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(838-840)GTG>TTG		olfactory receptor, family 5, subfamily P,							100.0	94.0	96.0					11																	7846682		2189	4296	6485	SO:0001583	missense	120066				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:7846682C>A	AF158377	CCDS7783.1	11p15.4	2012-08-09			ENSG00000182334	ENSG00000182334		"""GPCR / Class A : Olfactory receptors"""	14784	protein-coding gene	gene with protein product							Standard	NM_153445		Approved	JCG1	uc010rbg.2	Q8WZ94	OTTHUMG00000165669	ENST00000328375.1:c.838G>T	11.37:g.7846682C>A	ENSP00000332068:p.Val280Leu		Somatic					p.V280L	NM_153445	NP_703146	WXS	Illumina HiSeq	Unspecified	Q8WZ94	OR5P3_HUMAN		Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	1	838	-			280			Helical; Name=7; (Potential).		Q6IFE1|Q8NGM2	Missense_Mutation	SNP	ENST00000328375.1	37	c.838G>T	CCDS7783.1	.	.	.	.	.	.	.	.	.	.	C	11.44	1.638105	0.29157	.	.	ENSG00000182334	ENST00000328375	T	0.00279	8.33	4.67	3.77	0.43336	GPCR, rhodopsin-like superfamily (1);	0.314068	0.22711	N	0.056569	T	0.00300	0.0009	L	0.27944	0.81	0.09310	N	1	D	0.61080	0.989	P	0.60682	0.878	T	0.64193	-0.6465	10	0.34782	T	0.22	-33.061	10.8682	0.46869	0.0:0.9077:0.0:0.0923	.	280	Q8WZ94	OR5P3_HUMAN	L	280	ENSP00000332068:V280L	ENSP00000332068:V280L	V	-	1	0	OR5P3	7803258	0.412000	0.25392	0.641000	0.29422	0.102000	0.19082	1.053000	0.30442	1.195000	0.43115	-0.133000	0.14855	GTG		0.453	OR5P3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385697.1	NM_153445		27	119	1	0	8.88839e-20	0.002096	1.18305e-19	27	119				
TEAD1	7003	broad.mit.edu	37	11	12785743	12785743	+	5'UTR	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:12785743G>T	ENST00000527575.1	+	0	77				TEAD1_ENST00000361985.2_5'UTR|TEAD1_ENST00000527636.1_5'UTR|TEAD1_ENST00000361905.4_5'UTR|TEAD1_ENST00000334310.6_5'UTR			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)						gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TTCTTGAAAAGGCTCCAGGCT	0.463																																							uc001mkj.3		NA																	0					0						c.(-83--79)AAGGC>AATGC		TEA domain family member 1																																				SO:0001623	5_prime_UTR_variant	7003				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr11:12785743G>T	X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000527575.1:c.-37G>T	11.37:g.12785743G>T			Somatic						NM_021961	NP_068780	WXS	Illumina HiSeq	Unspecified	P28347	TEAD1_HUMAN		Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)	3	584	+								A4FUP2|E7EV65	Translation_Start_Site	SNP	ENST00000527575.1	37	c.-81G>T																																																																																					0.463	TEAD1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000386888.1	NM_021961		25	29	1	0	2.70662e-09	0.009535	3.1285e-09	25	29				
COPB1	1315	broad.mit.edu	37	11	14496111	14496111	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:14496111G>A	ENST00000249923.3	-	14	1967	c.1667C>T	c.(1666-1668)tCc>tTc	p.S556F	COPB1_ENST00000526191.1_5'UTR|COPB1_ENST00000439561.2_Missense_Mutation_p.S556F	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	556					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.S556F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TGTGGCAAGGGAGGCAGCAAC	0.423																																							uc001mli.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1666-1668)TCC>TTC		coatomer protein complex, subunit beta 1							156.0	157.0	157.0					11																	14496111		2200	4294	6494	SO:0001583	missense	1315				COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity	g.chr11:14496111G>A	BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.1667C>T	11.37:g.14496111G>A	ENSP00000249923:p.Ser556Phe		Somatic				COPB1_uc001mlg.2_Missense_Mutation_p.S556F|COPB1_uc001mlh.2_Missense_Mutation_p.S556F	p.S556F	NM_016451	NP_057535	WXS	Illumina HiSeq	Unspecified	P53618	COPB_HUMAN			14	1974	-			556					D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	37	c.1667C>T	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666319	0.88251	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.13538	2.58;2.58	6.03	6.03	0.97812	Armadillo-like helical (1);Armadillo-type fold (1);	0.046469	0.85682	D	0.000000	T	0.22166	0.0534	L	0.43923	1.385	0.80722	D	1	P	0.44429	0.835	P	0.46362	0.514	T	0.00085	-1.2097	10	0.87932	D	0	-4.1082	20.5666	0.99351	0.0:0.0:1.0:0.0	.	556	P53618	COPB_HUMAN	F	556	ENSP00000249923:S556F;ENSP00000397873:S556F	ENSP00000249923:S556F	S	-	2	0	COPB1	14452687	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.682000	0.84083	2.854000	0.98071	0.655000	0.94253	TCC		0.423	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451		47	213	0	0	0	0.00361	0	47	213				
GTF2H1	2965	broad.mit.edu	37	11	18380137	18380137	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:18380137C>T	ENST00000265963.4	+	13	1577	c.1417C>T	c.(1417-1419)Cga>Tga	p.R473*	GTF2H1_ENST00000534641.1_Nonsense_Mutation_p.R357*|GTF2H1_ENST00000453096.2_Nonsense_Mutation_p.R473*|GTF2H1_ENST00000526630.2_Nonsense_Mutation_p.R63*|GTF2H1_ENST00000530496.2_Nonsense_Mutation_p.R161*	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	473					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R473*(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						AGAACTTCTACGACATTTCTG	0.398								Nucleotide excision repair (NER)																															uc001moi.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1417-1419)CGA>TGA	NER	general transcription factor IIH, polypeptide 1,							200.0	190.0	194.0					11																	18380137		2199	4293	6492	SO:0001587	stop_gained	2965				mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding	g.chr11:18380137C>T		CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.1417C>T	11.37:g.18380137C>T	ENSP00000265963:p.Arg473*		Somatic				GTF2H1_uc001moh.2_Nonsense_Mutation_p.R473*|GTF2H1_uc009yhm.2_Nonsense_Mutation_p.R357*|GTF2H1_uc001moj.2_Nonsense_Mutation_p.R161*	p.R473*	NM_001142307	NP_001135779	WXS	Illumina HiSeq	Unspecified	P32780	TF2H1_HUMAN			14	2111	+			473					B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Nonsense_Mutation	SNP	ENST00000265963.4	37	c.1417C>T	CCDS7838.1	.	.	.	.	.	.	.	.	.	.	C	38	6.749797	0.97809	.	.	ENSG00000110768	ENST00000453096;ENST00000534641;ENST00000265963;ENST00000530496;ENST00000526630	.	.	.	6.04	5.07	0.68467	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.3858	17.9224	0.88970	0.1698:0.8302:0.0:0.0	.	.	.	.	X	473;357;473;161;63	.	ENSP00000265963:R473X	R	+	1	2	GTF2H1	18336713	0.956000	0.32656	0.973000	0.42090	0.941000	0.58515	1.849000	0.39318	2.873000	0.98535	0.563000	0.77884	CGA		0.398	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395627.2	NM_005316		45	140	0	0	0	0.00361	0	45	140				
MRGPRX1	259249	broad.mit.edu	37	11	18956125	18956125	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:18956125G>T	ENST00000302797.3	-	1	431	c.207C>A	c.(205-207)gcC>gcA	p.A69A	RP11-583F24.8_ENST00000528646.1_RNA|MRGPRX1_ENST00000526914.1_5'UTR	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	69					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A69A(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AGTCTGCTGCGGCCAAGTTGA	0.532																																							uc001mpg.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|central_nervous_system(1)	3						c.(205-207)GCC>GCA		MAS-related GPR, member X1							132.0	131.0	131.0					11																	18956125		2194	4285	6479	SO:0001819	synonymous_variant	259249				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18956125G>T		CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.207C>A	11.37:g.18956125G>T			Somatic					p.A69A	NM_147199	NP_671732	WXS	Illumina HiSeq	Unspecified	Q96LB2	MRGX1_HUMAN			1	425	-			69			Helical; Name=2; (Potential).		Q4V9L2|Q8TDD8|Q8TDD9	Silent	SNP	ENST00000302797.3	37	c.207C>A	CCDS7846.1																																																																																				0.532	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369913.1	NM_147199		71	300	1	0	6.03386e-27	0.00361	8.54921e-27	71	300				
TCP11L1	55346	broad.mit.edu	37	11	33076262	33076262	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:33076262C>T	ENST00000334274.4	+	3	687	c.287C>T	c.(286-288)cCa>cTa	p.P96L	TCP11L1_ENST00000531632.2_Missense_Mutation_p.P96L|TCP11L1_ENST00000530171.1_Intron|TCP11L1_ENST00000432887.1_Missense_Mutation_p.P96L	NM_018393.3	NP_060863.3	Q9NUJ3	T11L1_HUMAN	t-complex 11, testis-specific-like 1	96						microtubule (GO:0005874)		p.P96L(1)		kidney(1)|liver(2)|lung(2)|skin(1)	6						GTTGAATTACCAGAAAACAGG	0.373																																							uc001mud.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(286-288)CCA>CTA		t-complex 11 (mouse) like 1							127.0	132.0	130.0					11																	33076262		2202	4298	6500	SO:0001583	missense	55346							g.chr11:33076262C>T	BC041696	CCDS7882.1	11p13	2014-08-12	2012-09-20		ENSG00000176148	ENSG00000176148			25655	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 1"""				Standard	NM_001145541		Approved	FLJ11336	uc010rei.2	Q9NUJ3	OTTHUMG00000165303	ENST00000334274.4:c.287C>T	11.37:g.33076262C>T	ENSP00000335595:p.Pro96Leu		Somatic				TCP11L1_uc009yju.2_5'UTR|TCP11L1_uc010rei.1_Missense_Mutation_p.P96L|TCP11L1_uc001mue.2_Missense_Mutation_p.P96L	p.P96L	NM_018393	NP_060863	WXS	Illumina HiSeq	Unspecified	Q9NUJ3	T11L1_HUMAN			3	687	+			96					D3DR01|Q8IVX4	Missense_Mutation	SNP	ENST00000334274.4	37	c.287C>T	CCDS7882.1	.	.	.	.	.	.	.	.	.	.	C	16.38	3.106555	0.56291	.	.	ENSG00000176148	ENST00000530419;ENST00000334274;ENST00000531632;ENST00000432887	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	5.95	5.95	0.96441	.	0.150760	0.64402	D	0.000011	T	0.39118	0.1066	M	0.88310	2.945	0.80722	D	1	D	0.52996	0.957	P	0.51974	0.686	T	0.41413	-0.9510	10	0.87932	D	0	-15.5529	20.3812	0.98933	0.0:1.0:0.0:0.0	.	96	Q9NUJ3	T11L1_HUMAN	L	96	ENSP00000436428:P96L;ENSP00000335595:P96L;ENSP00000433067:P96L;ENSP00000395070:P96L	ENSP00000335595:P96L	P	+	2	0	TCP11L1	33032838	1.000000	0.71417	0.485000	0.27403	0.045000	0.14185	5.883000	0.69721	2.821000	0.97095	0.650000	0.86243	CCA		0.373	TCP11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383377.4	NM_018393		20	114	0	0	0	0.00333	0	20	114				
F2	2147	broad.mit.edu	37	11	46760614	46760614	+	Silent	SNP	A	A	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:46760614A>G	ENST00000311907.5	+	13	1727	c.1671A>G	c.(1669-1671)gaA>gaG	p.E557E	F2_ENST00000530231.1_Silent_p.E518E	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	557	High affinity receptor-binding region which is also known as the TP508 peptide.|Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)	p.E557E(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	AGCCTGATGAAGGGAAACGAG	0.552																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)	Esophageal Squamous(147;1147 1808 2148 38609 51144)	uc001ndf.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1669-1671)GAA>GAG		coagulation factor II preproprotein	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)						121.0	113.0	115.0					11																	46760614		2201	4299	6500	SO:0001819	synonymous_variant	2147				activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity	g.chr11:46760614A>G	M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.1671A>G	11.37:g.46760614A>G			Somatic				F2_uc001ndg.3_RNA	p.E557E	NM_000506	NP_000497	WXS	Illumina HiSeq	Unspecified	P00734	THRB_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.146)	13	1714	+		all_lung(304;0.000414)|Lung NSC(402;0.0011)	557			High affinity receptor-binding region which is also known as the TP508 peptide.|Peptidase S1.		B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Silent	SNP	ENST00000311907.5	37	c.1671A>G	CCDS31476.1																																																																																				0.552	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1			6	148	0	0	0	0.001984	0	6	148				
LOC440040	440040	broad.mit.edu	37	11	49830150	49830150	+	RNA	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:49830150C>T	ENST00000527477.1	+	0	1481																											GTGCAGGGCCCATCACTGGAC	0.483																																							uc010rhy.1		NA																	0					0						c.(988-990)CCC>CCT		SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;																																						440040							g.chr11:49830150C>T																													11.37:g.49830150C>T			Somatic				LOC440040_uc009ymb.2_Silent_p.P330P	p.P330P	NR_027044		WXS	Illumina HiSeq	Unspecified					6	1468	+									Silent	SNP	ENST00000527477.1	37	c.990C>T																																																																																					0.483	RP11-707M1.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000391378.2			10	16	0	0	0	0.00245	0	10	16				
OR4C13	283092	broad.mit.edu	37	11	49974394	49974394	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:49974394C>T	ENST00000555099.1	+	1	452	c.420C>T	c.(418-420)agC>agT	p.S140S		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S140S(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						ATGTTTGTAGCCTGCTAGTGG	0.468																																							uc010rhz.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(1)	4						c.(418-420)AGC>AGT		olfactory receptor, family 4, subfamily C,							124.0	107.0	113.0					11																	49974394		2201	4294	6495	SO:0001819	synonymous_variant	283092				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:49974394C>T	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.420C>T	11.37:g.49974394C>T			Somatic					p.S140S	NM_001001955	NP_001001955	WXS	Illumina HiSeq	Unspecified	Q8NGP0	OR4CD_HUMAN			1	420	+			140			Helical; Name=4; (Potential).		A6NJJ3|B9EH30|Q6IF48|Q96R68	Silent	SNP	ENST00000555099.1	37	c.420C>T	CCDS31495.1																																																																																				0.468	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955		136	144	0	0	0	0.00361	0	136	144				
OR4C13	283092	broad.mit.edu	37	11	49974893	49974893	+	Missense_Mutation	SNP	A	A	T	rs537150006		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:49974893A>T	ENST00000555099.1	+	1	951	c.919A>T	c.(919-921)Agt>Tgt	p.S307C		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S307C(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						AGCTATTTCAAGTGTCAAATA	0.368																																							uc010rhz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(919-921)AGT>TGT		olfactory receptor, family 4, subfamily C,							21.0	21.0	21.0					11																	49974893		2092	4225	6317	SO:0001583	missense	283092				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:49974893A>T	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.919A>T	11.37:g.49974893A>T	ENSP00000452277:p.Ser307Cys		Somatic					p.S307C	NM_001001955	NP_001001955	WXS	Illumina HiSeq	Unspecified	Q8NGP0	OR4CD_HUMAN			1	919	+			307			Cytoplasmic (Potential).		A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	ENST00000555099.1	37	c.919A>T	CCDS31495.1	.	.	.	.	.	.	.	.	.	.	.	8.980	0.975195	0.18736	.	.	ENSG00000258817	ENST00000555099	T	0.00309	8.16	2.8	-4.74	0.03249	.	3.174710	0.01270	U	0.009420	T	0.00109	0.0003	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.33420	-0.9869	9	.	.	.	.	3.3041	0.06993	0.3514:0.0:0.1977:0.4509	.	307	Q8NGP0	OR4CD_HUMAN	C	307	ENSP00000452277:S307C	.	S	+	1	0	OR4C13	49931469	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	-1.563000	0.02154	-1.304000	0.02329	0.164000	0.16699	AGT		0.368	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955		12	52	0	0	0	0.003163	0	12	52				
OR4C46	119749	broad.mit.edu	37	11	51515672	51515672	+	Missense_Mutation	SNP	A	A	G	rs140334906	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:51515672A>G	ENST00000328188.1	+	1	391	c.391A>G	c.(391-393)Atg>Gtg	p.M131V		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M131V(1)		endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						CTTGCACTATATGACTATCAT	0.478																																							uc010ric.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(391-393)ATG>GTG		olfactory receptor, family 4, subfamily C,		A	VAL/MET	0,4402		0,0,2201	177.0	171.0	173.0		391	-1.6	0.0	11	dbSNP_134	173	2,8590		0,2,4294	no	missense	OR4C46	NM_001004703.1	21	0,2,6495	GG,GA,AA		0.0233,0.0,0.0154	benign	131/310	51515672	2,12992	2201	4296	6497	SO:0001583	missense	119749				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51515672A>G		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.391A>G	11.37:g.51515672A>G	ENSP00000329056:p.Met131Val		Somatic					p.M131V	NM_001004703	NP_001004703	WXS	Illumina HiSeq	Unspecified	A6NHA9	O4C46_HUMAN			1	391	+			131			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000328188.1	37	c.391A>G	CCDS31498.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.659160	0.00006	0.0	2.33E-4	ENSG00000185926	ENST00000328188	T	0.19105	2.17	2.63	-1.56	0.08532	GPCR, rhodopsin-like superfamily (1);	0.561957	0.15234	N	0.273249	T	0.08537	0.0212	N	0.25286	0.73	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38779	-0.9645	10	0.02654	T	1	.	4.4702	0.11708	0.4875:0.385:0.1275:0.0	.	131	A6NHA9	O4C46_HUMAN	V	131	ENSP00000329056:M131V	ENSP00000329056:M131V	M	+	1	0	OR4C46	51372248	0.000000	0.05858	0.016000	0.15963	0.005000	0.04900	-0.555000	0.05999	-0.142000	0.11354	0.113000	0.15668	ATG		0.478	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703		180	192	0	0	0	0.00361	0	180	192				
TRIM48	79097	broad.mit.edu	37	11	55032517	55032517	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:55032517C>A	ENST00000417545.2	+	2	272	c.186C>A	c.(184-186)atC>atA	p.I62I		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	46						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.I62I(1)|p.I46I(1)		endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GGCAAGACATCCCAATTCTTA	0.458																																							uc010rid.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(184-186)ATC>ATA		tripartite motif-containing 48							105.0	103.0	104.0					11																	55032517		2186	4260	6446	SO:0001819	synonymous_variant	79097					intracellular	zinc ion binding	g.chr11:55032517C>A	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.186C>A	11.37:g.55032517C>A			Somatic					p.I62I	NM_024114	NP_077019	WXS	Illumina HiSeq	Unspecified	Q8IWZ4	TRI48_HUMAN			2	272	+			46			RING-type.		Q9BUW4	Silent	SNP	ENST00000417545.2	37	c.186C>A	CCDS7947.2																																																																																				0.458	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1			21	77	1	0	3.83957e-06	0.00278	4.20805e-06	21	77				
OR4C15	81309	broad.mit.edu	37	11	55322592	55322592	+	Silent	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:55322592C>G	ENST00000314644.2	+	1	810	c.810C>G	c.(808-810)tcC>tcG	p.S270S		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S270S(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TGCTTGTCTCCTATGCTGTCA	0.468										HNSCC(20;0.049)																													uc010rig.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(808-810)TCC>TCG		olfactory receptor, family 4, subfamily C,							221.0	169.0	187.0					11																	55322592		2201	4296	6497	SO:0001819	synonymous_variant	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322592C>G	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.810C>G	11.37:g.55322592C>G		HNSCC(20;0.049)	Somatic					p.S270S	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	810	+			216			Helical; Name=5; (Potential).		Q6IFE2	Silent	SNP	ENST00000314644.2	37	c.810C>G	CCDS31501.1																																																																																				0.468	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		271	398	0	0	0	0.00361	0	271	398				
OR5W2	390148	broad.mit.edu	37	11	55681287	55681287	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:55681287T>A	ENST00000344514.1	-	1	771	c.772A>T	c.(772-774)Atg>Ttg	p.M258L		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M258L(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CGGAAATACATAAAGAGCAGA	0.438																																					Melanoma(48;171 1190 15239 43886 49348)	Melanoma(48;171 1190 15239 43886 49348)	uc010rir.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(772-774)ATG>TTG		olfactory receptor, family 5, subfamily W,							81.0	93.0	89.0					11																	55681287		2201	4296	6497	SO:0001583	missense	390148				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55681287T>A	BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.772A>T	11.37:g.55681287T>A	ENSP00000342448:p.Met258Leu		Somatic					p.M258L	NM_001001960	NP_001001960	WXS	Illumina HiSeq	Unspecified	Q8NH69	OR5W2_HUMAN			1	772	-			258			Helical; Name=6; (Potential).			Missense_Mutation	SNP	ENST00000344514.1	37	c.772A>T	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.096570	0.56075	.	.	ENSG00000187612	ENST00000344514	T	0.00115	8.71	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.134115	0.34025	N	0.004334	T	0.00210	0.0006	L	0.45422	1.42	0.28362	N	0.920396	B	0.29716	0.255	B	0.41666	0.363	T	0.28170	-1.0052	10	0.87932	D	0	.	12.6788	0.56910	0.0:0.0:0.0:1.0	.	258	Q8NH69	OR5W2_HUMAN	L	258	ENSP00000342448:M258L	ENSP00000342448:M258L	M	-	1	0	OR5W2	55437863	0.001000	0.12720	0.884000	0.34674	0.949000	0.60115	0.197000	0.17197	1.874000	0.54306	0.448000	0.29417	ATG		0.438	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960		23	81	0	0	0	0.007291	0	23	81				
OR5F1	338674	broad.mit.edu	37	11	55761338	55761338	+	Missense_Mutation	SNP	C	C	G	rs58625186	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:55761338C>G	ENST00000278409.1	-	1	763	c.764G>C	c.(763-765)tGc>tCc	p.C255S		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	255					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C255S(1)		endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					AGTATAGATGCAGGTGGCATA	0.488													C|||	50	0.00998403	0.0363	0.0014	5008	,	,		18308	0.0		0.001	False		,,,				2504	0.0						uc010riv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(763-765)TGC>TCC		olfactory receptor, family 5, subfamily F,		C	SER/CYS	132,4270	95.3+/-134.0	6,120,2075	93.0	91.0	91.0		764	-0.4	0.0	11	dbSNP_129	91	3,8589	2.2+/-6.3	1,1,4294	yes	missense	OR5F1	NM_003697.1	112	7,121,6369	GG,GC,CC		0.0349,2.9986,1.0389	benign	255/315	55761338	135,12859	2201	4296	6497	SO:0001583	missense	338674				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55761338C>G	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.764G>C	11.37:g.55761338C>G	ENSP00000278409:p.Cys255Ser		Somatic					p.C255S	NM_003697	NP_003688	WXS	Illumina HiSeq	Unspecified	O95221	OR5F1_HUMAN			1	764	-	Esophageal squamous(21;0.00448)		255			Helical; Name=6; (Potential).		Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	c.764G>C	CCDS31515.1	18	0.008241758241758242	16	0.032520325203252036	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	0.248	-1.008793	0.02112	0.029986	3.49E-4	ENSG00000149133	ENST00000278409	T	0.00084	8.75	2.99	-0.397	0.12423	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.10629	0.01	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07158	-1.0787	9	0.56958	D	0.05	.	5.6452	0.17586	0.2082:0.5312:0.2606:0.0	rs58625186	255	O95221	OR5F1_HUMAN	S	255	ENSP00000278409:C255S	ENSP00000278409:C255S	C	-	2	0	OR5F1	55517914	0.000000	0.05858	0.019000	0.16419	0.059000	0.15707	-1.284000	0.02793	-0.028000	0.13850	-0.846000	0.03041	TGC		0.488	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		85	127	0	0	0	0.00361	0	85	127				
OR8J1	219477	broad.mit.edu	37	11	56128658	56128658	+	Silent	SNP	C	C	T	rs148720229		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:56128658C>T	ENST00000303039.3	+	1	968	c.936C>T	c.(934-936)tcC>tcT	p.S312S		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S312S(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					TGTGCTATTCCTTTAAAACAA	0.353																																							uc010rjh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(934-936)TCC>TCT		olfactory receptor, family 8, subfamily J,		C		1,4401		0,1,2200	49.0	46.0	47.0		936	-2.0	0.0	11	dbSNP_134	47	0,8590		0,0,4295	no	coding-synonymous	OR8J1	NM_001005205.2		0,1,6495	TT,TC,CC		0.0,0.0227,0.0077		312/317	56128658	1,12991	2201	4295	6496	SO:0001819	synonymous_variant	219477				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56128658C>T	AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.936C>T	11.37:g.56128658C>T			Somatic					p.S312S	NM_001005205	NP_001005205	WXS	Illumina HiSeq	Unspecified	Q8NGP2	OR8J1_HUMAN			1	936	+	Esophageal squamous(21;0.00448)		312			Cytoplasmic (Potential).		B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Silent	SNP	ENST00000303039.3	37	c.936C>T	CCDS31529.1																																																																																				0.353	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205		41	54	0	0	0	0.002852	0	41	54				
OR5AP2	338675	broad.mit.edu	37	11	56409890	56409890	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:56409890C>A	ENST00000302981.1	-	1	25	c.26G>T	c.(25-27)gGc>gTc	p.G9V	OR5AP2_ENST00000544374.1_Missense_Mutation_p.G10V	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G9V(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						TTGATTTCTGCCTCGAACCTC	0.368																																							uc001njb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(25-27)GGC>GTC		olfactory receptor, family 5, subfamily AP,							76.0	72.0	73.0					11																	56409890		2201	4296	6497	SO:0001583	missense	338675				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56409890C>A	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.26G>T	11.37:g.56409890C>A	ENSP00000303111:p.Gly9Val		Somatic					p.G9V	NM_001002925	NP_001002925	WXS	Illumina HiSeq	Unspecified	Q8NGF4	O5AP2_HUMAN			1	26	-			9			Extracellular (Potential).		B2RNM8	Missense_Mutation	SNP	ENST00000302981.1	37	c.26G>T	CCDS31534.1	.	.	.	.	.	.	.	.	.	.	C	9.333	1.061036	0.19987	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.00458	7.28;7.28	4.86	-1.81	0.07882	.	1.730840	0.03135	N	0.165684	T	0.00271	0.0008	N	0.19112	0.55	0.09310	N	0.999998	B	0.02656	0.0	B	0.06405	0.002	T	0.41787	-0.9489	10	0.22706	T	0.39	.	2.5138	0.04663	0.1268:0.4749:0.1101:0.2882	.	9	Q8NGF4	O5AP2_HUMAN	V	10;9	ENSP00000442701:G10V;ENSP00000303111:G9V	ENSP00000303111:G9V	G	-	2	0	OR5AP2	56166466	0.000000	0.05858	0.000000	0.03702	0.274000	0.26718	-0.222000	0.09190	-0.194000	0.10399	0.637000	0.83480	GGC		0.368	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1	NM_001002925		34	67	1	0	4.14481e-20	0.00623	5.54259e-20	34	67				
OR10W1	81341	broad.mit.edu	37	11	58034994	58034994	+	Missense_Mutation	SNP	G	G	T	rs544577916		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:58034994G>T	ENST00000395079.2	-	1	738	c.337C>A	c.(337-339)Cgc>Agc	p.R113S		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R113S(1)		kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				GCCACATAGCGGTCATAGGCC	0.532																																							uc001nmq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(337-339)CGC>AGC		olfactory receptor, family 10, subfamily W,							109.0	81.0	90.0					11																	58034994		2201	4295	6496	SO:0001583	missense	81341				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58034994G>T	AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.337C>A	11.37:g.58034994G>T	ENSP00000378516:p.Arg113Ser		Somatic					p.R113S	NM_207374	NP_997257	WXS	Illumina HiSeq	Unspecified	Q8NGF6	O10W1_HUMAN			1	739	-		Breast(21;0.0589)	113			Cytoplasmic (Potential).		A2RUD2|A8MTE1|Q6UXQ2	Missense_Mutation	SNP	ENST00000395079.2	37	c.337C>A	CCDS7968.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957180	0.53293	.	.	ENSG00000172772	ENST00000395079	T	0.77620	-1.11	5.81	0.458	0.16670	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000233	D	0.88559	0.6469	H	0.99104	4.43	0.29499	N	0.855084	D	0.64830	0.994	P	0.53102	0.718	D	0.83784	0.0227	10	0.87932	D	0	.	7.3571	0.26725	0.1285:0.0:0.5997:0.2717	.	113	Q8NGF6	O10W1_HUMAN	S	113	ENSP00000378516:R113S	ENSP00000378516:R113S	R	-	1	0	OR10W1	57791570	0.943000	0.32029	0.033000	0.17914	0.385000	0.30292	1.791000	0.38744	-0.159000	0.11021	0.655000	0.94253	CGC		0.532	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374		69	90	1	0	7.79919e-48	0.00361	1.2797e-47	69	90				
MS4A10	341116	broad.mit.edu	37	11	60558557	60558557	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:60558557G>T	ENST00000308287.1	+	3	390	c.294G>T	c.(292-294)ggG>ggT	p.G98G		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	98						integral component of membrane (GO:0016021)		p.G98G(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						CATTCTGGGGGGCTGCCTCTG	0.582																																							uc001npz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(292-294)GGG>GGT		membrane-spanning 4-domains, subfamily A, member							83.0	85.0	84.0					11																	60558557		2203	4300	6503	SO:0001819	synonymous_variant	341116					integral to membrane	receptor activity	g.chr11:60558557G>T	AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.294G>T	11.37:g.60558557G>T			Somatic					p.G98G	NM_206893	NP_996776	WXS	Illumina HiSeq	Unspecified	Q96PG2	M4A10_HUMAN			3	390	+			98			Helical; (Potential).		B2RP45|Q96PG3	Silent	SNP	ENST00000308287.1	37	c.294G>T	CCDS7992.1																																																																																				0.582	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395619.1	NM_206893		31	56	1	0	1.68508e-10	0.009718	1.98388e-10	31	56				
PRPF19	27339	broad.mit.edu	37	11	60666746	60666746	+	Missense_Mutation	SNP	T	T	G	rs201780573		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:60666746T>G	ENST00000227524.4	-	11	1064	c.859A>C	c.(859-861)Act>Cct	p.T287P		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19									p.T287P(2)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						ATCCTGATAGTGGCATCGGGG	0.488											OREG0020994	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001nqf.2		NA																	2	Substitution - Missense(2)		haematopoietic_and_lymphoid_tissue(1)|lung(1)	ovary(1)	1						c.(859-861)ACT>CCT		PRP19/PSO4 pre-mRNA processing factor 19							59.0	54.0	55.0					11																	60666746		2203	4299	6502	SO:0001583	missense	27339				DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity	g.chr11:60666746T>G	BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.859A>C	11.37:g.60666746T>G	ENSP00000227524:p.Thr287Pro		Somatic	OREG0020994	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1047		p.T287P	NM_014502	NP_055317	WXS	Illumina HiSeq	Unspecified	Q9UMS4	PRP19_HUMAN			11	1066	-			287			WD 2.			Missense_Mutation	SNP	ENST00000227524.4	37	c.859A>C	CCDS7995.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.838874	0.91117	.	.	ENSG00000110107	ENST00000227524	T	0.69806	-0.43	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);Ricin B lectin (1);	0.000000	0.85682	D	0.000000	D	0.88448	0.6439	H	0.98005	4.125	0.80722	D	1	D	0.53619	0.961	D	0.67725	0.953	D	0.92498	0.6006	10	0.87932	D	0	-24.5469	16.0218	0.80503	0.0:0.0:0.0:1.0	.	287	Q9UMS4	PRP19_HUMAN	P	287	ENSP00000227524:T287P	ENSP00000227524:T287P	T	-	1	0	PRPF19	60423322	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.287000	0.78681	2.254000	0.74563	0.533000	0.62120	ACT		0.488	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396334.1	NM_014502		6	56	0	0	0	0.001984	0	6	56				
DAGLA	747	broad.mit.edu	37	11	61504654	61504654	+	Splice_Site	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:61504654G>T	ENST00000257215.5	+	14	1488	c.1372G>T	c.(1372-1374)Ggc>Tgc	p.G458C		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	458					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.G458C(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CGGTCTCCAGGGCCGCGGAAC	0.637																																							uc001nsa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1372-1374)GGC>TGC		neural stem cell-derived dendrite regulator							109.0	115.0	113.0					11																	61504654		2202	4299	6501	SO:0001630	splice_region_variant	747				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity	g.chr11:61504654G>T	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1372-1G>T	11.37:g.61504654G>T			Somatic					p.G458C	NM_006133	NP_006124	WXS	Illumina HiSeq	Unspecified	Q9Y4D2	DGLA_HUMAN		READ - Rectum adenocarcinoma(4;0.219)	14	1483	+			458			Cytoplasmic (Potential).		A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	37	c.1372G>T	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.280461	0.59758	.	.	ENSG00000134780	ENST00000257215	T	0.25912	1.77	3.91	3.91	0.45181	.	0.256155	0.37857	N	0.001920	T	0.39545	0.1082	L	0.58810	1.83	0.58432	D	0.999993	P	0.49696	0.927	P	0.54174	0.744	T	0.25152	-1.0140	9	.	.	.	-34.6477	16.2789	0.82658	0.0:0.0:1.0:0.0	.	458	Q9Y4D2	DGLA_HUMAN	C	458	ENSP00000257215:G458C	.	G	+	1	0	DAGLA	61261230	1.000000	0.71417	1.000000	0.80357	0.434000	0.31775	5.959000	0.70339	1.901000	0.55032	0.313000	0.20887	GGC		0.637	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	Missense_Mutation	10	20	1	0	2.27111e-07	0.001368	2.54775e-07	10	20				
PPP2R5B	5526	broad.mit.edu	37	11	64699039	64699039	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:64699039G>T	ENST00000164133.2	+	10	1576	c.954G>T	c.(952-954)cgG>cgT	p.R318R		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	318					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.R318R(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						AGGTGATCCGGGGGCTGCTCA	0.597																																							uc001oby.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(952-954)CGG>CGT		beta isoform of regulatory subunit B56, protein							42.0	39.0	40.0					11																	64699039		2201	4297	6498	SO:0001819	synonymous_variant	5526				signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity	g.chr11:64699039G>T	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.954G>T	11.37:g.64699039G>T			Somatic				PPP2R5B_uc001obz.2_Silent_p.R318R	p.R318R	NM_006244	NP_006235	WXS	Illumina HiSeq	Unspecified	Q15173	2A5B_HUMAN			10	1539	+			318					Q13853	Silent	SNP	ENST00000164133.2	37	c.954G>T	CCDS8085.1	.	.	.	.	.	.	.	.	.	.	G	8.704	0.910504	0.17833	.	.	ENSG00000068971	ENST00000359279	.	.	.	4.53	1.63	0.23807	.	.	.	.	.	T	0.60314	0.2259	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60193	-0.7311	5	0.72032	D	0.01	-25.5434	5.9713	0.19353	0.3227:0.0:0.6773:0.0	.	.	.	.	W	344	.	ENSP00000352225:G344W	G	+	1	0	PPP2R5B	64455615	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	1.001000	0.29783	0.645000	0.30675	0.462000	0.41574	GGG		0.597	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244		8	12	1	0	0.000978159	0.000978	0.00102108	8	12				
TENM4	26011	broad.mit.edu	37	11	78412653	78412653	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:78412653C>A	ENST00000278550.7	-	28	5467	c.5005G>T	c.(5005-5007)Gag>Tag	p.E1669*		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1669					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.E1669*(2)									ATGGCCAACTCGTGTCCTTGT	0.507																																							uc001ozl.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|pancreas(2)	4						c.(5005-5007)GAG>TAG		odz, odd Oz/ten-m homolog 4							92.0	92.0	92.0					11																	78412653		2003	4168	6171	SO:0001587	stop_gained	26011				signal transduction	integral to membrane		g.chr11:78412653C>A	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5005G>T	11.37:g.78412653C>A	ENSP00000278550:p.Glu1669*		Somatic				ODZ4_uc009yvb.1_Nonsense_Mutation_p.E253*	p.E1669*	NM_001098816	NP_001092286	WXS	Illumina HiSeq	Unspecified	Q6N022	TEN4_HUMAN			28	5468	-			1669			Extracellular (Potential).		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Nonsense_Mutation	SNP	ENST00000278550.7	37	c.5005G>T	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	49	16.050550	0.99853	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3137	0.94202	0.0:1.0:0.0:0.0	.	.	.	.	X	1669;133	.	.	E	-	1	0	ODZ4	78090301	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	7.651000	0.83577	2.788000	0.95919	0.650000	0.86243	GAG		0.507	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			14	65	1	0	9.16793e-09	0.00499	1.04908e-08	14	65				
FAM181B	220382	broad.mit.edu	37	11	82444630	82444630	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:82444630C>T	ENST00000329203.3	-	1	276	c.142G>A	c.(142-144)Ggt>Agt	p.G48S		NM_175885.3	NP_787081.2	A6NEQ2	F181B_HUMAN	family with sequence similarity 181, member B	48								p.G48S(1)		large_intestine(1)|lung(2)|prostate(1)	4						AGCAGCGCACCCGCCGGAGCC	0.692																																							uc001ozp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(142-144)GGT>AGT		hypothetical protein LOC220382							15.0	16.0	15.0					11																	82444630		2191	4288	6479	SO:0001583	missense	220382							g.chr11:82444630C>T	AK095054, BC039262	CCDS31648.1	11q14.1	2011-11-30			ENSG00000182103	ENSG00000182103			28512	protein-coding gene	gene with protein product						12477932	Standard	NM_175885		Approved	LOC220382, MGC33846	uc001ozp.3	A6NEQ2	OTTHUMG00000166869	ENST00000329203.3:c.142G>A	11.37:g.82444630C>T	ENSP00000365295:p.Gly48Ser		Somatic					p.G48S	NM_175885	NP_787081	WXS	Illumina HiSeq	Unspecified	A6NEQ2	F181B_HUMAN			1	277	-			48					B2RWP1	Missense_Mutation	SNP	ENST00000329203.3	37	c.142G>A	CCDS31648.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.937985	0.34189	.	.	ENSG00000182103	ENST00000329203	T	0.36699	1.24	3.51	1.52	0.23074	.	0.222920	0.21363	U	0.075773	T	0.17280	0.0415	N	0.14661	0.345	0.09310	N	0.999996	B	0.22346	0.068	B	0.25140	0.058	T	0.16928	-1.0386	9	.	.	.	.	4.9064	0.13800	0.164:0.6409:0.0:0.1951	.	48	A6NEQ2	F181B_HUMAN	S	48	ENSP00000365295:G48S	.	G	-	1	0	FAM181B	82122278	0.887000	0.30362	0.991000	0.47740	0.009000	0.06853	2.649000	0.46656	0.674000	0.31244	0.455000	0.32223	GGT		0.692	FAM181B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391626.1	NM_175885		3	6	0	0	0	0.001984	0	3	6				
GRM5	2915	broad.mit.edu	37	11	88780774	88780774	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:88780774G>T	ENST00000305447.4	-	1	416	c.267C>A	c.(265-267)atC>atA	p.I89I	GRM5_ENST00000305432.5_Silent_p.I89I|GRM5_ENST00000393294.3_Silent_p.I89I|GRM5_ENST00000393297.1_Silent_p.I89I|GRM5_ENST00000418177.2_Silent_p.I89I|GRM5_ENST00000455756.2_Silent_p.I89I	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	89					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.I89I(2)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	AGCCCAGTGTGATGTTGGGCA	0.527																																							uc001pcq.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(265-267)ATC>ATA		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						81.0	71.0	74.0					11																	88780774		2201	4299	6500	SO:0001819	synonymous_variant	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88780774G>T	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.267C>A	11.37:g.88780774G>T			Somatic				GRM5_uc009yvm.2_Silent_p.I89I|GRM5_uc009yvn.1_Silent_p.I89I	p.I89I	NM_001143831	NP_001137303	WXS	Illumina HiSeq	Unspecified	P41594	GRM5_HUMAN			1	467	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	89			Extracellular (Potential).		Q6J164	Silent	SNP	ENST00000305447.4	37	c.267C>A	CCDS44694.1																																																																																				0.527	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		15	16	1	0	0.000132079	0.008871	0.000140441	15	16				
CHORDC1	26973	broad.mit.edu	37	11	89947211	89947211	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:89947211G>T	ENST00000320585.6	-	4	713	c.304C>A	c.(304-306)Cca>Aca	p.P102T	CHORDC1_ENST00000530765.1_Missense_Mutation_p.P102T|CHORDC1_ENST00000457199.2_Missense_Mutation_p.P83T	NM_012124.2	NP_036256.2	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain (CHORD) containing 1	102	Interaction with HSP90AA1 and HSP90AB1. {ECO:0000250}.				chaperone-mediated protein folding (GO:0061077)|negative regulation of Rho-dependent protein serine/threonine kinase activity (GO:2000299)|regulation of cellular response to heat (GO:1900034)|regulation of centrosome duplication (GO:0010824)|response to stress (GO:0006950)		Hsp90 protein binding (GO:0051879)|zinc ion binding (GO:0008270)	p.P102T(1)		endometrium(2)|large_intestine(2)|liver(1)|lung(6)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				GCTTCTACTGGCTTAGGGGCT	0.383																																							uc001pdg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(304-306)CCA>ACA		cysteine and histidine-rich domain-containing							159.0	158.0	158.0					11																	89947211		2201	4298	6499	SO:0001583	missense	26973				chaperone-mediated protein folding|regulation of response to stress|response to stress		Hsp90 protein binding|identical protein binding	g.chr11:89947211G>T	AF192466	CCDS8289.1, CCDS44705.1	11q14.3	2011-01-25	2011-01-25		ENSG00000110172	ENSG00000110172			14525	protein-coding gene	gene with protein product		604353	"""cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1"", ""cysteine and histidine-rich domain (CHORD)-containing 1"""			10571178	Standard	NM_012124		Approved	CHP1	uc001pdg.2	Q9UHD1	OTTHUMG00000167305	ENST00000320585.6:c.304C>A	11.37:g.89947211G>T	ENSP00000319255:p.Pro102Thr		Somatic				CHORDC1_uc009yvz.2_Missense_Mutation_p.P83T	p.P102T	NM_012124	NP_036256	WXS	Illumina HiSeq	Unspecified	Q9UHD1	CHRD1_HUMAN			4	714	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)	102			Interaction with HSP90AA1 and HSP90AB1 (By similarity).		B2R6P8|Q6IN49|Q8WVL9|Q9H3D6	Missense_Mutation	SNP	ENST00000320585.6	37	c.304C>A	CCDS8289.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722176	0.89298	.	.	ENSG00000110172	ENST00000320585;ENST00000457199;ENST00000530765	T;T	0.45276	0.91;0.9	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.57301	0.2044	M	0.77313	2.365	0.80722	D	1	P;P	0.42483	0.732;0.781	P;B	0.47915	0.561;0.358	T	0.57219	-0.7849	9	.	.	.	-12.6007	19.5268	0.95210	0.0:0.0:1.0:0.0	.	83;102	Q9UHD1-2;Q9UHD1	.;CHRD1_HUMAN	T	102;83;102	ENSP00000319255:P102T;ENSP00000401080:P83T	.	P	-	1	0	CHORDC1	89586859	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	9.109000	0.94291	2.611000	0.88343	0.552000	0.68991	CCA		0.383	CHORDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394111.1	NM_012124		24	67	1	0	1.17739e-12	0.005443	1.44269e-12	24	67				
PANX1	24145	broad.mit.edu	37	11	93862607	93862607	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:93862607G>T	ENST00000227638.3	+	1	514	c.129G>T	c.(127-129)gtG>gtT	p.V43V	PANX1_ENST00000436171.2_Silent_p.V43V	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	43					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)	p.V43V(1)		endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	GCATTGCGGTGGGGCTGCCCC	0.647																																							uc001per.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(127-129)GTG>GTT		pannexin 1							61.0	56.0	58.0					11																	93862607		2201	4298	6499	SO:0001819	synonymous_variant	24145				positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding	g.chr11:93862607G>T	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.129G>T	11.37:g.93862607G>T			Somatic				uc001pen.1_5'Flank|PANX1_uc001peq.2_Silent_p.V43V	p.V43V	NM_015368	NP_056183	WXS	Illumina HiSeq	Unspecified	Q96RD7	PANX1_HUMAN			1	514	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	43			Helical; (Potential).		O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Silent	SNP	ENST00000227638.3	37	c.129G>T	CCDS8296.1																																																																																				0.647	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	NM_015368		5	13	1	0	0.00621372	0.006214	0.00640439	5	13				
MAML2	84441	broad.mit.edu	37	11	95825768	95825768	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:95825768C>A	ENST00000524717.1	-	2	2711	c.1427G>T	c.(1426-1428)gGg>gTg	p.G476V		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	476					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.G476V(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TTTCTCCTGCCCAAATGGACC	0.607			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																		uc001pfw.1		NA		Dom	yes		11	11q22-q23	84441	T	mastermind-like 2 (Drosophila)			E	MECT1|CRTC3		salivary gland mucoepidermoid	CRTC1/MAML2(516)|CRTC3/MAML2(26)	1	Substitution - Missense(1)		lung(1)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546						c.(1426-1428)GGG>GTG		mastermind-like 2							48.0	51.0	50.0					11																	95825768		2105	4252	6357	SO:0001583	missense	84441				Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity	g.chr11:95825768C>A	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1427G>T	11.37:g.95825768C>A	ENSP00000434552:p.Gly476Val		Somatic					p.G476V	NM_032427	NP_115803	WXS	Illumina HiSeq	Unspecified	Q8IZL2	MAML2_HUMAN			2	2712	-		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)	476					A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	ENST00000524717.1	37	c.1427G>T	CCDS44714.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630157	0.28978	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.62639	0.01;0.01	5.89	0.00301	0.14052	.	0.636233	0.14913	N	0.291102	T	0.34193	0.0889	N	0.08118	0	0.47441	D	0.999421	B	0.06786	0.001	B	0.06405	0.002	T	0.05801	-1.0863	10	0.26408	T	0.33	-5.1153	5.7874	0.18340	0.3662:0.4703:0.0903:0.0731	.	476	Q8IZL2	MAML2_HUMAN	V	476	ENSP00000434552:G476V;ENSP00000412394:G476V	ENSP00000412394:G476V	G	-	2	0	MAML2	95465416	0.002000	0.14202	0.979000	0.43373	0.961000	0.63080	0.323000	0.19593	0.326000	0.23384	0.555000	0.69702	GGG		0.607	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1			37	62	1	0	1.32136e-16	0.00874	1.68414e-16	37	62				
TRPC6	7225	broad.mit.edu	37	11	101359765	101359765	+	Missense_Mutation	SNP	C	C	T	rs199747455		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:101359765C>T	ENST00000344327.3	-	4	1620	c.1196G>A	c.(1195-1197)cGa>cAa	p.R399Q	TRPC6_ENST00000348423.4_Intron|TRPC6_ENST00000532133.1_Missense_Mutation_p.R399Q|TRPC6_ENST00000360497.4_Intron	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	399					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.R399Q(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TGTCTGCTGTCGTAAACCAGA	0.448																																					Colon(166;1315 1927 11094 12848 34731)	Colon(166;1315 1927 11094 12848 34731)	uc001pgk.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1195-1197)CGA>CAA		transient receptor potential cation channel,							95.0	86.0	89.0					11																	101359765		2203	4299	6502	SO:0001583	missense	7225				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding	g.chr11:101359765C>T	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1196G>A	11.37:g.101359765C>T	ENSP00000340913:p.Arg399Gln		Somatic				TRPC6_uc009ywy.2_Intron|TRPC6_uc009ywz.1_Intron	p.R399Q	NM_004621	NP_004612	WXS	Illumina HiSeq	Unspecified	Q9Y210	TRPC6_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0442)	4	1621	-		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)	399			Cytoplasmic (Potential).		Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	c.1196G>A	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	C	36	5.822449	0.96989	.	.	ENSG00000137672	ENST00000344327;ENST00000532133	T;T	0.73789	-0.78;-0.78	5.77	5.77	0.91146	.	0.051437	0.64402	D	0.000001	D	0.88097	0.6345	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	P	0.59948	0.866	D	0.89442	0.3724	10	0.62326	D	0.03	-5.0747	19.9928	0.97374	0.0:1.0:0.0:0.0	.	399	Q9Y210	TRPC6_HUMAN	Q	399	ENSP00000340913:R399Q;ENSP00000435574:R399Q	ENSP00000340913:R399Q	R	-	2	0	TRPC6	100864975	1.000000	0.71417	0.991000	0.47740	0.945000	0.59286	4.892000	0.63193	2.745000	0.94114	0.650000	0.86243	CGA		0.448	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621		9	34	0	0	0	0.003163	0	9	34				
KIAA1377	57562	broad.mit.edu	37	11	101793446	101793446	+	Missense_Mutation	SNP	G	G	T	rs142032267	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:101793446G>T	ENST00000263468.8	+	2	473	c.203G>T	c.(202-204)cGa>cTa	p.R68L		NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	68								p.R68L(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AAAATATGTCGAAATCGAGCA	0.303																																							uc001pgm.2		NA																	1	Substitution - Missense(1)	p.R68*(1)	lung(1)	breast(2)|ovary(1)|central_nervous_system(1)	4						c.(202-204)CGA>CTA		hypothetical protein LOC57562							67.0	70.0	69.0					11																	101793446		2203	4299	6502	SO:0001583	missense	57562						protein binding	g.chr11:101793446G>T	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.203G>T	11.37:g.101793446G>T	ENSP00000263468:p.Arg68Leu		Somatic				KIAA1377_uc001pgn.2_Missense_Mutation_p.R24L	p.R68L	NM_020802	NP_065853	WXS	Illumina HiSeq	Unspecified	Q9P2H0	K1377_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.038)	2	473	+	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)	68			Potential.		Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	c.203G>T	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634566	0.87660	.	.	ENSG00000110318	ENST00000263468	T	0.12569	2.67	5.84	5.84	0.93424	.	0.000000	0.53938	D	0.000056	T	0.38241	0.1033	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.03728	-1.1009	10	0.87932	D	0	-11.1498	17.6233	0.88088	0.0:0.0:1.0:0.0	.	68	Q9P2H0	K1377_HUMAN	L	68	ENSP00000263468:R68L	ENSP00000263468:R68L	R	+	2	0	KIAA1377	101298656	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	5.645000	0.67909	2.758000	0.94735	0.591000	0.81541	CGA		0.303	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802		6	11	1	0	0.00116845	0.001168	0.00121527	6	11				
MMP1	4312	broad.mit.edu	37	11	102666324	102666324	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:102666324G>T	ENST00000315274.6	-	5	707	c.640C>A	c.(640-642)Cgt>Agt	p.R214S	WTAPP1_ENST00000525739.2_RNA	NM_001145938.1|NM_002421.3	NP_001139410.1|NP_002412.1	P03956	MMP1_HUMAN	matrix metallopeptidase 1 (interstitial collagenase)	214	Metalloprotease.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|proteolysis (GO:0006508)|viral process (GO:0016032)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R214S(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)	Marimastat(DB00786)	GCTGCAACACGATGTAAGTTG	0.368																																							uc001phi.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|lung(1)	4						c.(640-642)CGT>AGT		matrix metalloproteinase 1 isoform 1							60.0	53.0	56.0					11																	102666324		2203	4299	6502	SO:0001583	missense	4312				blood coagulation|collagen catabolic process|interspecies interaction between organisms|leukocyte migration|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102666324G>T	X54925	CCDS8322.1	11q21-q22	2014-01-30	2005-08-08		ENSG00000196611	ENSG00000196611	3.4.24.7	"""Endogenous ligands"""	7155	protein-coding gene	gene with protein product		120353	"""matrix metalloproteinase 1 (interstitial collagenase)"""	CLG			Standard	NM_002421		Approved		uc001phi.2	P03956	OTTHUMG00000048192	ENST00000315274.6:c.640C>A	11.37:g.102666324G>T	ENSP00000322788:p.Arg214Ser		Somatic				uc001phh.1_Intron|MMP1_uc010ruv.1_Missense_Mutation_p.R148S	p.R214S	NM_002421	NP_002412	WXS	Illumina HiSeq	Unspecified	P03956	MMP1_HUMAN	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)	5	783	-	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	214			Metalloprotease.		P08156	Missense_Mutation	SNP	ENST00000315274.6	37	c.640C>A	CCDS8322.1	.	.	.	.	.	.	.	.	.	.	g	10.96	1.497593	0.26861	.	.	ENSG00000196611	ENST00000315274	T	0.19394	2.15	5.65	3.77	0.43336	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.808466	0.11286	N	0.579780	T	0.07548	0.0190	N	0.02275	-0.615	0.09310	N	1	P	0.43750	0.816	B	0.34346	0.18	T	0.09818	-1.0657	10	0.72032	D	0.01	.	6.98	0.24698	0.1347:0.0:0.7235:0.1417	.	214	P03956	MMP1_HUMAN	S	214	ENSP00000322788:R214S	ENSP00000322788:R214S	R	-	1	0	MMP1	102171534	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.559000	0.23485	0.838000	0.34948	0.655000	0.94253	CGT		0.368	MMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109632.1	NM_002421		11	45	1	0	6.31663e-08	0.003163	7.14217e-08	11	45				
DDI1	414301	broad.mit.edu	37	11	103908205	103908205	+	Silent	SNP	C	C	A	rs550162614		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:103908205C>A	ENST00000302259.3	+	1	898	c.655C>A	c.(655-657)Cgg>Agg	p.R219R	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	219							aspartic-type endopeptidase activity (GO:0004190)	p.R219R(2)		central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		AGAGGAAATCCGGCAGCAAAA	0.483																																							uc001phr.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(655-657)CGG>AGG		DDI1, DNA-damage inducible 1, homolog 1							96.0	107.0	103.0					11																	103908205		2202	4299	6501	SO:0001819	synonymous_variant	414301				proteolysis		aspartic-type endopeptidase activity	g.chr11:103908205C>A		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.655C>A	11.37:g.103908205C>A			Somatic				PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	p.R219R	NM_001001711	NP_001001711	WXS	Illumina HiSeq	Unspecified	Q8WTU0	DDI1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)	1	898	+		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)	219					Q7Z4U6|Q8WTS3	Silent	SNP	ENST00000302259.3	37	c.655C>A	CCDS31660.1																																																																																				0.483	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711		20	32	1	0	7.33628e-21	0.002299	9.90311e-21	20	32				
NXPE2	120406	broad.mit.edu	37	11	114568908	114568908	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:114568908G>C	ENST00000389586.4	+	3	464	c.274G>C	c.(274-276)Gac>Cac	p.D92H	NXPE2_ENST00000375475.5_Missense_Mutation_p.D92H	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	92						integral component of membrane (GO:0016021)		p.D92H(2)									GGAGAAACTAGACCAGCAGAT	0.458																																							uc009yyy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(274-276)GAC>CAC		hypothetical protein LOC120406							193.0	157.0	168.0					11																	114568908		692	1591	2283	SO:0001583	missense	120406					integral to membrane		g.chr11:114568908G>C	AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.274G>C	11.37:g.114568908G>C	ENSP00000374237:p.Asp92His		Somatic					p.D92H	NM_182495	NP_872301	WXS	Illumina HiSeq	Unspecified	Q96DL1	FA55B_HUMAN			3	372	+			92					Q2NKI8	Missense_Mutation	SNP	ENST00000389586.4	37	c.274G>C	CCDS44738.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.314254	0.40996	.	.	ENSG00000204361	ENST00000389586;ENST00000375475;ENST00000505358	T;T	0.19105	2.69;2.17	4.54	-1.06	0.10002	.	0.689316	0.13016	N	0.420421	T	0.41143	0.1146	M	0.78049	2.395	0.09310	N	1	D	0.76494	0.999	D	0.72075	0.976	T	0.20273	-1.0280	10	0.48119	T	0.1	.	9.0973	0.36647	0.6027:0.0:0.3973:0.0	.	92	Q96DL1	FA55B_HUMAN	H	92	ENSP00000374237:D92H;ENSP00000364624:D92H	ENSP00000364624:D92H	D	+	1	0	FAM55B	114074118	0.007000	0.16637	0.095000	0.20976	0.950000	0.60333	-0.042000	0.12063	-0.240000	0.09696	0.591000	0.81541	GAC		0.458	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399181.1	NM_182495		48	160	0	0	0	0.00361	0	48	160				
SIK3	23387	broad.mit.edu	37	11	116728895	116728895	+	Nonsense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:116728895G>A	ENST00000292055.4	-	20	3003	c.2968C>T	c.(2968-2970)Caa>Taa	p.Q990*	SIK3_ENST00000375300.1_Nonsense_Mutation_p.Q1048*|SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000375288.1_Nonsense_Mutation_p.Q325*|SIK3_ENST00000542607.1_Nonsense_Mutation_p.Q930*|SIK3_ENST00000446921.2_Nonsense_Mutation_p.Q988*|SIK3_ENST00000434315.2_Nonsense_Mutation_p.Q829*|AP006216.12_ENST00000444200.1_RNA	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	990					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.Q1096*(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						TCAGCATTTTGATAAGATAAA	0.552																																							uc001ppy.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						c.(2968-2970)CAA>TAA		serine/threonine-protein kinase QSK							109.0	106.0	107.0					11																	116728895		2201	4296	6497	SO:0001587	stop_gained	23387					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:116728895G>A	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2968C>T	11.37:g.116728895G>A	ENSP00000292055:p.Gln990*		Somatic				SIK3_uc001ppz.2_Nonsense_Mutation_p.Q829*|SIK3_uc001pqa.2_Nonsense_Mutation_p.Q930*|SIK3_uc001ppw.2_Nonsense_Mutation_p.Q347*|SIK3_uc001ppx.2_Nonsense_Mutation_p.Q368*|SIK3_uc001pqb.2_Nonsense_Mutation_p.Q293*	p.Q990*	NM_025164	NP_079440	WXS	Illumina HiSeq	Unspecified	Q9Y2K2	SIK3_HUMAN			20	3004	-			990					A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Nonsense_Mutation	SNP	ENST00000292055.4	37	c.2968C>T	CCDS8379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.088177|10.088177	0.99333|0.99333	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000375288;ENST00000542607;ENST00000434315|ENST00000445177;ENST00000446921	.|.	.|.	.|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.214637|.	0.22314|.	U|.	0.061696|.	.|T	.|0.76601	.|0.4010	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.75088	.|-0.3441	.|3	0.87932|.	D|.	0|.	.|.	19.4865|19.4865	0.95030|0.95030	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1048;990;325;930;829|1089;952	.|.	ENSP00000292055:Q990X|.	Q|S	-|-	1|2	0|0	SIK3|SIK3	116234105|116234105	1.000000|1.000000	0.71417|0.71417	0.488000|0.488000	0.27440|0.27440	0.790000|0.790000	0.44656|0.44656	7.898000|7.898000	0.87363|0.87363	2.585000|2.585000	0.87301|0.87301	0.563000|0.563000	0.77884|0.77884	CAA|TCA		0.552	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164		9	37	0	0	0	0.008291	0	9	37				
ROBO4	54538	broad.mit.edu	37	11	124754802	124754802	+	Silent	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:124754802A>T	ENST00000306534.3	-	18	3494	c.3009T>A	c.(3007-3009)ccT>ccA	p.P1003P	ROBO4_ENST00000533054.1_Silent_p.P858P|RP11-664I21.5_ENST00000524453.1_RNA	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	1003					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.P1003P(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		AGTAATCTACAGGAGAAGCTG	0.557																																							uc001qbg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(3007-3009)CCT>CCA		roundabout homolog 4, magic roundabout							188.0	179.0	182.0					11																	124754802		2201	4299	6500	SO:0001819	synonymous_variant	54538				angiogenesis|cell differentiation	integral to membrane	receptor activity	g.chr11:124754802A>T	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.3009T>A	11.37:g.124754802A>T			Somatic				ROBO4_uc010sas.1_Silent_p.P858P	p.P1003P	NM_019055	NP_061928	WXS	Illumina HiSeq	Unspecified	Q8WZ75	ROBO4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)	18	3149	-	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	1003					A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	ENST00000306534.3	37	c.3009T>A	CCDS8455.1																																																																																				0.557	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055		18	58	0	0	0	0.00278	0	18	58				
ARHGAP32	9743	broad.mit.edu	37	11	128839021	128839021	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:128839021G>T	ENST00000310343.9	-	22	6044	c.6045C>A	c.(6043-6045)agC>agA	p.S2015R	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.S1666R|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.S1666R	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	2015	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)	p.S2015R(1)|p.S1666R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CAGTCACACTGCTCTGGCGCT	0.562																																							uc009zcp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(2)	5						c.(6043-6045)AGC>AGA		Rho GTPase-activating protein isoform 1							116.0	96.0	103.0					11																	128839021		2201	4297	6498	SO:0001583	missense	9743				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding	g.chr11:128839021G>T	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.6045C>A	11.37:g.128839021G>T	ENSP00000310561:p.Ser2015Arg		Somatic				ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Missense_Mutation_p.S974R|ARHGAP32_uc001qez.2_Missense_Mutation_p.S1666R	p.S2015R	NM_001142685	NP_001136157	WXS	Illumina HiSeq	Unspecified	A7KAX9	RHG32_HUMAN			22	6045	-			2015			Interaction with FYN.		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	c.6045C>A	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896136	0.33442	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.21191	2.02;2.02;2.02	5.56	1.38	0.22167	.	0.440966	0.27319	N	0.019908	T	0.17238	0.0414	L	0.47716	1.5	0.23681	N	0.99712	P	0.39216	0.664	B	0.36885	0.235	T	0.10382	-1.0632	10	0.87932	D	0	.	9.1608	0.37021	0.1428:0.1101:0.7471:0.0	.	2015	A7KAX9	RHG32_HUMAN	R	2015;1666;1666	ENSP00000310561:S2015R;ENSP00000376425:S1666R;ENSP00000432862:S1666R	ENSP00000310561:S2015R	S	-	3	2	ARHGAP32	128344231	0.996000	0.38824	0.003000	0.11579	0.749000	0.42624	2.389000	0.44407	0.279000	0.22186	0.650000	0.86243	AGC		0.562	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715		18	34	1	0	8.34094e-07	0.008871	9.3021e-07	18	34				
CACNA2D4	93589	broad.mit.edu	37	12	1953620	1953620	+	Silent	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:1953620T>A	ENST00000382722.5	-	25	2780	c.2418A>T	c.(2416-2418)tcA>tcT	p.S806S	CACNA2D4_ENST00000585708.1_Silent_p.S742S|CACNA2D4_ENST00000587995.1_Silent_p.S781S|CACNA2D4_ENST00000588077.1_Silent_p.S742S|CACNA2D4_ENST00000586184.1_Silent_p.S806S|CACNA2D4_ENST00000585732.1_Silent_p.S667S|CACNA2D4_ENST00000539048.2_5'UTR	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	806					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.S806S(2)		endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CAGGATGCTCTGAGGCCTGGC	0.632																																					Colon(2;101 179 21030 23310 28141)	Colon(2;101 179 21030 23310 28141)	uc001qjp.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2416-2418)TCA>TCT		voltage-gated calcium channel alpha(2)delta-4							47.0	56.0	53.0					12																	1953620		2055	4201	6256	SO:0001819	synonymous_variant	93589					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity	g.chr12:1953620T>A	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2418A>T	12.37:g.1953620T>A			Somatic				CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Silent_p.S670S|CACNA2D4_uc009zdr.1_RNA	p.S806S	NM_172364	NP_758952	WXS	Illumina HiSeq	Unspecified	Q7Z3S7	CA2D4_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)	25	2649	-	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	806			Extracellular (Potential).		Q7Z3S8|Q86XZ5|Q8IZS9	Silent	SNP	ENST00000382722.5	37	c.2418A>T	CCDS44785.1																																																																																				0.632	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2			14	22	0	0	0	0.007413	0	14	22				
SCNN1A	6337	broad.mit.edu	37	12	6463650	6463650	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:6463650C>A	ENST00000228916.2	-	8	1412	c.1314G>T	c.(1312-1314)cgG>cgT	p.R438R	SCNN1A_ENST00000538979.1_5'UTR|SCNN1A_ENST00000540037.1_Silent_p.R138R|SCNN1A_ENST00000358945.3_Silent_p.R438R|SCNN1A_ENST00000360168.3_Silent_p.R497R|SCNN1A_ENST00000396966.2_Silent_p.R438R|SCNN1A_ENST00000543768.1_Silent_p.R461R	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	438					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)	p.R438R(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	CGTTCTGGGGCCGCGGATAGA	0.587																																							uc001qnx.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1312-1314)CGG>CGT		sodium channel, nonvoltage-gated 1 alpha isoform	Amiloride(DB00594)|Triamterene(DB00384)						69.0	66.0	67.0					12																	6463650		2203	4300	6503	SO:0001819	synonymous_variant	6337				excretion|response to stimulus|sensory perception of taste	apical plasma membrane	WW domain binding	g.chr12:6463650C>A	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1314G>T	12.37:g.6463650C>A			Somatic				SCNN1A_uc001qnv.2_Silent_p.R138R|SCNN1A_uc001qnw.2_Silent_p.R497R|SCNN1A_uc010sfb.1_Silent_p.R461R	p.R438R	NM_001038	NP_001029	WXS	Illumina HiSeq	Unspecified	P37088	SCNNA_HUMAN			8	1603	-			438			Extracellular (By similarity).		A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Silent	SNP	ENST00000228916.2	37	c.1314G>T	CCDS8543.1																																																																																				0.587	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399055.1			21	16	1	0	1.16021e-09	0.007291	1.34924e-09	21	16				
TAS2R9	50835	broad.mit.edu	37	12	10962482	10962482	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:10962482C>G	ENST00000240691.2	-	1	285	c.193G>C	c.(193-195)Gat>Cat	p.D65H	TAS2R8_ENST00000240615.2_5'Flank	NM_023917.2	NP_076406.1	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	65					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	taste receptor activity (GO:0008527)	p.D65H(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AAGAAGCCATCTAATGATATT	0.413																																							uc001qyx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(193-195)GAT>CAT		taste receptor, type 2, member 9							104.0	101.0	102.0					12																	10962482		2203	4300	6503	SO:0001583	missense	50835				sensory perception of taste	integral to membrane	taste receptor activity	g.chr12:10962482C>G	AF227135	CCDS8633.1	12p13	2012-08-22			ENSG00000121381	ENSG00000121381		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14917	protein-coding gene	gene with protein product		604795				10761934, 10766242	Standard	NM_023917		Approved	T2R9, TRB6	uc001qyx.3	Q9NYW1	OTTHUMG00000168507	ENST00000240691.2:c.193G>C	12.37:g.10962482C>G	ENSP00000240691:p.Asp65His		Somatic				TAS2R8_uc010shh.1_5'Flank	p.D65H	NM_023917	NP_076406	WXS	Illumina HiSeq	Unspecified	Q9NYW1	TA2R9_HUMAN			1	286	-			65			Helical; Name=2; (Potential).		Q502V7|Q50KT0|Q50KT1|Q645W9	Missense_Mutation	SNP	ENST00000240691.2	37	c.193G>C	CCDS8633.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293710	0.60086	.	.	ENSG00000121381	ENST00000240691	T	0.37058	1.22	4.5	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	0.828040	0.10398	U	0.679572	T	0.46014	0.1371	M	0.63428	1.95	0.09310	N	0.999991	D	0.60575	0.988	P	0.56343	0.796	T	0.22556	-1.0213	10	0.36615	T	0.2	.	5.9259	0.19112	0.0:0.6837:0.0:0.3163	.	65	Q9NYW1	TA2R9_HUMAN	H	65	ENSP00000240691:D65H	ENSP00000240691:D65H	D	-	1	0	TAS2R9	10853749	0.000000	0.05858	0.236000	0.24074	0.562000	0.35680	-0.394000	0.07296	1.013000	0.39391	0.460000	0.39030	GAT		0.413	TAS2R9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399933.1			145	210	0	0	0	0.00361	0	145	210				
SOX5	6660	broad.mit.edu	37	12	23689448	23689448	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:23689448C>T	ENST00000451604.2	-	14	2028	c.1927G>A	c.(1927-1929)Ggt>Agt	p.G643S	SOX5_ENST00000309359.1_Missense_Mutation_p.G630S|SOX5_ENST00000546136.1_Missense_Mutation_p.G630S|SOX5_ENST00000545921.1_Missense_Mutation_p.G633S|SOX5_ENST00000541536.1_Missense_Mutation_p.G522S|SOX5_ENST00000381381.2_Missense_Mutation_p.G522S|SOX5_ENST00000537393.1_Missense_Mutation_p.G608S|SOX5_ENST00000396007.2_Missense_Mutation_p.G257S			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	643					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G643S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						TTGTATTCACCAATGCGCAGC	0.507																																							uc001rfw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(1)	6						c.(1927-1929)GGT>AGT		SRY (sex determining region Y)-box 5 isoform a							116.0	96.0	102.0					12																	23689448		2203	4300	6503	SO:0001583	missense	6660				transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr12:23689448C>T	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.1927G>A	12.37:g.23689448C>T	ENSP00000398273:p.Gly643Ser		Somatic				SOX5_uc001rfx.2_Missense_Mutation_p.G630S|SOX5_uc001rfy.2_Missense_Mutation_p.G522S|SOX5_uc001rfv.2_Missense_Mutation_p.G257S|SOX5_uc010siv.1_Missense_Mutation_p.G630S|SOX5_uc010siw.1_RNA	p.G643S	NM_006940	NP_008871	WXS	Illumina HiSeq	Unspecified	P35711	SOX5_HUMAN			14	2029	-			643					B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	c.1927G>A	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.679125	0.88542	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000537393;ENST00000541536;ENST00000396007;ENST00000545921	T;T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05	5.6	5.6	0.85130	.	0.047096	0.85682	D	0.000000	T	0.53850	0.1822	L	0.31526	0.94	0.46521	D	0.999089	B;B;B	0.31705	0.336;0.068;0.011	B;B;B	0.32289	0.143;0.088;0.039	T	0.48293	-0.9048	10	0.28530	T	0.3	.	19.9823	0.97331	0.0:1.0:0.0:0.0	.	522;643;257	P35711-4;P35711;P35711-3	.;SOX5_HUMAN;.	S	630;630;522;643;608;522;257;633	ENSP00000437487:G630S;ENSP00000308927:G630S;ENSP00000370788:G522S;ENSP00000398273:G643S;ENSP00000439832:G608S;ENSP00000441973:G522S;ENSP00000379328:G257S;ENSP00000443520:G633S	ENSP00000308927:G630S	G	-	1	0	SOX5	23580715	1.000000	0.71417	0.249000	0.24280	0.906000	0.53458	6.014000	0.70784	2.788000	0.95919	0.650000	0.86243	GGT		0.507	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		39	80	0	0	0	0.002522	0	39	80				
OVCH1	341350	broad.mit.edu	37	12	29624753	29624753	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:29624753G>A	ENST00000318184.5	-	16	1837	c.1838C>T	c.(1837-1839)gCa>gTa	p.A613V	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	613	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.A613V(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					ACAGTGGGCTGCGGTCAGAAT	0.493																																							uc001rix.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10						c.(1837-1839)GCA>GTA		ovochymase 1 precursor							56.0	58.0	57.0					12																	29624753		1993	4176	6169	SO:0001583	missense	341350				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	g.chr12:29624753G>A	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1838C>T	12.37:g.29624753G>A	ENSP00000326708:p.Ala613Val		Somatic					p.A613V	NM_183378	NP_899234	WXS	Illumina HiSeq	Unspecified	Q7RTY7	OVCH1_HUMAN			16	1838	-	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)		613			Peptidase S1 2.			Missense_Mutation	SNP	ENST00000318184.5	37	c.1838C>T		.	.	.	.	.	.	.	.	.	.	G	25.2	4.609446	0.87258	.	.	ENSG00000187950	ENST00000318184	D	0.95238	-3.65	2.22	2.22	0.28083	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.97455	0.9167	M	0.92691	3.335	0.42816	D	0.993971	D	0.76494	0.999	D	0.83275	0.996	D	0.97823	1.0258	9	0.87932	D	0	.	12.0122	0.53293	0.0:0.0:1.0:0.0	.	613	Q7RTY7	OVCH1_HUMAN	V	613	ENSP00000326708:A613V	ENSP00000326708:A613V	A	-	2	0	OVCH1	29516020	0.988000	0.35896	0.461000	0.27105	0.854000	0.48673	2.593000	0.46180	1.567000	0.49668	0.591000	0.81541	GCA		0.493	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378		37	53	0	0	0	0.009718	0	37	53				
IPO8	10526	broad.mit.edu	37	12	30837254	30837254	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:30837254G>T	ENST00000256079.4	-	3	642	c.304C>A	c.(304-306)Cgg>Agg	p.R102R	IPO8_ENST00000538338.1_5'Flank	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	102	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)	p.R102R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCTGGAGACCGAATTATTCCT	0.418																																							uc001rjd.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(304-306)CGG>AGG		importin 8							243.0	218.0	227.0					12																	30837254		2203	4300	6503	SO:0001819	synonymous_variant	10526				intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding	g.chr12:30837254G>T	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.304C>A	12.37:g.30837254G>T			Somatic					p.R102R	NM_006390	NP_006381	WXS	Illumina HiSeq	Unspecified	O15397	IPO8_HUMAN			3	474	-	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)		102			Importin N-terminal.		B7Z7M3	Silent	SNP	ENST00000256079.4	37	c.304C>A	CCDS8719.1																																																																																				0.418	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390		97	195	1	0	8.73416e-63	0.00361	1.50671e-62	97	195				
IPO8	10526	broad.mit.edu	37	12	30843467	30843467	+	Silent	SNP	T	T	A	rs369268640		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:30843467T>A	ENST00000256079.4	-	2	467	c.129A>T	c.(127-129)atA>atT	p.I43I	IPO8_ENST00000538338.1_5'Flank	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	43	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)	p.I43I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GGTCAGAGACTATAATCCGAA	0.328																																							uc001rjd.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(127-129)ATA>ATT		importin 8							113.0	129.0	124.0					12																	30843467		2203	4300	6503	SO:0001819	synonymous_variant	10526				intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding	g.chr12:30843467T>A	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.129A>T	12.37:g.30843467T>A			Somatic					p.I43I	NM_006390	NP_006381	WXS	Illumina HiSeq	Unspecified	O15397	IPO8_HUMAN			2	299	-	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)		43			Importin N-terminal.		B7Z7M3	Silent	SNP	ENST00000256079.4	37	c.129A>T	CCDS8719.1																																																																																				0.328	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390		63	65	0	0	0	0.00361	0	63	65				
ADAMTS20	80070	broad.mit.edu	37	12	43895977	43895977	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:43895977T>C	ENST00000389420.3	-	4	844	c.845A>G	c.(844-846)tAt>tGt	p.Y282C	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.Y282C	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	282	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Y282C(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AGTCAGTATATAGTTTTGCAA	0.279																																							uc010skx.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(844-846)TAT>TGT		a disintegrin-like and metalloprotease with							97.0	92.0	94.0					12																	43895977		2200	4298	6498	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43895977T>C	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.845A>G	12.37:g.43895977T>C	ENSP00000374071:p.Tyr282Cys		Somatic					p.Y282C	NM_025003	NP_079279	WXS	Illumina HiSeq	Unspecified	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	4	845	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	282			Peptidase M12B.		A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.845A>G	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876342	0.72180	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	D;D	0.88741	-2.42;-2.42	4.66	4.66	0.58398	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.48286	D	0.000197	D	0.96024	0.8705	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97300	0.9930	10	0.87932	D	0	.	14.8312	0.70149	0.0:0.0:0.0:1.0	.	282	P59510	ATS20_HUMAN	C	282	ENSP00000374071:Y282C;ENSP00000448341:Y282C	ENSP00000374068:Y282C	Y	-	2	0	ADAMTS20	42182244	1.000000	0.71417	0.909000	0.35828	0.985000	0.73830	7.160000	0.77495	2.043000	0.60533	0.533000	0.62120	TAT		0.279	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		10	15	0	0	0	0.000978	0	10	15				
KMT2D	8085	broad.mit.edu	37	12	49448739	49448739	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:49448739C>A	ENST00000301067.7	-	2	119	c.120G>T	c.(118-120)gaG>gaT	p.E40D		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	40					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.E40D(2)									GGACAGAGACCTCTCCCACAT	0.532																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		2	Substitution - Missense(2)		lung(2)	kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(118-120)GAG>GAT		myeloid/lymphoid or mixed-lineage leukemia 2							102.0	102.0	102.0					12																	49448739		1984	4178	6162	SO:0001583	missense	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49448739C>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.120G>T	12.37:g.49448739C>A	ENSP00000301067:p.Glu40Asp	HNSCC(34;0.089)	Somatic					p.E40D	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			2	120	-			40					O14687	Missense_Mutation	SNP	ENST00000301067.7	37	c.120G>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717850	0.30413	.	.	ENSG00000167548	ENST00000301067;ENST00000547610	T	0.79352	-1.26	5.1	4.11	0.48088	.	.	.	.	.	T	0.65312	0.2679	N	0.19112	0.55	0.23180	N	0.998166	B	0.06786	0.001	B	0.06405	0.002	T	0.59129	-0.7512	9	0.87932	D	0	.	11.5174	0.50529	0.1913:0.8087:0.0:0.0	.	40	O14686	MLL2_HUMAN	D	40	ENSP00000301067:E40D	ENSP00000301067:E40D	E	-	3	2	MLL2	47735006	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.403000	0.34612	2.342000	0.79632	0.557000	0.71058	GAG		0.532	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			163	232	1	0	1.02705e-64	0.00361	1.7825e-64	163	232				
XPOT	11260	broad.mit.edu	37	12	64819617	64819617	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:64819617G>T	ENST00000332707.5	+	15	2124	c.1595G>T	c.(1594-1596)gGt>gTt	p.G532V		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	532	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.G532V(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		GATCACAGAGGTCTGCGGCAT	0.373																																							uc001ssb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1594-1596)GGT>GTT		tRNA exportin							172.0	184.0	180.0					12																	64819617		2203	4300	6503	SO:0001583	missense	11260				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding	g.chr12:64819617G>T	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.1595G>T	12.37:g.64819617G>T	ENSP00000327821:p.Gly532Val		Somatic					p.G532V	NM_007235	NP_009166	WXS	Illumina HiSeq	Unspecified	O43592	XPOT_HUMAN		GBM - Glioblastoma multiforme(28;0.0404)	15	2021	+			532			Necessary for tRNA-binding, cytoplasmic localization and nuclear export.		A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	c.1595G>T	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.463167	0.84425	.	.	ENSG00000184575	ENST00000332707;ENST00000538086	T;T	0.28895	1.59;1.59	4.35	4.35	0.52113	Armadillo-like helical (1);Armadillo-type fold (1);	0.055085	0.64402	D	0.000001	T	0.59756	0.2217	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65549	-0.6141	9	.	.	.	.	17.7735	0.88500	0.0:0.0:1.0:0.0	.	532	O43592	XPOT_HUMAN	V	532;54	ENSP00000327821:G532V;ENSP00000444345:G54V	.	G	+	2	0	XPOT	63105884	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	9.142000	0.94618	2.368000	0.80403	0.591000	0.81541	GGT		0.373	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235		62	169	1	0	1.10345e-40	0.00361	1.75998e-40	62	169				
MSRB3	253827	broad.mit.edu	37	12	65857034	65857034	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:65857034A>T	ENST00000355192.3	+	6	637	c.511A>T	c.(511-513)Agc>Tgc	p.S171C	MSRB3_ENST00000308259.5_Missense_Mutation_p.S164C|MSRB3_ENST00000535664.1_Missense_Mutation_p.S164C	NM_198080.3	NP_932346.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3	171					protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)	p.S164C(1)|p.S171C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		ACCTGCGGATAGCAGTGGCAC	0.547																																							uc001ssn.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)|skin(1)	2						c.(511-513)AGC>TGC		methionine sulfoxide reductase B3 isoform 1							90.0	82.0	85.0					12																	65857034		2203	4300	6503	SO:0001583	missense	253827				protein repair	endoplasmic reticulum|mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|zinc ion binding	g.chr12:65857034A>T	BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099			27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74		21185009	Standard	NM_198080		Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000355192.3:c.511A>T	12.37:g.65857034A>T	ENSP00000347324:p.Ser171Cys		Somatic				MSRB3_uc001ssm.2_Missense_Mutation_p.S164C|MSRB3_uc009zqp.2_Missense_Mutation_p.S164C	p.S171C	NM_198080	NP_932346	WXS	Illumina HiSeq	Unspecified	Q8IXL7	MSRB3_HUMAN	LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)	6	572	+			171					B4DR19|B7ZAQ0|Q6UXS2	Missense_Mutation	SNP	ENST00000355192.3	37	c.511A>T	CCDS8973.1	.	.	.	.	.	.	.	.	.	.	A	17.62	3.433674	0.62955	.	.	ENSG00000174099	ENST00000355192;ENST00000308259;ENST00000535664;ENST00000535239	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-0.14	5.76	-1.38	0.09027	Mss4-like (1);Methionine sulphoxide reductase B (2);	0.477260	0.22576	N	0.058267	T	0.73528	0.3598	M	0.62723	1.935	0.09310	N	1	D;P	0.61080	0.989;0.933	P;P	0.49361	0.608;0.513	T	0.65890	-0.6058	9	.	.	.	-5.8712	6.0391	0.19724	0.5384:0.1395:0.322:0.0	.	171;164	Q8IXL7;Q8IXL7-2	MSRB3_HUMAN;.	C	171;164;164;164	ENSP00000347324:S171C;ENSP00000312274:S164C;ENSP00000441650:S164C;ENSP00000445843:S164C	.	S	+	1	0	MSRB3	64143301	0.027000	0.19231	0.003000	0.11579	0.002000	0.02628	0.585000	0.23879	-0.147000	0.11254	-0.899000	0.02877	AGC		0.547	MSRB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401421.1	NM_198080		29	60	0	0	0	0.002852	0	29	60				
TRHDE	29953	broad.mit.edu	37	12	72680664	72680664	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:72680664C>T	ENST00000261180.4	+	2	1079	c.983C>T	c.(982-984)tCc>tTc	p.S328F		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	328					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S328F(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						CCTCTCATGTCCACATATTAT	0.398																																							uc001sxa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(982-984)TCC>TTC		thyrotropin-releasing hormone degrading enzyme							120.0	115.0	116.0					12																	72680664		2203	4300	6503	SO:0001583	missense	29953				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr12:72680664C>T	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.983C>T	12.37:g.72680664C>T	ENSP00000261180:p.Ser328Phe		Somatic					p.S328F	NM_013381	NP_037513	WXS	Illumina HiSeq	Unspecified	Q9UKU6	TRHDE_HUMAN			2	1013	+			328			Extracellular (Potential).		A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	c.983C>T	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621386	0.87460	.	.	ENSG00000072657	ENST00000261180	T	0.05786	3.39	6.17	5.27	0.74061	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.41465	0.1160	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.64795	-0.6323	10	0.87932	D	0	.	16.7611	0.85512	0.1301:0.8699:0.0:0.0	.	328	Q9UKU6	TRHDE_HUMAN	F	328	ENSP00000261180:S328F	ENSP00000261180:S328F	S	+	2	0	TRHDE	70966931	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.818000	0.86416	1.582000	0.49881	0.655000	0.94253	TCC		0.398	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381		46	94	0	0	0	0.00361	0	46	94				
LRRIQ1	84125	broad.mit.edu	37	12	85546113	85546113	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:85546113C>T	ENST00000393217.2	+	20	4446	c.4385C>T	c.(4384-4386)aCa>aTa	p.T1462I		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1462								p.T1462I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CCTTCACAAACACTGCTTCTT	0.393																																							uc001tac.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(4384-4386)ACA>ATA		leucine-rich repeats and IQ motif containing 1							138.0	133.0	134.0					12																	85546113		1900	4112	6012	SO:0001583	missense	84125							g.chr12:85546113C>T	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4385C>T	12.37:g.85546113C>T	ENSP00000376910:p.Thr1462Ile		Somatic					p.T1462I	NM_001079910	NP_001073379	WXS	Illumina HiSeq	Unspecified	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	20	4496	+			1462					Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	c.4385C>T	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.153661	0.57259	.	.	ENSG00000133640	ENST00000393217	T	0.52983	0.64	5.22	5.22	0.72569	.	.	.	.	.	T	0.56529	0.1991	N	0.19112	0.55	0.34558	D	0.712065	D	0.89917	1.0	D	0.74674	0.984	T	0.68891	-0.5289	9	0.87932	D	0	.	18.8375	0.92168	0.0:1.0:0.0:0.0	.	1462	Q96JM4	LRIQ1_HUMAN	I	1462	ENSP00000376910:T1462I	ENSP00000376910:T1462I	T	+	2	0	LRRIQ1	84070244	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.183000	0.58317	2.471000	0.83476	0.586000	0.80456	ACA		0.393	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		40	95	0	0	0	0.00361	0	40	95				
UHRF1BP1L	23074	broad.mit.edu	37	12	100444041	100444041	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:100444041C>A	ENST00000279907.7	-	17	3835	c.3623G>T	c.(3622-3624)gGg>gTg	p.G1208V	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.G858V	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	1208								p.G1208V(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						TGTATCTTCCCCTCGGATGTC	0.388																																							uc001tgq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3622-3624)GGG>GTG		UHRF1 (ICBP90) binding protein 1-like isoform a							118.0	105.0	109.0					12																	100444041		2202	4300	6502	SO:0001583	missense	23074							g.chr12:100444041C>A		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.3623G>T	12.37:g.100444041C>A	ENSP00000279907:p.Gly1208Val		Somatic				UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.G858V	p.G1208V	NM_015054	NP_055869	WXS	Illumina HiSeq	Unspecified	A0JNW5	UH1BL_HUMAN			17	3852	-			1208					A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	37	c.3623G>T	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092073	0.76756	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.28895	1.61;1.59	5.48	3.66	0.41972	.	0.046421	0.85682	D	0.000000	T	0.53481	0.1799	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.56275	-0.8006	10	0.87932	D	0	-9.4154	12.1711	0.54160	0.0:0.8725:0.0:0.1275	.	1208	A0JNW5	UH1BL_HUMAN	V	1208;858	ENSP00000279907:G1208V;ENSP00000444824:G858V	ENSP00000279907:G1208V	G	-	2	0	UHRF1BP1L	98968172	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	6.420000	0.73349	0.676000	0.31285	0.591000	0.81541	GGG		0.388	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947		17	49	1	0	4.7796e-09	0.004656	5.51344e-09	17	49				
NR1H4	9971	broad.mit.edu	37	12	100926360	100926360	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:100926360G>A	ENST00000551379.1	+	3	628	c.600G>A	c.(598-600)atG>atA	p.M200I	NR1H4_ENST00000392986.3_Missense_Mutation_p.M190I|NR1H4_ENST00000549996.1_Intron|NR1H4_ENST00000548884.1_Missense_Mutation_p.M190I|NR1H4_ENST00000188403.7_Missense_Mutation_p.M200I			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	200					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.M190I(1)|p.M200I(1)		NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	GCAAAGAGATGGGAATGTTGG	0.403																																							uc001tht.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)|skin(1)	3						c.(598-600)ATG>ATA		nuclear receptor subfamily 1, group H, member 4							220.0	195.0	203.0					12																	100926360		2203	4300	6503	SO:0001583	missense	9971				bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr12:100926360G>A	U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.600G>A	12.37:g.100926360G>A	ENSP00000447149:p.Met200Ile		Somatic				NR1H4_uc001thp.1_Missense_Mutation_p.M190I|NR1H4_uc001thq.1_Missense_Mutation_p.M190I|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Missense_Mutation_p.M190I|NR1H4_uc010svk.1_Intron|NR1H4_uc001ths.1_Missense_Mutation_p.M200I	p.M200I	NM_005123	NP_005114	WXS	Illumina HiSeq	Unspecified	Q96RI1	NR1H4_HUMAN			3	628	+			200			Nuclear receptor.		A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Missense_Mutation	SNP	ENST00000551379.1	37	c.600G>A	CCDS55876.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.233360	0.58886	.	.	ENSG00000012504	ENST00000548884;ENST00000392986;ENST00000551379;ENST00000188403	D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13	5.67	5.67	0.87782	Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (4);	0.035138	0.85682	D	0.000000	D	0.90878	0.7134	N	0.04090	-0.28	0.80722	D	1	B;P;P;B	0.35684	0.372;0.459;0.515;0.009	B;B;B;B	0.38921	0.285;0.147;0.229;0.007	D	0.91668	0.5348	10	0.72032	D	0.01	.	13.986	0.64337	0.0724:0.0:0.9276:0.0	.	200;200;190;190	Q96RI1;Q96RI1-4;F1DAL1;B6ZGS9	NR1H4_HUMAN;.;.;.	I	190;190;200;200	ENSP00000448506:M190I;ENSP00000376712:M190I;ENSP00000447149:M200I;ENSP00000188403:M200I	ENSP00000188403:M200I	M	+	3	0	NR1H4	99450491	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.644000	0.83416	2.681000	0.91329	0.561000	0.74099	ATG		0.403	NR1H4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409140.1	NM_005123		9	279	0	0	0	0.008291	0	9	279				
NR1H4	9971	broad.mit.edu	37	12	100926373	100926373	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:100926373G>A	ENST00000551379.1	+	3	641	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K	NR1H4_ENST00000392986.3_Missense_Mutation_p.E195K|NR1H4_ENST00000549996.1_Intron|NR1H4_ENST00000548884.1_Missense_Mutation_p.E195K|NR1H4_ENST00000188403.7_Missense_Mutation_p.E205K			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	205					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.E195K(1)|p.E205K(1)		NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	AATGTTGGCTGAATGTATGTA	0.408																																							uc001tht.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)|skin(1)	3						c.(613-615)GAA>AAA		nuclear receptor subfamily 1, group H, member 4							203.0	180.0	188.0					12																	100926373		2203	4300	6503	SO:0001583	missense	9971				bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr12:100926373G>A	U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.613G>A	12.37:g.100926373G>A	ENSP00000447149:p.Glu205Lys		Somatic				NR1H4_uc001thp.1_Missense_Mutation_p.E195K|NR1H4_uc001thq.1_Missense_Mutation_p.E195K|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Missense_Mutation_p.E195K|NR1H4_uc010svk.1_Intron|NR1H4_uc001ths.1_Missense_Mutation_p.E205K	p.E205K	NM_005123	NP_005114	WXS	Illumina HiSeq	Unspecified	Q96RI1	NR1H4_HUMAN			3	641	+			205			Nuclear receptor.		A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Missense_Mutation	SNP	ENST00000551379.1	37	c.613G>A	CCDS55876.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924279	0.92319	.	.	ENSG00000012504	ENST00000548884;ENST00000392986;ENST00000551379;ENST00000188403	D;D;D;D	0.96522	-4.04;-4.04;-4.04;-4.04	5.67	5.67	0.87782	Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (2);	0.000000	0.85682	D	0.000000	D	0.95778	0.8626	N	0.08118	0	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.998;1.0	D;D;D;D	0.91635	0.999;0.995;0.989;0.992	D	0.97502	1.0061	10	0.87932	D	0	.	19.7619	0.96323	0.0:0.0:1.0:0.0	.	205;205;195;195	Q96RI1;Q96RI1-4;F1DAL1;B6ZGS9	NR1H4_HUMAN;.;.;.	K	195;195;205;205	ENSP00000448506:E195K;ENSP00000376712:E195K;ENSP00000447149:E205K;ENSP00000188403:E205K	ENSP00000188403:E205K	E	+	1	0	NR1H4	99450504	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.681000	0.91329	0.561000	0.74099	GAA		0.408	NR1H4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409140.1	NM_005123		7	259	0	0	0	0.004482	0	7	259				
SLC5A8	160728	broad.mit.edu	37	12	101573854	101573854	+	Missense_Mutation	SNP	A	A	T	rs199646960		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:101573854A>T	ENST00000536262.2	-	10	1744	c.1186T>A	c.(1186-1188)Tgt>Agt	p.C396S		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8									p.C396S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ATTCCAATACACAGGGCTCCA	0.433																																					GBM(60;420 1056 13605 22380 47675)	GBM(60;420 1056 13605 22380 47675)	uc001thz.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1186-1188)TGT>AGT		solute carrier family 5 (iodide transporter),							164.0	161.0	162.0					12																	101573854		2203	4300	6503	SO:0001583	missense	160728				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity	g.chr12:101573854A>T	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.1186T>A	12.37:g.101573854A>T	ENSP00000445340:p.Cys396Ser		Somatic					p.C396S	NM_145913	NP_666018	WXS	Illumina HiSeq	Unspecified	Q8N695	SC5A8_HUMAN			10	1576	-			396			Helical; (Potential).			Missense_Mutation	SNP	ENST00000536262.2	37	c.1186T>A	CCDS9080.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.067985	0.76301	.	.	ENSG00000256870	ENST00000536262	D	0.86769	-2.17	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.90109	0.6910	L	0.37697	1.125	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	D	0.90369	0.4379	10	0.49607	T	0.09	.	15.8883	0.79269	1.0:0.0:0.0:0.0	.	396	Q8N695	SC5A8_HUMAN	S	396	ENSP00000445340:C396S	ENSP00000445340:C396S	C	-	1	0	SLC5A8	100097985	1.000000	0.71417	0.670000	0.29842	0.515000	0.34225	7.743000	0.85020	2.235000	0.73313	0.528000	0.53228	TGT		0.433	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913		157	289	0	0	0	0.00361	0	157	289				
GNPTAB	79158	broad.mit.edu	37	12	102183810	102183810	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:102183810C>T	ENST00000299314.7	-	3	491	c.229G>A	c.(229-231)Gtt>Att	p.V77I	GNPTAB_ENST00000549940.1_Missense_Mutation_p.V77I|snoU13_ENST00000459085.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	77					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)	p.V77I(2)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GTGTAAACAACGTCAATCGGC	0.428																																							uc001tit.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|skin(1)	2						c.(229-231)GTT>ATT		N-acetylglucosamine-1-phosphate transferase							207.0	184.0	192.0					12																	102183810		2203	4300	6503	SO:0001583	missense	79158				cell differentiation	Golgi membrane|integral to membrane|nucleus	metal ion binding|transcription factor binding|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity	g.chr12:102183810C>T	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.229G>A	12.37:g.102183810C>T	ENSP00000299314:p.Val77Ile		Somatic				GNPTAB_uc001tiu.1_Missense_Mutation_p.V77I	p.V77I	NM_024312	NP_077288	WXS	Illumina HiSeq	Unspecified	Q3T906	GNPTA_HUMAN			3	408	-			77					A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	ENST00000299314.7	37	c.229G>A	CCDS9088.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289333	0.59976	.	.	ENSG00000111670	ENST00000299314;ENST00000549940	D;D	0.97480	-4.07;-4.4	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.97387	0.9145	L	0.45137	1.4	0.80722	D	1	P;D	0.89917	0.897;1.0	B;D	0.64237	0.127;0.923	D	0.96193	0.9139	10	0.28530	T	0.3	-19.639	20.2182	0.98305	0.0:1.0:0.0:0.0	.	77;77	Q3T906-2;Q3T906	.;GNPTA_HUMAN	I	77	ENSP00000299314:V77I;ENSP00000449150:V77I	ENSP00000299314:V77I	V	-	1	0	GNPTAB	100707941	1.000000	0.71417	0.987000	0.45799	0.793000	0.44817	7.412000	0.80091	2.785000	0.95823	0.655000	0.94253	GTT		0.428	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1			178	386	0	0	0	0.00361	0	178	386				
CKAP4	10970	broad.mit.edu	37	12	106633077	106633077	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:106633077T>A	ENST00000378026.4	-	2	1670	c.1534A>T	c.(1534-1536)Acg>Tcg	p.T512S	CKAP4_ENST00000552828.1_5'Flank	NM_006825.3	NP_006816.2	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	512						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.T512S(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|pancreas(1)|urinary_tract(1)	20						CTGAGCAGCGTGTGCACCTGC	0.607																																							uc001tlk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1534-1536)ACG>TCG		cytoskeleton-associated protein 4							58.0	55.0	56.0					12																	106633077		2203	4300	6503	SO:0001583	missense	10970					ER-Golgi intermediate compartment membrane|integral to membrane|membrane fraction		g.chr12:106633077T>A	X69910	CCDS9103.1	12q23.3	2006-06-23				ENSG00000136026			16991	protein-coding gene	gene with protein product						8314870	Standard	NM_006825		Approved	P63, CLIMP-63, ERGIC-63	uc001tlk.3	Q07065		ENST00000378026.4:c.1534A>T	12.37:g.106633077T>A	ENSP00000367265:p.Thr512Ser		Somatic					p.T512S	NM_006825	NP_006816	WXS	Illumina HiSeq	Unspecified	Q07065	CKAP4_HUMAN			2	1618	-			512					Q504S5|Q53ES6	Missense_Mutation	SNP	ENST00000378026.4	37	c.1534A>T	CCDS9103.1	.	.	.	.	.	.	.	.	.	.	T	4.751	0.139673	0.09083	.	.	ENSG00000136026	ENST00000378026	T	0.48522	0.81	5.51	0.127	0.14727	.	0.640102	0.16153	N	0.227185	T	0.24812	0.0602	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.22382	-1.0218	10	0.08381	T	0.77	-9.0983	3.9258	0.09263	0.3871:0.1916:0.0:0.4213	.	512	Q07065	CKAP4_HUMAN	S	512	ENSP00000367265:T512S	ENSP00000367265:T512S	T	-	1	0	CKAP4	105157207	0.000000	0.05858	0.755000	0.31263	0.991000	0.79684	-0.696000	0.05104	-0.214000	0.10078	0.528000	0.53228	ACG		0.607	CKAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407196.1			19	27	0	0	0	0.002299	0	19	27				
SELPLG	6404	broad.mit.edu	37	12	109017819	109017819	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:109017819G>C	ENST00000550948.1	-	2	489	c.265C>G	c.(265-267)Cgt>Ggt	p.R89G	SELPLG_ENST00000388962.3_Missense_Mutation_p.R89G|SELPLG_ENST00000228463.6_Missense_Mutation_p.R105G			Q14242	SELPL_HUMAN	selectin P ligand	89					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.R89G(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						CCAGTAGAACGCCTTGCAGCA	0.582																																							uc001tni.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(265-267)CGT>GGT		selectin P ligand							76.0	65.0	69.0					12																	109017819		2203	4300	6503	SO:0001583	missense	6404				blood coagulation|cellular response to interleukin-6	integral to plasma membrane|membrane fraction	bacterial cell surface binding|receptor binding	g.chr12:109017819G>C		CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.265C>G	12.37:g.109017819G>C	ENSP00000447752:p.Arg89Gly		Somatic				SELPLG_uc001tnh.2_Missense_Mutation_p.R89G|SELPLG_uc010sxe.1_Missense_Mutation_p.R105G	p.R89G	NM_003006	NP_002997	WXS	Illumina HiSeq	Unspecified	Q14242	SELPL_HUMAN			2	425	-			89			Extracellular (Potential).		A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Missense_Mutation	SNP	ENST00000550948.1	37	c.265C>G	CCDS31895.2	.	.	.	.	.	.	.	.	.	.	G	4.778	0.144664	0.09134	.	.	ENSG00000110876	ENST00000388962;ENST00000550948;ENST00000228463	T;T;T	0.32272	1.57;1.48;1.46	3.26	0.258	0.15578	.	0.932048	0.08809	N	0.890636	T	0.15392	0.0371	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.25467	-1.0131	10	0.20046	T	0.44	-7.5115	15.1995	0.73122	0.0:0.4114:0.5886:0.0	.	105;89;89	B7Z5C7;Q14242;B4DHR9	.;SELPL_HUMAN;.	G	89;89;105	ENSP00000373614:R89G;ENSP00000447752:R89G;ENSP00000228463:R105G	ENSP00000228463:R105G	R	-	1	0	SELPLG	107541948	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.527000	0.06200	0.048000	0.15891	-0.311000	0.09066	CGT		0.582	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403904.1			20	48	0	0	0	0.003954	0	20	48				
CCDC63	160762	broad.mit.edu	37	12	111321993	111321993	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:111321993C>A	ENST00000308208.5	+	8	1255	c.1013C>A	c.(1012-1014)aCg>aAg	p.T338K	CCDC63_ENST00000545036.1_Missense_Mutation_p.T298K|CCDC63_ENST00000552694.1_Missense_Mutation_p.T259K	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	338								p.T338K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						GCTCGGTTCACGTATGTCACG	0.562																																							uc001trv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(1)|pancreas(1)	8						c.(1012-1014)ACG>AAG		coiled-coil domain containing 63							118.0	111.0	113.0					12																	111321993		2203	4300	6503	SO:0001583	missense	160762							g.chr12:111321993C>A	AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.1013C>A	12.37:g.111321993C>A	ENSP00000312399:p.Thr338Lys		Somatic				CCDC63_uc010sye.1_Missense_Mutation_p.T298K|CCDC63_uc001trw.1_Missense_Mutation_p.T253K	p.T338K	NM_152591	NP_689804	WXS	Illumina HiSeq	Unspecified	Q8NA47	CCD63_HUMAN			8	1208	+			338					B4DY03|Q0P603|Q6P2E1	Missense_Mutation	SNP	ENST00000308208.5	37	c.1013C>A	CCDS9151.1	.	.	.	.	.	.	.	.	.	.	c	10.16	1.273703	0.23221	.	.	ENSG00000173093	ENST00000545036;ENST00000308208;ENST00000552694	T;T;T	0.21191	2.02;2.02;2.02	5.68	0.423	0.16463	.	0.380116	0.31020	N	0.008417	T	0.13457	0.0326	L	0.54323	1.7	0.09310	N	0.999999	B	0.29253	0.239	B	0.25506	0.061	T	0.11966	-1.0566	10	0.29301	T	0.29	.	1.1729	0.01829	0.1422:0.4002:0.2048:0.2528	.	338	Q8NA47	CCD63_HUMAN	K	298;338;259	ENSP00000445881:T298K;ENSP00000312399:T338K;ENSP00000450217:T259K	ENSP00000312399:T338K	T	+	2	0	CCDC63	109806376	0.100000	0.21855	0.379000	0.26080	0.590000	0.36582	0.196000	0.17176	0.364000	0.24374	-0.119000	0.15052	ACG		0.562	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591		49	114	1	0	5.47352e-35	0.00361	8.42421e-35	49	114				
HECTD4	283450	broad.mit.edu	37	12	112744003	112744003	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:112744003G>A	ENST00000430131.2	-	7	1163	c.18C>T	c.(16-18)ctC>ctT	p.L6L	HECTD4_ENST00000377560.5_Silent_p.L256L|HECTD4_ENST00000550722.1_Silent_p.L256L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	6					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.L256L(1)|p.L6L(1)									TGCCAATGGGGAGGTGATTGG	0.498																																							uc009zwc.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|lung(1)	2						c.(16-18)CTC>CTT		chromosome 12 open reading frame 51							42.0	42.0	42.0					12																	112744003		2000	4170	6170	SO:0001819	synonymous_variant	283450							g.chr12:112744003G>A	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.18C>T	12.37:g.112744003G>A			Somatic					p.L6L	NM_001109662	NP_001103132	WXS	Illumina HiSeq	Unspecified					1	36	-								L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37	c.18C>T																																																																																					0.498	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		28	30	0	0	0	0.006999	0	28	30				
SRRM4	84530	broad.mit.edu	37	12	119554754	119554754	+	Nonsense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:119554754T>A	ENST00000267260.4	+	4	766	c.378T>A	c.(376-378)taT>taA	p.Y126*	RP11-364C11.2_ENST00000537730.1_RNA	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	126	Lys-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)	p.Y126*(2)|p.Y223*(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						CCTCATCCTATAGCCCATCGC	0.473																																							uc001txa.1		NA																	3	Substitution - Nonsense(3)		lung(3)	ovary(2)	2						c.(376-378)TAT>TAA		KIAA1853 protein							78.0	70.0	73.0					12																	119554754		1847	4100	5947	SO:0001587	stop_gained	84530				cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding	g.chr12:119554754T>A	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.378T>A	12.37:g.119554754T>A	ENSP00000267260:p.Tyr126*		Somatic					p.Y126*	NM_194286	NP_919262	WXS	Illumina HiSeq	Unspecified	A7MD48	SRRM4_HUMAN			4	670	+			126			Ser-rich.|Lys-rich.		A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Nonsense_Mutation	SNP	ENST00000267260.4	37	c.378T>A	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	T	41	8.812912	0.98964	.	.	ENSG00000139767	ENST00000267260	.	.	.	5.46	-7.39	0.01402	.	0.393789	0.26414	N	0.024510	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3891	21.4207	0.99953	0.0:0.8481:0.0:0.1519	.	.	.	.	X	126	.	ENSP00000267260:Y126X	Y	+	3	2	SRRM4	118039137	0.023000	0.18921	0.524000	0.27887	0.979000	0.70002	-2.320000	0.01119	-1.411000	0.02032	-0.261000	0.10672	TAT		0.473	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286		11	45	0	0	0	0.003163	0	11	45				
PRKAB1	5564	broad.mit.edu	37	12	120112183	120112183	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:120112183C>T	ENST00000229328.5	+	4	948	c.456C>T	c.(454-456)atC>atT	p.I152I	PRKAB1_ENST00000540121.1_5'UTR|PRKAB1_ENST00000541640.1_Silent_p.I152I	NM_006253.4	NP_006244.2	Q9Y478	AAKB1_HUMAN	protein kinase, AMP-activated, beta 1 non-catalytic subunit	152	Glycogen-binding domain. {ECO:0000250}.				cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|positive regulation of gene expression (GO:0010628)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase activity (GO:0004672)	p.I152I(1)		endometrium(2)|large_intestine(3)|lung(5)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Metformin(DB00331)	TTAACAACATCATTCAAGTGA	0.418																																							uc009zwu.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(454-456)ATC>ATT		AMP-activated protein kinase beta 1	Adenosine monophosphate(DB00131)|Metformin(DB00331)						143.0	125.0	131.0					12																	120112183		2203	4300	6503	SO:0001819	synonymous_variant	5564				cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol		g.chr12:120112183C>T	BC001823	CCDS9191.1	12q24.1-q24.3	2008-05-14			ENSG00000111725	ENSG00000111725			9378	protein-coding gene	gene with protein product	"""AMPK beta 1"""	602740				8557660	Standard	NM_006253		Approved		uc001txg.3	Q9Y478	OTTHUMG00000168954	ENST00000229328.5:c.456C>T	12.37:g.120112183C>T			Somatic				PRKAB1_uc001txg.2_Silent_p.I152I	p.I152I	NM_006253	NP_006244	WXS	Illumina HiSeq	Unspecified	Q9Y478	AAKB1_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.166)	5	559	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		152					Q9UBV0|Q9UE20|Q9UEX2|Q9Y6V8	Silent	SNP	ENST00000229328.5	37	c.456C>T	CCDS9191.1																																																																																				0.418	PRKAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401731.2	NM_006253		5	88	0	0	0	0.006214	0	5	88				
PRKAB1	5564	broad.mit.edu	37	12	120112187	120112187	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:120112187C>T	ENST00000229328.5	+	4	952	c.460C>T	c.(460-462)Caa>Taa	p.Q154*	PRKAB1_ENST00000540121.1_5'UTR|PRKAB1_ENST00000541640.1_Nonsense_Mutation_p.Q154*	NM_006253.4	NP_006244.2	Q9Y478	AAKB1_HUMAN	protein kinase, AMP-activated, beta 1 non-catalytic subunit	154	Glycogen-binding domain. {ECO:0000250}.				cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|positive regulation of gene expression (GO:0010628)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase activity (GO:0004672)	p.Q154*(1)		endometrium(2)|large_intestine(3)|lung(5)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Metformin(DB00331)	CAACATCATTCAAGTGAAGAA	0.413																																							uc009zwu.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(460-462)CAA>TAA		AMP-activated protein kinase beta 1	Adenosine monophosphate(DB00131)|Metformin(DB00331)						144.0	127.0	133.0					12																	120112187		2203	4300	6503	SO:0001587	stop_gained	5564				cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol		g.chr12:120112187C>T	BC001823	CCDS9191.1	12q24.1-q24.3	2008-05-14			ENSG00000111725	ENSG00000111725			9378	protein-coding gene	gene with protein product	"""AMPK beta 1"""	602740				8557660	Standard	NM_006253		Approved		uc001txg.3	Q9Y478	OTTHUMG00000168954	ENST00000229328.5:c.460C>T	12.37:g.120112187C>T	ENSP00000229328:p.Gln154*		Somatic				PRKAB1_uc001txg.2_Nonsense_Mutation_p.Q154*	p.Q154*	NM_006253	NP_006244	WXS	Illumina HiSeq	Unspecified	Q9Y478	AAKB1_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.166)	5	563	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		154					Q9UBV0|Q9UE20|Q9UEX2|Q9Y6V8	Nonsense_Mutation	SNP	ENST00000229328.5	37	c.460C>T	CCDS9191.1	.	.	.	.	.	.	.	.	.	.	C	42	9.555840	0.99204	.	.	ENSG00000111725	ENST00000229328;ENST00000541640;ENST00000539596	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-2.4406	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	154;154;117	.	ENSP00000229328:Q154X	Q	+	1	0	PRKAB1	118596570	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CAA		0.413	PRKAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401731.2	NM_006253		7	92	0	0	0	0.008291	0	7	92				
DNAH10	196385	broad.mit.edu	37	12	124297768	124297768	+	Nonsense_Mutation	SNP	G	G	T	rs561113993	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:124297768G>T	ENST00000409039.3	+	19	2873	c.2848G>T	c.(2848-2850)Gaa>Taa	p.E950*		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	950	Poly-Glu.|Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E950*(1)|p.E768*(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GAAGGGGGAGGAAGAGGAAGT	0.393																																							uc001uft.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(2848-2850)GAA>TAA		dynein, axonemal, heavy chain 10							62.0	64.0	63.0					12																	124297768		2203	4300	6503	SO:0001587	stop_gained	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124297768G>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.2848G>T	12.37:g.124297768G>T	ENSP00000386770:p.Glu950*		Somatic				DNAH10_uc010tav.1_Nonsense_Mutation_p.E492*|DNAH10_uc010taw.1_Nonsense_Mutation_p.E435*	p.E950*	NM_207437	NP_997320	WXS	Illumina HiSeq	Unspecified	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	19	2873	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		950			Stem (By similarity).|Poly-Glu.		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Nonsense_Mutation	SNP	ENST00000409039.3	37	c.2848G>T	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	40	8.211611	0.98706	.	.	ENSG00000197653	ENST00000409039	.	.	.	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	20.1374	0.98035	0.0:0.0:1.0:0.0	.	.	.	.	X	950	.	ENSP00000386770:E950X	E	+	1	0	DNAH10	122863721	1.000000	0.71417	0.995000	0.50966	0.764000	0.43329	9.869000	0.99810	2.763000	0.94921	0.563000	0.77884	GAA		0.393	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			49	85	1	0	7.34454e-26	0.00361	1.0304e-25	49	85				
TMEM132D	121256	broad.mit.edu	37	12	130185209	130185209	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:130185209C>A	ENST00000422113.2	-	2	440	c.114G>T	c.(112-114)caG>caT	p.Q38H	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	38					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.Q38H(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGGAAAACCTCTGGATGCTCT	0.542																																							uc009zyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(112-114)CAG>CAT		transmembrane protein 132D precursor							116.0	79.0	91.0					12																	130185209		2203	4300	6503	SO:0001583	missense	121256					integral to membrane		g.chr12:130185209C>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.114G>T	12.37:g.130185209C>A	ENSP00000408581:p.Gln38His		Somatic					p.Q38H	NM_133448	NP_597705	WXS	Illumina HiSeq	Unspecified	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	2	442	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	38			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	c.114G>T	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.183577	0.57800	.	.	ENSG00000151952	ENST00000422113	T	0.13657	2.57	5.33	4.45	0.53987	.	0.000000	0.56097	D	0.000025	T	0.37839	0.1018	M	0.78049	2.395	0.40209	D	0.977609	D	0.89917	1.0	D	0.91635	0.999	T	0.27938	-1.0059	9	.	.	.	-32.0498	13.9088	0.63853	0.0:0.9268:0.0:0.0732	.	38	Q14C87	T132D_HUMAN	H	38	ENSP00000408581:Q38H	.	Q	-	3	2	TMEM132D	128751162	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	5.587000	0.67510	1.236000	0.43740	0.555000	0.69702	CAG		0.542	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		36	26	1	0	3.4597e-24	0.00361	4.81827e-24	36	26				
PIWIL1	9271	broad.mit.edu	37	12	130839524	130839524	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:130839524G>T	ENST00000245255.3	+	11	1535	c.1263G>T	c.(1261-1263)gtG>gtT	p.V421V		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	421					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)	p.V421V(2)		breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		AGCGTGAAGTGGGACGACTCA	0.378																																							uc001uik.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(1261-1263)GTG>GTT		piwi-like 1							201.0	189.0	193.0					12																	130839524		2203	4300	6503	SO:0001819	synonymous_variant	9271				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding	g.chr12:130839524G>T	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1263G>T	12.37:g.130839524G>T			Somatic				PIWIL1_uc001uij.1_Silent_p.V421V	p.V421V	NM_004764	NP_004755	WXS	Illumina HiSeq	Unspecified	Q96J94	PIWL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)	11	1353	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		421					A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	ENST00000245255.3	37	c.1263G>T	CCDS9268.1																																																																																				0.378	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1			156	275	1	0	9.2415e-74	0.00361	1.61868e-73	156	275				
SACS	26278	broad.mit.edu	37	13	23909782	23909782	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr13:23909782C>A	ENST00000382292.3	-	9	8506	c.8233G>T	c.(8233-8235)Gaa>Taa	p.E2745*	SACS_ENST00000382298.3_Nonsense_Mutation_p.E2745*|SACS_ENST00000402364.1_Nonsense_Mutation_p.E1995*			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2745					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.E2598*(1)|p.E2745*(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GAAATTTTTTCCATGTGATTA	0.383																																							uc001uon.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(8233-8235)GAA>TAA		sacsin							57.0	57.0	57.0					13																	23909782		2203	4298	6501	SO:0001587	stop_gained	26278				cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding	g.chr13:23909782C>A	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.8233G>T	13.37:g.23909782C>A	ENSP00000371729:p.Glu2745*		Somatic				SACS_uc001uoo.2_Nonsense_Mutation_p.E2598*|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	p.E2745*	NM_014363	NP_055178	WXS	Illumina HiSeq	Unspecified	Q9NZJ4	SACS_HUMAN		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)	10	8822	-		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	2745					O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Nonsense_Mutation	SNP	ENST00000382292.3	37	c.8233G>T	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	57	29.145667	0.99975	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	19.224	0.93810	0.0:1.0:0.0:0.0	.	.	.	.	X	2745;1995;2745	.	ENSP00000371729:E2745X	E	-	1	0	SACS	22807782	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.445000	0.80570	2.619000	0.88677	0.462000	0.41574	GAA		0.383	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		26	44	1	0	8.24728e-16	0.004656	1.04186e-15	26	44				
ATP12A	479	broad.mit.edu	37	13	25264583	25264583	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr13:25264583C>T	ENST00000381946.3	+	6	821	c.654C>T	c.(652-654)atC>atT	p.I218I	ATP12A_ENST00000218548.6_Silent_p.I218I			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	218					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)	p.I218I(1)		breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		CTGCAGACATCAGGGTGCTGT	0.572																																					Pancreas(156;1582 1935 18898 22665 26498)	Pancreas(156;1582 1935 18898 22665 26498)	uc001upp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6						c.(652-654)ATC>ATT		hydrogen/potassium-exchanging ATPase 12A	Esomeprazole(DB00736)|Pantoprazole(DB00213)						90.0	85.0	87.0					13																	25264583		2203	4300	6503	SO:0001819	synonymous_variant	479				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding	g.chr13:25264583C>T	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.654C>T	13.37:g.25264583C>T			Somatic				ATP12A_uc010aaa.2_Silent_p.I218I	p.I218I	NM_001676	NP_001667	WXS	Illumina HiSeq	Unspecified	P54707	AT12A_HUMAN		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	6	841	+		Lung SC(185;0.0225)|Breast(139;0.077)	218			Cytoplasmic (Potential).		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	ENST00000381946.3	37	c.654C>T	CCDS31948.1																																																																																				0.572	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676		15	132	0	0	0	0.003954	0	15	132				
AKAP11	11215	broad.mit.edu	37	13	42891710	42891710	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr13:42891710G>A	ENST00000025301.2	+	12	5626	c.5451G>A	c.(5449-5451)atG>atA	p.M1817I		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1817					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)	p.M1817I(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		ATATTGACATGGAGCCATGCA	0.373																																							uc001uys.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(5449-5451)ATG>ATA		A-kinase anchor protein 11							131.0	119.0	123.0					13																	42891710		2203	4300	6503	SO:0001583	missense	11215				intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding	g.chr13:42891710G>A	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5451G>A	13.37:g.42891710G>A	ENSP00000025301:p.Met1817Ile		Somatic					p.M1817I	NM_016248	NP_057332	WXS	Illumina HiSeq	Unspecified	Q9UKA4	AKA11_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)	12	5626	+		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)	1817					O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	c.5451G>A	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903584	0.52333	.	.	ENSG00000023516	ENST00000025301	T	0.13657	2.57	5.79	5.79	0.91817	.	0.246178	0.40144	N	0.001161	T	0.17874	0.0429	M	0.62723	1.935	0.32422	N	0.549204	B	0.25904	0.137	B	0.24269	0.052	T	0.06499	-1.0823	10	0.56958	D	0.05	.	14.2295	0.65882	0.0711:0.0:0.9289:0.0	.	1817	Q9UKA4	AKA11_HUMAN	I	1817	ENSP00000025301:M1817I	ENSP00000025301:M1817I	M	+	3	0	AKAP11	41789710	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.899000	0.48679	2.725000	0.93324	0.557000	0.71058	ATG		0.373	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248		8	155	0	0	0	0.006214	0	8	155				
DACH1	1602	broad.mit.edu	37	13	72255996	72255996	+	Missense_Mutation	SNP	G	G	C	rs369421581		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr13:72255996G>C	ENST00000359684.2	-	2	900	c.901C>G	c.(901-903)Cca>Gca	p.P301A	DACH1_ENST00000354591.4_Missense_Mutation_p.P301A|DACH1_ENST00000305425.4_Missense_Mutation_p.P301A|DACH1_ENST00000313174.7_Missense_Mutation_p.P301A			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	301	Interaction with SIX6 and HDAC3. {ECO:0000250}.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)	p.P301A(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		GAGTTCTCTGGGGAGGTGACA	0.418																																							uc010thn.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(895-897)CCA>GCA		dachshund homolog 1 isoform a		G	ALA/PRO,ALA/PRO,ALA/PRO	0,3814		0,0,1907	110.0	107.0	108.0		901,901,901	5.5	1.0	13		108	1,8275		0,1,4137	no	missense,missense,missense	DACH1	NM_004392.5,NM_080759.4,NM_080760.4	27,27,27	0,1,6044	CC,CG,GG		0.0121,0.0,0.0083	benign,benign,benign	301/507,301/709,301/561	72255996	1,12089	1907	4138	6045	SO:0001583	missense	1602				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding	g.chr13:72255996G>C	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.901C>G	13.37:g.72255996G>C	ENSP00000352712:p.Pro301Ala		Somatic				DACH1_uc010tho.1_Missense_Mutation_p.P299A|DACH1_uc010thp.1_Missense_Mutation_p.P299A	p.P299A	NM_080759	NP_542937	WXS	Illumina HiSeq	Unspecified	Q9UI36	DACH1_HUMAN		GBM - Glioblastoma multiforme(99;0.00032)	3	1318	-		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)	299			Interaction with SIX6 and HDAC3 (By similarity).		D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37	c.895C>G		.	.	.	.	.	.	.	.	.	.	G	12.77	2.037729	0.35989	0.0	1.21E-4	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.31247	1.52;1.51;1.5;1.52	5.49	5.49	0.81192	.	0.048392	0.85682	D	0.000000	T	0.43010	0.1228	L	0.44542	1.39	0.58432	D	0.999998	D;D;B	0.59767	0.986;0.986;0.225	P;P;B	0.56163	0.793;0.73;0.078	T	0.03587	-1.1022	10	0.25751	T	0.34	-9.1547	19.7401	0.96223	0.0:0.0:1.0:0.0	.	299;299;299	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	A	301	ENSP00000304994:P301A;ENSP00000318506:P301A;ENSP00000346604:P301A;ENSP00000352712:P301A	ENSP00000304994:P301A	P	-	1	0	DACH1	71153997	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.504000	0.81646	2.741000	0.93983	0.557000	0.71058	CCA		0.418	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392		57	41	0	0	0	0.00361	0	57	41				
ITGBL1	9358	broad.mit.edu	37	13	102367973	102367973	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr13:102367973G>T	ENST00000376180.3	+	11	1673	c.1454G>T	c.(1453-1455)tGt>tTt	p.C485F	ITGBL1_ENST00000376162.3_Missense_Mutation_p.C392F|RP11-397O8.7_ENST00000606869.1_lincRNA|ITGBL1_ENST00000545560.2_Missense_Mutation_p.C344F	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	485	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)		p.C485F(1)		breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGAAATGCATGTGAAATCTGG	0.373																																							uc001vpb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1453-1455)TGT>TTT		integrin, beta-like 1 (with EGF-like repeat							258.0	248.0	251.0					13																	102367973		2203	4300	6503	SO:0001583	missense	9358				cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity	g.chr13:102367973G>T	AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.1454G>T	13.37:g.102367973G>T	ENSP00000365351:p.Cys485Phe		Somatic				ITGBL1_uc010agb.2_Missense_Mutation_p.C436F|ITGBL1_uc001vpc.3_Missense_Mutation_p.C344F	p.C485F	NM_004791	NP_004782	WXS	Illumina HiSeq	Unspecified	O95965	ITGBL_HUMAN			11	1673	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		485			X.|Cysteine-rich tandem repeats.		A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Missense_Mutation	SNP	ENST00000376180.3	37	c.1454G>T	CCDS9499.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490713	0.84962	.	.	ENSG00000198542	ENST00000376180;ENST00000537118;ENST00000539955;ENST00000545560;ENST00000376162	D;D;D	0.96554	-4.05;-4.05;-4.05	5.83	5.83	0.93111	EGF, extracellular (1);	0.043943	0.85682	D	0.000000	D	0.98937	0.9639	H	0.96633	3.855	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.994;0.997	D	0.99177	1.0866	10	0.87932	D	0	.	20.1219	0.97964	0.0:0.0:1.0:0.0	.	344;485	B3KTP1;O95965	.;ITGBL_HUMAN	F	485;393;344;344;392	ENSP00000365351:C485F;ENSP00000439903:C344F;ENSP00000365332:C392F	ENSP00000365332:C392F	C	+	2	0	ITGBL1	101165974	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.224000	0.95209	2.758000	0.94735	0.650000	0.86243	TGT		0.373	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791		180	141	1	0	3.54448e-97	0.00361	6.32468e-97	180	141				
OR4E2	26686	broad.mit.edu	37	14	22133768	22133768	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:22133768G>T	ENST00000408935.1	+	1	472	c.472G>T	c.(472-474)Ggg>Tgg	p.G158W		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G158W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		TCACTCACTAGGGCAGACCTT	0.488																																							uc010tmd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(472-474)GGG>TGG		olfactory receptor, family 4, subfamily E,							165.0	158.0	161.0					14																	22133768		1991	4195	6186	SO:0001583	missense	26686				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22133768G>T		CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.472G>T	14.37:g.22133768G>T	ENSP00000386195:p.Gly158Trp		Somatic					p.G158W	NM_001001912	NP_001001912	WXS	Illumina HiSeq	Unspecified	Q8NGC2	OR4E2_HUMAN		GBM - Glioblastoma multiforme(265;0.0137)	1	472	+	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	158			Helical; Name=4; (Potential).		Q6IET6|Q96R62	Missense_Mutation	SNP	ENST00000408935.1	37	c.472G>T	CCDS41916.1	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739905	0.69304	.	.	ENSG00000221977	ENST00000408935	T	0.37235	1.21	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.230675	0.21428	U	0.074707	T	0.45196	0.1330	L	0.28014	0.82	0.30097	N	0.807797	D	0.56521	0.976	P	0.60473	0.875	T	0.45160	-0.9280	10	0.87932	D	0	.	15.501	0.75698	0.0:0.0:1.0:0.0	.	158	Q8NGC2	OR4E2_HUMAN	W	158	ENSP00000386195:G158W	ENSP00000386195:G158W	G	+	1	0	OR4E2	21203608	0.002000	0.14202	0.988000	0.46212	0.891000	0.51852	1.232000	0.32636	2.730000	0.93505	0.585000	0.79938	GGG		0.488	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401874.1			204	210	1	0	5.12032e-141	0.00361	9.40097e-141	204	210				
CMA1	1215	broad.mit.edu	37	14	24974789	24974789	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:24974789G>T	ENST00000250378.3	-	5	706	c.677C>A	c.(676-678)cCc>cAc	p.P226H	CMA1_ENST00000206446.4_Missense_Mutation_p.P115H|RP11-80A15.1_ENST00000555109.1_Intron	NM_001836.3	NP_001827.1	P23946	CMA1_HUMAN	chymase 1, mast cell	226	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|cellular response to glucose stimulus (GO:0071333)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|interleukin-1 beta biosynthetic process (GO:0050720)|midbrain development (GO:0030901)|peptide metabolic process (GO:0006518)|positive regulation of angiogenesis (GO:0045766)|regulation of inflammatory response (GO:0050727)	extracellular region (GO:0005576)|intracellular (GO:0005622)	peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.P226H(1)		kidney(1)|lung(8)|pancreas(1)|prostate(1)	11				GBM - Glioblastoma multiforme(265;0.0271)		GACAGCAGGGGGCTTTGCATC	0.587																																							uc001wpp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(676-678)CCC>CAC		chymase 1, mast cell preproprotein							86.0	82.0	84.0					14																	24974789		2203	4300	6503	SO:0001583	missense	1215				interleukin-1 beta biosynthetic process|proteolysis	extracellular region	serine-type endopeptidase activity	g.chr14:24974789G>T		CCDS9630.1	14q12	2012-08-30			ENSG00000092009	ENSG00000092009	3.4.21.39		2097	protein-coding gene	gene with protein product		118938				8468056	Standard	NM_001836		Approved		uc001wpp.1	P23946	OTTHUMG00000140181	ENST00000250378.3:c.677C>A	14.37:g.24974789G>T	ENSP00000250378:p.Pro226His		Somatic				CMA1_uc010alx.1_Missense_Mutation_p.P115H	p.P226H	NM_001836	NP_001827	WXS	Illumina HiSeq	Unspecified	P23946	CMA1_HUMAN		GBM - Glioblastoma multiforme(265;0.0271)	5	707	-			226			Peptidase S1.		B5BUM8|Q16018|Q3SY36|Q3SY37|Q9UDH5	Missense_Mutation	SNP	ENST00000250378.3	37	c.677C>A	CCDS9630.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977423	0.53720	.	.	ENSG00000092009	ENST00000250378;ENST00000206446	D;D	0.89343	-2.5;-2.5	5.39	4.5	0.54988	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.53938	D	0.000042	D	0.86785	0.6016	N	0.05574	-0.02	0.36105	D	0.844383	D	0.89917	1.0	D	0.97110	1.0	D	0.89232	0.3578	10	0.51188	T	0.08	.	10.0038	0.41944	0.0907:0.0:0.9093:0.0	.	226	P23946	CMA1_HUMAN	H	226;115	ENSP00000250378:P226H;ENSP00000206446:P115H	ENSP00000206446:P115H	P	-	2	0	CMA1	24044629	0.870000	0.30015	0.914000	0.36105	0.510000	0.34073	1.509000	0.35780	1.513000	0.48852	0.561000	0.74099	CCC		0.587	CMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276535.2			56	47	1	0	1.41257e-51	0.00361	2.3379e-51	56	47				
ARHGAP5	394	broad.mit.edu	37	14	32562466	32562466	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:32562466G>T	ENST00000345122.3	+	2	2906	c.2591G>T	c.(2590-2592)gGa>gTa	p.G864V	ARHGAP5_ENST00000556611.1_Missense_Mutation_p.G864V|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.G864V|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.G864V|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000433497.1_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	864					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.G864V(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GCTTCGATGGGAATGCTTCGA	0.383																																					NSCLC(9;77 350 3443 29227 41353)	NSCLC(9;77 350 3443 29227 41353)	uc001wrl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(2590-2592)GGA>GTA		Rho GTPase activating protein 5 isoform b							38.0	38.0	38.0					14																	32562466		2203	4297	6500	SO:0001583	missense	394				cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding	g.chr14:32562466G>T	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.2591G>T	14.37:g.32562466G>T	ENSP00000371897:p.Gly864Val		Somatic				ARHGAP5_uc001wrm.2_Missense_Mutation_p.G864V|ARHGAP5_uc001wrn.2_Missense_Mutation_p.G864V|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	p.G864V	NM_001173	NP_001025226	WXS	Illumina HiSeq	Unspecified	Q13017	RHG05_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)	2	2830	+	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		864					A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	c.2591G>T	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499729	0.44455	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	5.76	5.76	0.90799	.	0.047074	0.85682	D	0.000000	T	0.36744	0.0978	N	0.14661	0.345	0.80722	D	1	P;B	0.37061	0.58;0.444	B;B	0.42030	0.373;0.206	T	0.21008	-1.0258	10	0.49607	T	0.09	.	20.3239	0.98686	0.0:0.0:1.0:0.0	.	864;864	Q13017-2;Q13017	.;RHG05_HUMAN	V	864	ENSP00000452222:G864V;ENSP00000441692:G864V;ENSP00000371897:G864V;ENSP00000393307:G864V	ENSP00000371897:G864V	G	+	2	0	ARHGAP5	31632217	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.898000	0.75676	2.881000	0.98747	0.650000	0.86243	GGA		0.383	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055		15	109	1	0	3.51602e-12	0.008871	4.27159e-12	15	109				
KIAA0391	9692	broad.mit.edu	37	14	35596743	35596743	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:35596743T>A	ENST00000557565.1	+	4	1474	c.1093T>A	c.(1093-1095)Tat>Aat	p.Y365N	KIAA0391_ENST00000603544.1_Missense_Mutation_p.Y349N|KIAA0391_ENST00000605870.1_De_novo_Start_OutOfFrame|KIAA0391_ENST00000321130.10_Missense_Mutation_p.Y349N|KIAA0391_ENST00000250377.7_Missense_Mutation_p.Y270N|KIAA0391_ENST00000534898.4_Missense_Mutation_p.Y365N|KIAA0391_ENST00000604948.1_Missense_Mutation_p.Y270N|KIAA0391_ENST00000603588.1_3'UTR	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	365					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)		p.Y365N(1)		central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TCCAGAAGAATATGAATGTCT	0.363																																							uc001wsy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1093-1095)TAT>AAT		mitochondrial RNase P protein 3 precursor							80.0	79.0	79.0					14																	35596743		2203	4300	6503	SO:0001583	missense	9692				tRNA processing	mitochondrion		g.chr14:35596743T>A	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.1093T>A	14.37:g.35596743T>A	ENSP00000454657:p.Tyr365Asn		Somatic				KIAA0391_uc010tps.1_Missense_Mutation_p.Y270N|KIAA0391_uc001wsz.1_Missense_Mutation_p.Y349N|KIAA0391_uc001wta.2_RNA|KIAA0391_uc001wtb.1_Missense_Mutation_p.Y349N|KIAA0391_uc001wtc.1_5'UTR	p.Y365N	NM_014672	NP_055487	WXS	Illumina HiSeq	Unspecified	O15091	MRRP3_HUMAN	Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)	4	1453	+	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		365					B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Missense_Mutation	SNP	ENST00000557565.1	37	c.1093T>A	CCDS32063.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.428089	0.83667	.	.	ENSG00000100890	ENST00000554896;ENST00000250377;ENST00000321130;ENST00000534898;ENST00000556121	T;T;T	0.46819	0.92;0.86;0.87	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.69424	0.3109	M	0.77616	2.38	0.52099	D	0.999946	D;D	0.89917	0.999;1.0	D;D	0.83275	0.995;0.996	T	0.70702	-0.4799	10	0.42905	T	0.14	-12.0403	15.8257	0.78706	0.0:0.0:0.0:1.0	.	349;365	O15091-2;O15091	.;MRRP3_HUMAN	N	270;270;349;365;349	ENSP00000250377:Y270N;ENSP00000324697:Y349N;ENSP00000440915:Y365N	ENSP00000250377:Y270N	Y	+	1	0	KIAA0391	34666494	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	6.151000	0.71806	2.129000	0.65627	0.528000	0.53228	TAT		0.363	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000411280.1	NM_014672		41	187	0	0	0	0.002852	0	41	187				
FAM179B	23116	broad.mit.edu	37	14	45513851	45513851	+	Missense_Mutation	SNP	G	G	T	rs201399500		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:45513851G>T	ENST00000361577.3	+	13	4146	c.3932G>T	c.(3931-3933)cGt>cTt	p.R1311L	FAM179B_ENST00000361462.2_Missense_Mutation_p.R1311L|FAM179B_ENST00000382233.2_3'UTR|KLHL28_ENST00000553817.1_5'Flank	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1311								p.R1311L(1)		endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						AAAAATTTACGTTCTGGAGTT	0.308																																							uc001wvv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|upper_aerodigestive_tract(1)	3						c.(3931-3933)CGT>CTT		hypothetical protein LOC23116							64.0	64.0	64.0					14																	45513851		2202	4300	6502	SO:0001583	missense	23116						binding	g.chr14:45513851G>T	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.3932G>T	14.37:g.45513851G>T	ENSP00000355045:p.Arg1311Leu		Somatic				FAM179B_uc001wvw.2_Missense_Mutation_p.R1311L|FAM179B_uc010anc.2_RNA	p.R1311L	NM_015091	NP_055906	WXS	Illumina HiSeq	Unspecified	Q9Y4F4	F179B_HUMAN			13	4141	+			1311					Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	c.3932G>T	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026033	0.93518	.	.	ENSG00000198718	ENST00000361577;ENST00000361462	T;T	0.65178	-0.14;0.39	5.78	5.78	0.91487	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83041	0.5168	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85189	0.1008	10	0.87932	D	0	-7.5513	19.6126	0.95616	0.0:0.0:1.0:0.0	.	1311;1311	G3XAE9;Q9Y4F4	.;F179B_HUMAN	L	1311	ENSP00000355045:R1311L;ENSP00000354917:R1311L	ENSP00000354917:R1311L	R	+	2	0	FAM179B	44583601	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.540000	0.98080	2.730000	0.93505	0.650000	0.86243	CGT		0.308	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781		15	26	1	0	3.41278e-10	0.00499	3.99324e-10	15	26				
BMP4	652	broad.mit.edu	37	14	54417449	54417449	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:54417449G>A	ENST00000245451.4	-	4	921	c.528C>T	c.(526-528)caC>caT	p.H176H	MIR5580_ENST00000580850.1_RNA|BMP4_ENST00000558984.1_Silent_p.H176H|BMP4_ENST00000417573.1_Silent_p.H176H|BMP4_ENST00000559087.1_Silent_p.H176H	NM_001202.3	NP_001193.2	P12644	BMP4_HUMAN	bone morphogenetic protein 4	176					activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification (GO:0009948)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|BMP signaling pathway involved in nephric duct formation (GO:0071893)|BMP signaling pathway involved in renal system segmentation (GO:0061151)|BMP signaling pathway involved in ureter morphogenesis (GO:0061149)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchus development (GO:0060433)|bud dilation involved in lung branching (GO:0060503)|bud elongation involved in lung branching (GO:0060449)|cardiac septum development (GO:0003279)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte differentiation (GO:0002062)|cloacal septation (GO:0060197)|common-partner SMAD protein phosphorylation (GO:0007182)|cranial suture morphogenesis (GO:0060363)|deltoid tuberosity development (GO:0035993)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint morphogenesis (GO:0060272)|endocardial cushion development (GO:0003197)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in lung morphogenesis (GO:0060502)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal cell signaling (GO:0060684)|erythrocyte differentiation (GO:0030218)|extracellular matrix organization (GO:0030198)|germ cell development (GO:0007281)|glomerular capillary formation (GO:0072104)|glomerular visceral epithelial cell development (GO:0072015)|hematopoietic progenitor cell differentiation (GO:0002244)|inner ear receptor cell differentiation (GO:0060113)|intermediate mesodermal cell differentiation (GO:0048392)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|mammary gland formation (GO:0060592)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal cell proliferation involved in ureter development (GO:0072198)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate determination (GO:0007500)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway (GO:0072097)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in heart morphogenesis (GO:2000137)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of glomerulus development (GO:0090194)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell proliferation involved in ureter development (GO:0072200)|negative regulation of metanephric comma-shaped body morphogenesis (GO:2000007)|negative regulation of metanephric S-shaped body morphogenesis (GO:2000005)|negative regulation of mitosis (GO:0045839)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of cardiac muscle fiber development (GO:0055020)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell death (GO:0010942)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of kidney development (GO:0090184)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|pulmonary artery endothelial tube morphogenesis (GO:0061155)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|renal system process (GO:0003014)|secondary heart field specification (GO:0003139)|SMAD protein signal transduction (GO:0060395)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|specification of organ position (GO:0010159)|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway (GO:0072101)|steroid hormone mediated signaling pathway (GO:0043401)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|tendon cell differentiation (GO:0035990)|trachea development (GO:0060438)|trachea formation (GO:0060440)|type B pancreatic cell development (GO:0003323)|ureter epithelial cell differentiation (GO:0072192)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	BMP receptor binding (GO:0070700)|chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|heparin binding (GO:0008201)	p.H176H(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(3)|urinary_tract(1)	19						TGTTTATACGGTGGAAGCCCC	0.562																																							uc001xal.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(526-528)CAC>CAT		bone morphogenetic protein 4 preproprotein							40.0	40.0	40.0					14																	54417449		2203	4300	6503	SO:0001819	synonymous_variant	652				activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity	g.chr14:54417449G>A	AF035427	CCDS9715.1	14q22-q23	2014-01-30			ENSG00000125378	ENSG00000125378		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1071	protein-coding gene	gene with protein product		112262		BMP2B		7558046, 7579580	Standard	NM_001202		Approved		uc010aoh.3	P12644	OTTHUMG00000140303	ENST00000245451.4:c.528C>T	14.37:g.54417449G>A			Somatic				BMP4_uc010aoh.2_Silent_p.H176H|BMP4_uc001xao.3_Silent_p.H176H|BMP4_uc001xan.3_Silent_p.H176H	p.H176H	NM_130851	NP_570912	WXS	Illumina HiSeq	Unspecified	P12644	BMP4_HUMAN			3	715	-			176					Q9UM80	Silent	SNP	ENST00000245451.4	37	c.528C>T	CCDS9715.1																																																																																				0.562	BMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276894.2	NM_001202		5	25	0	0	0	0.001168	0	5	25				
KTN1	3895	broad.mit.edu	37	14	56122831	56122831	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:56122831G>C	ENST00000395314.3	+	29	2941	c.2873G>C	c.(2872-2874)aGc>aCc	p.S958T	KTN1_ENST00000395311.1_Missense_Mutation_p.S935T|KTN1_ENST00000416613.1_Missense_Mutation_p.S958T|KTN1_ENST00000395308.1_Missense_Mutation_p.S935T|KTN1_ENST00000554507.1_Missense_Mutation_p.S253T|KTN1_ENST00000438792.2_Missense_Mutation_p.S958T|KTN1_ENST00000395309.3_Missense_Mutation_p.S958T|KTN1_ENST00000413890.2_Missense_Mutation_p.S935T	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	958					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.S958T(1)		breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						GATCTTTCTAGCAAAACACAG	0.303			T	RET	papillary thryoid																																		uc001xcb.2		NA		Dom	yes		14	14q22.1	3895	T	kinectin 1 (kinesin receptor)			E	RET		papillary thryoid		1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7						c.(2872-2874)AGC>ACC		kinectin 1 isoform a							69.0	71.0	70.0					14																	56122831		2203	4300	6503	SO:0001583	missense	3895				microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction		g.chr14:56122831G>C		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.2873G>C	14.37:g.56122831G>C	ENSP00000378725:p.Ser958Thr		Somatic				KTN1_uc001xce.2_Missense_Mutation_p.S958T|KTN1_uc001xcc.2_Missense_Mutation_p.S958T|KTN1_uc001xcd.2_Missense_Mutation_p.S935T|KTN1_uc010trb.1_Missense_Mutation_p.S958T|KTN1_uc001xcf.1_Missense_Mutation_p.S935T|KTN1_uc010aoq.2_Missense_Mutation_p.S253T	p.S958T	NM_182926	NP_891556	WXS	Illumina HiSeq	Unspecified	Q86UP2	KTN1_HUMAN			30	3175	+			958			Lumenal (Potential).|Potential.		B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	c.2873G>C	CCDS41957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.47|11.47	1.648659|1.648659	0.29336|0.29336	.|.	.|.	ENSG00000126777|ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613;ENST00000554507|ENST00000554570	T;T;T;T;T;T;T;T|.	0.33654|.	1.49;1.49;1.4;1.49;1.49;1.49;1.49;1.4|.	5.51|5.51	-2.44|-2.44	0.06502|0.06502	.|.	0.701129|.	0.13687|.	N|.	0.369800|.	T|.	0.25680|.	0.0625|.	L|L	0.40543|0.40543	1.245|1.245	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.32829|.	0.132;0.132;0.386;0.132;0.119|.	B;B;B;B;B|.	0.35727|.	0.108;0.209;0.108;0.096;0.108|.	T|.	0.32322|.	-0.9911|.	10|.	0.33940|.	T|.	0.23|.	4.7456|4.7456	3.0384|3.0384	0.06130|0.06130	0.4684:0.111:0.3081:0.1125|0.4684:0.111:0.3081:0.1125	.|.	958;253;958;935;958|.	B4DZ88;G3V4Y7;Q86UP2-2;Q17RZ5;Q86UP2|.	.;.;.;.;KTN1_HUMAN|.	T|Y	935;958;958;958;935;935;958;253|4	ENSP00000394992:S935T;ENSP00000378720:S958T;ENSP00000391964:S958T;ENSP00000378725:S958T;ENSP00000378719:S935T;ENSP00000378722:S935T;ENSP00000388807:S958T;ENSP00000452073:S253T|.	ENSP00000378719:S935T|.	S|X	+|+	2|3	0|2	KTN1|KTN1	55192584|55192584	0.726000|0.726000	0.28059|0.28059	0.042000|0.042000	0.18584|0.18584	0.997000|0.997000	0.91878|0.91878	0.274000|0.274000	0.18680|0.18680	-0.120000|-0.120000	0.11809|0.11809	0.650000|0.650000	0.86243|0.86243	AGC|TAG		0.303	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2			14	45	0	0	0	0.004007	0	14	45				
PLEKHH1	57475	broad.mit.edu	37	14	68029127	68029127	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:68029127G>T	ENST00000329153.5	+	7	911	c.779G>T	c.(778-780)gGa>gTa	p.G260V		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	260						cytoskeleton (GO:0005856)		p.G299V(1)|p.G260V(1)		endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CCTCATCTGGGAAGAGAGAGC	0.542																																							uc001xjl.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(778-780)GGA>GTA		pleckstrin homology domain containing, family H							73.0	90.0	85.0					14																	68029127		1940	4127	6067	SO:0001583	missense	57475					cytoskeleton	binding	g.chr14:68029127G>T	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.779G>T	14.37:g.68029127G>T	ENSP00000330278:p.Gly260Val		Somatic					p.G260V	NM_020715	NP_065766	WXS	Illumina HiSeq	Unspecified	Q9ULM0	PKHH1_HUMAN		all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)	7	921	+			260					A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	37	c.779G>T	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	G	2.220	-0.378552	0.05000	.	.	ENSG00000054690	ENST00000329153	T	0.71103	-0.54	4.88	0.996	0.19844	.	1.133820	0.06186	N	0.680488	T	0.59252	0.2180	L	0.36672	1.1	0.09310	N	1	B	0.14438	0.01	B	0.13407	0.009	T	0.41142	-0.9525	10	0.30854	T	0.27	.	6.899	0.24273	0.3825:0.0:0.6175:0.0	.	260	Q9ULM0	PKHH1_HUMAN	V	260	ENSP00000330278:G260V	ENSP00000330278:G260V	G	+	2	0	PLEKHH1	67098880	0.010000	0.17322	0.310000	0.25168	0.037000	0.13140	0.178000	0.16820	0.079000	0.16929	-0.678000	0.03780	GGA		0.542	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3	XM_031054		24	37	1	0	1.71298e-08	0.003755	1.95232e-08	24	37				
STON2	85439	broad.mit.edu	37	14	81837395	81837395	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:81837395C>G	ENST00000267540.2	-	3	708	c.508G>C	c.(508-510)Gat>Cat	p.D170H	STON2_ENST00000555447.1_Missense_Mutation_p.D170H	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	170					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)		p.D170H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		AGCTGCAGATCTGTATACGAA	0.532																																							uc010tvu.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|pancreas(2)	5						c.(508-510)GAT>CAT		stonin 2							107.0	95.0	99.0					14																	81837395		2203	4300	6503	SO:0001583	missense	85439				endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding	g.chr14:81837395C>G	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.508G>C	14.37:g.81837395C>G	ENSP00000267540:p.Asp170His		Somatic				STON2_uc001xvk.1_Missense_Mutation_p.D170H	p.D170H	NM_033104	NP_149095	WXS	Illumina HiSeq	Unspecified	Q8WXE9	STON2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0348)	3	709	-			170					G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	c.508G>C	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.330245	0.81690	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.57907	0.37;0.37	5.77	5.77	0.91146	Stonin-2, N-terminal (1);	0.124466	0.51477	D	0.000087	T	0.70491	0.3230	L	0.59436	1.845	0.42996	D	0.994502	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.71915	-0.4448	10	0.72032	D	0.01	-20.769	17.7714	0.88494	0.0:1.0:0.0:0.0	.	170;170	Q8WXE9;G3V2T7	STON2_HUMAN;.	H	170;182;170	ENSP00000450857:D170H;ENSP00000267540:D170H	ENSP00000267540:D170H	D	-	1	0	STON2	80907148	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.434000	0.59935	2.724000	0.93272	0.561000	0.74099	GAT		0.532	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104		58	182	0	0	0	0.00361	0	58	182				
SLC24A4	123041	broad.mit.edu	37	14	92959901	92959901	+	Missense_Mutation	SNP	T	T	A	rs369241030		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:92959901T>A	ENST00000532405.1	+	17	2024	c.1798T>A	c.(1798-1800)Tgc>Agc	p.C600S	SLC24A4_ENST00000531433.1_Missense_Mutation_p.C581S|SLC24A4_ENST00000351924.5_Missense_Mutation_p.C564S|SLC24A4_ENST00000393265.2_Missense_Mutation_p.C536S|SLC24A4_ENST00000298877.1_Missense_Mutation_p.C583S			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	600					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.C583S(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		CATCTTCTTGTGCTTCTCCAT	0.552																																					NSCLC(10;315 435 10383 28450 38798)	NSCLC(10;315 435 10383 28450 38798)	uc001yak.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)	3						c.(1747-1749)TGC>AGC		solute carrier family 24 member 4 isoform 1		T	SER/CYS,SER/CYS,SER/CYS	1,4405	2.1+/-5.4	0,1,2202	242.0	192.0	209.0		1798,1741,1606	5.4	1.0	14		209	0,8600		0,0,4300	no	missense,missense,missense	SLC24A4	NM_153646.3,NM_153647.3,NM_153648.3	112,112,112	0,1,6502	AA,AT,TT		0.0,0.0227,0.0077	benign,benign,benign	600/623,581/604,536/559	92959901	1,13005	2203	4300	6503	SO:0001583	missense	123041					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity	g.chr14:92959901T>A	AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1798T>A	14.37:g.92959901T>A	ENSP00000431840:p.Cys600Ser		Somatic				SLC24A4_uc001yai.2_Missense_Mutation_p.C536S|SLC24A4_uc010twm.1_Missense_Mutation_p.C581S|SLC24A4_uc001yaj.2_Missense_Mutation_p.C564S|SLC24A4_uc010auj.2_3'UTR|SLC24A4_uc010twn.1_Missense_Mutation_p.C356S|SLC24A4_uc001yan.2_Missense_Mutation_p.C294S	p.C583S	NM_153646	NP_705932	WXS	Illumina HiSeq	Unspecified	Q8NFF2	NCKX4_HUMAN		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)	17	1771	+		all_cancers(154;0.0347)|all_epithelial(191;0.163)	600			Helical; (Potential).		B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	ENST00000532405.1	37	c.1747T>A	CCDS9903.2	.	.	.	.	.	.	.	.	.	.	T	18.47	3.630241	0.67015	2.27E-4	0.0	ENSG00000140090	ENST00000393265;ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	5.37	5.37	0.77165	Sodium/calcium exchanger membrane region (1);	0.092891	0.85682	D	0.000000	T	0.60650	0.2285	M	0.67397	2.05	0.54753	D	0.999981	B;B	0.32338	0.365;0.09	B;B	0.28465	0.09;0.034	T	0.63042	-0.6725	10	0.49607	T	0.09	.	15.3683	0.74541	0.0:0.0:0.0:1.0	.	581;600	Q8NFF2-3;Q8NFF2	.;NCKX4_HUMAN	S	536;581;600;583;564	ENSP00000376948:C536S;ENSP00000433302:C581S;ENSP00000431840:C600S;ENSP00000298877:C583S;ENSP00000337789:C564S	ENSP00000298877:C583S	C	+	1	0	SLC24A4	92029654	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.081000	0.71309	2.033000	0.60031	0.459000	0.35465	TGC		0.552	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646		12	34	0	0	0	0.001855	0	12	34				
C14orf177	283598	broad.mit.edu	37	14	99182659	99182659	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:99182659C>T	ENST00000325812.2	+	3	550	c.131C>T	c.(130-132)tCt>tTt	p.S44F		NM_182560.2	NP_872366.2	Q52M58	CN177_HUMAN	chromosome 14 open reading frame 177	44								p.S44F(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	13		Melanoma(154;0.128)				TGCCCAAGTTCTCAGCACCTG	0.532																																							uc001yfz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(130-132)TCT>TTT		hypothetical protein LOC283598							131.0	95.0	107.0					14																	99182659		2203	4300	6503	SO:0001583	missense	283598							g.chr14:99182659C>T	AK098639	CCDS9948.1	14q32.2	2012-05-30			ENSG00000176605	ENSG00000176605			26375	protein-coding gene	gene with protein product						12477932	Standard	NM_182560		Approved	FLJ25773	uc001yfz.2	Q52M58	OTTHUMG00000167745	ENST00000325812.2:c.131C>T	14.37:g.99182659C>T	ENSP00000321360:p.Ser44Phe		Somatic					p.S44F	NM_182560	NP_872366	WXS	Illumina HiSeq	Unspecified	Q52M58	CN177_HUMAN			3	550	+		Melanoma(154;0.128)	44					Q8N7D2	Missense_Mutation	SNP	ENST00000325812.2	37	c.131C>T	CCDS9948.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.244588	0.22796	.	.	ENSG00000176605	ENST00000325812;ENST00000541516	T;T	0.40756	1.11;1.02	3.43	-1.92	0.07618	.	.	.	.	.	T	0.25531	0.0621	N	0.08118	0	0.09310	N	1	D	0.58268	0.982	P	0.52189	0.692	T	0.11251	-1.0595	9	0.87932	D	0	.	0.6947	0.00897	0.1696:0.3527:0.1662:0.3115	.	44	Q52M58	CN177_HUMAN	F	44	ENSP00000321360:S44F;ENSP00000440687:S44F	ENSP00000321360:S44F	S	+	2	0	C14orf177	98252412	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.185000	0.16958	-0.439000	0.07222	0.650000	0.86243	TCT		0.532	C14orf177-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396078.1	NM_182560		48	81	0	0	0	0.00361	0	48	81				
C14orf177	283598	broad.mit.edu	37	14	99182700	99182700	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:99182700C>A	ENST00000325812.2	+	3	591	c.172C>A	c.(172-174)Ctg>Atg	p.L58M		NM_182560.2	NP_872366.2	Q52M58	CN177_HUMAN	chromosome 14 open reading frame 177	58								p.L58M(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	13		Melanoma(154;0.128)				GCAGCATGCCCTGACGCTCAC	0.473																																							uc001yfz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(172-174)CTG>ATG		hypothetical protein LOC283598							110.0	80.0	90.0					14																	99182700		2203	4300	6503	SO:0001583	missense	283598							g.chr14:99182700C>A	AK098639	CCDS9948.1	14q32.2	2012-05-30			ENSG00000176605	ENSG00000176605			26375	protein-coding gene	gene with protein product						12477932	Standard	NM_182560		Approved	FLJ25773	uc001yfz.2	Q52M58	OTTHUMG00000167745	ENST00000325812.2:c.172C>A	14.37:g.99182700C>A	ENSP00000321360:p.Leu58Met		Somatic					p.L58M	NM_182560	NP_872366	WXS	Illumina HiSeq	Unspecified	Q52M58	CN177_HUMAN			3	591	+		Melanoma(154;0.128)	58					Q8N7D2	Missense_Mutation	SNP	ENST00000325812.2	37	c.172C>A	CCDS9948.1	.	.	.	.	.	.	.	.	.	.	C	3.397	-0.123140	0.06795	.	.	ENSG00000176605	ENST00000325812;ENST00000541516	T;T	0.46451	0.97;0.87	2.89	-1.48	0.08745	.	.	.	.	.	T	0.30166	0.0756	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	P	0.59889	0.865	T	0.13764	-1.0497	9	0.87932	D	0	.	0.4318	0.00472	0.2023:0.3409:0.1986:0.2582	.	58	Q52M58	CN177_HUMAN	M	58	ENSP00000321360:L58M;ENSP00000440687:L58M	ENSP00000321360:L58M	L	+	1	2	C14orf177	98252453	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	0.076000	0.14712	-0.342000	0.08363	0.585000	0.79938	CTG		0.473	C14orf177-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396078.1	NM_182560		18	93	1	0	7.45023e-12	0.010504	8.97485e-12	18	93				
SLC12A1	6557	broad.mit.edu	37	15	48500154	48500154	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:48500154G>T	ENST00000558405.1	+	1	252	c.238G>T	c.(238-240)Gct>Tct	p.A80S	SLC12A1_ENST00000380993.3_Missense_Mutation_p.A80S|SLC12A1_ENST00000330289.6_Missense_Mutation_p.A80S|SLC12A1_ENST00000396577.3_Missense_Mutation_p.A80S|SLC12A1_ENST00000561031.1_Missense_Mutation_p.A80S			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	80					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)	p.A80S(2)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TGGAGAAACTGCTAAAACAGA	0.428																																							uc001zwn.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(238-240)GCT>TCT		sodium potassium chloride cotransporter 2	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)						111.0	108.0	109.0					15																	48500154		2198	4297	6495	SO:0001583	missense	6557				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity	g.chr15:48500154G>T		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.238G>T	15.37:g.48500154G>T	ENSP00000453409:p.Ala80Ser		Somatic				SLC12A1_uc010uew.1_Intron|SLC12A1_uc010bem.2_Missense_Mutation_p.A80S|SLC12A1_uc010uex.1_Missense_Mutation_p.A80S	p.A80S	NM_000338	NP_000329	WXS	Illumina HiSeq	Unspecified	Q13621	S12A1_HUMAN		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	2	454	+		all_lung(180;0.00219)	80			Cytoplasmic (Potential).		A8JYA2|E9PDW4	Missense_Mutation	SNP	ENST00000558405.1	37	c.238G>T	CCDS10129.2	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259248	0.23051	.	.	ENSG00000074803	ENST00000380993;ENST00000396577;ENST00000330289	D;D;D	0.91351	-1.94;-1.94;-2.83	5.05	1.99	0.26369	.	0.756159	0.13017	N	0.420355	T	0.77398	0.4124	N	0.08118	0	0.25657	N	0.98604	B;B	0.18863	0.031;0.0	B;B	0.18263	0.021;0.001	T	0.63283	-0.6672	10	0.19590	T	0.45	.	7.1052	0.25360	0.464:0.0:0.536:0.0	.	80;80	Q8IUN5;Q13621	.;S12A1_HUMAN	S	80	ENSP00000370381:A80S;ENSP00000379822:A80S;ENSP00000331550:A80S	ENSP00000331550:A80S	A	+	1	0	SLC12A1	46287446	0.292000	0.24362	0.968000	0.41197	0.999000	0.98932	0.718000	0.25866	0.655000	0.30866	0.655000	0.94253	GCT		0.428	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1			21	57	1	0	3.7963e-18	0.00333	4.93779e-18	21	57				
DMXL2	23312	broad.mit.edu	37	15	51829946	51829946	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:51829946C>A	ENST00000251076.5	-	11	1643	c.1356G>T	c.(1354-1356)ctG>ctT	p.L452L	DMXL2_ENST00000449909.3_Silent_p.L452L|DMXL2_ENST00000543779.2_Silent_p.L452L	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	452						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.L452L(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ATTCTCTATCCAGGGATAAAT	0.338																																							uc002abf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(3)	9						c.(1354-1356)CTG>CTT		Dmx-like 2							93.0	79.0	84.0					15																	51829946		2195	4293	6488	SO:0001819	synonymous_variant	23312					cell junction|synaptic vesicle membrane	Rab GTPase binding	g.chr15:51829946C>A	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.1356G>T	15.37:g.51829946C>A			Somatic				DMXL2_uc010ufy.1_Silent_p.L452L|DMXL2_uc010bfa.2_Silent_p.L452L	p.L452L	NM_015263	NP_056078	WXS	Illumina HiSeq	Unspecified	Q8TDJ6	DMXL2_HUMAN		all cancers(107;0.00494)	11	1581	-			452					B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	ENST00000251076.5	37	c.1356G>T	CCDS10141.1																																																																																				0.338	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263		47	94	1	0	3.57465e-26	0.00361	5.0274e-26	47	94				
FAM214A	56204	broad.mit.edu	37	15	52902041	52902041	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:52902041C>A	ENST00000261844.7	-	6	1222	c.1070G>T	c.(1069-1071)gGt>gTt	p.G357V	FAM214A_ENST00000546305.2_Missense_Mutation_p.G364V	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	357								p.G357V(1)									GTTAGTCTCACCAGCTGACTG	0.388																																							uc002acg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1069-1071)GGT>GTT		hypothetical protein LOC56204							53.0	49.0	50.0					15																	52902041		1824	4084	5908	SO:0001583	missense	56204							g.chr15:52902041C>A	AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.1070G>T	15.37:g.52902041C>A	ENSP00000261844:p.Gly357Val		Somatic				KIAA1370_uc002ach.3_RNA|KIAA1370_uc010bfg.1_Missense_Mutation_p.G269V|KIAA1370_uc010ugf.1_Missense_Mutation_p.G364V	p.G357V	NM_019600	NP_062546	WXS	Illumina HiSeq	Unspecified	Q32MH5	K1370_HUMAN		all cancers(107;0.0803)	6	1223	-			357					A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Missense_Mutation	SNP	ENST00000261844.7	37	c.1070G>T	CCDS45263.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.963096	0.34659	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000534964;ENST00000546305	T;T	0.44083	0.93;0.93	5.22	5.22	0.72569	.	0.332246	0.36134	N	0.002780	T	0.55097	0.1899	L	0.48642	1.525	0.80722	D	1	D;D	0.67145	0.996;0.992	D;P	0.65443	0.935;0.863	T	0.53634	-0.8411	10	0.51188	T	0.08	.	14.0455	0.64702	0.1509:0.8491:0.0:0.0	.	364;357	F5H8G0;Q32MH5	.;K1370_HUMAN	V	357;357;356;364	ENSP00000261844:G357V;ENSP00000443598:G364V	ENSP00000261844:G357V	G	-	2	0	KIAA1370	50689333	1.000000	0.71417	0.971000	0.41717	0.895000	0.52256	5.866000	0.69590	2.578000	0.87016	0.655000	0.94253	GGT		0.388	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419914.1	NM_019600		11	15	1	0	1.3612e-06	0.003163	1.51215e-06	11	15				
MAP2K1	5604	broad.mit.edu	37	15	66727455	66727455	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:66727455G>T	ENST00000307102.5	+	2	702	c.171G>T	c.(169-171)aaG>aaT	p.K57N		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	57					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)	p.K57N(3)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	TTACCCAGAAGCAGAAGGTGG	0.542																																							uc010bhq.2		NA																	3	Substitution - Missense(3)		lung(1)|prostate(1)|autonomic_ganglia(1)		0						c.(169-171)AAG>AAT		mitogen-activated protein kinase kinase 1							169.0	159.0	162.0					15																	66727455		2201	4299	6500	SO:0001583	missense	5604	Cardiofaciocutaneous_syndrome			activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr15:66727455G>T	L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.171G>T	15.37:g.66727455G>T	ENSP00000302486:p.Lys57Asn		Somatic				MAP2K1_uc010ujp.1_Missense_Mutation_p.K35N	p.K57N	NM_002755	NP_002746	WXS	Illumina HiSeq	Unspecified	Q02750	MP2K1_HUMAN			2	646	+			57						Missense_Mutation	SNP	ENST00000307102.5	37	c.171G>T	CCDS10216.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914461	0.72983	.	.	ENSG00000169032	ENST00000307102	D	0.93366	-3.21	5.06	1.72	0.24424	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.95175	0.8436	M	0.76170	2.325	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73380	0.98;0.98	D	0.93175	0.6569	10	0.44086	T	0.13	-30.8397	9.1637	0.37038	0.3678:0.0:0.6322:0.0	.	35;57	B4DFY5;Q02750	.;MP2K1_HUMAN	N	57	ENSP00000302486:K57N	ENSP00000302486:K57N	K	+	3	2	MAP2K1	64514509	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.420000	0.34804	0.539000	0.28788	0.460000	0.39030	AAG		0.542	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4			133	428	1	0	1.13329e-80	0.00361	1.99724e-80	133	428				
ITGA11	22801	broad.mit.edu	37	15	68596108	68596108	+	Splice_Site	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:68596108A>T	ENST00000315757.7	-	29	3582		c.e29+1		ITGA11_ENST00000423218.2_Splice_Site|RP11-709B3.2_ENST00000569808.1_lincRNA	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)	p.?(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						CAGGGCCCTCACCTTCCACAG	0.662																																							uc002ari.2		NA																	1	Unknown(1)		lung(1)	kidney(2)|pancreas(1)	3						c.e29+1		integrin, alpha 11 precursor	Tirofiban(DB00775)						32.0	37.0	36.0					15																	68596108		1924	4136	6060	SO:0001630	splice_region_variant	22801				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity	g.chr15:68596108A>T	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.3495+1T>A	15.37:g.68596108A>T			Somatic				ITGA11_uc010bib.2_Splice_Site_p.K1166_splice	p.K1165_splice	NM_001004439	NP_001004439	WXS	Illumina HiSeq	Unspecified	Q9UKX5	ITA11_HUMAN			29	3582	-								J3KQM2|Q8WYI8|Q9UKQ1	Splice_Site	SNP	ENST00000315757.7	37	c.3495_splice	CCDS45291.1	.	.	.	.	.	.	.	.	.	.	A	12.95	2.091822	0.36952	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491	.	.	.	5.66	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8917	0.52633	0.8538:0.1462:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGA11	66383162	1.000000	0.71417	1.000000	0.80357	0.190000	0.23558	6.131000	0.71670	0.947000	0.37659	-0.316000	0.08728	.		0.662	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_012211	Intron	16	35	0	0	0	0.010504	0	16	35				
NOX5	79400	broad.mit.edu	37	15	69335109	69335109	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:69335109G>C	ENST00000388866.3	+	10	1652	c.1611G>C	c.(1609-1611)agG>agC	p.R537S	NOX5_ENST00000530406.2_Missense_Mutation_p.R509S|NOX5_ENST00000448182.3_Missense_Mutation_p.R491S|RP11-809H16.4_ENST00000559495.1_RNA|NOX5_ENST00000260364.5_Missense_Mutation_p.R519S|NOX5_ENST00000455873.3_Missense_Mutation_p.R502S	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	537	C-terminal catalytic region.|FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)	p.R519S(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						GGCTGTCGAGGAGTGTGACAA	0.557																																							uc002ars.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|pancreas(1)	2						c.(1609-1611)AGG>AGC		NADPH oxidase, EF-hand calcium binding domain 5							154.0	129.0	138.0					15																	69335109		2200	4298	6498	SO:0001583	missense	79400				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity	g.chr15:69335109G>C	AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.1611G>C	15.37:g.69335109G>C	ENSP00000373518:p.Arg537Ser		Somatic				NOX5_uc002arp.1_Missense_Mutation_p.R519S|NOX5_uc002arq.1_Missense_Mutation_p.R491S|NOX5_uc010bid.1_Missense_Mutation_p.R502S|NOX5_uc002arr.1_Missense_Mutation_p.R509S|NOX5_uc010bie.1_Missense_Mutation_p.R337S|NOX5_uc010bif.1_RNA	p.R537S	NM_024505	NP_078781	WXS	Illumina HiSeq	Unspecified	Q96PH1	NOX5_HUMAN			10	1631	+			537			FAD-binding FR-type.|Cytoplasmic (Potential).|C-terminal catalytic region.		B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Missense_Mutation	SNP	ENST00000388866.3	37	c.1611G>C	CCDS32276.2	.	.	.	.	.	.	.	.	.	.	G	9.927	1.213863	0.22289	.	.	ENSG00000255346	ENST00000455873;ENST00000448182;ENST00000388866;ENST00000530406	D;D;D	0.94000	-2.77;-3.33;-2.77	3.52	1.32	0.21799	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.935599	0.09009	N	0.861817	D	0.87541	0.6203	L	0.45422	1.42	0.29014	N	0.886723	B;B;B	0.16396	0.008;0.017;0.005	B;B;B	0.15870	0.008;0.014;0.008	T	0.76077	-0.3091	10	0.20519	T	0.43	-16.8956	4.4183	0.11468	0.1386:0.2339:0.6275:0.0	.	502;537;509	Q96PH1-6;Q96PH1;Q96PH1-3	.;NOX5_HUMAN;.	S	502;519;537;509	ENSP00000416828:R502S;ENSP00000373518:R537S;ENSP00000432440:R509S	ENSP00000373518:R537S	R	+	3	2	NOX5	67122163	0.104000	0.21937	0.834000	0.33040	0.440000	0.31957	0.082000	0.14847	1.526000	0.49068	0.313000	0.20887	AGG		0.557	NOX5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257124.2	NM_024505		24	271	0	0	0	0.002096	0	24	271				
MYO9A	4649	broad.mit.edu	37	15	72197314	72197314	+	Nonsense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:72197314G>A	ENST00000356056.5	-	20	3191	c.2719C>T	c.(2719-2721)Caa>Taa	p.Q907*	MYO9A_ENST00000564571.1_Nonsense_Mutation_p.Q907*|MYO9A_ENST00000566885.1_Nonsense_Mutation_p.Q527*|MYO9A_ENST00000444904.1_Nonsense_Mutation_p.Q888*|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000424560.1_Nonsense_Mutation_p.Q907*	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	907	Actin-binding. {ECO:0000250}.|Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)	p.Q907*(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GGTTCTGCTTGACCAAGTGTT	0.328																																							uc002atl.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(2719-2721)CAA>TAA		myosin IXA							143.0	135.0	138.0					15																	72197314		2198	4297	6495	SO:0001587	stop_gained	4649				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity	g.chr15:72197314G>A	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.2719C>T	15.37:g.72197314G>A	ENSP00000348349:p.Gln907*		Somatic				MYO9A_uc010biq.2_Nonsense_Mutation_p.Q527*|MYO9A_uc002atn.1_Nonsense_Mutation_p.Q888*	p.Q907*	NM_006901	NP_008832	WXS	Illumina HiSeq	Unspecified	B2RTY4	MYO9A_HUMAN			20	3192	-			907			Actin-binding (By similarity).|Myosin head-like 2.		B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Nonsense_Mutation	SNP	ENST00000356056.5	37	c.2719C>T	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	G	43	9.942409	0.99300	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	18.6536	0.91440	0.0:0.0:1.0:0.0	.	.	.	.	X	907;907;888;888	.	ENSP00000261864:Q888X	Q	-	1	0	MYO9A	69984368	1.000000	0.71417	0.999000	0.59377	0.866000	0.49608	5.981000	0.70524	2.646000	0.89796	0.655000	0.94253	CAA		0.328	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901		27	607	0	0	0	0.005524	0	27	607				
LOC645752	645752	broad.mit.edu	37	15	78211427	78211427	+	lincRNA	SNP	G	G	T	rs71145882|rs78547308	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:78211427G>T	ENST00000565869.1	+	0	111				RP11-114H24.2_ENST00000567226.1_RNA|RN7SL214P_ENST00000487317.2_RNA																							TGCTCTCGGAGCATCTCCTCC	0.587													N|||	705	0.140775	0.093	0.17	5008	,	,		14880	0.1091		0.2406	False		,,,				2504	0.1145						uc010bky.2		NA																	0					0						c.(340-342)CTC>ATC		SubName: Full=GOLGA6 protein; Flags: Fragment;																																						645752							g.chr15:78211427G>T																													15.37:g.78211427G>T			Somatic					p.L114I	NR_027024		WXS	Illumina HiSeq	Unspecified					11	1104	-									Missense_Mutation	SNP	ENST00000565869.1	37	c.340C>A																																																																																					0.587	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000421587.1			14	26	1	0	3.51602e-12	0.008871	4.27159e-12	14	26				
AP3B2	8120	broad.mit.edu	37	15	83349659	83349659	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:83349659C>T	ENST00000261722.3	-	7	908	c.701G>A	c.(700-702)tGg>tAg	p.W234*	AP3B2_ENST00000535348.1_Nonsense_Mutation_p.W202*|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535359.1_Nonsense_Mutation_p.W234*	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	234					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.W234*(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CACCTGGCCCCACTCCTCCAC	0.612																																							uc010uoh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|breast(1)|pancreas(1)	5						c.(700-702)TGG>TAG		adaptor-related protein complex 3, beta 2							51.0	57.0	55.0					15																	83349659		2091	4212	6303	SO:0001587	stop_gained	8120				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity	g.chr15:83349659C>T	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.701G>A	15.37:g.83349659C>T	ENSP00000261722:p.Trp234*		Somatic				AP3B2_uc010uoi.1_Nonsense_Mutation_p.W234*|AP3B2_uc010uoj.1_Nonsense_Mutation_p.W202*|AP3B2_uc010uog.1_5'Flank	p.W234*	NM_004644	NP_004635	WXS	Illumina HiSeq	Unspecified	Q13367	AP3B2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.229)		7	878	-			234					A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Nonsense_Mutation	SNP	ENST00000261722.3	37	c.701G>A	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	C	36	5.928067	0.97110	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359;ENST00000541693	.	.	.	4.98	4.98	0.66077	.	0.126247	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.8264	18.4293	0.90619	0.0:1.0:0.0:0.0	.	.	.	.	X	234;202;234;190	.	ENSP00000261722:W234X	W	-	2	0	AP3B2	81146713	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.627000	0.83176	2.582000	0.87167	0.563000	0.77884	TGG		0.612	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1			5	28	0	0	0	0.001168	0	5	28				
ADAMTSL3	57188	broad.mit.edu	37	15	84651595	84651595	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:84651595C>A	ENST00000286744.5	+	21	3439	c.3215C>A	c.(3214-3216)tCc>tAc	p.S1072Y	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.S1072Y	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1072						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S1072Y(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGCACCAACTCCTGGGAGTTG	0.433																																							uc002bjz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27						c.(3214-3216)TCC>TAC		ADAMTS-like 3 precursor							69.0	70.0	69.0					15																	84651595		2203	4300	6503	SO:0001583	missense	57188					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr15:84651595C>A	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3215C>A	15.37:g.84651595C>A	ENSP00000286744:p.Ser1072Tyr		Somatic				ADAMTSL3_uc010bmt.1_Missense_Mutation_p.S1072Y|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.S1072Y	p.S1072Y	NM_207517	NP_997400	WXS	Illumina HiSeq	Unspecified	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		21	3439	+			1072					A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	c.3215C>A	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878939	0.72294	.	.	ENSG00000156218	ENST00000286744	T	0.67523	-0.27	5.43	4.46	0.54185	.	0.964312	0.08450	N	0.943970	T	0.79106	0.4390	M	0.64997	1.995	0.43110	D	0.994813	P;D	0.53885	0.889;0.963	P;P	0.58873	0.847;0.594	T	0.75935	-0.3142	10	0.87932	D	0	.	15.6389	0.76981	0.0:0.8625:0.1375:0.0	.	1072;1072	P82987-2;P82987	.;ATL3_HUMAN	Y	1072	ENSP00000286744:S1072Y	ENSP00000286744:S1072Y	S	+	2	0	ADAMTSL3	82442599	1.000000	0.71417	0.952000	0.39060	0.913000	0.54294	2.041000	0.41213	2.529000	0.85273	0.557000	0.71058	TCC		0.433	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		82	123	1	0	7.22319e-40	0.00361	1.14568e-39	82	123				
WDR93	56964	broad.mit.edu	37	15	90245192	90245192	+	Missense_Mutation	SNP	G	G	T	rs200074926		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:90245192G>T	ENST00000268130.7	+	2	316	c.215G>T	c.(214-216)tGg>tTg	p.W72L	RP11-300G22.2_ENST00000557964.1_RNA|WDR93_ENST00000560294.1_Missense_Mutation_p.W72L|WDR93_ENST00000558000.1_Missense_Mutation_p.W72L	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	72					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.W72L(1)		NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			GACCAGTCTTGGGAAATTATT	0.502																																							uc002boj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(214-216)TGG>TTG		WD repeat domain 93							75.0	71.0	72.0					15																	90245192		2200	4299	6499	SO:0001583	missense	56964				electron transport chain	mitochondrial inner membrane	oxidoreductase activity, acting on NADH or NADPH	g.chr15:90245192G>T		CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.215G>T	15.37:g.90245192G>T	ENSP00000268130:p.Trp72Leu		Somatic				WDR93_uc002bok.3_Missense_Mutation_p.W72L|WDR93_uc010bnr.2_Missense_Mutation_p.W72L	p.W72L	NM_020212	NP_064597	WXS	Illumina HiSeq	Unspecified	Q6P2C0	WDR93_HUMAN	KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)		2	316	+	Lung NSC(78;0.0237)|all_lung(78;0.0478)		72					Q8N7Y8|Q9NP89	Missense_Mutation	SNP	ENST00000268130.7	37	c.215G>T	CCDS32326.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.247464	0.39697	.	.	ENSG00000140527	ENST00000268130	T	0.47869	0.83	5.59	5.59	0.84812	.	0.100298	0.44902	D	0.000411	T	0.63768	0.2539	L	0.61036	1.89	0.80722	D	1	P;D;P	0.76494	0.859;0.999;0.859	P;D;P	0.83275	0.586;0.996;0.586	T	0.61753	-0.6998	10	0.40728	T	0.16	-10.9988	12.0788	0.53659	0.0:0.0:0.8281:0.1719	.	72;72;72	Q6P2C0-2;B4E3E2;Q6P2C0	.;.;WDR93_HUMAN	L	72	ENSP00000268130:W72L	ENSP00000268130:W72L	W	+	2	0	WDR93	88046196	1.000000	0.71417	0.980000	0.43619	0.014000	0.08584	3.182000	0.50910	2.640000	0.89533	0.650000	0.86243	TGG		0.502	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416369.1	NM_020212		42	59	1	0	9.39024e-22	0.009718	1.28273e-21	42	59				
ARRDC4	91947	broad.mit.edu	37	15	98512352	98512352	+	Splice_Site	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:98512352G>T	ENST00000268042.6	+	5	789		c.e5-1		ARRDC4_ENST00000538249.1_Splice_Site	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4						positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)		p.?(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			TTTCTTTTTAGGAGAAGCTAT	0.393																																							uc010bom.2		NA																	1	Unknown(1)		lung(1)		0						c.e5-1		arrestin domain containing 4							47.0	52.0	51.0					15																	98512352		2197	4297	6494	SO:0001630	splice_region_variant	91947				signal transduction			g.chr15:98512352G>T	BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.626-1G>T	15.37:g.98512352G>T			Somatic				ARRDC4_uc002bui.3_Splice_Site_p.G122_splice	p.G209_splice	NM_183376	NP_899232	WXS	Illumina HiSeq	Unspecified	Q8NCT1	ARRD4_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.0417)		5	785	+	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)							Q6NSI9	Splice_Site	SNP	ENST00000268042.6	37	c.626_splice	CCDS10377.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371645	0.82573	.	.	ENSG00000140450	ENST00000538249;ENST00000268042	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.889	0.92391	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARRDC4	96313356	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	9.813000	0.99286	2.539000	0.85634	0.591000	0.81541	.		0.393	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313535.1	NM_183376	Intron	9	18	1	0	5.50884e-06	0.001368	6.00295e-06	9	18				
LRRK1	79705	broad.mit.edu	37	15	101597252	101597252	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:101597252G>A	ENST00000388948.3	+	28	4883	c.4524G>A	c.(4522-4524)gaG>gaA	p.E1508E	LRRK1_ENST00000284395.5_Silent_p.E1505E|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.E1520E(1)|p.E1508E(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CTAAGCCAGAGAAGGTACTTG	0.647																																							uc002bwr.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12						c.(4522-4524)GAG>GAA		leucine-rich repeat kinase 1							48.0	56.0	53.0					15																	101597252		2021	4173	6194	SO:0001819	synonymous_variant	79705				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr15:101597252G>A	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4524G>A	15.37:g.101597252G>A			Somatic				LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	p.E1508E	NM_024652	NP_078928	WXS	Illumina HiSeq	Unspecified	Q38SD2	LRRK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		28	4843	+	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		1508			Protein kinase.			Silent	SNP	ENST00000388948.3	37	c.4524G>A	CCDS42086.1																																																																																				0.647	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652		10	20	0	0	0	0.008291	0	10	20				
OR4F6	390648	broad.mit.edu	37	15	102346241	102346241	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:102346241G>T	ENST00000328882.4	+	1	340	c.319G>T	c.(319-321)Gtt>Ttt	p.V107F		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V107F(1)		breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TATCCATGCAGTTGGGGGAAC	0.473																																							uc010utr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(319-321)GTT>TTT		olfactory receptor, family 4, subfamily F,							202.0	185.0	191.0					15																	102346241		2203	4300	6503	SO:0001583	missense	390648				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:102346241G>T	AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.319G>T	15.37:g.102346241G>T	ENSP00000327525:p.Val107Phe		Somatic					p.V107F	NM_001005326	NP_001005326	WXS	Illumina HiSeq	Unspecified	Q8NGB9	OR4F6_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)		1	319	+	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		107			Helical; Name=3; (Potential).		B9EH28|Q6IF95	Missense_Mutation	SNP	ENST00000328882.4	37	c.319G>T	CCDS32341.1	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.955958	0.00470	.	.	ENSG00000184140	ENST00000328882	T	0.01323	5.01	4.64	-4.0	0.04057	GPCR, rhodopsin-like superfamily (1);	0.945499	0.08753	N	0.898840	T	0.00384	0.0012	N	0.00263	-1.745	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.46331	-0.9199	10	0.02654	T	1	.	5.1638	0.15075	0.4396:0.2705:0.2899:0.0	.	107	Q8NGB9	OR4F6_HUMAN	F	107	ENSP00000327525:V107F	ENSP00000327525:V107F	V	+	1	0	OR4F6	100163764	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.134000	0.10436	-0.495000	0.06659	-0.218000	0.12543	GTT		0.473	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417593.1			147	659	1	0	3.69633e-99	0.00361	6.61632e-99	147	659				
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	RNA	SNP	G	G	A	rs201972834		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:102515299G>A	ENST00000557932.1	+	0	1145				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.G374S(10)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						TGGGGGCATCGGCAAGGCCAA	0.652																																							uc002cdi.2		NA																	10	Substitution - Missense(10)		kidney(7)|prostate(2)|endometrium(1)		0						c.(523-525)GGC>AGC		RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;																																						374666							g.chr15:102515299G>A			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515299G>A			Somatic				WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	p.G175S	NR_003659		WXS	Illumina HiSeq	Unspecified					9	1943	+									Missense_Mutation	SNP	ENST00000557932.1	37	c.523G>A		.	.	.	.	.	.	.	.	.	.	g	2.376	-0.343229	0.05243	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	1.01	0.19927	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	-23.1056	7.9382	0.29941	0.0:0.0:1.0:0.0	.	.	.	.	S	383;374	.	.	G	+	1	0	WASH3P	100332822	1.000000	0.71417	0.997000	0.53966	0.230000	0.25150	8.205000	0.89743	0.863000	0.35553	0.184000	0.17185	GGC		0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163		2	3	0	0	0	0.009096	0	2	3				
ZG16B	124220	broad.mit.edu	37	16	2881957	2881957	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:2881957T>A	ENST00000382280.3	+	4	503	c.424T>A	c.(424-426)Tat>Aat	p.Y142N	ZG16B_ENST00000572863.1_Missense_Mutation_p.Y112N	NM_145252.2	NP_660295.2	Q96DA0	ZG16B_HUMAN	zymogen granule protein 16B	142					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)	p.Y142N(1)		central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5						CAAGGACCGCTATTTCTATTT	0.542																																							uc002cru.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(424-426)TAT>AAT		zymogen granule protein 16 homolog B precursor							61.0	65.0	64.0					16																	2881957		1968	4160	6128	SO:0001583	missense	124220					extracellular region	sugar binding	g.chr16:2881957T>A	BC009722	CCDS10479.2	16p13.3	2014-02-12	2012-12-07		ENSG00000162078	ENSG00000162078			30456	protein-coding gene	gene with protein product	"""jacalin-like lectin domain containing 2"""		"""zymogen granule protein 16 homolog B (rat)"""			12477932	Standard	NM_145252		Approved	HRPE773, PRO1567, JCLN2	uc002cru.3	Q96DA0	OTTHUMG00000128933	ENST00000382280.3:c.424T>A	16.37:g.2881957T>A	ENSP00000371715:p.Tyr142Asn		Somatic					p.Y142N	NM_145252	NP_660295	WXS	Illumina HiSeq	Unspecified	Q96DA0	ZG16B_HUMAN			4	500	+			142					A6NIY1|B2R4F6|Q6UW28	Missense_Mutation	SNP	ENST00000382280.3	37	c.424T>A	CCDS10479.2	.	.	.	.	.	.	.	.	.	.	t	3.200	-0.163926	0.06502	.	.	ENSG00000162078	ENST00000382280	T	0.33865	1.39	2.89	-3.86	0.04230	Mannose-binding lectin (3);	5.008060	0.00520	N	0.000186	T	0.27205	0.0667	L	0.39245	1.2	0.09310	N	1	B	0.28055	0.199	B	0.28011	0.085	T	0.06075	-1.0847	10	0.35671	T	0.21	0.2289	3.4759	0.07585	0.2847:0.3036:0.0:0.4117	.	142	Q96DA0	ZG16B_HUMAN	N	142	ENSP00000371715:Y142N	ENSP00000371715:Y142N	Y	+	1	0	ZG16B	2821958	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.968000	0.01507	-1.576000	0.01652	-2.049000	0.00408	TAT		0.542	ZG16B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250912.1	NM_145252		8	13	0	0	0	0.008291	0	8	13				
UBN1	29855	broad.mit.edu	37	16	4924652	4924652	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:4924652G>A	ENST00000396658.4	+	14	2944	c.2241G>A	c.(2239-2241)ggG>ggA	p.G747G	UBN1_ENST00000590769.1_Silent_p.G747G|UBN1_ENST00000545171.1_Silent_p.G747G|UBN1_ENST00000262376.6_Silent_p.G747G	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	747					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G747G(1)		NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						TGGCACTGGGGCAGTCCTCTC	0.527																																							uc002cyb.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(2239-2241)GGG>GGA		ubinuclein 1							89.0	100.0	96.0					16																	4924652		2197	4300	6497	SO:0001819	synonymous_variant	29855				chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:4924652G>A	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.2241G>A	16.37:g.4924652G>A			Somatic				UBN1_uc010uxw.1_Silent_p.G747G|UBN1_uc002cyc.2_Silent_p.G747G	p.G747G	NM_001079514	NP_001072982	WXS	Illumina HiSeq	Unspecified	Q9NPG3	UBN1_HUMAN			15	2580	+			747					B7Z6D3|D3DUE8|Q13079|Q9P1P7	Silent	SNP	ENST00000396658.4	37	c.2241G>A	CCDS10525.1																																																																																				0.527	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936		35	98	0	0	0	0.009718	0	35	98				
GRIN2A	2903	broad.mit.edu	37	16	9943739	9943739	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:9943739G>T	ENST00000396573.2	-	6	1511	c.1202C>A	c.(1201-1203)cCg>cAg	p.P401Q	GRIN2A_ENST00000330684.3_Missense_Mutation_p.P401Q|GRIN2A_ENST00000562109.1_Missense_Mutation_p.P401Q|GRIN2A_ENST00000396575.2_Missense_Mutation_p.P401Q|GRIN2A_ENST00000404927.2_Missense_Mutation_p.P401Q|GRIN2A_ENST00000535259.1_Missense_Mutation_p.P244Q	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	401					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.P401Q(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTTGTCATCCGGCTCACAGTC	0.587																																							uc002czo.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(1201-1203)CCG>CAG		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						147.0	120.0	129.0					16																	9943739		2197	4300	6497	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9943739G>T		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1202C>A	16.37:g.9943739G>T	ENSP00000379818:p.Pro401Gln		Somatic				GRIN2A_uc010uym.1_Missense_Mutation_p.P401Q|GRIN2A_uc010uyn.1_Missense_Mutation_p.P244Q|GRIN2A_uc002czr.3_Missense_Mutation_p.P401Q	p.P401Q	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			5	1750	-			401			Extracellular (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.1202C>A	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715410	0.30413	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.04454	3.62;3.62;3.62;3.62;3.62	5.22	5.22	0.72569	.	0.285219	0.39544	N	0.001337	T	0.07773	0.0195	L	0.44542	1.39	0.43787	D	0.996322	B;B;P	0.45240	0.397;0.276;0.854	B;B;B	0.43301	0.296;0.155;0.415	T	0.36212	-0.9757	9	.	.	.	.	17.7785	0.88516	0.0:0.0:1.0:0.0	.	244;401;401	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	Q	401;401;244;401;401	ENSP00000379818:P401Q;ENSP00000385872:P401Q;ENSP00000441572:P244Q;ENSP00000332549:P401Q;ENSP00000379820:P401Q	.	P	-	2	0	GRIN2A	9851240	0.998000	0.40836	0.945000	0.38365	0.886000	0.51366	2.730000	0.47335	2.430000	0.82344	0.655000	0.94253	CCG		0.587	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			73	154	1	0	2.9056e-39	0.00361	4.59584e-39	73	154				
CLEC16A	23274	broad.mit.edu	37	16	11219945	11219945	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:11219945G>T	ENST00000409790.1	+	22	2813	c.2583G>T	c.(2581-2583)cgG>cgT	p.R861R	CLEC16A_ENST00000409552.3_Silent_p.R843R|CLEC16A_ENST00000381822.2_5'UTR	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.R861R(1)|p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						AGGGGCGCCGGGGCAGCAGCG	0.657																																							uc002dao.2		NA																	2	Whole gene deletion(1)|Substitution - coding silent(1)		haematopoietic_and_lymphoid_tissue(1)|lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2581-2583)CGG>CGT		C-type lectin domain family 16, member A							72.0	83.0	79.0					16																	11219945		2029	4188	6217	SO:0001819	synonymous_variant	23274							g.chr16:11219945G>T	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.2583G>T	16.37:g.11219945G>T			Somatic				CLEC16A_uc002dan.3_Silent_p.R843R|CLEC16A_uc002dap.2_5'UTR	p.R861R	NM_015226	NP_056041	WXS	Illumina HiSeq	Unspecified	Q2KHT3	CL16A_HUMAN			22	2813	+			861						Silent	SNP	ENST00000409790.1	37	c.2583G>T	CCDS45409.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.07|11.07	1.530024|1.530024	0.27387|0.27387	.|.	.|.	ENSG00000038532|ENSG00000038532	ENST00000428742|ENST00000261657	.|.	.|.	.|.	5.97|5.97	-7.52|-7.52	0.01341|0.01341	.|.	.|.	.|.	.|.	.|.	T|T	0.34629|0.34629	0.0904|0.0904	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.42965|0.42965	-0.9420|-0.9420	4|4	.|.	.|.	.|.	-17.024|-17.024	1.585|1.585	0.02642|0.02642	0.3265:0.0771:0.2408:0.3555|0.3265:0.0771:0.2408:0.3555	.|.	.|.	.|.	.|.	V|W	105|53	.|.	.|.	G|G	+|+	2|1	0|0	CLEC16A|CLEC16A	11127446|11127446	0.051000|0.051000	0.20477|0.20477	0.888000|0.888000	0.34837|0.34837	0.985000|0.985000	0.73830|0.73830	-0.815000|-0.815000	0.04481|0.04481	-1.016000|-1.016000	0.03371|0.03371	0.655000|0.655000	0.94253|0.94253	GGG|GGG		0.657	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226		10	25	1	0	5.01169e-05	0.00499	5.37909e-05	10	25				
XYLT1	64131	broad.mit.edu	37	16	17221646	17221646	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:17221646G>A	ENST00000261381.6	-	10	2184	c.2100C>T	c.(2098-2100)atC>atT	p.I700I		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	700					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.I700I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CATGATGCTTGATCAGAAAGC	0.517																																							uc002dfa.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(2098-2100)ATC>ATT		xylosyltransferase I							161.0	155.0	157.0					16																	17221646		2197	4300	6497	SO:0001819	synonymous_variant	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17221646G>A	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2100C>T	16.37:g.17221646G>A			Somatic					p.I700I	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			10	2185	-			700			Lumenal (Potential).		Q9H1B6	Silent	SNP	ENST00000261381.6	37	c.2100C>T	CCDS10569.1																																																																																				0.517	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		60	195	0	0	0	0.00361	0	60	195				
XYLT1	64131	broad.mit.edu	37	16	17221699	17221699	+	Missense_Mutation	SNP	G	G	T	rs563563293		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:17221699G>T	ENST00000261381.6	-	10	2131	c.2047C>A	c.(2047-2049)Cca>Aca	p.P683T		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	683					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.P683T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ACAGATGCTGGGTGGCCCATT	0.527																																							uc002dfa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(2047-2049)CCA>ACA		xylosyltransferase I							126.0	117.0	120.0					16																	17221699		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17221699G>T	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2047C>A	16.37:g.17221699G>T	ENSP00000261381:p.Pro683Thr		Somatic					p.P683T	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			10	2132	-			683			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.2047C>A	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454884	0.84209	.	.	ENSG00000103489	ENST00000261381	T	0.44881	0.91	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.66915	0.2838	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62034	-0.6939	10	0.31617	T	0.26	-14.6452	19.2867	0.94077	0.0:0.0:1.0:0.0	.	683	Q86Y38	XYLT1_HUMAN	T	683	ENSP00000261381:P683T	ENSP00000261381:P683T	P	-	1	0	XYLT1	17129200	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.027000	0.88791	2.793000	0.96121	0.655000	0.94253	CCA		0.527	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		82	81	1	0	1.63847e-34	0.00361	2.49484e-34	82	81				
XYLT1	64131	broad.mit.edu	37	16	17228362	17228362	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:17228362C>A	ENST00000261381.6	-	9	2079	c.1995G>T	c.(1993-1995)acG>acT	p.T665T	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	665			T -> M. {ECO:0000269|PubMed:16571645}.		cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.T665T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGTGCAGGGACGTCTCGGCCC	0.607																																							uc002dfa.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(1993-1995)ACG>ACT		xylosyltransferase I							73.0	63.0	67.0					16																	17228362		2197	4300	6497	SO:0001819	synonymous_variant	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17228362C>A	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1995G>T	16.37:g.17228362C>A			Somatic					p.T665T	NM_022166	NP_071449	WXS	Illumina HiSeq	Unspecified	Q86Y38	XYLT1_HUMAN			9	2080	-			665			Lumenal (Potential).		Q9H1B6	Silent	SNP	ENST00000261381.6	37	c.1995G>T	CCDS10569.1																																																																																				0.607	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		13	52	1	0	5.26018e-13	0.001882	6.48717e-13	13	52				
POLR3E	55718	broad.mit.edu	37	16	22325425	22325425	+	Silent	SNP	G	G	T	rs374256120		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:22325425G>T	ENST00000299853.5	+	8	665	c.498G>T	c.(496-498)gcG>gcT	p.A166A	POLR3E_ENST00000359210.4_Silent_p.A166A|POLR3E_ENST00000418581.2_Silent_p.A130A|POLR3E_ENST00000564209.1_Silent_p.A166A	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	166					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)	p.A166A(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		AGGATGAGGCGGAAGACGATG	0.637																																							uc002dkk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(496-498)GCG>GCT		RNA polymerase III polypeptide E							64.0	52.0	56.0					16																	22325425		2197	4300	6497	SO:0001819	synonymous_variant	55718				innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity	g.chr16:22325425G>T	AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.498G>T	16.37:g.22325425G>T			Somatic				POLR3E_uc002dkj.1_Silent_p.A166A|POLR3E_uc002dkm.2_Silent_p.A130A|POLR3E_uc010vbr.1_Silent_p.A166A|POLR3E_uc002dkl.2_Silent_p.A166A|POLR3E_uc010vbs.1_Silent_p.A130A|POLR3E_uc010vbt.1_Silent_p.A110A	p.A166A	NM_018119	NP_060589	WXS	Illumina HiSeq	Unspecified	Q9NVU0	RPC5_HUMAN		GBM - Glioblastoma multiforme(48;0.012)	8	654	+			166					B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Silent	SNP	ENST00000299853.5	37	c.498G>T	CCDS10605.1																																																																																				0.637	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211590.1	NM_018119		8	17	1	0	0.00010058	0.001368	0.000107148	8	17				
CLN3	1201	broad.mit.edu	37	16	28498827	28498827	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:28498827C>T	ENST00000569430.1	-	8	1229	c.410G>A	c.(409-411)gGa>gAa	p.G137E	CLN3_ENST00000568224.1_Missense_Mutation_p.G59E|CLN3_ENST00000333496.9_Missense_Mutation_p.G113E|CLN3_ENST00000535392.1_Missense_Mutation_p.G59E|CLN3_ENST00000565316.1_Missense_Mutation_p.G137E|CLN3_ENST00000355477.5_Missense_Mutation_p.G137E|CLN3_ENST00000357857.9_Missense_Mutation_p.G83E|CLN3_ENST00000567963.1_Missense_Mutation_p.G137E|CLN3_ENST00000395653.4_Missense_Mutation_p.G37E|CLN3_ENST00000359984.7_Missense_Mutation_p.G137E|CLN3_ENST00000357076.5_Missense_Mutation_p.G137E|CLN3_ENST00000354630.5_Missense_Mutation_p.G137E|CLN3_ENST00000360019.2_Missense_Mutation_p.G137E|CLN3_ENST00000357806.7_Nonsense_Mutation_p.W110*			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	137					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)	p.G137E(1)		breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						GACGAAGCTTCCAGCAGCACA	0.592																																							uc002dpo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(409-411)GGA>GAA		ceroid-lipofuscinosis, neuronal 3							111.0	84.0	93.0					16																	28498827		2197	4300	6497	SO:0001583	missense	1201				amyloid precursor protein catabolic process|arginine transport|associative learning|autophagic vacuole fusion|cell death|cellular amino acid metabolic process|cytosolic calcium ion homeostasis|galactosylceramide metabolic process|globoside metabolic process|glucosylceramide metabolic process|ionotropic glutamate receptor signaling pathway|lysosomal lumen acidification|lysosomal lumen pH elevation|negative regulation of catalytic activity|negative regulation of macroautophagy|negative regulation of neuron apoptosis|negative regulation of proteolysis|neuromuscular process controlling balance|neurotransmitter metabolic process|protein catabolic process|protein folding|protein processing|receptor-mediated endocytosis|regulation of action potential|sphingomyelin metabolic process|vacuolar transport	autophagic vacuole|caveola|cytosol|early endosome|Golgi membrane|Golgi stack|integral to endoplasmic reticulum membrane|late endosome|lysosomal membrane|membrane fraction|mitochondrion|neuron projection|nucleus|synaptic vesicle|trans-Golgi network	unfolded protein binding	g.chr16:28498827C>T	U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.410G>A	16.37:g.28498827C>T	ENSP00000454229:p.Gly137Glu		Somatic				uc010vct.1_Intron|CLN3_uc002dpl.2_Missense_Mutation_p.G59E|CLN3_uc010vcu.1_Missense_Mutation_p.G37E|CLN3_uc002dpn.2_Nonsense_Mutation_p.W110*|CLN3_uc002dpm.2_Missense_Mutation_p.G83E|CLN3_uc010vcv.1_Missense_Mutation_p.G113E|CLN3_uc010byd.2_Missense_Mutation_p.G137E|CLN3_uc002dpp.2_Missense_Mutation_p.G137E|CLN3_uc002dpt.1_Missense_Mutation_p.G37E|CLN3_uc002dpq.1_Missense_Mutation_p.G137E|CLN3_uc010bye.1_Missense_Mutation_p.G137E|CLN3_uc002dpr.1_RNA|CLN3_uc010byf.1_RNA|CLN3_uc002dps.1_Nonsense_Mutation_p.W82*|CLN3_uc002dpu.1_Missense_Mutation_p.G83E|CLN3_uc002dpw.1_Nonsense_Mutation_p.W56*|CLN3_uc010vcw.1_Missense_Mutation_p.G83E|CLN3_uc002dqa.2_Missense_Mutation_p.G188E|CLN3_uc010vcx.1_Missense_Mutation_p.G37E|CLN3_uc002dpx.1_Nonsense_Mutation_p.W86*|CLN3_uc002dpy.1_Nonsense_Mutation_p.W53*|CLN3_uc002dpz.1_RNA	p.G137E	NM_000086	NP_000077	WXS	Illumina HiSeq	Unspecified	Q13286	CLN3_HUMAN			6	733	-			137			Helical; (Potential).		B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	ENST00000569430.1	37	c.410G>A	CCDS10632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.6|29.6	5.018621|5.018621	0.93404|0.93404	.|.	.|.	ENSG00000188603|ENSG00000188603	ENST00000535392;ENST00000359984;ENST00000360019;ENST00000354630;ENST00000355477;ENST00000357857;ENST00000395653;ENST00000357076|ENST00000333496;ENST00000357806	T;T;T;T;T;T;T;D|.	0.96587|.	0.28;0.28;0.28;0.28;0.28;0.28;0.28;-4.06|.	5.53|5.53	5.53|5.53	0.82687|0.82687	Major facilitator superfamily domain, general substrate transporter (1);|.	0.239187|.	0.41294|.	D|.	0.000902|.	T|.	0.75917|.	0.3915|.	M|M	0.79475|0.79475	2.455|2.455	0.44142|0.44142	D|D	0.996932|0.996932	D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;0.993;1.0;1.0;0.976;1.0;1.0;0.997;0.992|.	D;D;D;D;D;D;D;D;D|.	0.80764|.	0.994;0.922;0.99;0.993;0.935;0.993;0.994;0.963;0.96|.	T|.	0.76753|.	-0.2843|.	10|.	0.41790|0.48119	T|T	0.15|0.1	-6.9836|-6.9836	14.9683|14.9683	0.71213|0.71213	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	37;113;137;137;188;83;37;137;137|.	B4DFT5;B4DXL3;Q13286-3;Q13286-4;B4DIA8;O95086;B4DMY6;Q13286-2;Q13286|.	.;.;.;.;.;.;.;.;CLN3_HUMAN|.	E|X	59;137;137;137;137;83;37;137|86;110	ENSP00000443221:G59E;ENSP00000353073:G137E;ENSP00000353116:G137E;ENSP00000346650:G137E;ENSP00000347660:G137E;ENSP00000350523:G83E;ENSP00000379014:G37E;ENSP00000349586:G137E|.	ENSP00000346650:G137E|ENSP00000329171:W86X	G|W	-|-	2|3	0|0	CLN3|CLN3	28406328|28406328	0.894000|0.894000	0.30519|0.30519	0.934000|0.934000	0.37439|0.37439	0.876000|0.876000	0.50452|0.50452	2.471000|2.471000	0.45127|0.45127	2.598000|2.598000	0.87819|0.87819	0.651000|0.651000	0.88453|0.88453	GGA|TGG		0.592	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214115.2			8	33	0	0	0	0.008291	0	8	33				
ATXN2L	11273	broad.mit.edu	37	16	28844674	28844674	+	Splice_Site	SNP	G	G	C	rs373472808		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:28844674G>C	ENST00000336783.4	+	14	2121	c.1954G>C	c.(1954-1956)Gaa>Caa	p.E652Q	ATXN2L_ENST00000340394.8_Splice_Site_p.E652Q|ATXN2L_ENST00000382686.4_Splice_Site_p.E652Q|ATXN2L_ENST00000325215.6_Splice_Site_p.E652Q|ATXN2L_ENST00000570200.1_Splice_Site_p.E652Q|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000564304.1_Splice_Site_p.E658Q|ATXN2L_ENST00000565845.1_3'UTR|ATXN2L_ENST00000395547.2_Splice_Site_p.E652Q	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	652					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)	p.E652Q(2)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CCCTGTTGCTGAGTGAGTGGA	0.577													.|||	1	0.000199681	0.0008	0.0	5008	,	,		17015	0.0		0.0	False		,,,				2504	0.0						uc002drc.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1954-1956)GAA>CAA		ataxin 2 related protein isoform A		G	GLN/GLU,GLN/GLU,GLN/GLU,GLN/GLU,GLN/GLU	3,4391		1,1,2195	45.0	45.0	45.0		1954,1954,1954,1954,1954	5.8	1.0	16		45	0,8600		0,0,4300	no	missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice	ATXN2L	NM_007245.2,NM_145714.1,NM_148414.1,NM_148415.1,NM_148416.1	29,29,29,29,29	1,1,6495	CC,CG,GG		0.0,0.0683,0.0231	benign,benign,benign,benign,benign	652/1076,652/1063,652/1098,652/1045,652/1045	28844674	3,12991	2197	4300	6497	SO:0001630	splice_region_variant	11273					membrane		g.chr16:28844674G>C		CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.1955+1G>C	16.37:g.28844674G>C			Somatic				uc010vct.1_Intron|ATXN2L_uc010byl.1_3'UTR|ATXN2L_uc002drb.2_Missense_Mutation_p.E652Q|ATXN2L_uc002dqy.2_Missense_Mutation_p.E652Q|ATXN2L_uc002dra.2_Missense_Mutation_p.E652Q|ATXN2L_uc002dqz.2_Missense_Mutation_p.E652Q|ATXN2L_uc010vdb.1_Missense_Mutation_p.E658Q|ATXN2L_uc002dre.2_Missense_Mutation_p.E652Q|ATXN2L_uc002drf.2_Missense_Mutation_p.E61Q|ATXN2L_uc002drg.2_5'Flank	p.E652Q	NM_007245	NP_009176	WXS	Illumina HiSeq	Unspecified	Q8WWM7	ATX2L_HUMAN			14	2122	+			652					A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	ENST00000336783.4	37	c.1954G>C	CCDS10641.1	.	.	.	.	.	.	.	.	.	.	.	19.12	3.766611	0.69878	6.83E-4	0.0	ENSG00000168488	ENST00000340394;ENST00000395547;ENST00000336783;ENST00000382686;ENST00000325215	T;T;T;T;T	0.54279	0.59;0.6;0.61;0.58;0.58	5.84	5.84	0.93424	.	0.071450	0.56097	D	0.000028	T	0.42921	0.1224	N	0.24115	0.695	0.48236	D	0.999615	B;B;B;B;B;B;P	0.38167	0.447;0.319;0.319;0.447;0.447;0.319;0.621	B;B;B;B;B;B;B	0.38803	0.192;0.094;0.146;0.192;0.192;0.094;0.282	T	0.19647	-1.0299	10	0.21014	T	0.42	-9.8797	18.9149	0.92501	0.0:0.0:1.0:0.0	.	652;652;652;652;652;652;652	Q8WWM7-6;Q63ZY4;Q8WWM7;Q8WWM7-2;Q8WWM7-4;A8K1R6;Q8WWM7-3	.;.;ATX2L_HUMAN;.;.;.;.	Q	652	ENSP00000341459:E652Q;ENSP00000378917:E652Q;ENSP00000338718:E652Q;ENSP00000372133:E652Q;ENSP00000315650:E652Q	ENSP00000315650:E652Q	E	+	1	0	ATXN2L	28752175	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.143000	0.77348	2.769000	0.95229	0.563000	0.77884	GAA		0.577	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1	NM_007245	Missense_Mutation	12	19	0	0	0	0.004007	0	12	19				
SALL1	6299	broad.mit.edu	37	16	51172949	51172949	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:51172949C>T	ENST00000251020.4	-	2	3217	c.3184G>A	c.(3184-3186)Gag>Aag	p.E1062K	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.E965K|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1062					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E1062K(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GAACTGGGCTCAAAGAGCTGG	0.488																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(3184-3186)GAG>AAG		sal-like 1 isoform a							88.0	84.0	85.0					16																	51172949		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51172949C>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3184G>A	16.37:g.51172949C>T	ENSP00000251020:p.Glu1062Lys		Somatic				SALL1_uc010vgr.1_Missense_Mutation_p.E965K|SALL1_uc010cbv.2_Intron	p.E1062K	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	3215	-		all_cancers(37;0.0322)	1062					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.3184G>A	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.232056	0.79688	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.07327	3.2;3.2	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.14442	0.0349	N	0.08118	0	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.40961	-0.9535	10	0.38643	T	0.18	.	19.6294	0.95694	0.0:1.0:0.0:0.0	.	1062	Q9NSC2	SALL1_HUMAN	K	1062;965;1026	ENSP00000251020:E1062K;ENSP00000407914:E965K	ENSP00000251020:E1062K	E	-	1	0	SALL1	49730450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.810000	0.86072	2.631000	0.89168	0.563000	0.77884	GAG		0.488	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		3	44	0	0	0	0.009096	0	3	44				
RPGRIP1L	23322	broad.mit.edu	37	16	53726179	53726179	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:53726179C>G	ENST00000379925.3	-	4	378	c.328G>C	c.(328-330)Gaa>Caa	p.E110Q	RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.E110Q|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.E110Q|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.E110Q	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	110					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)	p.E110Q(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				TCAATCATTTCTTCCATTTCC	0.448																																							uc002ehp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(328-330)GAA>CAA		RPGRIP1-like isoform a							212.0	217.0	215.0					16																	53726179		2198	4300	6498	SO:0001583	missense	23322				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding	g.chr16:53726179C>G		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.328G>C	16.37:g.53726179C>G	ENSP00000369257:p.Glu110Gln		Somatic				RPGRIP1L_uc002eho.3_Missense_Mutation_p.E110Q|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.E110Q|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.E110Q|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.E110Q|RPGRIP1L_uc002ehq.1_Missense_Mutation_p.E110Q	p.E110Q	NM_015272	NP_056087	WXS	Illumina HiSeq	Unspecified	Q68CZ1	FTM_HUMAN			4	392	-		all_cancers(37;0.0973)	110			Potential.		A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	c.328G>C	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843472	0.71488	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.79653	-1.29;-1.29	5.83	5.83	0.93111	.	0.098182	0.64402	D	0.000002	D	0.89083	0.6614	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.994;1.0	D;D;P;D	0.72075	0.926;0.949;0.827;0.976	D	0.87510	0.2439	10	0.44086	T	0.13	-22.8908	20.1374	0.98035	0.0:1.0:0.0:0.0	.	110;110;110;110	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	Q	110	ENSP00000369257:E110Q;ENSP00000262135:E110Q	ENSP00000262135:E110Q	E	-	1	0	RPGRIP1L	52283680	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.940000	0.75917	2.763000	0.94921	0.563000	0.77884	GAA		0.448	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272		15	106	0	0	0	0.007413	0	15	106				
MLKL	197259	broad.mit.edu	37	16	74708939	74708939	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:74708939C>A	ENST00000308807.7	-	10	1763	c.1300G>T	c.(1300-1302)Ggt>Tgt	p.G434C	MLKL_ENST00000306247.7_Missense_Mutation_p.G226C	NM_152649.2	NP_689862.1			mixed lineage kinase domain-like									p.G434C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(6)|skin(1)|stomach(2)	19						CAGTCTTCACCCAGTGGCTCC	0.552																																							uc002fdb.2		NA																	1	Substitution - Missense(1)		lung(1)	stomach(2)	2						c.(1300-1302)GGT>TGT		mixed lineage kinase domain-like isoform 1							49.0	51.0	50.0					16																	74708939		2198	4300	6498	SO:0001583	missense	197259						ATP binding|protein binding|protein kinase activity	g.chr16:74708939C>A	AK091708	CCDS32487.1, CCDS45528.1	16q22.3	2008-02-05				ENSG00000168404			26617	protein-coding gene	gene with protein product		615153				12477932	Standard	NM_152649		Approved	FLJ34389	uc002fdb.2	Q8NB16		ENST00000308807.7:c.1300G>T	16.37:g.74708939C>A	ENSP00000308351:p.Gly434Cys		Somatic				MLKL_uc002fdc.2_Missense_Mutation_p.G226C	p.G434C	NM_152649	NP_689862	WXS	Illumina HiSeq	Unspecified	Q8NB16	MLKL_HUMAN			10	1741	-			434			Protein kinase.			Missense_Mutation	SNP	ENST00000308807.7	37	c.1300G>T	CCDS32487.1	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701334	0.30142	.	.	ENSG00000168404	ENST00000308807;ENST00000306247	D;T	0.82711	-1.64;0.99	4.83	2.87	0.33458	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.211412	0.39407	N	0.001368	D	0.88691	0.6505	M	0.81802	2.56	0.28379	N	0.919635	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.989	T	0.80535	-0.1339	10	0.54805	T	0.06	-4.1302	6.4767	0.22039	0.0:0.7865:0.0:0.2135	.	226;434	Q8NB16-2;Q8NB16	.;MLKL_HUMAN	C	434;226	ENSP00000308351:G434C;ENSP00000303118:G226C	ENSP00000303118:G226C	G	-	1	0	MLKL	73266440	0.001000	0.12720	0.648000	0.29521	0.032000	0.12392	0.371000	0.20450	1.351000	0.45789	0.393000	0.25936	GGT		0.552	MLKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436403.3	NM_152649		9	40	1	0	1.15919e-05	0.008871	1.25836e-05	9	40				
PLCG2	5336	broad.mit.edu	37	16	81957157	81957157	+	Missense_Mutation	SNP	G	G	T	rs202210217		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:81957157G>T	ENST00000359376.3	+	22	2589	c.2375G>T	c.(2374-2376)cGt>cTt	p.R792L		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	792	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.R792L(2)		NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						AGCTTCTGCCGTGGTGCCCTC	0.567																																							uc002fgt.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						c.(2374-2376)CGT>CTT		phospholipase C, gamma 2							55.0	59.0	58.0					16																	81957157		1962	4156	6118	SO:0001583	missense	5336				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity	g.chr16:81957157G>T		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.2375G>T	16.37:g.81957157G>T	ENSP00000352336:p.Arg792Leu		Somatic					p.R792L	NM_002661	NP_002652	WXS	Illumina HiSeq	Unspecified	P16885	PLCG2_HUMAN			22	2527	+			792			SH3.		D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	37	c.2375G>T	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.209810	0.79240	.	.	ENSG00000197943	ENST00000359376	T	0.32272	1.46	5.55	5.55	0.83447	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);Src homology-3 domain (5);Pleckstrin homology domain (1);	0.094735	0.64402	D	0.000002	T	0.27629	0.0679	L	0.39397	1.21	0.47183	D	0.999344	P	0.48503	0.911	B	0.39660	0.306	T	0.06006	-1.0851	10	0.72032	D	0.01	.	15.039	0.71774	0.0:0.1417:0.8583:0.0	.	792	P16885	PLCG2_HUMAN	L	792	ENSP00000352336:R792L	ENSP00000352336:R792L	R	+	2	0	PLCG2	80514658	0.992000	0.36948	0.968000	0.41197	0.978000	0.69477	2.924000	0.48876	2.603000	0.88011	0.650000	0.86243	CGT		0.567	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1			21	24	1	0	3.73988e-18	0.00632	4.87551e-18	21	24				
MTHFSD	64779	broad.mit.edu	37	16	86582165	86582165	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:86582165C>A	ENST00000360900.6	-	4	281	c.256G>T	c.(256-258)Gtt>Ttt	p.V86F	MTHFSD_ENST00000546093.1_5'UTR|MTHFSD_ENST00000543303.2_Missense_Mutation_p.V85F|MTHFSD_ENST00000381214.5_Missense_Mutation_p.V86F|MTHFSD_ENST00000322911.6_Missense_Mutation_p.V85F|MTHFSD_ENST00000568037.1_5'UTR	NM_001159380.1	NP_001152852.1	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain containing	86							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V85F(1)|p.V86F(1)		endometrium(1)|large_intestine(3)|lung(6)|skin(1)	11						GGTGTTGGAACCAACAATGTT	0.358																																							uc002fjn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(256-258)GTT>TTT		methenyltetrahydrofolate synthetase domain							132.0	121.0	124.0					16																	86582165		1837	4075	5912	SO:0001583	missense	64779				folic acid-containing compound biosynthetic process		5-formyltetrahydrofolate cyclo-ligase activity|ATP binding|RNA binding	g.chr16:86582165C>A	AK023060	CCDS54047.1, CCDS54048.1, CCDS58490.1	16q24.1	2013-02-12				ENSG00000103248		"""RNA binding motif (RRM) containing"""	25778	protein-coding gene	gene with protein product						12477932	Standard	NM_022764		Approved	FLJ12998	uc010vor.2	Q2M296		ENST00000360900.6:c.256G>T	16.37:g.86582165C>A	ENSP00000354152:p.Val86Phe		Somatic				MTHFSD_uc010voo.1_Missense_Mutation_p.V66F|MTHFSD_uc002fjo.2_5'UTR|MTHFSD_uc002fjm.2_Missense_Mutation_p.V85F|MTHFSD_uc010vop.1_5'UTR|MTHFSD_uc010voq.1_Missense_Mutation_p.V85F|MTHFSD_uc010vor.1_Missense_Mutation_p.V86F|MTHFSD_uc002fjp.2_Missense_Mutation_p.V66F	p.V86F	NM_001159377	NP_001152849	WXS	Illumina HiSeq	Unspecified	Q2M296	MTHSD_HUMAN			4	307	-			86					A8MQ77|B7ZLC0|B7ZLC2|D3DUM9|E9PAM1|Q9H878|Q9H954	Missense_Mutation	SNP	ENST00000360900.6	37	c.256G>T	CCDS54047.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.818163	0.90790	.	.	ENSG00000103248	ENST00000543303;ENST00000381214;ENST00000360900;ENST00000322911	T;T;T	0.50813	0.73;0.73;0.73	5.3	5.3	0.74995	5-formyltetrahydrofolate cyclo-ligase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.76176	0.3951	M	0.91038	3.17	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.82236	-0.0557	10	0.87932	D	0	-17.8629	17.9576	0.89074	0.0:1.0:0.0:0.0	.	86;85;86;85	E9PAM1;B7ZLC0;Q2M296;Q2M296-2	.;.;MTHSD_HUMAN;.	F	84;86;86;85	ENSP00000370612:V86F;ENSP00000354152:V86F;ENSP00000326777:V85F	ENSP00000326777:V85F	V	-	1	0	MTHFSD	85139666	1.000000	0.71417	0.979000	0.43373	0.966000	0.64601	6.860000	0.75473	2.485000	0.83878	0.655000	0.94253	GTT		0.358	MTHFSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432182.1	NM_022764		9	34	1	0	0.00829132	0.008291	0.008515	9	34				
OR1A1	8383	broad.mit.edu	37	17	3119135	3119135	+	Nonsense_Mutation	SNP	C	C	A	rs267604805		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:3119135C>A	ENST00000304094.1	+	1	221	c.221C>A	c.(220-222)tCa>tAa	p.S74*		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						ATCTTCTTCTCATCGGTAACC	0.483																																							uc010vrc.1		NA																	0				ovary(1)|skin(1)	2						c.(220-222)TCA>TAA		olfactory receptor, family 1, subfamily A,							233.0	193.0	207.0					17																	3119135		2203	4300	6503	SO:0001587	stop_gained	8383				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr17:3119135C>A	AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.221C>A	17.37:g.3119135C>A	ENSP00000305207:p.Ser74*		Somatic					p.S74*	NM_014565	NP_055380	WXS	Illumina HiSeq	Unspecified	Q9P1Q5	OR1A1_HUMAN			1	221	+			74			Helical; Name=2; (Potential).		A5D914|Q6IFM1|Q6NTA9|Q96R87	Nonsense_Mutation	SNP	ENST00000304094.1	37	c.221C>A	CCDS11022.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.590257	0.66105	.	.	ENSG00000172146	ENST00000304094	.	.	.	4.96	3.97	0.46021	.	0.000000	0.47852	D	0.000214	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0752	0.42355	0.0:0.848:0.0:0.152	.	.	.	.	X	74	.	ENSP00000305207:S74X	S	+	2	0	OR1A1	3065885	0.000000	0.05858	0.996000	0.52242	0.712000	0.41017	0.574000	0.23714	2.584000	0.87258	0.436000	0.28706	TCA		0.483	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207292.1	NM_014565		300	413	1	0	1.11038e-139	0.00361	2.02564e-139	300	413				
SHPK	23729	broad.mit.edu	37	17	3514090	3514090	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:3514090C>A	ENST00000225519.3	-	7	1303	c.1201G>T	c.(1201-1203)Gct>Tct	p.A401S	SHPK_ENST00000572705.1_5'Flank	NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase	401					carbohydrate metabolic process (GO:0005975)|cellular response to interleukin-13 (GO:0035963)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|phosphorylation (GO:0016310)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|sedoheptulokinase activity (GO:0050277)	p.A401S(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)		CGGCACAGAGCCCGGGTCACG	0.647																																							uc002fvz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1201-1203)GCT>TCT		carbohydrate kinase-like							105.0	106.0	106.0					17																	3514090		2203	4300	6503	SO:0001583	missense	23729				carbohydrate metabolic process	cytoplasm	ATP binding|sedoheptulokinase activity	g.chr17:3514090C>A	AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417	2.7.1.14		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL		10673275, 18186520	Standard	NM_013276		Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694	ENST00000225519.3:c.1201G>T	17.37:g.3514090C>A	ENSP00000225519:p.Ala401Ser		Somatic				TRPV1_uc010vru.1_5'Flank	p.A401S	NM_013276	NP_037408	WXS	Illumina HiSeq	Unspecified	Q9UHJ6	SHPK_HUMAN		COAD - Colon adenocarcinoma(5;0.0828)	7	1304	-			401					B2R640|Q8WUH3	Missense_Mutation	SNP	ENST00000225519.3	37	c.1201G>T	CCDS11030.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811768	0.90707	.	.	ENSG00000197417	ENST00000225519	T	0.16897	2.31	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.32102	0.0818	L	0.52266	1.64	0.80722	D	1	D	0.65815	0.995	P	0.55965	0.788	T	0.01508	-1.1337	10	0.62326	D	0.03	-19.3742	18.1093	0.89530	0.0:1.0:0.0:0.0	.	401	Q9UHJ6	SHPK_HUMAN	S	401	ENSP00000225519:A401S	ENSP00000225519:A401S	A	-	1	0	SHPK	3460839	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.827000	0.75303	2.606000	0.88127	0.563000	0.77884	GCT		0.647	SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207378.2			8	44	1	0	0.00829132	0.008291	0.008515	8	44				
ELP5	23587	broad.mit.edu	37	17	7160226	7160226	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:7160226G>A	ENST00000396628.2	+	5	725	c.508G>A	c.(508-510)Gag>Aag	p.E170K	ELP5_ENST00000396627.2_Missense_Mutation_p.E170K|ELP5_ENST00000356683.2_Missense_Mutation_p.E170K|ELP5_ENST00000354429.2_Missense_Mutation_p.E170K|RP1-4G17.5_ENST00000577138.1_Intron|ELP5_ENST00000574993.1_Missense_Mutation_p.E170K	NM_203414.1	NP_981959.1	Q8TE02	ELP5_HUMAN	elongator acetyltransferase complex subunit 5	170					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Elongator holoenzyme complex (GO:0033588)|nucleus (GO:0005634)		p.E170K(2)									GCTACATGAAGAGCTTCATGG	0.582																																							uc002gfg.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(508-510)GAG>AAG		S-phase 2 protein isoform 4							83.0	68.0	73.0					17																	7160226		2203	4300	6503	SO:0001583	missense	23587				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding	g.chr17:7160226G>A	BC002762	CCDS11094.1, CCDS11095.1	17p13.1	2012-08-14	2012-08-08	2012-08-08	ENSG00000170291	ENSG00000170291		"""Elongator acetyltransferase complex subunits"""	30617	protein-coding gene	gene with protein product	"""dermal papilla derived protein 6"", ""S-phase 2 protein"""	615019	"""chromosome 17 open reading frame 81"""	C17orf81		22854966	Standard	NM_203415		Approved	DERP6	uc002gfi.1	Q8TE02	OTTHUMG00000177974	ENST00000396628.2:c.508G>A	17.37:g.7160226G>A	ENSP00000379869:p.Glu170Lys		Somatic				C17orf81_uc002gfj.2_Missense_Mutation_p.E170K|C17orf81_uc010cmb.2_Missense_Mutation_p.E170K|C17orf81_uc002gfh.1_Missense_Mutation_p.E170K|C17orf81_uc002gfi.1_Missense_Mutation_p.E170K|C17orf81_uc002gfl.1_Missense_Mutation_p.E170K	p.E170K	NM_203415	NP_981960	WXS	Illumina HiSeq	Unspecified	Q8TE02	DERP6_HUMAN			6	615	+			170					A8K1M5|D3DTN9|Q659B6|Q7Z2T4|Q8TDR9|Q9BUB2|Q9Y2Q4	Missense_Mutation	SNP	ENST00000396628.2	37	c.508G>A	CCDS11094.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719504	0.89205	.	.	ENSG00000170291	ENST00000354429;ENST00000396628;ENST00000396627;ENST00000356683	T;T;T;T	0.52526	1.35;1.35;1.35;0.66	5.32	5.32	0.75619	.	0.058472	0.64402	D	0.000003	T	0.64907	0.2641	M	0.62723	1.935	0.42039	D	0.99106	D;D;D	0.65815	0.994;0.995;0.995	D;D;D	0.69307	0.938;0.963;0.95	T	0.66921	-0.5801	10	0.66056	D	0.02	-18.4557	14.8805	0.70528	0.0:0.0:1.0:0.0	.	170;170;170	Q8TE02-2;A8K1M5;Q8TE02	.;.;DERP6_HUMAN	K	170	ENSP00000346412:E170K;ENSP00000379869:E170K;ENSP00000379868:E170K;ENSP00000349111:E170K	ENSP00000346412:E170K	E	+	1	0	C17orf81	7100950	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.442000	0.59988	2.679000	0.91253	0.655000	0.94253	GAG		0.582	ELP5-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440111.1	NM_015362		6	50	0	0	0	0.006214	0	6	50				
TP53	7157	broad.mit.edu	37	17	7578177	7578177	+	Splice_Site	SNP	C	C	A	rs267605076		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:7578177C>A	ENST00000269305.4	-	6	861	c.672G>T	c.(670-672)gaG>gaT	p.E224D	TP53_ENST00000455263.2_Splice_Site_p.E224D|TP53_ENST00000359597.4_Splice_Site_p.E224D|TP53_ENST00000420246.2_Splice_Site_p.E224D|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Splice_Site_p.E224D|TP53_ENST00000413465.2_Splice_Site_p.E224D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	224	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E224D(20)|p.?(13)|p.E224E(12)|p.0?(8)|p.E131D(3)|p.E131E(2)|p.V218_E224delVPYEPPE(1)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACCAGACCTCAGGCGGCT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		61	Substitution - Missense(23)|Substitution - coding silent(14)|Unknown(13)|Whole gene deletion(8)|Deletion - In frame(1)|Insertion - Frameshift(1)|Insertion - In frame(1)	p.E224D(11)|p.0?(7)|p.E224E(6)|p.E224K(5)|p.E224*(4)|p.?(3)|p.E224G(2)|p.E224fs*4(1)|p.E224fs*5(1)|p.V218_E224delVPYEPPE(1)|p.E224fs*23(1)|p.V225fs*24(1)|p.E224fs*24(1)|p.E224_V225insXX(1)	lung(23)|large_intestine(7)|bone(6)|biliary_tract(5)|endometrium(5)|oesophagus(3)|breast(3)|stomach(2)|central_nervous_system(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|ovary(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(670-672)GAG>GAT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							81.0	76.0	78.0					17																	7578177		2203	4300	6503	SO:0001630	splice_region_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578177C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.672+1G>T	17.37:g.7578177C>A		HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.E224D|TP53_uc002gih.2_Missense_Mutation_p.E224D|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E92D|TP53_uc010cng.1_Missense_Mutation_p.E92D|TP53_uc002gii.1_Missense_Mutation_p.E92D|TP53_uc010cnh.1_Missense_Mutation_p.E224D|TP53_uc010cni.1_Missense_Mutation_p.E224D|TP53_uc002gij.2_Missense_Mutation_p.E224D|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.E131D|TP53_uc002gio.2_Missense_Mutation_p.E92D|TP53_uc010vug.1_Missense_Mutation_p.E185D	p.E224D	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	6	866	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	224		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.672G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551846	0.65311	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66	5.28	4.31	0.51392	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057313	0.64402	D	0.000001	D	0.99230	0.9732	L	0.59436	1.845	0.51233	D	0.999915	B;B;B;B;B;B;B	0.28636	0.005;0.001;0.218;0.001;0.001;0.001;0.002	B;B;B;B;B;B;B	0.37346	0.015;0.017;0.247;0.002;0.03;0.037;0.006	D	0.99917	1.1232	10	0.87932	D	0	-13.9223	12.1312	0.53944	0.0:0.9158:0.0:0.0842	.	185;224;224;131;224;224;224	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	D	224;224;224;224;224;224;213;131;92;131	ENSP00000410739:E224D;ENSP00000352610:E224D;ENSP00000269305:E224D;ENSP00000398846:E224D;ENSP00000391127:E224D;ENSP00000391478:E224D;ENSP00000425104:E92D;ENSP00000423862:E131D	ENSP00000269305:E224D	E	-	3	2	TP53	7518902	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	6.040000	0.70980	1.362000	0.46000	0.563000	0.77884	GAG		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Missense_Mutation	31	31	1	0	6.29468e-14	0.004878	7.83064e-14	31	31				
USP43	124739	broad.mit.edu	37	17	9546400	9546400	+	5'Flank	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:9546400G>A	ENST00000285199.7	+	0	0				RP11-55L4.2_ENST00000584676.1_RNA|WDR16_ENST00000396219.3_Missense_Mutation_p.G515E|WDR16_ENST00000299764.5_Missense_Mutation_p.G593E|WDR16_ENST00000352665.5_Missense_Mutation_p.G583E|USP43_ENST00000570475.1_5'Flank	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43						ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.G583E(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						ACTCACGTTGGGGTGGGACAC	0.443																																							uc002gly.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1747-1749)GGG>GAG		WD40-repeat protein upregulated in HCC isoform							128.0	112.0	117.0					17																	9546400		2203	4300	6503	SO:0001631	upstream_gene_variant	146845					cytoplasm|intracellular membrane-bounded organelle	protein binding	g.chr17:9546400G>A	AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4			17.37:g.9546400G>A	Exception_encountered		Somatic				USP43_uc002gma.3_5'Flank|USP43_uc010cod.2_5'Flank|USP43_uc010vva.1_5'Flank|WDR16_uc002glz.2_Missense_Mutation_p.G515E|WDR16_uc010coc.2_Missense_Mutation_p.G593E	p.G583E	NM_145054	NP_659491	WXS	Illumina HiSeq	Unspecified	Q8N1V2	WDR16_HUMAN			14	1817	+			583					A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Missense_Mutation	SNP	ENST00000285199.7	37	c.1748G>A	CCDS45610.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340920	0.81911	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;T;T	0.60299	0.2;0.2;0.2	5.88	4.9	0.64082	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78419	0.4280	M	0.85373	2.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.82380	-0.0486	10	0.66056	D	0.02	-17.7101	15.2766	0.73745	0.0:0.0:0.8583:0.1417	.	593;515;583	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	E	583;515;593	ENSP00000339449:G583E;ENSP00000379521:G515E;ENSP00000299764:G593E	ENSP00000299764:G593E	G	+	2	0	WDR16	9487125	1.000000	0.71417	0.970000	0.41538	0.876000	0.50452	9.313000	0.96297	1.468000	0.48064	-0.181000	0.13052	GGG		0.443	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439855.3	NM_153210		5	57	0	0	0	0.000602	0	5	57				
SLFN13	146857	broad.mit.edu	37	17	33767735	33767735	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:33767735G>A	ENST00000285013.6	-	6	2848	c.2573C>T	c.(2572-2574)tCa>tTa	p.S858L	SLFN13_ENST00000360502.2_Missense_Mutation_p.S540L|SLFN13_ENST00000534689.1_Missense_Mutation_p.S540L|SLFN13_ENST00000542635.1_Missense_Mutation_p.S858L|SLFN13_ENST00000526861.1_Missense_Mutation_p.S858L|SLFN13_ENST00000533791.1_Missense_Mutation_p.S858L	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	858						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.S858L(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TTCCAGGCCTGAGAATCGCCG	0.488																																							uc002hjk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(2572-2574)TCA>TTA		schlafen family member 13							233.0	204.0	214.0					17																	33767735		2203	4300	6503	SO:0001583	missense	146857					intracellular	ATP binding	g.chr17:33767735G>A	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.2573C>T	17.37:g.33767735G>A	ENSP00000285013:p.Ser858Leu		Somatic				SLFN13_uc010wch.1_Missense_Mutation_p.S858L|SLFN13_uc002hjl.2_Missense_Mutation_p.S858L|SLFN13_uc010ctt.2_Missense_Mutation_p.S540L|SLFN13_uc002hjm.2_Missense_Mutation_p.S527L	p.S858L	NM_144682	NP_653283	WXS	Illumina HiSeq	Unspecified	Q68D06	SLN13_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	4	2903	-			858					E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	ENST00000285013.6	37	c.2573C>T	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	g	24.4	4.531660	0.85706	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689	D;D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61	3.27	2.28	0.28536	.	0.000000	0.38837	N	0.001555	D	0.89058	0.6607	M	0.84948	2.725	0.29484	N	0.856134	P;D	0.57899	0.836;0.981	P;D	0.67231	0.609;0.95	T	0.83015	-0.0170	10	0.87932	D	0	.	6.3126	0.21173	0.1453:0.0:0.8547:0.0	.	540;858	Q68D06-2;Q68D06	.;SLN13_HUMAN	L	858;540;858;858;540	ENSP00000285013:S858L;ENSP00000353692:S540L;ENSP00000434439:S858L;ENSP00000444016:S858L;ENSP00000435442:S540L	ENSP00000285013:S858L	S	-	2	0	SLFN13	30791848	1.000000	0.71417	0.892000	0.35008	0.932000	0.56968	4.118000	0.57884	0.686000	0.31488	0.407000	0.27541	TCA		0.488	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682		8	232	0	0	0	0.00308	0	8	232				
ZPBP2	124626	broad.mit.edu	37	17	38033026	38033026	+	Silent	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:38033026A>T	ENST00000348931.4	+	8	1172	c.981A>T	c.(979-981)ccA>ccT	p.P327P	ZPBP2_ENST00000377940.3_Silent_p.P305P|ZPBP2_ENST00000584588.1_Silent_p.P254P	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	327					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)		p.P327P(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			AATCTTGCCCACAAACTTCAA	0.418																																							uc002hte.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(979-981)CCA>CCT		zona pellucida binding protein 2 isoform 2							187.0	175.0	179.0					17																	38033026		2203	4300	6503	SO:0001819	synonymous_variant	124626				binding of sperm to zona pellucida	extracellular region		g.chr17:38033026A>T	BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.981A>T	17.37:g.38033026A>T			Somatic				ZPBP2_uc002htf.2_Silent_p.P305P	p.P327P	NM_199321	NP_955353	WXS	Illumina HiSeq	Unspecified	Q6X784	ZPBP2_HUMAN	Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)		8	1134	+	Colorectal(19;0.000442)		327					A8K8L8|Q6X783|Q86XL5	Silent	SNP	ENST00000348931.4	37	c.981A>T	CCDS11352.1																																																																																				0.418	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256609.2	NM_198844		47	156	0	0	0	0.00361	0	47	156				
KRTAP4-4	84616	broad.mit.edu	37	17	39316831	39316831	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:39316831G>T	ENST00000390661.3	-	1	152	c.113C>A	c.(112-114)cCc>cAc	p.P38H		NM_032524.1	NP_115913.1	Q9BYR3	KRA44_HUMAN	keratin associated protein 4-4	38	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].					keratin filament (GO:0045095)		p.P38H(1)		kidney(1)|large_intestine(1)|lung(5)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			ACAGCAGCTGGGGCGGCAGCA	0.652																																							uc002hwc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(112-114)CCC>CAC		keratin associated protein 4.4							38.0	51.0	47.0					17																	39316831		2187	4291	6478	SO:0001583	missense	84616					keratin filament		g.chr17:39316831G>T	AJ406936	CCDS11383.1	17q21.2	2013-06-25			ENSG00000171396	ENSG00000171396		"""Keratin associated proteins"""	16928	protein-coding gene	gene with protein product			"""keratin associated protein 4-13"""	KRTAP4-13		11279113	Standard	NM_032524		Approved	KAP4.4, KAP4.13	uc002hwc.3	Q9BYR3	OTTHUMG00000133428	ENST00000390661.3:c.113C>A	17.37:g.39316831G>T	ENSP00000375076:p.Pro38His		Somatic					p.P38H	NM_032524	NP_115913	WXS	Illumina HiSeq	Unspecified	Q9BYR3	KRA44_HUMAN	STAD - Stomach adenocarcinoma(17;0.000449)		1	153	-		Breast(137;0.000496)	38			26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].|4.		Q9BYU7	Missense_Mutation	SNP	ENST00000390661.3	37	c.113C>A	CCDS11383.1	.	.	.	.	.	.	.	.	.	.	.	16.00	2.997948	0.54147	.	.	ENSG00000171396	ENST00000390661	T	0.02258	4.37	4.73	3.7	0.42460	.	0.182328	0.26352	U	0.024867	T	0.20901	0.0503	H	0.98178	4.165	0.29091	N	0.882102	D	0.76494	0.999	D	0.72982	0.979	T	0.33904	-0.9850	10	0.87932	D	0	.	12.7687	0.57408	0.0:0.1654:0.8346:0.0	.	38	Q9BYR3	KRA44_HUMAN	H	38	ENSP00000375076:P38H	ENSP00000375076:P38H	P	-	2	0	KRTAP4-4	36570357	0.723000	0.28027	1.000000	0.80357	0.994000	0.84299	4.374000	0.59543	2.454000	0.82982	0.555000	0.69702	CCC		0.652	KRTAP4-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257291.1			40	59	1	0	3.76287e-55	0.00361	6.37566e-55	40	59				
STAT3	6774	broad.mit.edu	37	17	40483494	40483494	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:40483494C>T	ENST00000264657.5	-	11	1417	c.1105G>A	c.(1105-1107)Gac>Aac	p.D369N	STAT3_ENST00000404395.3_Missense_Mutation_p.D369N|STAT3_ENST00000588969.1_Missense_Mutation_p.D369N|STAT3_ENST00000585517.1_Missense_Mutation_p.D369N|STAT3_ENST00000389272.3_Missense_Mutation_p.D271N	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	369					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D369N(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		ACTTACTTGTCAATGCACACT	0.323									Hyperimmunoglobulin E Recurrent Infection Syndrome																														uc002hzl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(1105-1107)GAC>AAC		signal transducer and activator of transcription							79.0	82.0	81.0					17																	40483494		2202	4300	6502	SO:0001583	missense	6774	Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding	g.chr17:40483494C>T	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1105G>A	17.37:g.40483494C>T	ENSP00000264657:p.Asp369Asn		Somatic				STAT3_uc002hzk.1_Missense_Mutation_p.D369N|STAT3_uc002hzm.1_Missense_Mutation_p.D369N|STAT3_uc010wgh.1_Missense_Mutation_p.D271N|STAT3_uc002hzn.1_Missense_Mutation_p.D369N	p.D369N	NM_139276	NP_644805	WXS	Illumina HiSeq	Unspecified	P40763	STAT3_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.139)	11	1345	-		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)	369					A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	c.1105G>A	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	C	36	5.682681	0.96774	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.88664	-2.41;-2.41;-2.41	5.85	5.85	0.93711	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94827	0.8329	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.83275	0.994;0.996;0.996	D	0.94619	0.7811	10	0.72032	D	0.01	.	20.1708	0.98159	0.0:1.0:0.0:0.0	.	369;369;369	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	N	369;271;369	ENSP00000264657:D369N;ENSP00000373923:D271N;ENSP00000384943:D369N	ENSP00000264657:D369N	D	-	1	0	STAT3	37737020	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.780000	0.85658	2.761000	0.94854	0.655000	0.94253	GAC		0.323	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150		4	22	0	0	0	0.009096	0	4	22				
MYL4	4635	broad.mit.edu	37	17	45299121	45299121	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:45299121G>A	ENST00000354968.1	+	5	515	c.387G>A	c.(385-387)caG>caA	p.Q129Q	MYL4_ENST00000393450.1_Silent_p.Q129Q|MYL4_ENST00000572316.1_Silent_p.Q129Q|snoU13_ENST00000516279.1_RNA	NM_001002841.1	NP_001002841.1	P12829	MYL4_HUMAN	myosin, light chain 4, alkali; atrial, embryonic	129					cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of the force of heart contraction (GO:0002026)	A band (GO:0031672)|cytosol (GO:0005829)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin II heavy chain binding (GO:0032038)	p.Q129Q(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)	11						ACAAGGAGCAGGGCACCTATG	0.557																																							uc002ilg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(385-387)CAG>CAA		atrial/embryonic alkali myosin light chain							150.0	122.0	132.0					17																	45299121		2203	4300	6503	SO:0001819	synonymous_variant	4635				cardiac muscle contraction|muscle filament sliding|muscle organ development|positive regulation of ATPase activity|regulation of the force of heart contraction	A band|cytosol|muscle myosin complex	actin filament binding|actin monomer binding|calcium ion binding|myosin II heavy chain binding|structural constituent of muscle	g.chr17:45299121G>A		CCDS11510.1	17q21.32	2013-09-19	2006-09-29		ENSG00000198336	ENSG00000198336		"""Myosins / Light chain"", ""EF-hand domain containing"""	7585	protein-coding gene	gene with protein product	"""myosin, atrial/fetal muscle, light chain"""	160770	"""myosin, light polypeptide 4, alkali; atrial, embryonic"""			3417683	Standard	NM_002476		Approved	ALC1, AMLC, GT1, PRO1957	uc002ilg.3	P12829	OTTHUMG00000178232	ENST00000354968.1:c.387G>A	17.37:g.45299121G>A			Somatic				MYL4_uc002ilh.2_Silent_p.Q129Q	p.Q129Q	NM_001002841	NP_001002841	WXS	Illumina HiSeq	Unspecified	P12829	MYL4_HUMAN			5	515	+			129					D3DXJ7|P11783	Silent	SNP	ENST00000354968.1	37	c.387G>A	CCDS11510.1																																																																																				0.557	MYL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441059.1	NM_001002841		5	126	0	0	0	0.001168	0	5	126				
SCRN2	90507	broad.mit.edu	37	17	45915657	45915657	+	Silent	SNP	C	C	T	rs147761976	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:45915657C>T	ENST00000290216.9	-	7	1223	c.1098G>A	c.(1096-1098)ctG>ctA	p.L366L	SCRN2_ENST00000584123.1_Silent_p.L374L|SCRN2_ENST00000407215.3_Silent_p.L366L	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	366						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)	p.L366L(1)		cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						CCATCAGCCCCAGGGCTGCCT	0.592													C|||	5	0.000998403	0.0	0.0	5008	,	,		17846	0.0		0.005	False		,,,				2504	0.0						uc002imd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1096-1098)CTG>CTA		secernin 2 isoform 1		C	,	7,4399	12.9+/-30.5	0,7,2196	57.0	58.0	58.0		1098,1098	4.7	1.0	17	dbSNP_134	58	63,8537	36.9+/-92.0	0,63,4237	no	coding-synonymous,coding-synonymous	SCRN2	NM_001145023.1,NM_138355.3	,	0,70,6433	TT,TC,CC		0.7326,0.1589,0.5382	,	366/379,366/426	45915657	70,12936	2203	4300	6503	SO:0001819	synonymous_variant	90507				proteolysis		dipeptidase activity	g.chr17:45915657C>T	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.1098G>A	17.37:g.45915657C>T			Somatic				SCRN2_uc002imc.2_Silent_p.L374L|SCRN2_uc002imf.2_Silent_p.L366L|SCRN2_uc002ime.2_RNA	p.L366L	NM_138355	NP_612364	WXS	Illumina HiSeq	Unspecified	Q96FV2	SCRN2_HUMAN			7	1224	-			366					A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Silent	SNP	ENST00000290216.9	37	c.1098G>A	CCDS11519.1																																																																																				0.592	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355		3	29	0	0	0	0.009096	0	3	29				
OR4D2	124538	broad.mit.edu	37	17	56247349	56247349	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:56247349G>C	ENST00000545221.1	+	1	333	c.333G>C	c.(331-333)atG>atC	p.M111I		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M111I(1)		breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						GAGGTGCCATGGTCTTCTTCC	0.547																																							uc010wnp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(331-333)ATG>ATC		olfactory receptor, family 4, subfamily D,							92.0	86.0	88.0					17																	56247349		2203	4300	6503	SO:0001583	missense	124538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr17:56247349G>C		CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.333G>C	17.37:g.56247349G>C	ENSP00000441354:p.Met111Ile		Somatic					p.M111I	NM_001004707	NP_001004707	WXS	Illumina HiSeq	Unspecified	P58180	OR4D2_HUMAN			1	333	+			111			Helical; Name=3; (Potential).		Q6IFN8|Q96R75	Missense_Mutation	SNP	ENST00000545221.1	37	c.333G>C	CCDS32688.1	.	.	.	.	.	.	.	.	.	.	G	5.851	0.341175	0.11069	.	.	ENSG00000255713	ENST00000545221	T	0.00392	7.58	5.71	1.2	0.21068	GPCR, rhodopsin-like superfamily (1);	0.093072	0.46145	D	0.000304	T	0.00109	0.0003	N	0.02539	-0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.47824	-0.9087	10	0.87932	D	0	-11.0896	1.657	0.02784	0.1376:0.1547:0.3483:0.3595	.	111	P58180	OR4D2_HUMAN	I	111	ENSP00000441354:M111I	ENSP00000441354:M111I	M	+	3	0	OR4D2	53602348	0.000000	0.05858	0.999000	0.59377	0.056000	0.15407	-0.456000	0.06754	0.831000	0.34780	-0.407000	0.06327	ATG		0.547	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443366.1			85	51	0	0	0	0.00361	0	85	51				
BCAS3	54828	broad.mit.edu	37	17	59161869	59161869	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:59161869C>T	ENST00000390652.5	+	23	2445	c.2414C>T	c.(2413-2415)tCa>tTa	p.S805L	BCAS3_ENST00000407086.3_Missense_Mutation_p.S790L|BCAS3_ENST00000585744.1_Missense_Mutation_p.S576L|BCAS3_ENST00000408905.3_Missense_Mutation_p.S790L|BCAS3_ENST00000588462.1_Missense_Mutation_p.S805L|BCAS3_ENST00000588874.1_Missense_Mutation_p.S561L|BCAS3_ENST00000589222.1_Missense_Mutation_p.S790L	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3									p.S805L(1)		NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			ATGCCAGGGTCATCCCGTCCA	0.473																																							uc002iyv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(2413-2415)TCA>TTA		breast carcinoma amplified sequence 3 isoform 1							66.0	69.0	68.0					17																	59161869		1973	4171	6144	SO:0001583	missense	54828					nucleus		g.chr17:59161869C>T	AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.2414C>T	17.37:g.59161869C>T	ENSP00000375067:p.Ser805Leu		Somatic				BCAS3_uc002iyu.3_Missense_Mutation_p.S790L|BCAS3_uc002iyw.3_Missense_Mutation_p.S786L|BCAS3_uc002iyy.3_Missense_Mutation_p.S561L|BCAS3_uc002iyz.3_Missense_Mutation_p.S359L|BCAS3_uc002iza.3_Missense_Mutation_p.S344L	p.S805L	NM_001099432	NP_001092902	WXS	Illumina HiSeq	Unspecified	Q9H6U6	BCAS3_HUMAN	BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)		23	2523	+			805						Missense_Mutation	SNP	ENST00000390652.5	37	c.2414C>T	CCDS45749.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816935	0.90790	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000408905	T;T;T	0.32988	1.45;1.45;1.43	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.46541	0.1398	L	0.27053	0.805	0.58432	D	0.999999	D;P;P;B;P	0.67145	0.996;0.794;0.557;0.421;0.557	D;P;B;B;B	0.77557	0.99;0.585;0.295;0.154;0.295	T	0.41378	-0.9512	10	0.66056	D	0.02	.	20.3206	0.98668	0.0:1.0:0.0:0.0	.	790;805;790;805;790	Q9H6U6-3;Q9H6U6-8;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;BCAS3_HUMAN;.	L	805;790;790	ENSP00000375067:S805L;ENSP00000385323:S790L;ENSP00000386173:S790L	ENSP00000375067:S805L	S	+	2	0	BCAS3	56516651	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.267000	0.78462	2.809000	0.96659	0.655000	0.94253	TCA		0.473	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449578.1	NM_017679		21	82	0	0	0	0.002096	0	21	82				
LRRC37A3	374819	broad.mit.edu	37	17	62856639	62856639	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:62856639G>T	ENST00000584306.1	-	11	4155	c.3625C>A	c.(3625-3627)Cca>Aca	p.P1209T	LRRC37A3_ENST00000319651.5_Missense_Mutation_p.P1209T|LRRC37A3_ENST00000400877.3_Missense_Mutation_p.P247T|LRRC37A3_ENST00000339474.5_Missense_Mutation_p.P327T|LRRC37A3_ENST00000334962.5_Missense_Mutation_p.P186T	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1209						integral component of membrane (GO:0016021)		p.P1209T(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						CTTGGGGCTGGACTTCCGAGC	0.552																																							uc002jey.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3625-3627)CCA>ACA		leucine rich repeat containing 37, member A3							59.0	76.0	70.0					17																	62856639		2202	4300	6502	SO:0001583	missense	374819					integral to membrane		g.chr17:62856639G>T	AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.3625C>A	17.37:g.62856639G>T	ENSP00000464535:p.Pro1209Thr		Somatic				LRRC37A3_uc010wqg.1_Missense_Mutation_p.P327T|LRRC37A3_uc002jex.1_Missense_Mutation_p.P186T|LRRC37A3_uc010wqf.1_Missense_Mutation_p.P247T|LRRC37A3_uc010dek.1_Missense_Mutation_p.P215T	p.P1209T	NM_199340	NP_955372	WXS	Illumina HiSeq	Unspecified	O60309	L37A3_HUMAN			11	4156	-			1209			Extracellular (Potential).		Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	ENST00000584306.1	37	c.3625C>A	CCDS32708.1	.	.	.	.	.	.	.	.	.	.	.	11.71	1.719783	0.30503	.	.	ENSG00000176809	ENST00000339474;ENST00000400877;ENST00000334962;ENST00000319651	T;T;T	0.70164	1.01;0.99;-0.46	2.46	-4.48	0.03515	.	.	.	.	.	T	0.72317	0.3445	M	0.65975	2.015	0.09310	N	1	D;D	0.71674	0.992;0.998	P;D	0.73708	0.786;0.981	T	0.63129	-0.6706	9	0.46703	T	0.11	.	4.9592	0.14057	0.0:0.3686:0.2592:0.3722	.	327;1209	B4DG20;O60309	.;L37A3_HUMAN	T	290;247;186;1209	ENSP00000383674:P247T;ENSP00000335617:P186T;ENSP00000325713:P1209T	ENSP00000325713:P1209T	P	-	1	0	LRRC37A3	60287101	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.076000	0.11412	-0.506000	0.06558	-0.876000	0.02978	CCA		0.552	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445377.1	NM_199340		26	14	1	0	3.76114e-14	0.004289	4.6891e-14	26	14				
OTOP3	347741	broad.mit.edu	37	17	72938029	72938029	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:72938029G>T	ENST00000328801.4	+	3	524	c.524G>T	c.(523-525)tGc>tTc	p.C175F		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	175						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.C175F(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					TGCACCTTCTGCCTCAACATC	0.622																																							uc010wrr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(523-525)TGC>TTC		otopetrin 3							131.0	94.0	107.0					17																	72938029		2203	4300	6503	SO:0001583	missense	347741					integral to membrane|intracellular	zinc ion binding	g.chr17:72938029G>T	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.524G>T	17.37:g.72938029G>T	ENSP00000328090:p.Cys175Phe		Somatic				OTOP3_uc010wrq.1_Missense_Mutation_p.C157F	p.C175F	NM_178233	NP_839947	WXS	Illumina HiSeq	Unspecified	Q7RTS5	OTOP3_HUMAN			3	524	+	all_lung(278;0.151)|Lung NSC(278;0.185)		175			Helical; (Potential).			Missense_Mutation	SNP	ENST00000328801.4	37	c.524G>T	CCDS11709.1	.	.	.	.	.	.	.	.	.	.	g	8.380	0.837246	0.16891	.	.	ENSG00000182938	ENST00000328801	T	0.07800	3.16	3.64	2.58	0.30949	.	0.177678	0.36066	N	0.002816	T	0.09512	0.0234	L	0.57536	1.79	0.37351	D	0.910791	B	0.10296	0.003	B	0.06405	0.002	T	0.07462	-1.0771	10	0.59425	D	0.04	-23.1556	8.7111	0.34385	0.0:0.0:0.4056:0.5944	.	175	Q7RTS5	OTOP3_HUMAN	F	175	ENSP00000328090:C175F	ENSP00000328090:C175F	C	+	2	0	OTOP3	70449624	1.000000	0.71417	0.993000	0.49108	0.464000	0.32679	1.423000	0.34837	0.673000	0.31224	0.457000	0.33378	TGC		0.622	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445308.1	NM_178233		24	14	1	0	8.88839e-20	0.002096	1.18305e-19	24	14				
TNRC6C	57690	broad.mit.edu	37	17	76045357	76045357	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:76045357G>A	ENST00000588061.1	+	5	941	c.214G>A	c.(214-216)Gga>Aga	p.G72R	TNRC6C_ENST00000588847.1_Missense_Mutation_p.G72R|TNRC6C_ENST00000301624.4_Missense_Mutation_p.G72R|TNRC6C_ENST00000335749.4_Missense_Mutation_p.G72R|TNRC6C_ENST00000541771.1_Missense_Mutation_p.G72R|TNRC6C_ENST00000544502.1_Missense_Mutation_p.G72R			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	72	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G72R(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TGGTGGGGATGGAAAAATGGA	0.522																																							uc002jud.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(214-216)GGA>AGA		trinucleotide repeat containing 6C isoform 2							84.0	88.0	86.0					17																	76045357		2001	4161	6162	SO:0001583	missense	57690				gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding	g.chr17:76045357G>A	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.214G>A	17.37:g.76045357G>A	ENSP00000468647:p.Gly72Arg		Somatic				TNRC6C_uc002juf.2_Missense_Mutation_p.G72R|TNRC6C_uc002jue.2_Missense_Mutation_p.G72R	p.G72R	NM_018996	NP_061869	WXS	Illumina HiSeq	Unspecified	Q9HCJ0	TNR6C_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)		4	814	+			72			Sufficient for interaction with argonaute family proteins.		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	37	c.214G>A	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.308879	0.81247	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.16457	2.34;2.36;2.36;2.34	5.14	5.14	0.70334	.	0.328673	0.36972	N	0.002301	T	0.37100	0.0991	L	0.53249	1.67	0.50171	D	0.999858	D;D;P	0.59767	0.963;0.986;0.938	P;D;P	0.63877	0.76;0.919;0.58	T	0.02560	-1.1141	10	0.51188	T	0.08	-10.2417	18.8	0.92013	0.0:0.0:1.0:0.0	.	72;72;72	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	R	72	ENSP00000336783:G72R;ENSP00000301624:G72R;ENSP00000440310:G72R;ENSP00000442421:G72R	ENSP00000301624:G72R	G	+	1	0	TNRC6C	73556952	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.001000	0.63946	2.668000	0.90789	0.650000	0.86243	GGA		0.522	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996		13	116	0	0	0	0.003163	0	13	116				
TNRC6C	57690	broad.mit.edu	37	17	76061008	76061008	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:76061008G>A	ENST00000588061.1	+	6	3328	c.2601G>A	c.(2599-2601)ctG>ctA	p.L867L	TNRC6C_ENST00000588847.1_Silent_p.L864L|TNRC6C_ENST00000301624.4_Silent_p.L867L|RNU6-625P_ENST00000459412.1_RNA|TNRC6C_ENST00000335749.4_Silent_p.L864L|TNRC6C_ENST00000541771.1_Silent_p.L867L|TNRC6C_ENST00000544502.1_Silent_p.L864L			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	867	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L867L(1)|p.L864L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CCTCAGCCCTGTGCAAACCAG	0.532																																							uc002jud.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(2599-2601)CTG>CTA		trinucleotide repeat containing 6C isoform 2							16.0	18.0	17.0					17																	76061008		1967	4160	6127	SO:0001819	synonymous_variant	57690				gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding	g.chr17:76061008G>A	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2601G>A	17.37:g.76061008G>A			Somatic				TNRC6C_uc002juf.2_Silent_p.L864L|TNRC6C_uc002jue.2_Silent_p.L864L	p.L867L	NM_018996	NP_061869	WXS	Illumina HiSeq	Unspecified	Q9HCJ0	TNR6C_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)		5	3201	+			867			Sufficient for interaction with argonaute family proteins.		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	ENST00000588061.1	37	c.2601G>A	CCDS45798.1																																																																																				0.532	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996		6	3	0	0	0	0.001168	0	6	3				
CBX2	84733	broad.mit.edu	37	17	77757733	77757733	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:77757733G>T	ENST00000310942.4	+	5	595	c.491G>T	c.(490-492)cGg>cTg	p.R164L		NM_005189.2	NP_005180.1	Q14781	CBX2_HUMAN	chromobox homolog 2	164					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|development of primary sexual characteristics (GO:0045137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R164L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CGGAAGAAGCGGGGACGAAAG	0.677																																							uc002jxc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(490-492)CGG>CTG		chromobox homolog 2 isoform 1							44.0	48.0	47.0					17																	77757733		2199	4300	6499	SO:0001583	missense	84733				cell differentiation|chromatin modification|development of primary sexual characteristics|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex	DNA binding	g.chr17:77757733G>T	BC004252, BG354579	CCDS11764.1, CCDS32757.1	17q25.3	2010-07-06	2010-06-24		ENSG00000173894	ENSG00000173894			1552	protein-coding gene	gene with protein product	"""Pc class homolog (Drosophila)"""	602770	"""chromobox homolog 2 (Drosophila Pc class)"", ""cell division cycle associated 6"""	CDCA6		7782071, 2477932	Standard	NM_005189		Approved	MGC10561	uc002jxc.3	Q14781		ENST00000310942.4:c.491G>T	17.37:g.77757733G>T	ENSP00000308750:p.Arg164Leu		Somatic					p.R164L	NM_005189	NP_005180	WXS	Illumina HiSeq	Unspecified	Q14781	CBX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		5	533	+			164			Nuclear localization signal (Potential).		Q0VDA5|Q9BTB1	Missense_Mutation	SNP	ENST00000310942.4	37	c.491G>T	CCDS32757.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743593	0.69418	.	.	ENSG00000173894	ENST00000310942	.	.	.	5.47	5.47	0.80525	.	0.392527	0.25019	N	0.033768	T	0.68174	0.2972	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	T	0.70396	-0.4883	9	0.66056	D	0.02	-6.2498	19.3204	0.94236	0.0:0.0:1.0:0.0	.	164	Q14781	CBX2_HUMAN	L	164	.	ENSP00000308750:R164L	R	+	2	0	CBX2	75372328	1.000000	0.71417	0.948000	0.38648	0.152000	0.21847	9.425000	0.97467	2.577000	0.86979	0.655000	0.94253	CGG		0.677	CBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437040.1	NM_032647		4	1	1	0	1.06961e-07	0.00308	1.20463e-07	4	1				
RNF213	57674	broad.mit.edu	37	17	78343442	78343442	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:78343442A>G	ENST00000582970.1	+	45	12439	c.12296A>G	c.(12295-12297)cAa>cGa	p.Q4099R	CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.Q4148R|RNF213_ENST00000336301.6_Missense_Mutation_p.Q2172R	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4099					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q4148R(1)|p.Q2172R(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CTCTTCGTCCAAAAGGGGCGC	0.502																																							uc002jyh.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21						c.(6514-6516)CAA>CGA		ring finger protein 213							83.0	81.0	82.0					17																	78343442		2203	4300	6503	SO:0001583	missense	57674							g.chr17:78343442A>G	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.12296A>G	17.37:g.78343442A>G	ENSP00000464087:p.Gln4099Arg		Somatic				uc002jyi.1_Intron|RNF213_uc010dhw.1_Missense_Mutation_p.Q554R	p.Q2172R	NM_020914	NP_065965	WXS	Illumina HiSeq	Unspecified	Q9HCF4	ALO17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)		20	6738	+	all_neural(118;0.0538)		Error:Variant_position_missing_in_Q9HCF4_after_alignment					C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	c.6515A>G	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	A	10.07	1.250909	0.22880	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.21543	2.0	5.11	2.88	0.33553	.	0.619767	0.17401	N	0.175550	T	0.16342	0.0393	L	0.40543	1.245	0.09310	N	1	B;B	0.24823	0.001;0.112	B;B	0.18561	0.003;0.022	T	0.17715	-1.0360	10	0.72032	D	0.01	.	7.9855	0.30210	0.8373:0.0:0.1626:0.0	.	4148;2172	C9JCP4;Q63HN8	.;RN213_HUMAN	R	4099;4148;2172	ENSP00000338218:Q2172R	ENSP00000338218:Q2172R	Q	+	2	0	RNF213	75958037	.	.	0.002000	0.10522	0.014000	0.08584	.	.	0.899000	0.36444	0.529000	0.55759	CAA		0.502	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		3	47	0	0	0	0.004672	0	3	47				
SECTM1	6398	broad.mit.edu	37	17	80280050	80280050	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:80280050G>C	ENST00000269389.3	-	5	1084	c.734C>G	c.(733-735)gCc>gGc	p.A245G	SECTM1_ENST00000580437.1_3'UTR	NM_003004.2	NP_002995.1	Q8WVN6	SCTM1_HUMAN	secreted and transmembrane 1	245					immune response (GO:0006955)|mesoderm development (GO:0007498)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine activity (GO:0005125)|signal transducer activity (GO:0004871)	p.A245G(1)		endometrium(1)|large_intestine(2)|lung(1)	4	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			TGGGTCTGCGGCATATGGAAA	0.657																																							uc002keo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(733-735)GCC>GGC		secreted and transmembrane 1 precursor							61.0	64.0	63.0					17																	80280050		2203	4300	6503	SO:0001583	missense	6398				immune response|mesoderm development|positive regulation of I-kappaB kinase/NF-kappaB cascade	extracellular space|Golgi apparatus|integral to membrane|plasma membrane	cytokine activity|signal transducer activity	g.chr17:80280050G>C	U77643	CCDS11808.1	17q25	2008-07-18				ENSG00000141574			10707	protein-coding gene	gene with protein product	"""K12 protein"", ""type 1a transmembrane protein"""	602602				9480746	Standard	NM_003004		Approved	K12	uc002keo.3	Q8WVN6		ENST00000269389.3:c.734C>G	17.37:g.80280050G>C	ENSP00000269389:p.Ala245Gly		Somatic				SECTM1_uc002ken.2_Missense_Mutation_p.A243G|SECTM1_uc002kep.2_3'UTR	p.A245G	NM_003004	NP_002995	WXS	Illumina HiSeq	Unspecified	Q8WVN6	SCTM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)		5	1132	-	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		245			Cytoplasmic (Potential).		B2R7H0|O00466	Missense_Mutation	SNP	ENST00000269389.3	37	c.734C>G	CCDS11808.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.301601	0.40694	.	.	ENSG00000141574	ENST00000269389	.	.	.	0.64	0.64	0.17752	.	.	.	.	.	T	0.15955	0.0384	N	0.19112	0.55	0.09310	N	1	P;P	0.39424	0.673;0.673	B;B	0.32022	0.139;0.139	T	0.14117	-1.0484	7	0.87932	D	0	.	.	.	.	.	245;245	Q8WVN6;A8K3U3	SCTM1_HUMAN;.	G	245	.	ENSP00000269389:A245G	A	-	2	0	SECTM1	77873339	0.003000	0.15002	0.001000	0.08648	0.011000	0.07611	0.380000	0.20602	0.629000	0.30376	0.313000	0.20887	GCC		0.657	SECTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442856.1	NM_003004		6	2	0	0	0	0.006214	0	6	2				
DLGAP1	9229	broad.mit.edu	37	18	3742422	3742422	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:3742422G>T	ENST00000315677.3	-	6	1858	c.1263C>A	c.(1261-1263)gaC>gaA	p.D421E	DLGAP1_ENST00000478161.1_5'UTR|DLGAP1_ENST00000400155.1_Missense_Mutation_p.D127E|DLGAP1_ENST00000581699.1_Missense_Mutation_p.D127E|DLGAP1_ENST00000584874.1_Missense_Mutation_p.D421E|DLGAP1_ENST00000400150.3_Missense_Mutation_p.D127E|DLGAP1_ENST00000515196.2_Missense_Mutation_p.D421E|DLGAP1_ENST00000400147.2_Missense_Mutation_p.D119E|DLGAP1_ENST00000539435.1_Missense_Mutation_p.D119E|DLGAP1_ENST00000400145.2_Missense_Mutation_p.D119E|DLGAP1_ENST00000534970.1_Missense_Mutation_p.D133E|DLGAP1_ENST00000400149.3_Missense_Mutation_p.D129E|DLGAP1_ENST00000581527.1_Missense_Mutation_p.D421E	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	421					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)		p.D421E(1)|p.D119E(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GGTCCAGGCTGTCCAGGCTCC	0.557																																							uc002kmf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(1261-1263)GAC>GAA		discs large homolog-associated protein 1 isoform							77.0	68.0	71.0					18																	3742422		2203	4300	6503	SO:0001583	missense	9229				synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane		g.chr18:3742422G>T	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1263C>A	18.37:g.3742422G>T	ENSP00000316377:p.Asp421Glu		Somatic				DLGAP1_uc010wyz.1_Missense_Mutation_p.D421E|DLGAP1_uc002kme.1_Missense_Mutation_p.D119E|DLGAP1_uc010dkn.2_Missense_Mutation_p.D119E|DLGAP1_uc010wyw.1_Missense_Mutation_p.D127E|DLGAP1_uc010wyx.1_Missense_Mutation_p.D133E|DLGAP1_uc010wyy.1_Missense_Mutation_p.D133E|DLGAP1_uc002kmg.2_Missense_Mutation_p.D119E|DLGAP1_uc002kmk.2_Missense_Mutation_p.D421E	p.D421E	NM_004746	NP_004737	WXS	Illumina HiSeq	Unspecified	O14490	DLGP1_HUMAN			3	1330	-		Colorectal(8;0.0257)	421					A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	c.1263C>A	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332837	0.41297	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	T;T;T;T;T;T;T;T;T	0.16457	2.34;2.44;2.44;2.44;2.44;2.44;2.44;2.44;2.44	4.97	2.14	0.27477	.	0.102112	0.64402	D	0.000003	T	0.19565	0.0470	L	0.52126	1.63	0.42677	D	0.993531	B;P;P;B;P;B;B;B;P	0.42973	0.31;0.534;0.732;0.31;0.796;0.046;0.435;0.297;0.726	B;B;P;B;B;B;B;B;P	0.46975	0.091;0.091;0.533;0.091;0.433;0.031;0.204;0.207;0.5	T	0.01972	-1.1237	10	0.37606	T	0.19	-15.6173	8.8508	0.35199	0.3777:0.0:0.6223:0.0	.	421;133;107;127;119;421;119;421;119	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;Q6IS01;O14490-3;O14490;O14490-2	.;.;.;.;.;.;.;DLGP1_HUMAN;.	E	421;119;127;129;127;133;119;119;421	ENSP00000316377:D421E;ENSP00000383011:D119E;ENSP00000383014:D127E;ENSP00000383013:D129E;ENSP00000383019:D127E;ENSP00000437817:D133E;ENSP00000446312:D119E;ENSP00000383010:D119E;ENSP00000445973:D421E	ENSP00000316377:D421E	D	-	3	2	DLGAP1	3732422	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	2.388000	0.44398	0.642000	0.30620	-0.379000	0.06801	GAC		0.557	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4			4	8	1	0	5.18039e-06	0.00308	5.66667e-06	4	8				
PIEZO2	63895	broad.mit.edu	37	18	10671622	10671622	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:10671622C>A	ENST00000503781.3	-	52	8160	c.8161G>T	c.(8161-8163)Gga>Tga	p.G2721*	PIEZO2_ENST00000285141.4_Nonsense_Mutation_p.G513*|PIEZO2_ENST00000538948.1_Nonsense_Mutation_p.G678*|PIEZO2_ENST00000580640.1_Nonsense_Mutation_p.G2746*|PIEZO2_ENST00000302079.6_Nonsense_Mutation_p.G2658*|PIEZO2_ENST00000581680.1_5'Flank	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2721					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.G2721*(1)|p.G513*(1)									TCCAGTTCTCCTGTCTCTCGA	0.363																																							uc002kor.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(2032-2034)GGA>TGA		family with sequence similarity 38, member B							97.0	91.0	93.0					18																	10671622		2203	4300	6503	SO:0001587	stop_gained	63895					integral to membrane	ion channel activity	g.chr18:10671622C>A	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.8161G>T	18.37:g.10671622C>A	ENSP00000421377:p.Gly2721*		Somatic				FAM38B_uc002koq.2_Nonsense_Mutation_p.G513*	p.G678*	NM_022068	NP_071351	WXS	Illumina HiSeq	Unspecified	Q9H5I5	PIEZ2_HUMAN			14	2172	-			2721					B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Nonsense_Mutation	SNP	ENST00000503781.3	37	c.2032G>T		.	.	.	.	.	.	.	.	.	.	C	42	9.377568	0.99153	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	.	.	.	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	18.8189	0.92088	0.0:1.0:0.0:0.0	.	.	.	.	X	615;2721;678;513	.	ENSP00000285141:G513X	G	-	1	0	FAM38B	10661622	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.784000	0.85713	2.466000	0.83321	0.563000	0.77884	GGA		0.363	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068		19	51	1	0	7.41877e-09	0.001882	8.52338e-09	19	51				
PIEZO2	63895	broad.mit.edu	37	18	10672688	10672688	+	Splice_Site	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:10672688C>T	ENST00000503781.3	-	51	8004	c.8005G>A	c.(8005-8007)Ggt>Agt	p.G2669S	PIEZO2_ENST00000285141.4_Splice_Site_p.G461S|PIEZO2_ENST00000538948.1_Splice_Site_p.G626S|PIEZO2_ENST00000580640.1_Splice_Site_p.G2694S|PIEZO2_ENST00000302079.6_Splice_Site_p.G2606S|PIEZO2_ENST00000581680.1_5'UTR	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2669					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.G461S(1)|p.G2669S(1)									AGTCCTTACCCATAGCCAGCC	0.438																																							uc002kor.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1876-1878)GGT>AGT		family with sequence similarity 38, member B							100.0	95.0	97.0					18																	10672688		2203	4300	6503	SO:0001630	splice_region_variant	63895					integral to membrane	ion channel activity	g.chr18:10672688C>T	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.8006+1G>A	18.37:g.10672688C>T			Somatic				FAM38B_uc002koq.2_Missense_Mutation_p.G461S	p.G626S	NM_022068	NP_071351	WXS	Illumina HiSeq	Unspecified	Q9H5I5	PIEZ2_HUMAN			13	2016	-			2669			Helical; (Potential).		B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	ENST00000503781.3	37	c.1876G>A		.	.	.	.	.	.	.	.	.	.	C	34	5.390854	0.95988	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	T;T	0.80033	-1.33;-1.33	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000003	D	0.87128	0.6100	M	0.72118	2.19	0.54753	D	0.999988	D	0.56287	0.975	P	0.55260	0.772	D	0.85101	0.0957	10	0.38643	T	0.18	.	20.3668	0.98882	0.0:1.0:0.0:0.0	.	563	D6RFZ0	.	S	563;2669;626;461	ENSP00000443129:G626S;ENSP00000285141:G461S	ENSP00000285141:G461S	G	-	1	0	FAM38B	10662688	1.000000	0.71417	0.995000	0.50966	0.850000	0.48378	7.742000	0.85008	2.894000	0.99253	0.655000	0.94253	GGT		0.438	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	Missense_Mutation	6	127	0	0	0	0.00308	0	6	127				
PIEZO2	63895	broad.mit.edu	37	18	10672706	10672706	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:10672706C>T	ENST00000503781.3	-	51	7986	c.7987G>A	c.(7987-7989)Ggg>Agg	p.G2663R	PIEZO2_ENST00000285141.4_Missense_Mutation_p.G455R|PIEZO2_ENST00000538948.1_Missense_Mutation_p.G620R|PIEZO2_ENST00000580640.1_Missense_Mutation_p.G2688R|PIEZO2_ENST00000302079.6_Missense_Mutation_p.G2600R|PIEZO2_ENST00000581680.1_5'UTR	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2663					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.G2663R(1)|p.G455R(1)									GCCAGGAACCCCAGACTTGGG	0.463																																							uc002kor.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1858-1860)GGG>AGG		family with sequence similarity 38, member B							112.0	107.0	108.0					18																	10672706		2203	4300	6503	SO:0001583	missense	63895					integral to membrane	ion channel activity	g.chr18:10672706C>T	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7987G>A	18.37:g.10672706C>T	ENSP00000421377:p.Gly2663Arg		Somatic				FAM38B_uc002koq.2_Missense_Mutation_p.G455R	p.G620R	NM_022068	NP_071351	WXS	Illumina HiSeq	Unspecified	Q9H5I5	PIEZ2_HUMAN			13	1998	-			2663			Helical; (Potential).		B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	ENST00000503781.3	37	c.1858G>A		.	.	.	.	.	.	.	.	.	.	C	37	6.266177	0.97426	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	T;T	0.72282	-0.64;-0.64	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.84606	0.5509	M	0.73598	2.24	0.58432	D	0.99999	D	0.89917	1.0	D	0.83275	0.996	T	0.82024	-0.0662	10	0.38643	T	0.18	.	20.3668	0.98882	0.0:1.0:0.0:0.0	.	557	D6RFZ0	.	R	557;2663;620;455	ENSP00000443129:G620R;ENSP00000285141:G455R	ENSP00000285141:G455R	G	-	1	0	FAM38B	10662706	1.000000	0.71417	0.992000	0.48379	0.936000	0.57629	7.742000	0.85008	2.894000	0.99253	0.655000	0.94253	GGG		0.463	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068		8	139	0	0	0	0.006214	0	8	139				
ZNF519	162655	broad.mit.edu	37	18	14105896	14105896	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:14105896C>A	ENST00000590202.1	-	3	795	c.643G>T	c.(643-645)Ggt>Tgt	p.G215C	ZNF519_ENST00000589203.1_Intron|ZNF519_ENST00000589498.1_Intron|RP11-411B10.3_ENST00000592926.1_RNA	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	215					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G215C(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						GAAGTTTCACCACATTCATTA	0.299																																							uc002kst.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(643-645)GGT>TGT		zinc finger protein 519							55.0	58.0	57.0					18																	14105896		2202	4288	6490	SO:0001583	missense	162655				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:14105896C>A	BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.643G>T	18.37:g.14105896C>A	ENSP00000464872:p.Gly215Cys		Somatic				ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	p.G215C	NM_145287	NP_660330	WXS	Illumina HiSeq	Unspecified	Q8TB69	ZN519_HUMAN			3	796	-			215						Missense_Mutation	SNP	ENST00000590202.1	37	c.643G>T	CCDS32797.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.802529	0.31869	.	.	ENSG00000175322	ENST00000309305	.	.	.	0.646	0.646	0.17789	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.69886	0.3161	M	0.91459	3.21	0.26437	N	0.975848	D	0.89917	1.0	D	0.79108	0.992	T	0.56697	-0.7936	8	0.87932	D	0	.	7.2226	0.25997	0.0:0.9999:0.0:1.0E-4	.	215	Q8TB69	ZN519_HUMAN	C	215	.	ENSP00000307908:G215C	G	-	1	0	ZNF519	14095896	0.813000	0.29090	0.042000	0.18584	0.294000	0.27393	1.242000	0.32755	0.661000	0.30985	0.089000	0.15464	GGT		0.299	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1	NM_145287		38	86	1	0	3.37043e-27	0.00361	4.78735e-27	38	86				
CDH2	1000	broad.mit.edu	37	18	25562988	25562988	+	Nonsense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:25562988G>A	ENST00000269141.3	-	14	2692	c.2269C>T	c.(2269-2271)Caa>Taa	p.Q757*	CDH2_ENST00000399380.3_Nonsense_Mutation_p.Q726*	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	757					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.Q757*(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						ATTAAAAGTTGTTTGGCCTGG	0.353																																							uc002kwg.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|lung(1)	4						c.(2269-2271)CAA>TAA		cadherin 2, type 1 preproprotein							122.0	122.0	122.0					18																	25562988		2203	4300	6503	SO:0001587	stop_gained	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25562988G>A	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2269C>T	18.37:g.25562988G>A	ENSP00000269141:p.Gln757*		Somatic				CDH2_uc010xbn.1_Nonsense_Mutation_p.Q726*	p.Q757*	NM_001792	NP_001783	WXS	Illumina HiSeq	Unspecified	P19022	CADH2_HUMAN			14	2728	-			757			Cytoplasmic (Potential).		A8MWK3|B0YIY6|Q14923|Q8N173	Nonsense_Mutation	SNP	ENST00000269141.3	37	c.2269C>T	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	G	40	8.342433	0.98769	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	20.0852	0.97797	0.0:0.0:1.0:0.0	.	.	.	.	X	757;726	.	ENSP00000269141:Q757X	Q	-	1	0	CDH2	23816986	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.476000	0.97823	2.752000	0.94435	0.655000	0.94253	CAA		0.353	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		42	143	0	0	0	0.00361	0	42	143				
ASXL3	80816	broad.mit.edu	37	18	31325156	31325156	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:31325156C>A	ENST00000269197.5	+	12	5344	c.5344C>A	c.(5344-5346)Ctt>Att	p.L1782I		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1782					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L1782I(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TCCATTGCCTCTTCAAACTAC	0.507																																							uc010dmg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(5344-5346)CTT>ATT		additional sex combs like 3							54.0	54.0	54.0					18																	31325156		1924	4133	6057	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31325156C>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5344C>A	18.37:g.31325156C>A	ENSP00000269197:p.Leu1782Ile		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.L1489I	p.L1782I	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	5399	+			1782					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.5344C>A	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.896499	0.33442	.	.	ENSG00000141431	ENST00000269197	T	0.15952	2.38	5.7	5.7	0.88788	.	.	.	.	.	T	0.11110	0.0271	N	0.24115	0.695	0.29755	N	0.835997	B	0.33583	0.418	B	0.28553	0.091	T	0.06409	-1.0828	9	0.42905	T	0.14	.	8.8363	0.35115	0.0:0.8744:0.0:0.1256	.	1782	Q9C0F0	ASXL3_HUMAN	I	1782	ENSP00000269197:L1782I	ENSP00000269197:L1782I	L	+	1	0	ASXL3	29579154	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.419000	0.34793	2.698000	0.92095	0.655000	0.94253	CTT		0.507	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			25	71	1	0	3.17567e-06	0.008361	3.49385e-06	25	71				
CXXC1	30827	broad.mit.edu	37	18	47810186	47810186	+	Splice_Site	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:47810186C>T	ENST00000285106.6	-	11	2128		c.e11-1		CXXC1_ENST00000412036.2_Splice_Site|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000585672.1_5'Flank|MBD1_ENST00000590208.1_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000339998.6_5'Flank|MBD1_ENST00000424334.2_5'Flank|MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000585595.1_5'Flank|MBD1_ENST00000269471.5_5'Flank|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000591416.1_5'Flank|MBD1_ENST00000269468.5_5'Flank|CXXC1_ENST00000589940.1_Splice_Site	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.?(1)		autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						CCTCGTTGCTCTGCATGGAAT	0.577																																							uc002leq.3		NA																	1	Unknown(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.e11-1		CXXC finger 1 (PHD domain) isoform 2							138.0	122.0	128.0					18																	47810186		2203	4300	6503	SO:0001630	splice_region_variant	30827				histone H3-K4 methylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|Set1C/COMPASS complex	protein binding|unmethylated CpG binding|zinc ion binding	g.chr18:47810186C>T	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1414-1G>A	18.37:g.47810186C>T			Somatic				MBD1_uc002leg.2_5'Flank|MBD1_uc010dow.1_5'Flank|MBD1_uc010xdi.1_5'Flank|MBD1_uc002leh.3_5'Flank|MBD1_uc002len.2_5'Flank|MBD1_uc002lei.3_5'Flank|MBD1_uc002lej.3_5'Flank|MBD1_uc002lek.3_5'Flank|MBD1_uc002lel.3_5'Flank|MBD1_uc002lem.3_5'Flank|MBD1_uc010xdj.1_5'Flank|MBD1_uc010xdk.1_5'Flank|MBD1_uc002leo.2_5'Flank|CXXC1_uc002lep.3_Splice_Site_p.S329_splice|CXXC1_uc002ler.3_Splice_Site_p.S476_splice|CXXC1_uc010doy.2_Splice_Site_p.S472_splice	p.S472_splice	NM_014593	NP_055408	WXS	Illumina HiSeq	Unspecified	Q9P0U4	CXXC1_HUMAN			11	2147	-								B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Splice_Site	SNP	ENST00000285106.6	37	c.1414_splice	CCDS11945.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750181	0.49257	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	.	.	.	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3793	0.74641	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CXXC1	46064184	1.000000	0.71417	0.998000	0.56505	0.569000	0.35902	7.146000	0.77373	2.290000	0.77057	0.467000	0.42956	.		0.577	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255927.2	NM_014593	Intron	27	429	0	0	0	0.00361	0	27	429				
TCF4	6925	broad.mit.edu	37	18	52896212	52896212	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:52896212C>A	ENST00000356073.4	-	18	2344	c.1733G>T	c.(1732-1734)cGt>cTt	p.R578L	TCF4_ENST00000457482.3_Missense_Mutation_p.R422L|TCF4_ENST00000570177.2_Missense_Mutation_p.R448L|TCF4_ENST00000564999.1_Missense_Mutation_p.R578L|TCF4_ENST00000354452.3_Missense_Mutation_p.R582L|TCF4_ENST00000543082.1_Missense_Mutation_p.R536L|TCF4_ENST00000537856.3_Missense_Mutation_p.R448L|TCF4_ENST00000540999.1_Missense_Mutation_p.R554L|TCF4_ENST00000398339.1_Missense_Mutation_p.R684L|TCF4_ENST00000568740.1_Missense_Mutation_p.R553L|TCF4_ENST00000544241.2_Missense_Mutation_p.R511L|TCF4_ENST00000567880.1_Missense_Mutation_p.R518L|TCF4_ENST00000566279.1_Missense_Mutation_p.R522L|TCF4_ENST00000537578.1_Missense_Mutation_p.R558L|TCF4_ENST00000570287.2_Missense_Mutation_p.R418L|TCF4_ENST00000566286.1_Missense_Mutation_p.R575L|TCF4_ENST00000561831.3_Missense_Mutation_p.R418L|TCF4_ENST00000565018.2_Missense_Mutation_p.R582L|TCF4_ENST00000561992.1_Missense_Mutation_p.R448L|TCF4_ENST00000564403.2_Missense_Mutation_p.R588L|TCF4_ENST00000564228.1_Missense_Mutation_p.R507L|TCF4_ENST00000568673.1_Missense_Mutation_p.R558L	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	578	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.		R -> H (in PTHS). {ECO:0000269|PubMed:18728071}.|R -> P (in PTHS). {ECO:0000269|PubMed:20184619, ECO:0000269|PubMed:22045651}.		DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)	p.R578L(1)|p.R684L(1)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GTTGATGTCACGGACCCGCAG	0.592																																							uc002lfz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)	2						c.(1732-1734)CGT>CTT		transcription factor 4 isoform b							176.0	152.0	160.0					18																	52896212		2203	4300	6503	SO:0001583	missense	6925				positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding	g.chr18:52896212C>A	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1733G>T	18.37:g.52896212C>A	ENSP00000348374:p.Arg578Leu		Somatic				TCF4_uc002lfw.3_Missense_Mutation_p.R422L|TCF4_uc010xdu.1_Missense_Mutation_p.R448L|TCF4_uc010xdv.1_Missense_Mutation_p.R448L|TCF4_uc002lfx.2_Missense_Mutation_p.R511L|TCF4_uc010xdw.1_Missense_Mutation_p.R448L|TCF4_uc002lfy.2_Missense_Mutation_p.R536L|TCF4_uc010xdx.1_Missense_Mutation_p.R554L|TCF4_uc010dph.1_Missense_Mutation_p.R582L|TCF4_uc010xdy.1_Missense_Mutation_p.R558L|TCF4_uc002lga.2_Missense_Mutation_p.R684L|TCF4_uc002lgb.1_Missense_Mutation_p.R418L|TCF4_uc010dpi.2_Missense_Mutation_p.R588L|TCF4_uc002lfv.2_Missense_Mutation_p.R361L	p.R578L	NM_003199	NP_003190	WXS	Illumina HiSeq	Unspecified	P15884	ITF2_HUMAN		Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)	18	2345	-			578			Helix-loop-helix motif.		B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	ENST00000356073.4	37	c.1733G>T	CCDS11960.1	.	.	.	.	.	.	.	.	.	.	C	36	5.599214	0.96614	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	D;D;D;D;D;D;D;D;D	0.98044	-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68	5.89	5.89	0.94794	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98902	0.9628	M	0.87097	2.86	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.998;0.998;0.994;0.999;0.999;0.992;1.0	D;D;D;D;D;D;D;D;D	0.83275	0.996;0.989;0.978;0.961;0.988;0.992;0.996;0.979;0.989	D	0.99698	1.1003	10	0.87932	D	0	-4.7625	19.0276	0.92939	0.0:1.0:0.0:0.0	.	558;582;418;684;578;536;511;422;575	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	L	582;422;578;536;554;558;511;448;684	ENSP00000346440:R582L;ENSP00000409447:R422L;ENSP00000348374:R578L;ENSP00000439656:R536L;ENSP00000445202:R554L;ENSP00000440731:R558L;ENSP00000441562:R511L;ENSP00000439827:R448L;ENSP00000381382:R684L	ENSP00000346440:R582L	R	-	2	0	TCF4	51047210	1.000000	0.71417	0.978000	0.43139	0.992000	0.81027	7.818000	0.86416	2.797000	0.96272	0.563000	0.77884	CGT		0.592	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199		109	168	1	0	1.95696e-54	0.00361	3.28654e-54	109	168				
NEDD4L	23327	broad.mit.edu	37	18	56024480	56024480	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:56024480G>T	ENST00000400345.3	+	19	2046	c.1763G>T	c.(1762-1764)gGt>gTt	p.G588V	NEDD4L_ENST00000357895.5_Missense_Mutation_p.G580V|NEDD4L_ENST00000456986.1_Missense_Mutation_p.G467V|NEDD4L_ENST00000356462.6_Missense_Mutation_p.G524V|NEDD4L_ENST00000586263.1_Missense_Mutation_p.G560V|NEDD4L_ENST00000382850.4_Missense_Mutation_p.G568V|NEDD4L_ENST00000431212.2_Missense_Mutation_p.G467V|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000435432.2_Missense_Mutation_p.G447V|NEDD4L_ENST00000456173.2_Missense_Mutation_p.G447V|NEDD4L_ENST00000256832.7_Missense_Mutation_p.G447V|NEDD4L_ENST00000256830.9_Missense_Mutation_p.G484V	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	588					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)	p.G568V(1)|p.G588V(1)		breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						GCTATTACTGGTCCGGTCAGT	0.353																																							uc002lgy.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(4)	4						c.(1762-1764)GGT>GTT		neural precursor cell expressed, developmentally							83.0	84.0	84.0					18																	56024480		1831	4095	5926	SO:0001583	missense	23327				cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity	g.chr18:56024480G>T	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.1763G>T	18.37:g.56024480G>T	ENSP00000383199:p.Gly588Val		Somatic				NEDD4L_uc002lgz.2_Missense_Mutation_p.G524V|NEDD4L_uc002lgx.2_Missense_Mutation_p.G568V|NEDD4L_uc010xee.1_Missense_Mutation_p.G467V|NEDD4L_uc002lhc.2_Missense_Mutation_p.G580V|NEDD4L_uc002lhd.2_Missense_Mutation_p.G467V|NEDD4L_uc002lhb.2_Missense_Mutation_p.G447V|NEDD4L_uc002lhe.2_Missense_Mutation_p.G560V|NEDD4L_uc002lhf.2_Missense_Mutation_p.G447V|NEDD4L_uc002lhg.2_Missense_Mutation_p.G467V|NEDD4L_uc002lhh.2_Missense_Mutation_p.G363V|NEDD4L_uc010dpm.1_Missense_Mutation_p.G269V	p.G588V	NM_001144967	NP_001138439	WXS	Illumina HiSeq	Unspecified	Q96PU5	NED4L_HUMAN			19	2037	+			588					O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	37	c.1763G>T	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698750	0.88830	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	T;T;T;T;T;T;T;T;T;T	0.35421	1.31;1.32;1.35;1.36;1.86;1.82;1.71;1.82;1.82;1.82	5.04	5.04	0.67666	WW/Rsp5/WWP (1);	0.775534	0.12761	N	0.441331	T	0.67655	0.2916	M	0.84511	2.7	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;1.0;0.996;0.999	D;D;D;D;D;D;D	0.91635	0.998;0.988;0.988;0.998;0.999;0.957;0.988	T	0.70828	-0.4766	10	0.87932	D	0	.	18.7403	0.91770	0.0:0.0:1.0:0.0	.	484;560;580;447;524;588;568	Q96PU5-3;Q96PU5-6;Q96PU5-7;Q3LSM7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;.;.;NED4L_HUMAN;.	V	588;568;524;484;447;467;580;447;447;467	ENSP00000383199:G588V;ENSP00000372301:G568V;ENSP00000348847:G524V;ENSP00000256830:G484V;ENSP00000256832:G447V;ENSP00000411947:G467V;ENSP00000350569:G580V;ENSP00000393395:G447V;ENSP00000405440:G447V;ENSP00000389406:G467V	ENSP00000256830:G484V	G	+	2	0	NEDD4L	54175460	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.541000	0.98083	2.495000	0.84180	0.591000	0.81541	GGT		0.353	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1			68	174	1	0	1.91123e-38	0.00361	2.99811e-38	68	174				
PIGN	23556	broad.mit.edu	37	18	59749964	59749964	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:59749964C>G	ENST00000357637.5	-	28	2933	c.2518G>C	c.(2518-2520)Gtt>Ctt	p.V840L	PIGN_ENST00000400334.3_Missense_Mutation_p.V840L	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	840					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.V840L(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				ATAACAAGAACAAAGGGGATT	0.299																																							uc002lii.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5						c.(2518-2520)GTT>CTT		phosphatidylinositol glycan anchor biosynthesis,							48.0	43.0	45.0					18																	59749964		1806	4063	5869	SO:0001583	missense	23556				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups	g.chr18:59749964C>G	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.2518G>C	18.37:g.59749964C>G	ENSP00000350263:p.Val840Leu		Somatic				PIGN_uc002lij.3_Missense_Mutation_p.V840L	p.V840L	NM_176787	NP_789744	WXS	Illumina HiSeq	Unspecified	O95427	PIGN_HUMAN			29	2966	-		Colorectal(73;0.187)	840			Helical; (Potential).		Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	37	c.2518G>C	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	C	10.40	1.339818	0.24339	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.54866	0.55;0.55	5.68	3.86	0.44501	GPI ethanolamine phosphate transferase 1, C-terminal (1);	0.127483	0.53938	D	0.000053	T	0.40398	0.1115	L	0.47078	1.49	0.47153	D	0.99933	B;B	0.16396	0.017;0.008	B;B	0.23419	0.046;0.015	T	0.20207	-1.0282	10	0.05351	T	0.99	-10.6019	10.5061	0.44834	0.0:0.7912:0.1349:0.0738	.	840;840	B2RCI8;O95427	.;PIGN_HUMAN	L	840	ENSP00000350263:V840L;ENSP00000383188:V840L	ENSP00000350263:V840L	V	-	1	0	PIGN	57900944	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.696000	0.47052	0.831000	0.34780	0.591000	0.81541	GTT		0.299	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787		10	13	0	0	0	0.001855	0	10	13				
PHLPP1	23239	broad.mit.edu	37	18	60646229	60646229	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:60646229G>T	ENST00000262719.5	+	17	4953	c.4719G>T	c.(4717-4719)cgG>cgT	p.R1573R	PHLPP1_ENST00000400316.4_Silent_p.R1061R			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1573					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.R1573R(2)|p.R1060R(1)		endometrium(2)|kidney(2)|lung(13)	17						ACTGCAGCCGGGCCAAGGAGA	0.617																																							uc002lis.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(3181-3183)CGG>CGT		PH domain and leucine rich repeat protein							28.0	32.0	31.0					18																	60646229		2100	4210	6310	SO:0001819	synonymous_variant	23239				apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity	g.chr18:60646229G>T	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.4719G>T	18.37:g.60646229G>T			Somatic					p.R1061R	NM_194449	NP_919431	WXS	Illumina HiSeq	Unspecified	O60346	PHLP1_HUMAN			18	3361	+			1573					A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Silent	SNP	ENST00000262719.5	37	c.3183G>T	CCDS45881.2																																																																																				0.617	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449		27	27	1	0	1.15183e-24	0.009718	1.60806e-24	27	27				
SERPINB11	89778	broad.mit.edu	37	18	61387285	61387285	+	RNA	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:61387285C>T	ENST00000382749.5	+	0	759				SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000538847.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P172S(1)		breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				CACAATTGACCCTTCATCTGT	0.333																																					Ovarian(27;496 784 5942 8975 23930)	Ovarian(27;496 784 5942 8975 23930)	uc002ljk.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(514-516)CCT>TCT		serpin peptidase inhibitor, clade B, member 11							82.0	82.0	82.0					18																	61387285		1811	4075	5886			89778				regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity	g.chr18:61387285C>T			18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61387285C>T			Somatic				SERPINB11_uc010xes.1_5'UTR|SERPINB11_uc010dqd.2_Missense_Mutation_p.P58S|SERPINB11_uc002ljj.3_Missense_Mutation_p.P58S|SERPINB11_uc010dqe.2_Intron|SERPINB11_uc010dqf.2_Intron	p.P172S	NM_080475	NP_536723	WXS	Illumina HiSeq	Unspecified	Q96P15	SPB11_HUMAN			7	576	+		Esophageal squamous(42;0.129)	172					A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	ENST00000382749.5	37	c.514C>T		.	.	.	.	.	.	.	.	.	.	C	1.853	-0.464579	0.04476	.	.	ENSG00000206072	ENST00000544088	D	0.83755	-1.76	5.5	3.61	0.41365	Serpin domain (3);	.	.	.	.	T	0.61173	0.2326	N	0.17474	0.49	0.80722	D	1	B;B	0.29612	0.211;0.251	B;B	0.26202	0.04;0.067	T	0.57277	-0.7839	9	0.02654	T	1	.	4.5215	0.11960	0.1646:0.5911:0.0:0.2443	.	172;172	F5GYW9;Q96P15	.;SPB11_HUMAN	S	172	ENSP00000441497:P172S	ENSP00000421854:P172S	P	+	1	0	SERPINB11	59538265	0.000000	0.05858	0.995000	0.50966	0.951000	0.60555	-1.314000	0.02715	1.455000	0.47813	0.563000	0.77884	CCT		0.333	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000207392.3	NM_080475		64	72	0	0	0	0.00361	0	64	72				
ZADH2	284273	broad.mit.edu	37	18	72920923	72920923	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:72920923G>T	ENST00000322342.3	-	1	380	c.91C>A	c.(91-93)Caa>Aaa	p.Q31K	TSHZ1_ENST00000580243.1_5'Flank|TSHZ1_ENST00000322038.5_5'Flank	NM_175907.4	NP_787103.1	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain containing 2	31						mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)	p.Q31K(1)		endometrium(3)|large_intestine(3)|lung(8)|skin(1)	15		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)		TGCATGGCTTGGGGAATGGCG	0.716																																							uc002llx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(91-93)CAA>AAA		zinc binding alcohol dehydrogenase domain							17.0	16.0	16.0					18																	72920923		2156	4251	6407	SO:0001583	missense	284273					peroxisome	oxidoreductase activity|zinc ion binding	g.chr18:72920923G>T	BC033780	CCDS12008.1	18q22.3	2008-05-29	2008-05-29		ENSG00000180011	ENSG00000180011			28697	protein-coding gene	gene with protein product						12477932	Standard	NM_175907		Approved	MGC45594	uc002llx.3	Q8N4Q0	OTTHUMG00000132858	ENST00000322342.3:c.91C>A	18.37:g.72920923G>T	ENSP00000323678:p.Gln31Lys		Somatic				TSHZ1_uc002lly.2_5'Flank	p.Q31K	NM_175907	NP_787103	WXS	Illumina HiSeq	Unspecified	Q8N4Q0	ZADH2_HUMAN		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)	1	359	-		Esophageal squamous(42;0.131)|Prostate(75;0.155)	31					A8KA15|B4DZ91	Missense_Mutation	SNP	ENST00000322342.3	37	c.91C>A	CCDS12008.1	.	.	.	.	.	.	.	.	.	.	G	0.137	-1.106600	0.01828	.	.	ENSG00000180011	ENST00000322342	T	0.05025	3.51	3.26	-1.4	0.08968	GroES-like (1);	0.810877	0.10924	N	0.619132	T	0.01730	0.0055	N	0.02960	-0.455	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52779	-0.8530	10	0.05959	T	0.93	-0.8756	2.7402	0.05251	0.1043:0.1374:0.2303:0.528	.	31	Q8N4Q0	ZADH2_HUMAN	K	31	ENSP00000323678:Q31K	ENSP00000323678:Q31K	Q	-	1	0	ZADH2	71049911	0.997000	0.39634	0.861000	0.33841	0.623000	0.37688	0.527000	0.22987	1.835000	0.53391	0.449000	0.29647	CAA		0.716	ZADH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256332.1	NM_175907		3	5	1	0	0.00024832	0.009096	0.000261606	3	5				
SHC2	25759	broad.mit.edu	37	19	436212	436212	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:436212G>A	ENST00000264554.6	-	7	905	c.906C>T	c.(904-906)ttC>ttT	p.F302F		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	302	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)				endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTACTGCTTGAAGCGCAGCT	0.657																																							uc002loq.3		NA																	0					0						c.(904-906)TTC>TTT		SHC (Src homology 2 domain containing)							20.0	25.0	23.0					19																	436212		2125	4226	6351	SO:0001819	synonymous_variant	25759				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol		g.chr19:436212G>A	AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.906C>T	19.37:g.436212G>A			Somatic				SHC2_uc002lop.3_Silent_p.F43F	p.F302F	NM_012435	NP_036567	WXS	Illumina HiSeq	Unspecified	P98077	SHC2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	7	906	-		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	302			PID.		O60230|Q9NPL5|Q9UCX4	Silent	SNP	ENST00000264554.6	37	c.906C>T	CCDS45891.1																																																																																				0.657	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451840.3			4	4	0	0	0	0.009096	0	4	4				
FEM1A	55527	broad.mit.edu	37	19	4793326	4793326	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:4793326A>T	ENST00000269856.3	+	1	1599	c.1460A>T	c.(1459-1461)gAc>gTc	p.D487V	AC005523.2_ENST00000601192.1_RNA|AC005523.2_ENST00000596170.1_RNA|AC005523.3_ENST00000598782.1_lincRNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	487					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)	p.D487V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		GAGCCCGGAGACTCAGCCCAG	0.642																																							uc002mbf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1459-1461)GAC>GTC		fem-1 homolog a							54.0	62.0	59.0					19																	4793326		2203	4300	6503	SO:0001583	missense	55527				regulation of ubiquitin-protein ligase activity	cytoplasm	binding|ubiquitin-protein ligase activity	g.chr19:4793326A>T	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.1460A>T	19.37:g.4793326A>T	ENSP00000269856:p.Asp487Val		Somatic				uc002mbg.1_RNA	p.D487V	NM_018708	NP_061178	WXS	Illumina HiSeq	Unspecified	Q9BSK4	FEM1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)	1	1599	+		Hepatocellular(1079;0.137)	487					B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Missense_Mutation	SNP	ENST00000269856.3	37	c.1460A>T	CCDS12135.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.005099	0.54254	.	.	ENSG00000141965	ENST00000269856	T	0.69435	-0.4	4.92	4.92	0.64577	.	0.066737	0.64402	U	0.000013	T	0.68742	0.3034	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.71414	0.973	T	0.65734	-0.6096	10	0.22109	T	0.4	-30.8617	14.568	0.68191	1.0:0.0:0.0:0.0	.	487	Q9BSK4	FEM1A_HUMAN	V	487	ENSP00000269856:D487V	ENSP00000269856:D487V	D	+	2	0	FEM1A	4744326	1.000000	0.71417	0.935000	0.37517	0.436000	0.31835	7.365000	0.79537	1.836000	0.53414	0.402000	0.26972	GAC		0.642	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1			13	6	0	0	0	0.00245	0	13	6				
MUC16	94025	broad.mit.edu	37	19	9074611	9074611	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:9074611G>T	ENST00000397910.4	-	3	13038	c.12835C>A	c.(12835-12837)Cac>Aac	p.H4279N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4281	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.H4279N(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCCATGATGTGGGAGGTAACC	0.498																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(12835-12837)CAC>AAC		mucin 16							137.0	133.0	134.0					19																	9074611		2012	4185	6197	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9074611G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12835C>A	19.37:g.9074611G>T	ENSP00000381008:p.His4279Asn		Somatic					p.H4279N	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	13039	-			4281			Thr-rich.|Extracellular (Potential).|Ser-rich.		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.12835C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.447	-0.327291	0.05350	.	.	ENSG00000181143	ENST00000397910	T	0.21543	2.0	1.98	-2.04	0.07343	.	.	.	.	.	T	0.08492	0.0211	N	0.08118	0	.	.	.	B	0.24483	0.104	B	0.21360	0.034	T	0.27262	-1.0079	8	0.87932	D	0	.	2.2811	0.04114	0.3627:0.0:0.3828:0.2544	.	4279	B5ME49	.	N	4279	ENSP00000381008:H4279N	ENSP00000381008:H4279N	H	-	1	0	MUC16	8935611	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.324000	0.07986	-0.650000	0.05423	0.313000	0.20887	CAC		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		214	80	1	0	1.3228e-122	0.00361	2.38271e-122	214	80				
ZNF560	147741	broad.mit.edu	37	19	9578658	9578658	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:9578658C>A	ENST00000301480.4	-	10	1178	c.965G>T	c.(964-966)tGg>tTg	p.W322L		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W322L(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						ACATTGCTTCCATTCATTGAG	0.388																																							uc002mlp.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						c.(964-966)TGG>TTG		zinc finger protein 560							189.0	158.0	169.0					19																	9578658		2203	4300	6503	SO:0001583	missense	147741				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9578658C>A	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.965G>T	19.37:g.9578658C>A	ENSP00000301480:p.Trp322Leu		Somatic				ZNF560_uc010dwr.1_Missense_Mutation_p.W216L	p.W322L	NM_152476	NP_689689	WXS	Illumina HiSeq	Unspecified	Q96MR9	ZN560_HUMAN			10	1175	-			322					Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	c.965G>T	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109575	0.37242	.	.	ENSG00000198028	ENST00000301480	T	0.27720	1.65	2.05	-1.94	0.07571	.	.	.	.	.	T	0.19765	0.0475	L	0.29908	0.895	0.09310	N	1	P	0.52842	0.956	P	0.45071	0.468	T	0.13124	-1.0521	9	0.87932	D	0	.	1.8228	0.03114	0.1999:0.4645:0.1964:0.1392	.	322	Q96MR9	ZN560_HUMAN	L	322	ENSP00000301480:W322L	ENSP00000301480:W322L	W	-	2	0	ZNF560	9439658	0.386000	0.25180	0.000000	0.03702	0.383000	0.30230	1.971000	0.40530	-0.377000	0.07930	0.491000	0.48974	TGG		0.388	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		80	33	1	0	6.64032e-35	0.00361	1.0138e-34	80	33				
BRD4	23476	broad.mit.edu	37	19	15365073	15365073	+	Splice_Site	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:15365073G>A	ENST00000263377.2	-	11	2269	c.2048C>T	c.(2047-2049)gCt>gTt	p.A683V	BRD4_ENST00000371835.4_Splice_Site_p.A683V|BRD4_ENST00000602230.1_5'Flank|BRD4_ENST00000360016.5_Splice_Site_p.A683V	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	683					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)	p.A683V(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			AACTTTCTCAGCTGCAATCCA	0.582			T	C15orf55	lethal midline carcinoma of young people																																		uc002nar.2		NA		Dom	yes		19	19p13.1	23476	T	bromodomain containing 4			E	NUT|C15orf55		lethal midline carcinoma of young people		2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(2047-2049)GCT>GTT		bromodomain-containing protein 4 isoform long							63.0	54.0	57.0					19																	15365073		2203	4300	6503	SO:0001630	splice_region_variant	23476				interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding	g.chr19:15365073G>A	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.2048-1C>T	19.37:g.15365073G>A			Somatic				BRD4_uc002nas.2_Missense_Mutation_p.A683V|BRD4_uc002nat.3_Missense_Mutation_p.A683V	p.A683V	NM_058243	NP_490597	WXS	Illumina HiSeq	Unspecified	O60885	BRD4_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)		11	2270	-			683					O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	37	c.2048C>T	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.582217	0.46006	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.53857	0.6;0.6;0.6	5.22	5.22	0.72569	.	0.092777	0.47093	D	0.000246	T	0.42720	0.1215	N	0.08118	0	0.31939	N	0.611123	D;P;D	0.57571	0.98;0.844;0.98	P;B;P	0.52598	0.703;0.347;0.611	T	0.50767	-0.8789	10	0.37606	T	0.19	.	12.9753	0.58534	0.0:0.0:0.838:0.162	.	683;683;683	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	V	683	ENSP00000263377:A683V;ENSP00000360901:A683V;ENSP00000353112:A683V	ENSP00000263377:A683V	A	-	2	0	BRD4	15226073	1.000000	0.71417	0.985000	0.45067	0.721000	0.41392	5.118000	0.64673	2.608000	0.88229	0.462000	0.41574	GCT		0.582	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	Missense_Mutation	23	9	0	0	0	0.00632	0	23	9				
CTC-260E6.6	0	broad.mit.edu	37	19	20370088	20370088	+	RNA	SNP	G	G	T	rs186031755		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:20370088G>T	ENST00000593655.1	-	0	199																											GACCCATCCCGCAGAAAGCAC	0.413													G|||	1	0.000199681	0.0	0.0	5008	,	,		20965	0.001		0.0	False		,,,				2504	0.0						uc002nov.2		NA																	0					0						c.(880-882)CGC>CTC		SubName: Full=cDNA FLJ51655, highly similar to Actin-like protein 2;																																						284441							g.chr19:20370088G>T																													19.37:g.20370088G>T			Somatic					p.R294L	NR_003128		WXS	Illumina HiSeq	Unspecified					1	1632	+									Missense_Mutation	SNP	ENST00000593655.1	37	c.881G>T																																																																																					0.413	CTC-260E6.6-006	KNOWN	basic	antisense	antisense	OTTHUMT00000462901.1			5	35	1	0	0.000602214	0.000602	0.000629788	5	35				
ZNF208	7757	broad.mit.edu	37	19	22155657	22155657	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:22155657C>G	ENST00000397126.4	-	4	2327	c.2179G>C	c.(2179-2181)Ggc>Cgc	p.G727R	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	727					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G627R(2)|p.G727R(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AAGCTTTTGCCACATTCTTCA	0.378																																							uc002nqp.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(5)|skin(2)	7						c.(1879-1881)GGC>CGC		zinc finger protein 208							51.0	56.0	54.0					19																	22155657		2107	4244	6351	SO:0001583	missense	7757							g.chr19:22155657C>G	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2179G>C	19.37:g.22155657C>G	ENSP00000380315:p.Gly727Arg		Somatic				ZNF208_uc002nqo.1_Intron	p.G627R	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					5	2028	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	SNP	ENST00000397126.4	37	c.1879G>C	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.011781	0.35511	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.58506	0.33	2.43	1.34	0.21922	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.69196	0.3084	.	.	.	0.25774	N	0.984807	D	0.89917	1.0	D	0.97110	1.0	T	0.56565	-0.7958	8	0.72032	D	0.01	.	4.5667	0.12189	0.2127:0.6503:0.0:0.137	.	627	O43345	ZN208_HUMAN	R	727;627	ENSP00000380315:G727R	ENSP00000380315:G727R	G	-	1	0	ZNF208	21947497	0.956000	0.32656	0.021000	0.16686	0.065000	0.16274	1.124000	0.31320	0.038000	0.15604	0.280000	0.19369	GGC		0.378	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		45	124	0	0	0	0.00361	0	45	124				
ZNF208	7757	broad.mit.edu	37	19	22157153	22157153	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:22157153G>T	ENST00000397126.4	-	4	831	c.683C>A	c.(682-684)cCc>cAc	p.P228H	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.P228H(3)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACATCTGTAGGGTTTCTCTCC	0.363																																							uc002nqp.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(5)|skin(2)	7						c.(682-684)CCC>CAC		zinc finger protein 208							51.0	56.0	55.0					19																	22157153		2093	4234	6327	SO:0001583	missense	7757							g.chr19:22157153G>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.683C>A	19.37:g.22157153G>T	ENSP00000380315:p.Pro228His		Somatic				ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	p.P228H	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					4	832	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	SNP	ENST00000397126.4	37	c.683C>A	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.765894	0.31228	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.29397	1.57	2.93	-0.85	0.10720	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24586	0.0596	.	.	.	0.09310	N	1	B	0.31290	0.318	B	0.34873	0.191	T	0.25641	-1.0126	8	0.66056	D	0.02	.	7.2649	0.26224	0.333:0.0:0.667:0.0	.	228	O43345	ZN208_HUMAN	H	228	ENSP00000380315:P228H	ENSP00000380315:P228H	P	-	2	0	ZNF208	21948993	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.196000	0.17176	-0.571000	0.06014	-0.698000	0.03680	CCC		0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		62	67	1	0	9.12251e-31	0.00361	1.32543e-30	62	67				
ZNF254	9534	broad.mit.edu	37	19	24309689	24309689	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:24309689G>T	ENST00000357002.4	+	4	1002	c.887G>T	c.(886-888)tGt>tTt	p.C296F	ZNF254_ENST00000342944.6_Missense_Mutation_p.C211F	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	296					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C296F(1)					all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				CCTTACAAGTGTGAAGAATGT	0.363																																							uc002nru.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(886-888)TGT>TTT		zinc finger protein 254							37.0	39.0	38.0					19																	24309689		2202	4297	6499	SO:0001583	missense	9534				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:24309689G>T	AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.887G>T	19.37:g.24309689G>T	ENSP00000349494:p.Cys296Phe		Somatic				ZNF254_uc010xrk.1_Missense_Mutation_p.C211F	p.C296F	NM_203282	NP_975011	WXS	Illumina HiSeq	Unspecified	O75437	ZN254_HUMAN			4	1021	+		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)	296			C2H2-type 4.		A4QPC0|Q86XL7	Missense_Mutation	SNP	ENST00000357002.4	37	c.887G>T	CCDS32983.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931601	0.34096	.	.	ENSG00000213096	ENST00000342944;ENST00000357002	D;D	0.85088	-1.94;-1.94	1.11	-0.52	0.11935	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93236	0.7845	H	0.96662	3.86	0.09310	N	0.999991	D	0.76494	0.999	D	0.76071	0.987	D	0.83505	0.0077	9	0.87932	D	0	.	5.2351	0.15443	0.2436:0.0:0.7564:0.0	.	296	O75437	ZN254_HUMAN	F	211;296	ENSP00000445527:C211F;ENSP00000349494:C296F	ENSP00000445527:C211F	C	+	2	0	ZNF254	24101529	1.000000	0.71417	0.004000	0.12327	0.175000	0.22909	6.548000	0.73896	-0.295000	0.08960	0.305000	0.20034	TGT		0.363	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876		37	86	1	0	5.20006e-24	0.002852	7.22442e-24	37	86				
LSM14A	26065	broad.mit.edu	37	19	34710724	34710724	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:34710724A>T	ENST00000433627.5	+	8	1153	c.1078A>T	c.(1078-1080)Aat>Tat	p.N360Y	LSM14A_ENST00000540746.2_Missense_Mutation_p.N319Y|LSM14A_ENST00000544216.3_Missense_Mutation_p.N360Y	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	360					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.N360Y(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					ACTTGGACCTAATTGCTATTA	0.348																																							uc002nvb.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1078-1080)AAT>TAT		LSM14 homolog A isoform a							82.0	79.0	80.0					19																	34710724		2203	4300	6503	SO:0001583	missense	26065				cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule		g.chr19:34710724A>T	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.1078A>T	19.37:g.34710724A>T	ENSP00000413964:p.Asn360Tyr		Somatic				LSM14A_uc002nva.3_Missense_Mutation_p.N360Y|LSM14A_uc010xru.1_Missense_Mutation_p.N319Y|LSM14A_uc002nvc.3_Missense_Mutation_p.N166Y	p.N360Y	NM_001114093	NP_001107565	WXS	Illumina HiSeq	Unspecified	Q8ND56	LS14A_HUMAN			8	1274	+	Esophageal squamous(110;0.162)		360					B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Missense_Mutation	SNP	ENST00000433627.5	37	c.1078A>T	CCDS46040.1	.	.	.	.	.	.	.	.	.	.	a	21.4	4.137450	0.77775	.	.	ENSG00000257103	ENST00000544216;ENST00000433627;ENST00000540746	T;T;T	0.32753	1.44;1.44;1.45	5.99	5.99	0.97316	.	0.140079	0.64402	D	0.000005	T	0.45875	0.1364	M	0.64404	1.975	0.49299	D	0.999779	D;P;P	0.53151	0.958;0.873;0.898	P;P;P	0.57468	0.821;0.602;0.754	T	0.42137	-0.9469	10	0.52906	T	0.07	-11.2513	10.7713	0.46325	0.9298:0.0:0.0701:0.0	.	319;360;360	B4DTG6;Q8ND56;Q8ND56-2	.;LS14A_HUMAN;.	Y	360;360;319	ENSP00000446271:N360Y;ENSP00000413964:N360Y;ENSP00000446451:N319Y	ENSP00000314768:N360Y	N	+	1	0	LSM14A	39402564	1.000000	0.71417	0.987000	0.45799	0.955000	0.61496	7.046000	0.76592	2.291000	0.77112	0.533000	0.62120	AAT		0.348	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578		36	41	0	0	0	0.00874	0	36	41				
RBM42	79171	broad.mit.edu	37	19	36120510	36120510	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:36120510G>A	ENST00000262633.4	+	2	322	c.217G>A	c.(217-219)Gaa>Aaa	p.E73K	RBM42_ENST00000586618.1_Missense_Mutation_p.E73K|RBM42_ENST00000588161.1_Missense_Mutation_p.E73K|RBM42_ENST00000360475.4_Missense_Mutation_p.E73K|RBM42_ENST00000589871.1_Missense_Mutation_p.E73K|RBM42_ENST00000589559.1_Missense_Mutation_p.E73K|RBM42_ENST00000592202.1_Missense_Mutation_p.E73K	NM_024321.3	NP_077297.2	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	73						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E73K(1)		breast(1)|endometrium(3)|large_intestine(7)|lung(9)|prostate(1)	21	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCCCACAGTAGAAGCGATGCA	0.587																																							uc002oan.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(217-219)GAA>AAA		RNA binding motif protein 42							85.0	80.0	82.0					19																	36120510		2203	4300	6503	SO:0001583	missense	79171					cytoplasm|nucleus	nucleotide binding|RNA binding	g.chr19:36120510G>A	BC004204	CCDS12468.1	19q13.12	2013-02-12				ENSG00000126254		"""RNA binding motif (RRM) containing"""	28117	protein-coding gene	gene with protein product		613232				12477932	Standard	NM_024321		Approved	MGC10433	uc002oan.3	Q9BTD8		ENST00000262633.4:c.217G>A	19.37:g.36120510G>A	ENSP00000262633:p.Glu73Lys		Somatic				RBM42_uc010xsx.1_Missense_Mutation_p.E73K|RBM42_uc010eef.2_Missense_Mutation_p.E73K|RBM42_uc002oao.2_Missense_Mutation_p.E73K|RBM42_uc002oap.2_Missense_Mutation_p.E73K|RBM42_uc002oaq.2_Missense_Mutation_p.E73K|RBM42_uc010eeg.2_Missense_Mutation_p.E73K	p.E73K	NM_024321	NP_077297	WXS	Illumina HiSeq	Unspecified	Q9BTD8	RBM42_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		2	293	+	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		73					O00320|Q8N5R7|Q9BU66	Missense_Mutation	SNP	ENST00000262633.4	37	c.217G>A	CCDS12468.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.534173	0.85812	.	.	ENSG00000126254	ENST00000262633;ENST00000360475	T;T	0.07800	3.25;3.16	3.62	3.62	0.41486	.	0.207707	0.30890	N	0.008663	T	0.10981	0.0268	L	0.36672	1.1	0.25839	N	0.984073	P;P;P;P;D	0.53151	0.873;0.673;0.673;0.673;0.958	B;B;B;B;P	0.49799	0.291;0.351;0.351;0.351;0.622	T	0.04900	-1.0919	10	0.59425	D	0.04	-2.7133	11.1016	0.48177	0.0:0.0:1.0:0.0	.	73;73;73;73;73	B4DWT0;Q9BTD8-4;Q9BTD8-3;Q9BTD8-2;Q9BTD8	.;.;.;.;RBM42_HUMAN	K	73	ENSP00000262633:E73K;ENSP00000353663:E73K	ENSP00000262633:E73K	E	+	1	0	RBM42	40812350	0.565000	0.26610	0.682000	0.30024	0.773000	0.43773	3.337000	0.52120	2.320000	0.78422	0.655000	0.94253	GAA		0.587	RBM42-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459057.2	NM_024321		7	89	0	0	0	0.004482	0	7	89				
ZNF585B	92285	broad.mit.edu	37	19	37676497	37676497	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:37676497T>A	ENST00000532828.2	-	5	2193	c.1942A>T	c.(1942-1944)Aat>Tat	p.N648Y	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_Missense_Mutation_p.N236Y|ZNF585B_ENST00000531805.1_Missense_Mutation_p.N593Y|ZNF585B_ENST00000527838.1_3'UTR	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	648					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N648Y(1)		NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTACTGAGATTTGACCTGCCA	0.473																																					Melanoma(93;882 1454 18863 28917 48427)	Melanoma(93;882 1454 18863 28917 48427)	uc002ofq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1942-1944)AAT>TAT		zinc finger protein 585B							39.0	38.0	38.0					19																	37676497		2203	4299	6502	SO:0001583	missense	92285				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr19:37676497T>A	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1942A>T	19.37:g.37676497T>A	ENSP00000433773:p.Asn648Tyr		Somatic				uc002ofp.1_5'Flank|ZNF585B_uc002ofr.1_Missense_Mutation_p.N462Y	p.N648Y	NM_152279	NP_689492	WXS	Illumina HiSeq	Unspecified	Q52M93	Z585B_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		5	2196	-			648			C2H2-type 17.		Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	37	c.1942A>T	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	T	9.915	1.210499	0.22289	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	T;T;T	0.22134	1.97;1.97;3.16	2.35	-0.0364	0.13888	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40144	N	0.001177	T	0.29749	0.0743	L	0.53780	1.695	0.09310	N	1	B;D	0.89917	0.17;1.0	B;D	0.87578	0.014;0.998	T	0.09684	-1.0663	10	0.35671	T	0.21	.	2.1821	0.03877	0.4497:0.2597:0.0:0.2906	.	593;648	E9PQH3;Q52M93	.;Z585B_HUMAN	Y	593;648;236	ENSP00000436774:N593Y;ENSP00000433773:N648Y;ENSP00000442139:N236Y	ENSP00000442139:N236Y	N	-	1	0	ZNF585B	42368337	0.000000	0.05858	0.988000	0.46212	0.967000	0.64934	-3.221000	0.00552	0.105000	0.17753	0.254000	0.18369	AAT		0.473	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279		18	25	0	0	0	0.002096	0	18	25				
PSMD8	5714	broad.mit.edu	37	19	38873891	38873891	+	Splice_Site	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:38873891A>T	ENST00000215071.4	+	7	981		c.e7-1		PSMD8_ENST00000602911.1_Splice_Site|AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_5'Flank	NM_002812.4	NP_002803.2	P48556	PSMD8_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 8						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.?(2)		central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(1)	6	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCTTTCCTGCAGCGAGGGTGG	0.562																																							uc002oii.3		NA																	2	Unknown(2)		lung(2)	central_nervous_system(1)	1						c.e7-2		proteasome 26S non-ATPase subunit 8							52.0	46.0	48.0					19																	38873891		2203	4300	6503	SO:0001630	splice_region_variant	5714				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome regulatory particle	protein binding	g.chr19:38873891A>T	D38047	CCDS12515.2	19q13.2	2009-05-07			ENSG00000099341	ENSG00000099341		"""Proteasome (prosome, macropain) subunits"""	9566	protein-coding gene	gene with protein product						7621825	Standard	NM_002812		Approved	S14, Nin1p, p31, HIP6, HYPF, Rpn12	uc002oii.4	P48556	OTTHUMG00000150691	ENST00000215071.4:c.916-1A>T	19.37:g.38873891A>T			Somatic					p.R306_splice	NM_002812	NP_002803	WXS	Illumina HiSeq	Unspecified	P48556	PSMD8_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		7	968	+	all_cancers(60;3.4e-06)							B4DX18|Q6P1L7	Splice_Site	SNP	ENST00000215071.4	37	c.916_splice	CCDS12515.2	.	.	.	.	.	.	.	.	.	.	A	19.87	3.907443	0.72868	.	.	ENSG00000099341	ENST00000215071	.	.	.	4.21	4.21	0.49690	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5536	0.50735	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PSMD8	43565731	1.000000	0.71417	0.994000	0.49952	0.945000	0.59286	8.581000	0.90788	1.879000	0.54435	0.459000	0.35465	.		0.562	PSMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319627.1	NM_002812	Intron	7	11	0	0	0	0.006214	0	7	11				
FAM98C	147965	broad.mit.edu	37	19	38896205	38896205	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:38896205G>T	ENST00000252530.5	+	6	699	c.680G>T	c.(679-681)tGc>tTc	p.C227F	FAM98C_ENST00000588262.1_Intron|FAM98C_ENST00000343358.7_Missense_Mutation_p.C201F	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	227								p.C227F(1)		endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CAGTACCGCTGCCGCCGCTGC	0.597																																							uc002oin.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(679-681)TGC>TTC		hypothetical protein LOC147965							54.0	61.0	58.0					19																	38896205		2189	4294	6483	SO:0001583	missense	147965							g.chr19:38896205G>T		CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.680G>T	19.37:g.38896205G>T	ENSP00000252530:p.Cys227Phe		Somatic				FAM98C_uc002oio.1_Missense_Mutation_p.C201F|FAM98C_uc010xtz.1_Intron	p.C227F	NM_174905	NP_777565	WXS	Illumina HiSeq	Unspecified	Q17RN3	FA98C_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		6	699	+	all_cancers(60;3.95e-06)		227					A6NMW3|Q66K45	Missense_Mutation	SNP	ENST00000252530.5	37	c.680G>T	CCDS42562.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.932545	0.34096	.	.	ENSG00000130244	ENST00000252530;ENST00000343358	T;T	0.44881	0.91;0.91	5.02	1.1	0.20463	.	0.548059	0.15348	N	0.267098	T	0.41719	0.1171	M	0.79926	2.475	0.46185	D	0.99891	P;B	0.51147	0.942;0.344	P;B	0.44696	0.458;0.129	T	0.45308	-0.9270	10	0.13470	T	0.59	-0.3593	7.2956	0.26391	0.1017:0.3264:0.5719:0.0	.	201;227	Q17RN3-2;Q17RN3	.;FA98C_HUMAN	F	227;201	ENSP00000252530:C227F;ENSP00000340348:C201F	ENSP00000252530:C227F	C	+	2	0	FAM98C	43588045	0.999000	0.42202	0.981000	0.43875	0.837000	0.47467	2.080000	0.41586	0.502000	0.28037	-0.310000	0.09108	TGC		0.597	FAM98C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459222.1	NM_174905		10	14	1	0	1.58986e-06	0.008291	1.76274e-06	10	14				
RYR1	6261	broad.mit.edu	37	19	38983214	38983214	+	Missense_Mutation	SNP	G	G	T	rs139775280		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:38983214G>T	ENST00000359596.3	+	38	6212	c.6212G>T	c.(6211-6213)cGg>cTg	p.R2071L	RYR1_ENST00000360985.3_Missense_Mutation_p.R2071L|RYR1_ENST00000355481.4_Missense_Mutation_p.R2071L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2071	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.R2071L(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GAGAAAGTGCGGCTGGTGAAG	0.592																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(6211-6213)CGG>CTG		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						53.0	50.0	51.0					19																	38983214		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38983214G>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.6212G>T	19.37:g.38983214G>T	ENSP00000352608:p.Arg2071Leu		Somatic				RYR1_uc002oiu.2_Missense_Mutation_p.R2071L	p.R2071L	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		38	6342	+	all_cancers(60;7.91e-06)		2071			Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.6212G>T	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	g	14.35	2.509291	0.44660	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.72051	-0.62;-0.62;-0.62	5.05	2.44	0.29823	.	0.173200	0.32134	U	0.006527	T	0.61590	0.2359	L	0.48642	1.525	0.19575	N	0.999965	B;P	0.48503	0.239;0.911	B;B	0.42593	0.099;0.392	T	0.56269	-0.8007	10	0.49607	T	0.09	.	9.4058	0.38460	0.2693:0.0:0.7307:0.0	.	2071;2071	P21817-2;P21817	.;RYR1_HUMAN	L	2071	ENSP00000352608:R2071L;ENSP00000347667:R2071L;ENSP00000354254:R2071L	ENSP00000347667:R2071L	R	+	2	0	RYR1	43675054	0.637000	0.27216	0.997000	0.53966	0.970000	0.65996	1.180000	0.32005	1.089000	0.41292	0.539000	0.68188	CGG		0.592	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			8	10	1	0	6.72482e-11	0.003163	7.96654e-11	8	10				
ZNF526	116115	broad.mit.edu	37	19	42729117	42729117	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:42729117C>T	ENST00000301215.3	+	3	787	c.562C>T	c.(562-564)Ccc>Tcc	p.P188S		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P188S(1)		autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				TCCACCTTCTCCCCCATCCGA	0.597																																							uc002osz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(562-564)CCC>TCC		zinc finger protein 526							130.0	122.0	125.0					19																	42729117		2203	4300	6503	SO:0001583	missense	116115				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:42729117C>T	AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.562C>T	19.37:g.42729117C>T	ENSP00000301215:p.Pro188Ser		Somatic					p.P188S	NM_133444	NP_597701	WXS	Illumina HiSeq	Unspecified	Q8TF50	ZN526_HUMAN			3	718	+		Prostate(69;0.0704)	188					B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	ENST00000301215.3	37	c.562C>T	CCDS12598.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.832042	0.00579	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.08896	3.04	4.4	0.895	0.19247	.	0.848925	0.09846	N	0.748209	T	0.06280	0.0162	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37549	-0.9701	10	0.66056	D	0.02	-0.0087	7.5904	0.28017	0.0:0.4534:0.4399:0.1067	.	188	Q8TF50	ZN526_HUMAN	S	44;188	ENSP00000301215:P188S	ENSP00000301215:P188S	P	+	1	0	ZNF526	47420957	0.000000	0.05858	0.074000	0.20217	0.518000	0.34316	0.084000	0.14891	0.194000	0.20326	0.467000	0.42956	CCC		0.597	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463681.2	XM_057401		63	96	0	0	0	0.00361	0	63	96				
CLPTM1	1209	broad.mit.edu	37	19	45495879	45495879	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:45495879C>T	ENST00000337392.5	+	14	1884	c.1734C>T	c.(1732-1734)ttC>ttT	p.F578F	CLPTM1_ENST00000546079.1_Silent_p.F476F|CLPTM1_ENST00000541297.2_Silent_p.F564F	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	578					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.F578F(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		ATGTGGTTTTCTTCATCTACC	0.647																																							uc002pai.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1732-1734)TTC>TTT		cleft lip and palate associated transmembrane							71.0	67.0	68.0					19																	45495879		2203	4300	6503	SO:0001819	synonymous_variant	1209				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane		g.chr19:45495879C>T	AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.1734C>T	19.37:g.45495879C>T			Somatic				CLPTM1_uc010xxf.1_Silent_p.F476F|CLPTM1_uc010xxg.1_Silent_p.F564F	p.F578F	NM_001294	NP_001285	WXS	Illumina HiSeq	Unspecified	O96005	CLPT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)	14	1749	+		all_neural(266;0.224)|Ovarian(192;0.231)	578			Cytoplasmic (Potential).		B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Silent	SNP	ENST00000337392.5	37	c.1734C>T	CCDS12651.1																																																																																				0.647	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453267.1	NM_001294		11	36	0	0	0	0.00245	0	11	36				
EML2	24139	broad.mit.edu	37	19	46116800	46116800	+	Splice_Site	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:46116800C>A	ENST00000245925.3	-	18	1873	c.1823G>T	c.(1822-1824)cGa>cTa	p.R608L	EML2_ENST00000587152.1_Splice_Site_p.R809L|EML2_ENST00000589876.1_Splice_Site_p.R608L|EML2_ENST00000536630.1_Splice_Site_p.R755L	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	608	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R608L(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GGGACTCACTCGAGGCTGACA	0.572																																							uc002pcn.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1822-1824)CGA>CTA		echinoderm microtubule associated protein like							95.0	83.0	87.0					19																	46116800		2203	4300	6503	SO:0001630	splice_region_variant	24139				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding	g.chr19:46116800C>A	AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.1824+1G>T	19.37:g.46116800C>A			Somatic				EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Missense_Mutation_p.R492L|EML2_uc010xxl.1_Missense_Mutation_p.R755L|EML2_uc010xxm.1_Missense_Mutation_p.R809L	p.R608L	NM_012155	NP_036287	WXS	Illumina HiSeq	Unspecified	O95834	EMAL2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)	18	1858	-		Ovarian(192;0.179)|all_neural(266;0.224)	608			WD 10.		B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	ENST00000245925.3	37	c.1823G>T	CCDS12670.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793165	0.90453	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055	T;T	0.28255	1.62;2.89	4.75	4.75	0.60458	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53932	0.1827	M	0.74467	2.265	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.997	D;D;D	0.81914	0.965;0.995;0.937	T	0.48281	-0.9049	10	0.28530	T	0.3	-8.8226	15.6448	0.77039	0.0:1.0:0.0:0.0	.	774;755;608	B7Z3Q9;B7Z3I2;O95834	.;.;EMAL2_HUMAN	L	755;608;766	ENSP00000442365:R755L;ENSP00000245925:R608L	ENSP00000245925:R608L	R	-	2	0	EML2	50808640	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.545000	0.67237	2.653000	0.90120	0.563000	0.77884	CGA		0.572	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155	Missense_Mutation	46	68	1	0	5.86059e-21	0.00361	7.94868e-21	46	68				
TRPM4	54795	broad.mit.edu	37	19	49691969	49691969	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:49691969C>T	ENST00000252826.5	+	13	1941	c.1815C>T	c.(1813-1815)gaC>gaT	p.D605D	TRPM4_ENST00000355712.5_Silent_p.D251D|TRPM4_ENST00000427978.2_Silent_p.D605D	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	605					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)	p.D605D(1)		breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TGGAGCCTGACGCTGAGGAGG	0.642																																							uc002pmw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1813-1815)GAC>GAT		transient receptor potential cation channel,							102.0	88.0	93.0					19																	49691969		2203	4300	6503	SO:0001819	synonymous_variant	54795				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding	g.chr19:49691969C>T	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.1815C>T	19.37:g.49691969C>T			Somatic				TRPM4_uc010emu.2_Silent_p.D605D|TRPM4_uc010yak.1_Silent_p.D69D|TRPM4_uc002pmx.2_Silent_p.D431D|TRPM4_uc010emv.2_Silent_p.D490D|TRPM4_uc010yal.1_Silent_p.D251D|TRPM4_uc002pmy.2_Translation_Start_Site	p.D605D	NM_017636	NP_060106	WXS	Illumina HiSeq	Unspecified	Q8TD43	TRPM4_HUMAN		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)	13	1887	+		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)	605			Cytoplasmic (Potential).		A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Silent	SNP	ENST00000252826.5	37	c.1815C>T	CCDS33073.1																																																																																				0.642	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636		14	38	0	0	0	0.001882	0	14	38				
SIGLEC11	114132	broad.mit.edu	37	19	50462124	50462124	+	Missense_Mutation	SNP	G	G	C	rs149136670	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:50462124G>C	ENST00000447370.2	-	7	1229	c.1139C>G	c.(1138-1140)cCg>cGg	p.P380R	CTC-326K19.6_ENST00000451973.1_5'Flank|SIGLEC11_ENST00000426971.2_Missense_Mutation_p.P380R	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	380	Ig-like C2-type 3.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.P368R(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CTCCAGGACCGGGAGGGATGT	0.672													G|||	11	0.00219649	0.0061	0.0043	5008	,	,		16499	0.0		0.0	False		,,,				2504	0.0						uc010ybh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(1138-1140)CCG>CGG		sialic acid binding Ig-like lectin 11 isoform 1		G	ARG/PRO,ARG/PRO	9,4397		0,9,2194	32.0	37.0	35.0		1139,1139	2.2	0.0	19	dbSNP_134	35	9,8591		0,9,4291	no	missense,missense	SIGLEC11	NM_001135163.1,NM_052884.2	103,103	0,18,6485	CC,CG,GG		0.1047,0.2043,0.1384	benign,benign	380/603,380/699	50462124	18,12988	2203	4300	6503	SO:0001583	missense	114132				cell adhesion	integral to membrane	sugar binding	g.chr19:50462124G>C	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1139C>G	19.37:g.50462124G>C	ENSP00000412361:p.Pro380Arg		Somatic				SIGLEC11_uc010ybi.1_Missense_Mutation_p.P380R	p.P380R	NM_052884	NP_443116	WXS	Illumina HiSeq	Unspecified	Q96RL6	SIG11_HUMAN		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)	7	1230	-		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)	380			Ig-like C2-type 3.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000447370.2	37	c.1139C>G	CCDS12790.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.80|10.80	1.451864|1.451864	0.26074|0.26074	0.002043|0.002043	0.001047|0.001047	ENSG00000161640|ENSG00000161640	ENST00000447370;ENST00000458019|ENST00000426971	T|.	0.08984|.	3.03|.	3.24|3.24	2.15|2.15	0.27550|0.27550	Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	1.767760|.	0.02491|.	N|.	0.089519|.	T|T	0.36386|0.36386	0.0965|0.0965	L|L	0.41632|0.41632	1.29|1.29	0.09310|0.09310	N|N	1|1	P;B|.	0.35411|.	0.5;0.374|.	B;B|.	0.37888|.	0.26;0.199|.	T|T	0.22556|0.22556	-1.0213|-1.0213	10|5	0.48119|.	T|.	0.1|.	.|.	8.0853|8.0853	0.30769|0.30769	0.0:0.0:0.7569:0.2431|0.0:0.0:0.7569:0.2431	.|.	380;380|.	Q96RL6-2;Q96RL6|.	.;SIG11_HUMAN|.	R|G	380|370	ENSP00000412361:P380R|.	ENSP00000412361:P380R|.	P|R	-|-	2|1	0|2	SIGLEC11|SIGLEC11	55153936|55153936	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.278000|0.278000	0.26855|0.26855	0.153000|0.153000	0.16323|0.16323	0.609000|0.609000	0.30018|0.30018	0.556000|0.556000	0.70494|0.70494	CCG|CGG		0.672	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884		11	21	0	0	0	0.00499	0	11	21				
NR1H2	7376	broad.mit.edu	37	19	50885781	50885781	+	Silent	SNP	G	G	A	rs372744682		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:50885781G>A	ENST00000253727.5	+	10	1540	c.1305G>A	c.(1303-1305)tcG>tcA	p.S435S	NR1H2_ENST00000593926.1_Silent_p.S435S|POLD1_ENST00000440232.2_5'Flank|NR1H2_ENST00000598168.1_Silent_p.S405S|POLD1_ENST00000599857.1_5'Flank|NR1H2_ENST00000542413.1_Silent_p.S166S|NR1H2_ENST00000411902.2_Silent_p.S338S|NR1H2_ENST00000599105.1_Silent_p.S391S	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	435	Ligand-binding. {ECO:0000255}.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S435S(1)		endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CTGTGCACTCGGAGCAGGTCT	0.672																																							uc010enw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1306-1308)TCG>TCA		nuclear receptor subfamily 1, group H, member 2				0,4242		0,0,2121	21.0	26.0	24.0		1305	-6.1	1.0	19		24	1,8499		0,1,4249	no	coding-synonymous	NR1H2	NM_007121.4		0,1,6370	AA,AG,GG		0.0118,0.0,0.0078		435/461	50885781	1,12741	2121	4250	6371	SO:0001819	synonymous_variant	7376				negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of pinocytosis|negative regulation of transcription, DNA-dependent|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding	g.chr19:50885781G>A	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.1305G>A	19.37:g.50885781G>A			Somatic				NR1H2_uc002prv.3_RNA|NR1H2_uc002prz.3_Silent_p.S391S|NR1H2_uc002psa.3_Silent_p.S338S|POLD1_uc002psb.3_5'Flank|POLD1_uc002psc.3_5'Flank|POLD1_uc010enx.2_5'Flank	p.S436S	NM_007121	NP_009052	WXS	Illumina HiSeq	Unspecified	P55055	NR1H2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)	11	1584	+		all_neural(266;0.057)	435			Ligand-binding (Potential).		A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	ENST00000253727.5	37	c.1308G>A	CCDS42593.1																																																																																				0.672	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2			3	5	0	0	0	0.000602	0	3	5				
MYBPC2	4606	broad.mit.edu	37	19	50957609	50957609	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:50957609G>A	ENST00000357701.5	+	18	2048	c.1997G>A	c.(1996-1998)gGg>gAg	p.G666E		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	666	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.G666E(1)		breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		ATGTACGATGGGGGGAAGCCA	0.542																																							uc002psf.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1996-1998)GGG>GAG		myosin binding protein C, fast type							38.0	41.0	40.0					19																	50957609		2044	4188	6232	SO:0001583	missense	4606				cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle	g.chr19:50957609G>A		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1997G>A	19.37:g.50957609G>A	ENSP00000350332:p.Gly666Glu		Somatic					p.G666E	NM_004533	NP_004524	WXS	Illumina HiSeq	Unspecified	Q14324	MYPC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)	18	2048	+		all_neural(266;0.057)	666			Fibronectin type-III 1.		A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	37	c.1997G>A	CCDS46152.1	.	.	.	.	.	.	.	.	.	.	g	13.82	2.351901	0.41700	.	.	ENSG00000086967	ENST00000357701	T	0.57595	0.39	3.47	3.47	0.39725	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.35151	U	0.003415	T	0.82006	0.4943	H	0.99058	4.415	0.45962	D	0.998789	D	0.89917	1.0	D	0.97110	1.0	D	0.87845	0.2654	10	0.62326	D	0.03	.	12.345	0.55116	0.0:0.0:1.0:0.0	.	666	Q14324	MYPC2_HUMAN	E	666	ENSP00000350332:G666E	ENSP00000350332:G666E	G	+	2	0	MYBPC2	55649421	1.000000	0.71417	0.999000	0.59377	0.074000	0.17049	8.158000	0.89649	1.978000	0.57642	0.450000	0.29827	GGG		0.542	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533		40	58	0	0	0	0.00361	0	40	58				
SIGLECL1	284369	broad.mit.edu	37	19	51770634	51770634	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:51770634C>A	ENST00000316401.7	+	5	799	c.418C>A	c.(418-420)Cat>Aat	p.H140N	CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000593968.1_3'UTR|SIGLECL1_ENST00000597824.1_Missense_Mutation_p.H46N	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	504	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.H140N(1)									TAGAGTGAAACATATCAGAAA	0.453																																							uc002pwb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(418-420)CAT>AAT		hypothetical protein LOC284369							124.0	127.0	126.0					19																	51770634		2203	4300	6503	SO:0001583	missense	284369					integral to membrane		g.chr19:51770634C>A	AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.418C>A	19.37:g.51770634C>A	ENSP00000321249:p.His140Asn		Somatic				C19orf75_uc010eov.1_RNA|C19orf75_uc010ycw.1_Missense_Mutation_p.H46N	p.H140N	NM_173635	NP_775906	WXS	Illumina HiSeq	Unspecified	Q8N7X8	CS075_HUMAN			5	799	+			140					Q8IYH7	Missense_Mutation	SNP	ENST00000316401.7	37	c.418C>A	CCDS12827.1	.	.	.	.	.	.	.	.	.	.	C	7.427	0.637821	0.14386	.	.	ENSG00000179213	ENST00000316401	T	0.30448	1.53	3.7	1.57	0.23409	.	1.722310	0.03364	N	0.197990	T	0.24431	0.0592	L	0.29908	0.895	0.09310	N	1	P;P	0.46512	0.879;0.718	B;B	0.42245	0.381;0.279	T	0.18023	-1.0350	10	0.26408	T	0.33	-1.7619	5.9953	0.19491	0.0:0.7624:0.0:0.2376	.	46;140	B7ZLS6;Q8N7X8	.;CS075_HUMAN	N	140	ENSP00000321249:H140N	ENSP00000321249:H140N	H	+	1	0	C19orf75	56462446	0.016000	0.18221	0.058000	0.19502	0.813000	0.45954	0.006000	0.13152	0.541000	0.28827	-0.145000	0.13849	CAT		0.453	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2	NM_173635		81	244	1	0	1.36798e-35	0.00361	2.12259e-35	81	244				
ZNF610	162963	broad.mit.edu	37	19	52869019	52869019	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:52869019G>T	ENST00000403906.3	+	6	844	c.388G>T	c.(388-390)Gag>Tag	p.E130*	ZNF610_ENST00000321287.8_Nonsense_Mutation_p.E130*|ZNF610_ENST00000601151.1_Nonsense_Mutation_p.E87*|ZNF610_ENST00000327920.8_Nonsense_Mutation_p.E130*	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E130*(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		ATTAACCCTTGAGGCACATCT	0.398																																							uc002pyx.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(388-390)GAG>TAG		zinc finger protein 610 isoform a							117.0	127.0	124.0					19																	52869019		2203	4300	6503	SO:0001587	stop_gained	162963				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52869019G>T	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.388G>T	19.37:g.52869019G>T	ENSP00000383922:p.Glu130*		Somatic				ZNF610_uc002pyy.3_Nonsense_Mutation_p.E130*|ZNF610_uc002pyz.3_Nonsense_Mutation_p.E87*|ZNF610_uc002pza.2_Nonsense_Mutation_p.E130*	p.E130*	NM_001161426	NP_001154898	WXS	Illumina HiSeq	Unspecified	Q8N9Z0	ZN610_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)	6	794	+			130					A8K4C3|Q86YH8|Q8NDS9	Nonsense_Mutation	SNP	ENST00000403906.3	37	c.388G>T	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	G	18.28	3.589995	0.66105	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	.	.	.	1.11	-0.137	0.13469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	3.0981	0.06317	0.2747:0.4051:0.3202:0.0	.	.	.	.	X	130;87;130	.	ENSP00000324441:E87X	E	+	1	0	ZNF610	57560831	0.002000	0.14202	0.002000	0.10522	0.021000	0.10359	0.059000	0.14322	0.009000	0.14813	0.313000	0.20887	GAG		0.398	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530		77	134	1	0	3.11363e-52	0.00361	5.16826e-52	77	134				
NLRP12	91662	broad.mit.edu	37	19	54314478	54314478	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:54314478C>A	ENST00000324134.6	-	3	603	c.435G>T	c.(433-435)gcG>gcT	p.A145A	NLRP12_ENST00000351894.4_Silent_p.A145A|NLRP12_ENST00000391773.1_Silent_p.A145A|NLRP12_ENST00000391775.3_Silent_p.A145A|NLRP12_ENST00000354278.3_Silent_p.A145A|NLRP12_ENST00000345770.5_Silent_p.A145A|NLRP12_ENST00000391772.1_Silent_p.A145A|NLRP12_ENST00000535162.1_Silent_p.A145A	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	145					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.A145A(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CCCCTAGGCGCGCATTGCGGT	0.567																																							uc002qch.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(433-435)GCG>GCT		NLR family, pyrin domain containing 12 isoform							91.0	88.0	89.0					19																	54314478		2203	4300	6503	SO:0001819	synonymous_variant	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54314478C>A	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.435G>T	19.37:g.54314478C>A			Somatic				NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Silent_p.A145A|NLRP12_uc002qcj.3_Silent_p.A145A|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.A145A	p.A145A	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	3	655	-	Ovarian(34;0.19)		145					A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	37	c.435G>T	CCDS12864.1																																																																																				0.567	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		30	67	1	0	2.6416e-12	0.00623	3.22298e-12	30	67				
KIR3DL2	3812	broad.mit.edu	37	19	55378056	55378056	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:55378056G>T	ENST00000326321.3	+	9	1271	c.1238G>T	c.(1237-1239)cGc>cTc	p.R413L	KIR3DL1_ENST00000402254.2_Missense_Mutation_p.R413L|KIR3DL2_ENST00000270442.5_Missense_Mutation_p.R396L|RNU6-222P_ENST00000362438.1_RNA	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	413					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.R413L(2)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		AAAATCAGTCGCCCTTCTCAG	0.517																																							uc002qhl.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5						c.(1237-1239)CGC>CTC		SubName: Full=KIR3DS1;							266.0	259.0	261.0					19																	55378056		2203	4300	6503	SO:0001583	missense	3811				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity	g.chr19:55378056G>T	L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.1238G>T	19.37:g.55378056G>T	ENSP00000325525:p.Arg413Leu		Somatic				KIR3DL2_uc010esh.2_Missense_Mutation_p.R396L|KIR3DL2_uc002qho.3_Missense_Mutation_p.R413L	p.R413L			WXS	Illumina HiSeq	Unspecified	P43629	KI3L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	9	1301	+			413			Cytoplasmic (Potential).		Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	ENST00000326321.3	37	c.1238G>T	CCDS12906.1	.	.	.	.	.	.	.	.	.	.	G	7.746	0.702295	0.15172	.	.	ENSG00000167633;ENSG00000240403;ENSG00000240403	ENST00000402254;ENST00000326321;ENST00000270442	T;T;T	0.00482	7.2;7.17;7.1	1.59	-0.883	0.10600	.	.	.	.	.	T	0.01029	0.0034	M	0.79805	2.47	0.09310	N	1	B;D;D	0.71674	0.095;0.997;0.998	B;D;D	0.79784	0.081;0.985;0.993	T	0.49254	-0.8959	9	0.87932	D	0	.	2.5759	0.04806	0.0:0.4307:0.3345:0.2348	.	396;413;413	Q95366;P43630;F6QF33	.;KI3L2_HUMAN;.	L	413;413;396	ENSP00000384528:R413L;ENSP00000325525:R413L;ENSP00000270442:R396L	ENSP00000384528:R413L	R	+	2	0	KIR3DL1;KIR3DL2	60069868	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.536000	0.06135	0.027000	0.15297	-0.751000	0.03497	CGC		0.517	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1			312	499	1	0	7.70712e-192	0.00361	1.4242e-191	312	499				
NLRP4	147945	broad.mit.edu	37	19	56392837	56392837	+	Splice_Site	SNP	C	C	A	rs201553895		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:56392837C>A	ENST00000301295.6	+	10	3291	c.2869C>A	c.(2869-2871)Ctg>Atg	p.L957M	NLRP4_ENST00000346986.5_Splice_Site_p.L901M|NLRP4_ENST00000587891.1_Splice_Site_p.L882M	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	957				L -> P (in Ref. 4; AAL88672). {ECO:0000305}.	inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.L957M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TTTTACCAGGCTGAGAAAAAC	0.418																																							uc002qmd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.(2869-2871)CTG>ATG		NLR family, pyrin domain containing 4							40.0	38.0	39.0					19																	56392837		2203	4300	6503	SO:0001630	splice_region_variant	147945						ATP binding	g.chr19:56392837C>A	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2868-1C>A	19.37:g.56392837C>A			Somatic				NLRP4_uc002qmf.2_Missense_Mutation_p.L882M|NLRP4_uc010etf.2_Missense_Mutation_p.L732M	p.L957M	NM_134444	NP_604393	WXS	Illumina HiSeq	Unspecified	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	10	3291	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	957	L -> P (in Ref. 4; AAL88672).		LRR 8.		Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	c.2869C>A	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.991083	0.35131	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.70516	0.35;-0.49	3.36	2.29	0.28610	.	.	.	.	.	D	0.83936	0.5362	M	0.88241	2.94	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	T	0.70766	-0.4783	9	0.66056	D	0.02	.	7.8436	0.29412	0.2469:0.7531:0.0:0.0	.	901;882;957	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	M	957;901	ENSP00000301295:L957M;ENSP00000344787:L901M	ENSP00000301295:L957M	L	+	1	2	NLRP4	61084649	0.528000	0.26314	0.022000	0.16811	0.023000	0.10783	0.714000	0.25808	0.930000	0.37217	0.650000	0.86243	CTG		0.418	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	Missense_Mutation	13	18	1	0	1.67942e-08	0.006122	1.91789e-08	13	18				
SNTG2	54221	broad.mit.edu	37	2	1168851	1168851	+	Missense_Mutation	SNP	C	C	A	rs372258891		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:1168851C>A	ENST00000308624.5	+	8	702	c.573C>A	c.(571-573)aaC>aaA	p.N191K	SNTG2_ENST00000467759.1_3'UTR|SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	191					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)	p.N191K(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TGCATCTGAACGGAAACTCCA	0.448																																							uc002qwq.2		NA																	2	Substitution - Missense(2)	p.N191K(1)	large_intestine(1)|lung(1)	ovary(1)|large_intestine(1)|breast(1)	3						c.(571-573)AAC>AAA		syntrophin, gamma 2							156.0	156.0	156.0					2																	1168851		1911	4116	6027	SO:0001583	missense	54221				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding	g.chr2:1168851C>A	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.573C>A	2.37:g.1168851C>A	ENSP00000311837:p.Asn191Lys		Somatic				SNTG2_uc010ewi.2_Intron	p.N191K	NM_018968	NP_061841	WXS	Illumina HiSeq	Unspecified	Q9NY99	SNTG2_HUMAN		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)	8	701	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)	191					Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	c.573C>A	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	c	11.37	1.619965	0.28801	.	.	ENSG00000172554	ENST00000308624	T	0.38077	1.16	4.73	-3.49	0.04724	.	0.000000	0.85682	D	0.000000	T	0.52917	0.1764	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.54063	-0.8349	10	0.32370	T	0.25	.	12.497	0.55933	0.0:0.151:0.0:0.849	.	191	Q9NY99	SNTG2_HUMAN	K	191	ENSP00000311837:N191K	ENSP00000311837:N191K	N	+	3	2	SNTG2	1158851	0.972000	0.33761	0.023000	0.16930	0.138000	0.21146	-0.198000	0.09505	-0.620000	0.05641	-0.753000	0.03488	AAC		0.448	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968		161	338	1	0	4.95515e-46	0.00361	8.01526e-46	161	338				
PXDN	7837	broad.mit.edu	37	2	1652268	1652268	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:1652268T>A	ENST00000252804.4	-	17	3334	c.3284A>T	c.(3283-3285)cAc>cTc	p.H1095L		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1095					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.H1095L(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AAGGGGGAGGTGATCTTGTGC	0.582																																							uc002qxa.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(6)|ovary(2)	8						c.(3283-3285)CAC>CTC		peroxidasin precursor							43.0	53.0	49.0					2																	1652268		2140	4233	6373	SO:0001583	missense	7837				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity	g.chr2:1652268T>A	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3284A>T	2.37:g.1652268T>A	ENSP00000252804:p.His1095Leu		Somatic					p.H1095L	NM_012293	NP_036425	WXS	Illumina HiSeq	Unspecified	Q92626	PXDN_HUMAN		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)	17	3348	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)	1095					A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	c.3284A>T	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.915061	0.33815	.	.	ENSG00000130508	ENST00000252804	T	0.72725	-0.68	5.48	3.01	0.34805	.	0.102199	0.64402	D	0.000002	T	0.79251	0.4414	M	0.75884	2.315	0.54753	D	0.999982	P	0.41546	0.754	P	0.54174	0.744	T	0.78224	-0.2287	10	0.54805	T	0.06	-36.3389	12.3579	0.55186	0.0:0.0:0.267:0.733	.	1095	Q92626	PXDN_HUMAN	L	1095	ENSP00000252804:H1095L	ENSP00000252804:H1095L	H	-	2	0	PXDN	1631275	1.000000	0.71417	0.226000	0.23910	0.001000	0.01503	6.208000	0.72165	0.348000	0.23949	-0.320000	0.08662	CAC		0.582	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455		6	10	0	0	0	0.00308	0	6	10				
TRAPPC12	51112	broad.mit.edu	37	2	3405596	3405596	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:3405596G>T	ENST00000324266.5	+	3	1291	c.1096G>T	c.(1096-1098)Gca>Tca	p.A366S	TRAPPC12_ENST00000382110.2_Missense_Mutation_p.A366S	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	366					vesicle-mediated transport (GO:0016192)			p.A366S(1)									TGAAAAAGCTGCAGCAAAGAG	0.378																																							uc002qxm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|pancreas(1)	4						c.(1096-1098)GCA>TCA		tetratricopeptide repeat domain 15							194.0	192.0	193.0					2																	3405596		2203	4300	6503	SO:0001583	missense	51112						binding	g.chr2:3405596G>T	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.1096G>T	2.37:g.3405596G>T	ENSP00000324318:p.Ala366Ser		Somatic				TTC15_uc002qxn.1_Missense_Mutation_p.A366S|TTC15_uc010ewm.1_Missense_Mutation_p.A366S	p.A366S	NM_016030	NP_057114	WXS	Illumina HiSeq	Unspecified	Q8WVT3	TTC15_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)	3	1302	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)	366					B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	ENST00000324266.5	37	c.1096G>T	CCDS1652.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.013155	0.54468	.	.	ENSG00000171853	ENST00000382110;ENST00000304601;ENST00000324266	T;T	0.55588	0.51;0.51	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.64405	0.2595	M	0.79926	2.475	0.80722	D	1	D;P	0.54397	0.966;0.941	P;P	0.49752	0.621;0.621	T	0.64782	-0.6326	10	0.28530	T	0.3	.	17.7305	0.88376	0.0:0.0:1.0:0.0	.	349;366	E7ENL7;Q8WVT3	.;TPC12_HUMAN	S	366;349;366	ENSP00000371544:A366S;ENSP00000324318:A366S	ENSP00000303612:A349S	A	+	1	0	TTC15	3384603	1.000000	0.71417	0.992000	0.48379	0.967000	0.64934	8.675000	0.91195	2.605000	0.88082	0.655000	0.94253	GCA		0.378	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030		67	125	1	0	3.20846e-33	0.00361	4.78338e-33	67	125				
ASAP2	8853	broad.mit.edu	37	2	9525405	9525405	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:9525405C>T	ENST00000281419.3	+	21	2388	c.2048C>T	c.(2047-2049)tCt>tTt	p.S683F	ASAP2_ENST00000315273.4_Missense_Mutation_p.S683F	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	683					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)	p.S683F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AGATTTAATTCTCACGTTCAC	0.483																																							uc002qzh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2047-2049)TCT>TTT		ArfGAP with SH3 domain, ankyrin repeat and PH							171.0	136.0	148.0					2																	9525405		2203	4300	6503	SO:0001583	missense	8853				regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding	g.chr2:9525405C>T	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2048C>T	2.37:g.9525405C>T	ENSP00000281419:p.Ser683Phe		Somatic				ASAP2_uc002qzi.2_Missense_Mutation_p.S683F	p.S683F	NM_003887	NP_003878	WXS	Illumina HiSeq	Unspecified	O43150	ASAP2_HUMAN			21	2388	+			683					D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	c.2048C>T	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.583771	0.65992	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.57907	0.41;0.37	5.48	4.6	0.57074	Ankyrin repeat-containing domain (1);	0.172475	0.51477	D	0.000081	T	0.39489	0.1080	N	0.24115	0.695	0.47584	D	0.999468	B;P	0.49696	0.223;0.927	B;B	0.42593	0.042;0.392	T	0.14144	-1.0483	10	0.23891	T	0.37	.	14.0423	0.64684	0.0:0.928:0.0:0.072	.	683;683	O43150-2;O43150	.;ASAP2_HUMAN	F	683	ENSP00000281419:S683F;ENSP00000316404:S683F	ENSP00000281419:S683F	S	+	2	0	ASAP2	9442856	0.950000	0.32346	0.804000	0.32291	0.949000	0.60115	2.167000	0.42415	1.321000	0.45227	0.655000	0.94253	TCT		0.483	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887		8	174	0	0	0	0.008291	0	8	174				
APOB	338	broad.mit.edu	37	2	21224784	21224784	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:21224784C>T	ENST00000233242.1	-	29	13637	c.13510G>A	c.(13510-13512)Gac>Aac	p.D4504N	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4504					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.D4504N(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGAGTTGGTCTGAAAAATCT	0.358																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(13510-13512)GAC>AAC		apolipoprotein B precursor	Atorvastatin(DB01076)						96.0	106.0	103.0					2																	21224784		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21224784C>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.13510G>A	2.37:g.21224784C>T	ENSP00000233242:p.Asp4504Asn		Somatic					p.D4504N	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			29	13638	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		4504					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.13510G>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753786	0.69648	.	.	ENSG00000084674	ENST00000233242	T	0.00695	5.83	5.68	4.8	0.61643	.	0.118903	0.38492	N	0.001676	T	0.01189	0.0039	L	0.53249	1.67	0.80722	D	1	B	0.18166	0.026	B	0.21917	0.037	T	0.60203	-0.7309	10	0.36615	T	0.2	.	10.858	0.46810	0.0:0.8561:0.0:0.1439	.	4504	P04114	APOB_HUMAN	N	4504	ENSP00000233242:D4504N	ENSP00000233242:D4504N	D	-	1	0	APOB	21078289	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.698000	0.25571	1.397000	0.46682	0.591000	0.81541	GAC		0.358	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			18	49	0	0	0	0.007413	0	18	49				
TMEM214	54867	broad.mit.edu	37	2	27262916	27262916	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:27262916G>T	ENST00000238788.9	+	15	1703	c.1641G>T	c.(1639-1641)ctG>ctT	p.L547L	TMEM214_ENST00000404032.3_Silent_p.L502L	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	547					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.L547L(1)		kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						GGGAGACACTGCCGCTCTGGG	0.627																																							uc002ria.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1639-1641)CTG>CTT		transmembrane protein 214 isoform 1							43.0	45.0	44.0					2																	27262916		1987	4168	6155	SO:0001819	synonymous_variant	54867					integral to membrane	protein binding	g.chr2:27262916G>T		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.1641G>T	2.37:g.27262916G>T			Somatic				TMEM214_uc010yle.1_RNA|TMEM214_uc002rib.3_Silent_p.L502L	p.L547L	NM_017727	NP_060197	WXS	Illumina HiSeq	Unspecified	Q6NUQ4	TM214_HUMAN			15	1751	+			547					A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Silent	SNP	ENST00000238788.9	37	c.1641G>T	CCDS42664.1																																																																																				0.627	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727		6	13	1	0	5.50884e-06	0.001368	6.00295e-06	6	13				
XDH	7498	broad.mit.edu	37	2	31570447	31570447	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:31570447G>C	ENST00000379416.3	-	29	3265	c.3217C>G	c.(3217-3219)Ccc>Gcc	p.P1073A		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	1073					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.P1073A(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GAGGTGTTGGGCACAGTGTTA	0.562																																					Colon(66;682 1445 30109 40147)	Colon(66;682 1445 30109 40147)	uc002rnv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8						c.(3217-3219)CCC>GCC		xanthine dehydrogenase	Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)						109.0	109.0	109.0					2																	31570447		2203	4300	6503	SO:0001583	missense	7498				purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity	g.chr2:31570447G>C	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.3217C>G	2.37:g.31570447G>C	ENSP00000368727:p.Pro1073Ala		Somatic					p.P1073A	NM_000379	NP_000370	WXS	Illumina HiSeq	Unspecified	P47989	XDH_HUMAN			29	3296	-	Acute lymphoblastic leukemia(172;0.155)		1073					Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	c.3217C>G	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260098	0.80246	.	.	ENSG00000158125	ENST00000379416	T	0.52295	0.67	5.85	5.85	0.93711	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.046829	0.85682	D	0.000000	T	0.62853	0.2462	L	0.56769	1.78	0.80722	D	1	D	0.59357	0.985	P	0.57009	0.811	T	0.61695	-0.7010	10	0.54805	T	0.06	.	19.7753	0.96389	0.0:0.0:1.0:0.0	.	1073	P47989	XDH_HUMAN	A	1073	ENSP00000368727:P1073A	ENSP00000368727:P1073A	P	-	1	0	XDH	31423951	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	6.606000	0.74159	2.753000	0.94483	0.655000	0.94253	CCC		0.562	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379		34	58	0	0	0	0.00361	0	34	58				
THUMPD2	80745	broad.mit.edu	37	2	39997215	39997215	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:39997215C>A	ENST00000505747.1	-	3	334	c.307G>T	c.(307-309)Gga>Tga	p.G103*	THUMPD2_ENST00000454352.2_Nonsense_Mutation_p.G73*|THUMPD2_ENST00000260619.6_Nonsense_Mutation_p.G73*|THUMPD2_ENST00000403537.3_5'UTR	NM_025264.4	NP_079540.2	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2	103							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.G73*(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	17		all_hematologic(82;0.248)				AACCAACTTCCTGGATCTTCA	0.289																																							uc002rru.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(307-309)GGA>TGA		THUMP domain containing 2							46.0	47.0	47.0					2																	39997215		2193	4283	6476	SO:0001587	stop_gained	80745						methyltransferase activity	g.chr2:39997215C>A	AF380576	CCDS1805.1, CCDS1805.2	2p22.2	2004-06-04	2004-06-04	2004-06-04	ENSG00000138050	ENSG00000138050			14890	protein-coding gene	gene with protein product		611751	"""chromosome 2 open reading frame 8"""	C2orf8		12063391	Standard	NM_025264		Approved	MGC2454	uc002rru.2	Q9BTF0	OTTHUMG00000102149	ENST00000505747.1:c.307G>T	2.37:g.39997215C>A	ENSP00000423933:p.Gly103*		Somatic				THUMPD2_uc002rrv.2_RNA|THUMPD2_uc010ynt.1_Nonsense_Mutation_p.G10*|THUMPD2_uc010ynu.1_Nonsense_Mutation_p.G103*	p.G103*	NM_025264	NP_079540	WXS	Illumina HiSeq	Unspecified	Q9BTF0	THUM2_HUMAN			3	344	-		all_hematologic(82;0.248)	103					A8K7I7|Q53TT8|Q53TV0	Nonsense_Mutation	SNP	ENST00000505747.1	37	c.307G>T	CCDS1805.2	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641166	0.47153	.	.	ENSG00000138050	ENST00000505747;ENST00000260619;ENST00000454352	.	.	.	5.71	3.63	0.41609	.	0.931310	0.09225	N	0.831432	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.5821	0.12264	0.0:0.6329:0.2319:0.1352	.	.	.	.	X	103;73;73	.	.	G	-	1	0	THUMPD2	39850719	0.001000	0.12720	0.152000	0.22495	0.267000	0.26476	0.118000	0.15605	1.370000	0.46153	0.650000	0.86243	GGA		0.289	THUMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219991.2	NM_025264		6	18	1	0	0.00448238	0.004482	0.00463667	6	18				
SLC8A1	6546	broad.mit.edu	37	2	40656621	40656621	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:40656621C>A	ENST00000403092.1	-	2	833	c.800G>T	c.(799-801)cGa>cTa	p.R267L	SLC8A1_ENST00000405901.3_Missense_Mutation_p.R267L|SLC8A1_ENST00000408028.2_Missense_Mutation_p.R267L|SLC8A1_ENST00000406785.2_Missense_Mutation_p.R267L|SLC8A1_ENST00000405269.1_Missense_Mutation_p.R267L|SLC8A1_ENST00000406391.2_Missense_Mutation_p.R267L|SLC8A1_ENST00000402441.1_Missense_Mutation_p.R267L|SLC8A1_ENST00000542756.1_Missense_Mutation_p.R267L|SLC8A1_ENST00000542024.1_Missense_Mutation_p.R267L|SLC8A1_ENST00000332839.4_Missense_Mutation_p.R267L			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	267	Calmodulin-binding. {ECO:0000255}.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.R267L(2)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CTTGCCAGCTCGATACCTCTT	0.433																																							uc002rrx.2		NA																	2	Substitution - Missense(2)	p.R267L(1)	ovary(1)|lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(799-801)CGA>CTA		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						152.0	151.0	151.0					2																	40656621		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40656621C>A		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.800G>T	2.37:g.40656621C>A	ENSP00000384763:p.Arg267Leu		Somatic				SLC8A1_uc002rry.2_Missense_Mutation_p.R267L|SLC8A1_uc002rrz.2_Missense_Mutation_p.R267L|SLC8A1_uc002rsa.2_Missense_Mutation_p.R267L|SLC8A1_uc002rsd.3_Missense_Mutation_p.R267L|SLC8A1_uc002rsb.1_Missense_Mutation_p.R267L|SLC8A1_uc010fan.1_Missense_Mutation_p.R267L|SLC8A1_uc002rsc.1_Missense_Mutation_p.R267L	p.R267L	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			1	824	-			267			Calmodulin-binding (Potential).|Cytoplasmic (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.800G>T	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.160500	0.57368	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.34472	1.39;1.43;1.43;1.43;1.39;1.39;1.43;1.36;1.39;1.39	5.96	5.09	0.68999	.	0.178064	0.51477	D	0.000100	T	0.63307	0.2500	M	0.85859	2.78	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.996;1.0;1.0;0.999	D;D;D;D;D	0.85130	0.996;0.995;0.996;0.997;0.991	T	0.69221	-0.5202	10	0.66056	D	0.02	.	12.9583	0.58442	0.0:0.9223:0.0:0.0777	.	267;267;267;267;267	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	L	267	ENSP00000383886:R267L;ENSP00000440727:R267L;ENSP00000384763:R267L;ENSP00000385678:R267L;ENSP00000385188:R267L;ENSP00000385535:R267L;ENSP00000332931:R267L;ENSP00000384908:R267L;ENSP00000385811:R267L;ENSP00000443515:R267L	ENSP00000332931:R267L	R	-	2	0	SLC8A1	40510125	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	7.663000	0.83820	1.540000	0.49301	0.655000	0.94253	CGA		0.433	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		76	181	1	0	8.92586e-32	0.00361	1.31357e-31	76	181				
FSHR	2492	broad.mit.edu	37	2	49190064	49190064	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:49190064G>T	ENST00000406846.2	-	10	2015	c.1896C>A	c.(1894-1896)aaC>aaA	p.N632K	FSHR_ENST00000346173.3_Missense_Mutation_p.N570K|FSHR_ENST00000304421.4_Missense_Mutation_p.N606K|FSHR_ENST00000541117.1_Missense_Mutation_p.N368K	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	632					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.N632K(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CTCTGCGAAAGTTTTTGGTAA	0.463									Gonadal Dysgenesis, 46 XX																														uc002rww.2		NA																	2	Substitution - Missense(2)	p.N632K(1)	ovary(1)|lung(1)	ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8						c.(1894-1896)AAC>AAA		follicle stimulating hormone receptor isoform 1	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)						80.0	82.0	81.0					2																	49190064		2203	4300	6503	SO:0001583	missense	2492	Gonadal_Dysgenesis_46_XX	Familial Cancer Database		female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding	g.chr2:49190064G>T		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1896C>A	2.37:g.49190064G>T	ENSP00000384708:p.Asn632Lys		Somatic				FSHR_uc002rwx.2_Missense_Mutation_p.N570K|FSHR_uc010fbn.2_Missense_Mutation_p.N606K	p.N632K	NM_000145	NP_000136	WXS	Illumina HiSeq	Unspecified	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		10	1970	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	632			Cytoplasmic (Potential).		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	c.1896C>A	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.521950	0.27211	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.35	-0.16	0.13375	.	0.373020	0.30584	N	0.009315	T	0.31358	0.0794	M	0.67953	2.075	0.34427	D	0.698132	B;B;B	0.32717	0.381;0.374;0.381	B;B;B	0.36244	0.11;0.22;0.11	T	0.22906	-1.0203	9	.	.	.	.	5.3237	0.15895	0.5896:0.0:0.2522:0.1581	.	606;570;632	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	K	632;570;606;368	ENSP00000384708:N632K;ENSP00000333908:N570K;ENSP00000306780:N606K;ENSP00000444172:N368K	.	N	-	3	2	FSHR	49043568	0.295000	0.24389	0.993000	0.49108	0.988000	0.76386	-0.335000	0.07873	0.051000	0.15978	0.655000	0.94253	AAC		0.463	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			34	76	1	0	2.32173e-10	0.004878	2.7278e-10	34	76				
VRK2	7444	broad.mit.edu	37	2	58350345	58350345	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:58350345G>T	ENST00000435505.2	+	11	1398	c.653G>T	c.(652-654)aGc>aTc	p.S218I	VRK2_ENST00000340157.4_Missense_Mutation_p.S218I|VRK2_ENST00000417641.2_Missense_Mutation_p.S218I|VRK2_ENST00000440705.2_Missense_Mutation_p.S195I|VRK2_ENST00000412104.2_Missense_Mutation_p.S218I			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	218	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S218I(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						GAGTTTACCAGCTTGGATGCC	0.388																																							uc002rzo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(652-654)AGC>ATC		vaccinia related kinase 2 isoform 2							105.0	102.0	103.0					2																	58350345		2203	4300	6503	SO:0001583	missense	7444					integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr2:58350345G>T	AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.653G>T	2.37:g.58350345G>T	ENSP00000408002:p.Ser218Ile		Somatic				VRK2_uc010fcb.2_Missense_Mutation_p.S218I|VRK2_uc002rzs.2_Missense_Mutation_p.S218I|VRK2_uc002rzr.2_Missense_Mutation_p.S218I|VRK2_uc010fcc.2_Missense_Mutation_p.S100I|VRK2_uc002rzv.2_Missense_Mutation_p.S218I|VRK2_uc010fcd.2_Missense_Mutation_p.S195I|VRK2_uc002rzp.2_Missense_Mutation_p.S218I|VRK2_uc010ypg.1_Missense_Mutation_p.S218I|VRK2_uc002rzq.2_Missense_Mutation_p.S218I|VRK2_uc002rzu.2_Missense_Mutation_p.S218I|VRK2_uc002rzt.2_Missense_Mutation_p.S100I|VRK2_uc010yph.1_Missense_Mutation_p.S100I	p.S218I	NM_001130482	NP_001123954	WXS	Illumina HiSeq	Unspecified	Q86Y07	VRK2_HUMAN			11	1398	+			218			Protein kinase.		B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	ENST00000435505.2	37	c.653G>T	CCDS1859.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975923	0.92982	.	.	ENSG00000028116	ENST00000435505;ENST00000417641;ENST00000423109;ENST00000412104;ENST00000340157;ENST00000394539;ENST00000440705	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38	5.72	5.72	0.89469	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89825	0.6827	H	0.98333	4.205	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.995;0.998;1.0;1.0	D	0.93307	0.6681	10	0.87932	D	0	-15.4085	19.8611	0.96785	0.0:0.0:1.0:0.0	.	222;218;218;218	B7Z2X1;Q86Y07-2;Q86Y07-5;Q86Y07	.;.;.;VRK2_HUMAN	I	218;218;222;218;218;218;195	ENSP00000408002:S218I;ENSP00000402375:S218I;ENSP00000404156:S218I;ENSP00000342381:S218I;ENSP00000398323:S195I	ENSP00000342381:S218I	S	+	2	0	VRK2	58203849	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.687000	0.91594	0.585000	0.79938	AGC		0.388	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325304.2	NM_006296		66	124	1	0	3.83446e-41	0.00361	6.13298e-41	66	124				
ETAA1	54465	broad.mit.edu	37	2	67630052	67630052	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:67630052C>T	ENST00000272342.5	+	4	618	c.488C>T	c.(487-489)cCt>cTt	p.P163L	ETAA1_ENST00000462772.1_3'UTR	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	163						cytoplasm (GO:0005737)		p.P163L(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						ACTGCTATTCCTTGTACTCCC	0.368																																							uc002sdz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(487-489)CCT>CTT		ETAA16 protein							114.0	110.0	111.0					2																	67630052		2203	4300	6503	SO:0001583	missense	54465					cytoplasm|nucleus		g.chr2:67630052C>T	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.488C>T	2.37:g.67630052C>T	ENSP00000272342:p.Pro163Leu		Somatic					p.P163L	NM_019002	NP_061875	WXS	Illumina HiSeq	Unspecified	Q9NY74	ETAA1_HUMAN			4	627	+			163					Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	37	c.488C>T	CCDS1882.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351486	0.82132	.	.	ENSG00000143971	ENST00000272342	T	0.40476	1.03	6.16	6.16	0.99307	.	0.067859	0.64402	D	0.000010	T	0.64371	0.2592	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62812	-0.6775	10	0.87932	D	0	-9.2979	19.848	0.96722	0.0:1.0:0.0:0.0	.	163	Q9NY74	ETAA1_HUMAN	L	163	ENSP00000272342:P163L	ENSP00000272342:P163L	P	+	2	0	ETAA1	67483556	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.311000	0.65786	2.937000	0.99478	0.650000	0.86243	CCT		0.368	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002		40	69	0	0	0	0.00361	0	40	69				
HTRA2	27429	broad.mit.edu	37	2	74759976	74759976	+	Nonsense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:74759976T>A	ENST00000258080.3	+	8	1871	c.1241T>A	c.(1240-1242)tTg>tAg	p.L414*	AUP1_ENST00000377526.3_5'Flank|HTRA2_ENST00000467961.1_3'UTR|HTRA2_ENST00000352222.3_Nonsense_Mutation_p.L317*|LOXL3_ENST00000409249.1_3'UTR|LOXL3_ENST00000264094.3_3'UTR	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2	414	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)	p.L414*(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						GATGTGATTTTGGCCATTGGG	0.498																																							uc002smi.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1240-1242)TTG>TAG		HtrA serine peptidase 2 isoform 1 preproprotein							158.0	163.0	161.0					2																	74759976		2203	4300	6503	SO:0001587	stop_gained	27429				apoptosis|proteolysis|response to stress	CD40 receptor complex|endoplasmic reticulum membrane|internal side of plasma membrane|mitochondrial intermembrane space|mitochondrial membrane|nucleus	serine-type endopeptidase activity|unfolded protein binding	g.chr2:74759976T>A		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.1241T>A	2.37:g.74759976T>A	ENSP00000258080:p.Leu414*		Somatic				HTRA2_uc002smj.1_Nonsense_Mutation_p.L317*|HTRA2_uc002smk.1_Nonsense_Mutation_p.L392*|HTRA2_uc002sml.1_Nonsense_Mutation_p.L382*|HTRA2_uc002smm.1_Nonsense_Mutation_p.L155*|HTRA2_uc002smn.1_Nonsense_Mutation_p.L155*|LOXL3_uc002smo.1_3'UTR|LOXL3_uc010ffm.1_3'UTR|LOXL3_uc002smp.1_3'UTR|LOXL3_uc002smq.1_3'UTR	p.L414*	NM_013247	NP_037379	WXS	Illumina HiSeq	Unspecified	O43464	HTRA2_HUMAN			8	1843	+			414			PDZ.		Q9HBZ4|Q9P0Y3|Q9P0Y4	Nonsense_Mutation	SNP	ENST00000258080.3	37	c.1241T>A	CCDS1951.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339134	0.81911	.	.	ENSG00000115317	ENST00000258080;ENST00000352222;ENST00000437202	.	.	.	4.81	4.81	0.61882	.	0.277684	0.29884	N	0.010941	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3851	12.3473	0.55128	0.0:0.0:0.0:1.0	.	.	.	.	X	414;317;379	.	ENSP00000258080:L414X	L	+	2	0	HTRA2	74613484	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.988000	0.56951	2.013000	0.59113	0.421000	0.28195	TTG		0.498	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252219.2	NM_013247		101	156	0	0	0	0.00361	0	101	156				
CREG2	200407	broad.mit.edu	37	2	101967438	101967438	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:101967438C>A	ENST00000324768.5	-	4	957	c.820G>T	c.(820-822)Gca>Tca	p.A274S		NM_153836.3	NP_722578.1	Q8IUH2	CREG2_HUMAN	cellular repressor of E1A-stimulated genes 2	274						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	FMN binding (GO:0010181)|oxidoreductase activity (GO:0016491)	p.A274S(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						ATACTGGATGCGCCTCCATAC	0.443																																							uc002tba.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(820-822)GCA>TCA		cellular repressor of E1A-stimulated genes 2							124.0	118.0	120.0					2																	101967438		2203	4300	6503	SO:0001583	missense	200407					extracellular region	FMN binding	g.chr2:101967438C>A	AB046109	CCDS2052.1	2q12.1	2007-08-01			ENSG00000175874	ENSG00000175874			14272	protein-coding gene	gene with protein product						12408961	Standard	NM_153836		Approved		uc002tba.2	Q8IUH2	OTTHUMG00000130692	ENST00000324768.5:c.820G>T	2.37:g.101967438C>A	ENSP00000315203:p.Ala274Ser		Somatic					p.A274S	NM_153836	NP_722578	WXS	Illumina HiSeq	Unspecified	Q8IUH2	CREG2_HUMAN			4	866	-			274					Q86X03|Q8N540|Q8N9E3	Missense_Mutation	SNP	ENST00000324768.5	37	c.820G>T	CCDS2052.1	.	.	.	.	.	.	.	.	.	.	C	9.518	1.107453	0.20714	.	.	ENSG00000175874	ENST00000324768	T	0.47177	0.85	5.88	3.0	0.34707	FMN-binding split barrel-related (1);FMN-binding split barrel (1);	0.276508	0.34411	N	0.003993	T	0.34106	0.0886	L	0.35542	1.07	0.09310	N	1	B	0.21606	0.058	B	0.27380	0.079	T	0.21655	-1.0239	10	0.40728	T	0.16	.	6.8417	0.23967	0.0:0.6666:0.1257:0.2078	.	274	Q8IUH2	CREG2_HUMAN	S	274	ENSP00000315203:A274S	ENSP00000315203:A274S	A	-	1	0	CREG2	101333870	0.003000	0.15002	0.059000	0.19551	0.750000	0.42670	0.321000	0.19558	0.804000	0.34136	0.655000	0.94253	GCA		0.443	CREG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253188.2	NM_153836		41	83	1	0	1.06522e-23	0.003214	1.47631e-23	41	83				
PROC	5624	broad.mit.edu	37	2	128186390	128186390	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:128186390C>T	ENST00000234071.3	+	9	1341	c.1254C>T	c.(1252-1254)ggC>ggT	p.G418G	PROC_ENST00000453608.2_Silent_p.G473G|PROC_ENST00000422777.3_Silent_p.G418G|PROC_ENST00000409048.1_Silent_p.G452G	NM_000312.3	NP_000303.1	P04070	PROC_HUMAN	protein C (inactivator of coagulation factors Va and VIIIa)	418	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		G -> D (in THPH4; Hong Kong-2). {ECO:0000269|PubMed:1611081}.		blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood coagulation (GO:0030195)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.G418G(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0673)	Antihemophilic Factor(DB00025)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TCCTGGTGGGCCTGGTGAGCT	0.647																																							uc002tok.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1252-1254)GGC>GGT		protein C	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)						72.0	81.0	78.0					2																	128186390		2203	4300	6503	SO:0001819	synonymous_variant	5624				blood coagulation|leukocyte migration|negative regulation of apoptosis|negative regulation of blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|protein binding|serine-type endopeptidase activity	g.chr2:128186390C>T	X02750	CCDS2145.1	2q13-q14	2014-01-30			ENSG00000115718	ENSG00000115718		"""Endogenous ligands"""	9451	protein-coding gene	gene with protein product	"""prepro-protein C"""	612283				2991887, 2437584	Standard	NM_000312		Approved		uc002tok.3	P04070	OTTHUMG00000131528	ENST00000234071.3:c.1254C>T	2.37:g.128186390C>T			Somatic				PROC_uc002tol.2_Silent_p.G439G|PROC_uc010yzi.1_Silent_p.G474G|PROC_uc010yzj.1_Silent_p.G313G|PROC_uc010yzk.1_Silent_p.G473G|PROC_uc002tom.2_Silent_p.G452G	p.G418G	NM_000312	NP_000303	WXS	Illumina HiSeq	Unspecified	P04070	PROC_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0673)	9	1327	+	Colorectal(110;0.1)		418		G -> D (in ARPROCD; Hong Kong-2).	Peptidase S1.		B4DPQ7|Q15189|Q15190|Q16001|Q53S74|Q9UC55	Silent	SNP	ENST00000234071.3	37	c.1254C>T	CCDS2145.1	.	.	.	.	.	.	.	.	.	.	C	9.594	1.126956	0.20959	.	.	ENSG00000115718	ENST00000402125	.	.	.	4.84	2.97	0.34412	.	.	.	.	.	T	0.59636	0.2208	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54193	-0.8330	4	.	.	.	.	10.1363	0.42708	0.201:0.3205:0.4785:0.0	.	.	.	.	V	193	.	.	A	+	2	0	PROC	127902860	0.979000	0.34478	1.000000	0.80357	0.997000	0.91878	0.486000	0.22340	0.595000	0.29777	0.655000	0.94253	GCC		0.647	PROC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254385.2	NM_000312		13	18	0	0	0	0.004007	0	13	18				
POTEF	728378	broad.mit.edu	37	2	130832708	130832708	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:130832708C>A	ENST00000409914.2	-	17	2736	c.2337G>T	c.(2335-2337)tgG>tgT	p.W779C	POTEF_ENST00000357462.5_Missense_Mutation_p.W779C	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	779	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.W779C(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CCATGTCATCCCAGTTGGTGA	0.577																																							uc010fmh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(2335-2337)TGG>TGT		prostate, ovary, testis expressed protein on							47.0	49.0	48.0					2																	130832708		2198	4295	6493	SO:0001583	missense	728378					cell cortex	ATP binding	g.chr2:130832708C>A	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2337G>T	2.37:g.130832708C>A	ENSP00000386786:p.Trp779Cys		Somatic					p.W779C	NM_001099771	NP_001093241	WXS	Illumina HiSeq	Unspecified	A5A3E0	POTEF_HUMAN			17	2737	-			779			Actin-like.		A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	c.2337G>T	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	13.09	2.133708	0.37630	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	D;D	0.98105	-4.72;-4.72	.	.	.	.	.	.	.	.	D	0.99333	0.9766	H	0.99993	5.365	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.95846	0.8870	8	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	779	A5A3E0	POTEF_HUMAN	C	779	ENSP00000350052:W779C;ENSP00000386786:W779C	ENSP00000350052:W779C	W	-	3	0	POTEF	130549178	1.000000	0.71417	0.164000	0.22755	0.165000	0.22458	5.252000	0.65445	0.119000	0.18210	0.121000	0.15741	TGG		0.577	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		42	77	1	0	1.22102e-19	0.00361	1.6214e-19	42	77				
NCKAP5	344148	broad.mit.edu	37	2	133541594	133541594	+	Silent	SNP	C	C	A	rs368682818		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:133541594C>A	ENST00000409261.1	-	14	3163	c.2790G>T	c.(2788-2790)ccG>ccT	p.P930P	NCKAP5_ENST00000317721.6_Silent_p.P930P|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	930	Poly-Pro.							p.P930P(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTGGAGGGGGCGGAGGGGAAG	0.622																																							uc002ttp.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2788-2790)CCG>CCT		Nck-associated protein 5 isoform 1							18.0	20.0	19.0					2																	133541594		1937	4118	6055	SO:0001819	synonymous_variant	344148						protein binding	g.chr2:133541594C>A	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2790G>T	2.37:g.133541594C>A			Somatic				NCKAP5_uc002ttq.2_Intron	p.P930P	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			14	3164	-			930			Poly-Pro.		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	ENST00000409261.1	37	c.2790G>T	CCDS46418.1																																																																																				0.622	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		6	9	1	0	3.09899e-07	0.004482	3.46965e-07	6	9				
LRP1B	53353	broad.mit.edu	37	2	141116451	141116451	+	Silent	SNP	C	C	T	rs138052993	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:141116451C>T	ENST00000389484.3	-	73	12167	c.11196G>A	c.(11194-11196)tcG>tcA	p.S3732S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3732	LDL-receptor class A 31. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.S3732S(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACATTTGCTCCGACTGTAGGC	0.383										TSP Lung(27;0.18)			C|||	7	0.00139776	0.0038	0.0	5008	,	,		17124	0.0		0.0	False		,,,				2504	0.002				Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(11194-11196)TCG>TCA		low density lipoprotein-related protein 1B		C		5,4401	9.9+/-24.2	0,5,2198	188.0	168.0	175.0		11196	-1.9	0.8	2	dbSNP_134	175	0,8598		0,0,4299	no	coding-synonymous	LRP1B	NM_018557.2		0,5,6497	TT,TC,CC		0.0,0.1135,0.0384		3732/4600	141116451	5,12999	2203	4299	6502	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141116451C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11196G>A	2.37:g.141116451C>T		TSP Lung(27;0.18)	Somatic					p.S3732S	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	73	12168	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3732			Extracellular (Potential).|LDL-receptor class A 31.		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.11196G>A	CCDS2182.1																																																																																				0.383	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		13	406	0	0	0	0.003163	0	13	406				
PLA2R1	22925	broad.mit.edu	37	2	160901382	160901382	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:160901382C>A	ENST00000283243.7	-	2	602	c.396G>T	c.(394-396)gtG>gtT	p.V132V	PLA2R1_ENST00000392771.1_Silent_p.V132V	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	132	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.V132V(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TGTCATGCGCCACCTGGACAG	0.478																																							uc002ube.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(394-396)GTG>GTT		phospholipase A2 receptor 1 isoform 1 precursor							81.0	82.0	82.0					2																	160901382		2203	4300	6503	SO:0001819	synonymous_variant	22925				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr2:160901382C>A	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.396G>T	2.37:g.160901382C>A			Somatic				PLA2R1_uc010zcp.1_Silent_p.V132V|PLA2R1_uc002ubf.2_Silent_p.V132V	p.V132V	NM_007366	NP_031392	WXS	Illumina HiSeq	Unspecified	Q13018	PLA2R_HUMAN			2	603	-			132			Extracellular (Potential).|Ricin B-type lectin.		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	37	c.396G>T	CCDS33309.1																																																																																				0.478	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1			108	153	1	0	2.93447e-47	0.00361	4.78738e-47	108	153				
FAP	2191	broad.mit.edu	37	2	163082062	163082062	+	Silent	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:163082062T>A	ENST00000188790.4	-	4	423	c.216A>T	c.(214-216)gcA>gcT	p.A72A	FAP_ENST00000443424.1_Silent_p.A72A	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha									p.A72A(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						TATTGTTATCTGCAGATTGAT	0.303																																							uc002ucd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(214-216)GCA>GCT		fibroblast activation protein, alpha subunit							125.0	130.0	128.0					2																	163082062		2199	4298	6497	SO:0001819	synonymous_variant	2191				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity	g.chr2:163082062T>A	U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.216A>T	2.37:g.163082062T>A			Somatic				FAP_uc010zct.1_Silent_p.A72A|FAP_uc010fpd.2_Intron|FAP_uc010fpe.1_Silent_p.A39A	p.A72A	NM_004460	NP_004451	WXS	Illumina HiSeq	Unspecified	Q12884	SEPR_HUMAN			4	424	-			72			Extracellular (Potential).			Silent	SNP	ENST00000188790.4	37	c.216A>T	CCDS33311.1																																																																																				0.303	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2			29	49	0	0	0	0.003755	0	29	49				
FIGN	55137	broad.mit.edu	37	2	164468190	164468190	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:164468190T>A	ENST00000333129.3	-	3	466	c.152A>T	c.(151-153)cAg>cTg	p.Q51L	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'UTR	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	51					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.Q51L(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CCAGGCGTACTGATAGGTGCG	0.502																																							uc002uck.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|skin(1)	4						c.(151-153)CAG>CTG		fidgetin							131.0	131.0	131.0					2																	164468190		2047	4199	6246	SO:0001583	missense	55137					nuclear matrix	ATP binding|nucleoside-triphosphatase activity	g.chr2:164468190T>A	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.152A>T	2.37:g.164468190T>A	ENSP00000333836:p.Gln51Leu		Somatic					p.Q51L	NM_018086	NP_060556	WXS	Illumina HiSeq	Unspecified	Q5HY92	FIGN_HUMAN			3	463	-			51					B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	c.152A>T	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	T	14.69	2.612012	0.46631	.	.	ENSG00000182263	ENST00000333129	T	0.34072	1.38	6.17	6.17	0.99709	.	0.000000	0.85682	U	0.000000	T	0.46483	0.1395	M	0.74881	2.28	0.80722	D	1	P	0.47409	0.895	B	0.43783	0.431	T	0.53099	-0.8486	10	0.87932	D	0	-17.4727	16.8222	0.85835	0.0:0.0:0.0:1.0	.	51	Q5HY92	FIGN_HUMAN	L	51	ENSP00000333836:Q51L	ENSP00000333836:Q51L	Q	-	2	0	FIGN	164176436	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.289000	0.72696	2.371000	0.80710	0.533000	0.62120	CAG		0.502	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086		181	342	0	0	0	0.00361	0	181	342				
XIRP2	129446	broad.mit.edu	37	2	168101224	168101224	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:168101224G>T	ENST00000409195.1	+	9	3411	c.3322G>T	c.(3322-3324)Gaa>Taa	p.E1108*	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Nonsense_Mutation_p.E886*|XIRP2_ENST00000295237.9_Nonsense_Mutation_p.E1108*|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	933					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.E1108*(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTCTCTTTATGAAAAAGTTTC	0.363																																							uc002udx.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(3322-3324)GAA>TAA		xin actin-binding repeat containing 2 isoform 1							43.0	40.0	41.0					2																	168101224		1809	4074	5883	SO:0001587	stop_gained	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168101224G>T	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.3322G>T	2.37:g.168101224G>T	ENSP00000386840:p.Glu1108*		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Nonsense_Mutation_p.E933*|XIRP2_uc010fpq.2_Nonsense_Mutation_p.E886*|XIRP2_uc010fpr.2_Intron	p.E1108*	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	3340	+			933					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Nonsense_Mutation	SNP	ENST00000409195.1	37	c.3322G>T	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	42	9.198063	0.99098	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	.	.	.	6.08	6.08	0.98989	.	0.095412	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-26.7177	19.4349	0.94788	0.0:0.0:1.0:0.0	.	.	.	.	X	1108;1108;886	.	ENSP00000295237:E1108X	E	+	1	0	XIRP2	167809470	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.577000	0.82486	2.894000	0.99253	0.655000	0.94253	GAA		0.363	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		16	39	1	0	4.63292e-17	0.008871	5.97156e-17	16	39				
CCDC173	129881	broad.mit.edu	37	2	170518803	170518803	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:170518803C>A	ENST00000447353.1	-	5	911	c.806G>T	c.(805-807)aGg>aTg	p.R269M		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	269								p.R263M(1)									AAACCGTCTCCTGCTTTCATG	0.313																																							uc002ufe.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(805-807)AGG>ATG		hypothetical protein LOC129881							233.0	227.0	228.0					2																	170518803		1816	4075	5891	SO:0001583	missense	129881							g.chr2:170518803C>A	BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.806G>T	2.37:g.170518803C>A	ENSP00000391504:p.Arg269Met		Somatic					p.R269M	NM_001085447	NP_001078916	WXS	Illumina HiSeq	Unspecified	Q0VFZ6	CB077_HUMAN			5	900	-			269			Potential.		Q6PJF6	Missense_Mutation	SNP	ENST00000447353.1	37	c.806G>T	CCDS46445.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.439888	0.25900	.	.	ENSG00000154479	ENST00000447353	T	0.10477	2.87	4.48	0.659	0.17861	.	4.027150	0.00166	N	0.000015	T	0.14614	0.0353	L	0.41079	1.255	0.21967	N	0.999446	P	0.35908	0.527	P	0.44518	0.452	T	0.28933	-1.0028	10	0.23891	T	0.37	.	6.5919	0.22651	0.0:0.5258:0.0:0.4742	.	269	Q0VFZ6	CB077_HUMAN	M	269	ENSP00000391504:R269M	ENSP00000391504:R269M	R	-	2	0	C2orf77	170227049	0.117000	0.22190	0.828000	0.32881	0.638000	0.38207	0.505000	0.22642	0.211000	0.20683	-0.137000	0.14449	AGG		0.313	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333954.2	NM_001085447		251	372	1	0	1.68934e-126	0.00361	3.05257e-126	251	372				
HOXD11	3237	broad.mit.edu	37	2	176973838	176973838	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:176973838C>A	ENST00000249504.5	+	2	1055	c.985C>A	c.(985-987)Ctg>Atg	p.L329M	HOXD11_ENST00000498438.1_3'UTR|HOXD10_ENST00000490088.2_3'UTR|AC009336.1_ENST00000401374.2_RNA	NM_021192.2	NP_067015.2	P31277	HXD11_HUMAN	homeobox D11	329					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|single fertilization (GO:0007338)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.L329M(1)						OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		CAGAGACCGTCTGCAGTATTT	0.532			T	NUP98	AML																																		uc002uki.2		NA		Dom	yes		2	2q31-q32	3237	T	homeo box D11			L	NUP98		AML		1	Substitution - Missense(1)		lung(1)		0						c.(985-987)CTG>ATG		homeobox D11							98.0	105.0	103.0					2																	176973838		2203	4300	6503	SO:0001583	missense	3237					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176973838C>A		CCDS2265.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128713	ENSG00000128713		"""Homeoboxes / ANTP class : HOXL subclass"""	5134	protein-coding gene	gene with protein product		142986	"""homeo box D11"""	HOX4, HOX4F		1973146, 1358459	Standard	NM_021192		Approved		uc002uki.3	P31277	OTTHUMG00000132510	ENST00000249504.5:c.985C>A	2.37:g.176973838C>A	ENSP00000249504:p.Leu329Met		Somatic				HOXD11_uc010fqx.2_RNA	p.L329M	NM_021192	NP_067015	WXS	Illumina HiSeq	Unspecified	P31277	HXD11_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)	2	985	+			329					A6NIS4|Q9NS02	Missense_Mutation	SNP	ENST00000249504.5	37	c.985C>A	CCDS2265.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735947	0.69189	.	.	ENSG00000128713	ENST00000249504;ENST00000392538	D	0.93604	-3.25	5.32	5.32	0.75619	.	0.000000	0.28952	U	0.013606	D	0.93350	0.7880	L	0.35288	1.05	0.80722	D	1	P	0.51351	0.944	P	0.53649	0.731	D	0.93941	0.7223	10	0.66056	D	0.02	.	19.3639	0.94454	0.0:1.0:0.0:0.0	.	329	P31277	HXD11_HUMAN	M	329;150	ENSP00000249504:L329M	ENSP00000249504:L329M	L	+	1	2	HOXD11	176682084	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.846000	0.55888	2.658000	0.90341	0.603000	0.83216	CTG		0.532	HOXD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359250.2			54	71	1	0	1.55088e-19	0.00361	2.0499e-19	54	71				
PTH2R	5746	broad.mit.edu	37	2	209302298	209302298	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:209302298G>T	ENST00000272847.2	+	3	428	c.215G>T	c.(214-216)tGt>tTt	p.C72F	PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	72					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.C72F(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	GGACTCATTTGTTGGCCCAGA	0.333																																							uc002vdb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(214-216)TGT>TTT		parathyroid hormone 2 receptor precursor							77.0	81.0	80.0					2																	209302298		2203	4300	6503	SO:0001583	missense	5746					integral to plasma membrane	parathyroid hormone receptor activity	g.chr2:209302298G>T	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.215G>T	2.37:g.209302298G>T	ENSP00000272847:p.Cys72Phe		Somatic				PTH2R_uc010zjb.1_Missense_Mutation_p.C83F	p.C72F	NM_005048	NP_005039	WXS	Illumina HiSeq	Unspecified	P49190	PTH2R_HUMAN		Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	3	428	+			72			Extracellular (Potential).		Q8N429	Missense_Mutation	SNP	ENST00000272847.2	37	c.215G>T	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173934	0.78452	.	.	ENSG00000144407	ENST00000272847	T	0.73152	-0.72	5.6	5.6	0.85130	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.52532	D	0.000061	D	0.90393	0.6993	H	0.98133	4.155	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93437	0.6790	10	0.87932	D	0	.	17.4647	0.87629	0.0:0.0:1.0:0.0	.	72	P49190	PTH2R_HUMAN	F	72	ENSP00000272847:C72F	ENSP00000272847:C72F	C	+	2	0	PTH2R	209010543	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	8.910000	0.92685	2.793000	0.96121	0.563000	0.77884	TGT		0.333	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048		24	42	1	0	3.90053e-15	0.002445	4.90573e-15	24	42				
SPHKAP	80309	broad.mit.edu	37	2	228884540	228884540	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:228884540C>G	ENST00000392056.3	-	7	1076	c.1030G>C	c.(1030-1032)Gct>Cct	p.A344P	SPHKAP_ENST00000344657.5_Missense_Mutation_p.A344P	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	344						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.A344P(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GAGAAATAAGCATCTTTTGGA	0.423																																							uc002vpq.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)|ovary(4)|lung(1)	10						c.(1030-1032)GCT>CCT		sphingosine kinase type 1-interacting protein							146.0	139.0	141.0					2																	228884540		2203	4300	6503	SO:0001583	missense	80309					cytoplasm	protein binding	g.chr2:228884540C>G		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1030G>C	2.37:g.228884540C>G	ENSP00000375909:p.Ala344Pro		Somatic				SPHKAP_uc002vpp.2_Missense_Mutation_p.A344P|SPHKAP_uc010zlx.1_Missense_Mutation_p.A344P	p.A344P	NM_001142644	NP_001136116	WXS	Illumina HiSeq	Unspecified	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	7	1077	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	344					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.1030G>C	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523624	0.27299	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12774	2.65;2.65	5.78	3.61	0.41365	.	0.688391	0.14023	N	0.346680	T	0.27169	0.0666	M	0.62723	1.935	0.09310	N	1	D;D	0.63880	0.993;0.967	P;P	0.58721	0.844;0.663	T	0.03933	-1.0991	10	0.51188	T	0.08	.	9.3145	0.37926	0.1471:0.7684:0.0:0.0846	.	344;344	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	P	344	ENSP00000375909:A344P;ENSP00000339886:A344P	ENSP00000339886:A344P	A	-	1	0	SPHKAP	228592784	0.000000	0.05858	0.878000	0.34440	0.092000	0.18411	0.003000	0.13083	1.405000	0.46838	0.650000	0.86243	GCT		0.423	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		30	105	0	0	0	0.002096	0	30	105				
PER2	8864	broad.mit.edu	37	2	239157728	239157729	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:239157728_239157729CC>AA	ENST00000254657.3	-	22	3871_3872	c.3592_3593GG>TT	c.(3592-3594)GGc>TTc	p.G1198F	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	1198	CRY binding domain. {ECO:0000250|UniProtKB:Q9Z301}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)	p.G1198F(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TGCGGGCAGGCCGCCCGTCTGC	0.574																																							uc002vyc.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|breast(1)	2						c.(3592-3594)GGC>TTC		period 2																																				SO:0001583	missense	8864				circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity	g.chr2:239157728_239157729CC>AA	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.3592_3593delinsAA	2.37:g.239157728_239157729delinsAA	ENSP00000254657:p.Gly1198Phe		Somatic				PER2_uc010znv.1_Missense_Mutation_p.G1198F	p.G1198F	NM_022817	NP_073728	WXS	Illumina HiSeq	Unspecified	O15055	PER2_HUMAN		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)	22	3829_3830	-		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)	1198			CRY binding domain (By similarity).		A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	DNP	ENST00000254657.3	37	c.3592_3593GG>TT	CCDS2528.1																																																																																				0.574	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817		18	57	0	0	0	0.004672	0	18	57				
CPXM1	56265	broad.mit.edu	37	20	2775235	2775235	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:2775235C>T	ENST00000380605.2	-	13	1975	c.1911G>A	c.(1909-1911)ggG>ggA	p.G637G		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	637					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.G637G(1)		endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CGTCAGCAATCCCAAGCTCCG	0.592																																							uc002wgu.2		NA																	1	Substitution - coding silent(1)	p.G637E(1)	lung(1)	ovary(2)|skin(2)	4						c.(1909-1911)GGG>GGA		carboxypeptidase X, member 1 precursor							184.0	119.0	141.0					20																	2775235		2203	4300	6503	SO:0001819	synonymous_variant	56265				cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding	g.chr20:2775235C>T	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1911G>A	20.37:g.2775235C>T			Somatic				CPXM1_uc010gas.2_Silent_p.G563G	p.G637G	NM_019609	NP_062555	WXS	Illumina HiSeq	Unspecified	Q96SM3	CPXM1_HUMAN			13	1975	-			637					Q6P4G8|Q6UW65|Q9NUB5	Silent	SNP	ENST00000380605.2	37	c.1911G>A	CCDS13033.1																																																																																				0.592	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609		9	104	0	0	0	0.000978	0	9	104				
PAX1	5075	broad.mit.edu	37	20	21695388	21695388	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:21695388C>T	ENST00000398485.2	+	5	1606	c.1552C>T	c.(1552-1554)Cca>Tca	p.P518S	PAX1_ENST00000444366.2_3'UTR	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	518					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P518S(1)|p.P424S(1)		autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						GCCGGACCCACCACACTTCCT	0.637																																							uc002wsj.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|kidney(1)	2						c.(1552-1554)CCA>TCA		paired box 1							57.0	52.0	54.0					20																	21695388		2203	4300	6503	SO:0001583	missense	5075				regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding	g.chr20:21695388C>T		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.1552C>T	20.37:g.21695388C>T	ENSP00000381499:p.Pro518Ser		Somatic				PAX1_uc010zsl.1_3'UTR|PAX1_uc010zsm.1_3'UTR	p.P518S	NM_006192	NP_006183	WXS	Illumina HiSeq	Unspecified	P15863	PAX1_HUMAN			5	1606	+			518					B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	c.1552C>T	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	C	10.16	1.274821	0.23307	.	.	ENSG00000125813	ENST00000398485	D	0.97505	-4.41	4.09	-3.47	0.04753	.	2.122350	0.02639	N	0.105134	D	0.91637	0.7357	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.82261	-0.0545	10	0.87932	D	0	.	1.5203	0.02514	0.3864:0.317:0.1268:0.1699	.	518	P15863	PAX1_HUMAN	S	518	ENSP00000381499:P518S	ENSP00000381499:P518S	P	+	1	0	PAX1	21643388	0.004000	0.15560	0.000000	0.03702	0.005000	0.04900	0.121000	0.15667	-0.470000	0.06901	-1.497000	0.00963	CCA		0.637	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3			7	14	0	0	0	0.001984	0	7	14				
GZF1	64412	broad.mit.edu	37	20	23345114	23345114	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:23345114G>A	ENST00000338121.5	+	2	171	c.94G>A	c.(94-96)Gac>Aac	p.D32N	GZF1_ENST00000542987.1_Intron|GZF1_ENST00000544236.1_Intron|GZF1_ENST00000377051.2_Missense_Mutation_p.D32N			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	32	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)	p.D32N(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					TCACCTGTGTGACGTGACAGT	0.517																																							uc010gdb.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(94-96)GAC>AAC		GDNF-inducible zinc finger protein 1							88.0	83.0	84.0					20																	23345114		2203	4300	6503	SO:0001583	missense	64412				transcription, DNA-dependent	nucleolus|nucleoplasm	sequence-specific DNA binding|zinc ion binding	g.chr20:23345114G>A	AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.94G>A	20.37:g.23345114G>A	ENSP00000338290:p.Asp32Asn		Somatic				GZF1_uc002wsy.2_Missense_Mutation_p.D32N|GZF1_uc010zsq.1_Intron|GZF1_uc010zsr.1_Intron|GZF1_uc002wsz.2_Missense_Mutation_p.D32N	p.D32N	NM_022482	NP_071927	WXS	Illumina HiSeq	Unspecified	Q9H116	GZF1_HUMAN			3	268	+	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)		32	D->N: Decreased repression activity.		BTB.		A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	ENST00000338121.5	37	c.94G>A	CCDS13151.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996332	0.35226	.	.	ENSG00000125812	ENST00000338121;ENST00000424216;ENST00000377051	D;T;D	0.90955	-2.76;-0.38;-2.76	5.18	4.23	0.50019	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.64402	D	0.000010	D	0.93700	0.7987	H	0.95402	3.665	0.80722	D	1	P	0.42357	0.777	B	0.42738	0.396	D	0.94261	0.7502	10	0.87932	D	0	.	12.7548	0.57328	0.0794:0.0:0.9206:0.0	.	32	Q9H116	GZF1_HUMAN	N	32	ENSP00000338290:D32N;ENSP00000410009:D32N;ENSP00000366250:D32N	ENSP00000338290:D32N	D	+	1	0	GZF1	23293114	1.000000	0.71417	0.977000	0.42913	0.051000	0.14879	9.790000	0.99075	1.209000	0.43321	-0.142000	0.14014	GAC		0.517	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078333.1	NM_022482		4	39	0	0	0	0.001168	0	4	39				
NCOR1P1	149934	broad.mit.edu	37	20	26084304	26084304	+	RNA	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:26084304G>T	ENST00000478176.1	-	0	153					NR_003678.1		Q9H4R4	CT191_HUMAN	nuclear receptor corepressor 1 pseudogene 1									p.P38T(1)									CCAAATGCTGGATCCTTTAGA	0.393																																							uc002wvj.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(112-114)CCA>ACA		SubName: Full=Putative uncharacterized protein ENSP00000323172;							43.0	30.0	34.0					20																	26084304		692	1591	2283			149934							g.chr20:26084304G>T	AL391119		20p11.1	2011-09-16	2011-09-16	2011-09-16	ENSG00000240108	ENSG00000240108			16724	pseudogene	pseudogene			"""chromosome 20 open reading frame 191"""	C20orf191			Standard	NR_003678		Approved	bB329D4.2	uc002wvj.5	Q9H4R4	OTTHUMG00000032145		20.37:g.26084304G>T			Somatic					p.P38T	NR_003678		WXS	Illumina HiSeq	Unspecified					2	167	-								A2RUA0	Missense_Mutation	SNP	ENST00000478176.1	37	c.112C>A																																																																																					0.393	NCOR1P1-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000078478.2			15	100	1	0	2.48551e-13	0.00499	3.07858e-13	15	100				
CASS4	57091	broad.mit.edu	37	20	55012236	55012236	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:55012236C>A	ENST00000360314.3	+	3	278	c.53C>A	c.(52-54)gCa>gAa	p.A18E	CASS4_ENST00000371336.3_Missense_Mutation_p.A18E|CASS4_ENST00000434344.1_Missense_Mutation_p.A18E	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	18	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.A18E(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						CTGGCCAGGGCACTTTATGAC	0.557																																							uc002xxp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(52-54)GCA>GAA		HEF-like protein isoform a							75.0	66.0	69.0					20																	55012236		2203	4300	6503	SO:0001583	missense	57091				cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity	g.chr20:55012236C>A	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.53C>A	20.37:g.55012236C>A	ENSP00000353462:p.Ala18Glu		Somatic				CASS4_uc002xxq.3_Missense_Mutation_p.A18E|CASS4_uc002xxr.2_Missense_Mutation_p.A18E|CASS4_uc010zze.1_Missense_Mutation_p.A18E|CASS4_uc010gio.2_Missense_Mutation_p.A18E	p.A18E	NM_001164116	NP_001157588	WXS	Illumina HiSeq	Unspecified	Q9NQ75	CASS4_HUMAN			3	278	+			18			SH3.		E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	c.53C>A	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	C	33	5.269404	0.95429	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.70282	-0.47;-0.47;-0.47	5.71	5.71	0.89125	Src homology-3 domain (4);	0.051982	0.85682	D	0.000000	D	0.90580	0.7047	H	0.97682	4.055	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.998;0.999	D;D;D;D	0.91635	0.999;0.939;0.974;0.985	D	0.93366	0.6731	10	0.87932	D	0	-18.8106	19.8625	0.96789	0.0:1.0:0.0:0.0	.	18;18;18;18	B4DII4;Q9NQ75-3;Q9NQ75-2;Q9NQ75	.;.;.;CASS4_HUMAN	E	18	ENSP00000353462:A18E;ENSP00000360387:A18E;ENSP00000410027:A18E	ENSP00000353462:A18E	A	+	2	0	CASS4	54445643	1.000000	0.71417	0.723000	0.30687	0.984000	0.73092	7.290000	0.78711	2.689000	0.91719	0.655000	0.94253	GCA		0.557	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356		83	130	1	0	7.4264e-54	0.00361	1.23629e-53	83	130				
HMGB1P1	10357	broad.mit.edu	37	20	56063476	56063476	+	IGR	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:56063476T>A								RBM38 (79087 upstream) : CTCFL (7558 downstream)														p.E203V(1)									ttcttcatcttcttcatcttc	0.398																																							uc010zzl.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(607-609)GAA>GTA		high-mobility group box 1-like 1							72.0	84.0	80.0					20																	56063476		2199	4296	6495	SO:0001628	intergenic_variant	0							g.chr20:56063476T>A																													20.37:g.56063476T>A			Somatic					p.E203V	NM_001008735	NP_001008735	WXS	Illumina HiSeq	Unspecified					1	608	-									Missense_Mutation	SNP		37	c.608A>T																																																																																				0	0.398									20	33	0	0	0	0.001882	0	20	33				
TPTE	7179	broad.mit.edu	37	21	10920156	10920156	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:10920156C>A	ENST00000361285.4	-	19	1427	c.1098G>T	c.(1096-1098)ctG>ctT	p.L366L	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Silent_p.L328L|TPTE_ENST00000298232.7_Silent_p.L348L	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	366	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L366L(2)|p.L348L(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CAAAATAATACAGGCTTTCCT	0.383																																							uc002yip.1		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(1096-1098)CTG>CTT		transmembrane phosphatase with tensin homology							96.0	90.0	92.0					21																	10920156		2203	4299	6502	SO:0001819	synonymous_variant	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10920156C>A	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1098G>T	21.37:g.10920156C>A			Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.L348L|TPTE_uc002yir.1_Silent_p.L328L|TPTE_uc010gkv.1_Silent_p.L228L	p.L366L	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	19	1466	-			366			Phosphatase tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	ENST00000361285.4	37	c.1098G>T	CCDS13560.2																																																																																				0.383	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			12	259	1	0	2.23348e-06	0.004007	2.46201e-06	12	259				
TMPRSS15	5651	broad.mit.edu	37	21	19687505	19687505	+	Missense_Mutation	SNP	C	C	A	rs139992374		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:19687505C>A	ENST00000284885.3	-	17	2023	c.1990G>T	c.(1990-1992)Ggt>Tgt	p.G664C		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	664	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.G664C(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TGCAGATGACCGTCACAGAGA	0.398																																							uc002ykw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(1990-1992)GGT>TGT		enterokinase precursor							169.0	139.0	150.0					21																	19687505		2203	4300	6503	SO:0001583	missense	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19687505C>A		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1990G>T	21.37:g.19687505C>A	ENSP00000284885:p.Gly664Cys		Somatic					p.G664C	NM_002772	NP_002763	WXS	Illumina HiSeq	Unspecified	P98073	ENTK_HUMAN			17	2021	-			664			Extracellular (Potential).|LDL-receptor class A 2.		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.1990G>T	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.368864	0.24771	.	.	ENSG00000154646	ENST00000284885	D	0.96992	-4.2	5.27	-6.86	0.01676	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.389223	0.27881	N	0.017480	D	0.98185	0.9400	H	0.95187	3.635	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	D	0.95805	0.8836	9	.	.	.	.	16.7269	0.85424	0.0:0.1743:0.0:0.8257	.	664	P98073	ENTK_HUMAN	C	664	ENSP00000284885:G664C	.	G	-	1	0	TMPRSS15	18609376	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.925000	0.03992	-1.434000	0.01975	-0.142000	0.14014	GGT		0.398	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		128	232	1	0	6.32167e-57	0.00361	1.07751e-56	128	232				
ADAMTS1	9510	broad.mit.edu	37	21	28212677	28212677	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:28212677C>T	ENST00000284984.3	-	5	2037	c.1583G>A	c.(1582-1584)tGg>tAg	p.W528*		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	528	Disintegrin.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.W528*(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		GCCATCCGCCCACGGGAAGTG	0.522																																							uc002ymf.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(3)|large_intestine(2)|central_nervous_system(1)	6						c.(1582-1584)TGG>TAG		ADAM metallopeptidase with thrombospondin type 1							87.0	75.0	79.0					21																	28212677		2203	4300	6503	SO:0001587	stop_gained	9510				integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding	g.chr21:28212677C>T	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1583G>A	21.37:g.28212677C>T	ENSP00000284984:p.Trp528*		Somatic					p.W528*	NM_006988	NP_008919	WXS	Illumina HiSeq	Unspecified	Q9UHI8	ATS1_HUMAN		Lung(58;0.215)	5	2038	-		Breast(209;0.000962)	528			Disintegrin.		D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Nonsense_Mutation	SNP	ENST00000284984.3	37	c.1583G>A	CCDS33524.1	.	.	.	.	.	.	.	.	.	.	C	44	10.686296	0.99450	.	.	ENSG00000154734	ENST00000284984	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.1084	0.93307	0.0:1.0:0.0:0.0	.	.	.	.	X	528	.	ENSP00000284984:W528X	W	-	2	0	ADAMTS1	27134548	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	7.278000	0.78587	2.820000	0.97059	0.650000	0.86243	TGG		0.522	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2			58	53	0	0	0	0.00361	0	58	53				
ADAMTS5	11096	broad.mit.edu	37	21	28302275	28302275	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:28302275C>A	ENST00000284987.5	-	7	2276	c.2155G>T	c.(2155-2157)Gac>Tac	p.D719Y	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	719	Cys-rich.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D719Y(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CCGCACTTGTCATACTGCAGC	0.458																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	Esophageal Squamous(53;683 1080 10100 14424 45938)	uc002ymg.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						c.(2155-2157)GAC>TAC		ADAM metallopeptidase with thrombospondin type 1							223.0	199.0	207.0					21																	28302275		2203	4300	6503	SO:0001583	missense	11096				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr21:28302275C>A	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2155G>T	21.37:g.28302275C>A	ENSP00000284987:p.Asp719Tyr		Somatic					p.D719Y	NM_007038	NP_008969	WXS	Illumina HiSeq	Unspecified	Q9UNA0	ATS5_HUMAN			7	2884	-			719			Cys-rich.		Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	c.2155G>T	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335146	0.81801	.	.	ENSG00000154736	ENST00000284987	T	0.76316	-1.01	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.92864	0.7730	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94305	0.7540	10	0.87932	D	0	.	20.428	0.99075	0.0:1.0:0.0:0.0	.	719	Q9UNA0	ATS5_HUMAN	Y	719	ENSP00000284987:D719Y	ENSP00000284987:D719Y	D	-	1	0	ADAMTS5	27224146	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.440000	0.80464	2.837000	0.97791	0.655000	0.94253	GAC		0.458	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			78	443	1	0	2.70612e-23	0.00361	3.73235e-23	78	443				
ADAMTS5	11096	broad.mit.edu	37	21	28304454	28304454	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:28304454G>T	ENST00000284987.5	-	6	2039	c.1918C>A	c.(1918-1920)Cag>Aag	p.Q640K	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	640	Cys-rich.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Q640K(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						GCATCAGACTGATAGCCATTT	0.418																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	Esophageal Squamous(53;683 1080 10100 14424 45938)	uc002ymg.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						c.(1918-1920)CAG>AAG		ADAM metallopeptidase with thrombospondin type 1							133.0	114.0	121.0					21																	28304454		2203	4300	6503	SO:0001583	missense	11096				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr21:28304454G>T	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1918C>A	21.37:g.28304454G>T	ENSP00000284987:p.Gln640Lys		Somatic					p.Q640K	NM_007038	NP_008969	WXS	Illumina HiSeq	Unspecified	Q9UNA0	ATS5_HUMAN			6	2647	-			640			Cys-rich.		Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	c.1918C>A	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174813	0.78564	.	.	ENSG00000154736	ENST00000284987	T	0.03441	3.93	5.67	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.02649	0.0080	L	0.27053	0.805	0.44816	D	0.997823	P	0.43094	0.799	B	0.31869	0.137	T	0.62831	-0.6771	10	0.13470	T	0.59	.	15.0245	0.71659	0.0697:0.0:0.9303:0.0	.	640	Q9UNA0	ATS5_HUMAN	K	640	ENSP00000284987:Q640K	ENSP00000284987:Q640K	Q	-	1	0	ADAMTS5	27226325	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.420000	0.97426	2.669000	0.90835	0.655000	0.94253	CAG		0.418	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			20	189	1	0	6.21321e-17	0.00278	7.97246e-17	20	189				
N6AMT1	29104	broad.mit.edu	37	21	30252218	30252218	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:30252218G>T	ENST00000303775.5	-	4	395	c.370C>A	c.(370-372)Ccc>Acc	p.P124T	N6AMT1_ENST00000351429.3_Intron	NM_013240.4	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1 (putative)	124	Substrate binding. {ECO:0000250}.				positive regulation of cell growth (GO:0030307)|protein methylation (GO:0006479)	protein complex (GO:0043234)	nucleic acid binding (GO:0003676)|protein methyltransferase activity (GO:0008276)	p.P124T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)	12						ACTACATAGGGGGGATTAAAC	0.308																																							uc002ymo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)CCC>ACC		N-6 adenine-specific DNA methyltransferase 1							82.0	87.0	85.0					21																	30252218		2203	4300	6503	SO:0001583	missense	29104				positive regulation of cell growth	protein complex	nucleic acid binding|protein binding|protein methyltransferase activity	g.chr21:30252218G>T	AF139682	CCDS33525.1, CCDS33526.1	21q21.3	2006-12-14	2006-12-14	2006-12-14	ENSG00000156239	ENSG00000156239	2.1.1.72		16021	protein-coding gene	gene with protein product		614553	"""chromosome 21 open reading frame 127"", ""HemK methyltransferase family member 2"""	C21orf127, HEMK2			Standard	NM_013240		Approved	PRED28, N6AMT, MTQ2	uc002ymo.2	Q9Y5N5	OTTHUMG00000078750	ENST00000303775.5:c.370C>A	21.37:g.30252218G>T	ENSP00000303584:p.Pro124Thr		Somatic				N6AMT1_uc002ymp.1_Intron|N6AMT1_uc002ymq.1_RNA	p.P124T	NM_013240	NP_037372	WXS	Illumina HiSeq	Unspecified	Q9Y5N5	HEMK2_HUMAN			4	396	-			124			Substrate binding (By similarity).		Q96F73	Missense_Mutation	SNP	ENST00000303775.5	37	c.370C>A	CCDS33526.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105164	0.77096	.	.	ENSG00000156239	ENST00000303775	T	0.73258	-0.73	5.37	5.37	0.77165	DNA methylase, N-6 adenine-specific, conserved site (1);Methyltransferase small (1);	0.000000	0.85682	D	0.000000	D	0.90188	0.6933	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93300	0.6676	10	0.87932	D	0	-7.3986	16.6555	0.85227	0.0:0.0:1.0:0.0	.	124	Q9Y5N5	HEMK2_HUMAN	T	124	ENSP00000303584:P124T	ENSP00000303584:P124T	P	-	1	0	N6AMT1	29174089	1.000000	0.71417	0.995000	0.50966	0.811000	0.45836	7.508000	0.81686	2.793000	0.96121	0.563000	0.77884	CCC		0.308	N6AMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171738.1	NM_013240		37	202	1	0	6.08268e-21	0.00361	8.23036e-21	37	202				
CLDN8	9073	broad.mit.edu	37	21	31588059	31588059	+	Missense_Mutation	SNP	A	A	T	rs528758738		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:31588059A>T	ENST00000399899.1	-	1	332	c.185T>A	c.(184-186)aTg>aAg	p.M62K	CLDN8_ENST00000286809.1_Missense_Mutation_p.M62K	NM_199328.2	NP_955360.1	P56748	CLD8_HUMAN	claudin 8	62					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.M62K(1)		NS(1)|endometrium(2)|large_intestine(6)|lung(6)	15						TTTGCACTGCATCCTGATGTT	0.498																																							uc002ynu.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(184-186)ATG>AAG		claudin 8							107.0	100.0	102.0					21																	31588059		2203	4300	6503	SO:0001583	missense	9073				calcium-independent cell-cell adhesion	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity	g.chr21:31588059A>T	AJ250711	CCDS13587.1	21q22.1	2008-07-31			ENSG00000156284	ENSG00000156284		"""Claudins"""	2050	protein-coding gene	gene with protein product		611231				9892664	Standard	NM_199328		Approved		uc002ynu.2	P56748	OTTHUMG00000081872	ENST00000399899.1:c.185T>A	21.37:g.31588059A>T	ENSP00000382783:p.Met62Lys		Somatic					p.M62K	NM_199328	NP_955360	WXS	Illumina HiSeq	Unspecified	P56748	CLD8_HUMAN			1	260	-			62			Extracellular (Potential).		D3DSE3|Q53EX7	Missense_Mutation	SNP	ENST00000399899.1	37	c.185T>A	CCDS13587.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.263783	0.80358	.	.	ENSG00000156284	ENST00000399899;ENST00000286809;ENST00000536721	D;D	0.88586	-2.4;-2.4	5.05	5.05	0.67936	Claudin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95768	0.8623	H	0.94345	3.525	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	D	0.96827	0.9608	10	0.72032	D	0.01	.	14.934	0.70938	1.0:0.0:0.0:0.0	.	62	P56748	CLD8_HUMAN	K	62	ENSP00000382783:M62K;ENSP00000286809:M62K	ENSP00000286809:M62K	M	-	2	0	CLDN8	30509930	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.231000	0.78106	2.252000	0.74401	0.528000	0.53228	ATG		0.498	CLDN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182260.1	NM_199328		33	186	0	0	0	0.00361	0	33	186				
ITSN1	6453	broad.mit.edu	37	21	35124178	35124178	+	Missense_Mutation	SNP	A	A	C	rs544678761		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:35124178A>C	ENST00000381318.3	+	7	878	c.590A>C	c.(589-591)aAa>aCa	p.K197T	ITSN1_ENST00000399353.1_Missense_Mutation_p.K160T|ITSN1_ENST00000379960.5_Missense_Mutation_p.K197T|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399349.1_Missense_Mutation_p.K197T|ITSN1_ENST00000381291.4_Missense_Mutation_p.K197T|ITSN1_ENST00000399338.4_Missense_Mutation_p.K197T|ITSN1_ENST00000399326.3_Missense_Mutation_p.K197T|ITSN1_ENST00000399352.1_Missense_Mutation_p.K197T|ITSN1_ENST00000381285.4_Missense_Mutation_p.K197T|ITSN1_ENST00000399355.2_Missense_Mutation_p.K197T|ITSN1_ENST00000437442.2_Missense_Mutation_p.K197T|ITSN1_ENST00000399367.3_Missense_Mutation_p.K197T	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	197					apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K197T(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CTAAACACTAAATTACAAAAG	0.338																																							uc002yta.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(589-591)AAA>ACA		intersectin 1 isoform ITSN-l							119.0	106.0	110.0					21																	35124178		2203	4300	6503	SO:0001583	missense	6453				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity	g.chr21:35124178A>C	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.590A>C	21.37:g.35124178A>C	ENSP00000370719:p.Lys197Thr		Somatic				DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.K197T|ITSN1_uc010gmg.2_Missense_Mutation_p.K160T|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Missense_Mutation_p.K197T|ITSN1_uc010gmi.2_Missense_Mutation_p.K160T|ITSN1_uc010gmj.2_Missense_Mutation_p.K81T|ITSN1_uc002ysy.2_Missense_Mutation_p.K197T|ITSN1_uc002ysx.2_Missense_Mutation_p.K160T|ITSN1_uc002ytb.1_Missense_Mutation_p.K197T|ITSN1_uc002ytc.1_Missense_Mutation_p.K197T|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.K160T|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Missense_Mutation_p.K197T|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.K131T	p.K197T	NM_003024	NP_003015	WXS	Illumina HiSeq	Unspecified	Q15811	ITSN1_HUMAN			7	858	+			197					A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	c.590A>C	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.925830	0.52759	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000381283;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	T;T;T;T;T;T;T;T;T;T;T;T;T	0.41065	1.49;1.01;1.07;1.01;1.11;1.52;1.07;1.41;1.51;2.07;1.09;2.09;2.12	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.47563	0.1452	L	0.31664	0.95	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.76494	0.998;0.998;0.998;0.981;0.999;0.996;0.981;0.981;0.999;0.998	D;D;D;D;D;P;D;D;D;D	0.80764	0.987;0.987;0.987;0.954;0.994;0.906;0.954;0.954;0.994;0.987	T	0.35425	-0.9789	10	0.02654	T	1	.	15.6072	0.76682	1.0:0.0:0.0:0.0	.	160;160;160;197;197;197;197;197;197;160	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	T	160;197;197;197;197;197;197;197;197;197;137;197;197;197;197	ENSP00000382290:K160T;ENSP00000370719:K197T;ENSP00000370691:K197T;ENSP00000370685:K197T;ENSP00000382301:K197T;ENSP00000382289:K197T;ENSP00000382292:K197T;ENSP00000382286:K197T;ENSP00000370683:K137T;ENSP00000382275:K197T;ENSP00000387377:K197T;ENSP00000382265:K197T;ENSP00000369294:K197T	ENSP00000369294:K197T	K	+	2	0	ITSN1	34046048	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.782000	0.85680	2.093000	0.63338	0.455000	0.32223	AAA		0.338	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024		104	76	0	0	0	0.00361	0	104	76				
KRTAP10-9	386676	broad.mit.edu	37	21	46047579	46047579	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:46047579A>T	ENST00000397911.3	+	1	540	c.491A>T	c.(490-492)cAa>cTa	p.Q164L	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	164	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.Q164L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						TCATGCTGCCAACAGTCTAGC	0.602																																							uc002zfp.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(490-492)CAA>CTA		keratin associated protein 10-9							211.0	221.0	218.0					21																	46047579		2203	4300	6503	SO:0001583	missense	386676					keratin filament		g.chr21:46047579A>T	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.491A>T	21.37:g.46047579A>T	ENSP00000381009:p.Gln164Leu		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.Q164L	NM_198690	NP_941963	WXS	Illumina HiSeq	Unspecified	P60411	KR109_HUMAN			1	540	+			164			15.|25 X 5 AA repeats of C-C-X(3).		A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	ENST00000397911.3	37	c.491A>T	CCDS42961.1	.	.	.	.	.	.	.	.	.	.	a	4.594	0.110444	0.08780	.	.	ENSG00000221837	ENST00000397911	T	0.01584	4.75	2.73	0.322	0.15888	.	.	.	.	.	T	0.04272	0.0118	M	0.92459	3.31	0.21020	N	0.999807	B	0.22909	0.077	B	0.21708	0.036	T	0.28106	-1.0054	8	.	.	.	.	4.0059	0.09600	0.6518:0.2168:0.1313:0.0	.	164	P60411	KR109_HUMAN	L	164	ENSP00000381009:Q164L	.	Q	+	2	0	KRTAP10-9	44872007	0.000000	0.05858	0.993000	0.49108	0.024000	0.10985	-0.081000	0.11321	0.281000	0.22233	-0.278000	0.10074	CAA		0.602	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128040.1			57	245	0	0	0	0.00361	0	57	245				
DIP2A	23181	broad.mit.edu	37	21	47978160	47978160	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:47978160G>T	ENST00000417564.2	+	32	3844	c.3823G>T	c.(3823-3825)Gtg>Ttg	p.V1275L	DIP2A_ENST00000400274.1_Missense_Mutation_p.V1271L|DIP2A_ENST00000318711.7_Missense_Mutation_p.V1276L			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1275					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.V1275L(1)|p.V1276L(1)		cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CCTGTCATGTGTGCGCACGTG	0.657																																							uc002zjo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(3823-3825)GTG>TTG		disco-interacting protein 2A isoform a							25.0	30.0	28.0					21																	47978160		2120	4220	6340	SO:0001583	missense	23181				multicellular organismal development	nucleus	catalytic activity|transcription factor binding	g.chr21:47978160G>T	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3823G>T	21.37:g.47978160G>T	ENSP00000392066:p.Val1275Leu		Somatic				DIP2A_uc011afz.1_Missense_Mutation_p.V1271L|DIP2A_uc002zjr.2_Missense_Mutation_p.V242L	p.V1275L	NM_015151	NP_055966	WXS	Illumina HiSeq	Unspecified	Q14689	DIP2A_HUMAN		Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)	32	4006	+	Breast(49;0.0933)		1275					A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	c.3823G>T	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468568	0.84533	.	.	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000417564	T;T;T	0.31247	1.5;1.5;1.5	5.2	5.2	0.72013	AMP-dependent synthetase/ligase (1);	0.000000	0.64402	D	0.000001	T	0.40619	0.1124	L	0.35542	1.07	0.80722	D	1	P;D;B	0.69078	0.933;0.997;0.314	P;D;B	0.79108	0.718;0.992;0.277	T	0.08472	-1.0720	10	0.02654	T	1	-23.4022	17.7235	0.88359	0.0:0.0:1.0:0.0	.	1276;66;1275	E9PER1;Q9NSX6;Q14689	.;.;DIP2A_HUMAN	L	1271;1276;1275	ENSP00000383133:V1271L;ENSP00000323633:V1276L;ENSP00000392066:V1275L	ENSP00000323633:V1276L	V	+	1	0	DIP2A	46802588	1.000000	0.71417	0.985000	0.45067	0.967000	0.64934	9.618000	0.98365	2.430000	0.82344	0.557000	0.71058	GTG		0.657	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151		6	12	1	0	8.12818e-05	0.001984	8.67513e-05	6	12				
RSPH14	27156	broad.mit.edu	37	22	23401723	23401723	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:23401723C>A	ENST00000216036.4	-	7	1160	c.964G>T	c.(964-966)Gag>Tag	p.E322*		NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		322								p.E322*(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		TCGTAAGTCTCCACCTCCATG	0.617																																							uc002zwt.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(964-966)GAG>TAG		rhabdoid tumor deletion region protein 1							110.0	105.0	107.0					22																	23401723		2203	4300	6503	SO:0001587	stop_gained	27156						binding	g.chr22:23401723C>A																												ENST00000216036.4:c.964G>T	22.37:g.23401723C>A	ENSP00000216036:p.Glu322*		Somatic					p.E322*	NM_014433	NP_055248	WXS	Illumina HiSeq	Unspecified	Q9UHP6	RTDR1_HUMAN		READ - Rectum adenocarcinoma(21;0.175)	7	1122	-	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)		322						Nonsense_Mutation	SNP	ENST00000216036.4	37	c.964G>T	CCDS13803.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932324	0.73442	.	.	ENSG00000100218	ENST00000216036	.	.	.	5.08	2.88	0.33553	.	1.789350	0.02633	N	0.104538	.	.	.	.	.	.	0.20926	N	0.999828	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-1.1789	7.363	0.26758	0.0:0.7194:0.182:0.0986	.	.	.	.	X	322	.	ENSP00000216036:E322X	E	-	1	0	RTDR1	21731723	0.111000	0.22076	0.017000	0.16124	0.008000	0.06430	1.535000	0.36061	1.238000	0.43771	0.561000	0.74099	GAG		0.617	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319049.1			30	38	1	0	1.36161e-19	0.004289	1.8039e-19	30	38				
CRYBA4	1413	broad.mit.edu	37	22	27019232	27019232	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:27019232G>T	ENST00000354760.3	+	3	109	c.74G>T	c.(73-75)cGg>cTg	p.R25L	CRYBA4_ENST00000466315.1_Intron	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4	25	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.R25L(1)		large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						TTCCAGGGCCGGCGGCACGAG	0.602																																							uc003acz.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(73-75)CGG>CTG		crystallin, beta A4							86.0	94.0	91.0					22																	27019232		2203	4300	6503	SO:0001583	missense	1413				camera-type eye development|visual perception	soluble fraction	structural constituent of eye lens	g.chr22:27019232G>T		CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.74G>T	22.37:g.27019232G>T	ENSP00000346805:p.Arg25Leu		Somatic					p.R25L	NM_001886	NP_001877	WXS	Illumina HiSeq	Unspecified	P53673	CRBA4_HUMAN			3	109	+			25			Beta/gamma crystallin 'Greek key' 1.		Q4VB22|Q6ICE4	Missense_Mutation	SNP	ENST00000354760.3	37	c.74G>T	CCDS13841.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410422	0.83340	.	.	ENSG00000196431	ENST00000354760	T	0.77877	-1.13	4.44	4.44	0.53790	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.071375	0.56097	D	0.000036	D	0.85919	0.5809	M	0.83012	2.62	0.53688	D	0.999974	D	0.54964	0.969	P	0.56278	0.795	D	0.88558	0.3121	10	0.87932	D	0	.	14.6154	0.68544	0.0:0.0:1.0:0.0	.	25	P53673	CRBA4_HUMAN	L	25	ENSP00000346805:R25L	ENSP00000346805:R25L	R	+	2	0	CRYBA4	25349232	0.894000	0.30519	1.000000	0.80357	0.972000	0.66771	2.311000	0.43717	2.309000	0.77851	0.650000	0.86243	CGG		0.602	CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320793.1	NM_001886		14	69	1	0	2.21704e-12	0.00278	2.71076e-12	14	69				
SLC5A4	6527	broad.mit.edu	37	22	32620393	32620393	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:32620393C>A	ENST00000266086.4	-	13	1537	c.1526G>T	c.(1525-1527)gGg>gTg	p.G509V	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	509					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.G509V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CAAGCAACTCCCTGTTCCATA	0.458																																							uc003ami.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1525-1527)GGG>GTG		solute carrier family 5 (low affinity glucose							95.0	75.0	82.0					22																	32620393		2203	4300	6503	SO:0001583	missense	6527				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity	g.chr22:32620393C>A	U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.1526G>T	22.37:g.32620393C>A	ENSP00000266086:p.Gly509Val		Somatic					p.G509V	NM_014227	NP_055042	WXS	Illumina HiSeq	Unspecified	Q9NY91	SC5A4_HUMAN			13	1528	-			509			Extracellular (Potential).		O15279	Missense_Mutation	SNP	ENST00000266086.4	37	c.1526G>T	CCDS13903.1	.	.	.	.	.	.	.	.	.	.	C	4.454	0.084083	0.08583	.	.	ENSG00000100191	ENST00000266086	T	0.62364	0.03	4.86	2.78	0.32641	.	0.148781	0.64402	D	0.000010	T	0.63593	0.2524	M	0.80746	2.51	0.80722	D	1	B	0.19706	0.038	B	0.25884	0.064	T	0.61362	-0.7078	10	0.66056	D	0.02	.	10.9141	0.47126	0.0:0.7857:0.1345:0.0798	.	509	Q9NY91	SC5A4_HUMAN	V	509	ENSP00000266086:G509V	ENSP00000266086:G509V	G	-	2	0	SLC5A4	30950393	0.685000	0.27652	0.024000	0.17045	0.001000	0.01503	2.454000	0.44979	0.268000	0.21939	-0.795000	0.03280	GGG		0.458	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315724.1	NM_014227		9	88	1	0	3.45872e-05	0.004007	3.72628e-05	9	88				
CSF2RB	1439	broad.mit.edu	37	22	37329915	37329915	+	Silent	SNP	C	C	A	rs199780194	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:37329915C>A	ENST00000403662.3	+	10	1416	c.1194C>A	c.(1192-1194)gcC>gcA	p.A398A	CSF2RB_ENST00000536485.1_Silent_p.A345A|CSF2RB_ENST00000262825.5_Silent_p.A404A|CSF2RB_ENST00000406230.1_Silent_p.A404A			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	398	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.A398A(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	ACAGCATGGCCCTGCCAGCCC	0.677																																							uc003aqa.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|pancreas(1)	3						c.(1192-1194)GCC>GCA		colony stimulating factor 2 receptor, beta	Sargramostim(DB00020)						89.0	74.0	79.0					22																	37329915		2201	4299	6500	SO:0001819	synonymous_variant	1439				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity	g.chr22:37329915C>A	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.1194C>A	22.37:g.37329915C>A			Somatic				CSF2RB_uc003aqc.3_Silent_p.A404A	p.A398A	NM_000395	NP_000386	WXS	Illumina HiSeq	Unspecified	P32927	IL3RB_HUMAN			10	1411	+			398			Extracellular (Potential).|Fibronectin type-III 2.		Q5JZI1|Q6ICE0	Silent	SNP	ENST00000403662.3	37	c.1194C>A	CCDS13936.1																																																																																				0.677	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395		13	2	1	0	1.10513e-12	0.002299	1.35706e-12	13	2				
IL2RB	3560	broad.mit.edu	37	22	37532295	37532295	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:37532295G>T	ENST00000216223.5	-	7	874	c.676C>A	c.(676-678)Ccc>Acc	p.P226T	AL022314.1_ENST00000516333.1_RNA	NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	226	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)	p.P226T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	AAGGCCAGGGGCTGGCTCCAG	0.647																																							uc003aqv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(676-678)CCC>ACC		interleukin 2 receptor beta precursor	Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)						26.0	27.0	27.0					22																	37532295		2203	4299	6502	SO:0001583	missense	3560				interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity	g.chr22:37532295G>T	M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.676C>A	22.37:g.37532295G>T	ENSP00000216223:p.Pro226Thr		Somatic					p.P226T	NM_000878	NP_000869	WXS	Illumina HiSeq	Unspecified	P14784	IL2RB_HUMAN			7	807	-			226			Extracellular (Potential).|Fibronectin type-III.		B2R765	Missense_Mutation	SNP	ENST00000216223.5	37	c.676C>A	CCDS13942.1	.	.	.	.	.	.	.	.	.	.	G	9.281	1.048237	0.19827	.	.	ENSG00000100385	ENST00000216223	D	0.97256	-4.31	4.5	-5.4	0.02656	Short hematopoietin receptor, family 1, conserved site (1);Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.805132	0.11113	N	0.598354	D	0.90438	0.7006	L	0.37750	1.13	0.33017	D	0.528289	P	0.38440	0.631	B	0.28784	0.094	D	0.84284	0.0496	10	0.25751	T	0.34	-8.6031	7.9026	0.29744	0.0:0.2156:0.3211:0.4633	.	226	P14784	IL2RB_HUMAN	T	226	ENSP00000216223:P226T	ENSP00000216223:P226T	P	-	1	0	IL2RB	35862241	0.900000	0.30661	0.994000	0.49952	0.845000	0.48019	-0.095000	0.11077	-0.374000	0.07967	0.462000	0.41574	CCC		0.647	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318792.1			19	34	1	0	4.54149e-19	0.002299	5.98889e-19	19	34				
IL17REL	400935	broad.mit.edu	37	22	50438923	50438923	+	Missense_Mutation	SNP	C	C	A	rs137904241		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:50438923C>A	ENST00000389983.2	-	6	582	c.318G>T	c.(316-318)caG>caT	p.Q106H	IL17REL_ENST00000341280.5_Missense_Mutation_p.Q106H	NM_001001694.2	NP_001001694.2	Q6ZVW7	I17EL_HUMAN	interleukin 17 receptor E-like	106								p.Q106H(1)		endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		CGAGGTGCCTCTGGTCCAGCT	0.652																																							uc003bje.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(316-318)CAG>CAT		interleukin 17 receptor E-like							70.0	69.0	69.0					22																	50438923		2203	4300	6503	SO:0001583	missense	400935							g.chr22:50438923C>A	AK123987	CCDS33679.1	22q13.33	2009-01-13			ENSG00000188263	ENSG00000188263			33808	protein-coding gene	gene with protein product		613414					Standard	NM_001001694		Approved	FLJ41993	uc003bje.1	Q6ZVW7	OTTHUMG00000150242	ENST00000389983.2:c.318G>T	22.37:g.50438923C>A	ENSP00000374633:p.Gln106His		Somatic					p.Q106H	NM_001001694	NP_001001694	WXS	Illumina HiSeq	Unspecified	Q6ZVW7	I17EL_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)	6	550	-		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)	106					A6NCN4|A6PVC1	Missense_Mutation	SNP	ENST00000389983.2	37	c.318G>T	CCDS33679.1	.	.	.	.	.	.	.	.	.	.	c	10.82	1.458632	0.26248	.	.	ENSG00000188263	ENST00000389983;ENST00000341280	T;T	0.16457	2.34;2.34	3.99	-2.82	0.05787	.	0.713723	0.12937	U	0.426861	T	0.19327	0.0464	L	0.53249	1.67	0.09310	N	1	P	0.47677	0.899	P	0.53549	0.729	T	0.12268	-1.0554	10	0.44086	T	0.13	.	1.5167	0.02507	0.1443:0.4169:0.1426:0.2962	.	106	Q6ZVW7	I17EL_HUMAN	H	106	ENSP00000374633:Q106H;ENSP00000342520:Q106H	ENSP00000342520:Q106H	Q	-	3	2	IL17REL	48781050	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.219000	0.09228	-0.081000	0.12662	0.651000	0.88453	CAG		0.652	IL17REL-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317011.1	NM_001001694		4	5	1	0	0.00909568	0.009096	0.00927435	4	5				
KLHDC7B	113730	broad.mit.edu	37	22	50987690	50987690	+	Silent	SNP	C	C	T	rs147168342	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:50987690C>T	ENST00000395676.2	+	1	1229	c.1095C>T	c.(1093-1095)tcC>tcT	p.S365S	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	365								p.S266S(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TCCGTGGCTCCGGTGCCAAGG	0.672													C|||	7	0.00139776	0.0008	0.0029	5008	,	,		14569	0.0		0.003	False		,,,				2504	0.001						uc003bmi.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1093-1095)TCC>TCT		kelch domain containing 7B		C		2,4318		0,2,2158	38.0	44.0	42.0		1095	-10.7	0.0	22	dbSNP_134	42	34,8396		0,34,4181	no	coding-synonymous	KLHDC7B	NM_138433.3		0,36,6339	TT,TC,CC		0.4033,0.0463,0.2824		365/595	50987690	36,12714	2160	4215	6375	SO:0001819	synonymous_variant	113730							g.chr22:50987690C>T	BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1095C>T	22.37:g.50987690C>T			Somatic					p.S365S	NM_138433	NP_612442	WXS	Illumina HiSeq	Unspecified	Q96G42	KLD7B_HUMAN		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	1	1229	+		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)	365			Kelch 2.			Silent	SNP	ENST00000395676.2	37	c.1095C>T	CCDS14097.2																																																																																				0.672	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317089.2	NM_138433		2	1	0	0	0	0.004672	0	2	1				
CHL1	10752	broad.mit.edu	37	3	433422	433422	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:433422G>T	ENST00000256509.2	+	23	3498	c.2856G>T	c.(2854-2856)tgG>tgT	p.W952C	CHL1_ENST00000397491.2_Missense_Mutation_p.W936C	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.W952C(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CTTTATCTTGGGGACTACCTA	0.323																																							uc003bou.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12						c.(2806-2808)TGG>TGT		cell adhesion molecule with homology to L1CAM							84.0	85.0	85.0					3																	433422		2203	4300	6503	SO:0001583	missense	10752				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr3:433422G>T	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2856G>T	3.37:g.433422G>T	ENSP00000256509:p.Trp952Cys		Somatic				CHL1_uc003bot.2_Missense_Mutation_p.W952C|CHL1_uc003bow.1_Missense_Mutation_p.W936C|CHL1_uc011asi.1_Missense_Mutation_p.W952C	p.W936C	NM_006614	NP_006605	WXS	Illumina HiSeq	Unspecified	O00533	CHL1_HUMAN		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)	22	3079	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	936			Fibronectin type-III 4.|Extracellular (Potential).		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	c.2808G>T	CCDS2556.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.29|19.29	3.799455|3.799455	0.70567|0.70567	.|.	.|.	ENSG00000134121|ENSG00000134121	ENST00000445697|ENST00000256509;ENST00000397491	.|D;D	.|0.86297	.|-2.1;-2.1	5.62|5.62	5.62|5.62	0.85841|0.85841	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95881|0.95881	0.8659|0.8659	H|H	0.95504|0.95504	3.68|3.68	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.96729|0.96729	0.9538|0.9538	5|10	.|0.87932	.|D	.|0	.|.	19.6536|19.6536	0.95828|0.95828	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|936;936;952	.|B3KX75;O00533;O00533-2	.|.;CHL1_HUMAN;.	V|C	139|952;936	.|ENSP00000256509:W952C;ENSP00000380628:W936C	.|ENSP00000256509:W952C	G|W	+|+	2|3	0|0	CHL1|CHL1	408422|408422	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.684000|0.684000	0.39900|0.39900	8.553000|8.553000	0.90686|0.90686	2.637000|2.637000	0.89404|0.89404	0.650000|0.650000	0.86243|0.86243	GGG|TGG		0.323	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614		40	21	1	0	6.07928e-31	0.009718	8.87792e-31	40	21				
DLEC1	9940	broad.mit.edu	37	3	38104226	38104226	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:38104226C>T	ENST00000308059.6	+	5	1049	c.1028C>T	c.(1027-1029)tCt>tTt	p.S343F	DLEC1_ENST00000452631.2_Missense_Mutation_p.S343F|DLEC1_ENST00000346219.3_Missense_Mutation_p.S343F					deleted in lung and esophageal cancer 1									p.S343F(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		GGAGGCAAGTCTCTTGTTTTT	0.458																																							uc003cho.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(1027-1029)TCT>TTT		deleted in lung and esophageal cancer 1 isoform							89.0	86.0	87.0					3																	38104226		1846	4097	5943	SO:0001583	missense	9940				negative regulation of cell proliferation	cytoplasm		g.chr3:38104226C>T	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.1028C>T	3.37:g.38104226C>T	ENSP00000308597:p.Ser343Phe		Somatic				DLEC1_uc003chp.1_Missense_Mutation_p.S343F|DLEC1_uc010hgv.1_Missense_Mutation_p.S343F|DLEC1_uc010hgw.1_Missense_Mutation_p.S42F|DLEC1_uc003chq.1_RNA	p.S343F	NM_007335	NP_031361	WXS	Illumina HiSeq	Unspecified	Q9Y238	DLEC1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)	5	1049	+			343						Missense_Mutation	SNP	ENST00000308059.6	37	c.1028C>T	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	C	18.26	3.583940	0.65992	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.06687	3.28;3.27;3.5	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	M	0.77820	2.39	0.53005	D	0.999962	D;D;D;D	0.89917	0.996;1.0;1.0;1.0	P;D;D;D	0.85130	0.693;0.997;0.994;0.996	T	0.01081	-1.1458	10	0.72032	D	0.01	-25.3211	13.25	0.60045	0.0:1.0:0.0:0.0	.	343;343;343;343	A1L305;F8W6T4;Q9Y238-3;Q9Y238	.;.;.;DLEC1_HUMAN	F	343	ENSP00000308597:S343F;ENSP00000315914:S343F;ENSP00000410427:S343F	ENSP00000308597:S343F	S	+	2	0	DLEC1	38079230	1.000000	0.71417	0.986000	0.45419	0.734000	0.41952	2.722000	0.47269	2.581000	0.87130	0.655000	0.94253	TCT		0.458	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337		18	12	0	0	0	0.002299	0	18	12				
XIRP1	165904	broad.mit.edu	37	3	39229235	39229235	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:39229235G>T	ENST00000340369.3	-	2	1930	c.1702C>A	c.(1702-1704)Cag>Aag	p.Q568K	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.Q568K	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	568	Interaction with CTNNB1. {ECO:0000250}.				cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.Q568K(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TGTCGTTCCTGCTGCTCCCGT	0.617																																							uc003cjk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8						c.(1702-1704)CAG>AAG		xin actin-binding repeat containing 1							55.0	52.0	53.0					3																	39229235		2203	4300	6503	SO:0001583	missense	165904						actin binding	g.chr3:39229235G>T	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1702C>A	3.37:g.39229235G>T	ENSP00000343140:p.Gln568Lys		Somatic				XIRP1_uc003cji.2_Missense_Mutation_p.Q568K|XIRP1_uc003cjj.2_Intron	p.Q568K	NM_194293	NP_919269	WXS	Illumina HiSeq	Unspecified	Q702N8	XIRP1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)	2	1923	-			568			Interaction with CTNNB1 (By similarity).		A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	c.1702C>A	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	G	1.217	-0.628056	0.03610	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.04862	3.54;3.92	5.06	3.14	0.36123	.	0.399171	0.25975	N	0.027104	T	0.07908	0.0198	L	0.31065	0.9	0.42845	D	0.994066	P;D	0.57899	0.483;0.981	B;P	0.48952	0.057;0.596	T	0.45556	-0.9253	10	0.22706	T	0.39	.	14.0351	0.64640	0.0:0.2849:0.7151:0.0	.	568;568	Q702N8;Q702N8-2	XIRP1_HUMAN;.	K	568	ENSP00000379550:Q568K;ENSP00000343140:Q568K	ENSP00000343140:Q568K	Q	-	1	0	XIRP1	39204239	0.984000	0.35163	0.806000	0.32338	0.111000	0.19643	2.888000	0.48594	1.257000	0.44085	0.655000	0.94253	CAG		0.617	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522		17	4	1	0	2.41591e-17	0.004656	3.12101e-17	17	4				
ZNF35	7584	broad.mit.edu	37	3	44700712	44700713	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:44700712_44700713CC>AA	ENST00000396056.2	+	4	1092_1093	c.857_858CC>AA	c.(856-858)gCC>gAA	p.A286E	ZNF35_ENST00000542250.1_Missense_Mutation_p.A126E|ZNF35_ENST00000296092.3_3'UTR|RP11-944L7.4_ENST00000457331.1_RNA	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	286					cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A286E(1)		large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		TGTGGGAAAGCCTTCACTCAGA	0.411																																							uc003cnq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(856-858)GCC>GAA		zinc finger protein 35																																				SO:0001583	missense	7584				cellular response to retinoic acid|spermatogenesis	nucleus|perinuclear region of cytoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:44700712_44700713CC>AA	X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	Exception_encountered	3.37:g.44700712_44700713delinsAA	ENSP00000379368:p.Ala286Glu		Somatic				ZNF35_uc003cnr.2_Missense_Mutation_p.A126E	p.A286E	NM_003420	NP_003411	WXS	Illumina HiSeq	Unspecified	P13682	ZNF35_HUMAN		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	4	1078_1079	+		Ovarian(412;0.0228)	286			C2H2-type 3.		B2RBU6|Q53Y54|Q96D01	Missense_Mutation	DNP	ENST00000396056.2	37	c.857_858CC>AA	CCDS2718.2																																																																																				0.411	ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256749.4	NM_003420		43	26	0	0	0	0.004672	0	43	26				
PRSS42	339906	broad.mit.edu	37	3	46873408	46873408	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:46873408C>A	ENST00000429665.1	-	4	749	c.750G>T	c.(748-750)ggG>ggT	p.G250G	PRSS42_ENST00000447340.1_Intron	NM_182702.1	NP_874361.1	Q7Z5A4	PRS42_HUMAN	protease, serine, 42	250	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				germ cell development (GO:0007281)|spermatogenesis (GO:0007283)	anchored component of plasma membrane (GO:0046658)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.G250G(1)		breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	8						CACAGACCATCCCTTTTATTA	0.383																																							uc011bap.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(748-750)GGG>GGT		testis serine protease 2 precursor							182.0	179.0	180.0					3																	46873408		1874	4114	5988	SO:0001819	synonymous_variant	339906				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr3:46873408C>A		CCDS46816.1	3p21.31	2010-05-07			ENSG00000178055	ENSG00000178055		"""Serine peptidases / Serine peptidases"""	30716	protein-coding gene	gene with protein product	"""testis serine protease 2"""					12838346	Standard	NM_182702		Approved	TESSP2	uc011bap.2	Q7Z5A4	OTTHUMG00000156496	ENST00000429665.1:c.750G>T	3.37:g.46873408C>A			Somatic				PRSS42_uc003cqj.2_Intron	p.G250G	NM_182702	NP_874361	WXS	Illumina HiSeq	Unspecified	Q7Z5A4	PRS42_HUMAN			4	750	-			250			Peptidase S1.			Silent	SNP	ENST00000429665.1	37	c.750G>T	CCDS46816.1																																																																																				0.383	PRSS42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344347.1	NM_182702		43	26	1	0	1.47857e-17	0.00361	1.91879e-17	43	26				
KIF9	64147	broad.mit.edu	37	3	47286357	47286357	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:47286357C>T	ENST00000265529.3	-	16	2118	c.1438G>A	c.(1438-1440)Gga>Aga	p.G480R	KIF9_ENST00000444589.2_Missense_Mutation_p.G480R|KIF9_ENST00000335044.2_Missense_Mutation_p.G480R|KIF9_ENST00000487440.1_5'UTR|KIF9_ENST00000452770.2_Missense_Mutation_p.G480R|KIF9-AS1_ENST00000429315.3_RNA|KIF9_ENST00000352910.4_Missense_Mutation_p.G387R			Q9HAQ2	KIF9_HUMAN	kinesin family member 9	480					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)	p.G480R(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		ACTCCGAGTCCAAAGTTTTGT	0.527																																					Colon(44;962 1147 15977 24541)	Colon(44;962 1147 15977 24541)	uc010hjp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1438-1440)GGA>AGA		kinesin family member 9 isoform 2							123.0	109.0	113.0					3																	47286357		2203	4300	6503	SO:0001583	missense	64147				blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr3:47286357C>T	AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.1438G>A	3.37:g.47286357C>T	ENSP00000265529:p.Gly480Arg		Somatic				KIF9_uc003cqx.2_Missense_Mutation_p.G480R|KIF9_uc003cqy.2_Missense_Mutation_p.G480R|KIF9_uc011bat.1_RNA	p.G480R	NM_001134878	NP_001128350	WXS	Illumina HiSeq	Unspecified	Q9HAQ2	KIF9_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)	16	2042	-		Acute lymphoblastic leukemia(5;0.164)	480					Q86Z28|Q9H8A4	Missense_Mutation	SNP	ENST00000265529.3	37	c.1438G>A	CCDS2752.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.116743	0.56505	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000444589;ENST00000452770;ENST00000352910	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	4.65	4.65	0.58169	.	0.134500	0.47852	D	0.000211	T	0.66723	0.2818	L	0.61218	1.895	0.38795	D	0.955074	D;D	0.56287	0.975;0.97	P;P	0.61397	0.888;0.743	T	0.70081	-0.4970	10	0.52906	T	0.07	.	15.4111	0.74923	0.0:1.0:0.0:0.0	.	480;480	Q9HAQ2-2;Q9HAQ2	.;KIF9_HUMAN	R	480;480;480;480;387	ENSP00000333942:G480R;ENSP00000265529:G480R;ENSP00000414987:G480R;ENSP00000391100:G480R;ENSP00000292334:G387R	ENSP00000265529:G480R	G	-	1	0	KIF9	47261361	0.992000	0.36948	0.897000	0.35233	0.091000	0.18340	4.281000	0.58965	2.591000	0.87537	0.650000	0.86243	GGA		0.527	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257475.2			3	39	0	0	0	0.009096	0	3	39				
EPHA3	2042	broad.mit.edu	37	3	89456501	89456501	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:89456501C>A	ENST00000336596.2	+	8	1902	c.1677C>A	c.(1675-1677)gtC>gtA	p.V559V	EPHA3_ENST00000494014.1_Silent_p.V559V	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	559					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.V559V(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TCACTGTTGTCATCTATGTTT	0.423										TSP Lung(6;0.00050)																													uc003dqy.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(1675-1677)GTC>GTA		ephrin receptor EphA3 isoform a precursor							201.0	166.0	178.0					3																	89456501		2203	4300	6503	SO:0001819	synonymous_variant	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89456501C>A	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1677C>A	3.37:g.89456501C>A		TSP Lung(6;0.00050)	Somatic				EPHA3_uc010hon.1_RNA	p.V559V	NM_005233	NP_005224	WXS	Illumina HiSeq	Unspecified	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	8	1902	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	559			Helical; (Potential).		Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	c.1677C>A	CCDS2922.1																																																																																				0.423	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		65	68	1	0	1.15062e-32	0.00361	1.7065e-32	65	68				
PLCXD2	257068	broad.mit.edu	37	3	111427042	111427042	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:111427042G>T	ENST00000477665.1	+	2	757	c.433G>T	c.(433-435)Gaa>Taa	p.E145*	PLCXD2_ENST00000393934.3_Nonsense_Mutation_p.E145*	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2	145	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)	p.E145*(1)		endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						TGGGCTGATGGAAATTGACTC	0.493																																							uc003dya.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(433-435)GAA>TAA		phosphatidylinositol-specific phospholipase C, X							135.0	133.0	134.0					3																	111427042		2203	4300	6503	SO:0001587	stop_gained	257068				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity	g.chr3:111427042G>T	AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.433G>T	3.37:g.111427042G>T	ENSP00000420686:p.Glu145*		Somatic				PLCXD2_uc003dyb.2_Nonsense_Mutation_p.E145*|PLCXD2_uc003dxz.2_Nonsense_Mutation_p.E145*	p.E145*	NM_001134478	NP_001127950	WXS	Illumina HiSeq	Unspecified	Q0VAA5	PLCX2_HUMAN			2	1019	+			145			PI-PLC X-box.		Q96N12	Nonsense_Mutation	SNP	ENST00000477665.1	37	c.433G>T	CCDS54619.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799351	0.90538	.	.	ENSG00000240891	ENST00000393934;ENST00000477665;ENST00000468174	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-26.7832	17.5138	0.87767	0.0:0.0:1.0:0.0	.	.	.	.	X	145;145;55	.	ENSP00000377511:E145X	E	+	1	0	PLCXD2	112909732	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	8.354000	0.90080	2.804000	0.96469	0.655000	0.94253	GAA		0.493	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354322.1	NM_153268		39	100	1	0	4.64027e-19	0.00361	6.10505e-19	39	100				
ATP1B3	483	broad.mit.edu	37	3	141632604	141632604	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:141632604G>T	ENST00000286371.3	+	4	645	c.457G>T	c.(457-459)Gca>Tca	p.A153S	ATP1B3_ENST00000539728.1_Missense_Mutation_p.A139S|ATP1B3_ENST00000462082.1_Intron	NM_001679.2	NP_001670.1	P54709	AT1B3_HUMAN	ATPase, Na+/K+ transporting, beta 3 polypeptide	153					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|transport (GO:0006810)	caveola (GO:0005901)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.A153S(1)		cervix(1)|endometrium(1)|lung(2)	4						ATTACTTCAAGCATGCAGTGG	0.398																																							uc003eug.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(457-459)GCA>TCA		Na+/K+ -ATPase beta 3 subunit							186.0	176.0	180.0					3																	141632604		2203	4300	6503	SO:0001583	missense	483				ATP biosynthetic process|blood coagulation|leukocyte migration	melanosome|sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity	g.chr3:141632604G>T	BC011835	CCDS3121.1	3q23	2012-10-22			ENSG00000069849	ENSG00000069849		"""CD molecules"", ""ATPases / P-type"""	806	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-3"", ""sodium pump subunit beta-3"", ""sodium-potassium ATPase subunit beta 3 (non-catalytic)"""	601867				8798450, 9457675	Standard	NM_001679		Approved	FLJ29027, CD298	uc003eug.1	P54709	OTTHUMG00000159081	ENST00000286371.3:c.457G>T	3.37:g.141632604G>T	ENSP00000286371:p.Ala153Ser		Somatic				ATP1B3_uc011bne.1_RNA|ATP1B3_uc003euh.1_Missense_Mutation_p.A139S	p.A153S	NM_001679	NP_001670	WXS	Illumina HiSeq	Unspecified	P54709	AT1B3_HUMAN			4	631	+			153			Extracellular (Potential).		B7Z1N7	Missense_Mutation	SNP	ENST00000286371.3	37	c.457G>T	CCDS3121.1	.	.	.	.	.	.	.	.	.	.	G	6.139	0.393920	0.11638	.	.	ENSG00000069849	ENST00000475483;ENST00000286371;ENST00000539728	T;T;T	0.28895	1.59;1.59;1.59	5.32	2.34	0.29019	.	1.278880	0.04749	N	0.424199	T	0.26412	0.0645	L	0.43554	1.36	0.09310	N	1	B;B	0.24132	0.026;0.098	B;B	0.20384	0.029;0.029	T	0.25916	-1.0118	10	0.15499	T	0.54	-28.9352	8.1291	0.31016	0.089:0.4274:0.4836:0.0	.	139;153	D3DNF9;P54709	.;AT1B3_HUMAN	S	96;153;139	ENSP00000417522:A96S;ENSP00000286371:A153S;ENSP00000440307:A139S	ENSP00000286371:A153S	A	+	1	0	ATP1B3	143115294	0.000000	0.05858	0.001000	0.08648	0.181000	0.23173	0.226000	0.17776	0.605000	0.29947	0.591000	0.81541	GCA		0.398	ATP1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353218.1	NM_001679		134	69	1	0	1.47408e-88	0.00361	2.60589e-88	134	69				
B3GNT5	84002	broad.mit.edu	37	3	182988136	182988136	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:182988136C>T	ENST00000326505.3	+	2	1080	c.550C>T	c.(550-552)Cca>Tca	p.P184S	B3GNT5_ENST00000465010.1_Missense_Mutation_p.P184S|MCF2L2_ENST00000473233.1_Intron|MCF2L2_ENST00000447025.2_Intron|MCF2L2_ENST00000328913.3_Intron|B3GNT5_ENST00000460419.1_Missense_Mutation_p.P184S	NM_032047.4	NP_114436.1	Q9BYG0	B3GN5_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5	184					cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycolipid biosynthetic process (GO:0009247)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity (GO:0008457)|galactosyltransferase activity (GO:0008378)|lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase activity (GO:0047256)|lipopolysaccharide N-acetylglucosaminyltransferase activity (GO:0008917)	p.P184S(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TACCTATTGTCCACATGCCAA	0.333																																							uc003flk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(550-552)CCA>TCA		UDP-GlcNAc:betaGal							98.0	97.0	98.0					3																	182988136		2203	4300	6503	SO:0001583	missense	84002				central nervous system development|glycolipid biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity|galactosyltransferase activity	g.chr3:182988136C>T	AB045278	CCDS3244.1	3q28	2013-02-21			ENSG00000176597	ENSG00000176597	2.4.1.206	"""Beta 3-glycosyltransferases"""	15684	protein-coding gene	gene with protein product	"""lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase"""	615333				11283017	Standard	XM_005247824		Approved	B3GN-T5, beta3Gn-T5	uc003flk.3	Q9BYG0	OTTHUMG00000158436	ENST00000326505.3:c.550C>T	3.37:g.182988136C>T	ENSP00000316173:p.Pro184Ser		Somatic				MCF2L2_uc003fli.1_Intron|MCF2L2_uc003flj.1_Intron|MCF2L2_uc011bqr.1_Intron|B3GNT5_uc003fll.2_Missense_Mutation_p.P184S|B3GNT5_uc003flm.2_Missense_Mutation_p.P184S	p.P184S	NM_032047	NP_114436	WXS	Illumina HiSeq	Unspecified	Q9BYG0	B3GN5_HUMAN	all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)		2	1080	+	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		184			Lumenal (Potential).		D3DNS5|Q59FE3|Q7L9Z5|Q8WWP9	Missense_Mutation	SNP	ENST00000326505.3	37	c.550C>T	CCDS3244.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.897908	0.52227	.	.	ENSG00000176597	ENST00000326505;ENST00000460419;ENST00000465010	T;T;T	0.49432	0.78;0.78;0.78	5.91	5.0	0.66597	.	0.184499	0.47852	D	0.000215	T	0.49321	0.1550	L	0.56396	1.775	0.44685	D	0.997676	P	0.43578	0.811	B	0.40825	0.341	T	0.54497	-0.8285	10	0.52906	T	0.07	.	18.7369	0.91757	0.0:0.8744:0.1256:0.0	.	184	Q9BYG0	B3GN5_HUMAN	S	184	ENSP00000316173:P184S;ENSP00000420778:P184S;ENSP00000417868:P184S	ENSP00000316173:P184S	P	+	1	0	B3GNT5	184470830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.990000	0.40717	2.804000	0.96469	0.650000	0.86243	CCA		0.333	B3GNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351009.1	NM_032047		7	151	0	0	0	0.004482	0	7	151				
MUC4	4585	broad.mit.edu	37	3	195516223	195516223	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:195516223G>C	ENST00000463781.3	-	2	2687	c.2228C>G	c.(2227-2229)tCt>tGt	p.S743C	MUC4_ENST00000475231.1_Missense_Mutation_p.S743C|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	748					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S743C(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACACTACAGAGTTGGCCAG	0.602																																							uc011bto.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2227-2229)TCT>TGT		mucin 4 isoform a							105.0	115.0	112.0					3																	195516223		2138	4256	6394	SO:0001583	missense	4585				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity	g.chr3:195516223G>C	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2228C>G	3.37:g.195516223G>C	ENSP00000417498:p.Ser743Cys		Somatic				MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.S625C	p.S743C	NM_018406	NP_060876	WXS	Illumina HiSeq	Unspecified	Q99102	MUC4_HUMAN	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)	2	2688	-	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	748					O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	c.2228C>G	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.072	0.198918	0.09652	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.48836	0.8;0.82	2.77	2.77	0.32553	.	0.545868	0.15377	N	0.265519	T	0.55337	0.1914	L	0.46157	1.445	0.09310	N	1	D;D	0.76494	0.999;0.999	P;P	0.62813	0.886;0.907	T	0.37865	-0.9687	10	0.59425	D	0.04	-6.0784	9.4939	0.38976	0.0:0.0:1.0:0.0	.	743;748	E7ESK3;Q99102	.;MUC4_HUMAN	C	743;743;717	ENSP00000417498:S743C;ENSP00000420243:S743C	ENSP00000376209:S717C	S	-	2	0	MUC4	197000618	0.285000	0.24296	0.002000	0.10522	0.009000	0.06853	2.675000	0.46875	1.907000	0.55213	0.621000	0.83404	TCT		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406		13	8	0	0	0	0.00245	0	13	8				
NOP14	8602	broad.mit.edu	37	4	2954074	2954074	+	Silent	SNP	C	C	T	rs149472162	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:2954074C>T	ENST00000314262.6	-	6	846	c.798G>A	c.(796-798)gcG>gcA	p.A266A	NOP14_ENST00000398071.4_Silent_p.A266A|NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000502735.1_Silent_p.A266A|NOP14-AS1_ENST00000515194.1_RNA|NOP14_ENST00000416614.2_Silent_p.A266A	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	266					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)	p.A266A(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TAGAGGGCTGCGCCTTCATTT	0.468													C|||	4	0.000798722	0.0015	0.0	5008	,	,		15246	0.0		0.0	False		,,,				2504	0.002						uc003ggj.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(796-798)GCG>GCA		probable nucleolar complex protein 14		C		5,4401	9.9+/-24.2	0,5,2198	99.0	88.0	92.0		798	-10.5	0.0	4	dbSNP_134	92	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NOP14	NM_003703.1		0,6,6497	TT,TC,CC		0.0116,0.1135,0.0461		266/858	2954074	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	8602				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding	g.chr4:2954074C>T	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.798G>A	4.37:g.2954074C>T			Somatic				C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Silent_p.A12A|NOP14_uc003ggk.3_Silent_p.A266A|NOP14_uc003ggl.2_Silent_p.A266A|NOP14_uc010icq.1_RNA	p.A266A	NM_003703	NP_003694	WXS	Illumina HiSeq	Unspecified	P78316	NOP14_HUMAN			6	870	-			266					D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Silent	SNP	ENST00000314262.6	37	c.798G>A	CCDS33945.1																																																																																				0.468	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358135.2	NM_003703		3	35	0	0	0	0.000602	0	3	35				
HS3ST1	9957	broad.mit.edu	37	4	11401489	11401489	+	Silent	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:11401489T>A	ENST00000002596.5	-	2	1315	c.141A>T	c.(139-141)ccA>ccT	p.P47P		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	47					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)	p.P47P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						CAGAGCCGTTTGGGGCCACGC	0.692																																							uc003gmq.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(139-141)CCA>CCT		heparan sulfate D-glucosaminyl							27.0	25.0	25.0					4																	11401489		2200	4297	6497	SO:0001819	synonymous_variant	9957					Golgi lumen|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity	g.chr4:11401489T>A	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.141A>T	4.37:g.11401489T>A			Somatic					p.P47P	NM_005114	NP_005105	WXS	Illumina HiSeq	Unspecified	O14792	HS3S1_HUMAN			2	464	-			47					B3KUA6|Q6PEY8	Silent	SNP	ENST00000002596.5	37	c.141A>T	CCDS3408.1																																																																																				0.692	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	NM_005114		11	16	0	0	0	0.001368	0	11	16				
GPR125	166647	broad.mit.edu	37	4	22422541	22422541	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:22422541C>A	ENST00000334304.5	-	12	2046	c.1777G>T	c.(1777-1779)Gtt>Ttt	p.V593F	GPR125_ENST00000502482.1_Missense_Mutation_p.V593F|GPR125_ENST00000282943.5_5'UTR|GPR125_ENST00000508133.1_Missense_Mutation_p.V367F	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	593					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)	p.V593F(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				GTATTTGAAACATTGCACTTA	0.413																																							uc003gqm.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1777-1779)GTT>TTT		G protein-coupled receptor 125 precursor							203.0	211.0	209.0					4																	22422541		2203	4300	6503	SO:0001583	missense	166647				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity	g.chr4:22422541C>A	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.1777G>T	4.37:g.22422541C>A	ENSP00000334952:p.Val593Phe		Somatic				GPR125_uc010ieo.1_Missense_Mutation_p.V467F|GPR125_uc003gqn.1_Missense_Mutation_p.V367F|GPR125_uc003gqo.2_Missense_Mutation_p.V593F	p.V593F	NM_145290	NP_660333	WXS	Illumina HiSeq	Unspecified	Q8IWK6	GP125_HUMAN			12	2042	-		Breast(46;0.198)	593			Extracellular (Potential).		Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	c.1777G>T	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.324216	0.60634	.	.	ENSG00000152990	ENST00000334304;ENST00000508133;ENST00000502482	T;T	0.58797	0.58;0.31	5.21	4.27	0.50696	.	0.196374	0.47093	D	0.000243	T	0.55401	0.1918	L	0.38175	1.15	0.48975	D	0.999738	P;D;P;P	0.52996	0.793;0.957;0.571;0.624	P;P;B;B	0.48795	0.536;0.59;0.183;0.154	T	0.60337	-0.7283	10	0.87932	D	0	-23.1487	13.6391	0.62239	0.0:0.9192:0.0:0.0808	.	468;593;367;593	Q8IWK6-3;Q8IWK6-2;Q8IWK6-4;Q8IWK6	.;.;.;GP125_HUMAN	F	593;367;593	ENSP00000334952:V593F;ENSP00000421006:V593F	ENSP00000334952:V593F	V	-	1	0	GPR125	22031639	0.971000	0.33674	0.124000	0.21820	0.893000	0.52053	2.298000	0.43602	1.151000	0.42436	0.655000	0.94253	GTT		0.413	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3			93	420	1	0	8.58103e-55	0.00361	1.44536e-54	93	420				
CCKAR	886	broad.mit.edu	37	4	26487314	26487314	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:26487314G>T	ENST00000295589.3	-	3	765	c.571C>A	c.(571-573)Cag>Aag	p.Q191K		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	191					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)	p.Q191K(1)		NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	TTCGCGGTCTGGTTGTTATTT	0.408																																							uc003gse.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|pancreas(1)	4						c.(571-573)CAG>AAG		cholecystokinin A receptor	Ceruletide(DB00403)						118.0	113.0	114.0					4																	26487314		2203	4300	6503	SO:0001583	missense	886				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity	g.chr4:26487314G>T	L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.571C>A	4.37:g.26487314G>T	ENSP00000295589:p.Gln191Lys		Somatic					p.Q191K	NM_000730	NP_000721	WXS	Illumina HiSeq	Unspecified	P32238	CCKAR_HUMAN			3	724	-		Breast(46;0.0503)	191			Extracellular (Potential).		B2R9Z5	Missense_Mutation	SNP	ENST00000295589.3	37	c.571C>A	CCDS3438.1	.	.	.	.	.	.	.	.	.	.	G	6.901	0.535722	0.13188	.	.	ENSG00000163394	ENST00000295589	T	0.36340	1.26	5.69	5.69	0.88448	GPCR, rhodopsin-like superfamily (1);	0.171410	0.50627	D	0.000114	T	0.19406	0.0466	N	0.12527	0.23	0.36188	D	0.849863	B	0.15473	0.013	B	0.17098	0.017	T	0.10636	-1.0621	10	0.05525	T	0.97	.	13.7688	0.63012	0.0:0.0:0.744:0.256	.	191	P32238	CCKAR_HUMAN	K	191	ENSP00000295589:Q191K	ENSP00000295589:Q191K	Q	-	1	0	CCKAR	26096412	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	4.470000	0.60175	2.679000	0.91253	0.650000	0.86243	CAG		0.408	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2			42	132	1	0	9.22156e-22	0.00361	1.26271e-21	42	132				
PGM2	55276	broad.mit.edu	37	4	37841740	37841740	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:37841740C>T	ENST00000381967.4	+	6	678	c.578C>T	c.(577-579)tCt>tTt	p.S193F	PGM2_ENST00000537241.1_Missense_Mutation_p.S33F|PGM2_ENST00000544359.1_Missense_Mutation_p.S54F	NM_018290.3	NP_060760.2	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	193					carbohydrate metabolic process (GO:0005975)|deoxyribose phosphate catabolic process (GO:0046386)|galactose catabolic process (GO:0019388)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)|phosphopentomutase activity (GO:0008973)	p.S193F(1)		breast(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	19						AAAGGGATTTCTCAAGCTATT	0.418																																							uc011byb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(577-579)TCT>TTT		phosphoglucomutase 2							112.0	121.0	118.0					4																	37841740		2203	4300	6503	SO:0001583	missense	55276				glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity|phosphopentomutase activity	g.chr4:37841740C>T	BC010087	CCDS3443.1	4p14	2012-10-02			ENSG00000169299	ENSG00000169299	5.4.2.2		8906	protein-coding gene	gene with protein product	"""phosphopentomutase"""	172000				9549096	Standard	NM_018290		Approved	FLJ10983	uc011byb.1	Q96G03	OTTHUMG00000097813	ENST00000381967.4:c.578C>T	4.37:g.37841740C>T	ENSP00000371393:p.Ser193Phe		Somatic				PGM2_uc011bya.1_Missense_Mutation_p.S54F|PGM2_uc011byc.1_Missense_Mutation_p.S33F	p.S193F	NM_018290	NP_060760	WXS	Illumina HiSeq	Unspecified	Q96G03	PGM2_HUMAN			6	651	+			193					B4E0G8|Q53FP5|Q5QTR0|Q9H0P9|Q9NV22	Missense_Mutation	SNP	ENST00000381967.4	37	c.578C>T	CCDS3443.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165314	0.57476	.	.	ENSG00000169299	ENST00000381967;ENST00000544359;ENST00000537241	T;T;T	0.63744	-0.06;-0.06;-0.06	5.95	5.95	0.96441	Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (1);Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.195026	0.56097	D	0.000029	T	0.68357	0.2992	L	0.49455	1.56	0.80722	D	1	P;P	0.37525	0.592;0.598	P;P	0.49561	0.492;0.615	T	0.58194	-0.7679	10	0.10377	T	0.69	-0.5566	20.4024	0.99000	0.0:1.0:0.0:0.0	.	193;54	Q96G03;B4E0G8	PGM2_HUMAN;.	F	193;54;33	ENSP00000371393:S193F;ENSP00000438025:S54F;ENSP00000437342:S33F	ENSP00000371393:S193F	S	+	2	0	PGM2	37518135	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.744000	0.85034	2.827000	0.97445	0.650000	0.86243	TCT		0.418	PGM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215079.2	NM_018290		7	212	0	0	0	0.00308	0	7	212				
EPHA5	2044	broad.mit.edu	37	4	66217258	66217258	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:66217258G>T	ENST00000273854.3	-	14	2957	c.2357C>A	c.(2356-2358)gCa>gAa	p.A786E	EPHA5_ENST00000511294.1_Missense_Mutation_p.A787E|EPHA5_ENST00000354839.4_Missense_Mutation_p.A764E|EPHA5_ENST00000432638.2_Missense_Mutation_p.A623E	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	786	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.A786E(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						CTTCATTCCTGCAGAGATACC	0.413										TSP Lung(17;0.13)																													uc003hcy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(2356-2358)GCA>GAA		ephrin receptor EphA5 isoform a precursor							127.0	111.0	116.0					4																	66217258		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66217258G>T	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2357C>A	4.37:g.66217258G>T	ENSP00000273854:p.Ala786Glu	TSP Lung(17;0.13)	Somatic				EPHA5_uc003hcx.2_Missense_Mutation_p.A718E|EPHA5_uc003hcz.2_Missense_Mutation_p.A764E|EPHA5_uc011cah.1_Missense_Mutation_p.A787E|EPHA5_uc011cai.1_Missense_Mutation_p.A765E|EPHA5_uc003hda.2_Missense_Mutation_p.A787E	p.A786E	NM_004439	NP_004430	WXS	Illumina HiSeq	Unspecified	P54756	EPHA5_HUMAN			14	2550	-			786			Cytoplasmic (Potential).|Protein kinase.		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.2357C>A	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787460	0.90367	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56	5.98	5.98	0.97165	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.106857	0.41712	D	0.000831	T	0.80844	0.4701	N	0.02247	-0.625	0.58432	D	0.999993	P;P;P;P	0.51933	0.611;0.949;0.557;0.836	P;D;P;P	0.64321	0.737;0.924;0.619;0.68	D	0.86677	0.1914	10	0.87932	D	0	.	20.4366	0.99092	0.0:0.0:1.0:0.0	.	765;787;764;786	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	E	786;623;764;787	ENSP00000273854:A786E;ENSP00000389208:A623E;ENSP00000346899:A764E;ENSP00000427638:A787E	ENSP00000273854:A786E	A	-	2	0	EPHA5	65899853	1.000000	0.71417	0.971000	0.41717	0.560000	0.35617	9.869000	0.99810	2.843000	0.97960	0.585000	0.79938	GCA		0.413	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		79	77	1	0	1.0627e-70	0.00361	1.85567e-70	79	77				
UGT2B28	54490	broad.mit.edu	37	4	70152489	70152489	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:70152489A>T	ENST00000335568.5	+	3	892	c.890A>T	c.(889-891)cAg>cTg	p.Q297L	UGT2B28_ENST00000511240.1_Missense_Mutation_p.Q297L	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	297					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.Q297L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						GAATTTGTACAGAGCTCTGGT	0.403																																							uc003hej.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(889-891)CAG>CTG		UDP glucuronosyltransferase 2 family,	Flunitrazepam(DB01544)						131.0	149.0	143.0					4																	70152489		2074	4256	6330	SO:0001583	missense	54490				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70152489A>T	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.890A>T	4.37:g.70152489A>T	ENSP00000334276:p.Gln297Leu		Somatic				UGT2B28_uc010ihr.2_Missense_Mutation_p.Q297L	p.Q297L	NM_053039	NP_444267	WXS	Illumina HiSeq	Unspecified	Q9BY64	UDB28_HUMAN			3	892	+			297					B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	37	c.890A>T	CCDS3528.1	.	.	.	.	.	.	.	.	.	.	-	11.28	1.593532	0.28357	.	.	ENSG00000135226	ENST00000335568;ENST00000511240	T;T	0.62364	0.03;0.03	1.85	1.85	0.25348	.	0.086077	0.48767	U	0.000179	T	0.81054	0.4743	M	0.94142	3.5	0.28368	N	0.920122	D;P	0.89917	1.0;0.934	D;P	0.91635	0.999;0.561	T	0.72653	-0.4228	10	0.87932	D	0	.	7.3524	0.26700	1.0:0.0:0.0:0.0	.	297;297	Q9BY64-2;Q9BY64	.;UDB28_HUMAN	L	297	ENSP00000334276:Q297L;ENSP00000427399:Q297L	ENSP00000334276:Q297L	Q	+	2	0	UGT2B28	70187078	1.000000	0.71417	0.926000	0.36857	0.012000	0.07955	8.022000	0.88759	0.846000	0.35142	0.155000	0.16302	CAG		0.403	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039		77	224	0	0	0	0.00361	0	77	224				
UTP3	57050	broad.mit.edu	37	4	71555768	71555768	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:71555768G>A	ENST00000254803.2	+	1	1573	c.1374G>A	c.(1372-1374)gaG>gaA	p.E458E		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	458					brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.E458E(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			GTAAAGAAGAGCAACGTTATA	0.388																																							uc003hfo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1372-1374)GAG>GAA		UTP3, small subunit processome component							144.0	150.0	148.0					4																	71555768		2203	4300	6503	SO:0001819	synonymous_variant	57050				brain development|chromatin modification|gene silencing	nucleolus		g.chr4:71555768G>A	AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.1374G>A	4.37:g.71555768G>A			Somatic					p.E458E	NM_020368	NP_065101	WXS	Illumina HiSeq	Unspecified	Q9NQZ2	SAS10_HUMAN	Lung(101;0.235)		1	1573	+			458					Q6FI82	Silent	SNP	ENST00000254803.2	37	c.1374G>A	CCDS3546.1																																																																																				0.388	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252163.2	NM_020368		71	127	0	0	0	0.00361	0	71	127				
AFP	174	broad.mit.edu	37	4	74313324	74313324	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:74313324T>A	ENST00000395792.2	+	8	1089	c.989T>A	c.(988-990)cTa>cAa	p.L330Q	AFP_ENST00000226359.2_Missense_Mutation_p.L330Q	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	330	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)	p.L330Q(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCTCCAAATCTAAACAGGTTT	0.358									Alpha-Fetoprotein, Hereditary Persistence of																														uc003hgz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(988-990)CTA>CAA		alpha-fetoprotein precursor							38.0	40.0	39.0					4																	74313324		2199	4300	6499	SO:0001583	missense	174	Alpha-Fetoprotein_Hereditary_Persistence_of	Familial Cancer Database	HPAFP	transport		metal ion binding	g.chr4:74313324T>A	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.989T>A	4.37:g.74313324T>A	ENSP00000379138:p.Leu330Gln		Somatic				AFP_uc003hha.1_Missense_Mutation_p.L330Q|AFP_uc011cbg.1_Missense_Mutation_p.L104Q	p.L330Q	NM_001134	NP_001125	WXS	Illumina HiSeq	Unspecified	P02771	FETA_HUMAN	Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		8	1036	+	Breast(15;0.00102)		330			Albumin 2.		B2RBU3	Missense_Mutation	SNP	ENST00000395792.2	37	c.989T>A	CCDS3556.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.886851	0.51908	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.74421	-0.84;-0.84	5.55	4.38	0.52667	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.547984	0.16984	N	0.191583	T	0.81683	0.4874	M	0.65498	2.005	0.09310	N	1	D;D	0.69078	0.994;0.997	D;D	0.67231	0.95;0.947	T	0.71052	-0.4704	10	0.56958	D	0.05	.	7.4275	0.27107	0.0:0.0969:0.0:0.9031	.	172;330	B4DMX4;P02771	.;FETA_HUMAN	Q	330	ENSP00000379138:L330Q;ENSP00000226359:L330Q	ENSP00000226359:L330Q	L	+	2	0	AFP	74532188	0.015000	0.18098	0.003000	0.11579	0.977000	0.68977	1.947000	0.40293	1.131000	0.42111	0.533000	0.62120	CTA		0.358	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3			32	18	0	0	0	0.002836	0	32	18				
PRKG2	5593	broad.mit.edu	37	4	82126159	82126159	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:82126159C>A	ENST00000395578.1	-	2	159	c.43G>T	c.(43-45)Gat>Tat	p.D15Y	PRKG2_ENST00000264399.1_Missense_Mutation_p.D15Y|PRKG2_ENST00000418486.2_Missense_Mutation_p.D15Y			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	15					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)	p.D15Y(2)		NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						GAGTGTCCATCTGGGTGCTTA	0.502																																							uc003hmh.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						c.(43-45)GAT>TAT		protein kinase, cGMP-dependent, type II							72.0	65.0	68.0					4																	82126159		2203	4300	6503	SO:0001583	missense	5593				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity	g.chr4:82126159C>A	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.43G>T	4.37:g.82126159C>A	ENSP00000378945:p.Asp15Tyr		Somatic				PRKG2_uc011cch.1_Missense_Mutation_p.D15Y	p.D15Y	NM_006259	NP_006250	WXS	Illumina HiSeq	Unspecified	Q13237	KGP2_HUMAN			1	57	-			15					B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	c.43G>T	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742378	0.30865	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	T;T;T	0.72282	-0.47;-0.47;-0.64	5.1	4.25	0.50352	.	0.213888	0.47852	D	0.000210	T	0.60196	0.2250	N	0.24115	0.695	0.80722	D	1	P;P	0.51791	0.948;0.948	B;B	0.44315	0.446;0.446	T	0.65853	-0.6067	10	0.66056	D	0.02	-20.5745	13.2488	0.60039	0.0:0.923:0.0:0.077	.	15;15	E7EPE6;Q13237	.;KGP2_HUMAN	Y	15	ENSP00000378945:D15Y;ENSP00000264399:D15Y;ENSP00000389038:D15Y	ENSP00000264399:D15Y	D	-	1	0	PRKG2	82345183	1.000000	0.71417	1.000000	0.80357	0.166000	0.22503	1.551000	0.36233	1.385000	0.46445	0.585000	0.79938	GAT		0.502	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259		3	38	1	0	0.00909568	0.009096	0.00927435	3	38				
SLC10A6	345274	broad.mit.edu	37	4	87770264	87770264	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:87770264C>T	ENST00000273905.6	-	1	152	c.5G>A	c.(4-6)aGa>aAa	p.R2K	SLC10A6_ENST00000505535.1_5'UTR	NM_197965.2	NP_932069.1	Q3KNW5	SOAT_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 6	2					sodium-dependent organic anion transport (GO:0043251)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)|sodium-dependent organic anion transmembrane transporter activity (GO:0043250)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	9		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		ACAATTGGCTCTCATCTCCTC	0.512																																							uc003hqd.2		NA																	0					0						c.(4-6)AGA>AAA		sodium-dependent organic anion transporter							89.0	85.0	87.0					4																	87770264		2203	4300	6503	SO:0001583	missense	345274					integral to membrane|plasma membrane	bile acid:sodium symporter activity	g.chr4:87770264C>T	AJ583502	CCDS3614.1	4q22.1	2013-07-18	2013-07-18		ENSG00000145283	ENSG00000145283		"""Solute carriers"""	30603	protein-coding gene	gene with protein product		613366				15020217, 17491011	Standard	NM_197965		Approved	SOAT	uc003hqd.2	Q3KNW5	OTTHUMG00000130596	ENST00000273905.6:c.5G>A	4.37:g.87770264C>T	ENSP00000273905:p.Arg2Lys		Somatic					p.R2K	NM_197965	NP_932069	WXS	Illumina HiSeq	Unspecified	Q3KNW5	SOAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00099)	1	153	-		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)	2			Extracellular (Potential).		Q70EX7	Missense_Mutation	SNP	ENST00000273905.6	37	c.5G>A	CCDS3614.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.708201	0.48412	.	.	ENSG00000145283	ENST00000273905	T	0.06449	3.3	5.38	0.986	0.19784	.	0.929689	0.09126	N	0.845096	T	0.02929	0.0087	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47018	-0.9149	10	0.25106	T	0.35	-39.0297	3.0019	0.06016	0.1678:0.3342:0.3945:0.1034	.	2	Q3KNW5	SOAT_HUMAN	K	2	ENSP00000273905:R2K	ENSP00000273905:R2K	R	-	2	0	SLC10A6	87989288	0.030000	0.19436	0.705000	0.30386	0.820000	0.46376	-0.134000	0.10436	0.582000	0.29556	0.655000	0.94253	AGA		0.512	SLC10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253043.2	NM_197965		6	125	0	0	0	0.001984	0	6	125				
SPARCL1	8404	broad.mit.edu	37	4	88416205	88416205	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:88416205G>T	ENST00000282470.6	-	3	599	c.129C>A	c.(127-129)ccC>ccA	p.P43P	SPARCL1_ENST00000418378.1_Silent_p.P43P|SPARCL1_ENST00000503414.1_5'UTR	NM_004684.4	NP_004675.3	Q14515	SPRL1_HUMAN	SPARC-like 1 (hevin)	43					signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.P43P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(2)	21				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		CCCTTAAACTGGGGATTGCAG	0.358																																							uc010ikm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(127-129)CCC>CCA		SPARC-like 1 precursor							166.0	175.0	172.0					4																	88416205		2203	4300	6503	SO:0001819	synonymous_variant	8404				signal transduction	extracellular space|proteinaceous extracellular matrix	calcium ion binding	g.chr4:88416205G>T	X86693	CCDS3622.1	4q22-q25	2013-01-10	2008-08-29		ENSG00000152583	ENSG00000152583		"""EF-hand domain containing"""	11220	protein-coding gene	gene with protein product		606041	"""SPARC-like 1 (mast9, hevin)"""			8488563, 7600298, 16844696	Standard	NM_001128310		Approved	MAST9	uc003hqs.4	Q14515	OTTHUMG00000130605	ENST00000282470.6:c.129C>A	4.37:g.88416205G>T			Somatic				SPARCL1_uc011cdc.1_Intron|SPARCL1_uc003hqs.3_Silent_p.P43P|SPARCL1_uc011cdd.1_5'UTR|SPARCL1_uc003hqt.2_Silent_p.P43P	p.P43P	NM_001128310	NP_001121782	WXS	Illumina HiSeq	Unspecified	Q14515	SPRL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00118)	4	701	-			43			O-glycosylated at two sites.		B4E2Z0|E7ESU2|Q14800	Silent	SNP	ENST00000282470.6	37	c.129C>A	CCDS3622.1																																																																																				0.358	SPARCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253059.2			57	108	1	0	6.83469e-46	0.00361	1.10243e-45	57	108				
BANK1	55024	broad.mit.edu	37	4	102751288	102751288	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:102751288C>T	ENST00000322953.4	+	2	668	c.394C>T	c.(394-396)Caa>Taa	p.Q132*	BANK1_ENST00000428908.1_Intron|BANK1_ENST00000444316.2_Nonsense_Mutation_p.Q102*|BANK1_ENST00000508653.1_Intron|BANK1_ENST00000504592.1_Nonsense_Mutation_p.Q117*	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	132	Interaction with ITPR2.				B cell activation (GO:0042113)			p.Q132*(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		AAATATCTCTCAAAGCAGATG	0.373																																							uc003hvy.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(1)	3						c.(394-396)CAA>TAA		B-cell scaffold protein with ankyrin repeats 1							59.0	65.0	63.0					4																	102751288		2201	4300	6501	SO:0001587	stop_gained	55024				B cell activation			g.chr4:102751288C>T	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.394C>T	4.37:g.102751288C>T	ENSP00000320509:p.Gln132*		Somatic				BANK1_uc003hvx.3_Nonsense_Mutation_p.Q117*|BANK1_uc010ill.2_Intron|BANK1_uc003hvz.3_Nonsense_Mutation_p.Q102*	p.Q132*	NM_017935	NP_060405	WXS	Illumina HiSeq	Unspecified	Q8NDB2	BANK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)	2	668	+		Hepatocellular(203;0.217)	132			Interaction with ITPR2.		A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Nonsense_Mutation	SNP	ENST00000322953.4	37	c.394C>T	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	C	38	6.942289	0.97952	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000444316	.	.	.	5.12	-5.21	0.02815	.	1.555950	0.04070	N	0.307913	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	8.5855	0.33655	0.3013:0.4361:0.2625:0.0	.	.	.	.	X	117;132;102	.	ENSP00000320509:Q132X	Q	+	1	0	BANK1	102970311	0.000000	0.05858	0.000000	0.03702	0.939000	0.58152	-1.048000	0.03517	-1.035000	0.03291	-0.171000	0.13296	CAA		0.373	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935		44	85	0	0	0	0.00361	0	44	85				
SEC24B	10427	broad.mit.edu	37	4	110448546	110448546	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:110448546G>T	ENST00000265175.5	+	18	3089	c.3034G>T	c.(3034-3036)Gga>Tga	p.G1012*	SEC24B_ENST00000399100.2_Nonsense_Mutation_p.G977*|SEC24B_ENST00000504968.2_Nonsense_Mutation_p.G1042*	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	1012					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.G977*(1)|p.G1012*(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TGTATATGCGGGAGTGGATGT	0.368																																							uc003hzk.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|large_intestine(1)	3						c.(3034-3036)GGA>TGA		SEC24 (S. cerevisiae) homolog B isoform a							137.0	128.0	131.0					4																	110448546		1889	4122	6011	SO:0001587	stop_gained	10427				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding	g.chr4:110448546G>T	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.3034G>T	4.37:g.110448546G>T	ENSP00000265175:p.Gly1012*		Somatic				SEC24B_uc003hzl.2_Nonsense_Mutation_p.G977*|SEC24B_uc011cfp.1_Nonsense_Mutation_p.G1042*|SEC24B_uc011cfq.1_Nonsense_Mutation_p.G1011*|SEC24B_uc011cfr.1_Nonsense_Mutation_p.G976*	p.G1012*	NM_006323	NP_006314	WXS	Illumina HiSeq	Unspecified	O95487	SC24B_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)	18	3089	+		Hepatocellular(203;0.217)	1012					B7ZKM8|B7ZKN4|Q0VG08	Nonsense_Mutation	SNP	ENST00000265175.5	37	c.3034G>T	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	G	42	9.189828	0.99094	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.1192	20.0897	0.97814	0.0:0.0:1.0:0.0	.	.	.	.	X	1042;977;1012	.	ENSP00000265175:G1012X	G	+	1	0	SEC24B	110667995	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	9.869000	0.99810	2.832000	0.97577	0.655000	0.94253	GGA		0.368	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2			55	58	1	0	1.38705e-31	0.00361	2.03601e-31	55	58				
ANK2	287	broad.mit.edu	37	4	114158753	114158754	+	Splice_Site	DNP	AG	AG	TA			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:114158753_114158754AG>TA	ENST00000357077.4	+	7	722		c.e7-1		ANK2_ENST00000394537.3_Splice_Site|ANK2_ENST00000506722.1_Splice_Site|ANK2_ENST00000264366.6_Splice_Site	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal						atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.?(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACACTGCTTCAGATGATGGTGA	0.361																																							uc003ibe.3		NA																	1	Unknown(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.e7-1		ankyrin 2 isoform 1																																				SO:0001630	splice_region_variant	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114158753_114158754AG>TA	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	Exception_encountered	4.37:g.114158753_114158754delinsTA			Somatic				ANK2_uc003ibd.3_Splice_Site_p.M203_splice|ANK2_uc003ibf.3_Splice_Site_p.M224_splice|ANK2_uc003ibc.2_Splice_Site_p.M200_splice|ANK2_uc011cgb.1_Splice_Site_p.M239_splice	p.M224_splice	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	7	770	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)						Q01485|Q08AC7|Q08AC8|Q7Z3L5	Splice_Site	DNP	ENST00000357077.4	37	c.670_splice	CCDS3702.1																																																																																				0.361	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	Intron	41	62	0	0	0	0.004672	0	41	62				
ANK2	287	broad.mit.edu	37	4	114276963	114276963	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:114276963T>C	ENST00000357077.4	+	38	7242	c.7189T>C	c.(7189-7191)Tca>Cca	p.S2397P	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.S2364P|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2397					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.S2397P(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGGAACTGAATCAAAACCTCA	0.502																																							uc003ibe.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(7189-7191)TCA>CCA		ankyrin 2 isoform 1							64.0	65.0	65.0					4																	114276963		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114276963T>C	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.7189T>C	4.37:g.114276963T>C	ENSP00000349588:p.Ser2397Pro		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Intron|ANK2_uc011cgb.1_Missense_Mutation_p.S2412P	p.S2397P	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	7289	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	2364					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.7189T>C	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	T	5.653	0.305134	0.10678	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.67698	-0.27;-0.28	5.24	1.53	0.23141	.	0.816360	0.10440	N	0.674411	T	0.39835	0.1093	N	0.04043	-0.29	0.09310	N	0.999995	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21999	-1.0229	9	.	.	.	.	7.8296	0.29334	0.0:0.2369:0.0:0.7631	.	2364;2397	Q01484;Q01484-4	ANK2_HUMAN;.	P	2397;2364	ENSP00000349588:S2397P;ENSP00000264366:S2364P	.	S	+	1	0	ANK2	114496412	0.000000	0.05858	0.010000	0.14722	0.681000	0.39784	-0.459000	0.06728	0.121000	0.18284	0.533000	0.62120	TCA		0.502	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		60	76	0	0	0	0.00361	0	60	76				
MFSD8	256471	broad.mit.edu	37	4	128863280	128863281	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:128863280_128863281CC>AA	ENST00000296468.3	-	6	599_600	c.472_473GG>TT	c.(472-474)GGt>TTt	p.G158F	MFSD8_ENST00000513559.1_Missense_Mutation_p.G113F|MFSD8_ENST00000541133.1_Missense_Mutation_p.G113F|MFSD8_ENST00000515130.1_5'UTR	NM_152778.2	NP_689991.1	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing 8	158					cell death (GO:0008219)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)		p.G158F(1)		cervix(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)	23						GGAAGTAGCACCAGCAGTATAT	0.356																																							uc003ifp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|liver(1)	2						c.(472-474)GGT>TTT		major facilitator superfamily domain containing																																				SO:0001583	missense	256471				cell death|transmembrane transport	integral to membrane|lysosomal membrane		g.chr4:128863280_128863281CC>AA	AK074564	CCDS3736.1	4q28.2	2014-09-17			ENSG00000164073	ENSG00000164073			28486	protein-coding gene	gene with protein product		611124	"""ceroid-lipofuscinosis, neuronal 7, late infantile, variant"""	CLN7		17564970	Standard	NM_152778		Approved	MGC33302	uc003ifp.3	Q8NHS3	OTTHUMG00000133303	ENST00000296468.3:c.472_473delinsAA	4.37:g.128863280_128863281delinsAA	ENSP00000296468:p.Gly158Phe		Somatic				MFSD8_uc011cgu.1_Missense_Mutation_p.G113F|MFSD8_uc011cgv.1_Intron|MFSD8_uc011cgw.1_Intron|MFSD8_uc011cgx.1_Missense_Mutation_p.G113F	p.G158F	NM_152778	NP_689991	WXS	Illumina HiSeq	Unspecified	Q8NHS3	MFSD8_HUMAN			6	635_636	-			158			Cytoplasmic (Potential).		B2RDM1|B7Z205|Q8N2P3	Missense_Mutation	DNP	ENST00000296468.3	37	c.472_473GG>TT	CCDS3736.1																																																																																				0.356	MFSD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257097.1	NM_152778		54	96	0	0	0	0.004672	0	54	96				
INPP4B	8821	broad.mit.edu	37	4	143129683	143129683	+	Splice_Site	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:143129683C>A	ENST00000513000.1	-	15	1401		c.e15-1		INPP4B_ENST00000508116.1_Splice_Site|INPP4B_ENST00000262992.4_Splice_Site|INPP4B_ENST00000509777.1_Splice_Site|INPP4B_ENST00000308502.4_Splice_Site	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa						cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.?(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					AAAGAGGACCCTGATGGAAAC	0.303																																							uc003iix.3		NA																	1	Unknown(1)		lung(1)	ovary(1)|lung(1)	2						c.e15-1		inositol polyphosphate-4-phosphatase, type II,							82.0	82.0	82.0					4																	143129683		2203	4300	6503	SO:0001630	splice_region_variant	8821				signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity	g.chr4:143129683C>A	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.968-1G>T	4.37:g.143129683C>A			Somatic				INPP4B_uc003iiw.3_Splice_Site_p.G323_splice|INPP4B_uc011chm.1_Splice_Site|INPP4B_uc011chn.1_Splice_Site_p.G138_splice|INPP4B_uc011cho.1_Splice_Site|INPP4B_uc011chp.1_Splice_Site_p.G194_splice	p.G323_splice	NM_003866	NP_003857	WXS	Illumina HiSeq	Unspecified	O15327	INP4B_HUMAN			15	1563	-	all_hematologic(180;0.158)							Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Splice_Site	SNP	ENST00000513000.1	37	c.968_splice	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852401	0.71719	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4174	0.90575	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	INPP4B	143349133	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	5.115000	0.64655	2.648000	0.89879	0.484000	0.47621	.		0.303	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	Intron	11	26	1	0	0.00136819	0.001368	0.00142043	11	26				
ARHGAP10	79658	broad.mit.edu	37	4	148876486	148876486	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:148876486A>G	ENST00000336498.3	+	16	1650	c.1411A>G	c.(1411-1413)Atg>Gtg	p.M471V	ARHGAP10_ENST00000414545.2_Missense_Mutation_p.M120V	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	1234					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.M471V(1)		autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		AGAGCCTCTCATGACCTATGA	0.348																																							uc003ilf.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|pancreas(1)|lung(1)	4						c.(1411-1413)ATG>GTG		Rho GTPase activating protein 10							164.0	180.0	174.0					4																	148876486		2203	4299	6502	SO:0001583	missense	79658				apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding	g.chr4:148876486A>G	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.1411A>G	4.37:g.148876486A>G	ENSP00000336923:p.Met471Val		Somatic				ARHGAP10_uc003ilg.2_Missense_Mutation_p.M120V|ARHGAP10_uc003ilh.2_Missense_Mutation_p.M52V	p.M471V	NM_024605	NP_078881	WXS	Illumina HiSeq	Unspecified	A1A4S6	RHG10_HUMAN		GBM - Glioblastoma multiforme(119;0.0423)	16	1411	+	all_hematologic(180;0.151)	Renal(17;0.0166)	471			Rho-GAP.		Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	37	c.1411A>G	CCDS34075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.02|18.02	3.528949|3.528949	0.64860|0.64860	.|.	.|.	ENSG00000071205|ENSG00000071205	ENST00000507661|ENST00000336498;ENST00000414545	.|T;T	.|0.16324	.|2.35;2.35	5.12|5.12	5.12|5.12	0.69794|0.69794	.|Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.35856|0.35856	0.0946|0.0946	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|D;D;P	.|0.89917	.|1.0;0.965;0.69	.|D;D;P	.|0.87578	.|0.998;0.952;0.748	T|T	0.09378|0.09378	-1.0677|-1.0677	5|10	.|0.87932	.|D	.|0	.|.	15.2189|15.2189	0.73296|0.73296	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|52;120;471	.|Q86T21;E7EUW5;A1A4S6	.|.;.;RHG10_HUMAN	R|V	148|471;120	.|ENSP00000336923:M471V;ENSP00000406624:M120V	.|ENSP00000336923:M471V	H|M	+|+	2|1	0|0	ARHGAP10|ARHGAP10	149095936|149095936	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	7.757000|7.757000	0.85209|0.85209	2.057000|2.057000	0.61298|0.61298	0.459000|0.459000	0.35465|0.35465	CAT|ATG		0.348	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	NM_024605		71	256	0	0	0	0.00361	0	71	256				
LRBA	987	broad.mit.edu	37	4	151223840	151223840	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:151223840C>A	ENST00000357115.3	-	54	8230	c.7987G>T	c.(7987-7989)Gat>Tat	p.D2663Y	LRBA_ENST00000535741.1_Missense_Mutation_p.D2652Y|LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000510413.1_Missense_Mutation_p.D2652Y	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2663						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.D2663Y(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGAGTTGCATCACGTGACCCT	0.423																																							uc010ipj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(3)|skin(1)	7						c.(7987-7989)GAT>TAT		LPS-responsive vesicle trafficking, beach and							157.0	139.0	145.0					4																	151223840		2203	4300	6503	SO:0001583	missense	987					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding	g.chr4:151223840C>A	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.7987G>T	4.37:g.151223840C>A	ENSP00000349629:p.Asp2663Tyr		Somatic				LRBA_uc010ipi.2_Missense_Mutation_p.D185Y|LRBA_uc003ils.3_Missense_Mutation_p.D558Y|LRBA_uc003ilt.3_Missense_Mutation_p.D1311Y|LRBA_uc003ilu.3_Missense_Mutation_p.D2652Y|LRBA_uc003ilr.3_Missense_Mutation_p.D83Y	p.D2663Y	NM_006726	NP_006717	WXS	Illumina HiSeq	Unspecified	P50851	LRBA_HUMAN			54	8461	-	all_hematologic(180;0.151)		2663			WD 3.		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	c.7987G>T	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656757	0.88154	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115	D;D;D	0.89415	-2.51;-2.51;-2.51	5.78	5.78	0.91487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.97155	0.9070	H	0.98314	4.2	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.997;1.0	D;D;D;D	0.97110	0.999;0.999;0.997;1.0	D	0.98208	1.0471	10	0.87932	D	0	.	20.0172	0.97481	0.0:1.0:0.0:0.0	.	2663;2652;2652;558	P50851;F5H1X8;P50851-2;Q68D03	LRBA_HUMAN;.;.;.	Y	2652;2652;2663	ENSP00000446299:D2652Y;ENSP00000421552:D2652Y;ENSP00000349629:D2663Y	ENSP00000349629:D2663Y	D	-	1	0	LRBA	151443290	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.723000	0.93209	0.585000	0.79938	GAT		0.423	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			69	124	1	0	3.58576e-35	0.00361	5.5487e-35	69	124				
DCHS2	54798	broad.mit.edu	37	4	155156960	155156960	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:155156960G>A	ENST00000357232.4	-	25	7478	c.7479C>T	c.(7477-7479)ctC>ctT	p.L2493L		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2493	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L2493L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTTCTTTGTTGAGTTGACTTT	0.353																																							uc003inw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(7477-7479)CTC>CTT		dachsous 2 isoform 1							92.0	98.0	96.0					4																	155156960		2203	4300	6503	SO:0001819	synonymous_variant	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155156960G>A	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.7479C>T	4.37:g.155156960G>A			Somatic					p.L2493L	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	25	7479	-	all_hematologic(180;0.208)	Renal(120;0.0854)	2493			Cadherin 22.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	c.7479C>T	CCDS3785.1																																																																																				0.353	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		4	90	0	0	0	0.009096	0	4	90				
NPY2R	4887	broad.mit.edu	37	4	156135190	156135191	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:156135190_156135191CC>AA	ENST00000329476.3	+	2	588_589	c.99_100CC>AA	c.(97-102)gtCCct>gtAAct	p.P34T	NPY2R_ENST00000506608.1_Missense_Mutation_p.P34T	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	34					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)	p.P34T(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	GTGAACTGGTCCCTGACCCTGA	0.475																																							uc003ioq.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(1)	3						c.(97-102)GTCCCT>GTAACT		neuropeptide Y receptor Y2																																				SO:0001583	missense	4887				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity	g.chr4:156135190_156135191CC>AA	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		Exception_encountered	4.37:g.156135190_156135191delinsAA	ENSP00000332591:p.Pro34Thr		Somatic				NPY2R_uc003ior.2_Missense_Mutation_p.P34T	p.P34T	NM_000910	NP_000901	WXS	Illumina HiSeq	Unspecified	P49146	NPY2R_HUMAN			2	594_595	+	all_hematologic(180;0.24)	Renal(120;0.0854)	34			Extracellular (Potential).		Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	DNP	ENST00000329476.3	37	c.99_100CC>AA	CCDS3791.1																																																																																				0.475	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910		32	71	0	0	0	0.004672	0	32	71				
GUCY1A3	2982	broad.mit.edu	37	4	156631723	156631723	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:156631723C>G	ENST00000296518.7	+	6	615	c.406C>G	c.(406-408)Ctt>Gtt	p.L136V	GUCY1A3_ENST00000511507.1_Missense_Mutation_p.L136V|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.L136V|GUCY1A3_ENST00000515602.1_3'UTR|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.L136V|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.L136V|GUCY1A3_ENST00000393832.3_5'UTR|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.L136V			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	136					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.L136V(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		CAAAGAATCTCTTGGTGAAGA	0.388																																							uc003iov.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(406-408)CTT>GTT		guanylate cyclase 1, soluble, alpha 3 isoform A							71.0	77.0	75.0					4																	156631723		2203	4300	6503	SO:0001583	missense	2982				blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity	g.chr4:156631723C>G		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.406C>G	4.37:g.156631723C>G	ENSP00000296518:p.Leu136Val		Somatic				GUCY1A3_uc003iou.2_Missense_Mutation_p.L136V|GUCY1A3_uc010iqc.2_Missense_Mutation_p.L136V|GUCY1A3_uc003iow.2_Missense_Mutation_p.L136V|GUCY1A3_uc010iqd.2_Missense_Mutation_p.L135V|GUCY1A3_uc003iox.2_Missense_Mutation_p.L136V|GUCY1A3_uc003ioz.2_5'UTR|GUCY1A3_uc003ioy.2_Missense_Mutation_p.L136V|GUCY1A3_uc010iqe.2_Intron|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Missense_Mutation_p.L136V	p.L136V	NM_000856	NP_000847	WXS	Illumina HiSeq	Unspecified	Q02108	GCYA3_HUMAN		COAD - Colon adenocarcinoma(41;0.17)	7	942	+	all_hematologic(180;0.24)	Renal(120;0.0854)	136	VIKESLGEEVFKICYEEDENILGVVGGTLKDFLNSFSTLLK QSSHCQEAGKRGR -> LSKNLLVKRFLKYVTRKMKTSLGW LEAPLKIFKQLQYPSETEQPLPRSRKKGQ (in Ref. 1).				D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	c.406C>G	CCDS34085.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.670291	0.47677	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000296518;ENST00000513574	T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0	5.55	4.71	0.59529	Heme-NO binding (1);	0.000000	0.53938	D	0.000044	T	0.43875	0.1267	M	0.66939	2.045	0.58432	D	0.999996	B;B;B	0.13145	0.007;0.007;0.007	B;B;B	0.27887	0.053;0.053;0.084	T	0.42749	-0.9433	10	0.59425	D	0.04	.	10.8458	0.46743	0.0:0.8546:0.0:0.1454	.	136;136;136	B3KU69;Q02108;D6RDW3	.;GCYA3_HUMAN;.	V	136	ENSP00000424361:L136V;ENSP00000421493:L136V;ENSP00000426968:L136V;ENSP00000412201:L136V;ENSP00000296518:L136V;ENSP00000426040:L136V	ENSP00000296518:L136V	L	+	1	0	GUCY1A3	156851173	0.993000	0.37304	0.921000	0.36526	0.962000	0.63368	2.090000	0.41682	1.483000	0.48342	0.637000	0.83480	CTT		0.388	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2			4	83	0	0	0	0.001168	0	4	83				
SLC6A18	348932	broad.mit.edu	37	5	1240646	1240646	+	Splice_Site	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:1240646G>A	ENST00000324642.3	+	7	969	c.846G>A	c.(844-846)agG>agA	p.R282R	SLC6A18_ENST00000296821.4_Splice_Site_p.R277R	NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	282					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)	p.R282R(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TTGTGCCCAGGAATGACTGCC	0.587																																							uc003jby.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(844-846)AGG>AGA		solute carrier family 6, member 18							174.0	132.0	146.0					5																	1240646		2203	4300	6503	SO:0001630	splice_region_variant	348932				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chr5:1240646G>A	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.846-1G>A	5.37:g.1240646G>A			Somatic					p.R282R	NM_182632	NP_872438	WXS	Illumina HiSeq	Unspecified	Q96N87	S6A18_HUMAN	Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		7	969	+	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		282			Cytoplasmic (Potential).			Silent	SNP	ENST00000324642.3	37	c.846G>A	CCDS3860.1																																																																																				0.587	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206728.3	NM_182632	Silent	6	38	0	0	0	0.006214	0	6	38				
ICE1	23379	broad.mit.edu	37	5	5473809	5473809	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:5473809G>T	ENST00000296564.7	+	16	6583	c.6361G>T	c.(6361-6363)Gat>Tat	p.D2121Y		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		2121					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.D2121Y(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						ATTTGCCATTGATCTGCTCTG	0.333																																							uc003jdm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(6361-6363)GAT>TAT		hypothetical protein LOC23379							55.0	52.0	53.0					5																	5473809		1891	4118	6009	SO:0001583	missense	23379							g.chr5:5473809G>T																												ENST00000296564.7:c.6361G>T	5.37:g.5473809G>T	ENSP00000296564:p.Asp2121Tyr		Somatic					p.D2121Y	NM_015325	NP_056140	WXS	Illumina HiSeq	Unspecified	Q9Y2F5	K0947_HUMAN			16	6583	+			2121					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	c.6361G>T	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446297	0.63178	.	.	ENSG00000164151	ENST00000296564	T	0.13657	2.57	5.44	5.44	0.79542	.	.	.	.	.	T	0.31796	0.0808	M	0.61703	1.905	0.43714	D	0.996189	D	0.76494	0.999	D	0.74348	0.983	T	0.01706	-1.1291	9	0.87932	D	0	-16.453	10.2378	0.43294	0.0898:0.0:0.9102:0.0	.	2121	Q9Y2F5	K0947_HUMAN	Y	2121	ENSP00000296564:D2121Y	ENSP00000296564:D2121Y	D	+	1	0	KIAA0947	5526809	1.000000	0.71417	0.942000	0.38095	0.983000	0.72400	5.353000	0.66034	2.562000	0.86427	0.655000	0.94253	GAT		0.333	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			11	27	1	0	2.32078e-09	0.003163	2.68797e-09	11	27				
SEMA5A	9037	broad.mit.edu	37	5	9190417	9190417	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:9190417C>G	ENST00000382496.5	-	11	1900	c.1235G>C	c.(1234-1236)gGc>gCc	p.G412A		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	412	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.G412A(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CGCTTCTCTGCCCTGCACCAC	0.522																																							uc003jek.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1234-1236)GGC>GCC		semaphorin 5A precursor							86.0	73.0	78.0					5																	9190417		2203	4300	6503	SO:0001583	missense	9037				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane		g.chr5:9190417C>G	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1235G>C	5.37:g.9190417C>G	ENSP00000371936:p.Gly412Ala		Somatic					p.G412A	NM_003966	NP_003957	WXS	Illumina HiSeq	Unspecified	Q13591	SEM5A_HUMAN			11	1947	-			412			Sema.|Extracellular (Potential).		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	c.1235G>C	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808455	0.31961	.	.	ENSG00000112902	ENST00000382496	T	0.19806	2.12	5.75	2.95	0.34219	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.099482	0.64402	N	0.000001	T	0.11367	0.0277	N	0.17631	0.505	0.53688	D	0.99997	B	0.13145	0.007	B	0.23275	0.045	T	0.13495	-1.0507	10	0.07325	T	0.83	.	9.4245	0.38572	0.0:0.6531:0.2718:0.0751	.	412	Q13591	SEM5A_HUMAN	A	412	ENSP00000371936:G412A	ENSP00000371936:G412A	G	-	2	0	SEMA5A	9243417	1.000000	0.71417	0.895000	0.35142	0.943000	0.58893	3.938000	0.56583	0.329000	0.23460	0.655000	0.94253	GGC		0.522	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			11	47	0	0	0	0.003163	0	11	47				
CTNND2	1501	broad.mit.edu	37	5	11098777	11098777	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:11098777G>T	ENST00000304623.8	-	15	2736	c.2547C>A	c.(2545-2547)ccC>ccA	p.P849P	CTNND2_ENST00000458100.2_Silent_p.P416P|CTNND2_ENST00000359640.2_Intron|CTNND2_ENST00000503622.1_Silent_p.P512P|CTNND2_ENST00000511377.1_Silent_p.P758P|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	849					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P849P(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GTGTGAGGTAGGGTTTGACTA	0.562																																							uc003jfa.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(2545-2547)CCC>CCA		catenin (cadherin-associated protein), delta 2							144.0	129.0	134.0					5																	11098777		2203	4300	6503	SO:0001819	synonymous_variant	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11098777G>T	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2547C>A	5.37:g.11098777G>T			Somatic				CTNND2_uc010itt.2_Silent_p.P758P|CTNND2_uc011cmy.1_Silent_p.P512P|CTNND2_uc011cmz.1_Silent_p.P416P|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Silent_p.P416P	p.P849P	NM_001332	NP_001323	WXS	Illumina HiSeq	Unspecified	Q9UQB3	CTND2_HUMAN			15	2692	-			849			ARM 7.		B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	c.2547C>A	CCDS3881.1																																																																																				0.562	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		43	48	1	0	7.22619e-39	0.00361	1.13982e-38	43	48				
DROSHA	29102	broad.mit.edu	37	5	31406967	31406967	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:31406967C>G	ENST00000511367.2	-	33	4184	c.3940G>C	c.(3940-3942)Gga>Cga	p.G1314R	DROSHA_ENST00000442743.1_Missense_Mutation_p.G1277R|DROSHA_ENST00000344624.3_Missense_Mutation_p.G1314R|DROSHA_ENST00000513349.1_Missense_Mutation_p.G1277R	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1314	DRBM.|Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)	p.G1314R(1)		breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TACCTTGGTCCTTTCCCACAG	0.463																																							uc003jhg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3940-3942)GGA>CGA		ribonuclease III, nuclear isoform 1							151.0	135.0	140.0					5																	31406967		1885	4105	5990	SO:0001583	missense	29102				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity	g.chr5:31406967C>G	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.3940G>C	5.37:g.31406967C>G	ENSP00000425979:p.Gly1314Arg		Somatic				RNASEN_uc003jhh.2_Missense_Mutation_p.G1277R	p.G1314R	NM_013235	NP_037367	WXS	Illumina HiSeq	Unspecified	Q9NRR4	RNC_HUMAN			33	4299	-			1314			Necessary for interaction with DGCR8 and pri-miRNA processing activity.|DRBM.		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	37	c.3940G>C	CCDS47195.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737817	0.89573	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.61	5.61	0.85477	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.110905	0.64402	D	0.000011	D	0.94670	0.8281	H	0.97077	3.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.96016	0.9005	10	0.87932	D	0	-20.0364	19.6419	0.95762	0.0:1.0:0.0:0.0	.	1277;1314	E7EMP9;Q9NRR4	.;RNC_HUMAN	R	1314;1314;1277;1277;1239	ENSP00000425979:G1314R;ENSP00000339845:G1314R;ENSP00000409335:G1277R;ENSP00000424161:G1277R	ENSP00000265075:G1239R	G	-	1	0	DROSHA	31442724	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.226000	0.78060	2.640000	0.89533	0.655000	0.94253	GGA		0.463	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235		31	82	0	0	0	0.004878	0	31	82				
ADAMTS12	81792	broad.mit.edu	37	5	33576861	33576861	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:33576861G>T	ENST00000504830.1	-	19	3605	c.3270C>A	c.(3268-3270)ccC>ccA	p.P1090P	ADAMTS12_ENST00000504582.1_5'Flank|ADAMTS12_ENST00000352040.3_Silent_p.P1005P	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1090	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P1090P(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						AAGTGAGGATGGGCTGGGAAG	0.512										HNSCC(64;0.19)																													uc003jia.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(3268-3270)CCC>CCA		ADAM metallopeptidase with thrombospondin type 1							109.0	102.0	104.0					5																	33576861		2203	4300	6503	SO:0001819	synonymous_variant	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33576861G>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3270C>A	5.37:g.33576861G>T		HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Silent_p.P1005P	p.P1090P	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			19	3433	-			1090			Spacer 2.		A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	c.3270C>A	CCDS34140.1																																																																																				0.512	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		110	198	1	0	2.31934e-59	0.00361	3.9651e-59	110	198				
IL7R	3575	broad.mit.edu	37	5	35876346	35876346	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:35876346C>A	ENST00000303115.3	+	8	1267	c.1138C>A	c.(1138-1140)Cct>Act	p.P380T	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	380					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.P380T(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			ATGTGACGCCCCTATTCTCTC	0.537			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																uc003jjs.2		NA		Dom	yes		5	5p13	146661		interleukin 7 receptor	yes		L					1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|skin(1)	5						c.(1138-1140)CCT>ACT		interleukin 7 receptor precursor							98.0	89.0	92.0					5																	35876346		2203	4300	6503	SO:0001583	missense	3575				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity	g.chr5:35876346C>A	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.1138C>A	5.37:g.35876346C>A	ENSP00000306157:p.Pro380Thr		Somatic				IL7R_uc011cop.1_RNA	p.P380T	NM_002185	NP_002176	WXS	Illumina HiSeq	Unspecified	P16871	IL7RA_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)		8	1227	+	all_lung(31;0.00015)		380			Cytoplasmic (Potential).		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	c.1138C>A	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	C	4.278	0.050723	0.08243	.	.	ENSG00000168685	ENST00000303115;ENST00000505875	T;T	0.33654	1.9;1.4	5.6	2.44	0.29823	.	.	.	.	.	T	0.30135	0.0755	L	0.56769	1.78	0.09310	N	0.999995	B	0.18863	0.031	B	0.14023	0.01	T	0.33085	-0.9882	9	0.54805	T	0.06	-16.8302	2.8424	0.05533	0.2198:0.5284:0.0:0.2518	.	380	P16871	IL7RA_HUMAN	T	380;146	ENSP00000306157:P380T;ENSP00000420923:P146T	ENSP00000306157:P380T	P	+	1	0	IL7R	35912103	0.000000	0.05858	0.013000	0.15412	0.004000	0.04260	-0.006000	0.12833	0.709000	0.31976	-0.169000	0.13324	CCT		0.537	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			31	69	1	0	3.78316e-11	0.00623	4.51921e-11	31	69				
HCN1	348980	broad.mit.edu	37	5	45262807	45262807	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:45262807C>A	ENST00000303230.4	-	8	1946	c.1889G>T	c.(1888-1890)aGg>aTg	p.R630M		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	630					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.R630M(2)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CACCATCTCCCTGTCATGTTT	0.448																																							uc003jok.2		NA																	2	Substitution - Missense(2)		prostate(1)|lung(1)	ovary(1)	1						c.(1888-1890)AGG>ATG		hyperpolarization activated cyclic							152.0	133.0	140.0					5																	45262807		2203	4300	6503	SO:0001583	missense	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45262807C>A	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1889G>T	5.37:g.45262807C>A	ENSP00000307342:p.Arg630Met		Somatic					p.R630M	NM_021072	NP_066550	WXS	Illumina HiSeq	Unspecified	O60741	HCN1_HUMAN			8	1914	-			630			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000303230.4	37	c.1889G>T	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.691532	0.68271	.	.	ENSG00000164588	ENST00000303230	T	0.72282	-0.64	6.16	5.3	0.74995	.	0.000000	0.64402	D	0.000001	D	0.83133	0.5188	M	0.72353	2.195	0.50171	D	0.999855	D	0.89917	1.0	D	0.77004	0.989	D	0.85377	0.1117	10	0.87932	D	0	.	15.6102	0.76710	0.0:0.9346:0.0:0.0654	.	630	O60741	HCN1_HUMAN	M	630	ENSP00000307342:R630M	ENSP00000307342:R630M	R	-	2	0	HCN1	45298564	0.992000	0.36948	1.000000	0.80357	0.803000	0.45373	7.818000	0.86416	1.628000	0.50416	-0.145000	0.13849	AGG		0.448	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		80	131	1	0	2.76863e-45	0.00361	4.45321e-45	80	131				
RASGRF2	5924	broad.mit.edu	37	5	80369234	80369234	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:80369234A>G	ENST00000265080.4	+	5	917	c.850A>G	c.(850-852)Atc>Gtc	p.I284V	RASGRF2_ENST00000502677.1_3'UTR	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	284	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I284V(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GAAGCCCCCCATCAGCCACGA	0.483																																							uc003kha.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12						c.(850-852)ATC>GTC		Ras protein-specific guanine							71.0	70.0	70.0					5																	80369234		2203	4300	6503	SO:0001583	missense	5924				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr5:80369234A>G	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.850A>G	5.37:g.80369234A>G	ENSP00000265080:p.Ile284Val		Somatic				RASGRF2_uc011ctn.1_RNA|RASGRF2_uc003khb.1_Missense_Mutation_p.I112V	p.I284V	NM_006909	NP_008840	WXS	Illumina HiSeq	Unspecified	O14827	RGRF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)	5	850	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	284			DH.		B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	c.850A>G	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	A	16.04	3.010050	0.54361	.	.	ENSG00000113319	ENST00000265080	T	0.65549	-0.16	5.3	5.3	0.74995	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.45034	0.1322	N	0.05467	-0.045	0.54753	D	0.999989	B;B	0.23937	0.094;0.092	B;B	0.31016	0.123;0.096	T	0.38693	-0.9649	10	0.22706	T	0.39	.	15.541	0.76048	1.0:0.0:0.0:0.0	.	284;284	D6RAS9;O14827	.;RGRF2_HUMAN	V	284	ENSP00000265080:I284V	ENSP00000265080:I284V	I	+	1	0	RASGRF2	80404990	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.287000	0.95975	2.123000	0.65237	0.391000	0.25812	ATC		0.483	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		4	29	0	0	0	0.000978	0	4	29				
EDIL3	10085	broad.mit.edu	37	5	83402547	83402547	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:83402547G>T	ENST00000296591.5	-	6	989	c.571C>A	c.(571-573)Ccc>Acc	p.P191T	EDIL3_ENST00000380138.3_Missense_Mutation_p.P181T	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	191	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		GCATAGTAGGGATACCATTTT	0.458																																							uc003kio.1		NA																	0				skin(2)	2						c.(571-573)CCC>ACC		EGF-like repeats and discoidin I-like							193.0	195.0	194.0					5																	83402547		2203	4300	6503	SO:0001583	missense	10085				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding	g.chr5:83402547G>T	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.571C>A	5.37:g.83402547G>T	ENSP00000296591:p.Pro191Thr		Somatic				EDIL3_uc003kip.1_Missense_Mutation_p.P181T	p.P191T	NM_005711	NP_005702	WXS	Illumina HiSeq	Unspecified	O43854	EDIL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)	6	990	-		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)	191			F5/8 type C 1.		B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	37	c.571C>A	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000944	0.93227	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.99436	-5.9;-5.9	5.55	5.55	0.83447	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.103288	0.64402	D	0.000002	D	0.99648	0.9870	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.97978	1.0347	10	0.87932	D	0	-16.0423	19.5157	0.95162	0.0:0.0:1.0:0.0	.	181;191	O43854-2;O43854	.;EDIL3_HUMAN	T	191;181	ENSP00000296591:P191T;ENSP00000369483:P181T	ENSP00000296591:P191T	P	-	1	0	EDIL3	83438303	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.209000	0.95087	2.630000	0.89119	0.650000	0.86243	CCC		0.458	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711		48	139	1	0	1.00776e-21	0.00361	1.37334e-21	48	139				
PAM	5066	broad.mit.edu	37	5	102343170	102343170	+	Missense_Mutation	SNP	G	G	T	rs148652099		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:102343170G>T	ENST00000438793.3	+	19	2494	c.2024G>T	c.(2023-2025)gGg>gTg	p.G675V	PAM_ENST00000346918.2_Missense_Mutation_p.G675V|PAM_ENST00000274392.9_Missense_Mutation_p.G578V|PAM_ENST00000379787.4_Missense_Mutation_p.G55V|PAM_ENST00000304400.7_Missense_Mutation_p.G675V|PAM_ENST00000348126.2_Missense_Mutation_p.G568V|PAM_ENST00000455264.2_Missense_Mutation_p.G675V	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	675	Peptidyl-alpha-hydroxyglycine alpha- amidating lyase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)	p.G675V(2)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	GAGTCTTCAGGGAGCAGTCCT	0.438																																							uc003knw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2023-2025)GGG>GTG		peptidylglycine alpha-amidating monooxygenase	Vitamin C(DB00126)						125.0	133.0	130.0					5																	102343170		2203	4300	6503	SO:0001583	missense	5066				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding	g.chr5:102343170G>T	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.2024G>T	5.37:g.102343170G>T	ENSP00000396493:p.Gly675Val		Somatic				PAM_uc003kns.2_Missense_Mutation_p.G568V|PAM_uc003knt.2_Missense_Mutation_p.G675V|PAM_uc003knu.2_Missense_Mutation_p.G675V|PAM_uc003knv.2_Missense_Mutation_p.G675V|PAM_uc011cuz.1_Missense_Mutation_p.G578V|PAM_uc003knz.2_5'UTR	p.G675V	NM_000919	NP_000910	WXS	Illumina HiSeq	Unspecified	P19021	AMD_HUMAN		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	19	2397	+		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)	675			Peptidyl-alpha-hydroxyglycine alpha- amidating lyase (By similarity).|NHL 4.|Intragranular (Potential).		A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	c.2024G>T	CCDS54885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.982|5.982	0.365117|0.365117	0.11296|0.11296	.|.	.|.	ENSG00000145730|ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000379787;ENST00000304400;ENST00000274392;ENST00000455264|ENST00000379799	T;T;T;T;T;T;T|.	0.69435|.	0.47;0.34;0.32;-0.01;0.47;-0.4;0.36|.	5.27|5.27	3.4|3.4	0.38934|0.38934	Six-bladed beta-propeller, TolB-like (1);|.	0.404644|.	0.30193|.	N|.	0.010183|.	T|T	0.27384|0.27384	0.0672|0.0672	L|L	0.39397|0.39397	1.21|1.21	0.21861|0.21861	N|N	0.999505|0.999505	B;B;B;B;B;B|.	0.21753|.	0.001;0.0;0.011;0.003;0.001;0.06|.	B;B;B;B;B;B|.	0.20384|.	0.007;0.003;0.008;0.018;0.007;0.029|.	T|T	0.24333|0.24333	-1.0163|-1.0163	10|5	0.33141|.	T|.	0.24|.	.|.	1.6337|1.6337	0.02737|0.02737	0.1635:0.2292:0.4094:0.198|0.1635:0.2292:0.4094:0.198	.|.	578;675;675;675;675;568|.	F8WE90;P19021;P19021-4;P19021-3;P19021-5;P19021-2|.	.;AMD_HUMAN;.;.;.;.|.	V|S	675;675;568;55;675;578;675|447	ENSP00000396493:G675V;ENSP00000282992:G675V;ENSP00000314638:G568V;ENSP00000369113:G55V;ENSP00000306100:G675V;ENSP00000274392:G578V;ENSP00000403461:G675V|.	ENSP00000274392:G578V|.	G|R	+|+	2|3	0|2	PAM|PAM	102371069|102371069	0.012000|0.012000	0.17670|0.17670	0.776000|0.776000	0.31678|0.31678	0.516000|0.516000	0.34256|0.34256	0.533000|0.533000	0.23082|0.23082	0.717000|0.717000	0.32145|0.32145	0.655000|0.655000	0.94253|0.94253	GGG|AGG		0.438	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919		28	66	1	0	2.05212e-20	0.005524	2.75708e-20	28	66				
FBN2	2201	broad.mit.edu	37	5	127597560	127597560	+	Nonsense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:127597560G>C	ENST00000508053.1	-	70	9206	c.8232C>G	c.(8230-8232)taC>taG	p.Y2744*	FBN2_ENST00000262464.4_Nonsense_Mutation_p.Y2744*			P35556	FBN2_HUMAN	fibrillin 2	2744					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.Y2744*(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCAGTGACAGGTACTGCCCCT	0.438																																							uc003kuu.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(8230-8232)TAC>TAG		fibrillin 2 precursor							180.0	154.0	163.0					5																	127597560		2203	4300	6503	SO:0001587	stop_gained	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127597560G>C	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.8232C>G	5.37:g.127597560G>C	ENSP00000424571:p.Tyr2744*		Somatic					p.Y2744*	NM_001999	NP_001990	WXS	Illumina HiSeq	Unspecified	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	64	8671	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	2744					B4DU01|Q59ES6	Nonsense_Mutation	SNP	ENST00000508053.1	37	c.8232C>G	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	51	17.496915	0.99887	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	.	.	.	5.37	3.46	0.39613	.	0.000000	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.1251	0.30995	0.298:0.0:0.702:0.0	.	.	.	.	X	2744	.	ENSP00000262464:Y2744X	Y	-	3	2	FBN2	127625459	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	0.501000	0.22578	1.516000	0.48900	0.650000	0.86243	TAC		0.438	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		53	81	0	0	0	0.00361	0	53	81				
PCDHA4	56144	broad.mit.edu	37	5	140188720	140188720	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:140188720C>A	ENST00000530339.1	+	1	1948	c.1948C>A	c.(1948-1950)Ctg>Atg	p.L650M	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.L650M|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.L650M	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	650	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L650M(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTACTGGTACTGGTGAAGGA	0.677																																							uc003lhi.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(1948-1950)CTG>ATG		protocadherin alpha 4 isoform 1 precursor							73.0	75.0	74.0					5																	140188720		2203	4300	6503	SO:0001583	missense	56144				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140188720C>A	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1948C>A	5.37:g.140188720C>A	ENSP00000435300:p.Leu650Met		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.L650M|PCDHA4_uc011daa.1_Missense_Mutation_p.L650M	p.L650M	NM_018907	NP_061730	WXS	Illumina HiSeq	Unspecified	Q9UN74	PCDA4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2049	+			650			Cadherin 6.|Extracellular (Potential).		O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	c.1948C>A	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	c	5.792	0.330382	0.10956	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.39592	1.07;1.07;1.07	3.93	1.93	0.25924	Cadherin (4);Cadherin-like (1);	0.266946	0.19560	U	0.111358	T	0.55097	0.1899	M	0.70787	2.145	0.20196	N	0.999924	P;P;P	0.51933	0.744;0.826;0.949	B;B;P	0.60286	0.335;0.292;0.872	T	0.42396	-0.9454	10	0.62326	D	0.03	.	8.7834	0.34804	0.0:0.5401:0.3715:0.0884	.	650;650;650	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	M	650	ENSP00000423470:L650M;ENSP00000349344:L650M;ENSP00000435300:L650M	ENSP00000349344:L650M	L	+	1	2	PCDHA4	140168904	0.000000	0.05858	1.000000	0.80357	0.173000	0.22820	-1.391000	0.02525	0.784000	0.33661	0.484000	0.47621	CTG		0.677	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		43	36	1	0	5.73332e-34	0.00361	8.63779e-34	43	36				
PCDHA10	56139	broad.mit.edu	37	5	140237084	140237084	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:140237084A>T	ENST00000307360.5	+	1	1451	c.1451A>T	c.(1450-1452)cAg>cTg	p.Q484L	PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.Q484L	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	484	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.Q484L(2)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGACGCGCAGGAGAACGCC	0.662																																							uc003lhx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)|breast(1)	5						c.(1450-1452)CAG>CTG		protocadherin alpha 10 isoform 1 precursor							82.0	82.0	82.0					5																	140237084		2196	4273	6469	SO:0001583	missense	56139				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140237084A>T	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1451A>T	5.37:g.140237084A>T	ENSP00000304234:p.Gln484Leu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.Q484L|PCDHA10_uc011dad.1_Missense_Mutation_p.Q484L	p.Q484L	NM_018901	NP_061724	WXS	Illumina HiSeq	Unspecified	Q9Y5I2	PCDAA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1451	+			484			Cadherin 5.|Extracellular (Potential).		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	c.1451A>T	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	A	10.94	1.491523	0.26774	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.61040	4.65;0.14	3.74	1.22	0.21188	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.44286	0.1286	N	0.17474	0.49	0.09310	N	1	B;B;P	0.45715	0.043;0.053;0.865	B;B;P	0.48270	0.19;0.114;0.572	T	0.27434	-1.0074	9	0.52906	T	0.07	.	5.1789	0.15150	0.3961:0.3118:0.2921:0.0	.	484;484;484	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	L	484	ENSP00000421030:Q484L;ENSP00000304234:Q484L	ENSP00000304234:Q484L	Q	+	2	0	PCDHA10	140217268	0.000000	0.05858	0.999000	0.59377	0.688000	0.40055	-0.222000	0.09190	0.140000	0.18849	0.374000	0.22700	CAG		0.662	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901		11	30	0	0	0	0.007413	0	11	30				
PCDHB4	56131	broad.mit.edu	37	5	140502607	140502607	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:140502607C>A	ENST00000194152.1	+	1	1027	c.1027C>A	c.(1027-1029)Ccc>Acc	p.P343T	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	343	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P343T(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAATGACAATCCCCCAGAACT	0.443																																							uc003lip.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1027-1029)CCC>ACC		protocadherin beta 4 precursor							151.0	162.0	158.0					5																	140502607		2203	4300	6503	SO:0001583	missense	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140502607C>A	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1027C>A	5.37:g.140502607C>A	ENSP00000194152:p.Pro343Thr		Somatic					p.P343T	NM_018938	NP_061761	WXS	Illumina HiSeq	Unspecified	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1027	+			343			Cadherin 3.|Extracellular (Potential).		Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	c.1027C>A	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	C	2.529	-0.308856	0.05458	.	.	ENSG00000081818	ENST00000194152	T	0.39787	1.06	4.41	1.42	0.22433	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.33818	0.0876	L	0.43646	1.37	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.28713	-1.0035	9	0.48119	T	0.1	.	9.6638	0.39972	0.0781:0.2771:0.6448:0.0	.	343	Q9Y5E5	PCDB4_HUMAN	T	343	ENSP00000194152:P343T	ENSP00000194152:P343T	P	+	1	0	PCDHB4	140482791	0.000000	0.05858	0.717000	0.30585	0.278000	0.26855	0.126000	0.15769	0.603000	0.29913	-0.171000	0.13296	CCC		0.443	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		71	212	1	0	6.44082e-31	0.00361	9.38191e-31	71	212				
PCDHB6	56130	broad.mit.edu	37	5	140531538	140531538	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:140531538C>A	ENST00000231136.1	+	1	1700	c.1700C>A	c.(1699-1701)tCc>tAc	p.S567Y	PCDHB6_ENST00000543635.1_Missense_Mutation_p.S431Y	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	567	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S567Y(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGAACGGCTCCGCGCCCTGC	0.721																																							uc003lir.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1699-1701)TCC>TAC		protocadherin beta 6 precursor							16.0	22.0	20.0					5																	140531538		2153	4271	6424	SO:0001583	missense	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140531538C>A	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1700C>A	5.37:g.140531538C>A	ENSP00000231136:p.Ser567Tyr		Somatic				PCDHB6_uc011dah.1_Missense_Mutation_p.S431Y	p.S567Y	NM_018939	NP_061762	WXS	Illumina HiSeq	Unspecified	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1700	+			567			Cadherin 6.|Extracellular (Potential).		B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	c.1700C>A	CCDS4248.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.03|15.03	2.710929|2.710929	0.48517|0.48517	.|.	.|.	ENSG00000113211|ENSG00000113211	ENST00000542861|ENST00000543635;ENST00000231136	.|T;T	.|0.60672	.|0.17;0.17	4.19|4.19	4.19|4.19	0.49359|0.49359	.|Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.72301|0.72301	0.3443|0.3443	M|M	0.65975|0.65975	2.015|2.015	0.09310|0.09310	N|N	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.74023	.|0.982	T|T	0.62058|0.62058	-0.6934|-0.6934	6|9	0.19147|0.87932	T|D	0.46|0	.|.	11.6113|11.6113	0.51062|0.51062	0.0:0.9093:0.0:0.0907|0.0:0.9093:0.0:0.0907	.|.	.|567	.|Q9Y5E3	.|PCDB6_HUMAN	T|Y	352|431;567	.|ENSP00000438466:S431Y;ENSP00000231136:S567Y	ENSP00000438850:P352T|ENSP00000231136:S567Y	P|S	+|+	1|2	0|0	PCDHB6|PCDHB6	140511722|140511722	0.985000|0.985000	0.35326|0.35326	0.989000|0.989000	0.46669|0.46669	0.954000|0.954000	0.61252|0.61252	5.839000|5.839000	0.69395|0.69395	2.047000|2.047000	0.60756|0.60756	0.556000|0.556000	0.70494|0.70494	CCG|TCC		0.721	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		4	6	1	0	0.000602214	0.000602	0.000629788	4	6				
PCDHB16	57717	broad.mit.edu	37	5	140563163	140563163	+	Silent	SNP	T	T	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:140563163T>C	ENST00000361016.2	+	1	2184	c.1029T>C	c.(1027-1029)aaT>aaC	p.N343N		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	343	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N343N(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAATGACAATCCCCCACAGG	0.517																																							uc003liv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1027-1029)AAT>AAC		protocadherin beta 16 precursor							92.0	98.0	96.0					5																	140563163		2203	4300	6503	SO:0001819	synonymous_variant	57717				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140563163T>C	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1029T>C	5.37:g.140563163T>C			Somatic				PCDHB16_uc010jfw.1_Silent_p.N15N	p.N343N	NM_020957	NP_066008	WXS	Illumina HiSeq	Unspecified	Q9NRJ7	PCDBG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2184	+			343			Extracellular (Potential).|Cadherin 3.		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	c.1029T>C	CCDS4251.1																																																																																				0.517	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		24	72	0	0	0	0.008361	0	24	72				
PCDHGA4	56111	broad.mit.edu	37	5	140736507	140736507	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:140736507C>T	ENST00000571252.1	+	1	1740	c.1740C>T	c.(1738-1740)cgC>cgT	p.R580R	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	580	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCACCCCGCTCCGCAGATT	0.587																																							uc003ljq.1		NA																	0					0						c.(1738-1740)CGC>CGT		protocadherin gamma subfamily A, 4 isoform 1							140.0	151.0	147.0					5																	140736507		2199	4300	6499	SO:0001819	synonymous_variant	56111				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140736507C>T	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1740C>T	5.37:g.140736507C>T			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Silent_p.R580R	p.R580R	NM_018917	NP_061740	WXS	Illumina HiSeq	Unspecified	Q9Y5G9	PCDG4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1740	+			580			Extracellular (Potential).|Cadherin 6.		Q9Y5D3	Silent	SNP	ENST00000571252.1	37	c.1740C>T	CCDS58979.1																																																																																				0.587	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917		30	103	0	0	0	0.00361	0	30	103				
PCDH1	5097	broad.mit.edu	37	5	141244523	141244523	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:141244523A>C	ENST00000394536.3	-	3	1512	c.1373T>G	c.(1372-1374)cTg>cGg	p.L458R	PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000536585.1_Missense_Mutation_p.L436R|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000456271.1_Missense_Mutation_p.L446R|PCDH1_ENST00000287008.3_Missense_Mutation_p.L458R	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	458	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L458R(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GGTAGTCTGCAGGAAATACTT	0.557																																					Ovarian(132;1609 1739 4190 14731 45037)	Ovarian(132;1609 1739 4190 14731 45037)	uc003llq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(1372-1374)CTG>CGG		protocadherin 1 isoform 1 precursor							200.0	189.0	192.0					5																	141244523		2203	4300	6503	SO:0001583	missense	5097				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding	g.chr5:141244523A>C	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1373T>G	5.37:g.141244523A>C	ENSP00000378043:p.Leu458Arg		Somatic				PCDH1_uc003llp.2_Missense_Mutation_p.L458R|PCDH1_uc011dbf.1_Missense_Mutation_p.L436R	p.L458R	NM_002587	NP_002578	WXS	Illumina HiSeq	Unspecified	Q08174	PCDH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)	3	1490	-		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	458			Extracellular (Potential).|Cadherin 4.		Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	37	c.1373T>G	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	a	17.49	3.402773	0.62288	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	5.88	5.88	0.94601	Cadherin (4);Cadherin-like (1);	0.000000	0.41396	D	0.000884	D	0.86682	0.5991	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91267	0.5041	10	0.87932	D	0	.	14.2672	0.66126	1.0:0.0:0.0:0.0	.	458;458	Q08174;Q08174-2	PCDH1_HUMAN;.	R	458;458;446;469;436	ENSP00000287008:L458R;ENSP00000378043:L458R;ENSP00000403497:L446R;ENSP00000350122:L469R;ENSP00000438825:L436R	ENSP00000287008:L458R	L	-	2	0	PCDH1	141224707	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.339000	0.96797	2.263000	0.75096	0.524000	0.50904	CTG		0.557	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420		68	293	0	0	0	0.00361	0	68	293				
SH3RF2	153769	broad.mit.edu	37	5	145393468	145393468	+	Silent	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:145393468C>A	ENST00000511217.1	+	4	955	c.903C>A	c.(901-903)atC>atA	p.I301I	SH3RF2_ENST00000359120.4_Silent_p.I301I			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	301					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGTTTTCCATCACAACAGCCT	0.577																																							uc003lnt.2		NA																	0				ovary(1)|skin(1)	2						c.(901-903)ATC>ATA		SH3 domain containing ring finger 2							114.0	106.0	109.0					5																	145393468		2203	4300	6503	SO:0001819	synonymous_variant	153769						ligase activity|protein phosphatase 1 binding|zinc ion binding	g.chr5:145393468C>A	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.903C>A	5.37:g.145393468C>A			Somatic				SH3RF2_uc011dbl.1_Silent_p.I301I	p.I301I	NM_152550	NP_689763	WXS	Illumina HiSeq	Unspecified	Q8TEC5	SH3R2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		5	1141	+			301					A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Silent	SNP	ENST00000511217.1	37	c.903C>A	CCDS4280.1																																																																																				0.577	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1	NM_152550		108	430	1	0	5.01931e-35	0.00361	7.74601e-35	108	430				
GRIA1	2890	broad.mit.edu	37	5	153030061	153030061	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:153030061C>G	ENST00000285900.5	+	4	975	c.632C>G	c.(631-633)gCt>gGt	p.A211G	GRIA1_ENST00000518862.1_3'UTR|GRIA1_ENST00000518783.1_Missense_Mutation_p.A221G|GRIA1_ENST00000521843.2_Missense_Mutation_p.A142G|GRIA1_ENST00000518142.1_Missense_Mutation_p.A131G|GRIA1_ENST00000340592.5_Missense_Mutation_p.A211G|GRIA1_ENST00000448073.4_Missense_Mutation_p.A221G	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	211					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.A211G(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CGCCTCAATGCTATCTTGGGC	0.527																																							uc003lva.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(631-633)GCT>GGT		glutamate receptor, ionotropic, AMPA 1 isoform	Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						79.0	72.0	74.0					5																	153030061		2203	4300	6503	SO:0001583	missense	2890				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding	g.chr5:153030061C>G		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.632C>G	5.37:g.153030061C>G	ENSP00000285900:p.Ala211Gly		Somatic				GRIA1_uc003luy.3_Missense_Mutation_p.A211G|GRIA1_uc003luz.3_Missense_Mutation_p.A116G|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.A131G|GRIA1_uc011dcx.1_Missense_Mutation_p.A142G|GRIA1_uc011dcy.1_Missense_Mutation_p.A221G|GRIA1_uc011dcz.1_Missense_Mutation_p.A221G|GRIA1_uc010jia.1_Missense_Mutation_p.A191G	p.A211G	NM_001114183	NP_001107655	WXS	Illumina HiSeq	Unspecified	P42261	GRIA1_HUMAN	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		4	997	+		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	211			Extracellular (Potential).		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	c.632C>G	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.672274	0.29693	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	D;D;D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7	5.6	5.6	0.85130	Extracellular ligand-binding receptor (1);	0.224693	0.43416	D	0.000564	T	0.66005	0.2746	N	0.08118	0	0.37164	D	0.902741	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.0;0.001;0.0;0.0;0.0	T	0.64529	-0.6386	10	0.19590	T	0.45	.	11.9087	0.52727	0.0:0.9121:0.0:0.0879	.	221;221;131;221;211;211	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	G	211;211;131;165;211;142;142;221;221	ENSP00000285900:A211G;ENSP00000427920:A131G;ENSP00000339343:A211G;ENSP00000427864:A142G;ENSP00000442108:A142G;ENSP00000428994:A221G;ENSP00000415569:A221G	ENSP00000285900:A211G	A	+	2	0	GRIA1	153010254	0.998000	0.40836	1.000000	0.80357	0.960000	0.62799	1.860000	0.39428	2.627000	0.88993	0.650000	0.86243	GCT		0.527	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3			48	56	0	0	0	0.00361	0	48	56				
GRIA1	2890	broad.mit.edu	37	5	153085295	153085295	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:153085295G>T	ENST00000285900.5	+	11	1834	c.1491G>T	c.(1489-1491)ttG>ttT	p.L497F	GRIA1_ENST00000518783.1_Missense_Mutation_p.L507F|GRIA1_ENST00000521843.2_Missense_Mutation_p.L428F|GRIA1_ENST00000518142.1_Missense_Mutation_p.L417F|GRIA1_ENST00000340592.5_Missense_Mutation_p.L497F|GRIA1_ENST00000448073.4_Missense_Mutation_p.L507F	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	497					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.L497F(2)|p.I495fs*19(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CTATCACTTTGGTCCGGGAAG	0.388																																							uc003lva.3		NA																	4	Substitution - Missense(2)|Deletion - Frameshift(2)		lung(2)|breast(2)	ovary(4)|skin(2)	6						c.(1489-1491)TTG>TTT		glutamate receptor, ionotropic, AMPA 1 isoform	Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						37.0	40.0	39.0					5																	153085295		2203	4300	6503	SO:0001583	missense	2890				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding	g.chr5:153085295G>T		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1491G>T	5.37:g.153085295G>T	ENSP00000285900:p.Leu497Phe		Somatic				GRIA1_uc003luy.3_Missense_Mutation_p.L497F|GRIA1_uc003luz.3_Missense_Mutation_p.L402F|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.L417F|GRIA1_uc011dcx.1_Missense_Mutation_p.L428F|GRIA1_uc011dcy.1_Missense_Mutation_p.L507F|GRIA1_uc011dcz.1_Missense_Mutation_p.L507F|GRIA1_uc010jia.1_Missense_Mutation_p.L477F	p.L497F	NM_001114183	NP_001107655	WXS	Illumina HiSeq	Unspecified	P42261	GRIA1_HUMAN	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		11	1856	+		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	497			Extracellular (Potential).		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	c.1491G>T	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.912338	0.52439	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.39406	1.61;1.61;1.08;1.61;1.61;1.61;1.08	4.78	3.9	0.45041	Ionotropic glutamate receptor (1);	0.000000	0.64402	D	0.000001	T	0.40570	0.1122	N	0.16266	0.395	0.58432	D	0.999999	D;D;B;D;D;B	0.58620	0.983;0.963;0.058;0.983;0.978;0.083	D;P;B;D;P;B	0.62955	0.909;0.715;0.036;0.909;0.852;0.022	T	0.16364	-1.0405	10	0.39692	T	0.17	.	8.4137	0.32659	0.1757:0.0:0.8243:0.0	.	507;507;417;507;497;497	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	F	497;497;417;451;497;428;428;507;507	ENSP00000285900:L497F;ENSP00000427920:L417F;ENSP00000339343:L497F;ENSP00000427864:L428F;ENSP00000442108:L428F;ENSP00000428994:L507F;ENSP00000415569:L507F	ENSP00000285900:L497F	L	+	3	2	GRIA1	153065488	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.741000	0.26202	2.347000	0.79759	0.655000	0.94253	TTG		0.388	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3			4	12	1	0	0.00024832	0.009096	0.000261606	4	12				
ITK	3702	broad.mit.edu	37	5	156638359	156638359	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:156638359G>T	ENST00000422843.3	+	3	457	c.305G>T	c.(304-306)tGg>tTg	p.W102L	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	102	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.W102L(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CGGCAGCGCTGGGTGCTGGCC	0.488			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	Esophageal Squamous(70;1378 1469 8785 19883)	uc003lwo.1		NA		Dom	yes		5	5q31-q32	3702	T	IL2-inducible T-cell kinase			L	SYK		peripheral T-cell lymphoma		1	Substitution - Missense(1)		lung(1)	lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26						c.(304-306)TGG>TTG		IL2-inducible T-cell kinase							107.0	102.0	103.0					5																	156638359		2203	4300	6503	SO:0001583	missense	3702				cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr5:156638359G>T	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.305G>T	5.37:g.156638359G>T	ENSP00000398655:p.Trp102Leu		Somatic					p.W102L	NM_005546	NP_005537	WXS	Illumina HiSeq	Unspecified	Q08881	ITK_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		3	387	+	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	102			PH.		B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	c.305G>T	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003057	0.93287	.	.	ENSG00000113263	ENST00000422843	D	0.99882	-7.48	5.8	5.8	0.92144	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.99915	0.9960	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96412	0.9305	10	0.87932	D	0	.	18.8345	0.92155	0.0:0.0:1.0:0.0	.	102	Q08881	ITK_HUMAN	L	102	ENSP00000398655:W102L	ENSP00000398655:W102L	W	+	2	0	ITK	156570937	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.633000	0.83260	2.735000	0.93741	0.655000	0.94253	TGG		0.488	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			28	95	1	0	1.22674e-20	0.00874	1.65205e-20	28	95				
ATP10B	23120	broad.mit.edu	37	5	160076224	160076224	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:160076224C>T	ENST00000327245.5	-	8	1561	c.715G>A	c.(715-717)Gtg>Atg	p.V239M		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	239					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.V239M(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCTCACACACGATGGTATTG	0.408																																							uc003lym.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(715-717)GTG>ATG		ATPase, class V, type 10B							184.0	179.0	180.0					5																	160076224		1875	4104	5979	SO:0001583	missense	23120				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr5:160076224C>T	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.715G>A	5.37:g.160076224C>T	ENSP00000313600:p.Val239Met		Somatic				ATP10B_uc003lyp.2_Missense_Mutation_p.V239M|ATP10B_uc011deg.1_Missense_Mutation_p.V283M|ATP10B_uc003lyo.2_Missense_Mutation_p.V211M	p.V239M	NM_025153	NP_079429	WXS	Illumina HiSeq	Unspecified	O94823	AT10B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		8	1562	-	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	239			Cytoplasmic (Potential).		Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	c.715G>A	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566368	0.65651	.	.	ENSG00000118322	ENST00000327245	T	0.74842	-0.88	5.63	4.77	0.60923	ATPase, P-type, ATPase-associated domain (1);	0.072732	0.53938	D	0.000042	D	0.84079	0.5393	M	0.74258	2.255	0.44085	D	0.996848	D;D;D;D	0.89917	0.997;0.987;0.996;1.0	D;P;P;D	0.70227	0.922;0.753;0.872;0.968	D	0.84527	0.0631	9	.	.	.	.	12.418	0.55504	0.0:0.9193:0.0:0.0807	.	283;239;211;239	B4DHG1;O94823-2;O94823-3;O94823	.;.;.;AT10B_HUMAN	M	239	ENSP00000313600:V239M	.	V	-	1	0	ATP10B	160008802	0.990000	0.36364	1.000000	0.80357	0.998000	0.95712	2.887000	0.48586	1.390000	0.46547	0.655000	0.94253	GTG		0.408	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		17	81	0	0	0	0.00333	0	17	81				
TENM2	57451	broad.mit.edu	37	5	167645863	167645863	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:167645863T>A	ENST00000518659.1	+	23	5006	c.4967T>A	c.(4966-4968)aTc>aAc	p.I1656N	TENM2_ENST00000519204.1_Missense_Mutation_p.I1535N|TENM2_ENST00000520394.1_Missense_Mutation_p.I1417N|TENM2_ENST00000545108.1_Missense_Mutation_p.I1655N|TENM2_ENST00000403607.2_Missense_Mutation_p.I1480N	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1656					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.I1489N(1)|p.I1535N(1)|p.I1656N(1)									GACAACCAGATCATCACCCTC	0.532																																							uc010jjd.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(6)|central_nervous_system(4)	10						c.(4939-4941)ATC>AAC		odz, odd Oz/ten-m homolog 2							157.0	161.0	160.0					5																	167645863		2099	4223	6322	SO:0001583	missense	57451							g.chr5:167645863T>A	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4967T>A	5.37:g.167645863T>A	ENSP00000429430:p.Ile1656Asn		Somatic				ODZ2_uc003lzr.3_Missense_Mutation_p.I1417N|ODZ2_uc003lzt.3_Missense_Mutation_p.I1020N|ODZ2_uc010jje.2_Missense_Mutation_p.I911N	p.I1647N	NM_001122679	NP_001116151	WXS	Illumina HiSeq	Unspecified			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	23	4940	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37	c.4940T>A		.	.	.	.	.	.	.	.	.	.	T	20.3	3.961843	0.74016	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.51817	1.39;0.69;1.39;1.39;1.39	5.85	5.85	0.93711	.	0.165679	0.56097	D	0.000035	T	0.46795	0.1411	N	0.08118	0	0.58432	D	0.999997	D;D;D	0.62365	0.991;0.966;0.986	P;P;P	0.61592	0.891;0.703;0.564	T	0.53746	-0.8395	10	0.40728	T	0.16	.	16.2303	0.82332	0.0:0.0:0.0:1.0	.	1655;1656;1417	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	N	1656;1655;1535;1417;1480	ENSP00000429430:I1656N;ENSP00000438635:I1655N;ENSP00000428964:I1535N;ENSP00000427874:I1417N;ENSP00000384905:I1480N	ENSP00000384905:I1480N	I	+	2	0	ODZ2	167578441	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.040000	0.89188	2.233000	0.73108	0.533000	0.62120	ATC		0.532	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		153	496	0	0	0	0.00361	0	153	496				
SPDL1	54908	broad.mit.edu	37	5	169023609	169023609	+	Silent	SNP	A	A	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:169023609A>G	ENST00000265295.4	+	8	1215	c.936A>G	c.(934-936)gaA>gaG	p.E312E		NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1									p.E312E(1)									CTCAAACTGAATTTGAGCAGC	0.348																																							uc003mae.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|liver(1)	2						c.(934-936)GAA>GAG		coiled-coil domain containing 99							84.0	88.0	87.0					5																	169023609		2203	4300	6503	SO:0001819	synonymous_variant	54908				cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding	g.chr5:169023609A>G	BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.936A>G	5.37:g.169023609A>G			Somatic				CCDC99_uc010jjj.2_Silent_p.E241E|CCDC99_uc011deq.1_Silent_p.E129E|CCDC99_uc010jjk.2_Silent_p.E38E	p.E312E	NM_017785	NP_060255	WXS	Illumina HiSeq	Unspecified	Q96EA4	SPDLY_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		8	1215	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	312			Potential.			Silent	SNP	ENST00000265295.4	37	c.936A>G	CCDS4370.1	.	.	.	.	.	.	.	.	.	.	A	9.515	1.106792	0.20714	.	.	ENSG00000040275	ENST00000505977	.	.	.	5.7	3.26	0.37387	.	.	.	.	.	T	0.55065	0.1897	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46148	-0.9212	4	.	.	.	-21.1796	6.5664	0.22515	0.744:0.1336:0.1224:0.0	.	.	.	.	V	233	.	.	I	+	1	0	CCDC99	168956187	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	1.512000	0.35812	0.404000	0.25506	0.533000	0.62120	ATT		0.348	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785		26	89	0	0	0	0.003755	0	26	89				
F13A1	2162	broad.mit.edu	37	6	6197479	6197479	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:6197479C>A	ENST00000264870.3	-	9	1458	c.1193G>T	c.(1192-1194)aGc>aTc	p.S398I		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	398					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.S398I(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CTGGGGGGTGCTGTCCACAGC	0.478																																							uc003mwv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6						c.(1192-1194)AGC>ATC		coagulation factor XIII A1 subunit precursor	L-Glutamine(DB00130)						92.0	86.0	88.0					6																	6197479		2203	4300	6503	SO:0001583	missense	2162				peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr6:6197479C>A	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1193G>T	6.37:g.6197479C>A	ENSP00000264870:p.Ser398Ile		Somatic				F13A1_uc011dib.1_Missense_Mutation_p.S335I	p.S398I	NM_000129	NP_000120	WXS	Illumina HiSeq	Unspecified	P00488	F13A_HUMAN			9	1316	-	Ovarian(93;0.0816)	all_hematologic(90;0.152)	398					Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	c.1193G>T	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281844	0.80692	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	D	0.95690	-3.78	5.47	5.47	0.80525	Transglutaminase-like (1);	0.168590	0.53938	D	0.000053	D	0.96608	0.8893	M	0.62723	1.935	0.39917	D	0.974101	D;D	0.89917	0.976;1.0	P;D	0.85130	0.714;0.997	D	0.97193	0.9859	10	0.72032	D	0.01	.	13.9962	0.64402	0.0:0.8487:0.1513:0.0	.	335;398	F5H080;P00488	.;F13A_HUMAN	I	398;335	ENSP00000264870:S398I	ENSP00000264870:S398I	S	-	2	0	F13A1	6142478	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.996000	0.70639	2.558000	0.86282	0.655000	0.94253	AGC		0.478	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129		40	98	1	0	4.75955e-12	0.00361	5.77007e-12	40	98				
CAGE1	285782	broad.mit.edu	37	6	7355286	7355286	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:7355286G>T	ENST00000512086.1	-	9	2373	c.2171C>A	c.(2170-2172)tCc>tAc	p.S724Y	CAGE1_ENST00000296742.7_Missense_Mutation_p.S588Y|CAGE1_ENST00000338150.4_Missense_Mutation_p.S751Y|CAGE1_ENST00000502583.1_Missense_Mutation_p.S786Y|CAGE1_ENST00000379918.4_Missense_Mutation_p.S764Y			Q8TC20	CAGE1_HUMAN	cancer antigen 1	724								p.S751Y(1)|p.S786Y(1)|p.S588Y(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					TGCAATCTGGGAGTGGGATAT	0.308																																							uc003mxi.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(1762-1764)TCC>TAC		cancer antigen 1							103.0	98.0	100.0					6																	7355286		1819	4080	5899	SO:0001583	missense	285782							g.chr6:7355286G>T	BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.2171C>A	6.37:g.7355286G>T	ENSP00000427583:p.Ser724Tyr		Somatic				CAGE1_uc003mxh.2_RNA|CAGE1_uc003mxj.2_Missense_Mutation_p.S541Y|CAGE1_uc003mxk.1_Missense_Mutation_p.S506Y	p.S588Y	NM_205864	NP_995586	WXS	Illumina HiSeq	Unspecified	Q8TC20	CAGE1_HUMAN			8	2484	-	Ovarian(93;0.0418)		724					D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Missense_Mutation	SNP	ENST00000512086.1	37	c.1763C>A		.	.	.	.	.	.	.	.	.	.	G	11.96	1.795084	0.31777	.	.	ENSG00000164304	ENST00000541116;ENST00000379918;ENST00000502583;ENST00000296742;ENST00000512086;ENST00000338150	T;T;T;T;T	0.46819	1.2;0.86;1.34;1.34;1.34	4.9	3.08	0.35506	.	0.141721	0.33382	N	0.004976	T	0.33990	0.0882	L	0.46157	1.445	0.30261	N	0.793131	P;P;P	0.46277	0.818;0.717;0.875	P;P;P	0.51806	0.568;0.568;0.68	T	0.14783	-1.0460	10	0.66056	D	0.02	-2.2496	7.7478	0.28879	0.1961:0.0:0.8039:0.0	.	751;786;724	Q8TC20-3;D6RCT9;Q8TC20	.;.;CAGE1_HUMAN	Y	724;764;786;588;724;751	ENSP00000369250:S764Y;ENSP00000425493:S786Y;ENSP00000296742:S588Y;ENSP00000427583:S724Y;ENSP00000338107:S751Y	ENSP00000296742:S588Y	S	-	2	0	CAGE1	7300285	0.993000	0.37304	0.969000	0.41365	0.933000	0.57130	0.692000	0.25482	1.292000	0.44672	0.655000	0.94253	TCC		0.308	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	protein_coding	OTTHUMT00000367136.1	NM_175745		47	57	1	0	2.92391e-54	0.00361	4.89604e-54	47	57				
TDP2	51567	broad.mit.edu	37	6	24666767	24666767	+	Missense_Mutation	SNP	C	C	T	rs143844222	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:24666767C>T	ENST00000378198.4	-	2	408	c.238G>A	c.(238-240)Gag>Aag	p.E80K	TDP2_ENST00000341060.3_5'UTR|ACOT13_ENST00000537591.1_5'Flank|TDP2_ENST00000545995.1_Missense_Mutation_p.E110K|ACOT13_ENST00000230048.4_5'Flank			O95551	TYDP2_HUMAN	tyrosyl-DNA phosphodiesterase 2	80					cell surface receptor signaling pathway (GO:0007166)|double-strand break repair (GO:0006302)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|PML body (GO:0016605)	5'-tyrosyl-DNA phosphodiesterase activity (GO:0070260)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)|tyrosyl-RNA phosphodiesterase activity (GO:0036317)	p.E80K(1)		kidney(2)|large_intestine(1)|lung(5)|ovary(1)	9						GTCTTGGGCTCAGAGATGGTT	0.602								Direct reversal of damage					C|||	2	0.000399361	0.0	0.0	5008	,	,		19153	0.0		0.002	False		,,,				2504	0.0						uc003nej.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(238-240)GAG>AAG	Direct_reversal_of_damage|Editing_and_processing_nucleases	TRAF and TNF receptor-associated protein							159.0	163.0	162.0					6																	24666767		2203	4300	6503	SO:0001583	missense	51567				cell surface receptor linked signaling pathway|double-strand break repair	PML body	5'-tyrosyl-DNA phosphodiesterase activity|magnesium ion binding|nuclease activity|protein binding|transcription corepressor activity	g.chr6:24666767C>T	AJ269473	CCDS4557.1	6p22.3-p22.1	2010-05-07	2010-05-07	2010-05-07	ENSG00000111802	ENSG00000111802	3.1.4.-		17768	protein-coding gene	gene with protein product		605764	"""TRAF and TNF receptor associated protein"""	TTRAP		11478795	Standard	NM_016614		Approved		uc003nej.3	O95551	OTTHUMG00000014360	ENST00000378198.4:c.238G>A	6.37:g.24666767C>T	ENSP00000367440:p.Glu80Lys		Somatic				TDP2_uc003nei.2_5'UTR|TDP2_uc010jpu.1_Missense_Mutation_p.E80K|ACOT13_uc010jpv.2_5'Flank|ACOT13_uc003nek.2_5'Flank	p.E80K	NM_016614	NP_057698	WXS	Illumina HiSeq	Unspecified	O95551	TYDP2_HUMAN			2	263	-			80					B4DKL8|B4DQ95|Q2TBE2|Q5JYM0|Q7Z6U5|Q9NUK5|Q9NYY9	Missense_Mutation	SNP	ENST00000378198.4	37	c.238G>A	CCDS4557.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	7.013	0.557111	0.13436	.	.	ENSG00000111802	ENST00000378198;ENST00000545995	T;T	0.23147	1.95;1.92	4.84	1.24	0.21308	.	1.261060	0.05609	N	0.577757	T	0.04497	0.0123	L	0.31664	0.95	0.09310	N	1	B;B	0.13594	0.008;0.001	B;B	0.09377	0.004;0.001	T	0.32134	-0.9918	10	0.07175	T	0.84	-12.4478	5.4153	0.16370	0.0:0.5015:0.355:0.1435	.	110;80	O95551-2;O95551	.;TYDP2_HUMAN	K	80;110	ENSP00000367440:E80K;ENSP00000437637:E110K	ENSP00000367440:E80K	E	-	1	0	TDP2	24774746	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.110000	0.10824	0.373000	0.24621	0.655000	0.94253	GAG		0.602	TDP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000040012.1			22	235	0	0	0	0.009535	0	22	235				
HIST1H2AJ	8331	broad.mit.edu	37	6	27782248	27782248	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:27782248C>T	ENST00000333151.3	-	1	359	c.271G>A	c.(271-273)Gat>Aat	p.D91N	HIST1H2BM_ENST00000359465.4_5'Flank	NM_021066.2	NP_066544.1	Q99878	H2A1J_HUMAN	histone cluster 1, H2aj	91						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D91N(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	11						AGCTCCTCATCGTTGCGGATG	0.612																																							uc003njn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(271-273)GAT>AAT		histone cluster 1, H2aj							62.0	65.0	64.0					6																	27782248		2202	4279	6481	SO:0001583	missense	8331				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27782248C>T	Z83736	CCDS4628.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000182611	ENSG00000276368		"""Histones / Replication-dependent"""	4727	protein-coding gene	gene with protein product		602791	"""H2A histone family, member E"", ""histone 1, H2aj"""	H2AFE		9439656, 12408966	Standard	NM_021066		Approved	H2A/E	uc003njn.1	Q99878	OTTHUMG00000014486	ENST00000333151.3:c.271G>A	6.37:g.27782248C>T	ENSP00000328484:p.Asp91Asn		Somatic				HIST1H2BM_uc003njo.2_5'Flank	p.D91N	NM_021066	NP_066544	WXS	Illumina HiSeq	Unspecified	Q99878	H2A1J_HUMAN			1	271	-			91					A2RUU6|Q5JXQ5	Missense_Mutation	SNP	ENST00000333151.3	37	c.271G>A	CCDS4628.1	.	.	.	.	.	.	.	.	.	.	.	23.2	4.388773	0.82902	.	.	ENSG00000182611	ENST00000333151	D	0.90324	-2.65	4.15	4.15	0.48705	Histone-fold (2);Histone core (1);Histone H2A (1);	0.000000	0.33959	U	0.004398	D	0.96087	0.8725	M	0.92317	3.295	0.43617	D	0.995999	D	0.89917	1.0	D	0.97110	1.0	D	0.96585	0.9433	10	0.72032	D	0.01	.	16.6779	0.85284	0.0:1.0:0.0:0.0	.	91	Q99878	H2A1J_HUMAN	N	91	ENSP00000328484:D91N	ENSP00000328484:D91N	D	-	1	0	HIST1H2AJ	27890227	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.663000	0.68038	2.582000	0.87167	0.655000	0.94253	GAT		0.612	HIST1H2AJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040154.1	NM_021066		13	23	0	0	0	0.00278	0	13	23				
SLC26A8	116369	broad.mit.edu	37	6	35918953	35918953	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:35918953G>T	ENST00000490799.1	-	19	2812	c.2459C>A	c.(2458-2460)tCa>tAa	p.S820*	SLC26A8_ENST00000355574.2_Nonsense_Mutation_p.S820*|SLC26A8_ENST00000394602.2_Nonsense_Mutation_p.S715*	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8									p.S820*(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						GTCTGTTTCTGAGTAGGTTTC	0.552																																							uc003olm.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(2458-2460)TCA>TAA		solute carrier family 26, member 8 isoform a							136.0	115.0	122.0					6																	35918953		2203	4300	6503	SO:0001587	stop_gained	116369				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity	g.chr6:35918953G>T	AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.2459C>A	6.37:g.35918953G>T	ENSP00000417638:p.Ser820*		Somatic				SLC26A8_uc010jwa.2_RNA|SLC26A8_uc003olk.2_Nonsense_Mutation_p.S402*|SLC26A8_uc003oln.2_Nonsense_Mutation_p.S820*|SLC26A8_uc003oll.2_Nonsense_Mutation_p.S715*	p.S820*	NM_052961	NP_443193	WXS	Illumina HiSeq	Unspecified	Q96RN1	S26A8_HUMAN			19	2570	-			820			Interaction with RACGAP1.|Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000490799.1	37	c.2459C>A	CCDS4813.1	.	.	.	.	.	.	.	.	.	.	G	42	9.285989	0.99125	.	.	ENSG00000112053	ENST00000490799;ENST00000394602;ENST00000355574	.	.	.	5.02	5.02	0.67125	.	0.460978	0.18679	N	0.134220	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5547	0.68091	0.0:0.0:1.0:0.0	.	.	.	.	X	820;715;820	.	ENSP00000347778:S820X	S	-	2	0	SLC26A8	36026931	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	2.076000	0.41548	2.702000	0.92279	0.655000	0.94253	TCA		0.552	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2			92	97	1	0	1.9643e-79	0.00361	3.45112e-79	92	97				
LRFN2	57497	broad.mit.edu	37	6	40360626	40360626	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:40360626A>C	ENST00000338305.6	-	3	1968	c.1426T>G	c.(1426-1428)Ttc>Gtc	p.F476V		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	476	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.F476V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TTGACCACGAAGGCCTTGTTG	0.597																																							uc003oph.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1426-1428)TTC>GTC		leucine rich repeat and fibronectin type III							42.0	44.0	44.0					6																	40360626		2203	4300	6503	SO:0001583	missense	57497					cell junction|integral to membrane|postsynaptic membrane		g.chr6:40360626A>C	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1426T>G	6.37:g.40360626A>C	ENSP00000345985:p.Phe476Val		Somatic					p.F476V	NM_020737	NP_065788	WXS	Illumina HiSeq	Unspecified	Q9ULH4	LRFN2_HUMAN			3	1891	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		476			Fibronectin type-III.|Extracellular (Potential).		A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	c.1426T>G	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	a	19.05	3.752023	0.69533	.	.	ENSG00000156564	ENST00000338305	T	0.53640	0.61	5.29	4.08	0.47627	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.046699	0.85682	D	0.000000	T	0.58836	0.2150	M	0.83118	2.625	0.58432	D	0.999999	D	0.61080	0.989	D	0.70227	0.968	T	0.65533	-0.6145	10	0.87932	D	0	.	10.1953	0.43051	0.8507:0.0:0.0:0.1493	.	476	Q9ULH4	LRFN2_HUMAN	V	476	ENSP00000345985:F476V	ENSP00000345985:F476V	F	-	1	0	LRFN2	40468604	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.293000	0.96082	0.788000	0.33755	0.529000	0.55759	TTC		0.597	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		16	24	0	0	0	0.007413	0	16	24				
LRFN2	57497	broad.mit.edu	37	6	40399650	40399650	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:40399650G>T	ENST00000338305.6	-	2	1745	c.1203C>A	c.(1201-1203)ggC>ggA	p.G401G		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	401						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.G401G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TCTTGCTGGAGCCAGTGATGT	0.657																																							uc003oph.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1201-1203)GGC>GGA		leucine rich repeat and fibronectin type III							45.0	46.0	45.0					6																	40399650		2203	4300	6503	SO:0001819	synonymous_variant	57497					cell junction|integral to membrane|postsynaptic membrane		g.chr6:40399650G>T	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1203C>A	6.37:g.40399650G>T			Somatic					p.G401G	NM_020737	NP_065788	WXS	Illumina HiSeq	Unspecified	Q9ULH4	LRFN2_HUMAN			2	1668	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		401			Extracellular (Potential).		A5PKU3|Q5SYP9	Silent	SNP	ENST00000338305.6	37	c.1203C>A	CCDS34443.1																																																																																				0.657	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		7	5	1	0	9.31168e-06	0.001855	1.01276e-05	7	5				
TREML2	79865	broad.mit.edu	37	6	41162245	41162245	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:41162245G>A	ENST00000483722.1	-	3	888	c.703C>T	c.(703-705)Ctc>Ttc	p.L235F		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	235					T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.L294F(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTGGTGCTGAGGTCCCCAGAC	0.622																																							uc010jxm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(703-705)CTC>TTC		triggering receptor expressed on myeloid							90.0	89.0	90.0					6																	41162245		2203	4300	6503	SO:0001583	missense	79865				T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity	g.chr6:41162245G>A	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.703C>T	6.37:g.41162245G>A	ENSP00000418767:p.Leu235Phe		Somatic					p.L235F	NM_024807	NP_079083	WXS	Illumina HiSeq	Unspecified	Q5T2D2	TRML2_HUMAN			3	882	-	Ovarian(28;0.0418)|Colorectal(47;0.196)		235			Extracellular (Potential).		Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	37	c.703C>T	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	G	13.87	2.364656	0.41902	.	.	ENSG00000112195	ENST00000483722	T	0.06849	3.25	4.0	2.14	0.27477	.	1.335270	0.05259	N	0.515341	T	0.05868	0.0153	L	0.53249	1.67	0.09310	N	1	P	0.50943	0.94	P	0.50440	0.641	T	0.29119	-1.0022	10	0.42905	T	0.14	-1.2352	4.834	0.13454	0.1196:0.2238:0.6566:0.0	.	235	Q5T2D2	TRML2_HUMAN	F	235	ENSP00000418767:L235F	ENSP00000418767:L235F	L	-	1	0	TREML2	41270223	0.005000	0.15991	0.002000	0.10522	0.018000	0.09664	1.499000	0.35671	0.988000	0.38734	0.655000	0.94253	CTC		0.622	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807		8	9	0	0	0	0.00308	0	8	9				
TCTE1	202500	broad.mit.edu	37	6	44253930	44253930	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:44253930A>T	ENST00000371505.4	-	3	739	c.617T>A	c.(616-618)cTc>cAc	p.L206H	TCTE1_ENST00000371504.1_Missense_Mutation_p.L53H|RP11-444E17.6_ENST00000505802.1_Intron|TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371503.3_Missense_Mutation_p.L53H	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	206								p.L206H(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GCCCGGCCGGAGCTGGGCCGG	0.672																																							uc003oxi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(616-618)CTC>CAC		t-complex-associated testis expressed 1							38.0	41.0	40.0					6																	44253930		2203	4300	6503	SO:0001583	missense	202500							g.chr6:44253930A>T	BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.617T>A	6.37:g.44253930A>T	ENSP00000360560:p.Leu206His		Somatic				SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	p.L206H	NM_182539	NP_872345	WXS	Illumina HiSeq	Unspecified	Q5JU00	TCTE1_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		3	773	-	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		206					B4DX59|Q8IYS6	Missense_Mutation	SNP	ENST00000371505.4	37	c.617T>A	CCDS4910.1	.	.	.	.	.	.	.	.	.	.	A	3.961	-0.010372	0.07727	.	.	ENSG00000146221	ENST00000371505;ENST00000371503;ENST00000371504	T;T;T	0.45276	1.9;0.9;0.9	4.81	0.541	0.17168	.	0.718403	0.14205	N	0.334437	T	0.09992	0.0245	N	0.22421	0.69	0.09310	N	1	P	0.41748	0.761	B	0.37780	0.258	T	0.11203	-1.0597	10	0.37606	T	0.19	-16.8887	6.0391	0.19724	0.3056:0.0:0.5518:0.1427	.	206	Q5JU00	TCTE1_HUMAN	H	206;53;53	ENSP00000360560:L206H;ENSP00000360558:L53H;ENSP00000360559:L53H	ENSP00000360558:L53H	L	-	2	0	TCTE1	44361908	0.049000	0.20398	0.002000	0.10522	0.020000	0.10135	0.272000	0.18644	0.074000	0.16767	-0.624000	0.04008	CTC		0.672	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040736.1	NM_182539		5	6	0	0	0	0.004482	0	5	6				
COL21A1	81578	broad.mit.edu	37	6	55922481	55922481	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:55922481G>A	ENST00000244728.5	-	30	3245	c.2848C>T	c.(2848-2850)Ccg>Tcg	p.P950S	COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000535941.1_Missense_Mutation_p.P950S|COL21A1_ENST00000370819.1_Missense_Mutation_p.P947S|COL21A1_ENST00000370808.2_Missense_Mutation_p.P316S	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	950					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.P950S(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TTTCTGAACGGATCTCTTCTG	0.473																																							uc003pcs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(2848-2850)CCG>TCG		collagen, type XXI, alpha 1 precursor							92.0	86.0	88.0					6																	55922481		1912	4132	6044	SO:0001583	missense	81578				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr6:55922481G>A	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2848C>T	6.37:g.55922481G>A	ENSP00000244728:p.Pro950Ser		Somatic				COL21A1_uc010jzz.2_Missense_Mutation_p.P335S|COL21A1_uc011dxg.1_Missense_Mutation_p.P323S|COL21A1_uc011dxh.1_Missense_Mutation_p.P301S|COL21A1_uc003pcr.2_Missense_Mutation_p.P307S	p.P950S	NM_030820	NP_110447	WXS	Illumina HiSeq	Unspecified	Q96P44	COLA1_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)		30	3080	-	Lung NSC(77;0.0483)		950					A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	c.2848C>T	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524225	0.27299	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811;ENST00000370808	D;D;D;D	0.90563	-2.42;-2.37;-2.42;-2.69	4.62	4.62	0.57501	.	0.000000	0.56097	D	0.000039	D	0.91811	0.7409	L	0.35723	1.085	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.996;0.997	D	0.93166	0.6562	10	0.72032	D	0.01	.	17.8313	0.88683	0.0:0.0:1.0:0.0	.	316;950;950;307	Q96P44-2;B7ZLK3;Q96P44;B3KU30	.;.;COLA1_HUMAN;.	S	950;947;950;947;316	ENSP00000244728:P950S;ENSP00000359855:P947S;ENSP00000444384:P950S;ENSP00000359844:P316S	ENSP00000244728:P950S	P	-	1	0	COL21A1	56030440	1.000000	0.71417	0.999000	0.59377	0.318000	0.28184	5.331000	0.65905	2.275000	0.75901	0.655000	0.94253	CCG		0.473	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2			33	45	0	0	0	0.00623	0	33	45				
RFPL4B	442247	broad.mit.edu	37	6	112671067	112671067	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:112671067C>T	ENST00000441065.2	+	3	469	c.157C>T	c.(157-159)Cga>Tga	p.R53*	RP11-506B6.6_ENST00000585611.1_RNA|RP11-506B6.6_ENST00000587816.1_RNA|RP11-506B6.6_ENST00000590673.1_RNA	NM_001013734.2	NP_001013756.2	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	53							zinc ion binding (GO:0008270)	p.R53*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	14		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		CCCCTTGTGTCGAGACGTGGT	0.463																																							uc003pvx.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(157-159)CGA>TGA		ret finger protein-like 4B							137.0	118.0	124.0					6																	112671067		2203	4300	6503	SO:0001587	stop_gained	442247						zinc ion binding	g.chr6:112671067C>T	AK122906	CCDS34515.1	6q21	2007-04-24			ENSG00000251258	ENSG00000251258		"""RING-type (C3HC4) zinc fingers"""	33264	protein-coding gene	gene with protein product							Standard	NM_001013734		Approved	RNF211	uc003pvx.1	Q6ZWI9	OTTHUMG00000015390	ENST00000441065.2:c.157C>T	6.37:g.112671067C>T	ENSP00000423391:p.Arg53*		Somatic					p.R53*	NM_001013734	NP_001013756	WXS	Illumina HiSeq	Unspecified	Q6ZWI9	RFPLB_HUMAN		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)	3	469	+		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)	53			RING-type.		A2RU91	Nonsense_Mutation	SNP	ENST00000441065.2	37	c.157C>T	CCDS34515.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040220	0.75732	.	.	ENSG00000251258	ENST00000441065	.	.	.	4.01	-5.5	0.02576	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.1089	0.10050	0.462:0.1873:0.0:0.3507	.	.	.	.	X	53	.	ENSP00000423391:R53X	R	+	1	2	RFPL4B	112777760	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	-0.424000	0.07025	-1.332000	0.02249	-0.140000	0.14226	CGA		0.463	RFPL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041885.2	NM_001013734		3	38	0	0	0	0.009096	0	3	38				
NCOA7	135112	broad.mit.edu	37	6	126210971	126210971	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:126210971G>T	ENST00000368357.3	+	10	2123	c.1771G>T	c.(1771-1773)Gta>Tta	p.V591L	NCOA7_ENST00000392477.2_Missense_Mutation_p.V591L|NCOA7_ENST00000229634.9_Missense_Mutation_p.V476L	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	591					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)	p.V591L(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		GCCCCTCCCGGTAAAACTGAA	0.468																																							uc010kes.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1771-1773)GTA>TTA		nuclear receptor coactivator 7 isoform 1							54.0	59.0	57.0					6																	126210971		2203	4300	6503	SO:0001583	missense	135112				cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chr6:126210971G>T	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.1771G>T	6.37:g.126210971G>T	ENSP00000357341:p.Val591Leu		Somatic				NCOA7_uc003qae.3_Missense_Mutation_p.V591L|NCOA7_uc003qah.2_Missense_Mutation_p.V580L|NCOA7_uc003qai.2_Missense_Mutation_p.V591L|NCOA7_uc010ket.2_Missense_Mutation_p.V476L	p.V591L	NM_181782	NP_861447	WXS	Illumina HiSeq	Unspecified	Q8NI08	NCOA7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)	11	2220	+			591					B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	ENST00000368357.3	37	c.1771G>T	CCDS5132.1	.	.	.	.	.	.	.	.	.	.	G	0.100	-1.153510	0.01700	.	.	ENSG00000111912	ENST00000368357;ENST00000392477;ENST00000229634;ENST00000413085	T;T;T;T	0.28454	1.61;1.61;1.61;1.61	5.49	-1.82	0.07857	.	1.134080	0.06744	N	0.778753	T	0.02727	0.0082	N	0.02916	-0.46	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.37150	-0.9718	10	0.26408	T	0.33	0.2205	0.6081	0.00756	0.2627:0.2889:0.1192:0.3292	.	580;580;591	B3KXK4;Q8NI08-2;Q8NI08	.;.;NCOA7_HUMAN	L	591;591;476;389	ENSP00000357341:V591L;ENSP00000376269:V591L;ENSP00000229634:V476L;ENSP00000389186:V389L	ENSP00000229634:V476L	V	+	1	0	NCOA7	126252664	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-0.686000	0.05161	-0.264000	0.09365	-0.302000	0.09304	GTA		0.468	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748		20	34	1	0	3.5997e-14	0.002299	4.49765e-14	20	34				
PDE10A	10846	broad.mit.edu	37	6	165806140	165806140	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:165806140G>A	ENST00000366882.1	-	17	1775	c.1621C>T	c.(1621-1623)Ctt>Ttt	p.L541F	PDE10A_ENST00000354448.4_Missense_Mutation_p.L541F|PDE10A_ENST00000539869.2_Missense_Mutation_p.L551F			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	541					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.L541F(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	CCCACCTCAAGGTCTGTGAAA	0.458																																					Esophageal Squamous(22;308 615 5753 12038 40624)	Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1621-1623)CTT>TTT		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						159.0	119.0	133.0					6																	165806140		2203	4300	6503	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165806140G>A	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1621C>T	6.37:g.165806140G>A	ENSP00000355847:p.Leu541Phe		Somatic				PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.L471F|PDE10A_uc003quo.2_Missense_Mutation_p.L551F	p.L541F	NM_006661	NP_006652	WXS	Illumina HiSeq	Unspecified	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	17	1862	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	541					Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.1621C>T		.	.	.	.	.	.	.	.	.	.	G	14.99	2.701318	0.48307	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	D;D	0.85339	-1.97;-1.97	5.43	3.65	0.41850	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.068692	0.64402	D	0.000012	T	0.82047	0.4952	L	0.56280	1.765	0.54753	D	0.999987	P;P	0.52842	0.956;0.511	P;B	0.57101	0.813;0.363	T	0.82851	-0.0253	10	0.87932	D	0	.	7.4252	0.27094	0.1441:0.1384:0.7175:0.0	.	551;541	Q9ULW9;Q9Y233	.;PDE10_HUMAN	F	541;569;551;541;540	ENSP00000355847:L541F;ENSP00000346435:L541F	ENSP00000341187:L551F	L	-	1	0	PDE10A	165726130	1.000000	0.71417	0.024000	0.17045	0.376000	0.30014	4.289000	0.59013	0.663000	0.31027	0.585000	0.79938	CTT		0.458	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			109	312	0	0	0	0.00361	0	109	312				
CARD11	84433	broad.mit.edu	37	7	2976689	2976689	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:2976689G>T	ENST00000396946.4	-	9	1726	c.1323C>A	c.(1321-1323)gaC>gaA	p.D441E		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	441					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.D434E(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GGTTGTTGCTGTCCTTGGAGA	0.672			Mis		DLBCL																																		uc003smv.2		NA		Dom	yes		7	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""			L			DLBCL		1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50						c.(1321-1323)GAC>GAA		caspase recruitment domain family, member 11							83.0	73.0	76.0					7																	2976689		2203	4300	6503	SO:0001583	missense	84433				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	g.chr7:2976689G>T	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1323C>A	7.37:g.2976689G>T	ENSP00000380150:p.Asp441Glu		Somatic					p.D441E	NM_032415	NP_115791	WXS	Illumina HiSeq	Unspecified	Q9BXL7	CAR11_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)	9	1727	-		Ovarian(82;0.0115)	441			Potential.		A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	c.1323C>A	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	0.472	-0.884160	0.02530	.	.	ENSG00000198286	ENST00000396946	T	0.30182	1.54	5.11	3.23	0.37069	.	0.000000	0.85682	D	0.000000	T	0.15998	0.0385	N	0.16903	0.455	0.37640	D	0.92202	B	0.20671	0.047	B	0.15052	0.012	T	0.09357	-1.0678	10	0.30854	T	0.27	-29.1858	6.6825	0.23127	0.1572:0.1467:0.6961:0.0	.	441	Q9BXL7	CAR11_HUMAN	E	441	ENSP00000380150:D441E	ENSP00000380150:D441E	D	-	3	2	CARD11	2943215	1.000000	0.71417	0.961000	0.40146	0.847000	0.48162	1.987000	0.40687	1.119000	0.41883	0.561000	0.74099	GAC		0.672	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415		14	12	1	0	7.05477e-17	0.00499	9.032e-17	14	12				
MEOX2	4223	broad.mit.edu	37	7	15652213	15652213	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:15652213C>A	ENST00000262041.5	-	3	1123	c.714G>T	c.(712-714)agG>agT	p.R238S		NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	238					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)	p.R238S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ACTTCATCCGCCTGTTTTGGA	0.438																																					Esophageal Squamous(140;197 1769 16409 18257 29929)	Esophageal Squamous(140;197 1769 16409 18257 29929)	uc003stc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(712-714)AGG>AGT		mesenchyme homeobox 2							106.0	105.0	105.0					7																	15652213		2203	4300	6503	SO:0001583	missense	4223				blood circulation|multicellular organismal development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:15652213C>A		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.714G>T	7.37:g.15652213C>A	ENSP00000262041:p.Arg238Ser		Somatic				MEOX2_uc011jxw.1_Missense_Mutation_p.R238S	p.R238S	NM_005924	NP_005915	WXS	Illumina HiSeq	Unspecified	P50222	MEOX2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)	3	995	-			238			Homeobox.		B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	ENST00000262041.5	37	c.714G>T	CCDS34605.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474824	0.26511	.	.	ENSG00000106511	ENST00000262041	D	0.97710	-4.5	5.78	3.97	0.46021	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98689	0.9560	M	0.92122	3.275	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.99069	1.0833	10	0.87932	D	0	-15.644	7.485	0.27427	0.0:0.6539:0.0:0.3461	.	238	P50222	MEOX2_HUMAN	S	238	ENSP00000262041:R238S	ENSP00000262041:R238S	R	-	3	2	MEOX2	15618738	0.432000	0.25554	0.894000	0.35097	0.011000	0.07611	0.475000	0.22164	1.464000	0.47987	0.563000	0.77884	AGG		0.438	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924		19	93	1	0	7.45023e-12	0.010504	8.97485e-12	19	93				
ABCB5	340273	broad.mit.edu	37	7	20698196	20698196	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:20698196T>A	ENST00000404938.2	+	14	2256	c.1604T>A	c.(1603-1605)aTt>aAt	p.I535N	ABCB5_ENST00000406935.1_Missense_Mutation_p.I90N|ABCB5_ENST00000258738.6_Missense_Mutation_p.I90N|ABCB5_ENST00000443026.2_Missense_Mutation_p.I90N	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	535	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.I90N(2)|p.I535N(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						AGGATCGCAATTGCTCGTGCC	0.438																																							uc003suw.3		NA																	3	Substitution - Missense(3)		lung(3)	skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(268-270)ATT>AAT		ATP-binding cassette, sub-family B, member 5							133.0	117.0	122.0					7																	20698196		2203	4300	6503	SO:0001583	missense	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20698196T>A	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1604T>A	7.37:g.20698196T>A	ENSP00000384881:p.Ile535Asn		Somatic				ABCB5_uc010kuh.2_Missense_Mutation_p.I535N|ABCB5_uc003suv.3_Missense_Mutation_p.I90N|ABCB5_uc011jyi.1_Missense_Mutation_p.I90N	p.I90N	NM_178559	NP_848654	WXS	Illumina HiSeq	Unspecified	Q2M3G0	ABCB5_HUMAN			5	815	+			90			ABC transporter 1.|Extracellular (Potential).		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	c.269T>A	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	T	19.04	3.749964	0.69533	.	.	ENSG00000004846	ENST00000404938;ENST00000443026;ENST00000406935;ENST00000258738	D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93	5.77	4.61	0.57282	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.086851	0.46442	D	0.000297	D	0.98563	0.9520	H	0.98883	4.36	0.51233	D	0.999916	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	D	0.98552	1.0637	10	0.87932	D	0	.	10.7801	0.46374	0.0:0.074:0.0:0.926	.	90;535;90;90	B5MD19;A7BKA4;Q2M3G0;Q2M3G0-2	.;.;ABCB5_HUMAN;.	N	535;90;90;90	ENSP00000384881:I535N;ENSP00000406730:I90N;ENSP00000383899:I90N;ENSP00000258738:I90N	ENSP00000258738:I90N	I	+	2	0	ABCB5	20664721	1.000000	0.71417	0.983000	0.44433	0.492000	0.33523	6.102000	0.71486	2.330000	0.79161	0.528000	0.53228	ATT		0.438	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		33	145	0	0	0	0.00874	0	33	145				
GPNMB	10457	broad.mit.edu	37	7	23286420	23286420	+	5'UTR	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:23286420C>T	ENST00000381990.2	+	0	105				GPNMB_ENST00000539136.1_5'UTR|GPNMB_ENST00000409458.3_5'UTR|GPNMB_ENST00000453162.2_5'UTR|GPNMB_ENST00000258733.4_5'UTR	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb						bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			TCTTGGTGGACGGGCCCAGAG	0.493																																							uc003swc.2		NA																	0				ovary(3)|breast(2)	5						c.(-58--54)GACGG>GATGG		glycoprotein (transmembrane) nmb isoform a							129.0	148.0	142.0					7																	23286420		692	1591	2283	SO:0001623	5_prime_UTR_variant	10457				negative regulation of cell proliferation	melanosome		g.chr7:23286420C>T	X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.-57C>T	7.37:g.23286420C>T			Somatic				GPNMB_uc003swa.2_Translation_Start_Site|GPNMB_uc003swb.2_Translation_Start_Site|GPNMB_uc011jyy.1_Translation_Start_Site|GPNMB_uc011jyz.1_Translation_Start_Site		NM_001005340	NP_001005340	WXS	Illumina HiSeq	Unspecified	Q14956	GPNMB_HUMAN	GBM - Glioblastoma multiforme(13;0.154)		1	105	+								A4D155|Q6UVX1|Q8N1A1	Translation_Start_Site	SNP	ENST00000381990.2	37	c.-56C>T	CCDS34610.1	.	.	.	.	.	.	.	.	.	.	c	8.840	0.942104	0.18281	.	.	ENSG00000136235	ENST00000435486	.	.	.	5.69	-0.893	0.10567	.	.	.	.	.	T	0.11707	0.0285	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	T	0.33445	-0.9868	5	0.02654	T	1	.	5.9747	0.19371	0.0:0.3758:0.2781:0.3461	.	.	.	.	M	29	.	ENSP00000409199:T29M	T	+	2	0	GPNMB	23252945	0.000000	0.05858	0.002000	0.10522	0.093000	0.18481	-0.509000	0.06336	-0.144000	0.11314	-1.280000	0.01385	ACG		0.493	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340		19	22	0	0	0	0.008871	0	19	22				
ANLN	54443	broad.mit.edu	37	7	36462361	36462361	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:36462361T>A	ENST00000265748.2	+	14	2640	c.2419T>A	c.(2419-2421)Tca>Aca	p.S807T	ANLN_ENST00000396068.2_Missense_Mutation_p.S770T	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	807	Localization to the cleavage furrow.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.S807T(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						AGTTACTTTGTCAGAAATCCG	0.388																																							uc003tff.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2419-2421)TCA>ACA		anillin, actin binding protein							198.0	198.0	198.0					7																	36462361		2203	4300	6503	SO:0001583	missense	54443				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding	g.chr7:36462361T>A	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.2419T>A	7.37:g.36462361T>A	ENSP00000265748:p.Ser807Thr		Somatic				ANLN_uc011kaz.1_Missense_Mutation_p.S719T|ANLN_uc003tfg.2_Missense_Mutation_p.S770T|ANLN_uc010kxe.2_Missense_Mutation_p.S769T	p.S807T	NM_018685	NP_061155	WXS	Illumina HiSeq	Unspecified	Q9NQW6	ANLN_HUMAN			14	2623	+			807			Localization to the cleavage furrow.		Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	37	c.2419T>A	CCDS5447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.58|16.58	3.161676|3.161676	0.57368|0.57368	.|.	.|.	ENSG00000011426|ENSG00000011426	ENST00000446635;ENST00000457743|ENST00000265748;ENST00000396068	.|T;T	.|0.54071	.|0.59;0.59	6.05|6.05	6.05|6.05	0.98169|0.98169	.|.	.|0.218806	.|0.44902	.|D	.|0.000414	.|T	.|0.67933	.|0.2946	L|L	0.51422|0.51422	1.61|1.61	0.46927|0.46927	D|D	0.999257|0.999257	.|D;P;P;P	.|0.89917	.|1.0;0.767;0.724;0.767	.|D;P;P;P	.|0.87578	.|0.998;0.609;0.474;0.609	.|T	.|0.68511	.|-0.5389	.|10	.|0.54805	.|T	.|0.06	-16.6284|-16.6284	15.7804|15.7804	0.78255|0.78255	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|684;769;770;807	.|B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.|.;.;.;ANLN_HUMAN	X|T	160;10|807;770	.|ENSP00000265748:S807T;ENSP00000379380:S770T	.|ENSP00000265748:S807T	C|S	+|+	3|1	2|0	ANLN|ANLN	36428886|36428886	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.560000|2.560000	0.45896|0.45896	2.311000|2.311000	0.77944|0.77944	0.528000|0.528000	0.53228|0.53228	TGT|TCA		0.388	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685		30	153	0	0	0	0.003271	0	30	153				
POU6F2	11281	broad.mit.edu	37	7	39379247	39379247	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:39379247C>T	ENST00000403058.1	+	6	672	c.518C>T	c.(517-519)tCa>tTa	p.S173L	POU6F2_ENST00000518318.2_Missense_Mutation_p.S173L|POU6F2_ENST00000517348.1_3'UTR|POU6F2_ENST00000559001.1_Missense_Mutation_p.S165L	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	173	Gln-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S173L(1)		NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						GTAGCTACCTCATCCCTGAAC	0.567																																							uc003thb.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(517-519)TCA>TTA		POU class 6 homeobox 2 isoform 1							25.0	24.0	24.0					7																	39379247		2162	4248	6410	SO:0001583	missense	11281				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:39379247C>T	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.518C>T	7.37:g.39379247C>T	ENSP00000384004:p.Ser173Leu		Somatic				POU6F2_uc010kxo.2_Missense_Mutation_p.S165L	p.S173L	NM_007252	NP_009183	WXS	Illumina HiSeq	Unspecified	P78424	PO6F2_HUMAN			5	560	+			173			Gln-rich.		A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	c.518C>T	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639320	0.67244	.	.	ENSG00000106536	ENST00000403058;ENST00000518318	D;D	0.85861	-1.99;-2.04	4.81	4.81	0.61882	.	0.582807	0.15143	U	0.278182	D	0.87838	0.6278	L	0.40543	1.245	0.51012	D	0.999906	D;P	0.61697	0.99;0.9	P;P	0.57152	0.814;0.461	D	0.88363	0.2989	10	0.59425	D	0.04	.	17.858	0.88772	0.0:1.0:0.0:0.0	.	173;173	P78424-2;P78424	.;PO6F2_HUMAN	L	173	ENSP00000384004:S173L;ENSP00000430514:S173L	ENSP00000384004:S173L	S	+	2	0	POU6F2	39345772	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.152000	0.71812	2.200000	0.70718	0.557000	0.71058	TCA		0.567	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252		13	22	0	0	0	0.003163	0	13	22				
GLI3	2737	broad.mit.edu	37	7	42063147	42063147	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:42063147C>A	ENST00000395925.3	-	10	1501	c.1417G>T	c.(1417-1419)Gag>Tag	p.E473*	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	473					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E473*(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						ACTTCAGGCTCCTGTTTGCTT	0.547									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																														uc011kbh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						c.(1417-1419)GAG>TAG		GLI-Kruppel family member GLI3							170.0	129.0	143.0					7																	42063147		2203	4300	6503	SO:0001587	stop_gained	2737	Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome	Familial Cancer Database	;	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:42063147C>A		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1417G>T	7.37:g.42063147C>A	ENSP00000379258:p.Glu473*		Somatic				GLI3_uc011kbg.1_Nonsense_Mutation_p.E414*	p.E473*	NM_000168	NP_000159	WXS	Illumina HiSeq	Unspecified	P10071	GLI3_HUMAN			10	1508	-			473					A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Nonsense_Mutation	SNP	ENST00000395925.3	37	c.1417G>T	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	40	8.152704	0.98680	.	.	ENSG00000106571	ENST00000395925	.	.	.	5.81	5.81	0.92471	.	0.044377	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0912	0.97820	0.0:1.0:0.0:0.0	.	.	.	.	X	473	.	ENSP00000379258:E473X	E	-	1	0	GLI3	42029672	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.746000	0.94184	0.591000	0.81541	GAG		0.547	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		41	51	1	0	6.17242e-35	0.00361	9.44893e-35	41	51				
CDC14C	168448	broad.mit.edu	37	7	48965406	48965406	+	IGR	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:48965406C>T								AC004899.1 (74185 upstream) : AC010971.1 (304326 downstream)																							GAATCAAGACCAGCAAGAACC	0.458																																							uc010kyv.1		NA																	0					0						c.(1138-1140)CAG>TAG		SubName: Full=Putative uncharacterized protein MGC26484;																																				SO:0001628	intergenic_variant	168448							g.chr7:48965406C>T																													7.37:g.48965406C>T			Somatic					p.Q380*	NR_003595		WXS	Illumina HiSeq	Unspecified					1	1250	+									Nonsense_Mutation	SNP		37	c.1138C>T																																																																																				0	0.458									9	22	0	0	0	0.001855	0	9	22				
DDC	1644	broad.mit.edu	37	7	50563117	50563117	+	Splice_Site	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:50563117T>A	ENST00000444124.2	-	9	1077		c.e9-2		DDC_ENST00000380984.4_Splice_Site|DDC_ENST00000431062.1_Splice_Site|DDC_ENST00000357936.5_Splice_Site|DDC_ENST00000426377.1_Splice_Site	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)						catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)	p.?(2)		breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	ATCTGCAAACTGCCAAAGAAC	0.338																																							uc003tpf.3		NA																	2	Unknown(2)		lung(2)	ovary(2)	2						c.e9-1		dopa decarboxylase (aromatic L-amino acid	Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)						64.0	61.0	62.0					7																	50563117		2203	4300	6503	SO:0001630	splice_region_variant	1644				cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding	g.chr7:50563117T>A		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.877-2A>T	7.37:g.50563117T>A			Somatic				DDC_uc010kza.2_Splice_Site_p.F208_splice|DDC_uc003tpg.3_Splice_Site_p.F293_splice	p.F293_splice	NM_000790	NP_000781	WXS	Illumina HiSeq	Unspecified	P20711	DDC_HUMAN			9	963	-	Glioma(55;0.08)|all_neural(89;0.245)							C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Splice_Site	SNP	ENST00000444124.2	37	c.877_splice	CCDS5511.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449805	0.63290	.	.	ENSG00000132437	ENST00000357936;ENST00000431062;ENST00000426377;ENST00000444124;ENST00000430300;ENST00000380984	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3483	0.66682	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DDC	50530611	1.000000	0.71417	0.996000	0.52242	0.697000	0.40408	7.001000	0.76297	2.085000	0.62840	0.533000	0.62120	.		0.338	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1		Intron	12	37	0	0	0	0.00245	0	12	37				
Unknown	0	broad.mit.edu	37	7	63674397	63674397	+	IGR	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:63674397C>A								GUSBP6 (63298 upstream) : ZNF679 (14454 downstream)																							ACAGGTATGACTGTCTCTAAG	0.393																																							uc011kdn.1		NA																	0					0						c.(172-174)ACT>AAT		zinc finger protein 735																																				SO:0001628	intergenic_variant	730291				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:63674397C>A																													7.37:g.63674397C>A			Somatic					p.T58N	NM_001159524	NP_001152996	WXS	Illumina HiSeq	Unspecified	P0CB33	ZN735_HUMAN			3	173	+			58			KRAB.			Missense_Mutation	SNP		37	c.173C>A																																																																																				0	0.393									9	40	1	0	0.000274275	0.004482	0.000288418	9	40				
MAGI2	9863	broad.mit.edu	37	7	78131003	78131003	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:78131003G>T	ENST00000354212.4	-	5	1109	c.856C>A	c.(856-858)Cag>Aag	p.Q286K	MAGI2_ENST00000535697.1_Missense_Mutation_p.Q123K|MAGI2_ENST00000536571.1_Missense_Mutation_p.Q118K|MAGI2_ENST00000419488.1_Missense_Mutation_p.Q286K|MAGI2_ENST00000522391.1_Missense_Mutation_p.Q286K	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	286					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.Q286K(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TCATCCATCTGCTCCTTCAGC	0.507																																							uc003ugx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|lung(4)|breast(1)|skin(1)	11						c.(856-858)CAG>AAG		membrane associated guanylate kinase, WW and PDZ							278.0	218.0	238.0					7																	78131003		2203	4300	6503	SO:0001583	missense	9863					cell junction|synapse|synaptosome	phosphatase binding	g.chr7:78131003G>T	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.856C>A	7.37:g.78131003G>T	ENSP00000346151:p.Gln286Lys		Somatic				MAGI2_uc003ugy.2_Missense_Mutation_p.Q286K|MAGI2_uc011kgr.1_Missense_Mutation_p.Q118K|MAGI2_uc011kgs.1_Missense_Mutation_p.Q123K	p.Q286K	NM_012301	NP_036433	WXS	Illumina HiSeq	Unspecified	Q86UL8	MAGI2_HUMAN			5	1110	-		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)	286					A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	c.856C>A	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	G	4.341	0.062728	0.08388	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.11169	2.93;2.93;2.8;3.75;3.76	5.9	2.98	0.34508	Guanylate kinase/L-type calcium channel (1);	0.921727	0.08793	U	0.892861	T	0.04679	0.0127	N	0.03608	-0.345	0.24914	N	0.992025	B;B;B;B	0.13594	0.002;0.006;0.008;0.005	B;B;B;B	0.16722	0.016;0.008;0.015;0.007	T	0.33497	-0.9866	10	0.05959	T	0.93	.	10.1683	0.42893	0.0:0.5028:0.3812:0.1159	.	123;118;286;286	F5GWH1;F5GWK7;Q86UL8-2;Q86UL8	.;.;.;MAGI2_HUMAN	K	286;286;286;286;118;123	ENSP00000405766:Q286K;ENSP00000346151:Q286K;ENSP00000428389:Q286K;ENSP00000441584:Q118K;ENSP00000441603:Q123K	ENSP00000346151:Q286K	Q	-	1	0	MAGI2	77968939	0.998000	0.40836	0.953000	0.39169	0.983000	0.72400	3.598000	0.54038	0.796000	0.33947	0.655000	0.94253	CAG		0.507	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301		25	101	1	0	1.88708e-17	0.008361	2.44337e-17	25	101				
CACNA2D1	781	broad.mit.edu	37	7	81964549	81964549	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:81964549C>A	ENST00000356253.5	-	3	451	c.196G>T	c.(196-198)Gat>Tat	p.D66Y	CACNA2D1_ENST00000423588.1_Missense_Mutation_p.D66Y|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.D66Y			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	66					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.D66Y(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GTATACAAATCTTGATATTTC	0.353																																							uc003uhr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(1)	6						c.(196-198)GAT>TAT		calcium channel, voltage-dependent, alpha	Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)						128.0	133.0	131.0					7																	81964549		2203	4300	6503	SO:0001583	missense	781					voltage-gated calcium channel complex	metal ion binding	g.chr7:81964549C>A	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.196G>T	7.37:g.81964549C>A	ENSP00000348589:p.Asp66Tyr		Somatic					p.D66Y	NM_000722	NP_000713	WXS	Illumina HiSeq	Unspecified	P54289	CA2D1_HUMAN			3	452	-			66			Extracellular (Potential).		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37	c.196G>T		.	.	.	.	.	.	.	.	.	.	C	13.40	2.225964	0.39300	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000423588	T;T;T	0.24350	3.19;3.19;1.86	5.9	5.9	0.94986	.	0.068246	0.56097	D	0.000031	T	0.22126	0.0533	L	0.36672	1.1	0.80722	D	1	P	0.36909	0.573	B	0.32211	0.142	T	0.02184	-1.1199	10	0.66056	D	0.02	-16.0704	15.7248	0.77747	0.0:0.8642:0.1358:0.0	.	66	P54289-2	.	Y	66	ENSP00000349320:D66Y;ENSP00000348589:D66Y;ENSP00000405395:D66Y	ENSP00000284088:D66Y	D	-	1	0	CACNA2D1	81802485	0.993000	0.37304	1.000000	0.80357	0.958000	0.62258	0.914000	0.28624	2.788000	0.95919	0.650000	0.86243	GAT		0.353	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				16	97	1	0	0.000229342	0.001882	0.000242508	16	97				
PCLO	27445	broad.mit.edu	37	7	82585203	82585203	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:82585203G>T	ENST00000333891.9	-	5	5403	c.5066C>A	c.(5065-5067)aCa>aAa	p.T1689K	PCLO_ENST00000423517.2_Missense_Mutation_p.T1689K	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.T1689K(2)|p.T1689fs*6(1)|p.T1620fs*6(1)|p.T1620K(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATACAAACTTGTTTTTTTCTG	0.428																																							uc003uhx.2		NA																	5	Substitution - Missense(3)|Insertion - Frameshift(2)		lung(3)|haematopoietic_and_lymphoid_tissue(2)	ovary(7)	7						c.(5065-5067)ACA>AAA		piccolo isoform 1							88.0	81.0	84.0					7																	82585203		1856	4091	5947	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82585203G>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5066C>A	7.37:g.82585203G>T	ENSP00000334319:p.Thr1689Lys		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.T1689K	p.T1689K	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			5	5355	-			1620						Missense_Mutation	SNP	ENST00000333891.9	37	c.5066C>A	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	7.134	0.580508	0.13686	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15834	2.39;2.39	5.33	5.33	0.75918	.	.	.	.	.	T	0.13628	0.0330	N	0.19112	0.55	0.46458	D	0.999059	B;B	0.25904	0.137;0.137	B;B	0.25140	0.058;0.058	T	0.06058	-1.0848	9	0.87932	D	0	.	14.9545	0.71101	0.0:0.1849:0.8151:0.0	.	1689;1689	Q9Y6V0-5;Q9Y6V0-6	.;.	K	1620;1689;1689	ENSP00000334319:T1689K;ENSP00000388393:T1689K	ENSP00000334319:T1689K	T	-	2	0	PCLO	82423139	0.482000	0.25948	0.689000	0.30133	0.963000	0.63663	2.931000	0.48932	2.509000	0.84616	0.650000	0.86243	ACA		0.428	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		15	22	1	0	2.5808e-16	0.006122	3.28204e-16	15	22				
SAMD9	54809	broad.mit.edu	37	7	92734038	92734038	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:92734038C>A	ENST00000379958.2	-	3	1642	c.1373G>T	c.(1372-1374)aGc>aTc	p.S458I		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	458						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.S458I(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TGCTACTCGGCTTTCTTTGTA	0.383																																							uc003umf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(1372-1374)AGC>ATC		sterile alpha motif domain containing 9							56.0	52.0	54.0					7																	92734038		2203	4299	6502	SO:0001583	missense	54809					cytoplasm		g.chr7:92734038C>A	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.1373G>T	7.37:g.92734038C>A	ENSP00000369292:p.Ser458Ile		Somatic				SAMD9_uc003umg.2_Missense_Mutation_p.S458I	p.S458I	NM_017654	NP_060124	WXS	Illumina HiSeq	Unspecified	Q5K651	SAMD9_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		3	1629	-	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		458					A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	c.1373G>T	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	9.058	0.993862	0.19043	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.13420	2.59;2.59	4.38	2.38	0.29361	.	0.536026	0.17678	N	0.165739	T	0.11067	0.0270	M	0.63428	1.95	0.24354	N	0.994904	P	0.37015	0.578	B	0.28305	0.088	T	0.18871	-1.0323	10	0.46703	T	0.11	-3.7753	5.0982	0.14745	0.0:0.4235:0.408:0.1685	.	458	Q5K651	SAMD9_HUMAN	I	458	ENSP00000369292:S458I;ENSP00000414529:S458I	ENSP00000369292:S458I	S	-	2	0	SAMD9	92571974	0.000000	0.05858	1.000000	0.80357	0.434000	0.31775	0.807000	0.27140	1.171000	0.42768	0.603000	0.83216	AGC		0.383	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654		9	42	1	0	1.08611e-07	0.000978	1.2208e-07	9	42				
PPP1R9A	55607	broad.mit.edu	37	7	94540239	94540239	+	Missense_Mutation	SNP	C	C	T	rs140508899		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:94540239C>T	ENST00000433881.1	+	2	1346	c.814C>T	c.(814-816)Cac>Tac	p.H272Y	PPP1R9A_ENST00000424654.1_Missense_Mutation_p.H272Y|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.H272Y|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.H272Y|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.H272Y|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.H272Y			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	272					actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.H272Y(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			AGAGGATGCTCACAAGAGTAA	0.458										HNSCC(28;0.073)																													uc003unp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(814-816)CAC>TAC		protein phosphatase 1, regulatory (inhibitor)		C	TYR/HIS,TYR/HIS,TYR/HIS,TYR/HIS,TYR/HIS	0,4406		0,0,2203	68.0	57.0	61.0		814,814,814,814,814	2.8	1.0	7	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	PPP1R9A	NM_001166160.1,NM_001166161.1,NM_001166162.1,NM_001166163.1,NM_017650.2	83,83,83,83,83	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	272/1375,272/1297,272/1254,272/1091,272/1099	94540239	1,13005	2203	4300	6503	SO:0001583	missense	55607					cell junction|synapse|synaptosome	actin binding	g.chr7:94540239C>T	AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.814C>T	7.37:g.94540239C>T	ENSP00000398870:p.His272Tyr	HNSCC(28;0.073)	Somatic				PPP1R9A_uc010lfj.2_Missense_Mutation_p.H272Y|PPP1R9A_uc011kif.1_Missense_Mutation_p.H272Y|PPP1R9A_uc003unq.2_Missense_Mutation_p.H272Y|PPP1R9A_uc011kig.1_Missense_Mutation_p.H272Y	p.H272Y	NM_017650	NP_060120	WXS	Illumina HiSeq	Unspecified	Q9ULJ8	NEB1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		2	1096	+	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		272					A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	37	c.814C>T	CCDS34683.1	.	.	.	.	.	.	.	.	.	.	C	3.530	-0.095859	0.07010	0.0	1.16E-4	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	4.69	2.82	0.32997	.	0.725793	0.14137	N	0.338951	D	0.84615	0.5511	N	0.08118	0	0.20196	N	0.999927	B;B;B;B;B	0.17465	0.022;0.014;0.014;0.001;0.0	B;B;B;B;B	0.23852	0.016;0.026;0.049;0.0;0.0	T	0.70171	-0.4945	9	.	.	.	.	12.1987	0.54313	0.118:0.5372:0.3449:0.0	.	272;272;272;272;272	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	Y	272	ENSP00000405514:H272Y;ENSP00000344524:H272Y;ENSP00000411342:H272Y;ENSP00000398870:H272Y;ENSP00000289495:H272Y;ENSP00000402893:H272Y	.	H	+	1	0	PPP1R9A	94378175	0.993000	0.37304	1.000000	0.80357	0.006000	0.05464	0.651000	0.24873	0.851000	0.35264	0.585000	0.79938	CAC		0.458	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160		32	38	0	0	0	0.009718	0	32	38				
MUC17	140453	broad.mit.edu	37	7	100682038	100682038	+	Silent	SNP	A	A	G	rs142442389		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:100682038A>G	ENST00000306151.4	+	3	7405	c.7341A>G	c.(7339-7341)ccA>ccG	p.P2447P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2447	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.P2447P(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCAGCATACCAACCTCACCTC	0.537													A|||	1	0.000199681	0.0	0.0	5008	,	,		26488	0.0		0.001	False		,,,				2504	0.0						uc003uxp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(7339-7341)CCA>CCG		mucin 17 precursor		A		8,4398	14.3+/-33.2	0,8,2195	358.0	353.0	355.0		7341	-2.9	0.0	7	dbSNP_134	355	57,8543	35.9+/-90.5	1,55,4244	no	coding-synonymous	MUC17	NM_001040105.1		1,63,6439	GG,GA,AA		0.6628,0.1816,0.4998		2447/4494	100682038	65,12941	2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100682038A>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7341A>G	7.37:g.100682038A>G			Somatic				MUC17_uc010lho.1_RNA	p.P2447P	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	7394	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2447			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|39.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.7341A>G	CCDS34711.1																																																																																				0.537	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		14	505	0	0	0	0.003163	0	14	505				
PIK3CG	5294	broad.mit.edu	37	7	106509787	106509787	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:106509787G>A	ENST00000359195.3	+	2	2091	c.1781G>A	c.(1780-1782)aGt>aAt	p.S594N	PIK3CG_ENST00000440650.2_Missense_Mutation_p.S594N|PIK3CG_ENST00000496166.1_Missense_Mutation_p.S594N	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	594	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S594N(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						AAGCTATTTAGTTCAGTGAAA	0.428																																							uc003vdv.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						c.(1780-1782)AGT>AAT		phosphoinositide-3-kinase, catalytic, gamma							110.0	105.0	106.0					7																	106509787		2203	4300	6503	SO:0001583	missense	5294				G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding	g.chr7:106509787G>A		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1781G>A	7.37:g.106509787G>A	ENSP00000352121:p.Ser594Asn		Somatic				PIK3CG_uc003vdu.2_Missense_Mutation_p.S594N|PIK3CG_uc003vdw.2_Missense_Mutation_p.S594N	p.S594N	NM_002649	NP_002640	WXS	Illumina HiSeq	Unspecified	P48736	PK3CG_HUMAN			2	1866	+			594					A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	37	c.1781G>A	CCDS5739.1	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642629	0.47153	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.63580	-0.05;-0.05;-0.05	5.54	5.54	0.83059	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.135075	0.85682	D	0.000000	T	0.66307	0.2776	M	0.62266	1.93	0.53688	D	0.999974	B	0.32467	0.372	B	0.39771	0.309	T	0.61322	-0.7086	10	0.22109	T	0.4	-26.7816	19.5024	0.95100	0.0:0.0:1.0:0.0	.	594	P48736	PK3CG_HUMAN	N	594	ENSP00000392258:S594N;ENSP00000419260:S594N;ENSP00000352121:S594N	ENSP00000352121:S594N	S	+	2	0	PIK3CG	106297023	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.523000	0.81856	2.607000	0.88179	0.655000	0.94253	AGT		0.428	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1			32	80	0	0	0	0.005524	0	32	80				
PPP1R3A	5506	broad.mit.edu	37	7	113518041	113518041	+	Nonsense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:113518041G>A	ENST00000284601.3	-	4	3174	c.3106C>T	c.(3106-3108)Caa>Taa	p.Q1036*		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1036					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.Q1036*(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TATAGTGATTGCCCAGAGCTT	0.398																																							uc010ljy.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						c.(3106-3108)CAA>TAA		protein phosphatase 1, regulatory (inhibitor)							201.0	196.0	198.0					7																	113518041		2203	4299	6502	SO:0001587	stop_gained	5506				glycogen metabolic process	integral to membrane		g.chr7:113518041G>A	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3106C>T	7.37:g.113518041G>A	ENSP00000284601:p.Gln1036*		Somatic					p.Q1036*	NM_002711	NP_002702	WXS	Illumina HiSeq	Unspecified	Q16821	PPR3A_HUMAN			4	3137	-			1036					A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Nonsense_Mutation	SNP	ENST00000284601.3	37	c.3106C>T	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.664432	0.67700	.	.	ENSG00000154415	ENST00000284601	.	.	.	5.49	4.61	0.57282	.	0.239625	0.29653	N	0.011560	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-0.8981	11.7266	0.51712	0.0:0.0:0.6602:0.3398	.	.	.	.	X	1036	.	ENSP00000284601:Q1036X	Q	-	1	0	PPP1R3A	113305277	0.665000	0.27466	0.433000	0.26760	0.072000	0.16883	1.836000	0.39191	1.302000	0.44855	0.650000	0.86243	CAA		0.398	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		215	310	0	0	0	0.00361	0	215	310				
HYAL4	23553	broad.mit.edu	37	7	123509169	123509169	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:123509169G>T	ENST00000223026.4	+	3	1480	c.842G>T	c.(841-843)cGg>cTg	p.R281L	HYAL4_ENST00000476325.1_Missense_Mutation_p.R281L	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	281					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)	p.R281L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						TCCAAATTTCGGGTGCATGAA	0.443																																							uc003vlc.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(841-843)CGG>CTG		hyaluronoglucosaminidase 4							66.0	63.0	64.0					7																	123509169		2203	4300	6503	SO:0001583	missense	23553				fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity	g.chr7:123509169G>T	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.842G>T	7.37:g.123509169G>T	ENSP00000223026:p.Arg281Leu		Somatic				HYAL4_uc011knz.1_Missense_Mutation_p.R281L	p.R281L	NM_012269	NP_036401	WXS	Illumina HiSeq	Unspecified	Q2M3T9	HYAL4_HUMAN			3	1480	+			281			Extracellular (Potential).		D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	ENST00000223026.4	37	c.842G>T	CCDS5789.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.831781	0.50845	.	.	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.42513	0.97;0.97	5.89	4.98	0.66077	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.67979	0.2951	M	0.86740	2.835	0.47819	D	0.999521	D;D	0.76494	0.999;0.999	D;D	0.73380	0.966;0.98	T	0.73736	-0.3889	9	.	.	.	-8.2362	14.1867	0.65609	0.0742:0.0:0.9258:0.0	.	281;281	F8WDH9;Q2M3T9	.;HYAL4_HUMAN	L	281	ENSP00000223026:R281L;ENSP00000417186:R281L	.	R	+	2	0	HYAL4	123296405	1.000000	0.71417	0.178000	0.23040	0.006000	0.05464	6.756000	0.74919	1.409000	0.46915	0.655000	0.94253	CGG		0.443	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348545.1	NM_012269		19	67	1	0	6.21321e-17	0.00278	7.97246e-17	19	67				
GRM8	2918	broad.mit.edu	37	7	126173844	126173844	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:126173844C>T	ENST00000339582.2	-	9	2400	c.1592G>A	c.(1591-1593)gGg>gAg	p.G531E	GRM8_ENST00000444921.2_Missense_Mutation_p.G531E|GRM8_ENST00000480995.1_Intron|GRM8_ENST00000358373.3_Missense_Mutation_p.G531E			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	531					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.G531E(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GCAAGGGACCCCTTTCACCGT	0.552										HNSCC(24;0.065)																													uc003vlr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.(1591-1593)GGG>GAG		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)						95.0	93.0	94.0					7																	126173844		2203	4300	6503	SO:0001583	missense	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126173844C>T		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1592G>A	7.37:g.126173844C>T	ENSP00000344173:p.Gly531Glu	HNSCC(24;0.065)	Somatic				GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.G531E|GRM8_uc010lkz.1_RNA	p.G531E	NM_000845	NP_000836	WXS	Illumina HiSeq	Unspecified	O00222	GRM8_HUMAN			8	1903	-		Prostate(267;0.186)	531			Extracellular (Potential).		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	c.1592G>A	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363674	0.82353	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.90955	-2.76;-2.76;-2.76	5.8	5.8	0.92144	GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.95730	0.8611	M	0.82193	2.58	0.80722	D	1	D;P	0.76494	0.999;0.943	D;P	0.74023	0.982;0.823	D	0.95784	0.8819	10	0.87932	D	0	.	19.0428	0.93008	0.0:1.0:0.0:0.0	.	531;531	O00222-2;O00222	.;GRM8_HUMAN	E	531	ENSP00000344173:G531E;ENSP00000409790:G531E;ENSP00000351142:G531E	ENSP00000344173:G531E	G	-	2	0	GRM8	125961080	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.811000	0.86092	2.758000	0.94735	0.643000	0.83706	GGG		0.552	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			16	86	0	0	0	0.001882	0	16	86				
KEL	3792	broad.mit.edu	37	7	142639572	142639572	+	Silent	SNP	C	C	A	rs140592001	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:142639572C>A	ENST00000355265.2	-	18	2460	c.1986G>T	c.(1984-1986)ctG>ctT	p.L662L		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	662					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.L662L(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CCAGGCTGGGCAGGACAGTCT	0.587																																							uc003wcb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1984-1986)CTG>CTT		Kell blood group, metallo-endopeptidase							59.0	41.0	47.0					7																	142639572		2203	4300	6503	SO:0001819	synonymous_variant	3792				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr7:142639572C>A	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1986G>T	7.37:g.142639572C>A			Somatic					p.L662L	NM_000420	NP_000411	WXS	Illumina HiSeq	Unspecified	P23276	KELL_HUMAN			18	2196	-	Melanoma(164;0.059)		662			Extracellular (Potential).		B2RBV4|Q96RS8|Q99885	Silent	SNP	ENST00000355265.2	37	c.1986G>T	CCDS34766.1																																																																																				0.587	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		12	35	1	0	9.16793e-09	0.00499	1.04908e-08	12	35				
OR2F2	135948	broad.mit.edu	37	7	143633237	143633237	+	Silent	SNP	A	A	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:143633237A>G	ENST00000408955.2	+	1	979	c.912A>G	c.(910-912)ctA>ctG	p.L304L		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L304L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					GGCATAAACTATTAGAGAAAT	0.418																																							uc011ktv.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(910-912)CTA>CTG		olfactory receptor, family 2, subfamily F,							47.0	47.0	47.0					7																	143633237		2006	4211	6217	SO:0001819	synonymous_variant	135948				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143633237A>G		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.912A>G	7.37:g.143633237A>G			Somatic					p.L304L	NM_001004685	NP_001004685	WXS	Illumina HiSeq	Unspecified	O95006	OR2F2_HUMAN			1	912	+	Melanoma(164;0.0903)		304			Cytoplasmic (Potential).		A4D2G0|Q6IFP8	Silent	SNP	ENST00000408955.2	37	c.912A>G	CCDS43666.1																																																																																				0.418	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1			16	63	0	0	0	0.001882	0	16	63				
ZNF398	57541	broad.mit.edu	37	7	148876178	148876178	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:148876178G>T	ENST00000475153.1	+	6	1481	c.1214G>T	c.(1213-1215)aGg>aTg	p.R405M	ZNF398_ENST00000491174.1_Missense_Mutation_p.R234M|ZNF398_ENST00000335901.4_Missense_Mutation_p.R234M|ZNF398_ENST00000540950.1_Missense_Mutation_p.R410M|ZNF398_ENST00000426851.2_Missense_Mutation_p.R234M|ZNF398_ENST00000420008.2_Missense_Mutation_p.R234M|ZNF398_ENST00000483892.1_Missense_Mutation_p.R234M			Q8TD17	ZN398_HUMAN	zinc finger protein 398	405					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R405M(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			CACTGTGCCAGGACTTTTACT	0.582																																							uc003wfl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1213-1215)AGG>ATG		zinc finger 398 isoform a							155.0	145.0	148.0					7																	148876178		2203	4300	6503	SO:0001583	missense	57541				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:148876178G>T	AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.1214G>T	7.37:g.148876178G>T	ENSP00000420418:p.Arg405Met		Somatic				ZNF398_uc011kul.1_Missense_Mutation_p.R234M|ZNF398_uc011kum.1_Missense_Mutation_p.R410M	p.R405M	NM_170686	NP_733787	WXS	Illumina HiSeq	Unspecified	Q8TD17	ZN398_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00143)		6	1489	+	Melanoma(164;0.15)		405			C2H2-type 3.		A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Missense_Mutation	SNP	ENST00000475153.1	37	c.1214G>T	CCDS5894.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.682860	0.68157	.	.	ENSG00000197024	ENST00000426851;ENST00000420008;ENST00000475153;ENST00000483892;ENST00000491174;ENST00000540950;ENST00000335901	T;T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38;2.38	4.98	4.02	0.46733	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.118903	0.37857	N	0.001909	T	0.23649	0.0572	L	0.52905	1.665	0.32879	D	0.510254	D;D	0.58970	0.976;0.984	P;P	0.53593	0.628;0.73	T	0.24225	-1.0166	10	0.72032	D	0.01	-23.0056	5.9188	0.19070	0.2044:0.0:0.7956:0.0	.	410;405	B4DXA9;Q8TD17	.;ZN398_HUMAN	M	234;234;405;234;234;410;234	ENSP00000389972:R234M;ENSP00000416751:R234M;ENSP00000420418:R405M;ENSP00000418564:R234M;ENSP00000419391:R234M;ENSP00000439340:R410M;ENSP00000338984:R234M	ENSP00000338984:R234M	R	+	2	0	ZNF398	148507111	0.029000	0.19370	1.000000	0.80357	0.998000	0.95712	1.622000	0.36997	2.591000	0.87537	0.650000	0.86243	AGG		0.582	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352722.2			59	54	1	0	4.83248e-46	0.00361	7.83906e-46	59	54				
KMT2C	58508	broad.mit.edu	37	7	151919678	151919678	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:151919678G>T	ENST00000262189.6	-	21	3631	c.3413C>A	c.(3412-3414)cCc>cAc	p.P1138H	KMT2C_ENST00000355193.2_Missense_Mutation_p.P1138H	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1138					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P1138H(2)									AGGCATATAGGGTCTGCACAT	0.398																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(3412-3414)CCC>CAC		myeloid/lymphoid or mixed-lineage leukemia 3							57.0	45.0	49.0					7																	151919678		2203	4299	6502	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151919678G>T	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3413C>A	7.37:g.151919678G>T	ENSP00000262189:p.Pro1138His		Somatic				MLL3_uc003wkz.2_Missense_Mutation_p.P199H	p.P1138H	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	21	3632	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	1138			PHD-type 6.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.3413C>A	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.149793	0.57151	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.64260	-0.09;-0.09	5.73	5.73	0.89815	Zinc finger, PHD-finger (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.46145	D	0.000303	T	0.78432	0.4282	M	0.63843	1.955	0.80722	D	1	D;D	0.76494	0.999;0.999	P;D	0.72075	0.894;0.976	T	0.79264	-0.1875	10	0.87932	D	0	.	19.8994	0.96980	0.0:0.0:1.0:0.0	.	1138;199	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	H	1138	ENSP00000262189:P1138H;ENSP00000347325:P1138H	ENSP00000262189:P1138H	P	-	2	0	MLL3	151550611	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.676000	0.68131	2.703000	0.92315	0.650000	0.86243	CCC		0.398	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			16	62	1	0	3.41278e-10	0.00499	3.99324e-10	16	62				
ESYT2	57488	broad.mit.edu	37	7	158529746	158529746	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:158529746C>A	ENST00000251527.5	-	19	2538	c.2473G>T	c.(2473-2475)Gat>Tat	p.D825Y	ESYT2_ENST00000435514.2_Missense_Mutation_p.D260Y	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	853	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)	p.D825Y(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						TACCTTTGATCAAACACTGGA	0.463																																							uc003wob.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|kidney(1)	3						c.(2473-2475)GAT>TAT		family with sequence similarity 62 (C2 domain							236.0	216.0	223.0					7																	158529746		2203	4300	6503	SO:0001583	missense	57488					integral to membrane|plasma membrane		g.chr7:158529746C>A	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.2473G>T	7.37:g.158529746C>A	ENSP00000251527:p.Asp825Tyr		Somatic				ESYT2_uc003wny.1_RNA|ESYT2_uc003wnz.1_Missense_Mutation_p.D264Y|ESYT2_uc003woa.1_Missense_Mutation_p.D402Y	p.D825Y	NM_020728	NP_065779	WXS	Illumina HiSeq	Unspecified	A0FGR8	ESYT2_HUMAN			19	2539	-			853			C2 3.		A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	ENST00000251527.5	37	c.2473G>T	CCDS34791.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703425	0.68501	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000435514	T;T;T	0.09255	3.0;3.0;3.0	4.83	4.83	0.62350	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.45935	0.1367	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.63278	-0.6673	10	0.87932	D	0	-20.5972	16.9428	0.86222	0.0:1.0:0.0:0.0	.	825;853	A0FGR8-2;A0FGR8	.;ESYT2_HUMAN	Y	825;874;816;260	ENSP00000251527:D825Y;ENSP00000275418:D816Y;ENSP00000411488:D260Y	ENSP00000251527:D825Y	D	-	1	0	ESYT2	158222507	1.000000	0.71417	1.000000	0.80357	0.342000	0.28953	7.660000	0.83776	2.220000	0.72140	0.655000	0.94253	GAT		0.463	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728		65	315	1	0	3.25985e-27	0.00361	4.64183e-27	65	315				
SARAF	51669	broad.mit.edu	37	8	29927564	29927564	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:29927564C>T	ENST00000256255.6	-	3	551	c.294G>A	c.(292-294)aaG>aaA	p.K98K	TMEM66_ENST00000545648.1_5'UTR|TMEM66_ENST00000536273.1_5'UTR	NM_016127.4	NP_057211.4	Q96BY9	SARAF_HUMAN		98					calcium ion transport (GO:0006816)|regulation of store-operated calcium entry (GO:2001256)	integral component of endoplasmic reticulum membrane (GO:0030176)		p.K98K(1)		endometrium(2)|large_intestine(1)|lung(11)	14				KIRC - Kidney renal clear cell carcinoma(542;0.0993)|Kidney(114;0.119)		CTAAGTCCGTCTTACATTCCC	0.398																																							uc003xhs.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(292-294)AAG>AAA		transmembrane protein 66 precursor							131.0	143.0	139.0					8																	29927564		2201	4299	6500	SO:0001819	synonymous_variant	51669					integral to membrane		g.chr8:29927564C>T																												ENST00000256255.6:c.294G>A	8.37:g.29927564C>T			Somatic				TMEM66_uc003xht.2_Silent_p.K98K|TMEM66_uc003xhu.2_Silent_p.K62K|TMEM66_uc003xhv.2_5'UTR	p.K98K	NM_016127	NP_057211	WXS	Illumina HiSeq	Unspecified	Q96BY9	TMM66_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0993)|Kidney(114;0.119)	3	478	-			98					B3KQQ4|B7Z9J1|D3DSU7|H9MHJ8|H9MHJ9|Q53HE8|Q9UNZ3|Q9Y683	Silent	SNP	ENST00000256255.6	37	c.294G>A	CCDS6074.1	.	.	.	.	.	.	.	.	.	.	C	3.682	-0.065372	0.07273	.	.	ENSG00000133872	ENST00000521265	.	.	.	5.61	2.43	0.29744	.	.	.	.	.	T	0.55784	0.1942	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49457	-0.8938	4	.	.	.	-23.7004	7.7831	0.29077	0.0:0.6403:0.0:0.3597	.	.	.	.	K	98	.	.	R	-	2	0	TMEM66	30047106	1.000000	0.71417	0.995000	0.50966	0.523000	0.34469	0.796000	0.26986	0.757000	0.33036	-0.237000	0.12165	AGA		0.398	TMEM66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257254.4			11	163	0	0	0	0.000978	0	11	163				
ADAM32	203102	broad.mit.edu	37	8	39027483	39027483	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:39027483G>T	ENST00000379907.4	+	10	1009	c.882G>T	c.(880-882)atG>atT	p.M294I	ADAM32_ENST00000437682.2_Missense_Mutation_p.M301I|ADAM32_ENST00000519315.1_Missense_Mutation_p.M294I	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	294	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.M293I(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			CTGGAACAATGTGTATTACTC	0.244																																							uc003xmt.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|kidney(1)	3						c.(880-882)ATG>ATT		a disintegrin and metalloprotease domain 32							148.0	139.0	142.0					8																	39027483		1813	4077	5890	SO:0001583	missense	203102				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr8:39027483G>T	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.882G>T	8.37:g.39027483G>T	ENSP00000369238:p.Met294Ile		Somatic				ADAM32_uc011lch.1_Missense_Mutation_p.M301I|ADAM32_uc003xmu.3_Missense_Mutation_p.M294I	p.M294I	NM_145004	NP_659441	WXS	Illumina HiSeq	Unspecified	Q8TC27	ADA32_HUMAN	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)		10	1127	+		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	294			Peptidase M12B.|Extracellular (Potential).		Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	37	c.882G>T	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	G	7.462	0.644877	0.14451	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907	T;T;T	0.63255	-0.03;-0.03;-0.03	5.81	1.94	0.25998	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.429211	0.17302	N	0.179238	T	0.39462	0.1079	N	0.13371	0.34	0.28229	N	0.926205	B;B;B	0.20261	0.043;0.007;0.015	B;B;B	0.31101	0.086;0.017;0.124	T	0.23762	-1.0179	10	0.25751	T	0.34	.	2.4395	0.04490	0.1645:0.1501:0.5299:0.1555	.	301;294;294	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	I	301;294;294	ENSP00000405978:M301I;ENSP00000429422:M294I;ENSP00000369238:M294I	ENSP00000369238:M294I	M	+	3	0	ADAM32	39146640	1.000000	0.71417	0.790000	0.31976	0.380000	0.30137	0.754000	0.26390	0.071000	0.16664	0.650000	0.86243	ATG		0.244	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004		64	38	1	0	1.11883e-47	0.00361	1.83052e-47	64	38				
ANK1	286	broad.mit.edu	37	8	41552150	41552150	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:41552150G>C	ENST00000347528.4	-	28	3370	c.3287C>G	c.(3286-3288)cCg>cGg	p.P1096R	ANK1_ENST00000352337.4_Missense_Mutation_p.P1096R|ANK1_ENST00000289734.7_Missense_Mutation_p.P1096R|ANK1_ENST00000396945.1_Missense_Mutation_p.P1096R|ANK1_ENST00000265709.8_Missense_Mutation_p.P1137R|ANK1_ENST00000379758.2_Missense_Mutation_p.P1096R|ANK1_ENST00000396942.1_Missense_Mutation_p.P1096R	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1096	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.P1096L(1)|p.P1137L(1)|p.P1137R(1)|p.P1096R(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GGCATTCTCCGGGAACGTTGC	0.632																																							uc003xok.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9						c.(3286-3288)CCG>CGG		ankyrin 1 isoform 1							76.0	69.0	72.0					8																	41552150		2203	4300	6503	SO:0001583	missense	286				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	g.chr8:41552150G>C	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3287C>G	8.37:g.41552150G>C	ENSP00000339620:p.Pro1096Arg		Somatic				NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.P412R|ANK1_uc003xoi.2_Missense_Mutation_p.P1096R|ANK1_uc003xoj.2_Missense_Mutation_p.P1096R|ANK1_uc003xol.2_Missense_Mutation_p.P1096R|ANK1_uc003xom.2_Missense_Mutation_p.P1137R	p.P1096R	NM_020476	NP_065209	WXS	Illumina HiSeq	Unspecified	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)		28	3371	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	1096					A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	c.3287C>G	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350869	0.82132	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.63189	0.2490	M	0.87180	2.865	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.978;1.0;1.0	T	0.70706	-0.4798	10	0.87932	D	0	.	18.7799	0.91928	0.0:0.0:1.0:0.0	.	1137;1096;1096;1096;1096;412	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.;.;ANK1_HUMAN;.;.;.	R	1096;1096;1096;1096;1096;1096;1137;1096	ENSP00000339620:P1096R;ENSP00000289734:P1096R;ENSP00000369082:P1096R;ENSP00000380149:P1096R;ENSP00000380147:P1096R;ENSP00000309131:P1096R;ENSP00000265709:P1137R	ENSP00000265709:P1137R	P	-	2	0	ANK1	41671307	1.000000	0.71417	0.913000	0.36048	0.679000	0.39708	9.813000	0.99286	2.495000	0.84180	0.462000	0.41574	CCG		0.632	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		7	4	0	0	0	0.008291	0	7	4				
PRKDC	5591	broad.mit.edu	37	8	48855770	48855770	+	Splice_Site	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:48855770T>A	ENST00000314191.2	-	10	1021	c.965A>T	c.(964-966)cAg>cTg	p.Q322L	PRKDC_ENST00000338368.3_Splice_Site_p.Q322L|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	322					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.Q322L(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TTGTGGTACCTGTTTCAGAAA	0.353								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	Esophageal Squamous(79;1091 1253 12329 31680 40677)	uc003xqi.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34						c.(964-966)CAG>CTG	NHEJ	protein kinase, DNA-activated, catalytic							90.0	88.0	89.0					8																	48855770		1855	4097	5952	SO:0001630	splice_region_variant	5591				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding	g.chr8:48855770T>A		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.966+1A>T	8.37:g.48855770T>A			Somatic				PRKDC_uc003xqj.2_Missense_Mutation_p.Q322L|PRKDC_uc011ldh.1_Missense_Mutation_p.Q322L	p.Q322L	NM_006904	NP_008835	WXS	Illumina HiSeq	Unspecified	P78527	PRKDC_HUMAN			10	1022	-		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)	322			HEAT 1.		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37	c.965A>T		.	.	.	.	.	.	.	.	.	.	T	25.9	4.682518	0.88542	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.44083	0.93;0.93	5.35	5.35	0.76521	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64843	0.2635	.	.	.	0.80722	D	1	D;D;P	0.61697	0.99;0.983;0.77	D;P;B	0.66847	0.947;0.791;0.405	T	0.70117	-0.4960	9	0.87932	D	0	.	15.3481	0.74359	0.0:0.0:0.0:1.0	.	322;322;322	P78527-2;E7EUY0;P78527	.;.;PRKDC_HUMAN	L	322	ENSP00000313420:Q322L;ENSP00000345182:Q322L	ENSP00000313420:Q322L	Q	-	2	0	PRKDC	49018323	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.517000	0.81783	2.033000	0.60031	0.533000	0.62120	CAG		0.353	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	Missense_Mutation	22	8	0	0	0	0.009535	0	22	8				
PXDNL	137902	broad.mit.edu	37	8	52370158	52370158	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:52370158G>T	ENST00000356297.4	-	9	982	c.882C>A	c.(880-882)aaC>aaA	p.N294K	PXDNL_ENST00000543296.1_Missense_Mutation_p.N294K	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	294	Ig-like C2-type 1.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.N294K(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				ACTCTCTGGTGTTTCGGATCA	0.443																																							uc003xqu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(880-882)AAC>AAA		peroxidasin homolog-like precursor							176.0	173.0	174.0					8																	52370158		1971	4163	6134	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52370158G>T		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.882C>A	8.37:g.52370158G>T	ENSP00000348645:p.Asn294Lys		Somatic					p.N294K	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			9	983	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	294			Ig-like C2-type 1.		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.882C>A	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.574018	0.28092	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.43294	0.95;0.95	3.71	1.84	0.25277	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.35566	0.0936	L	0.55743	1.74	0.32097	N	0.591073	P	0.41188	0.741	B	0.39971	0.315	T	0.41179	-0.9523	9	0.42905	T	0.14	.	6.349	0.21365	0.248:0.0:0.752:0.0	.	294	A1KZ92	PXDNL_HUMAN	K	294	ENSP00000348645:N294K;ENSP00000444865:N294K	ENSP00000348645:N294K	N	-	3	2	PXDNL	52532711	1.000000	0.71417	0.006000	0.13384	0.592000	0.36648	2.094000	0.41719	0.172000	0.19760	0.555000	0.69702	AAC		0.443	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		204	134	1	0	5.58888e-140	0.00361	1.02284e-139	204	134				
XKR4	114786	broad.mit.edu	37	8	56436303	56436303	+	Silent	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:56436303A>T	ENST00000327381.6	+	3	1570	c.1470A>T	c.(1468-1470)ccA>ccT	p.P490P	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	490						integral component of membrane (GO:0016021)		p.P490P(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TTGCCATTCCAGCGCTGTGTG	0.453																																							uc003xsf.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)	2						c.(1468-1470)CCA>CCT		XK, Kell blood group complex subunit-related							108.0	95.0	100.0					8																	56436303		2203	4300	6503	SO:0001819	synonymous_variant	114786					integral to membrane		g.chr8:56436303A>T	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1470A>T	8.37:g.56436303A>T			Somatic					p.P490P	NM_052898	NP_443130	WXS	Illumina HiSeq	Unspecified	Q5GH76	XKR4_HUMAN	Epithelial(17;0.000117)|all cancers(17;0.000836)		3	1502	+			490			Helical; (Potential).		Q96PZ8	Silent	SNP	ENST00000327381.6	37	c.1470A>T	CCDS34893.1																																																																																				0.453	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898		38	22	0	0	0	0.00361	0	38	22				
ARFGEF1	10565	broad.mit.edu	37	8	68208800	68208800	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:68208800C>A	ENST00000262215.3	-	5	894	c.505G>T	c.(505-507)Ggg>Tgg	p.G169W		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	169	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.G169W(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AGTACAGTCCCTTCATGAATT	0.328																																							uc003xxo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8						c.(505-507)GGG>TGG		brefeldin A-inhibited guanine							174.0	153.0	160.0					8																	68208800		2203	4300	6503	SO:0001583	missense	10565				exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding	g.chr8:68208800C>A	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.505G>T	8.37:g.68208800C>A	ENSP00000262215:p.Gly169Trp		Somatic					p.G169W	NM_006421	NP_006412	WXS	Illumina HiSeq	Unspecified	Q9Y6D6	BIG1_HUMAN	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)		5	895	-	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	169					Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	c.505G>T	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.520914	0.85495	.	.	ENSG00000066777	ENST00000262215	T	0.20881	2.04	4.9	4.9	0.64082	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52837	0.1759	M	0.85099	2.735	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61855	-0.6977	10	0.72032	D	0.01	.	18.0899	0.89471	0.0:1.0:0.0:0.0	.	169	Q9Y6D6	BIG1_HUMAN	W	169	ENSP00000262215:G169W	ENSP00000262215:G169W	G	-	1	0	ARFGEF1	68371354	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.612000	0.82975	2.261000	0.74972	0.585000	0.79938	GGG		0.328	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421		38	78	1	0	5.04308e-16	0.00623	6.39911e-16	38	78				
SBSPON	157869	broad.mit.edu	37	8	73993266	73993266	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:73993266C>G	ENST00000297354.6	-	2	601	c.397G>C	c.(397-399)Ggg>Cgg	p.G133R	SBSPON_ENST00000519697.1_5'UTR|RP11-956J14.1_ENST00000442274.1_RNA	NM_153225.3	NP_694957.3	Q8IVN8	SBSPO_HUMAN	somatomedin B and thrombospondin, type 1 domain containing	133					immune response (GO:0006955)	proteinaceous extracellular matrix (GO:0005578)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.G128W(1)|p.G128R(1)									TAGGTGTGCCCGCAGTCCTGG	0.582																																							uc003xzf.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(397-399)GGG>CGG		RPE-spondin precursor							103.0	115.0	111.0					8																	73993266		2023	4178	6201	SO:0001583	missense	157869				immune response	extracellular region	polysaccharide binding|scavenger receptor activity	g.chr8:73993266C>G		CCDS43747.2	8q21.11	2013-08-07	2012-05-15	2012-05-15	ENSG00000164764	ENSG00000164764			30362	protein-coding gene	gene with protein product	"""RPE spondin"", ""rpe-spondin"""		"""chromosome 8 open reading frame 84"""	C8orf84		12107410	Standard	NM_153225		Approved	RPESP	uc003xzf.3	Q8IVN8	OTTHUMG00000157144	ENST00000297354.6:c.397G>C	8.37:g.73993266C>G	ENSP00000297354:p.Gly133Arg		Somatic					p.G133R	NM_153225	NP_694957	WXS	Illumina HiSeq	Unspecified	Q8IVN8	RPESP_HUMAN			2	602	-			133					A8KAA5|Q96J64	Missense_Mutation	SNP	ENST00000297354.6	37	c.397G>C	CCDS43747.2	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967559	0.34754	.	.	ENSG00000164764	ENST00000297354	T	0.21932	1.98	5.51	5.51	0.81932	.	0.224153	0.45867	D	0.000339	T	0.40297	0.1111	L	0.51422	1.61	0.49389	D	0.999782	D	0.71674	0.998	D	0.68483	0.958	T	0.02821	-1.1106	10	0.19590	T	0.45	-10.5307	19.406	0.94647	0.0:1.0:0.0:0.0	.	133	Q8IVN8	RPESP_HUMAN	R	133	ENSP00000297354:G133R	ENSP00000297354:G133R	G	-	1	0	C8orf84	74155820	0.998000	0.40836	0.998000	0.56505	0.266000	0.26442	5.190000	0.65104	2.598000	0.87819	0.650000	0.86243	GGG		0.582	SBSPON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347584.2	NM_153225		18	260	0	0	0	0.005443	0	18	260				
PI15	51050	broad.mit.edu	37	8	75737519	75737519	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:75737519T>C	ENST00000260113.2	+	2	214	c.35T>C	c.(34-36)cTg>cCg	p.L12P	PI15_ENST00000523773.1_Missense_Mutation_p.L12P|RP11-758M4.4_ENST00000523860.1_RNA|RP11-758M4.4_ENST00000518128.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	12						extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)	p.L12P(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			AGTGCACTCCTGTTCTCCCTT	0.468																																							uc003yal.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(34-36)CTG>CCG		protease inhibitor 15 preproprotein							248.0	249.0	248.0					8																	75737519		2203	4300	6503	SO:0001583	missense	51050					extracellular region	peptidase inhibitor activity	g.chr8:75737519T>C	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.35T>C	8.37:g.75737519T>C	ENSP00000260113:p.Leu12Pro		Somatic				uc003yak.1_Intron|PI15_uc003yam.2_Missense_Mutation_p.L12P	p.L12P	NM_015886	NP_056970	WXS	Illumina HiSeq	Unspecified	O43692	PI15_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)		2	214	+	Breast(64;0.137)		12					Q68CY1	Missense_Mutation	SNP	ENST00000260113.2	37	c.35T>C	CCDS6218.1	.	.	.	.	.	.	.	.	.	.	T	14.78	2.638249	0.47153	.	.	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.13901	2.55;2.55	4.77	4.77	0.60923	.	0.087613	0.47852	D	0.000217	T	0.36496	0.0969	M	0.69823	2.125	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.17440	-1.0369	10	0.87932	D	0	.	14.7548	0.69554	0.0:0.0:0.0:1.0	.	12	O43692	PI15_HUMAN	P	12	ENSP00000260113:L12P;ENSP00000428567:L12P	ENSP00000260113:L12P	L	+	2	0	PI15	75900074	1.000000	0.71417	0.999000	0.59377	0.930000	0.56654	5.287000	0.65645	2.143000	0.66587	0.459000	0.35465	CTG		0.468	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886		157	262	0	0	0	0.00361	0	157	262				
ZFHX4	79776	broad.mit.edu	37	8	77767417	77767417	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:77767417A>G	ENST00000521891.2	+	10	8708	c.8260A>G	c.(8260-8262)Aca>Gca	p.T2754A	ZFHX4_ENST00000050961.6_Missense_Mutation_p.T2709A|ZFHX4_ENST00000518282.1_Missense_Mutation_p.T2728A|ZFHX4_ENST00000455469.2_Missense_Mutation_p.T2709A	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2709					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.T2738A(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TACAGTGTCAACACCTGTTAG	0.383										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(8125-8127)ACA>GCA		zinc finger homeodomain 4							66.0	63.0	64.0					8																	77767417		1846	4097	5943	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77767417A>G		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8260A>G	8.37:g.77767417A>G	ENSP00000430497:p.Thr2754Ala	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.T2754A|ZFHX4_uc003yaw.1_Missense_Mutation_p.T2709A	p.T2709A	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	8512	+			2709					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.8125A>G	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	8.103	0.777062	0.16120	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.52526	0.66;0.71;0.68;0.67	4.97	4.97	0.65823	.	0.000000	0.45867	U	0.000338	T	0.58722	0.2142	L	0.46157	1.445	0.80722	D	1	P;P;P	0.51653	0.771;0.853;0.947	P;P;P	0.62382	0.741;0.868;0.901	T	0.56269	-0.8007	10	0.36615	T	0.2	.	14.8134	0.70013	1.0:0.0:0.0:0.0	.	2709;2709;2754	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	A	2754;2738;2709;2709;2728	ENSP00000430497:T2754A;ENSP00000399605:T2709A;ENSP00000050961:T2709A;ENSP00000430848:T2728A	ENSP00000050961:T2709A	T	+	1	0	ZFHX4	77929972	1.000000	0.71417	0.065000	0.19835	0.027000	0.11550	9.139000	0.94554	2.089000	0.63090	0.454000	0.30748	ACA		0.383	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		28	43	0	0	0	0.005524	0	28	43				
CNGB3	54714	broad.mit.edu	37	8	87738759	87738759	+	Splice_Site	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:87738759C>T	ENST00000320005.5	-	3	385	c.338G>A	c.(337-339)aGc>aAc	p.S113N	CNGB3_ENST00000519777.1_5'UTR|RP11-386D6.1_ENST00000519041.1_RNA	NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	113					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.S113N(1)		NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						AAATGCTCACCTGTTTGGACC	0.458																																							uc003ydx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(337-339)AGC>AAC		cyclic nucleotide gated channel beta 3							273.0	252.0	259.0					8																	87738759		2203	4300	6503	SO:0001630	splice_region_variant	54714				signal transduction|visual perception	integral to membrane	cGMP binding	g.chr8:87738759C>T	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.338+1G>A	8.37:g.87738759C>T			Somatic					p.S113N	NM_019098	NP_061971	WXS	Illumina HiSeq	Unspecified	Q9NQW8	CNGB3_HUMAN			3	384	-			113			Cytoplasmic (Potential).		C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	c.338G>A	CCDS6244.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.514616	0.27123	.	.	ENSG00000170289	ENST00000320005	T	0.61510	0.1	5.71	3.89	0.44902	.	0.431538	0.16835	U	0.197564	T	0.45135	0.1327	L	0.43923	1.385	0.34777	D	0.734313	B	0.14805	0.011	B	0.06405	0.002	T	0.48559	-0.9025	9	.	.	.	.	8.4551	0.32895	0.0:0.8474:0.0:0.1526	.	113	Q9NQW8	CNGB3_HUMAN	N	113	ENSP00000316605:S113N	.	S	-	2	0	CNGB3	87807875	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	1.957000	0.40392	2.687000	0.91594	0.655000	0.94253	AGC		0.458	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098	Missense_Mutation	68	122	0	0	0	0.00361	0	68	122				
NBN	4683	broad.mit.edu	37	8	90982638	90982638	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:90982638C>G	ENST00000265433.3	-	7	1004	c.850G>C	c.(850-852)Gac>Cac	p.D284H	NBN_ENST00000409330.1_Missense_Mutation_p.D202H	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	284	Interaction with MTOR, MAPKAP1 and RICTOR.|Mediates interaction with SP100. {ECO:0000250}.				blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)	p.D284H(1)		autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTCTGACAGTCAGGAATTAAG	0.333								Homologous recombination																															uc003yej.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|kidney(3)|lung(1)	7						c.(850-852)GAC>CAC	Direct_reversal_of_damage|Homologous_recombination	nibrin							104.0	100.0	102.0					8																	90982638		2203	4300	6503	SO:0001583	missense	4683	Nijmegen_Breakage_syndrome			cell cycle arrest|DNA damage response, signal transduction by p53 class mediator|DNA duplex unwinding|double-strand break repair via homologous recombination|meiosis|mitotic cell cycle G1/S transition checkpoint|mitotic cell cycle G2/M transition DNA damage checkpoint|positive regulation of kinase activity|positive regulation of protein autophosphorylation|regulation of DNA-dependent DNA replication initiation|telomere maintenance	Mre11 complex|nuclear chromosome, telomeric region|nuclear inclusion body|nucleolus|nucleoplasm	protein N-terminus binding|transcription factor binding	g.chr8:90982638C>G	AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.850G>C	8.37:g.90982638C>G	ENSP00000265433:p.Asp284His		Somatic				NBN_uc003yei.1_Missense_Mutation_p.D202H|NBN_uc011lgb.1_Missense_Mutation_p.D284H	p.D284H	NM_002485	NP_002476	WXS	Illumina HiSeq	Unspecified	O60934	NBN_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0344)		7	960	-			284					B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Missense_Mutation	SNP	ENST00000265433.3	37	c.850G>C	CCDS6249.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.514090	0.27123	.	.	ENSG00000104320	ENST00000265433;ENST00000409330;ENST00000452387	T;T	0.59364	0.28;0.27	5.6	2.66	0.31614	.	0.649867	0.16997	N	0.191073	T	0.41994	0.1183	L	0.27053	0.805	0.09310	N	1	B;B	0.23058	0.079;0.079	B;B	0.21546	0.035;0.035	T	0.30937	-0.9961	10	0.42905	T	0.14	-10.7674	9.2406	0.37493	0.0:0.6523:0.273:0.0747	.	284;284	A6H8Y5;O60934	.;NBN_HUMAN	H	284;202;284	ENSP00000265433:D284H;ENSP00000386924:D202H	ENSP00000265433:D284H	D	-	1	0	NBN	91051814	0.981000	0.34729	0.994000	0.49952	0.644000	0.38419	0.236000	0.17967	0.706000	0.31912	0.655000	0.94253	GAC		0.333	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331583.3	NM_001024688		44	99	0	0	0	0.00361	0	44	99				
KIAA1429	25962	broad.mit.edu	37	8	95522735	95522735	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:95522735C>A	ENST00000297591.5	-	14	3611	c.3536G>T	c.(3535-3537)cGt>cTt	p.R1179L	KIAA1429_ENST00000437199.1_Missense_Mutation_p.R1179L|KIAA1429_ENST00000523405.1_Intron	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1179					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R1179L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			AACACAAATACGCCGTAACAT	0.423																																							uc003ygo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(3535-3537)CGT>CTT		hypothetical protein LOC25962 isoform 1							129.0	113.0	118.0					8																	95522735		2203	4300	6503	SO:0001583	missense	25962				mRNA processing|RNA splicing	nucleus		g.chr8:95522735C>A	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.3536G>T	8.37:g.95522735C>A	ENSP00000297591:p.Arg1179Leu		Somatic				KIAA1429_uc010maz.1_RNA	p.R1179L	NM_015496	NP_056311	WXS	Illumina HiSeq	Unspecified	Q69YN4	VIR_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00185)		14	3549	-	Breast(36;3.29e-05)		1179					Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	c.3536G>T	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238179	0.79800	.	.	ENSG00000164944	ENST00000297591;ENST00000437199	T;T	0.67865	-0.29;-0.29	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.81856	0.4911	M	0.71036	2.16	0.80722	D	1	D	0.67145	0.996	D	0.79108	0.992	T	0.80276	-0.1450	10	0.44086	T	0.13	-14.7371	19.9405	0.97159	0.0:1.0:0.0:0.0	.	1179	Q69YN4	VIR_HUMAN	L	1179	ENSP00000297591:R1179L;ENSP00000395600:R1179L	ENSP00000297591:R1179L	R	-	2	0	KIAA1429	95591911	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.248000	0.78268	2.716000	0.92895	0.650000	0.86243	CGT		0.423	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496		73	133	1	0	1.32003e-40	0.00361	2.09955e-40	73	133				
CSMD3	114788	broad.mit.edu	37	8	113392679	113392679	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:113392679G>T	ENST00000297405.5	-	38	6282	c.6038C>A	c.(6037-6039)aCa>aAa	p.T2013K	CSMD3_ENST00000455883.2_Missense_Mutation_p.T1909K|CSMD3_ENST00000343508.3_Missense_Mutation_p.T1973K|CSMD3_ENST00000352409.3_Missense_Mutation_p.T1943K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2013	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T1973K(1)|p.T2013K(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATGGGGTATTGTTGTTCCTGA	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(6037-6039)ACA>AAA		CUB and Sushi multiple domains 3 isoform 1							100.0	105.0	103.0					8																	113392679		2203	4295	6498	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113392679G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6038C>A	8.37:g.113392679G>T	ENSP00000297405:p.Thr2013Lys	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.T1215K|CSMD3_uc003ynt.2_Missense_Mutation_p.T1973K|CSMD3_uc011lhx.1_Missense_Mutation_p.T1909K	p.T2013K	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			38	6197	-			2013			Extracellular (Potential).|CUB 11.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.6038C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.920069	0.92249	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.16457	2.34;2.34;2.34;2.34;2.34	5.64	5.64	0.86602	CUB (5);	0.000000	0.64402	D	0.000001	T	0.32285	0.0824	L	0.33485	1.01	0.80722	D	1	D;P;D	0.89917	1.0;0.953;1.0	D;D;D	0.97110	0.999;0.974;1.0	T	0.01428	-1.1357	10	0.23302	T	0.38	.	19.2842	0.94065	0.0:0.0:1.0:0.0	.	1909;2013;1973	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	K	1973;2013;1283;1909;1943	ENSP00000345799:T1973K;ENSP00000297405:T2013K;ENSP00000341558:T1283K;ENSP00000412263:T1909K;ENSP00000343124:T1943K	ENSP00000297405:T2013K	T	-	2	0	CSMD3	113461855	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.553000	0.98118	2.654000	0.90174	0.591000	0.81541	ACA		0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		46	101	1	0	7.91745e-34	0.00361	1.1897e-33	46	101				
TRPS1	7227	broad.mit.edu	37	8	116617221	116617221	+	Silent	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:116617221T>A	ENST00000220888.5	-	3	1095	c.936A>T	c.(934-936)tcA>tcT	p.S312S	TRPS1_ENST00000520276.1_Silent_p.S316S|TRPS1_ENST00000395715.3_Silent_p.S325S|TRPS1_ENST00000519076.1_Silent_p.S266S|TRPS1_ENST00000519674.1_Silent_p.S312S			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	312					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S325S(1)|p.S312S(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATGTTCCACCTGAAGTCACCT	0.463									Langer-Giedion syndrome																														uc003ynz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(934-936)TCA>TCT		zinc finger transcription factor TRPS1							71.0	66.0	67.0					8																	116617221		1888	4123	6011	SO:0001819	synonymous_variant	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116617221T>A	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.936A>T	8.37:g.116617221T>A			Somatic				TRPS1_uc011lhy.1_Silent_p.S316S|TRPS1_uc003yny.2_Silent_p.S325S|TRPS1_uc010mcy.2_Silent_p.S312S	p.S312S	NM_014112	NP_054831	WXS	Illumina HiSeq	Unspecified	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		3	1395	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		312					B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	37	c.936A>T																																																																																					0.463	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		53	92	0	0	0	0.00361	0	53	92				
ENPP2	5168	broad.mit.edu	37	8	120580440	120580440	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:120580440C>A	ENST00000075322.6	-	22	2164	c.2106G>T	c.(2104-2106)atG>atT	p.M702I	ENPP2_ENST00000427067.2_Missense_Mutation_p.M723I|ENPP2_ENST00000522167.1_Missense_Mutation_p.M337I|ENPP2_ENST00000522826.1_Missense_Mutation_p.M727I|ENPP2_ENST00000259486.6_Missense_Mutation_p.M754I	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	702					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.M754I(1)|p.M727I(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ACATTGGAACCATATTGGTTA	0.313																																					Melanoma(20;305 879 2501 4818 31020)	Melanoma(20;305 879 2501 4818 31020)	uc003yot.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7						c.(2104-2106)ATG>ATT		autotaxin isoform 2 preproprotein							130.0	135.0	133.0					8																	120580440		2203	4299	6502	SO:0001583	missense	5168				cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding	g.chr8:120580440C>A	D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.2106G>T	8.37:g.120580440C>A	ENSP00000075322:p.Met702Ile		Somatic				ENPP2_uc011lic.1_Missense_Mutation_p.M240I|ENPP2_uc003yor.1_Missense_Mutation_p.M337I|ENPP2_uc003yos.1_Missense_Mutation_p.M754I|ENPP2_uc010mdd.1_Missense_Mutation_p.M727I	p.M702I	NM_001040092	NP_001035181	WXS	Illumina HiSeq	Unspecified	Q13822	ENPP2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00185)		22	2192	-	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		702					A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	37	c.2106G>T	CCDS34936.1	.	.	.	.	.	.	.	.	.	.	C	2.675	-0.276776	0.05679	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522167;ENST00000522826;ENST00000075322	T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83	5.34	5.34	0.76211	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.132632	0.64402	D	0.000001	T	0.10035	0.0246	N	0.02685	-0.53	0.33556	D	0.596765	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.09377	0.004;0.003;0.003;0.002;0.003	T	0.09292	-1.0681	10	0.02654	T	1	.	14.0188	0.64541	0.0:0.7294:0.2706:0.0	.	240;727;702;754;337	B4DJD3;E9PHP7;Q13822;Q13822-2;E5RIA2	.;.;ENPP2_HUMAN;.;.	I	754;723;337;727;702	ENSP00000259486:M754I;ENSP00000403315:M723I;ENSP00000429476:M337I;ENSP00000428291:M727I;ENSP00000075322:M702I	ENSP00000075322:M702I	M	-	3	0	ENPP2	120649621	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.767000	0.47637	2.667000	0.90743	0.650000	0.86243	ATG		0.313	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1			151	209	1	0	8.31651e-93	0.00361	1.47935e-92	151	209				
FER1L6	654463	broad.mit.edu	37	8	125015557	125015557	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:125015557C>A	ENST00000522917.1	+	13	1876	c.1670C>A	c.(1669-1671)cCg>cAg	p.P557Q	FER1L6-AS1_ENST00000518567.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.P557Q	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	557						integral component of membrane (GO:0016021)		p.P557Q(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			ACCACTCACCCGGAGAAGCCA	0.522																																							uc003yqw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(1669-1671)CCG>CAG		fer-1-like 6							40.0	41.0	41.0					8																	125015557		1944	4142	6086	SO:0001583	missense	654463					integral to membrane		g.chr8:125015557C>A	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.1670C>A	8.37:g.125015557C>A	ENSP00000428280:p.Pro557Gln		Somatic				uc003yqx.1_Intron	p.P557Q	NM_001039112	NP_001034201	WXS	Illumina HiSeq	Unspecified	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		13	1876	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		557			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000522917.1	37	c.1670C>A	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631133	0.87660	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.82433	-1.61;-1.61	5.73	5.73	0.89815	.	0.346719	0.21928	U	0.067072	D	0.91643	0.7359	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.90463	0.4447	10	0.41790	T	0.15	.	19.4953	0.95070	0.0:1.0:0.0:0.0	.	557	Q2WGJ9	FR1L6_HUMAN	Q	557	ENSP00000428280:P557Q;ENSP00000381982:P557Q	ENSP00000381982:P557Q	P	+	2	0	FER1L6	125084738	0.993000	0.37304	1.000000	0.80357	0.980000	0.70556	5.322000	0.65852	2.709000	0.92574	0.655000	0.94253	CCG		0.522	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		50	87	1	0	3.69863e-55	0.00361	6.28548e-55	50	87				
KIAA0196	9897	broad.mit.edu	37	8	126061389	126061389	+	Silent	SNP	C	C	A	rs376307168		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:126061389C>A	ENST00000318410.7	-	19	2587	c.2238G>T	c.(2236-2238)gcG>gcT	p.A746A	KIAA0196_ENST00000517845.1_Silent_p.A598A	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	746					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.A746A(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			CATCCATGGTCGCTCCCAACT	0.398																																							uc003yrt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2236-2238)GCG>GCT		strumpellin							97.0	85.0	89.0					8																	126061389		2203	4300	6503	SO:0001819	synonymous_variant	9897				cell death	WASH complex		g.chr8:126061389C>A		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.2238G>T	8.37:g.126061389C>A			Somatic				KIAA0196_uc011lir.1_Silent_p.A598A|KIAA0196_uc003yru.1_Silent_p.A320A	p.A746A	NM_014846	NP_055661	WXS	Illumina HiSeq	Unspecified	Q12768	STRUM_HUMAN	STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		19	2567	-	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		746					A8K4R7|Q3KQX5|Q8TBQ2	Silent	SNP	ENST00000318410.7	37	c.2238G>T	CCDS6355.1	.	.	.	.	.	.	.	.	.	.	C	9.350	1.065150	0.20067	.	.	ENSG00000164961	ENST00000523273	.	.	.	5.88	-10.7	0.00240	.	.	.	.	.	T	0.42653	0.1212	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51364	-0.8715	4	.	.	.	-16.0637	6.3908	0.21585	0.1563:0.1859:0.506:0.1518	.	.	.	.	L	363	.	.	R	-	2	0	KIAA0196	126130571	0.767000	0.28508	0.295000	0.24960	0.882000	0.50991	-0.149000	0.10204	-2.251000	0.00700	-1.065000	0.02276	CGA		0.398	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846		59	112	1	0	2.47556e-37	0.00361	3.87273e-37	59	112				
ADCY8	114	broad.mit.edu	37	8	131795974	131795974	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:131795974G>T	ENST00000286355.5	-	17	5323	c.3231C>A	c.(3229-3231)atC>atA	p.I1077I	ADCY8_ENST00000377928.3_Silent_p.I946I	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	1077					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.I1077I(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AATGCTTGTTGATCTCCTGTA	0.502										HNSCC(32;0.087)																													uc003ytd.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|large_intestine(1)|central_nervous_system(1)	6						c.(3229-3231)ATC>ATA		adenylate cyclase 8							163.0	148.0	153.0					8																	131795974		2203	4300	6503	SO:0001819	synonymous_variant	114				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding	g.chr8:131795974G>T	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.3231C>A	8.37:g.131795974G>T		HNSCC(32;0.087)	Somatic				ADCY8_uc010mds.2_Silent_p.I946I	p.I1077I	NM_001115	NP_001106	WXS	Illumina HiSeq	Unspecified	P40145	ADCY8_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000538)		17	3487	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		1077			Cytoplasmic (Potential).			Silent	SNP	ENST00000286355.5	37	c.3231C>A	CCDS6363.1																																																																																				0.502	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			90	168	1	0	5.30932e-60	0.00361	9.10397e-60	90	168				
KCNK9	51305	broad.mit.edu	37	8	140631035	140631035	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:140631035C>A	ENST00000520439.1	-	2	654	c.591G>T	c.(589-591)ttG>ttT	p.L197F	KCNK9_ENST00000523477.1_5'Flank|KCNK9_ENST00000303015.1_Missense_Mutation_p.L197F	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	197					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.L197F(1)		NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	CAATGGTAGTCAACGTGATGA	0.577																																							uc003yvf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(589-591)TTG>TTT		potassium channel, subfamily K, member 9							83.0	82.0	82.0					8																	140631035		2203	4300	6503	SO:0001583	missense	51305					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity	g.chr8:140631035C>A	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.591G>T	8.37:g.140631035C>A	ENSP00000430676:p.Leu197Phe		Somatic				KCNK9_uc003yvg.1_Missense_Mutation_p.L197F|KCNK9_uc003yve.1_RNA	p.L197F	NM_016601	NP_057685	WXS	Illumina HiSeq	Unspecified	Q9NPC2	KCNK9_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0855)		2	655	-	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	197					Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	c.591G>T	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.969831	0.53614	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.35789	1.29;1.29;1.29	5.85	2.96	0.34315	Ion transport 2 (1);	0.000000	0.64402	D	0.000009	T	0.57272	0.2042	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.58222	-0.7674	10	0.49607	T	0.09	.	16.8143	0.85729	0.0:0.453:0.547:0.0	.	197	Q9NPC2	KCNK9_HUMAN	F	197	ENSP00000429847:L197F;ENSP00000302166:L197F;ENSP00000430676:L197F	ENSP00000302166:L197F	L	-	3	2	KCNK9	140700217	1.000000	0.71417	0.900000	0.35374	0.885000	0.51271	1.797000	0.38804	0.315000	0.23110	0.655000	0.94253	TTG		0.577	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601		29	72	1	0	1.8613e-05	0.004289	2.01288e-05	29	72				
CNTLN	54875	broad.mit.edu	37	9	17298192	17298192	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:17298192G>C	ENST00000380647.3	+	7	1072	c.988G>C	c.(988-990)Gaa>Caa	p.E330Q	CNTLN_ENST00000262360.5_Splice_Site_p.E330Q|CNTLN_ENST00000380641.4_Missense_Mutation_p.E330Q|CNTLN_ENST00000425824.1_Splice_Site_p.E330Q			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	330					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.E330Q(1)		breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GCACAGGAAGGAACTGCAGGA	0.408																																							uc003zmz.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(988-990)GAA>CAA		centlein isoform 1							80.0	76.0	77.0					9																	17298192		1910	4127	6037	SO:0001583	missense	54875					centriole|membrane	two-component sensor activity	g.chr9:17298192G>C	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.988G>C	9.37:g.17298192G>C	ENSP00000370021:p.Glu330Gln		Somatic				CNTLN_uc003zmx.3_Missense_Mutation_p.E330Q|CNTLN_uc003zmy.2_Missense_Mutation_p.E330Q|CNTLN_uc010mio.2_Missense_Mutation_p.E9Q	p.E330Q	NM_017738	NP_060208	WXS	Illumina HiSeq	Unspecified	Q9NXG0	CNTLN_HUMAN		GBM - Glioblastoma multiforme(50;6.14e-10)	7	1014	+			330					A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	c.988G>C	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.287408	0.80803	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360;ENST00000380641	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	5.72	5.72	0.89469	.	.	.	.	.	T	0.56630	0.1998	M	0.66939	2.045	0.52501	D	0.999956	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.997	T	0.50947	-0.8767	9	0.42905	T	0.14	.	19.8829	0.96904	0.0:0.0:1.0:0.0	.	330;330;330;330	Q9NXG0;C9J1F9;Q9NXG0-2;Q9NXG0-3	CNTLN_HUMAN;.;.;.	Q	330	ENSP00000370021:E330Q;ENSP00000392798:E330Q;ENSP00000262360:E330Q;ENSP00000370015:E330Q	ENSP00000262360:E330Q	E	+	1	0	CNTLN	17288192	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	5.558000	0.67319	2.717000	0.92951	0.650000	0.86243	GAA		0.408	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738		37	41	0	0	0	0.00623	0	37	41				
GNE	10020	broad.mit.edu	37	9	36246104	36246104	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:36246104C>T	ENST00000539815.1	-	2	580	c.540G>A	c.(538-540)ttG>ttA	p.L180L	GNE_ENST00000543356.2_Silent_p.L175L|GNE_ENST00000447283.2_Silent_p.L180L|GNE_ENST00000377902.5_Silent_p.L180L|GNE_ENST00000396594.3_Silent_p.L211L|GNE_ENST00000539208.1_Silent_p.L121L			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	180					carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)	p.L180L(1)|p.L211L(1)|p.L175L(1)		endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			GGCAGCCTGCCAAAAGGATGC	0.483																																					GBM(184;106 2118 20004 35750 50727)	GBM(184;106 2118 20004 35750 50727)	uc010mlh.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(538-540)TTG>TTA		UDP-N-acetylglucosamine-2-epimerase/N-							152.0	128.0	136.0					9																	36246104		2203	4300	6503	SO:0001819	synonymous_variant	10020				cell adhesion|lipopolysaccharide biosynthetic process|N-acetylneuraminate metabolic process|UDP-N-acetylglucosamine metabolic process		ATP binding|N-acylmannosamine kinase activity|UDP-N-acetylglucosamine 2-epimerase activity	g.chr9:36246104C>T	AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.540G>A	9.37:g.36246104C>T			Somatic				CLTA_uc003zzf.1_Intron|GNE_uc010mlg.2_Silent_p.L180L|GNE_uc011lpl.1_Silent_p.L121L|GNE_uc010mli.2_Silent_p.L211L|GNE_uc010mlj.2_Silent_p.L175L	p.L180L	NM_005476	NP_005467	WXS	Illumina HiSeq	Unspecified	Q9Y223	GLCNE_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)		3	755	-			180			UDP-N-acetylglucosamine 2-epimerase.		A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Silent	SNP	ENST00000539815.1	37	c.540G>A	CCDS6602.1																																																																																				0.483	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052412.4	NM_005476		5	136	0	0	0	0.001984	0	5	136				
TRPM3	80036	broad.mit.edu	37	9	73235267	73235267	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:73235267C>T	ENST00000377111.2	-	15	2061	c.1818G>A	c.(1816-1818)ttG>ttA	p.L606L	TRPM3_ENST00000423814.3_Silent_p.L633L|TRPM3_ENST00000377105.1_Silent_p.L465L|TRPM3_ENST00000377106.1_Silent_p.L478L|TRPM3_ENST00000357533.2_Silent_p.L610L|TRPM3_ENST00000358082.3_Silent_p.L468L|TRPM3_ENST00000396280.5_Silent_p.L455L|TRPM3_ENST00000408909.2_Silent_p.L465L|TRPM3_ENST00000360823.2_Silent_p.L468L|TRPM3_ENST00000377110.3_Silent_p.L606L|TRPM3_ENST00000396285.1_Silent_p.L453L|TRPM3_ENST00000396292.4_Silent_p.L478L	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	631					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.L610L(1)|p.L606L(1)|p.L478L(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TTCCTCGCCTCAAGGGAATAT	0.438																																							uc004aid.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						c.(1816-1818)TTG>TTA		transient receptor potential cation channel,							245.0	231.0	235.0					9																	73235267		2203	4300	6503	SO:0001819	synonymous_variant	80036					integral to membrane	calcium channel activity	g.chr9:73235267C>T	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1818G>A	9.37:g.73235267C>T			Somatic				TRPM3_uc004ahu.2_Silent_p.L436L|TRPM3_uc004ahv.2_Silent_p.L408L|TRPM3_uc004ahw.2_Silent_p.L478L|TRPM3_uc004ahx.2_Silent_p.L465L|TRPM3_uc004ahy.2_Silent_p.L468L|TRPM3_uc004ahz.2_Silent_p.L455L|TRPM3_uc004aia.2_Silent_p.L453L|TRPM3_uc004aib.2_Silent_p.L443L|TRPM3_uc004aic.2_Silent_p.L606L	p.L606L	NM_001007471	NP_001007472	WXS	Illumina HiSeq	Unspecified	Q9HCF6	TRPM3_HUMAN			15	2062	-			631			Cytoplasmic (Potential).		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37	c.1818G>A		.	.	.	.	.	.	.	.	.	.	C	7.845	0.722832	0.15439	.	.	ENSG00000083067	ENST00000396280	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	T	0.64483	0.2602	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61426	-0.7065	4	.	.	.	-17.1029	11.8613	0.52467	0.0:0.8658:0.0:0.1342	.	.	.	.	K	455	.	.	E	-	1	0	TRPM3	72425087	0.993000	0.37304	1.000000	0.80357	0.958000	0.62258	0.460000	0.21924	2.890000	0.99128	0.650000	0.86243	GAG		0.438	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945		70	322	0	0	0	0.00361	0	70	322				
TRPM3	80036	broad.mit.edu	37	9	73235278	73235278	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:73235278C>T	ENST00000377111.2	-	15	2050	c.1807G>A	c.(1807-1809)Gat>Aat	p.D603N	TRPM3_ENST00000423814.3_Missense_Mutation_p.D630N|TRPM3_ENST00000377105.1_Missense_Mutation_p.D462N|TRPM3_ENST00000377106.1_Missense_Mutation_p.D475N|TRPM3_ENST00000357533.2_Missense_Mutation_p.D607N|TRPM3_ENST00000358082.3_Missense_Mutation_p.D465N|TRPM3_ENST00000396280.5_Missense_Mutation_p.D452N|TRPM3_ENST00000408909.2_Missense_Mutation_p.D462N|TRPM3_ENST00000360823.2_Missense_Mutation_p.D465N|TRPM3_ENST00000377110.3_Missense_Mutation_p.D603N|TRPM3_ENST00000396285.1_Missense_Mutation_p.D450N|TRPM3_ENST00000396292.4_Missense_Mutation_p.D475N	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	628					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.D607N(1)|p.D603N(1)|p.D475N(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AAGGGAATATCATCCTGTAAT	0.438																																							uc004aid.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						c.(1807-1809)GAT>AAT		transient receptor potential cation channel,							221.0	212.0	215.0					9																	73235278		2203	4300	6503	SO:0001583	missense	80036					integral to membrane	calcium channel activity	g.chr9:73235278C>T	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1807G>A	9.37:g.73235278C>T	ENSP00000366315:p.Asp603Asn		Somatic				TRPM3_uc004ahu.2_Missense_Mutation_p.D433N|TRPM3_uc004ahv.2_Missense_Mutation_p.D405N|TRPM3_uc004ahw.2_Missense_Mutation_p.D475N|TRPM3_uc004ahx.2_Missense_Mutation_p.D462N|TRPM3_uc004ahy.2_Missense_Mutation_p.D465N|TRPM3_uc004ahz.2_Missense_Mutation_p.D452N|TRPM3_uc004aia.2_Missense_Mutation_p.D450N|TRPM3_uc004aib.2_Missense_Mutation_p.D440N|TRPM3_uc004aic.2_Missense_Mutation_p.D603N	p.D603N	NM_001007471	NP_001007472	WXS	Illumina HiSeq	Unspecified	Q9HCF6	TRPM3_HUMAN			15	2051	-			628			Cytoplasmic (Potential).		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37	c.1807G>A		.	.	.	.	.	.	.	.	.	.	C	22.2	4.253170	0.80135	.	.	ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	T;T;T;T;T;T;T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.74;-0.78;-0.74;-0.78;-0.78;-0.78;-0.74;-0.78	6.07	6.07	0.98685	.	0.049104	0.85682	D	0.000000	D	0.83926	0.5360	L	0.57536	1.79	0.58432	D	0.999999	P;B;D;P;P;D;B;P	0.89917	0.562;0.049;1.0;0.882;0.882;0.996;0.364;0.83	P;B;D;P;P;D;B;P	0.91635	0.544;0.039;0.999;0.601;0.601;0.956;0.17;0.482	T	0.76788	-0.2830	10	0.14656	T	0.56	-22.7089	20.6439	0.99570	0.0:1.0:0.0:0.0	.	603;603;593;607;465;462;575;450	Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.;.;.;.;.;.;.;.	N	603;603;475;465;462;607;462;450;475;465;630	ENSP00000366315:D603N;ENSP00000366314:D603N;ENSP00000366310:D475N;ENSP00000354066:D465N;ENSP00000366309:D462N;ENSP00000350140:D607N;ENSP00000386127:D462N;ENSP00000379581:D450N;ENSP00000379587:D475N;ENSP00000350791:D465N;ENSP00000389542:D630N	ENSP00000350140:D607N	D	-	1	0	TRPM3	72425098	1.000000	0.71417	0.997000	0.53966	0.912000	0.54170	7.487000	0.81328	2.890000	0.99128	0.650000	0.86243	GAT		0.438	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945		59	316	0	0	0	0.00361	0	59	316				
OSTF1	26578	broad.mit.edu	37	9	77752469	77752469	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:77752469A>C	ENST00000346234.6	+	8	574	c.424A>C	c.(424-426)Aca>Cca	p.T142P		NM_012383.4	NP_036515.4	Q92882	OSTF1_HUMAN	osteoclast stimulating factor 1	142					ossification (GO:0001503)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)				endometrium(1)|skin(1)	2						GTTGGGAGATACAGCTTTGCA	0.393																																							uc004ajv.3		NA																	0				skin(1)	1						c.(424-426)ACA>CCA		osteoclast stimulating factor 1							164.0	141.0	149.0					9																	77752469		2203	4300	6503	SO:0001583	missense	26578				ossification|signal transduction	cytoplasm	identical protein binding	g.chr9:77752469A>C	U63717	CCDS6651.1	9q13-q21.2	2013-01-10			ENSG00000134996	ENSG00000134996		"""Ankyrin repeat domain containing"""	8510	protein-coding gene	gene with protein product		610180				10092216	Standard	NM_012383		Approved	SH3P2, OSF, bA235O14.1	uc004ajv.4	Q92882	OTTHUMG00000020033	ENST00000346234.6:c.424A>C	9.37:g.77752469A>C	ENSP00000340836:p.Thr142Pro		Somatic				OSTF1_uc004ajw.3_Missense_Mutation_p.T99P|OSTF1_uc004ajx.3_Missense_Mutation_p.T145P	p.T142P	NM_012383	NP_036515	WXS	Illumina HiSeq	Unspecified	Q92882	OSTF1_HUMAN			8	635	+			142			ANK 3.		Q5W126|Q96IJ4	Missense_Mutation	SNP	ENST00000346234.6	37	c.424A>C	CCDS6651.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.483368	0.84854	.	.	ENSG00000134996	ENST00000346234	D	0.82344	-1.6	5.51	5.51	0.81932	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.94265	0.8158	H	0.97491	4.015	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.995;0.997	D	0.96078	0.9051	10	0.87932	D	0	-19.1964	14.6084	0.68498	1.0:0.0:0.0:0.0	.	142;142	A8K646;Q92882	.;OSTF1_HUMAN	P	142	ENSP00000340836:T142P	ENSP00000340836:T142P	T	+	1	0	OSTF1	76942289	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.288000	0.89921	2.090000	0.63153	0.460000	0.39030	ACA		0.393	OSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052704.1	NM_012383		14	67	0	0	0	0.006122	0	14	67				
TLE4	7091	broad.mit.edu	37	9	82242321	82242321	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:82242321G>T	ENST00000376552.2	+	6	1366	c.348G>T	c.(346-348)cgG>cgT	p.R116R	TLE4_ENST00000265284.6_Intron|TLE4_ENST00000376537.4_Silent_p.R116R|TLE4_ENST00000455913.1_3'UTR|TLE4_ENST00000376534.4_5'UTR|TLE4_ENST00000376544.3_Silent_p.R116R|TLE4_ENST00000376520.4_Silent_p.R116R	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	116	Gln-rich (Q domain).				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)	p.R116R(2)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						CTGTGGAACGGGCCAAGCAGG	0.453																																							uc004ald.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(325-327)CGG>CGT		transducin-like enhancer protein 4							167.0	173.0	171.0					9																	82242321		2199	4300	6499	SO:0001819	synonymous_variant	7091							g.chr9:82242321G>T	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.348G>T	9.37:g.82242321G>T			Somatic				TLE4_uc004alc.2_Silent_p.R116R|TLE4_uc010mpr.2_5'UTR|TLE4_uc004ale.2_5'UTR|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Silent_p.R109R|TLE4_uc004alf.2_Silent_p.R54R	p.R109R	NM_007005	NP_008936	WXS	Illumina HiSeq	Unspecified	O60756	BCE1_HUMAN			6	1176	+			Error:Variant_position_missing_in_O60756_after_alignment					F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Silent	SNP	ENST00000376552.2	37	c.327G>T	CCDS43837.1																																																																																				0.453	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237		226	240	1	0	4.96009e-127	0.00361	8.99115e-127	226	240				
TLE4	7091	broad.mit.edu	37	9	82336678	82336678	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:82336678G>T	ENST00000376552.2	+	17	2879	c.1861G>T	c.(1861-1863)Gga>Tga	p.G621*	TLE4_ENST00000265284.6_Nonsense_Mutation_p.G596*|TLE4_ENST00000376537.4_Nonsense_Mutation_p.G653*|TLE4_ENST00000376534.4_Nonsense_Mutation_p.G258*|TLE4_ENST00000376544.3_Nonsense_Mutation_p.G552*|TLE4_ENST00000376520.4_Nonsense_Mutation_p.G653*	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	621					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)	p.G621*(1)|p.G653*(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						CCACACAGATGGAGCCAGCTG	0.473																																							uc004ald.2		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(1936-1938)GGA>TGA		transducin-like enhancer protein 4							66.0	65.0	65.0					9																	82336678		2203	4300	6503	SO:0001587	stop_gained	7091							g.chr9:82336678G>T	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.1861G>T	9.37:g.82336678G>T	ENSP00000365735:p.Gly621*		Somatic				TLE4_uc004alc.2_Nonsense_Mutation_p.G621*|TLE4_uc010mpr.2_Nonsense_Mutation_p.G500*|TLE4_uc004ale.2_Nonsense_Mutation_p.G258*|TLE4_uc011lsq.1_Nonsense_Mutation_p.G589*|TLE4_uc010mps.2_Nonsense_Mutation_p.G545*|TLE4_uc004alf.2_Nonsense_Mutation_p.G560*	p.G646*	NM_007005	NP_008936	WXS	Illumina HiSeq	Unspecified	O60756	BCE1_HUMAN			18	2785	+			Error:Variant_position_missing_in_O60756_after_alignment					F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Nonsense_Mutation	SNP	ENST00000376552.2	37	c.1936G>T	CCDS43837.1	.	.	.	.	.	.	.	.	.	.	G	49	15.641287	0.99840	.	.	ENSG00000106829	ENST00000376552;ENST00000376544;ENST00000376520;ENST00000376537;ENST00000376534;ENST00000265284	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-15.3836	20.5373	0.99239	0.0:0.0:1.0:0.0	.	.	.	.	X	621;552;653;653;258;596	.	ENSP00000265284:G596X	G	+	1	0	TLE4	81526498	1.000000	0.71417	0.998000	0.56505	0.912000	0.54170	9.869000	0.99810	2.857000	0.98124	0.650000	0.86243	GGA		0.473	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237		52	58	1	0	5.80444e-35	0.00361	8.9095e-35	52	58				
SPATA31E1	286234	broad.mit.edu	37	9	90501607	90501607	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:90501607G>T	ENST00000325643.5	+	4	2271	c.2205G>T	c.(2203-2205)gaG>gaT	p.E735D		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	735					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.E735D(1)									AAGACAAGGAGGCAGAAGGTG	0.547																																							uc004app.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2203-2205)GAG>GAT		chromosome 9 open reading frame 79							56.0	55.0	55.0					9																	90501607		2203	4300	6503	SO:0001583	missense	286234					integral to membrane		g.chr9:90501607G>T	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2205G>T	9.37:g.90501607G>T	ENSP00000322640:p.Glu735Asp		Somatic				C9orf79_uc004apo.1_Missense_Mutation_p.E547D	p.E735D	NM_178828	NP_849150	WXS	Illumina HiSeq	Unspecified	Q6ZUB1	CI079_HUMAN			4	2240	+			735					B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	c.2205G>T	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	g	8.800	0.932566	0.18131	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.07444	3.19	2.43	0.0557	0.14316	.	1.201130	0.06295	N	0.699867	T	0.15176	0.0366	L	0.42744	1.35	0.09310	N	1	D;D	0.61697	0.983;0.99	D;P	0.62955	0.909;0.719	T	0.22452	-1.0216	10	0.36615	T	0.2	.	2.9912	0.05983	0.1591:0.0:0.4941:0.3468	.	735;387	Q6ZUB1;Q8NA33	CI079_HUMAN;.	D	735;387	ENSP00000322640:E735D	ENSP00000322640:E735D	E	+	3	2	C9orf79	89691427	0.213000	0.23551	0.000000	0.03702	0.020000	0.10135	0.165000	0.16564	-0.002000	0.14469	0.557000	0.71058	GAG		0.547	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828		41	41	1	0	4.49093e-37	0.00361	7.00635e-37	41	41				
SPATA31C2	645961	broad.mit.edu	37	9	90746326	90746326	+	IGR	SNP	C	C	G	rs149069834	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:90746326C>G								U6 (133076 upstream) : U3 (242857 downstream)																							CCTCAGAGGTCGCCCCCAGAA	0.517																																							uc011lti.1		NA																	0					NA						c.(1624-1626)GCG>GCC		SubName: Full=cDNA FLJ59639;							12.0	15.0	14.0					9																	90746326		692	1591	2283	SO:0001628	intergenic_variant	0							g.chr9:90746326C>G																													9.37:g.90746326C>G			Somatic					p.A542A			WXS	Illumina HiSeq	Unspecified					4	1655	-									Silent	SNP		37	c.1626G>C																																																																																				0	0.517									17	66	0	0	0	0.00278	0	17	66				
NOL8	55035	broad.mit.edu	37	9	95072852	95072852	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:95072852C>A	ENST00000535387.1	-	7	2463	c.2464G>T	c.(2464-2466)Ggc>Tgc	p.G822C	NOL8_ENST00000358855.4_Missense_Mutation_p.G792C|NOL8_ENST00000542053.1_Missense_Mutation_p.G792C|NOL8_ENST00000442668.2_Missense_Mutation_p.G860C|NOL8_ENST00000545558.1_Missense_Mutation_p.G860C					nucleolar protein 8									p.G862C(1)|p.G860C(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						CCAGCTCTGCCCTCAAACTGA	0.388																																							uc004arv.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2578-2580)GGC>TGC		nucleolar protein 8							145.0	135.0	138.0					9																	95072852		1917	4135	6052	SO:0001583	missense	55035				DNA replication|positive regulation of cell growth	nucleolus	nucleotide binding|protein binding|RNA binding	g.chr9:95072852C>A	AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.2464G>T	9.37:g.95072852C>A	ENSP00000441300:p.Gly822Cys		Somatic				NOL8_uc010mqw.2_RNA|NOL8_uc004arw.2_Missense_Mutation_p.G92C|NOL8_uc011ltw.1_Missense_Mutation_p.G792C	p.G860C	NM_017948	NP_060418	WXS	Illumina HiSeq	Unspecified	Q76FK4	NOL8_HUMAN			9	2915	-			860						Missense_Mutation	SNP	ENST00000535387.1	37	c.2578G>T	CCDS47993.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.704494	0.88924	.	.	ENSG00000198000	ENST00000442668;ENST00000375594;ENST00000358855;ENST00000545558;ENST00000535387;ENST00000542053;ENST00000432670	T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.76357	0.3976	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77928	-0.2404	10	0.87932	D	0	-16.0749	20.2789	0.98501	0.0:1.0:0.0:0.0	.	792;860	Q76FK4-2;Q76FK4	.;NOL8_HUMAN	C	860;824;792;860;822;792;860	ENSP00000401177:G860C;ENSP00000351723:G792C;ENSP00000441140:G860C;ENSP00000441300:G822C;ENSP00000440709:G792C;ENSP00000414112:G860C	ENSP00000351723:G792C	G	-	1	0	NOL8	94112673	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.038000	0.76537	2.788000	0.95919	0.650000	0.86243	GGC		0.388	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053082.2	NM_017948		123	456	1	0	1.9257e-63	0.00361	3.33204e-63	123	456				
ERCC6L2	375748	broad.mit.edu	37	9	98678647	98678647	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:98678647G>T	ENST00000288985.7	+	6	1427	c.1122G>T	c.(1120-1122)aaG>aaT	p.K374N	ERCC6L2_ENST00000437817.1_Missense_Mutation_p.K185N|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	374					DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)	p.K374N(1)									TTGCCAAAAAGATGTCTGGCT	0.453																																							uc004avt.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1120-1122)AAG>AAT		RAD26L hypothetical protein							65.0	69.0	68.0					9																	98678647		2203	4300	6503	SO:0001583	missense	375748				DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding	g.chr9:98678647G>T	BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.1122G>T	9.37:g.98678647G>T	ENSP00000288985:p.Lys374Asn		Somatic				C9orf102_uc010mrx.1_RNA|C9orf102_uc011lum.1_Missense_Mutation_p.K76N|C9orf102_uc010mry.1_Missense_Mutation_p.K76N|C9orf102_uc010mrz.2_Missense_Mutation_p.K185N	p.K374N	NM_001010895	NP_001010895	WXS	Illumina HiSeq	Unspecified	Q5T890	RAD26_HUMAN			6	1510	+		Acute lymphoblastic leukemia(62;0.0559)	374					A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	ENST00000288985.7	37	c.1122G>T	CCDS35072.1	.	.	.	.	.	.	.	.	.	.	G	4.713	0.132507	0.09032	.	.	ENSG00000182150	ENST00000405401;ENST00000288985;ENST00000437817	D;D	0.92858	-3.12;-3.12	4.92	3.09	0.35607	SNF2-related (1);	0.378699	0.20542	N	0.090291	D	0.89107	0.6621	M	0.67397	2.05	0.41298	D	0.987027	P;B;P	0.36909	0.573;0.213;0.563	B;B;B	0.39094	0.165;0.29;0.243	D	0.83886	0.0282	10	0.30078	T	0.28	-2.8425	5.9043	0.18984	0.4251:0.0:0.5749:0.0	.	185;56;374	Q5T890-2;F2Z2R4;Q5T890	.;.;RAD26_HUMAN	N	56;374;185	ENSP00000288985:K374N;ENSP00000416286:K185N	ENSP00000288985:K374N	K	+	3	2	C9orf102	97718468	1.000000	0.71417	0.652000	0.29579	0.290000	0.27261	1.977000	0.40589	0.785000	0.33685	0.650000	0.86243	AAG		0.453	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053247.2	NM_001010895		40	49	1	0	2.68985e-26	0.00361	3.79236e-26	40	49				
CDC14B	8555	broad.mit.edu	37	9	99285924	99285924	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:99285924C>G	ENST00000375241.1	-	10	1481	c.1030G>C	c.(1030-1032)Gtc>Ctc	p.V344L	CDC14B_ENST00000463569.1_Missense_Mutation_p.V344L|CDC14B_ENST00000375240.3_Missense_Mutation_p.V344L|CDC14B_ENST00000481149.1_5'Flank|CDC14B_ENST00000375242.3_Missense_Mutation_p.V307L|CDC14B_ENST00000375236.1_Missense_Mutation_p.V344L|CDC14B_ENST00000265659.2_Missense_Mutation_p.V344L	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B	344	B.				activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.V344L(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				CAGATCCTGACCCACGCAATG	0.527																																							uc004awj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1030-1032)GTC>CTC		CDC14 homolog B isoform 2							85.0	74.0	78.0					9																	99285924		2203	4300	6503	SO:0001583	missense	8555				activation of anaphase-promoting complex activity|DNA repair|G2/M transition DNA damage checkpoint	nucleolus|nucleoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr9:99285924C>G	AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.1030G>C	9.37:g.99285924C>G	ENSP00000364389:p.Val344Leu		Somatic				CDC14B_uc004awk.2_Missense_Mutation_p.V344L|CDC14B_uc004awl.2_RNA|CDC14B_uc004awi.2_Missense_Mutation_p.V307L	p.V344L	NM_033331	NP_201588	WXS	Illumina HiSeq	Unspecified	O60729	CC14B_HUMAN			10	1482	-		Acute lymphoblastic leukemia(62;0.0559)	344			B.		A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Missense_Mutation	SNP	ENST00000375241.1	37	c.1030G>C	CCDS6722.1	.	.	.	.	.	.	.	.	.	.	C	9.928	1.214105	0.22289	.	.	ENSG00000081377	ENST00000265659;ENST00000375241;ENST00000375240;ENST00000375242;ENST00000463569;ENST00000375236	D;D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01;-2.01	5.2	-2.67	0.06059	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (1);	0.321554	0.35124	N	0.003426	T	0.51550	0.1681	N	0.01209	-0.955	0.34802	D	0.736818	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.54159	-0.8335	10	0.05525	T	0.97	-8.9316	7.0737	0.25193	0.0:0.1321:0.2673:0.6006	.	344;344;307	O60729-2;O60729;A8MQ20	.;CC14B_HUMAN;.	L	344;344;344;307;344;344	ENSP00000265659:V344L;ENSP00000364389:V344L;ENSP00000364388:V344L;ENSP00000364390:V307L;ENSP00000420572:V344L;ENSP00000364384:V344L	ENSP00000265659:V344L	V	-	1	0	CDC14B	98325745	1.000000	0.71417	0.656000	0.29637	0.981000	0.71138	2.093000	0.41710	-0.488000	0.06726	-0.300000	0.09419	GTC		0.527	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053278.2	NM_033331		20	63	0	0	0	0.003954	0	20	63				
ZNF510	22869	broad.mit.edu	37	9	99521121	99521121	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:99521121A>G	ENST00000375231.1	-	6	2641	c.1991T>C	c.(1990-1992)tTa>tCa	p.L664S	ZNF510_ENST00000223428.4_Missense_Mutation_p.L664S			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	664					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L664S(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				CTTCTTACATAATTTCCCATA	0.363																																							uc004awn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1990-1992)TTA>TCA		zinc finger protein 510							90.0	95.0	93.0					9																	99521121		2203	4300	6503	SO:0001583	missense	22869				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:99521121A>G	AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.1991T>C	9.37:g.99521121A>G	ENSP00000364379:p.Leu664Ser		Somatic				ZNF510_uc004awo.1_Missense_Mutation_p.L664S	p.L664S	NM_014930	NP_055745	WXS	Illumina HiSeq	Unspecified	Q9Y2H8	ZN510_HUMAN			6	2180	-		Acute lymphoblastic leukemia(62;0.0527)	664					Q5SZP5	Missense_Mutation	SNP	ENST00000375231.1	37	c.1991T>C	CCDS35074.1	.	.	.	.	.	.	.	.	.	.	A	13.67	2.305178	0.40795	.	.	ENSG00000081386	ENST00000375231;ENST00000223428	T;T	0.19938	2.11;2.11	2.92	1.75	0.24633	.	.	.	.	.	T	0.06325	0.0163	N	0.00985	-1.075	0.09310	N	1	B	0.33694	0.421	B	0.30029	0.11	T	0.23440	-1.0188	9	0.56958	D	0.05	.	6.3874	0.21568	0.745:0.0:0.0:0.255	.	664	Q9Y2H8	ZN510_HUMAN	S	664	ENSP00000364379:L664S;ENSP00000223428:L664S	ENSP00000223428:L664S	L	-	2	0	ZNF510	98560942	0.901000	0.30685	0.005000	0.12908	0.033000	0.12548	3.050000	0.49877	0.488000	0.27723	0.533000	0.62120	TTA		0.363	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053287.1	NM_014930		38	88	0	0	0	0.00361	0	38	88				
TEX10	54881	broad.mit.edu	37	9	103088600	103088600	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:103088600C>A	ENST00000374902.4	-	9	2139	c.1963G>T	c.(1963-1965)Ggg>Tgg	p.G655W	TEX10_ENST00000535814.1_Missense_Mutation_p.G658W	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	655						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)		p.G655W(1)		NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TGCAGTATCCCGATAAGCATG	0.418																																							uc004bas.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1963-1965)GGG>TGG		testis expressed 10 isoform 1							102.0	84.0	90.0					9																	103088600		2203	4300	6503	SO:0001583	missense	54881					integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding	g.chr9:103088600C>A	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1963G>T	9.37:g.103088600C>A	ENSP00000364037:p.Gly655Trp		Somatic				TEX10_uc011lvf.1_Missense_Mutation_p.G494W|TEX10_uc011lvg.1_Missense_Mutation_p.G658W	p.G655W	NM_017746	NP_060216	WXS	Illumina HiSeq	Unspecified	Q9NXF1	TEX10_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.157)	9	2178	-		Acute lymphoblastic leukemia(62;0.0527)	655					B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	37	c.1963G>T	CCDS6748.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.012821	0.35511	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730	.	.	.	5.67	4.58	0.56647	.	0.156920	0.64402	D	0.000019	T	0.41143	0.1146	N	0.24115	0.695	0.80722	D	1	B;B;B	0.30033	0.033;0.266;0.073	B;B;B	0.24974	0.013;0.057;0.029	T	0.41251	-0.9519	9	0.54805	T	0.06	-7.5461	11.1501	0.48453	0.1313:0.7916:0.0:0.0771	.	658;523;655	B4DYV2;E7ERG2;Q9NXF1	.;.;TEX10_HUMAN	W	658;655;523	.	ENSP00000364037:G655W	G	-	1	0	TEX10	102128421	0.999000	0.42202	1.000000	0.80357	0.988000	0.76386	2.910000	0.48766	2.662000	0.90505	0.591000	0.81541	GGG		0.418	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746		38	137	1	0	5.34276e-22	0.00361	7.33344e-22	38	137				
MSANTD3	91283	broad.mit.edu	37	9	103204311	103204311	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:103204311G>C	ENST00000395067.2	+	2	362	c.91G>C	c.(91-93)Gtg>Ctg	p.V31L	MSANTD3_ENST00000374885.1_Missense_Mutation_p.V31L|MSANTD3-TMEFF1_ENST00000502978.1_5'Flank|TMEFF1_ENST00000334943.6_5'Flank	NM_001198805.1|NM_001198806.1|NM_080655.2	NP_001185734.1|NP_001185735.1|NP_542386.1	Q96H12	MSD3_HUMAN	Myb/SANT-like DNA-binding domain containing 3	31	Myb-like.							p.V31L(2)		endometrium(2)|lung(2)	4						GTATAAATATGTGCTGGAATG	0.448																																							uc004bay.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(91-93)GTG>CTG		transmembrane protein with EGF-like and two							58.0	56.0	56.0					9																	103204311		2203	4300	6503	SO:0001583	missense	8577				multicellular organismal development	integral to membrane|plasma membrane		g.chr9:103204311G>C	BC008993	CCDS6749.1, CCDS56579.1	9q31.1	2012-03-13	2012-03-13	2012-03-13	ENSG00000066697	ENSG00000066697			23370	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 30"""	C9orf30			Standard	NM_080655		Approved	MGC17337		Q96H12	OTTHUMG00000020365	ENST00000395067.2:c.91G>C	9.37:g.103204311G>C	ENSP00000378506:p.Val31Leu		Somatic				C9orf30_uc004baw.2_Missense_Mutation_p.V31L|C9orf30_uc004bax.2_RNA	p.V31L	NM_003692	NP_003683	WXS	Illumina HiSeq	Unspecified	Q8IYR6	TEFF1_HUMAN			1	124	+		Acute lymphoblastic leukemia(62;0.0452)	Error:Variant_position_missing_in_Q8IYR6_after_alignment					B2RC35|Q5T726|Q5T727|Q5T728	Missense_Mutation	SNP	ENST00000395067.2	37	c.91G>C	CCDS6749.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570401	0.86542	.	.	ENSG00000066697	ENST00000395067;ENST00000398977;ENST00000374885;ENST00000374886	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	T	0.74839	0.3769	L	0.49126	1.545	0.45515	D	0.99847	D	0.57571	0.98	D	0.68621	0.959	T	0.70475	-0.4861	8	0.35671	T	0.21	-0.6244	19.1261	0.93384	0.0:0.0:1.0:0.0	.	31	Q96H12	CI030_HUMAN	L	31	.	ENSP00000364020:V31L	V	+	1	0	C9orf30	102244132	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.778000	0.75043	2.779000	0.95612	0.655000	0.94253	GTG		0.448	MSANTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053410.1	NM_080655		12	37	0	0	0	0.001855	0	12	37				
GRIN3A	116443	broad.mit.edu	37	9	104448937	104448937	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:104448937G>T	ENST00000361820.3	-	2	1845	c.1245C>A	c.(1243-1245)agC>agA	p.S415R		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	415					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.S415R(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	AGTTCATCGTGCTGGGAATGA	0.478																																							uc004bbp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(1243-1245)AGC>AGA		glutamate receptor, ionotropic,	Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)						165.0	136.0	146.0					9																	104448937		2203	4300	6503	SO:0001583	missense	116443				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding	g.chr9:104448937G>T		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1245C>A	9.37:g.104448937G>T	ENSP00000355155:p.Ser415Arg		Somatic				GRIN3A_uc004bbq.1_Missense_Mutation_p.S415R	p.S415R	NM_133445	NP_597702	WXS	Illumina HiSeq	Unspecified	Q8TCU5	NMD3A_HUMAN			2	1846	-		Acute lymphoblastic leukemia(62;0.0568)	415			Extracellular (Potential).		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	c.1245C>A	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726810	0.48833	.	.	ENSG00000198785	ENST00000361820	D	0.86164	-2.08	5.83	4.84	0.62591	.	0.106120	0.64402	D	0.000003	D	0.83202	0.5203	L	0.56769	1.78	0.42929	D	0.99431	B	0.16802	0.019	B	0.26094	0.066	T	0.78373	-0.2229	10	0.41790	T	0.15	.	7.0476	0.25055	0.1896:0.0:0.8104:0.0	.	415	Q8TCU5	NMD3A_HUMAN	R	415	ENSP00000355155:S415R	ENSP00000355155:S415R	S	-	3	2	GRIN3A	103488758	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.265000	0.33027	2.763000	0.94921	0.563000	0.77884	AGC		0.478	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			62	240	1	0	8.07507e-42	0.00361	1.29519e-41	62	240				
KLF4	9314	broad.mit.edu	37	9	110248160	110248160	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:110248160C>A	ENST00000374672.4	-	5	1785	c.1312G>T	c.(1312-1314)Gcc>Tcc	p.A438S		NM_004235.4	NP_004226.3	O43474	KLF4_HUMAN	Kruppel-like factor 4 (gut)	472					cellular response to cycloheximide (GO:0071409)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|epidermal cell differentiation (GO:0009913)|epidermis morphogenesis (GO:0048730)|fat cell differentiation (GO:0045444)|mesodermal cell fate determination (GO:0007500)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of muscle hyperplasia (GO:0014740)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic camera-type eye development (GO:0031077)|post-embryonic hemopoiesis (GO:0035166)|regulation of cell differentiation (GO:0045595)|response to retinoic acid (GO:0032526)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001010)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A429S(1)		breast(1)|central_nervous_system(3)|endometrium(5)|large_intestine(1)|lung(3)|pancreas(1)|prostate(2)	16						TCTGAGCGGGCGAATTTCCAT	0.493																																							uc004bdh.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|lung(1)	3						c.(1387-1389)GCC>TCC		Kruppel-like factor 4 (gut)							95.0	88.0	90.0					9																	110248160		2203	4300	6503	SO:0001583	missense	9314				fat cell differentiation|mesodermal cell fate determination|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|stem cell maintenance|transcription from RNA polymerase II promoter	nucleus	RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor recruiting transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr9:110248160C>A	AF022184	CCDS6770.2	9q31	2013-01-08			ENSG00000136826	ENSG00000136826		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6348	protein-coding gene	gene with protein product		602253				9422764, 16372018	Standard	NM_004235		Approved	EZF, GKLF	uc004bdg.3	O43474	OTTHUMG00000020449	ENST00000374672.4:c.1312G>T	9.37:g.110248160C>A	ENSP00000363804:p.Ala438Ser		Somatic				KLF4_uc004bdf.1_Missense_Mutation_p.A388S|KLF4_uc004bdg.2_Missense_Mutation_p.A438S	p.A463S	NM_004235	NP_004226	WXS	Illumina HiSeq	Unspecified	O43474	KLF4_HUMAN			4	2008	-			472			C2H2-type 2.		B2R8S4|B3KT79|L0R3I6|L0R4N5|P78338|Q5T3J8|Q5T3J9|Q8N717|Q9UNP3	Missense_Mutation	SNP	ENST00000374672.4	37	c.1387G>T	CCDS6770.2	.	.	.	.	.	.	.	.	.	.	C	19.29	3.799239	0.70567	.	.	ENSG00000136826	ENST00000374672	T	0.35605	1.3	5.82	5.82	0.92795	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38837	N	0.001541	T	0.47893	0.1470	N	0.16708	0.43	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.985;0.996	T	0.52548	-0.8561	10	0.72032	D	0.01	.	19.719	0.96135	0.0:1.0:0.0:0.0	.	472;438	O43474;O43474-1	KLF4_HUMAN;.	S	438	ENSP00000363804:A438S	ENSP00000363804:A438S	A	-	1	0	KLF4	109287981	1.000000	0.71417	0.973000	0.42090	0.291000	0.27294	7.818000	0.86416	2.756000	0.94617	0.563000	0.77884	GCC		0.493	KLF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053556.2	NM_004235		7	40	1	0	3.86212e-05	0.008291	4.15305e-05	7	40				
RABGAP1	23637	broad.mit.edu	37	9	125748687	125748687	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:125748687A>T	ENST00000373647.4	+	4	713	c.579A>T	c.(577-579)gaA>gaT	p.E193D		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	193	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.E121D(1)|p.E193D(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						ATGTGTCTGAAGGAATTGTGA	0.403																																							uc011lzh.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|kidney(2)	5						c.(577-579)GAA>GAT		RAB GTPase activating protein 1							170.0	166.0	168.0					9																	125748687		2203	4300	6503	SO:0001583	missense	23637				cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding	g.chr9:125748687A>T	AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.579A>T	9.37:g.125748687A>T	ENSP00000362751:p.Glu193Asp		Somatic				RABGAP1_uc004bnl.3_RNA|RABGAP1_uc004bnm.1_Missense_Mutation_p.E193D	p.E193D	NM_012197	NP_036329	WXS	Illumina HiSeq	Unspecified	Q9Y3P9	RBGP1_HUMAN			4	713	+			193			PID.		B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Missense_Mutation	SNP	ENST00000373647.4	37	c.579A>T	CCDS6848.2	.	.	.	.	.	.	.	.	.	.	A	8.831	0.939885	0.18281	.	.	ENSG00000011454	ENST00000373647;ENST00000317419;ENST00000426918	T	0.62941	-0.01	5.3	1.69	0.24217	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.60907	0.2305	N	0.22421	0.69	0.80722	D	1	B;D	0.61697	0.003;0.99	B;D	0.73380	0.018;0.98	T	0.53774	-0.8391	10	0.30854	T	0.27	-19.3125	8.4646	0.32949	0.775:0.0:0.225:0.0	.	193;193	Q9Y3P9;Q9Y3P9-4	RBGP1_HUMAN;.	D	193;193;24	ENSP00000362751:E193D	ENSP00000324973:E193D	E	+	3	2	RABGAP1	124788508	1.000000	0.71417	0.999000	0.59377	0.352000	0.29268	1.042000	0.30303	0.051000	0.15978	0.374000	0.22700	GAA		0.403	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197		183	214	0	0	0	0.00361	0	183	214				
NR6A1	2649	broad.mit.edu	37	9	127300525	127300525	+	Nonsense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:127300525G>A	ENST00000487099.2	-	6	827	c.670C>T	c.(670-672)Caa>Taa	p.Q224*	NR6A1_ENST00000416460.2_Nonsense_Mutation_p.Q219*|NR6A1_ENST00000373584.3_Nonsense_Mutation_p.Q220*|NR6A1_ENST00000344523.4_Nonsense_Mutation_p.Q223*	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	224	Sufficient for interaction with UIMC1. {ECO:0000250}.				cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.Q224*(1)		NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						GGTATATATTGGTAATGTGGA	0.488																																					Esophageal Squamous(192;272 2884 6208 20560)	Esophageal Squamous(192;272 2884 6208 20560)	uc004bor.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(670-672)CAA>TAA		nuclear receptor subfamily 6, group A, member 1							181.0	170.0	174.0					9																	127300525		2203	4300	6503	SO:0001587	stop_gained	2649				cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr9:127300525G>A	U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.670C>T	9.37:g.127300525G>A	ENSP00000420267:p.Gln224*		Somatic				NR6A1_uc004boq.1_Nonsense_Mutation_p.Q219*|NR6A1_uc010mwq.1_Nonsense_Mutation_p.Q220*	p.Q224*	NM_033334	NP_201591	WXS	Illumina HiSeq	Unspecified	Q15406	NR6A1_HUMAN			6	848	-			224			Sufficient for interaction with UIMC1 (By similarity).		O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Nonsense_Mutation	SNP	ENST00000487099.2	37	c.670C>T	CCDS35137.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384137	0.82792	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523;ENST00000475178	.	.	.	5.39	5.39	0.77823	.	0.052613	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	18.1297	0.89597	0.0:0.0:1.0:0.0	.	.	.	.	X	224;220;219;223;182	.	ENSP00000341135:Q223X	Q	-	1	0	NR6A1	126340346	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.434000	0.97515	2.529000	0.85273	0.561000	0.74099	CAA		0.488	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054043.4			74	69	0	0	0	0.00361	0	74	69				
TRUB2	26995	broad.mit.edu	37	9	131087468	131087468	+	5'Flank	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:131087468G>T	ENST00000372890.4	-	0	0				COQ4_ENST00000300452.3_Missense_Mutation_p.K83N|TRUB2_ENST00000546104.1_5'Flank|COQ4_ENST00000372875.3_Missense_Mutation_p.K83N|TRUB2_ENST00000460320.1_5'Flank	NM_015679.1	NP_056494.1	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase family member 2						pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.K83N(1)		kidney(2)|large_intestine(2)|lung(3)|ovary(1)	8						GCACCCTGAAGGTCCTCAGGG	0.567																																							uc004bur.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(247-249)AAG>AAT		coenzyme Q4 homolog precursor							64.0	59.0	61.0					9																	131087468		2203	4300	6503	SO:0001631	upstream_gene_variant	51117				ubiquinone biosynthetic process	mitochondrial inner membrane		g.chr9:131087468G>T	AK001956	CCDS6897.1	9q34.11	2014-01-28	2013-09-02		ENSG00000167112	ENSG00000167112			17170	protein-coding gene	gene with protein product		610727	"""TruB pseudouridine (psi) synthase homolog 2 (E. coli)"""			12736709	Standard	NM_015679		Approved	CLONE24922	uc004buq.1	O95900	OTTHUMG00000020741		9.37:g.131087468G>T	Exception_encountered		Somatic				TRUB2_uc004buq.1_5'Flank|COQ4_uc011max.1_Missense_Mutation_p.K83N|COQ4_uc004bus.2_Missense_Mutation_p.K59N|COQ4_uc010mxy.2_Missense_Mutation_p.K59N	p.K83N	NM_016035	NP_057119	WXS	Illumina HiSeq	Unspecified	Q9Y3A0	COQ4_HUMAN			3	596	+			83					B7Z7G5	Missense_Mutation	SNP	ENST00000372890.4	37	c.249G>T	CCDS6897.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.911093	0.33721	.	.	ENSG00000167113	ENST00000300452;ENST00000372875	T;T	0.44482	0.92;0.92	5.59	1.66	0.24008	.	0.719952	0.14214	N	0.333870	T	0.38957	0.1060	L	0.58583	1.82	0.09310	N	1	P;B	0.45078	0.85;0.351	P;B	0.45971	0.499;0.187	T	0.17837	-1.0356	10	0.23302	T	0.38	-43.2956	5.706	0.17909	0.462:0.1357:0.4023:0.0	.	83;83	Q5T4B9;Q9Y3A0	.;COQ4_HUMAN	N	83	ENSP00000300452:K83N;ENSP00000361966:K83N	ENSP00000300452:K83N	K	+	3	2	COQ4	130127289	0.000000	0.05858	0.978000	0.43139	0.975000	0.68041	-0.465000	0.06680	0.042000	0.15717	0.558000	0.71614	AAG		0.567	TRUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054419.1	NM_015679		17	26	1	0	6.94344e-10	0.006122	8.10778e-10	17	26				
NUP188	23511	broad.mit.edu	37	9	131731775	131731775	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:131731775G>T	ENST00000372577.2	+	10	915	c.894G>T	c.(892-894)caG>caT	p.Q298H		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	298					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.Q298H(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						AGTTTGCGCAGGATGGGCTTA	0.423																																							uc004bws.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						c.(892-894)CAG>CAT		nucleoporin 188kDa							133.0	112.0	119.0					9																	131731775		2203	4300	6503	SO:0001583	missense	23511				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr9:131731775G>T	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.894G>T	9.37:g.131731775G>T	ENSP00000361658:p.Gln298His		Somatic					p.Q298H	NM_015354	NP_056169	WXS	Illumina HiSeq	Unspecified	Q5SRE5	NU188_HUMAN			10	916	+			298					Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	c.894G>T	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514292	0.44763	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.32753	1.44	5.79	5.79	0.91817	.	0.541810	0.21178	N	0.078868	T	0.21468	0.0517	N	0.14661	0.345	0.25275	N	0.989482	B	0.30973	0.302	B	0.36766	0.232	T	0.18461	-1.0336	10	0.44086	T	0.13	-9.7489	10.0546	0.42237	0.0:0.1477:0.6989:0.1533	.	298	Q5SRE5	NU188_HUMAN	H	187;298	ENSP00000361658:Q298H	ENSP00000349125:Q187H	Q	+	3	2	NUP188	130771596	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.715000	0.25822	2.722000	0.93159	0.655000	0.94253	CAG		0.423	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			48	162	1	0	2.76378e-25	0.00361	3.86794e-25	48	162				
QSOX2	169714	broad.mit.edu	37	9	139115927	139115927	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:139115927C>T	ENST00000358701.5	-	4	547	c.510G>A	c.(508-510)caG>caA	p.Q170Q		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	170	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)	p.Q170Q(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		CAATCATCGTCTGTCTGACTG	0.627																																							uc010nbi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(508-510)CAG>CAA		quiescin Q6 sulfhydryl oxidase 2 precursor							119.0	104.0	109.0					9																	139115927		2203	4300	6503	SO:0001819	synonymous_variant	169714				cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity	g.chr9:139115927C>T	AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.510G>A	9.37:g.139115927C>T			Somatic					p.Q170Q	NM_181701	NP_859052	WXS	Illumina HiSeq	Unspecified	Q6ZRP7	QSOX2_HUMAN		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)	4	548	-		Myeloproliferative disorder(178;0.0511)	170			Thioredoxin.		A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Silent	SNP	ENST00000358701.5	37	c.510G>A	CCDS35178.1	.	.	.	.	.	.	.	.	.	.	C	3.888	-0.024562	0.07589	.	.	ENSG00000165661	ENST00000455222	.	.	.	5.18	-10.4	0.00318	.	.	.	.	.	T	0.29061	0.0722	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35101	-0.9802	4	.	.	.	-2.6721	12.6959	0.57003	0.0:0.1811:0.5758:0.243	.	.	.	.	N	17	.	.	D	-	1	0	QSOX2	138255748	0.001000	0.12720	0.000000	0.03702	0.441000	0.31987	-1.038000	0.03553	-2.000000	0.00965	0.467000	0.42956	GAC		0.627	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701		16	25	0	0	0	0.007413	0	16	25				
QSOX2	169714	broad.mit.edu	37	9	139115958	139115958	+	Splice_Site	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:139115958C>T	ENST00000358701.5	-	4	516	c.479G>A	c.(478-480)gGa>gAa	p.G160E		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	160	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)	p.G160E(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		TCGGTCAGGTCCTGCCGGAAG	0.657																																							uc010nbi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(478-480)GGA>GAA		quiescin Q6 sulfhydryl oxidase 2 precursor							88.0	75.0	80.0					9																	139115958		2203	4300	6503	SO:0001630	splice_region_variant	169714				cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity	g.chr9:139115958C>T	AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.479-1G>A	9.37:g.139115958C>T			Somatic					p.G160E	NM_181701	NP_859052	WXS	Illumina HiSeq	Unspecified	Q6ZRP7	QSOX2_HUMAN		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)	4	517	-		Myeloproliferative disorder(178;0.0511)	160			Thioredoxin.		A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	ENST00000358701.5	37	c.479G>A	CCDS35178.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.450778	0.63290	.	.	ENSG00000165661	ENST00000358701;ENST00000389471	T	0.69175	-0.38	5.18	5.18	0.71444	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.79718	0.4494	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.76798	-0.2826	10	0.02654	T	1	.	17.672	0.88221	0.0:1.0:0.0:0.0	.	160	Q6ZRP7	QSOX2_HUMAN	E	160;38	ENSP00000351536:G160E	ENSP00000351536:G160E	G	-	2	0	QSOX2	138255779	1.000000	0.71417	0.947000	0.38551	0.151000	0.21798	6.781000	0.75068	2.419000	0.82065	0.467000	0.42956	GGA		0.657	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055046.2	NM_181701	Missense_Mutation	11	21	0	0	0	0.00245	0	11	21				
PPP2R3B	28227	broad.mit.edu	37	X	308043	308043	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:308043C>A	ENST00000390665.3	-	4	661	c.643G>T	c.(643-645)Gcc>Tcc	p.A215S		NM_013239.4	NP_037371.2	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'', beta	215					cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|phosphoprotein phosphatase activity (GO:0004721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.A215S(1)|p.A215T(1)		endometrium(5)|lung(5)|skin(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACGAACTTGGCCGCGTCGTCG	0.617																																							uc004cpg.2		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)		0						c.(643-645)GCC>TCC		protein phosphatase 2, regulatory subunit B'',							209.0	227.0	221.0					X																	308043		2101	4195	6296	SO:0001583	missense	28227				cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity	g.chrX:308043C>A	AF215840	CCDS14104.1	Xp22.3 and Yp11.3	2013-01-10	2010-06-18		ENSG00000167393	ENSG00000167393		"""Pseudoautosomal regions / PAR1"", ""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	13417	protein-coding gene	gene with protein product		300339	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta"""	PPP2R3L		11173861	Standard	NM_013239		Approved	PPP2R3LY, PR48	uc004cpg.3	Q9Y5P8	OTTHUMG00000021052	ENST00000390665.3:c.643G>T	X.37:g.308043C>A	ENSP00000375080:p.Ala215Ser		Somatic				PPP2R3B_uc011mha.1_Missense_Mutation_p.A54S	p.A215S	NM_013239	NP_037371	WXS	Illumina HiSeq	Unspecified	Q9Y5P8	P2R3B_HUMAN			4	844	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	215					Q6P4G9|Q7RTT1|Q96H01	Missense_Mutation	SNP	ENST00000390665.3	37	c.643G>T	CCDS14104.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.673539	0.00104	.	.	ENSG00000167393	ENST00000390665	T	0.29917	1.55	2.14	-0.0182	0.13965	.	0.149402	0.45126	U	0.000392	T	0.07999	0.0200	N	0.02120	-0.675	0.09310	N	1	B;B	0.22604	0.072;0.007	B;B	0.27076	0.076;0.019	T	0.34675	-0.9819	10	0.02654	T	1	.	4.2472	0.10677	0.0:0.5758:0.2133:0.2109	.	54;215	B4DE79;Q9Y5P8	.;P2R3B_HUMAN	S	215	ENSP00000375080:A215S	ENSP00000375080:A215S	A	-	1	0	PPP2R3B	228043	0.634000	0.27190	0.005000	0.12908	0.040000	0.13550	0.912000	0.28597	-0.376000	0.07943	0.174000	0.16983	GCC		0.617	PPP2R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055577.2	NM_013239		5	29	1	0	0.00116845	0.001168	0.00121527	5	29				
MXRA5	25878	broad.mit.edu	37	X	3235270	3235270	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:3235270G>T	ENST00000217939.6	-	6	6606	c.6452C>A	c.(6451-6453)aCc>aAc	p.T2151N		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2151	Ig-like C2-type 6.					extracellular vesicular exosome (GO:0070062)		p.T2151N(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CCGCGGGGAGGTGCCCGTGAT	0.711																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(6451-6453)ACC>AAC		adlican precursor							29.0	24.0	25.0					X																	3235270		2203	4299	6502	SO:0001583	missense	25878					extracellular region		g.chrX:3235270G>T	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6452C>A	X.37:g.3235270G>T	ENSP00000217939:p.Thr2151Asn		Somatic					p.T2151N	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			6	6609	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	2151			Ig-like C2-type 6.		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.6452C>A	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.294000	0.23564	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.68331	-0.32	3.48	1.36	0.22044	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.446860	0.15974	U	0.235607	T	0.68137	0.2968	L	0.33137	0.985	0.09310	N	1	D	0.59767	0.986	P	0.59056	0.851	T	0.62310	-0.6881	10	0.41790	T	0.15	.	13.9646	0.64200	0.0:0.4561:0.5439:0.0	.	2151	Q9NR99	MXRA5_HUMAN	N	2151	ENSP00000217939:T2151N	ENSP00000217939:T2151N	T	-	2	0	MXRA5	3245270	0.967000	0.33354	0.002000	0.10522	0.002000	0.02628	2.415000	0.44635	0.336000	0.23639	0.597000	0.82753	ACC		0.711	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		18	4	1	0	8.24728e-16	0.004656	1.04186e-15	18	4				
FRMPD4	9758	broad.mit.edu	37	X	12735148	12735148	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:12735148C>A	ENST00000380682.1	+	15	3076	c.2570C>A	c.(2569-2571)gCc>gAc	p.A857D		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	857					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.A847D(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CCCACCAGCGCCGAAGGCAAG	0.572																																							uc004cuz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						c.(2569-2571)GCC>GAC		FERM and PDZ domain containing 4							99.0	92.0	94.0					X																	12735148		2203	4300	6503	SO:0001583	missense	9758				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chrX:12735148C>A	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2570C>A	X.37:g.12735148C>A	ENSP00000370057:p.Ala857Asp		Somatic				FRMPD4_uc011mij.1_Missense_Mutation_p.A849D	p.A857D	NM_014728	NP_055543	WXS	Illumina HiSeq	Unspecified	Q14CM0	FRPD4_HUMAN			15	3076	+			857					A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	c.2570C>A	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.488697	0.26686	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.06218	3.33	5.15	5.15	0.70609	.	0.631054	0.16998	N	0.191032	T	0.08582	0.0213	L	0.44542	1.39	0.09310	N	1	B;B	0.28820	0.224;0.224	B;B	0.21360	0.034;0.034	T	0.15235	-1.0444	10	0.54805	T	0.06	.	18.0655	0.89389	0.0:1.0:0.0:0.0	.	849;857	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	D	857;848;846	ENSP00000370057:A857D	ENSP00000304583:A846D	A	+	2	0	FRMPD4	12645069	0.481000	0.25941	0.399000	0.26333	0.878000	0.50629	3.650000	0.54424	2.289000	0.77006	0.600000	0.82982	GCC		0.572	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		76	63	1	0	5.64992e-62	0.00361	9.71718e-62	76	63				
TLR8	51311	broad.mit.edu	37	X	12940213	12940213	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:12940213G>T	ENST00000218032.6	+	2	3141	c.3054G>T	c.(3052-3054)ctG>ctT	p.L1018L	TLR8_ENST00000311912.5_Silent_p.L1036L	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	1018	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	GGCAAACTCTGAGAAATGTGG	0.443																																							uc004cve.2		NA																	0				ovary(4)|lung(2)|large_intestine(1)	7						c.(3052-3054)CTG>CTT		toll-like receptor 8 precursor							138.0	132.0	134.0					X																	12940213		2203	4300	6503	SO:0001819	synonymous_variant	51311				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity	g.chrX:12940213G>T	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.3054G>T	X.37:g.12940213G>T			Somatic				TLR8_uc004cvd.2_Silent_p.L1036L	p.L1018L	NM_138636	NP_619542	WXS	Illumina HiSeq	Unspecified	Q9NR97	TLR8_HUMAN			2	3122	+			1018			Cytoplasmic (Potential).|TIR.		B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Silent	SNP	ENST00000218032.6	37	c.3054G>T	CCDS14152.1																																																																																				0.443	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610		8	242	1	0	2.17888e-05	0.006214	2.35187e-05	8	242				
NHS	4810	broad.mit.edu	37	X	17746185	17746185	+	Missense_Mutation	SNP	T	T	A	rs368703052		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:17746185T>A	ENST00000380060.3	+	6	4234	c.3896T>A	c.(3895-3897)gTg>gAg	p.V1299E	NHS_ENST00000398097.3_Missense_Mutation_p.V1143E	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1320					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.V1299E(1)|p.V1143E(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					CCTGAATCTGTGGATGTAATC	0.438																																							uc004cxx.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(3895-3897)GTG>GAG		Nance-Horan syndrome protein isoform 1							90.0	81.0	84.0					X																	17746185		2203	4300	6503	SO:0001583	missense	4810					nucleus		g.chrX:17746185T>A		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.3896T>A	X.37:g.17746185T>A	ENSP00000369400:p.Val1299Glu		Somatic				NHS_uc011mix.1_Missense_Mutation_p.V1320E|NHS_uc004cxy.2_Missense_Mutation_p.V1143E|NHS_uc004cxz.2_Missense_Mutation_p.V1122E|NHS_uc004cya.2_Missense_Mutation_p.V1022E	p.V1299E	NM_198270	NP_938011	WXS	Illumina HiSeq	Unspecified	Q6T4R5	NHS_HUMAN			6	4234	+	Hepatocellular(33;0.183)		1299					B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	c.3896T>A	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	T	6.108	0.388269	0.11581	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.47528	0.84;0.87	5.74	-1.01	0.10169	.	0.994946	0.08152	N	0.989952	T	0.29190	0.0726	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.30973	0.001;0.001;0.001;0.302	B;B;B;B	0.34779	0.004;0.004;0.004;0.189	T	0.24941	-1.0146	10	0.09590	T	0.72	-0.142	2.9296	0.05795	0.0874:0.2773:0.2244:0.4109	.	1320;1141;1143;1299	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	E	1299;1143;1141	ENSP00000369400:V1299E;ENSP00000381170:V1143E	ENSP00000369397:V1141E	V	+	2	0	NHS	17656106	0.000000	0.05858	0.001000	0.08648	0.878000	0.50629	-0.572000	0.05881	-0.249000	0.09569	-0.377000	0.06932	GTG		0.438	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270		67	89	0	0	0	0.00361	0	67	89				
SUPT20HL1	100130302	broad.mit.edu	37	X	24381889	24381889	+	IGR	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:24381889G>A								AC004552.1 (14866 upstream) : PDK3 (101448 downstream)														p.G445R(1)									AGACCCTTTTGGATTTGCGTT	0.527																																							uc011mjx.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(1012-1014)GGA>AGA		hypothetical protein LOC100130302							138.0	119.0	125.0					X																	24381889		1568	3582	5150	SO:0001628	intergenic_variant	100130302							g.chrX:24381889G>A																													X.37:g.24381889G>A			Somatic					p.G338R	NM_001136234	NP_001129706	WXS	Illumina HiSeq	Unspecified					1	1012	+									Missense_Mutation	SNP		37	c.1012G>A																																																																																				0	0.527									90	59	0	0	0	0.00361	0	90	59				
MAGEB2	4113	broad.mit.edu	37	X	30237624	30237624	+	Missense_Mutation	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:30237624A>T	ENST00000378988.4	+	2	1028	c.927A>T	c.(925-927)gaA>gaT	p.E309D		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	309	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.E309D(2)		breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						ATTACGAAGAAGCTTTGAAAG	0.498																																							uc004dbz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(925-927)GAA>GAT		melanoma antigen family B, 2							38.0	41.0	40.0					X																	30237624		2201	4300	6501	SO:0001583	missense	4113						protein binding	g.chrX:30237624A>T	AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.927A>T	X.37:g.30237624A>T	ENSP00000368273:p.Glu309Asp		Somatic					p.E309D	NM_002364	NP_002355	WXS	Illumina HiSeq	Unspecified	O15479	MAGB2_HUMAN			2	1030	+			309			MAGE.		O75860	Missense_Mutation	SNP	ENST00000378988.4	37	c.927A>T	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	A	12.10	1.837194	0.32513	.	.	ENSG00000099399	ENST00000378988	T	0.02258	4.37	3.27	-2.15	0.07102	.	0.182301	0.45361	D	0.000367	T	0.03263	0.0095	M	0.83603	2.65	0.09310	N	1	P	0.40909	0.732	B	0.38378	0.272	T	0.23547	-1.0185	10	0.49607	T	0.09	.	4.4499	0.11616	0.5356:0.1806:0.2839:0.0	.	309	O15479	MAGB2_HUMAN	D	309	ENSP00000368273:E309D	ENSP00000368273:E309D	E	+	3	2	MAGEB2	30147545	0.000000	0.05858	0.003000	0.11579	0.022000	0.10575	-1.948000	0.01533	-0.718000	0.04949	-0.466000	0.05196	GAA		0.498	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	NM_002364		38	12	0	0	0	0.007835	0	38	12				
FAM47A	158724	broad.mit.edu	37	X	34148608	34148608	+	Silent	SNP	A	A	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:34148608A>T	ENST00000346193.3	-	1	1839	c.1788T>A	c.(1786-1788)tcT>tcA	p.S596S		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	596								p.S596S(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GAAGAGAGTCAGAAACGCACT	0.453																																							uc004ddg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(1786-1788)TCT>TCA		hypothetical protein LOC158724							98.0	89.0	92.0					X																	34148608		2148	4258	6406	SO:0001819	synonymous_variant	158724							g.chrX:34148608A>T	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1788T>A	X.37:g.34148608A>T			Somatic					p.S596S	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	1821	-			596					A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	c.1788T>A	CCDS43926.1																																																																																				0.453	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		7	75	0	0	0	0.00308	0	7	75				
TSPAN7	7102	broad.mit.edu	37	X	38525426	38525426	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:38525426G>T	ENST00000378482.2	+	2	310	c.133G>T	c.(133-135)Ggc>Tgc	p.G45C	TSPAN7_ENST00000545599.1_Missense_Mutation_p.G19C|TM4SF2_ENST00000465127.1_Missense_Mutation_p.G75C|TSPAN7_ENST00000488893.1_3'UTR|TSPAN7_ENST00000286824.6_Missense_Mutation_p.G62C|TSPAN7_ENST00000422612.2_Missense_Mutation_p.G71C	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7	45					viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)		p.G45C(1)|p.G40C(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						ACTTACTCTGGGCACCTATAT	0.502																																							uc004deg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(133-135)GGC>TGC		tetraspanin 7							168.0	122.0	138.0					X																	38525426		2202	4300	6502	SO:0001583	missense	7102				interspecies interaction between organisms	integral to plasma membrane		g.chrX:38525426G>T	D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.133G>T	X.37:g.38525426G>T	ENSP00000367743:p.Gly45Cys		Somatic				TSPAN7_uc011mkj.1_Missense_Mutation_p.G71C|TSPAN7_uc011mkk.1_Missense_Mutation_p.G62C|TSPAN7_uc004deh.2_5'UTR	p.G45C	NM_004615	NP_004606	WXS	Illumina HiSeq	Unspecified	P41732	TSN7_HUMAN			2	202	+			45			Extracellular (Potential).		B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Missense_Mutation	SNP	ENST00000378482.2	37	c.133G>T	CCDS14248.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711969	0.89112	.	.	ENSG00000250349;ENSG00000156298;ENSG00000156298;ENSG00000156298;ENSG00000156298	ENST00000465127;ENST00000378482;ENST00000422612;ENST00000286824;ENST00000545599	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.90222	0.6943	M	0.79805	2.47	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.74674	0.971;0.984;0.95	D	0.90194	0.4252	9	.	.	.	.	18.9583	0.92668	0.0:0.0:1.0:0.0	.	62;71;45	B4DDG0;B4DEA5;P41732	.;.;TSN7_HUMAN	C	75;45;71;62;19	ENSP00000417050:G75C;ENSP00000367743:G45C;ENSP00000388954:G71C;ENSP00000286824:G62C;ENSP00000441540:G19C	.	G	+	1	0	RP5-972B16.2;TSPAN7	38410370	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	9.476000	0.97823	2.424000	0.82194	0.594000	0.82650	GGC		0.502	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356412.1			47	37	1	0	1.67211e-32	0.00361	2.46712e-32	47	37				
ZNF157	7712	broad.mit.edu	37	X	47271905	47271905	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:47271905G>T	ENST00000377073.3	+	4	519	c.433G>T	c.(433-435)Gag>Tag	p.E145*		NM_003446.3	NP_003437.2	P51786	ZN157_HUMAN	zinc finger protein 157	145					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E145*(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						AGCCTTCCATGAGAAAACAGG	0.388																																							uc004dhr.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(433-435)GAG>TAG		zinc finger protein 157							83.0	71.0	75.0					X																	47271905		2203	4300	6503	SO:0001587	stop_gained	7712				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:47271905G>T	U28687	CCDS14278.1	Xp11.2	2013-01-08	2006-08-22		ENSG00000147117	ENSG00000147117		"""Zinc fingers, C2H2-type"", ""-"""	12942	protein-coding gene	gene with protein product		300024	"""zinc finger protein 157 (HZF22)"""			8586441	Standard	NM_003446		Approved	HZF22	uc004dhr.1	P51786	OTTHUMG00000021443	ENST00000377073.3:c.433G>T	X.37:g.47271905G>T	ENSP00000366273:p.Glu145*		Somatic					p.E145*	NM_003446	NP_003437	WXS	Illumina HiSeq	Unspecified	P51786	ZN157_HUMAN			4	502	+			145					Q96LE9	Nonsense_Mutation	SNP	ENST00000377073.3	37	c.433G>T	CCDS14278.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109167	0.56398	.	.	ENSG00000147117	ENST00000377073	.	.	.	2.95	-0.507	0.11985	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	3.0026	0.06018	0.3666:0.0:0.4248:0.2086	.	.	.	.	X	145	.	ENSP00000366273:E145X	E	+	1	0	ZNF157	47156849	0.000000	0.05858	0.001000	0.08648	0.476000	0.33039	-0.970000	0.03810	-0.214000	0.10078	0.529000	0.55759	GAG		0.388	ZNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056415.1	NM_003446		109	75	1	0	6.95862e-65	0.00361	1.21139e-64	109	75				
FTSJ1	24140	broad.mit.edu	37	X	48340805	48340805	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:48340805C>A	ENST00000348411.2	+	10	993	c.670C>A	c.(670-672)Cag>Aag	p.Q224K	FTSJ1_ENST00000456787.1_Missense_Mutation_p.Q222K|FTSJ1_ENST00000496365.1_3'UTR|FTSJ1_ENST00000396894.4_Missense_Mutation_p.Q87K|FTSJ1_ENST00000019019.2_Missense_Mutation_p.Q222K	NM_012280.2	NP_036412.1			FtsJ RNA methyltransferase homolog 1 (E. coli)									p.Q224K(1)		breast(1)|central_nervous_system(1)|lung(4)|skin(1)	7						AGATTTCAACCAGCTGGATGG	0.582																																							uc004djo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(670-672)CAG>AAG		FtsJ homolog 1 isoform a							118.0	77.0	91.0					X																	48340805		2203	4300	6503	SO:0001583	missense	24140				RNA methylation|rRNA processing		methyltransferase activity|nucleic acid binding	g.chrX:48340805C>A	AJ005892	CCDS14294.1, CCDS14295.1, CCDS75972.1	Xp11.23	2012-06-12	2012-06-12		ENSG00000068438	ENSG00000068438			13254	protein-coding gene	gene with protein product	"""tRNA methyltransferase 7 homolog (S. cerevisiae)"""	300499	"""mental retardation, X-linked 9"", ""mental retardation, X-linked 44"""	MRX9, MRX44		15342698, 15162322	Standard	XR_246715		Approved	JM23, CDLIV, SPB1, TRM7, TRMT7	uc004djo.1	Q9UET6	OTTHUMG00000024118	ENST00000348411.2:c.670C>A	X.37:g.48340805C>A	ENSP00000326948:p.Gln224Lys		Somatic				FTSJ1_uc004djl.2_Missense_Mutation_p.Q222K|FTSJ1_uc004djm.2_Missense_Mutation_p.Q224K|FTSJ1_uc004djn.1_Missense_Mutation_p.Q222K|FTSJ1_uc004djp.1_Missense_Mutation_p.Q222K|FTSJ1_uc011mlw.1_Missense_Mutation_p.Q87K	p.Q224K	NM_012280	NP_036412	WXS	Illumina HiSeq	Unspecified	Q9UET6	RRMJ1_HUMAN			10	993	+			224						Missense_Mutation	SNP	ENST00000348411.2	37	c.670C>A	CCDS14294.1	.	.	.	.	.	.	.	.	.	.	c	13.82	2.352083	0.41700	.	.	ENSG00000068438	ENST00000019019;ENST00000348411;ENST00000396894;ENST00000456787	T;T;T	0.40756	1.02;1.02;1.02	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.33177	0.0854	L	0.55103	1.725	0.45822	D	0.998696	B;B;B;B	0.33345	0.409;0.012;0.049;0.006	B;B;B;B	0.27715	0.082;0.009;0.021;0.009	T	0.11518	-1.0584	10	0.08381	T	0.77	-36.1278	13.3465	0.60575	0.0:1.0:0.0:0.0	.	87;224;222;222	B7Z4K4;Q9UET6;Q9UET6-2;B3KN91	.;RRMJ1_HUMAN;.;.	K	222;224;87;222	ENSP00000019019:Q222K;ENSP00000326948:Q224K;ENSP00000415457:Q222K	ENSP00000019019:Q222K	Q	+	1	0	FTSJ1	48225749	1.000000	0.71417	0.986000	0.45419	0.968000	0.65278	6.603000	0.74145	2.305000	0.77605	0.445000	0.29226	CAG		0.582	FTSJ1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060726.1			6	45	1	0	8.12818e-05	0.001984	8.67513e-05	6	45				
ZXDB	158586	broad.mit.edu	37	X	57620678	57620678	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:57620678G>T	ENST00000374888.1	+	1	2410	c.2197G>T	c.(2197-2199)Gac>Tac	p.D733Y		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	733					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.D733Y(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						GCTAACAGTGGACACAGATGC	0.502																																							uc004dvd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2197-2199)GAC>TAC		zinc finger, X-linked, duplicated B							132.0	96.0	108.0					X																	57620678		2203	4300	6503	SO:0001583	missense	158586				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chrX:57620678G>T	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.2197G>T	X.37:g.57620678G>T	ENSP00000364023:p.Asp733Tyr		Somatic					p.D733Y	NM_007157	NP_009088	WXS	Illumina HiSeq	Unspecified	P98169	ZXDB_HUMAN			1	2410	+			733					A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	c.2197G>T	CCDS35313.1	.	.	.	.	.	.	.	.	.	.	.	12.53	1.964545	0.34659	.	.	ENSG00000198455	ENST00000374888	T	0.09911	2.93	3.91	3.91	0.45181	.	0.167032	0.51477	D	0.000085	T	0.19765	0.0475	L	0.53249	1.67	0.48288	D	0.999623	P	0.51791	0.948	P	0.53722	0.733	T	0.00834	-1.1547	10	0.48119	T	0.1	.	12.7657	0.57391	0.0:0.0:1.0:0.0	.	733	P98169	ZXDB_HUMAN	Y	733	ENSP00000364023:D733Y	ENSP00000364023:D733Y	D	+	1	0	ZXDB	57637403	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.113000	0.77095	1.954000	0.56735	0.529000	0.55759	GAC		0.502	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157		22	17	1	0	7.38237e-10	0.00632	8.60272e-10	22	17				
ZXDA	7789	broad.mit.edu	37	X	57935364	57935364	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:57935364C>T	ENST00000358697.4	-	1	1703	c.1491G>A	c.(1489-1491)ctG>ctA	p.L497L		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	497	Required for interaction with ZXDC.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L497L(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						TGTGGCCTTTCAGATGTTCGG	0.542																																							uc004dve.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1489-1491)CTG>CTA		zinc finger, X-linked, duplicated A							73.0	65.0	68.0					X																	57935364		2203	4300	6503	SO:0001819	synonymous_variant	7789				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:57935364C>T	L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.1491G>A	X.37:g.57935364C>T			Somatic					p.L497L	NM_007156	NP_009087	WXS	Illumina HiSeq	Unspecified	P98168	ZXDA_HUMAN			1	1704	-			497			C2H2-type 8.|Required for interaction with ZXDC.		Q9UJP7	Silent	SNP	ENST00000358697.4	37	c.1491G>A	CCDS14376.1																																																																																				0.542	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156		24	20	0	0	0	0.00632	0	24	20				
AMER1	139285	broad.mit.edu	37	X	63411404	63411404	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:63411404G>T	ENST00000330258.3	-	2	2035	c.1763C>A	c.(1762-1764)gCt>gAt	p.A588D	AMER1_ENST00000374869.3_Missense_Mutation_p.A588D|AMER1_ENST00000403336.1_Missense_Mutation_p.A588D	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	588					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.A588D(2)									CCTGGCATGAGCTTCTCGGGC	0.607																																							uc004dvo.2		NA																	69	Whole gene deletion(67)|Substitution - Missense(2)	p.0?(40)	kidney(65)|lung(2)|ovary(1)|large_intestine(1)	kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						c.(1762-1764)GCT>GAT		family with sequence similarity 123B							53.0	49.0	50.0					X																	63411404		2203	4300	6503	SO:0001583	missense	139285				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		g.chrX:63411404G>T	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1763C>A	X.37:g.63411404G>T	ENSP00000329117:p.Ala588Asp		Somatic					p.A588D	NM_152424	NP_689637	WXS	Illumina HiSeq	Unspecified	Q5JTC6	F123B_HUMAN			2	2036	-			588					A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	c.1763C>A	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772725	0.31411	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.48836	0.8;0.81;0.8	4.07	4.07	0.47477	.	0.559564	0.16386	N	0.216691	T	0.43433	0.1247	L	0.52573	1.65	0.09310	N	1	P	0.38195	0.622	B	0.38803	0.282	T	0.45338	-0.9268	10	0.87932	D	0	-2.1003	10.6723	0.45766	0.0:0.0:0.8088:0.1912	.	588	Q5JTC6	F123B_HUMAN	D	588	ENSP00000364003:A588D;ENSP00000329117:A588D;ENSP00000384722:A588D	ENSP00000329117:A588D	A	-	2	0	FAM123B	63328129	0.773000	0.28580	0.014000	0.15608	0.647000	0.38526	3.894000	0.56250	2.300000	0.77407	0.600000	0.82982	GCT		0.607	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		4	100	1	0	0.000602214	0.000602	0.000629788	4	100				
TEX11	56159	broad.mit.edu	37	X	69964040	69964040	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:69964040T>A	ENST00000395889.2	-	11	922	c.767A>T	c.(766-768)aAg>aTg	p.K256M	TEX11_ENST00000344304.3_Missense_Mutation_p.K256M|TEX11_ENST00000374333.2_Missense_Mutation_p.K241M	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	256					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.K241M(1)		breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					AGTAGATTTCTTATCCATCTT	0.239																																							uc004dyl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|skin(1)	5						c.(766-768)AAG>ATG		testis expressed sequence 11 isoform 1							45.0	39.0	41.0					X																	69964040		2203	4289	6492	SO:0001583	missense	56159						protein binding	g.chrX:69964040T>A	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.767A>T	X.37:g.69964040T>A	ENSP00000379226:p.Lys256Met		Somatic				TEX11_uc004dym.2_Missense_Mutation_p.K241M	p.K256M	NM_001003811	NP_001003811	WXS	Illumina HiSeq	Unspecified	Q8IYF3	TEX11_HUMAN			11	929	-	Renal(35;0.156)		256					A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	37	c.767A>T	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	T	12.91	2.078759	0.36662	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000344304	T;T;T	0.63417	-0.04;-0.04;-0.04	3.66	-0.356	0.12583	Tetratricopeptide-like helical (1);	0.486384	0.20341	N	0.094226	T	0.60470	0.2271	L	0.34521	1.04	0.09310	N	1	D;D	0.76494	0.998;0.999	P;D	0.66497	0.906;0.944	T	0.52601	-0.8554	9	.	.	.	0.1503	5.9892	0.19452	0.0:0.3856:0.0:0.6144	.	241;256	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	M	241;256;256	ENSP00000363453:K241M;ENSP00000379226:K256M;ENSP00000340995:K256M	.	K	-	2	0	TEX11	69880765	0.004000	0.15560	0.001000	0.08648	0.359000	0.29487	-0.695000	0.05109	-0.378000	0.07918	0.412000	0.27726	AAG		0.239	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			15	10	0	0	0	0.002299	0	15	10				
NLGN3	54413	broad.mit.edu	37	X	70375176	70375176	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:70375176C>T	ENST00000358741.3	+	5	993	c.690C>T	c.(688-690)gtC>gtT	p.V230V	NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Silent_p.V190V|NLGN3_ENST00000374051.3_Silent_p.V210V	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	230					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.V230V(1)|p.V210V(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					ATGGCAATGTCATCGTCATCA	0.542																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	Esophageal Squamous(103;760 1488 16849 22250 40351)	uc004dzd.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(688-690)GTC>GTT		neuroligin 3							302.0	195.0	231.0					X																	70375176		2203	4300	6503	SO:0001819	synonymous_variant	54413				neuron cell-cell adhesion|positive regulation of synaptogenesis|receptor-mediated endocytosis|social behavior|synapse assembly	cell surface|endocytic vesicle|integral to plasma membrane|synapse	neurexin binding|receptor activity	g.chrX:70375176C>T	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.690C>T	X.37:g.70375176C>T			Somatic				NLGN3_uc010nlb.1_Silent_p.V190V|NLGN3_uc004dzb.2_Silent_p.V210V|NLGN3_uc004dzc.2_Silent_p.V93V|NLGN3_uc011mps.1_Silent_p.V190V|NLGN3_uc004dze.2_Silent_p.V28V|NLGN3_uc011mpr.1_Silent_p.V190V	p.V230V	NM_018977	NP_061850	WXS	Illumina HiSeq	Unspecified	Q9NZ94	NLGN3_HUMAN			4	890	+	Renal(35;0.156)		230			Extracellular (Potential).		B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	ENST00000358741.3	37	c.690C>T	CCDS55441.1																																																																																				0.542	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977		36	199	0	0	0	0.00361	0	36	199				
NLGN3	54413	broad.mit.edu	37	X	70375182	70375182	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:70375182C>T	ENST00000358741.3	+	5	999	c.696C>T	c.(694-696)gtC>gtT	p.V232V	NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Silent_p.V192V|NLGN3_ENST00000374051.3_Silent_p.V212V	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	232					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.V212V(1)|p.V232V(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					ATGTCATCGTCATCACCCTCA	0.537																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	Esophageal Squamous(103;760 1488 16849 22250 40351)	uc004dzd.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(694-696)GTC>GTT		neuroligin 3							297.0	195.0	229.0					X																	70375182		2203	4300	6503	SO:0001819	synonymous_variant	54413				neuron cell-cell adhesion|positive regulation of synaptogenesis|receptor-mediated endocytosis|social behavior|synapse assembly	cell surface|endocytic vesicle|integral to plasma membrane|synapse	neurexin binding|receptor activity	g.chrX:70375182C>T	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.696C>T	X.37:g.70375182C>T			Somatic				NLGN3_uc010nlb.1_Silent_p.V192V|NLGN3_uc004dzb.2_Silent_p.V212V|NLGN3_uc004dzc.2_Silent_p.V95V|NLGN3_uc011mps.1_Silent_p.V192V|NLGN3_uc004dze.2_Silent_p.V30V|NLGN3_uc011mpr.1_Silent_p.V192V	p.V232V	NM_018977	NP_061850	WXS	Illumina HiSeq	Unspecified	Q9NZ94	NLGN3_HUMAN			4	896	+	Renal(35;0.156)		232			Extracellular (Potential).		B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	ENST00000358741.3	37	c.696C>T	CCDS55441.1																																																																																				0.537	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977		41	198	0	0	0	0.00361	0	41	198				
NLGN3	54413	broad.mit.edu	37	X	70375185	70375185	+	Silent	SNP	C	C	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:70375185C>T	ENST00000358741.3	+	5	1002	c.699C>T	c.(697-699)atC>atT	p.I233I	NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Silent_p.I193I|NLGN3_ENST00000374051.3_Silent_p.I213I	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	233					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.I233I(1)|p.I213I(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					TCATCGTCATCACCCTCAACT	0.532																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	Esophageal Squamous(103;760 1488 16849 22250 40351)	uc004dzd.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(697-699)ATC>ATT		neuroligin 3							292.0	192.0	226.0					X																	70375185		2203	4300	6503	SO:0001819	synonymous_variant	54413				neuron cell-cell adhesion|positive regulation of synaptogenesis|receptor-mediated endocytosis|social behavior|synapse assembly	cell surface|endocytic vesicle|integral to plasma membrane|synapse	neurexin binding|receptor activity	g.chrX:70375185C>T	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.699C>T	X.37:g.70375185C>T			Somatic				NLGN3_uc010nlb.1_Silent_p.I193I|NLGN3_uc004dzb.2_Silent_p.I213I|NLGN3_uc004dzc.2_Silent_p.I96I|NLGN3_uc011mps.1_Silent_p.I193I|NLGN3_uc004dze.2_Silent_p.I31I|NLGN3_uc011mpr.1_Silent_p.I193I	p.I233I	NM_018977	NP_061850	WXS	Illumina HiSeq	Unspecified	Q9NZ94	NLGN3_HUMAN			4	899	+	Renal(35;0.156)		233			Extracellular (Potential).		B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	ENST00000358741.3	37	c.699C>T	CCDS55441.1																																																																																				0.532	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977		44	196	0	0	0	0.00361	0	44	196				
MAGEE2	139599	broad.mit.edu	37	X	75003586	75003586	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:75003586A>G	ENST00000373359.2	-	1	1493	c.1301T>C	c.(1300-1302)gTa>gCa	p.V434A		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	434	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.V434A(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTTTCTCCCTACATCCACACT	0.453																																							uc004ecj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1300-1302)GTA>GCA		melanoma antigen family E, 2							119.0	104.0	109.0					X																	75003586		2203	4300	6503	SO:0001583	missense	139599							g.chrX:75003586A>G	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.1301T>C	X.37:g.75003586A>G	ENSP00000362457:p.Val434Ala		Somatic					p.V434A	NM_138703	NP_619648	WXS	Illumina HiSeq	Unspecified	Q8TD90	MAGE2_HUMAN			1	1486	-			434			MAGE 2.		Q5JSI5	Missense_Mutation	SNP	ENST00000373359.2	37	c.1301T>C	CCDS14431.1	.	.	.	.	.	.	.	.	.	.	A	9.862	1.196483	0.22037	.	.	ENSG00000186675	ENST00000373359	T	0.04275	3.66	2.49	2.49	0.30216	.	.	.	.	.	T	0.04048	0.0113	N	0.02334	-0.595	0.25848	N	0.983976	D	0.56968	0.978	D	0.74348	0.983	T	0.29549	-1.0008	9	0.02654	T	1	.	6.0979	0.20031	1.0:0.0:0.0:0.0	.	434	Q8TD90	MAGE2_HUMAN	A	434	ENSP00000362457:V434A	ENSP00000362457:V434A	V	-	2	0	MAGEE2	74920311	1.000000	0.71417	0.999000	0.59377	0.610000	0.37248	2.395000	0.44459	1.229000	0.43630	0.341000	0.21757	GTA		0.453	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703		11	231	0	0	0	0.001855	0	11	231				
TAF9B	51616	broad.mit.edu	37	X	77388927	77388927	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:77388927G>A	ENST00000341864.5	-	6	594	c.500C>T	c.(499-501)tCt>tTt	p.S167F		NM_015975.4	NP_057059.2	Q9HBM6	TAF9B_HUMAN	TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa	167					DNA-templated transcription, initiation (GO:0006352)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell growth (GO:0030307)|programmed cell death (GO:0012501)|protein stabilization (GO:0050821)|response to organic cyclic compound (GO:0014070)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	14						ATTTGGGACAGACACCGTTTG	0.418																																							uc004eda.2		NA																	0					0						c.(499-501)TCT>TTT		transcription associated factor 9B							248.0	219.0	229.0					X																	77388927		2203	4296	6499	SO:0001583	missense	51616				negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell growth|transcription initiation, DNA-dependent	transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding	g.chrX:77388927G>A	AF220509	CCDS35340.1	Xq13.1-q21.1	2010-08-16	2006-01-04	2006-01-04	ENSG00000187325	ENSG00000187325			17306	protein-coding gene	gene with protein product		300754	"""TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa"""	TAF9L		15899866	Standard	XM_005262142		Approved	TAFII31L, DN-7, DN7, TFIID-31	uc004eda.3	Q9HBM6	OTTHUMG00000021887	ENST00000341864.5:c.500C>T	X.37:g.77388927G>A	ENSP00000339917:p.Ser167Phe		Somatic					p.S167F	NM_015975	NP_057059	WXS	Illumina HiSeq	Unspecified	Q9HBM6	TAF9B_HUMAN			6	571	-			167					B2RUZ9|Q9Y2S3	Missense_Mutation	SNP	ENST00000341864.5	37	c.500C>T	CCDS35340.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142697	0.77888	.	.	ENSG00000187325	ENST00000341864	T	0.34275	1.37	4.85	4.85	0.62838	.	0.207528	0.41823	D	0.000803	T	0.33411	0.0862	L	0.43923	1.385	0.50813	D	0.999891	P	0.39964	0.697	B	0.38562	0.276	T	0.27468	-1.0073	10	0.87932	D	0	-10.5685	14.2228	0.65839	0.0:0.0:1.0:0.0	.	167	Q9HBM6	TAF9B_HUMAN	F	167	ENSP00000339917:S167F	ENSP00000339917:S167F	S	-	2	0	TAF9B	77275583	1.000000	0.71417	0.872000	0.34217	0.926000	0.56050	7.598000	0.82745	2.228000	0.72767	0.600000	0.82982	TCT		0.418	TAF9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057308.1	NM_015975		15	534	0	0	0	0.008871	0	15	534				
CYLC1	1538	broad.mit.edu	37	X	83129105	83129105	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:83129105G>T	ENST00000329312.4	+	4	1426	c.1389G>T	c.(1387-1389)aaG>aaT	p.K463N		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	463					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K462N(1)|p.K463N(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						ATGAAAAGAAGGGGAAGAAAG	0.353																																							uc004eei.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(1387-1389)AAG>AAT		cylicin, basic protein of sperm head							37.0	31.0	33.0					X																	83129105		2201	4299	6500	SO:0001583	missense	1538				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity	g.chrX:83129105G>T	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1389G>T	X.37:g.83129105G>T	ENSP00000331556:p.Lys463Asn		Somatic				CYLC1_uc004eeh.1_Missense_Mutation_p.K462N	p.K463N	NM_021118	NP_066941	WXS	Illumina HiSeq	Unspecified	P35663	CYLC1_HUMAN			4	1410	+			463			6.		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	c.1389G>T	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	g	8.204	0.798888	0.16397	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.25749	1.78	3.83	0.981	0.19756	.	.	.	.	.	T	0.22322	0.0538	M	0.63843	1.955	0.09310	N	1	B;B	0.32031	0.352;0.352	B;B	0.33750	0.169;0.169	T	0.23940	-1.0174	9	0.25106	T	0.35	-0.3405	3.9702	0.09449	0.1208:0.0:0.4609:0.4183	.	463;463	P35663;F5H4V5	CYLC1_HUMAN;.	N	463	ENSP00000331556:K463N	ENSP00000331556:K463N	K	+	3	2	CYLC1	83015761	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-0.658000	0.05329	0.074000	0.16767	0.600000	0.82982	AAG		0.353	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118		37	37	1	0	2.61675e-31	0.003214	3.8312e-31	37	37				
CPXCR1	53336	broad.mit.edu	37	X	88009116	88009117	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:88009116_88009117GG>TT	ENST00000276127.4	+	3	960_961	c.701_702GG>TT	c.(700-702)aGG>aTT	p.R234I	CPXCR1_ENST00000373111.1_Missense_Mutation_p.R234I	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	234							metal ion binding (GO:0046872)	p.R234I(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						GCTATTGTGAGGTCTGTGCTCT	0.361																																							uc004efd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(700-702)AGG>ATT		CPX chromosome region, candidate 1																																				SO:0001583	missense	53336					intracellular	zinc ion binding	g.chrX:88009116_88009117GG>TT	AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	Exception_encountered	X.37:g.88009116_88009117delinsTT	ENSP00000276127:p.Arg234Ile		Somatic				CPXCR1_uc004efc.3_Missense_Mutation_p.R234I	p.R234I	NM_033048	NP_149037	WXS	Illumina HiSeq	Unspecified	Q8N123	CPXCR_HUMAN			3	960_961	+			234					B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	DNP	ENST00000276127.4	37	c.701_702GG>TT	CCDS14458.1																																																																																				0.361	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048		22	28	0	0	0	0.004672	0	22	28				
TCEAL6	158931	broad.mit.edu	37	X	101395859	101395859	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:101395859C>A	ENST00000372774.3	-	3	694	c.445G>T	c.(445-447)Gct>Tct	p.A149S	TCEAL6_ENST00000372773.1_Missense_Mutation_p.A149S	NM_001006938.2	NP_001006939.2	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A149S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	14						TCCTCCTGAGCCCTTGACACA	0.517																																							uc004eiq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(445-447)GCT>TCT		transcription elongation factor A (SII)-like 6							107.0	98.0	101.0					X																	101395859		2203	4297	6500	SO:0001583	missense	158931				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chrX:101395859C>A	BC071675	CCDS43978.1	Xq22.1	2014-03-21			ENSG00000204071	ENSG00000204071			24553	protein-coding gene	gene with protein product						16221301	Standard	NM_001006938		Approved	WEX2	uc004eiq.3	Q6IPX3	OTTHUMG00000022050	ENST00000372774.3:c.445G>T	X.37:g.101395859C>A	ENSP00000361860:p.Ala149Ser		Somatic					p.A149S	NM_001006938	NP_001006939	WXS	Illumina HiSeq	Unspecified	Q6IPX3	TCAL6_HUMAN			3	606	-			149					Q5H9J8	Missense_Mutation	SNP	ENST00000372774.3	37	c.445G>T	CCDS43978.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.193092	0.38707	.	.	ENSG00000204071	ENST00000372774;ENST00000372773;ENST00000536102	T;T	0.10477	2.87;2.87	2.82	2.82	0.32997	.	0.000000	0.38436	N	0.001697	T	0.25044	0.0608	M	0.63428	1.95	0.09310	N	0.999998	D	0.71674	0.998	D	0.80764	0.994	T	0.00901	-1.1521	10	0.66056	D	0.02	.	8.3639	0.32374	0.0:1.0:0.0:0.0	.	149	Q6IPX3-2	.	S	149	ENSP00000361860:A149S;ENSP00000361859:A149S	ENSP00000361859:A149S	A	-	1	0	TCEAL6	101282515	0.008000	0.16893	0.231000	0.23993	0.980000	0.70556	0.942000	0.29017	1.692000	0.51112	0.468000	0.43344	GCT		0.517	TCEAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057609.1	NM_001006938		127	84	1	0	2.48536e-91	0.00361	4.40728e-91	127	84				
CT47B1	643311	broad.mit.edu	37	X	120008777	120008777	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:120008777T>A	ENST00000371311.3	-	1	1002	c.748A>T	c.(748-750)Acc>Tcc	p.T250S		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	250								p.T250S(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						TCCTCTGAGGTCGGTTCCTCT	0.697																																							uc011muc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(748-750)ACC>TCC		cancer/testis antigen family 147, member B1							36.0	34.0	35.0					X																	120008777		692	1590	2282	SO:0001583	missense	643311							g.chrX:120008777T>A		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.748A>T	X.37:g.120008777T>A	ENSP00000360360:p.Thr250Ser		Somatic					p.T250S	NM_001145718	NP_001139190	WXS	Illumina HiSeq	Unspecified	P0C2W7	CT47B_HUMAN			1	1003	-			250					A6NM97	Missense_Mutation	SNP	ENST00000371311.3	37	c.748A>T	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	T	5.171	0.217096	0.09810	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.43	-0.86	0.10680	.	.	.	.	.	T	0.14657	0.0354	N	0.14661	0.345	0.09310	N	1	B	0.19583	0.037	B	0.10450	0.005	T	0.30707	-0.9969	8	0.06625	T	0.88	.	3.9309	0.09285	0.0:0.5007:0.0:0.4993	.	250	P0C2W7	CT47B_HUMAN	S	250	.	ENSP00000360360:T250S	T	-	1	0	CT47B1	119892805	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.271000	0.02828	-0.263000	0.09378	-1.261000	0.01458	ACC		0.697	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1	NM_001145718		17	8	0	0	0	0.00278	0	17	8				
TENM1	10178	broad.mit.edu	37	X	123518364	123518364	+	Silent	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:123518364G>T	ENST00000371130.3	-	29	6459	c.6396C>A	c.(6394-6396)cgC>cgA	p.R2132R	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Silent_p.R2139R	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2132					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.R2134R(1)									ATATTACCATGCGGCCCACAT	0.398																																							uc004euj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(6394-6396)CGC>CGA		odz, odd Oz/ten-m homolog 1 isoform 3							205.0	172.0	183.0					X																	123518364		2203	4300	6503	SO:0001819	synonymous_variant	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123518364G>T	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6396C>A	X.37:g.123518364G>T			Somatic				ODZ1_uc011muj.1_Silent_p.R2138R|ODZ1_uc010nqy.2_Silent_p.R2139R	p.R2132R	NM_014253	NP_055068	WXS	Illumina HiSeq	Unspecified	Q9UKZ4	TEN1_HUMAN			29	6460	-			2132			Extracellular (Potential).|YD 16.		B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	c.6396C>A	CCDS14609.1																																																																																				0.398	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		178	129	1	0	9.38108e-128	0.00361	1.70592e-127	178	129				
RAP2C	57826	broad.mit.edu	37	X	131351048	131351048	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:131351048G>T	ENST00000342983.2	-	2	995	c.249C>A	c.(247-249)agC>agA	p.S83R	RAP2C-AS1_ENST00000421483.2_RNA|RAP2C-AS1_ENST00000441399.2_RNA|RAP2C_ENST00000460462.1_5'UTR|RAP2C_ENST00000370874.1_Missense_Mutation_p.S83R	NM_001271187.1|NM_021183.4	NP_001258116.1|NP_067006.3	Q9Y3L5	RAP2C_HUMAN	RAP2C, member of RAS oncogene family	83					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of protein tyrosine kinase activity (GO:0061097)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|transcription coactivator activity (GO:0003713)	p.S83R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(2)	8	Acute lymphoblastic leukemia(192;0.000127)					GATTAACCAGGCTATAAACCA	0.468																																							uc004ewp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(247-249)AGC>AGA		RAP2C, member of RAS oncogene family precursor							97.0	92.0	94.0					X																	131351048		2203	4300	6503	SO:0001583	missense	57826				negative regulation of cell migration|positive regulation of protein autophosphorylation|Rap protein signal transduction|regulation of protein tyrosine kinase activity	recycling endosome membrane	GTP binding|GTPase activity	g.chrX:131351048G>T	BC051467	CCDS14632.1, CCDS76024.1	Xq25	2014-05-09			ENSG00000123728	ENSG00000123728			21165	protein-coding gene	gene with protein product							Standard	NM_001271186		Approved	DKFZp313B211	uc004ewp.4	Q9Y3L5	OTTHUMG00000022424	ENST00000342983.2:c.249C>A	X.37:g.131351048G>T	ENSP00000340274:p.Ser83Arg		Somatic				uc004ewr.1_5'Flank|RAP2C_uc004ewo.2_Missense_Mutation_p.S17R|RAP2C_uc010nrk.2_RNA|RAP2C_uc004ewq.3_Missense_Mutation_p.S83R	p.S83R	NM_021183	NP_067006	WXS	Illumina HiSeq	Unspecified	Q9Y3L5	RAP2C_HUMAN			2	1033	-	Acute lymphoblastic leukemia(192;0.000127)		83					B3KWD6|Q5H9H9|Q9BTS0	Missense_Mutation	SNP	ENST00000342983.2	37	c.249C>A	CCDS14632.1	.	.	.	.	.	.	.	.	.	.	g	15.39	2.818697	0.50633	.	.	ENSG00000123728	ENST00000342983;ENST00000370874	T;T	0.81330	-1.48;-1.48	5.22	-1.75	0.08031	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90981	0.7164	H	0.97365	3.99	0.41851	D	0.990179	D	0.89917	1.0	D	0.97110	1.0	D	0.88366	0.2991	10	0.87932	D	0	.	7.9058	0.29761	0.3866:0.1239:0.4895:0.0	.	83	Q9Y3L5	RAP2C_HUMAN	R	83	ENSP00000340274:S83R;ENSP00000359911:S83R	ENSP00000340274:S83R	S	-	3	2	RAP2C	131178729	1.000000	0.71417	0.953000	0.39169	0.450000	0.32258	3.870000	0.56070	-0.341000	0.08376	-0.939000	0.02691	AGC		0.468	RAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058312.1	NM_021183		3	52	1	0	0.00909568	0.009096	0.00927435	3	52				
SPANXC	64663	broad.mit.edu	37	X	140335779	140335779	+	Silent	SNP	G	G	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:140335779G>A	ENST00000358993.2	-	2	203	c.165C>T	c.(163-165)taC>taT	p.Y55Y		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	55						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Y55Y(1)		large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					CGTTCCTCCTGTAGCGAACCA	0.507																																							uc004fbk.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(163-165)TAC>TAT		sperm protein associated with the nucleus, X							176.0	129.0	145.0					X																	140335779		2133	4129	6262	SO:0001819	synonymous_variant	64663					cytoplasm|nucleus		g.chrX:140335779G>A	AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.165C>T	X.37:g.140335779G>A			Somatic				SPANXC_uc004fbl.2_RNA	p.Y55Y	NM_022661	NP_073152	WXS	Illumina HiSeq	Unspecified	Q9NY87	SPNXC_HUMAN			2	221	-	Acute lymphoblastic leukemia(192;7.65e-05)		55					Q32WL9|Q5JX88	Silent	SNP	ENST00000358993.2	37	c.165C>T	CCDS14673.1																																																																																				0.507	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058590.1	NM_022661		5	144	0	0	0	0.004482	0	5	144				
TMLHE	55217	broad.mit.edu	37	X	154774874	154774874	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:154774874T>A	ENST00000334398.3	-	2	209	c.64A>T	c.(64-66)Ata>Tta	p.I22L	TMLHE_ENST00000369439.4_Missense_Mutation_p.I22L|TMLHE-AS1_ENST00000452506.1_RNA	NM_018196.3	NP_060666.1	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon	22					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|trimethyllysine dioxygenase activity (GO:0050353)	p.I22L(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	GCCGGATATATGACTCCTCCC	0.468																																							uc004fnn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(64-66)ATA>TTA		trimethyllysine hydroxylase, epsilon	Succinic acid(DB00139)|Vitamin C(DB00126)						98.0	87.0	91.0					X																	154774874		2202	4292	6494	SO:0001583	missense	55217				carnitine biosynthetic process	mitochondrial matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|trimethyllysine dioxygenase activity	g.chrX:154774874T>A	AF373407, X97513	CCDS14768.1, CCDS55547.1	Xq28	2006-07-14			ENSG00000185973	ENSG00000185973			18308	protein-coding gene	gene with protein product	"""butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 2"""	300777				8908511, 11431483	Standard	NM_018196		Approved	TMLH, FLJ10727, BBOX2, XAP130	uc004fnn.3	Q9NVH6	OTTHUMG00000022674	ENST00000334398.3:c.64A>T	X.37:g.154774874T>A	ENSP00000335261:p.Ile22Leu		Somatic				TMLHE_uc004fno.2_Missense_Mutation_p.I22L|TMLHE_uc004fnp.3_Missense_Mutation_p.I22L	p.I22L	NM_018196	NP_060666	WXS	Illumina HiSeq	Unspecified	Q9NVH6	TMLH_HUMAN			2	230	-	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		22					A8K6M9|B4E3R3|Q5TZB5|Q6IA90|Q8TBT0	Missense_Mutation	SNP	ENST00000334398.3	37	c.64A>T	CCDS14768.1	.	.	.	.	.	.	.	.	.	.	T	5.659	0.306179	0.10733	.	.	ENSG00000185973	ENST00000334398;ENST00000369439	D;T	0.81908	-1.55;-1.0	3.91	3.91	0.45181	.	0.498330	0.18431	N	0.141440	T	0.68137	0.2968	N	0.19112	0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.52396	-0.8581	10	0.21014	T	0.42	0.4356	8.4328	0.32769	0.0:0.0:0.0:1.0	.	22;22;22	Q9NVH6-2;A8K6M9;Q9NVH6	.;.;TMLH_HUMAN	L	22	ENSP00000335261:I22L;ENSP00000358447:I22L	ENSP00000335261:I22L	I	-	1	0	TMLHE	154428068	0.018000	0.18449	0.055000	0.19348	0.357000	0.29423	1.261000	0.32980	1.584000	0.49913	0.339000	0.21740	ATA		0.468	TMLHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058817.1	NM_018196		126	508	0	0	0	0.00361	0	126	508				
VPS13D	55187	broad.mit.edu	37	1	12422832	12422833	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:12422832_12422833insC	ENST00000358136.3	+	51	10328_10329	c.10198_10199insC	c.(10198-10200)gccfs	p.A3400fs	VPS13D_ENST00000356315.4_Frame_Shift_Ins_p.A3375fs	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GGTCATCTTTGCCCCCCGTTAC	0.426																																							uc001atv.2		NA																	0				ovary(4)|pancreas(1)	5						c.(10198-10200)GCCfs		vacuolar protein sorting 13D isoform 1																																				SO:0001589	frameshift_variant	55187				protein localization			g.chr1:12422832_12422833insC	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.10204dupC	1.37:g.12422838_12422838dupC	ENSP00000350854:p.Ala3400fs		Somatic				VPS13D_uc001atw.2_Frame_Shift_Ins_p.A3375fs|VPS13D_uc001atx.2_Frame_Shift_Ins_p.A2587fs	p.A3400fs	NM_015378	NP_056193	WXS	Illumina HiSeq	Unspecified	Q5THJ4	VP13D_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)	51	10339_10340	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	3399	A -> T (in Ref. 6; CAE46021).					Frame_Shift_Ins	INS	ENST00000358136.3	37	c.10198_10199insC	CCDS30588.1																																																																																				0.426	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		14	849	NA	NA	NA	NA	NA	14	849	---	---	---	---
CSF3R	1441	broad.mit.edu	37	1	36935322	36935323	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:36935322_36935323insG	ENST00000373106.1	-	11	1951_1952	c.1404_1405insC	c.(1402-1407)cccagcfs	p.S469fs	CSF3R_ENST00000418048.2_Frame_Shift_Ins_p.S469fs|CSF3R_ENST00000361632.4_Frame_Shift_Ins_p.S469fs|CSF3R_ENST00000373103.1_Frame_Shift_Ins_p.S469fs|CSF3R_ENST00000487540.2_5'UTR|CSF3R_ENST00000440588.2_Frame_Shift_Ins_p.S469fs|CSF3R_ENST00000331941.5_Frame_Shift_Ins_p.S469fs|CSF3R_ENST00000373104.1_Frame_Shift_Ins_p.S469fs|CSF3R_ENST00000338937.5_Frame_Shift_Ins_p.S469fs	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	469	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	TTGCTCGCGCTGGGGGGGCCCA	0.634																																							uc001caw.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1402-1407)CCCAGCfs		colony stimulating factor 3 receptor isoform a	Filgrastim(DB00099)|Pegfilgrastim(DB00019)																																			SO:0001589	frameshift_variant	1441				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity	g.chr1:36935322_36935323insG	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.1405dupC	1.37:g.36935329_36935329dupG	ENSP00000362198:p.Ser469fs		Somatic				CSF3R_uc001cat.1_Frame_Shift_Ins_p.P31fs|CSF3R_uc009vvc.1_Frame_Shift_Ins_p.P31fs|CSF3R_uc001cau.1_5'UTR|CSF3R_uc001cav.1_Frame_Shift_Ins_p.P468fs|CSF3R_uc001cax.1_Frame_Shift_Ins_p.P468fs|CSF3R_uc001cay.1_Frame_Shift_Ins_p.P468fs	p.P468fs	NM_000760	NP_000751	WXS	Illumina HiSeq	Unspecified	Q99062	CSF3R_HUMAN			11	1582_1583	-		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	468_469			Extracellular (Potential).|Fibronectin type-III 4.			Frame_Shift_Ins	INS	ENST00000373106.1	37	c.1404_1405insC	CCDS413.1																																																																																				0.634	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2	NM_156039		8	205	NA	NA	NA	NA	NA	8	205	---	---	---	---
FOXJ3	22887	broad.mit.edu	37	1	42657204	42657205	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:42657204_42657205insG	ENST00000372572.1	-	11	1431_1432	c.1120_1121insC	c.(1120-1122)cagfs	p.Q374fs	FOXJ3_ENST00000361346.1_Frame_Shift_Ins_p.Q374fs|FOXJ3_ENST00000372571.1_5'Flank|FOXJ3_ENST00000361776.1_Frame_Shift_Ins_p.Q340fs|FOXJ3_ENST00000372573.1_Frame_Shift_Ins_p.Q374fs|FOXJ3_ENST00000545068.1_Frame_Shift_Ins_p.Q374fs	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	374					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGTGTGCATCTGGGGGTGAGAC	0.584																																							uc001che.2		NA																	0				ovary(2)	2						c.(1120-1122)CAGfs		forkhead box J3																																				SO:0001589	frameshift_variant	22887				embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr1:42657204_42657205insG	AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.1121dupC	1.37:g.42657209_42657209dupG	ENSP00000361653:p.Gln374fs		Somatic				FOXJ3_uc001chf.2_Frame_Shift_Ins_p.Q374fs|FOXJ3_uc001chg.2_Frame_Shift_Ins_p.Q374fs|FOXJ3_uc001chh.1_Frame_Shift_Ins_p.Q340fs	p.Q374fs	NM_014947	NP_055762	WXS	Illumina HiSeq	Unspecified	Q9UPW0	FOXJ3_HUMAN			11	1432_1433	-	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	374					A7MBL7|A7MD18|D3DPW2|Q9NSS7	Frame_Shift_Ins	INS	ENST00000372572.1	37	c.1120_1121insC	CCDS30689.1																																																																																				0.584	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000018310.1	NM_014947		7	906	NA	NA	NA	NA	NA	7	906	---	---	---	---
FAM151A	338094	broad.mit.edu	37	1	55081756	55081757	+	Frame_Shift_Ins	INS	-	-	G	rs371885641		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:55081756_55081757insG	ENST00000302250.2	-	3	511_512	c.351_352insC	c.(349-354)cccactfs	p.T118fs	ACOT11_ENST00000371316.3_Intron|FAM151A_ENST00000371304.2_Frame_Shift_Ins_p.T118fs	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	118						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.T118fs*43(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						CTGTAGATAGTGGGGGGGTGTG	0.594																																							uc001cxn.2		NA																	1	Deletion - Frameshift(1)		ovary(1)		0						c.(349-354)CCCACTfs		hypothetical protein LOC338094			,	13,4253		0,13,2120					,	3.2	0.2			92	8,8246		0,8,4119	no	frameshift,intron	ACOT11,FAM151A	NM_176782.2,NM_015547.3	,	0,21,6239	A1A1,A1R,RR		0.0969,0.3047,0.1677	,	,		21,12499				SO:0001589	frameshift_variant	338094					integral to membrane		g.chr1:55081756_55081757insG	AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.352dupC	1.37:g.55081763_55081763dupG	ENSP00000306888:p.Thr118fs		Somatic				ACOT11_uc001cxm.1_Intron	p.P117fs	NM_176782	NP_788954	WXS	Illumina HiSeq	Unspecified	Q8WW52	F151A_HUMAN			3	483_484	-			117_118					Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Frame_Shift_Ins	INS	ENST00000302250.2	37	c.351_352insC	CCDS594.1																																																																																				0.594	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027342.1	NM_176782		13	248	NA	NA	NA	NA	NA	13	248	---	---	---	---
FGGY	55277	broad.mit.edu	37	1	59812016	59812017	+	Frame_Shift_Ins	INS	-	-	G	rs145440779|rs183693555	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:59812016_59812017insG	ENST00000303721.7	+	4	585_586	c.411_412insG	c.(412-414)gggfs	p.G138fs	FGGY_ENST00000474476.1_3'UTR|FGGY_ENST00000371218.4_Frame_Shift_Ins_p.G138fs|FGGY_ENST00000371212.1_Intron	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	138					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					TCCAGTACGTCGGGGGGGTGAT	0.5																																							uc001czi.3		NA																	0				ovary(1)	1						c.(409-414)GTCGGGfs		FGGY carbohydrate kinase domain containing																																				SO:0001589	frameshift_variant	55277				carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor	g.chr1:59812016_59812017insG		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.418dupG	1.37:g.59812023_59812023dupG	ENSP00000305922:p.Gly138fs		Somatic				FGGY_uc001czg.2_Frame_Shift_Ins_p.V25fs|FGGY_uc001czh.2_RNA|FGGY_uc009wac.2_Frame_Shift_Ins_p.V137fs|FGGY_uc001czj.3_Frame_Shift_Ins_p.V137fs|FGGY_uc001czk.3_Frame_Shift_Ins_p.V25fs|FGGY_uc001czl.3_Intron	p.V137fs	NM_018291	NP_060761	WXS	Illumina HiSeq	Unspecified	Q96C11	FGGY_HUMAN			4	623_624	+	all_cancers(7;7.36e-05)		137_138					B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Frame_Shift_Ins	INS	ENST00000303721.7	37	c.411_412insG	CCDS611.2																																																																																				0.500	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023210.2	NM_001113411		14	215	NA	NA	NA	NA	NA	14	215	---	---	---	---
EPHX4	253152	broad.mit.edu	37	1	92511121	92511122	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:92511121_92511122insG	ENST00000370383.4	+	4	606_607	c.508_509insG	c.(508-510)tggfs	p.W170fs		NM_173567.4	NP_775838.3	Q8IUS5	EPHX4_HUMAN	epoxide hydrolase 4	170						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			central_nervous_system(1)|large_intestine(3)|lung(8)	12						TGGCCATGACTGGGGGGGCATG	0.386																																					GBM(140;473 1857 5172 22066 49719)	GBM(140;473 1857 5172 22066 49719)	uc001don.2		NA																	0				central_nervous_system(1)	1						c.(508-510)TGGfs		abhydrolase domain containing 7																																				SO:0001589	frameshift_variant	253152					integral to membrane	hydrolase activity	g.chr1:92511121_92511122insG	AK074822	CCDS736.1	1p22.1	2011-10-05	2009-04-06	2009-04-06	ENSG00000172031	ENSG00000172031		"""Abhydrolase domain containing"""	23758	protein-coding gene	gene with protein product			"""abhydrolase domain containing 7"""	ABHD7		12477932	Standard	NM_173567		Approved	EPHXRP, FLJ90341	uc001don.2	Q8IUS5	OTTHUMG00000010114	ENST00000370383.4:c.515dupG	1.37:g.92511128_92511128dupG	ENSP00000359410:p.Trp170fs		Somatic					p.W170fs	NM_173567	NP_775838	WXS	Illumina HiSeq	Unspecified	Q8IUS5	EPHX4_HUMAN			4	612_613	+			170					Q8NCC6	Frame_Shift_Ins	INS	ENST00000370383.4	37	c.508_509insG	CCDS736.1																																																																																				0.386	EPHX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027985.1	NM_173567		10	350	NA	NA	NA	NA	NA	10	350	---	---	---	---
F3	2152	broad.mit.edu	37	1	95001694	95001695	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:95001694_95001695insC	ENST00000334047.7	-	3	401_402	c.238_239insG	c.(238-240)aaafs	p.K80fs	F3_ENST00000370207.4_Frame_Shift_Ins_p.K80fs|F3_ENST00000480356.1_5'UTR	NM_001993.4	NP_001984.1	P13726	TF_HUMAN	coagulation factor III (thromboplastin, tissue factor)	80					activation of blood coagulation via clotting cascade (GO:0002543)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of plasma proteins involved in acute inflammatory response (GO:0002541)|blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)|protease binding (GO:0002020)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)	14		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	GTAAAAGCATTTGCTTTTCCAA	0.446																																					Melanoma(40;358 1339 15970 39161)	Melanoma(40;358 1339 15970 39161)	uc001dqr.2		NA																	0				central_nervous_system(1)	1						c.(238-240)AAAfs		coagulation factor III precursor	Coagulation factor VIIa(DB00036)																																			SO:0001589	frameshift_variant	2152				activation of caspase activity|activation of plasma proteins involved in acute inflammatory response|anti-apoptosis|blood coagulation, extrinsic pathway|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of protein kinase B signaling cascade	extracellular matrix|extracellular space|integral to membrane	cell surface binding|phospholipid binding|protease binding	g.chr1:95001694_95001695insC	BC011029	CCDS750.1, CCDS53345.1	1p22-p21	2012-10-02			ENSG00000117525	ENSG00000117525		"""CD molecules"""	3541	protein-coding gene	gene with protein product		134390					Standard	NM_001993		Approved	CD142	uc001dqr.3	P13726	OTTHUMG00000010716	ENST00000334047.7:c.238_239insG	1.37:g.95001694_95001695insC	ENSP00000334145:p.Lys80fs		Somatic				F3_uc001dqp.2_RNA|F3_uc001dqq.2_RNA|F3_uc001dqs.2_Frame_Shift_Ins_p.K80fs	p.K80fs	NM_001993	NP_001984	WXS	Illumina HiSeq	Unspecified	P13726	TF_HUMAN		all cancers(265;0.0232)|Epithelial(280;0.121)	3	417_418	-		all_lung(203;0.00106)|Lung NSC(277;0.00475)	80			Extracellular (Potential).		D3DT47|Q6FHG2|Q86WH4	Frame_Shift_Ins	INS	ENST00000334047.7	37	c.238_239insG	CCDS750.1																																																																																				0.446	F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029593.1	NM_001993		13	340	NA	NA	NA	NA	NA	13	340	---	---	---	---
ITGA10	8515	broad.mit.edu	37	1	145534121	145534122	+	Frame_Shift_Ins	INS	-	-	C	rs147270843	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:145534121_145534122insC	ENST00000369304.3	+	14	1801_1802	c.1626_1627insC	c.(1627-1629)cccfs	p.P543fs	ITGA10_ENST00000538811.1_Frame_Shift_Ins_p.P412fs|ITGA10_ENST00000539363.1_Frame_Shift_Ins_p.P400fs	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	543					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTCAGCCAGAACCCCCCCAGGA	0.554																																							uc001eoa.2		NA																	0				lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8						c.(1624-1629)GAACCCfs		integrin, alpha 10 precursor																																				SO:0001589	frameshift_variant	8515				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity	g.chr1:145534121_145534122insC	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1633dupC	1.37:g.145534128_145534128dupC	ENSP00000358310:p.Pro543fs		Somatic				NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Frame_Shift_Ins_p.E411fs|ITGA10_uc009wiw.2_Frame_Shift_Ins_p.E399fs|ITGA10_uc010oyw.1_Frame_Shift_Ins_p.E487fs	p.E542fs	NM_003637	NP_003628	WXS	Illumina HiSeq	Unspecified	O75578	ITA10_HUMAN			14	1702_1703	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		542_543			Extracellular (Potential).|FG-GAP 6.		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Frame_Shift_Ins	INS	ENST00000369304.3	37	c.1626_1627insC	CCDS918.1																																																																																				0.554	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637		8	244	NA	NA	NA	NA	NA	8	244	---	---	---	---
TDRD10	126668	broad.mit.edu	37	1	154493907	154493908	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:154493907_154493908insC	ENST00000368480.3	+	6	406_407	c.321_322insC	c.(322-324)cccfs	p.P108fs	TDRD10_ENST00000479937.1_3'UTR|TDRD10_ENST00000368482.4_Frame_Shift_Ins_p.P108fs			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	108							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CAAGCAAAAGGCCCCCCAAGAG	0.52																																							uc009wow.2		NA																	0				ovary(1)	1						c.(319-324)AGGCCCfs		tudor domain containing 10 isoform a																																				SO:0001589	frameshift_variant	126668						nucleotide binding|RNA binding	g.chr1:154493907_154493908insC	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.327dupC	1.37:g.154493913_154493913dupC	ENSP00000357465:p.Pro108fs		Somatic				TDRD10_uc001ffd.2_Frame_Shift_Ins_p.R107fs|TDRD10_uc001ffe.2_Frame_Shift_Ins_p.R28fs	p.R107fs	NM_001098475	NP_001091945	WXS	Illumina HiSeq	Unspecified	Q5VZ19	TDR10_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		6	1159_1160	+	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		107_108					A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Frame_Shift_Ins	INS	ENST00000368480.3	37	c.321_322insC	CCDS41406.1																																																																																				0.520	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499		8	301	NA	NA	NA	NA	NA	8	301	---	---	---	---
ASH1L	55870	broad.mit.edu	37	1	155491185	155491186	+	Frame_Shift_Ins	INS	-	-	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:155491185_155491186insT	ENST00000368346.3	-	2	764_765	c.125_126insA	c.(124-126)aacfs	p.N42fs	ASH1L_ENST00000548830.1_Frame_Shift_Ins_p.N42fs|ASH1L_ENST00000392403.3_Frame_Shift_Ins_p.N42fs			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	42					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CCTCCTTTGTGTTTTTTTCTAG	0.431																																							uc009wqq.2		NA																	0				skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11						c.(124-126)AACfs		absent, small, or homeotic 1-like																																				SO:0001589	frameshift_variant	55870				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr1:155491185_155491186insT	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.126dupA	1.37:g.155491192_155491192dupT	ENSP00000357330:p.Asn42fs		Somatic				ASH1L_uc001fkt.2_Frame_Shift_Ins_p.N42fs|ASH1L_uc009wqr.1_Frame_Shift_Ins_p.N42fs	p.N42fs	NM_018489	NP_060959	WXS	Illumina HiSeq	Unspecified	Q9NR48	ASH1L_HUMAN	Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)		2	605_606	-	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		42					Q59GP1|Q5T714|Q5T715|Q9P2C7	Frame_Shift_Ins	INS	ENST00000368346.3	37	c.125_126insA																																																																																					0.431	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489		9	1277	NA	NA	NA	NA	NA	9	1277	---	---	---	---
KIRREL	55243	broad.mit.edu	37	1	158058202	158058203	+	Frame_Shift_Ins	INS	-	-	C	rs548707549		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:158058202_158058203insC	ENST00000359209.6	+	8	1069_1070	c.1002_1003insC	c.(1003-1005)cccfs	p.P335fs	KIRREL_ENST00000368173.3_Frame_Shift_Ins_p.P335fs|KIRREL_ENST00000360089.4_Frame_Shift_Ins_p.P171fs|KIRREL_ENST00000392272.2_Frame_Shift_Ins_p.P232fs|KIRREL_ENST00000368172.1_Frame_Shift_Ins_p.P133fs|KIRREL_ENST00000416935.2_Frame_Shift_Ins_p.P235fs			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	335	Ig-like C2-type 4.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					GGGTTGGGAATCCCCCCCTCAC	0.455																																							uc001frn.3		NA																	0				ovary(1)	1						c.(1000-1005)AATCCCfs		kin of IRRE like precursor																																				SO:0001589	frameshift_variant	55243					integral to membrane		g.chr1:158058202_158058203insC	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1009dupC	1.37:g.158058209_158058209dupC	ENSP00000352138:p.Pro335fs		Somatic				KIRREL_uc010pib.1_Frame_Shift_Ins_p.N234fs|KIRREL_uc009wsq.2_Frame_Shift_Ins_p.N170fs|KIRREL_uc001fro.3_Frame_Shift_Ins_p.N132fs	p.N334fs	NM_018240	NP_060710	WXS	Illumina HiSeq	Unspecified	Q96J84	KIRR1_HUMAN			8	1406_1407	+	all_hematologic(112;0.0378)		334_335			Extracellular (Potential).|Ig-like C2-type 4.		Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Frame_Shift_Ins	INS	ENST00000359209.6	37	c.1002_1003insC	CCDS1172.2																																																																																				0.455	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240		8	270	NA	NA	NA	NA	NA	8	270	---	---	---	---
CD1C	911	broad.mit.edu	37	1	158262099	158262100	+	Frame_Shift_Ins	INS	-	-	C	rs535534188		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:158262099_158262100insC	ENST00000368170.3	+	3	833_834	c.554_555insC	c.(553-558)tgccccfs	p.CP185fs		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	185					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					AGAAGCACTTGCCCCCGATTTC	0.45																																							uc001fru.2		NA																	0				ovary(2)|skin(1)|pancreas(1)	4						c.(553-555)TGCfs		CD1C antigen precursor																																				SO:0001589	frameshift_variant	911				antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding	g.chr1:158262099_158262100insC	M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.559dupC	1.37:g.158262104_158262104dupC	ENSP00000357152:p.Cys185fs		Somatic				CD1C_uc001frv.2_5'UTR	p.C185fs	NM_001765	NP_001756	WXS	Illumina HiSeq	Unspecified	P29017	CD1C_HUMAN			3	846_847	+	all_hematologic(112;0.0378)		185			Extracellular (Potential).		Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Frame_Shift_Ins	INS	ENST00000368170.3	37	c.554_555insC	CCDS1175.1																																																																																				0.450	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046351.2	NM_001765		7	2000	NA	NA	NA	NA	NA	7	2000	---	---	---	---
OR10Z1	128368	broad.mit.edu	37	1	158576486	158576487	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:158576486_158576487insG	ENST00000361284.1	+	1	258_259	c.258_259insG	c.(259-261)gggfs	p.G87fs		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					CTGGCCTGGCTGGGGGGGACCA	0.554																																							uc010pio.1		NA																	0				pancreas(1)|skin(1)	2						c.(256-261)GCTGGGfs		olfactory receptor, family 10, subfamily Z,																																				SO:0001589	frameshift_variant	128368				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158576486_158576487insG	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.265dupG	1.37:g.158576493_158576493dupG	ENSP00000354707:p.Gly87fs		Somatic					p.A86fs	NM_001004478	NP_001004478	WXS	Illumina HiSeq	Unspecified	Q8NGY1	O10Z1_HUMAN			1	258_259	+	all_hematologic(112;0.0378)		86_87			Extracellular (Potential).		Q5VYL0|Q6IFR7	Frame_Shift_Ins	INS	ENST00000361284.1	37	c.258_259insG	CCDS30901.1																																																																																				0.554	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478		23	867	NA	NA	NA	NA	NA	23	867	---	---	---	---
OR10Z1	128368	broad.mit.edu	37	1	158577072	158577073	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:158577072_158577073insC	ENST00000361284.1	+	1	844_845	c.844_845insC	c.(844-846)accfs	p.T282fs		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TACTGTAGTGACCCCCCTCCTT	0.46																																							uc010pio.1		NA																	0				pancreas(1)|skin(1)	2						c.(844-846)ACCfs		olfactory receptor, family 10, subfamily Z,																																				SO:0001589	frameshift_variant	128368				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158577072_158577073insC	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.850dupC	1.37:g.158577078_158577078dupC	ENSP00000354707:p.Thr282fs		Somatic					p.T282fs	NM_001004478	NP_001004478	WXS	Illumina HiSeq	Unspecified	Q8NGY1	O10Z1_HUMAN			1	844_845	+	all_hematologic(112;0.0378)		282			Helical; Name=7; (Potential).		Q5VYL0|Q6IFR7	Frame_Shift_Ins	INS	ENST00000361284.1	37	c.844_845insC	CCDS30901.1																																																																																				0.460	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478		10	1276	NA	NA	NA	NA	NA	10	1276	---	---	---	---
XCL2	6846	broad.mit.edu	37	1	168510352	168510352	+	Frame_Shift_Del	DEL	A	A	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:168510352delA	ENST00000367819.2	-	3	215	c.183delT	c.(181-183)attfs	p.I61fs		NM_003175.3	NP_003166.1	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2	61					blood circulation (GO:0008015)|cell chemotaxis (GO:0060326)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			large_intestine(1)|lung(6)|ovary(1)	8	all_hematologic(923;0.215)					CACGTTTGGTAATAAAACTGT	0.468																																							uc001gfn.3		NA																	0				ovary(1)	1						c.(181-183)ATTfs		chemokine (C motif) ligand 2 precursor							150.0	134.0	139.0					1																	168510352		2203	4300	6503	SO:0001589	frameshift_variant	6846				blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity	g.chr1:168510352delA	BC070309	CCDS1273.1	1q24.2	2013-02-28	2002-08-22	2002-08-23	ENSG00000143185	ENSG00000143185		"""Endogenous ligands"""	10646	protein-coding gene	gene with protein product		604828	"""small inducible cytokine subfamily C, member 2"""	SCYC2		7875320	Standard	NM_003175		Approved	SCM-1b	uc001gfn.4	Q9UBD3	OTTHUMG00000034549	ENST00000367819.2:c.183delT	1.37:g.168510352delA	ENSP00000356793:p.Ile61fs		Somatic					p.I61fs	NM_003175	NP_003166	WXS	Illumina HiSeq	Unspecified	Q9UBD3	XCL2_HUMAN			3	216	-	all_hematologic(923;0.215)		61						Frame_Shift_Del	DEL	ENST00000367819.2	37	c.183delT	CCDS1273.1																																																																																				0.468	XCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083613.1	NM_003175		22	406	NA	NA	NA	NA	NA	22	406	---	---	---	---
XCL1	6375	broad.mit.edu	37	1	168550290	168550290	+	Splice_Site	DEL	T	T	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:168550290delT	ENST00000367818.3	+	3	342	c.177delT	c.(175-177)att>at	p.I59fs		NM_002995.2	NP_002986.1	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	59					cell-cell signaling (GO:0007267)|cellular response to interleukin-4 (GO:0071353)|cellular response to transforming growth factor beta stimulus (GO:0071560)|immune response (GO:0006955)|mature natural killer cell chemotaxis (GO:0035782)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T-helper 1 cell activation (GO:2000518)|negative regulation of T-helper 1 type immune response (GO:0002826)|negative regulation of transcription, DNA-templated (GO:0045892)|neutrophil chemotaxis (GO:0030593)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000566)|positive regulation of granzyme A production (GO:2000513)|positive regulation of granzyme B production (GO:0071663)|positive regulation of immunoglobulin production in mucosal tissue (GO:2000558)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 cell cytokine production (GO:2000556)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of thymocyte migration (GO:2000412)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of inflammatory response (GO:0050727)|release of sequestered calcium ion into cytosol (GO:0051209)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|protein homodimerization activity (GO:0042803)			kidney(2)|lung(7)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.208)					TGCGTTACAGTTTTATTACCA	0.463																																							uc001gfo.1		NA																	0					0						c.(175-177)ATTfs		chemokine (C motif) ligand 1							128.0	129.0	129.0					1																	168550290		2203	4300	6503	SO:0001630	splice_region_variant	6375				CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity	g.chr1:168550290delT	D43768	CCDS1274.1	1q24.2	2014-01-30	2002-08-22	2002-08-23	ENSG00000143184	ENSG00000143184		"""Endogenous ligands"""	10645	protein-coding gene	gene with protein product		600250	"""small inducible cytokine subfamily C, member 1 (lymphotactin)"""	LTN, SCYC1		7602097, 7875320	Standard	NM_002995		Approved	LPTN, ATAC, SCM-1a, SCM-1, lymphotactin	uc001gfo.2	P47992	OTTHUMG00000034548	ENST00000367818.3:c.177-1T>-	1.37:g.168550290delT			Somatic					p.I59fs	NM_002995	NP_002986	WXS	Illumina HiSeq	Unspecified	P47992	XCL1_HUMAN			3	197	+	all_hematologic(923;0.208)		59					Q52MA8	Frame_Shift_Del	DEL	ENST00000367818.3	37	c.177delT	CCDS1274.1																																																																																				0.463	XCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083612.1	NM_002995	Frame_Shift_Del	10	97	NA	NA	NA	NA	NA	10	97	---	---	---	---
PAPPA2	60676	broad.mit.edu	37	1	176762723	176762724	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:176762723_176762724insC	ENST00000367662.3	+	20	6212_6213	c.5048_5049insC	c.(5047-5052)atccccfs	p.IP1683fs		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1683	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TTGTGTGTAATCCCCCCCAGTG	0.47																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(5047-5049)ATCfs		pappalysin 2 isoform 1																																				SO:0001589	frameshift_variant	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176762723_176762724insC	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5055dupC	1.37:g.176762730_176762730dupC	ENSP00000356634:p.Ile1683fs		Somatic				PAPPA2_uc009www.2_RNA	p.I1683fs	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			20	6212_6213	+			1683			Sushi 5.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Frame_Shift_Ins	INS	ENST00000367662.3	37	c.5048_5049insC	CCDS41438.1																																																																																				0.470	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			19	469	NA	NA	NA	NA	NA	19	469	---	---	---	---
ATP2B4	493	broad.mit.edu	37	1	203667345	203667346	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:203667345_203667346insC	ENST00000357681.5	+	3	1377_1378	c.254_255insC	c.(253-258)atccccfs	p.IP85fs	ATP2B4_ENST00000367218.3_Frame_Shift_Ins_p.IP85fs|ATP2B4_ENST00000367219.3_Frame_Shift_Ins_p.IP85fs|ATP2B4_ENST00000391954.2_Frame_Shift_Ins_p.IP85fs|ATP2B4_ENST00000341360.2_Frame_Shift_Ins_p.IP85fs	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	85					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CACAACGTGATCCCCCCCAAAA	0.48																																							uc001gzw.2		NA																	0				ovary(2)|skin(1)	3						c.(253-255)ATCfs		plasma membrane calcium ATPase 4 isoform 4b																																				SO:0001589	frameshift_variant	493				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding	g.chr1:203667345_203667346insC	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.261dupC	1.37:g.203667352_203667352dupC	ENSP00000350310:p.Ile85fs		Somatic				ATP2B4_uc001gzv.2_Frame_Shift_Ins_p.I85fs|ATP2B4_uc009xaq.2_Frame_Shift_Ins_p.I85fs	p.I85fs	NM_001684	NP_001675	WXS	Illumina HiSeq	Unspecified	P23634	AT2B4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		3	1138_1139	+	all_cancers(21;0.071)|all_epithelial(62;0.228)		85			Cytoplasmic (Potential).		B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Frame_Shift_Ins	INS	ENST00000357681.5	37	c.254_255insC	CCDS1440.1																																																																																				0.480	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396		9	181	NA	NA	NA	NA	NA	9	181	---	---	---	---
GOLT1A	127845	broad.mit.edu	37	1	204170835	204170836	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:204170835_204170836insC	ENST00000308302.3	-	3	406_407	c.221_222insG	c.(220-222)ggtfs	p.G74fs	GOLT1A_ENST00000475517.1_5'Flank	NM_198447.1	NP_940849.1			golgi transport 1A											kidney(1)|lung(2)|urinary_tract(1)	4	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.244)			CGATAACCACACCCCCCAGGAG	0.545																																							uc001has.1		NA																	0					0						c.(220-222)GGTfs		golgi transport 1 homolog A																																				SO:0001589	frameshift_variant	127845				protein transport|vesicle-mediated transport	Golgi membrane|integral to membrane		g.chr1:204170835_204170836insC	BC058832	CCDS1443.1	1q32.1	2010-06-24	2010-06-24		ENSG00000174567	ENSG00000174567			24766	protein-coding gene	gene with protein product			"""golgi transport 1 homolog A (S. cerevisiae)"""			12477932	Standard	NM_198447		Approved	FLJ42654, CGI-141, YMR292W, GOT1, MGC62027	uc001has.1	Q6ZVE7	OTTHUMG00000036056	ENST00000308302.3:c.222dupG	1.37:g.204170841_204170841dupC	ENSP00000308535:p.Gly74fs		Somatic				GOLT1A_uc001hat.1_Frame_Shift_Ins_p.G74fs	p.G74fs	NM_198447	NP_940849	WXS	Illumina HiSeq	Unspecified	Q6ZVE7	GOT1A_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.244)		3	407_408	-	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)		74			Helical; Name=3; (Potential).			Frame_Shift_Ins	INS	ENST00000308302.3	37	c.221_222insG	CCDS1443.1																																																																																				0.545	GOLT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087887.1	NM_198447		8	571	NA	NA	NA	NA	NA	8	571	---	---	---	---
CR2	1380	broad.mit.edu	37	1	207642043	207642044	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:207642043_207642044insC	ENST00000367058.3	+	3	806_807	c.617_618insC	c.(616-621)gtccccfs	p.VP206fs	CR2_ENST00000367057.3_Frame_Shift_Ins_p.VP206fs|CR2_ENST00000458541.2_Frame_Shift_Ins_p.VP206fs|CR2_ENST00000485707.1_3'UTR|CR2_ENST00000367059.3_Frame_Shift_Ins_p.VP206fs	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	206	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)	p.T209fs*10(1)		NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TGGAGTGCTGTCCCCCCCACAT	0.396																																							uc001hfw.2		NA																	1	Deletion - Frameshift(1)		breast(1)	upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						c.(616-618)GTCfs		complement component (3d/Epstein Barr virus)																																				SO:0001589	frameshift_variant	1380				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity	g.chr1:207642043_207642044insC	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.624dupC	1.37:g.207642050_207642050dupC	ENSP00000356025:p.Val206fs		Somatic				CR2_uc001hfv.2_Frame_Shift_Ins_p.V206fs|CR2_uc009xch.2_Frame_Shift_Ins_p.V206fs|CR2_uc009xci.1_5'Flank	p.V206fs	NM_001877	NP_001868	WXS	Illumina HiSeq	Unspecified	P20023	CR2_HUMAN			3	711_712	+			206			Sushi 3.|Extracellular (Potential).		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Frame_Shift_Ins	INS	ENST00000367058.3	37	c.617_618insC	CCDS1478.1																																																																																				0.396	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877		13	335	NA	NA	NA	NA	NA	13	335	---	---	---	---
DIEXF	27042	broad.mit.edu	37	1	210014266	210014267	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:210014266_210014267insC	ENST00000491415.2	+	8	1408_1409	c.1351_1352insC	c.(1351-1353)tccfs	p.S451fs		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	451					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						CCTCATTGCTTCCCCCCTGGGC	0.465																																							uc001hhr.1		NA																	0					0						c.(1351-1353)TCCfs		digestive-organ expansion factor homolog																																				SO:0001589	frameshift_variant	27042				multicellular organismal development	nucleus		g.chr1:210014266_210014267insC	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.1357dupC	1.37:g.210014272_210014272dupC	ENSP00000419005:p.Ser451fs		Somatic				C1orf107_uc009xcu.1_Frame_Shift_Ins_p.S166fs	p.S451fs	NM_014388	NP_055203	WXS	Illumina HiSeq	Unspecified	Q68CQ4	DIEXF_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0367)	8	1427_1428	+			451					O75992|Q4VY00|Q63HL9	Frame_Shift_Ins	INS	ENST00000491415.2	37	c.1351_1352insC	CCDS1493.1																																																																																				0.465	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388		7	324	NA	NA	NA	NA	NA	7	324	---	---	---	---
SIPA1L2	57568	broad.mit.edu	37	1	232650637	232650638	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr1:232650637_232650638insG	ENST00000366630.1	-	2	806_807	c.448_449insC	c.(448-450)caafs	p.Q150fs	SIPA1L2_ENST00000262861.4_Frame_Shift_Ins_p.Q150fs			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	150					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				AAGTCCTCTTTGGGGGGAATGG	0.49																																							uc001hvg.2		NA																	0				ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(448-450)CAAfs		signal-induced proliferation-associated 1 like																																				SO:0001589	frameshift_variant	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232650637_232650638insG	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.449dupC	1.37:g.232650643_232650643dupG	ENSP00000355589:p.Gln150fs		Somatic					p.Q150fs	NM_020808	NP_065859	WXS	Illumina HiSeq	Unspecified	Q9P2F8	SI1L2_HUMAN			1	606_607	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	150					Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Frame_Shift_Ins	INS	ENST00000366630.1	37	c.448_449insC	CCDS41474.1																																																																																				0.490	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		7	525	NA	NA	NA	NA	NA	7	525	---	---	---	---
ZEB1	6935	broad.mit.edu	37	10	31809832	31809833	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:31809832_31809833insG	ENST00000320985.10	+	7	1679_1680	c.1569_1570insG	c.(1570-1572)gggfs	p.G524fs	ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000560721.2_Frame_Shift_Ins_p.G504fs|ZEB1_ENST00000542815.3_Frame_Shift_Ins_p.G457fs|ZEB1_ENST00000446923.2_Frame_Shift_Ins_p.G508fs|ZEB1_ENST00000361642.5_Frame_Shift_Ins_p.G525fs			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	524					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				AAAGCTTTGAAGGGGGGGTGAA	0.371																																					Ovarian(40;423 959 14296 36701 49589)	Ovarian(40;423 959 14296 36701 49589)	uc001ivs.3		NA																	0				ovary(3)|central_nervous_system(2)	5	GRCh37	CD075582	ZEB1	D	rs35708848	c.(1567-1572)GAAGGGfs		zinc finger E-box binding homeobox 1 isoform b																																				SO:0001589	frameshift_variant	6935				cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr10:31809832_31809833insG	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.1576dupG	10.37:g.31809839_31809839dupG	ENSP00000319248:p.Gly524fs		Somatic				ZEB1_uc001ivr.3_Frame_Shift_Ins_p.E305fs|ZEB1_uc010qee.1_Frame_Shift_Ins_p.E305fs|ZEB1_uc010qef.1_Frame_Shift_Ins_p.E305fs|ZEB1_uc009xlj.1_Frame_Shift_Ins_p.E449fs|ZEB1_uc010qeg.1_Frame_Shift_Ins_p.E382fs|ZEB1_uc009xlk.1_Frame_Shift_Ins_p.E305fs|ZEB1_uc001ivt.3_Frame_Shift_Ins_p.E305fs|ZEB1_uc001ivu.3_Frame_Shift_Ins_p.E524fs|ZEB1_uc001ivv.3_Frame_Shift_Ins_p.E503fs|ZEB1_uc010qeh.1_Frame_Shift_Ins_p.E456fs|ZEB1_uc009xlo.1_Frame_Shift_Ins_p.E506fs|ZEB1_uc009xlp.2_Frame_Shift_Ins_p.E507fs	p.E523fs	NM_030751	NP_110378	WXS	Illumina HiSeq	Unspecified	P37275	ZEB1_HUMAN			7	1632_1633	+		Prostate(175;0.0156)	523_524					B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Frame_Shift_Ins	INS	ENST00000320985.10	37	c.1569_1570insG	CCDS7169.1																																																																																				0.371	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751		11	256	NA	NA	NA	NA	NA	11	256	---	---	---	---
PARD3	56288	broad.mit.edu	37	10	34666941	34666942	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:34666941_34666942insC	ENST00000374789.3	-	10	1817_1818	c.1492_1493insG	c.(1492-1494)gcgfs	p.A498fs	PARD3_ENST00000545260.1_Frame_Shift_Ins_p.A454fs|PARD3_ENST00000374794.3_Frame_Shift_Ins_p.A454fs|PARD3_ENST00000374773.1_Frame_Shift_Ins_p.A498fs|PARD3_ENST00000340077.5_Frame_Shift_Ins_p.A498fs|PARD3_ENST00000545693.1_Frame_Shift_Ins_p.A498fs|PARD3_ENST00000350537.4_Frame_Shift_Ins_p.A498fs|PARD3_ENST00000346874.4_Frame_Shift_Ins_p.A498fs|PARD3_ENST00000374788.3_Frame_Shift_Ins_p.A498fs|PARD3_ENST00000374790.3_Frame_Shift_Ins_p.A454fs|PARD3_ENST00000374776.1_Frame_Shift_Ins_p.A498fs|PARD3_ENST00000544292.1_Frame_Shift_Ins_p.A228fs	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	498	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CTGAATGGCCGCCCCCCGGGGG	0.48																																							uc010qej.1		NA																	0				ovary(1)	1						c.(1492-1494)GCGfs		partitioning-defective protein 3 homolog																																				SO:0001589	frameshift_variant	56288				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chr10:34666941_34666942insC	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.1493dupG	10.37:g.34666947_34666947dupC	ENSP00000363921:p.Ala498fs		Somatic				PARD3_uc010qek.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qel.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qem.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qen.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qeo.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qep.1_Frame_Shift_Ins_p.A454fs|PARD3_uc010qeq.1_Frame_Shift_Ins_p.A454fs|PARD3_uc001ixo.1_Frame_Shift_Ins_p.A228fs|PARD3_uc001ixp.1_Frame_Shift_Ins_p.A363fs|PARD3_uc001ixq.1_Frame_Shift_Ins_p.A498fs|PARD3_uc001ixr.1_Frame_Shift_Ins_p.A498fs|PARD3_uc001ixt.1_Frame_Shift_Ins_p.A319fs|PARD3_uc001ixu.1_Frame_Shift_Ins_p.A454fs|PARD3_uc001ixs.1_Frame_Shift_Ins_p.A151fs	p.A498fs	NM_019619	NP_062565	WXS	Illumina HiSeq	Unspecified	Q8TEW0	PARD3_HUMAN			10	1492_1493	-		Breast(68;0.0707)	498			PDZ 2.		F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Frame_Shift_Ins	INS	ENST00000374789.3	37	c.1492_1493insG	CCDS7178.1																																																																																				0.480	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619		7	154	NA	NA	NA	NA	NA	7	154	---	---	---	---
AGAP7P	653268	broad.mit.edu	37	10	51465345	51465346	+	Frame_Shift_Ins	INS	-	-	G	rs377066109	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:51465345_51465346insG	ENST00000374095.5	-	7	1235_1236	c.1110_1111insC	c.(1108-1113)ccctctfs	p.S371fs		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		371	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						GCATGAGGAGAGGGGGGCGGGT	0.53																																							uc001jio.2		NA																	0					0						c.(1108-1113)CCCTCTfs		ArfGAP with GTPase domain, ankyrin repeat and PH																																				SO:0001589	frameshift_variant	653268				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr10:51465345_51465346insG																												ENST00000374095.5:c.1111dupC	10.37:g.51465351_51465351dupG	ENSP00000363208:p.Ser371fs		Somatic				PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron	p.P370fs	NM_001077685	NP_001071153	WXS	Illumina HiSeq	Unspecified	Q5VUJ5	AGAP7_HUMAN			7	1236_1237	-			370_371			PH.		A6NGH4	Frame_Shift_Ins	INS	ENST00000374095.5	37	c.1110_1111insC	CCDS41524.1																																																																																				0.530	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048033.1			15	74	NA	NA	NA	NA	NA	15	74	---	---	---	---
SEC24C	9632	broad.mit.edu	37	10	75525559	75525560	+	Splice_Site	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:75525559_75525560insC	ENST00000339365.2	+	11	1530_1531	c.1368_1369insC	c.(1369-1371)ccc>Cccc	p.P457fs	SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000546025.1_Intron|SEC24C_ENST00000345254.4_Splice_Site_p.P457fs|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Splice_Site_p.P338fs	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	457					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					TTCCCACAGTTCCCCCCCAGTA	0.51																																							uc001juw.2		NA																	0				skin(2)|central_nervous_system(1)	3						c.(1366-1371)GTTCCCfs		SEC24-related protein C																																				SO:0001630	splice_region_variant	9632				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding	g.chr10:75525559_75525560insC	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1367-1->C	10.37:g.75525566_75525566dupC			Somatic				SEC24C_uc010qkn.1_Intron|SEC24C_uc009xrj.1_Frame_Shift_Ins_p.V314fs|SEC24C_uc001jux.2_Frame_Shift_Ins_p.V456fs|SEC24C_uc010qko.1_Frame_Shift_Ins_p.V337fs|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	p.V456fs	NM_004922	NP_004913	WXS	Illumina HiSeq	Unspecified	P53992	SC24C_HUMAN			11	1547_1548	+	Prostate(51;0.0112)		456_457					B4DZT4|Q8WV25	Frame_Shift_Ins	INS	ENST00000339365.2	37	c.1368_1369insC	CCDS7332.1																																																																																				0.510	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1		Frame_Shift_Ins	18	371	NA	NA	NA	NA	NA	18	371	---	---	---	---
KAT6B	23522	broad.mit.edu	37	10	76790222	76790223	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:76790222_76790223insC	ENST00000287239.4	+	18	6129_6130	c.5640_5641insC	c.(5641-5643)cccfs	p.P1881fs	KAT6B_ENST00000372725.1_Frame_Shift_Ins_p.P1589fs|KAT6B_ENST00000372714.1_Frame_Shift_Ins_p.P1589fs|KAT6B_ENST00000372724.1_Frame_Shift_Ins_p.P1589fs|KAT6B_ENST00000372711.1_Frame_Shift_Ins_p.P1698fs	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1881	Interaction with RUNX1 and RUNX2.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CCATGACCCCACCCCCCAACCT	0.535																																							uc001jwn.1		NA								T					CREBBP		AML		0				central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16						c.(5638-5643)CCACCCfs		MYST histone acetyltransferase (monocytic																																				SO:0001589	frameshift_variant	23522				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding	g.chr10:76790222_76790223insC	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.5646dupC	10.37:g.76790228_76790228dupC	ENSP00000287239:p.Pro1881fs		Somatic				MYST4_uc001jwo.1_Frame_Shift_Ins_p.P1588fs|MYST4_uc001jwp.1_Frame_Shift_Ins_p.P1697fs	p.P1880fs	NM_012330	NP_036462	WXS	Illumina HiSeq	Unspecified	Q8WYB5	MYST4_HUMAN			18	6133_6134	+	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)		1880_1881			Interaction with RUNX1 and RUNX2.		O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Frame_Shift_Ins	INS	ENST00000287239.4	37	c.5640_5641insC	CCDS7345.1																																																																																				0.535	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330		10	243	NA	NA	NA	NA	NA	10	243	---	---	---	---
HECTD2	143279	broad.mit.edu	37	10	93272060	93272061	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:93272060_93272061insC	ENST00000298068.5	+	21	2344_2345	c.2250_2251insC	c.(2251-2253)cccfs	p.P751fs	HECTD2_ENST00000371667.1_Frame_Shift_Ins_p.P401fs|HECTD2_ENST00000446394.1_Frame_Shift_Ins_p.P755fs|HECTD2_ENST00000536715.1_Frame_Shift_Ins_p.P340fs	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	751	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						AACTTTGCCTTCCCCCCTACAA	0.356																																					NSCLC(12;376 469 1699 39910 41417)	NSCLC(12;376 469 1699 39910 41417)	uc001khl.2		NA																	0				skin(1)	1						c.(2248-2253)CTTCCCfs		HECT domain containing 2 isoform a																																				SO:0001589	frameshift_variant	143279				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity	g.chr10:93272060_93272061insC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.2256dupC	10.37:g.93272066_93272066dupC	ENSP00000298068:p.Pro751fs		Somatic				LOC100188947_uc010qnl.1_Intron|HECTD2_uc010qnm.1_Frame_Shift_Ins_p.L754fs|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_Frame_Shift_Ins_p.L339fs|HECTD2_uc001khn.1_Frame_Shift_Ins_p.L400fs	p.L750fs	NM_182765	NP_877497	WXS	Illumina HiSeq	Unspecified	Q5U5R9	HECD2_HUMAN			21	2350_2351	+			750_751			HECT.		Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Frame_Shift_Ins	INS	ENST00000298068.5	37	c.2250_2251insC	CCDS7414.1																																																																																				0.356	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1			8	451	NA	NA	NA	NA	NA	8	451	---	---	---	---
TLL2	7093	broad.mit.edu	37	10	98164994	98164995	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:98164994_98164995insG	ENST00000357947.3	-	10	1486_1487	c.1261_1262insC	c.(1261-1263)cttfs	p.L421fs	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	421	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CTTACCCAAAAGGGGGGCTTTT	0.48																																							uc001kml.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(1261-1263)CTTfs		tolloid-like 2 precursor																																				SO:0001589	frameshift_variant	7093				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr10:98164994_98164995insG	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1262dupC	10.37:g.98165000_98165000dupG	ENSP00000350630:p.Leu421fs		Somatic				TLL2_uc009xvf.1_Frame_Shift_Ins_p.L399fs	p.L421fs	NM_012465	NP_036597	WXS	Illumina HiSeq	Unspecified	Q9Y6L7	TLL2_HUMAN		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)	10	1487_1488	-		Colorectal(252;0.0846)	421			CUB 1.		A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Frame_Shift_Ins	INS	ENST00000357947.3	37	c.1261_1262insC	CCDS7449.1																																																																																				0.480	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			7	494	NA	NA	NA	NA	NA	7	494	---	---	---	---
BTRC	8945	broad.mit.edu	37	10	103310572	103310573	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:103310572_103310573insC	ENST00000370187.3	+	14	1891_1892	c.1773_1774insC	c.(1774-1776)cccfs	p.P592fs	BTRC_ENST00000493877.1_3'UTR|BTRC_ENST00000393441.4_Frame_Shift_Ins_p.P551fs|BTRC_ENST00000408038.2_Frame_Shift_Ins_p.P556fs	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	592			P -> H (in dbSNP:rs2270439).		anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CCCAAGCTGAACCCCCCCGTTC	0.431																																							uc001kta.2		NA																	0				ovary(1)	1						c.(1771-1776)GAACCCfs		beta-transducin repeat containing protein																																				SO:0001589	frameshift_variant	8945				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex		g.chr10:103310572_103310573insC	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1780dupC	10.37:g.103310579_103310579dupC	ENSP00000359206:p.Pro592fs		Somatic				BTRC_uc001ktb.2_Frame_Shift_Ins_p.E555fs|BTRC_uc001ktc.2_Frame_Shift_Ins_p.E565fs	p.E591fs	NM_033637	NP_378663	WXS	Illumina HiSeq	Unspecified	Q9Y297	FBW1A_HUMAN		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)	14	1886_1887	+		Colorectal(252;0.234)	591_592					B5MD49|Q5W141|Q5W142|Q9Y213	Frame_Shift_Ins	INS	ENST00000370187.3	37	c.1773_1774insC	CCDS7512.1																																																																																				0.431	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637		9	352	NA	NA	NA	NA	NA	9	352	---	---	---	---
TRUB1	142940	broad.mit.edu	37	10	116730191	116730192	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr10:116730191_116730192insC	ENST00000298746.3	+	5	649_650	c.588_589insC	c.(589-591)cccfs	p.P197fs	RNU6-1121P_ENST00000516802.1_RNA	NM_139169.4	NP_631908.1	Q8WWH5	TRUB1_HUMAN	TruB pseudouridine (psi) synthase family member 1	197					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(2)|kidney(2)|large_intestine(1)|lung(5)|urinary_tract(2)	12		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)		Epithelial(162;0.00879)|all cancers(201;0.0243)		TAATGCAAGTGCCCCCCCTGTA	0.317																																							uc001lcd.2		NA																	0					0						c.(586-591)GTGCCCfs		TruB pseudouridine (psi) synthase homolog 1																																				SO:0001589	frameshift_variant	142940				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding	g.chr10:116730191_116730192insC	AF448144	CCDS7591.1	10q25.3	2013-09-02	2013-09-02		ENSG00000165832	ENSG00000165832			16060	protein-coding gene	gene with protein product		610726	"""TruB pseudouridine (psi) synthase homolog 1 (E. coli)"""			12736709	Standard	NM_139169		Approved	PUS4	uc001lcd.3	Q8WWH5	OTTHUMG00000019094	ENST00000298746.3:c.595dupC	10.37:g.116730198_116730198dupC	ENSP00000298746:p.Pro197fs		Somatic				TRUB1_uc010qsl.1_Frame_Shift_Ins_p.V98fs	p.V196fs	NM_139169	NP_631908	WXS	Illumina HiSeq	Unspecified	Q8WWH5	TRUB1_HUMAN		Epithelial(162;0.00879)|all cancers(201;0.0243)	5	649_650	+		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)	196_197					B2R716|Q53ES2	Frame_Shift_Ins	INS	ENST00000298746.3	37	c.588_589insC	CCDS7591.1																																																																																				0.317	TRUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050504.1	NM_139169		12	183	NA	NA	NA	NA	NA	12	183	---	---	---	---
OR51E1	143503	broad.mit.edu	37	11	4674216	4674217	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:4674216_4674217insG	ENST00000396952.5	+	2	1110_1111	c.460_461insG	c.(460-462)cggfs	p.R154fs	OR51E1_ENST00000530215.1_Intron	NM_152430.3	NP_689643.2	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A155fs*3(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGCTGTGGTGCGGGGGGCTGCA	0.559																																							uc001lzi.3		NA																	1	Deletion - Frameshift(1)		ovary(1)	large_intestine(3)|pancreas(1)	4						c.(460-462)CGGfs		olfactory receptor, family 51, subfamily E,																																				SO:0001589	frameshift_variant	143503				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4674216_4674217insG	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000396952.5:c.466dupG	11.37:g.4674222_4674222dupG	ENSP00000380155:p.Arg154fs		Somatic					p.R154fs	NM_152430	NP_689643	WXS	Illumina HiSeq	Unspecified	Q8TCB6	O51E1_HUMAN		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)	2	604_605	+		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)	153			Helical; Name=4; (Potential).		A8KAM6|Q5S4P5|Q66X57|Q6IF93	Frame_Shift_Ins	INS	ENST00000396952.5	37	c.460_461insG	CCDS31358.2																																																																																				0.559	OR51E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347136.2	NM_152430		29	926	NA	NA	NA	NA	NA	29	926	---	---	---	---
OR52B6	340980	broad.mit.edu	37	11	5602545	5602546	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:5602545_5602546insC	ENST00000345043.2	+	1	439_440	c.439_440insC	c.(439-441)tccfs	p.S147fs	AC015691.13_ENST00000394793.2_RNA|HBG2_ENST00000380259.2_Intron	NM_001005162.2	NP_001005162.2	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B, member 6	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCCATCTGCTCCCCCCTGCGA	0.51																																							uc010qzi.1		NA																	0				ovary(1)	1						c.(439-441)TCCfs		olfactory receptor, family 52, subfamily B,																																				SO:0001589	frameshift_variant	340980				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5602545_5602546insC	AB065858	CCDS41611.1	11p15.4	2012-08-09			ENSG00000187747	ENSG00000187747		"""GPCR / Class A : Olfactory receptors"""	15211	protein-coding gene	gene with protein product							Standard	NM_001005162		Approved		uc010qzi.2	Q8NGF0	OTTHUMG00000066906	ENST00000345043.2:c.445dupC	11.37:g.5602551_5602551dupC	ENSP00000341581:p.Ser147fs		Somatic				HBG2_uc001mak.1_Intron	p.S147fs	NM_001005162	NP_001005162	WXS	Illumina HiSeq	Unspecified	Q8NGF0	O52B6_HUMAN		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	439_440	+		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)	147			Cytoplasmic (Potential).		Q6IFI7	Frame_Shift_Ins	INS	ENST00000345043.2	37	c.439_440insC	CCDS41611.1																																																																																				0.510	OR52B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143397.1	NM_001005162		9	842	NA	NA	NA	NA	NA	9	842	---	---	---	---
DCHS1	8642	broad.mit.edu	37	11	6662141	6662142	+	Frame_Shift_Ins	INS	-	-	G	rs188153920|rs143767864	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:6662141_6662142insG	ENST00000299441.3	-	2	1114_1115	c.703_704insC	c.(703-705)cggfs	p.R235fs		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	235	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R235Q(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGGGCCCTCCGGGGGGGTGAA	0.589																																							uc001mem.1		NA																	1	Substitution - Missense(1)		urinary_tract(1)	ovary(3)|large_intestine(1)|pancreas(1)	5						c.(703-705)CGGfs		dachsous 1 precursor				14,4250		0,14,2118						4.7	0.9			101	0,8254		0,0,4127	no	frameshift	DCHS1	NM_003737.2		0,14,6245	A1A1,A1R,RR		0.0,0.3283,0.1118				14,12504				SO:0001589	frameshift_variant	8642				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr11:6662141_6662142insG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.704dupC	11.37:g.6662148_6662148dupG	ENSP00000299441:p.Arg235fs		Somatic					p.R235fs	NM_003737	NP_003728	WXS	Illumina HiSeq	Unspecified	Q96JQ0	PCD16_HUMAN		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	1113_1114	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	235			Cadherin 2.|Extracellular (Potential).		O15098	Frame_Shift_Ins	INS	ENST00000299441.3	37	c.703_704insC	CCDS7771.1																																																																																				0.589	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		8	86	NA	NA	NA	NA	NA	8	86	---	---	---	---
DDB1	1642	broad.mit.edu	37	11	61093159	61093160	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:61093159_61093160insC	ENST00000301764.7	-	6	1082_1083	c.685_686insG	c.(685-687)gccfs	p.A229fs	DDB1_ENST00000545930.1_5'UTR|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	229	Interaction with CDT1.|WD repeat beta-propeller A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						AATGATGATGGCCCCCCCAAAG	0.49								Nucleotide excision repair (NER)																															uc001nrc.3		NA																	0				ovary(2)|lung(1)|central_nervous_system(1)	4						c.(685-687)GCCfs	NER	damage-specific DNA binding protein 1																																				SO:0001589	frameshift_variant	1642				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding	g.chr11:61093159_61093160insC	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.686dupG	11.37:g.61093166_61093166dupC	ENSP00000301764:p.Ala229fs		Somatic				DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Frame_Shift_Ins_p.A229fs|DDB1_uc010rlg.1_RNA|DDB1_uc001nrd.2_Frame_Shift_Ins_p.A229fs|DDB1_uc009ynl.1_Frame_Shift_Ins_p.A116fs	p.A229fs	NM_001923	NP_001914	WXS	Illumina HiSeq	Unspecified	Q16531	DDB1_HUMAN			6	911_912	-			229			Interaction with CDT1.		A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Frame_Shift_Ins	INS	ENST00000301764.7	37	c.685_686insG	CCDS31576.1																																																																																				0.490	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	NM_001923		7	82	NA	NA	NA	NA	NA	7	82	---	---	---	---
CPSF7	79869	broad.mit.edu	37	11	61183884	61183885	+	Frame_Shift_Ins	INS	-	-	G	rs548830763		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:61183884_61183885insG	ENST00000394888.4	-	6	829_830	c.657_658insC	c.(655-660)cccagtfs	p.S220fs	CPSF7_ENST00000439958.3_Frame_Shift_Ins_p.S211fs|CPSF7_ENST00000448745.1_Frame_Shift_Ins_p.S211fs|CPSF7_ENST00000340437.4_Frame_Shift_Ins_p.S263fs	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	220	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						GGCAGCACACTGGGGGGCTTAT	0.594																																							uc001nrq.2		NA																	0				central_nervous_system(1)	1						c.(655-660)CCCAGTfs		pre-mRNA cleavage factor I, 59 kDa subunit																																				SO:0001589	frameshift_variant	79869				mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|protein tetramerization|termination of RNA polymerase II transcription	mRNA cleavage factor complex	nucleotide binding|protein binding|RNA binding	g.chr11:61183884_61183885insG		CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.658dupC	11.37:g.61183890_61183890dupG	ENSP00000378352:p.Ser220fs		Somatic				CPSF7_uc001nro.2_Frame_Shift_Ins_p.P210fs|CPSF7_uc001nrp.2_Frame_Shift_Ins_p.P262fs|CPSF7_uc001nrr.2_Frame_Shift_Ins_p.P210fs|CPSF7_uc001nrs.1_Frame_Shift_Ins_p.P120fs	p.P219fs	NM_001136040	NP_001129512	WXS	Illumina HiSeq	Unspecified	Q8N684	CPSF7_HUMAN			6	791_792	-			219_220			Pro-rich.		B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Frame_Shift_Ins	INS	ENST00000394888.4	37	c.657_658insC	CCDS44619.1																																																																																				0.594	CPSF7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347835.2	NM_024811		10	532	NA	NA	NA	NA	NA	10	532	---	---	---	---
BSCL2	26580	broad.mit.edu	37	11	62458782	62458783	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:62458782_62458783insC	ENST00000403550.1	-	7	1205_1206	c.782_783insG	c.(781-783)ggcfs	p.G261fs	BSCL2_ENST00000360796.5_Frame_Shift_Ins_p.G325fs|BSCL2_ENST00000421906.1_Frame_Shift_Ins_p.G261fs|BSCL2_ENST00000433053.1_Frame_Shift_Ins_p.G325fs|BSCL2_ENST00000407022.3_Frame_Shift_Ins_p.G261fs|BSCL2_ENST00000278893.7_Intron|LRRN4CL_ENST00000317449.4_5'Flank|BSCL2_ENST00000405837.1_Frame_Shift_Ins_p.G325fs|HNRNPUL2-BSCL2_ENST00000403734.2_3'UTR			Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)	261					cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						GGGGCCAGATGCCCCCCCACAC	0.559																																							uc001nuo.1		NA																	0					0	GRCh37	CI033285	BSCL2	I		c.(781-783)GGCfs		seipin isoform 2			,,	12,4252		0,12,2120					,,	3.3	0.9			68	10,8244		0,10,4117	no	frameshift,intron,frameshift	BSCL2	NM_032667.6,NM_001130702.2,NM_001122955.3	,,	0,22,6237	A1A1,A1R,RR		0.1212,0.2814,0.1757	,,	,,		22,12496				SO:0001589	frameshift_variant	26580				cell death	integral to endoplasmic reticulum membrane		g.chr11:62458782_62458783insC		CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000403550.1:c.783dupG	11.37:g.62458789_62458789dupC	ENSP00000385561:p.Gly261fs		Somatic				LRRN4CL_uc001nun.2_5'Flank|BSCL2_uc009yoc.1_Intron|BSCL2_uc001nup.2_Frame_Shift_Ins_p.G261fs|BSCL2_uc001nuq.1_Frame_Shift_Ins_p.G261fs|BSCL2_uc001nur.3_Frame_Shift_Ins_p.G325fs|BSCL2_uc009yod.2_Frame_Shift_Ins_p.G325fs|BSCL2_uc001nut.3_Frame_Shift_Ins_p.G325fs|HNRNPUL2_uc001nuu.1_RNA	p.G261fs	NM_032667	NP_116056	WXS	Illumina HiSeq	Unspecified	Q96G97	BSCL2_HUMAN			7	1206_1207	-			261			Helical; (Potential).		G3XAE4|Q567S1|Q96SV1|Q9BSQ0	Frame_Shift_Ins	INS	ENST00000403550.1	37	c.782_783insG	CCDS8031.1																																																																																				0.559	BSCL2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000319185.1	NM_032667		7	140	NA	NA	NA	NA	NA	7	140	---	---	---	---
NCAM1	4684	broad.mit.edu	37	11	113076860	113076861	+	Frame_Shift_Ins	INS	-	-	G	rs576548045		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:113076860_113076861insG	ENST00000533760.1	+	5	831_832	c.232_233insG	c.(232-234)cggfs	p.R78fs	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Frame_Shift_Ins_p.R186fs|NCAM1_ENST00000401611.2_Frame_Shift_Ins_p.R195fs	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	196	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		AATCCTGGCACGGGGGGAGATC	0.495																																							uc009yyq.1		NA																	0				ovary(1)	1						c.(232-234)CGGfs		neural cell adhesion molecule 1 isoform 3																																				SO:0001589	frameshift_variant	4684				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane		g.chr11:113076860_113076861insG		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.238dupG	11.37:g.113076866_113076866dupG	ENSP00000473281:p.Arg78fs		Somatic				NCAM1_uc001pno.2_Frame_Shift_Ins_p.R78fs	p.R78fs	NM_001076682	NP_001070150	WXS	Illumina HiSeq	Unspecified	P13591	NCAM1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)	5	926_927	+		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)	196			Ig-like C2-type 2.|Extracellular (Potential).		A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Frame_Shift_Ins	INS	ENST00000533760.1	37	c.232_233insG																																																																																					0.495	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615		11	752	NA	NA	NA	NA	NA	11	752	---	---	---	---
KMT2A	4297	broad.mit.edu	37	11	118344185	118344186	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:118344185_118344186insC	ENST00000389506.5	+	3	2311_2312	c.2311_2312insC	c.(2311-2313)accfs	p.T771fs	KMT2A_ENST00000534358.1_Frame_Shift_Ins_p.T771fs|KMT2A_ENST00000354520.4_Frame_Shift_Ins_p.T771fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	771					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CTCACCTCTCACCCCCCCGTCT	0.45																																							uc001pta.2		NA								T|O					MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB		AML|ALL		0				lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25						c.(2311-2313)ACCfs		myeloid/lymphoid or mixed-lineage leukemia																																				SO:0001589	frameshift_variant	4297				apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding	g.chr11:118344185_118344186insC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.2318dupC	11.37:g.118344192_118344192dupC	ENSP00000374157:p.Thr771fs		Somatic				MLL_uc001ptb.2_Frame_Shift_Ins_p.T771fs|MLL_uc001psz.1_Frame_Shift_Ins_p.T804fs|MLL_uc001ptd.1_Intron	p.T771fs	NM_005933	NP_005924	WXS	Illumina HiSeq	Unspecified	Q03164	MLL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)	3	2334_2335	+	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)	771					E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Ins	INS	ENST00000389506.5	37	c.2311_2312insC	CCDS31686.1																																																																																				0.450	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933		9	196	NA	NA	NA	NA	NA	9	196	---	---	---	---
JAM3	83700	broad.mit.edu	37	11	134018467	134018468	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr11:134018467_134018468insG	ENST00000299106.4	+	7	897_898	c.738_739insG	c.(739-741)gggfs	p.G247fs	NCAPD3_ENST00000526787.2_5'Flank|JAM3_ENST00000441717.3_Frame_Shift_Ins_p.G196fs|JAM3_ENST00000529443.2_Frame_Shift_Ins_p.G292fs			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	247					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		GCGGAATTATTGGGGGGGTTCT	0.485																																							uc001qhb.1		NA																	0				ovary(1)	1						c.(871-876)ATTGGGfs		junctional adhesion molecule 3 precursor																																				SO:0001589	frameshift_variant	83700				angiogenesis|blood coagulation|regulation of neutrophil chemotaxis	cell-cell contact zone|desmosome|extracellular space|integral to membrane	integrin binding	g.chr11:134018467_134018468insG	AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.745dupG	11.37:g.134018474_134018474dupG	ENSP00000299106:p.Gly247fs		Somatic				JAM3_uc009zcz.1_Frame_Shift_Ins_p.I240fs	p.I291fs	NM_032801	NP_116190	WXS	Illumina HiSeq	Unspecified	Q9BX67	JAM3_HUMAN		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)	7	897_898	+	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)	246_247			Helical; (Potential).		B3KWG9|Q8WWL8|Q96FL1	Frame_Shift_Ins	INS	ENST00000299106.4	37	c.873_874insG	CCDS8494.2																																																																																				0.485	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393303.4	NM_032801		9	205	NA	NA	NA	NA	NA	9	205	---	---	---	---
C1S	716	broad.mit.edu	37	12	7177938	7177939	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:7177938_7177939insC	ENST00000406697.1	+	15	2678_2679	c.2050_2051insC	c.(2050-2052)accfs	p.T684fs	C1S_ENST00000360817.5_Frame_Shift_Ins_p.T684fs|C1S_ENST00000402681.3_Frame_Shift_Ins_p.T517fs|C1S_ENST00000328916.3_Frame_Shift_Ins_p.T684fs			P09871	C1S_HUMAN	complement component 1, s subcomponent	684					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	GGAAAATAGCACCCCCCGTGAG	0.49																																					GBM(156;750 1943 12971 24779 31015)	GBM(156;750 1943 12971 24779 31015)	uc001qsj.2		NA																	0				skin(1)	1						c.(2050-2052)ACCfs		complement component 1, s subcomponent	Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)																																			SO:0001589	frameshift_variant	716				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity	g.chr12:7177938_7177939insC		CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.2056dupC	12.37:g.7177944_7177944dupC	ENSP00000385035:p.Thr684fs		Somatic				C1S_uc001qsk.2_Frame_Shift_Ins_p.T684fs|C1S_uc001qsl.2_Frame_Shift_Ins_p.T684fs|C1S_uc009zfr.2_Frame_Shift_Ins_p.T517fs|C1S_uc009zfs.2_RNA	p.T684fs	NM_201442	NP_958850	WXS	Illumina HiSeq	Unspecified	P09871	C1S_HUMAN			15	2769_2770	+			684					D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Frame_Shift_Ins	INS	ENST00000406697.1	37	c.2050_2051insC	CCDS31735.1																																																																																				0.490	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317481.1	NM_001734		11	655	NA	NA	NA	NA	NA	11	655	---	---	---	---
CLSTN3	9746	broad.mit.edu	37	12	7288059	7288060	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:7288059_7288060insC	ENST00000266546.6	+	4	970_971	c.520_521insC	c.(520-522)tccfs	p.S174fs	CLSTN3_ENST00000537408.1_Frame_Shift_Ins_p.S186fs	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	174	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CGGTGACTGCTCCCCCCAGTAC	0.574																																							uc001qsr.2		NA																	0				large_intestine(1)	1						c.(520-522)TCCfs		calsyntenin 3 precursor																																				SO:0001589	frameshift_variant	9746				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr12:7288059_7288060insC	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.526dupC	12.37:g.7288065_7288065dupC	ENSP00000266546:p.Ser174fs		Somatic				CLSTN3_uc001qss.2_Frame_Shift_Ins_p.S186fs	p.S174fs	NM_014718	NP_055533	WXS	Illumina HiSeq	Unspecified	Q9BQT9	CSTN3_HUMAN			4	798_799	+			174			Extracellular (Potential).|Cadherin 2.		D3DUT6|O94831|Q2T9J5|Q5UE57	Frame_Shift_Ins	INS	ENST00000266546.6	37	c.520_521insC	CCDS8575.1																																																																																				0.574	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718		10	1253	NA	NA	NA	NA	NA	10	1253	---	---	---	---
HEBP1	50865	broad.mit.edu	37	12	13142224	13142225	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:13142224_13142225insC	ENST00000014930.4	-	2	361_362	c.203_204insG	c.(202-204)ggcfs	p.G68fs	HEBP1_ENST00000536942.1_Frame_Shift_Ins_p.G68fs	NM_015987.4	NP_057071.2	Q9NRV9	HEBP1_HUMAN	heme binding protein 1	68					circadian rhythm (GO:0007623)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	heme binding (GO:0020037)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	7		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		TGTCATTGGTGCCCCCCGCATA	0.554																																							uc001rbd.2		NA																	0				breast(1)	1						c.(202-204)GGCfs		heme binding protein 1																																				SO:0001589	frameshift_variant	50865				circadian rhythm	extracellular region		g.chr12:13142224_13142225insC	AF117615	CCDS31749.1	12p13.2	2014-01-30			ENSG00000013583	ENSG00000013583		"""Endogenous ligands"""	17176	protein-coding gene	gene with protein product		605826				10640688	Standard	NM_015987		Approved	HEBP, HBP	uc001rbd.3	Q9NRV9	OTTHUMG00000168771	ENST00000014930.4:c.204dupG	12.37:g.13142230_13142230dupC	ENSP00000014930:p.Gly68fs		Somatic				HEBP1_uc001rbf.2_Frame_Shift_Ins_p.G68fs	p.G68fs	NM_015987	NP_057071	WXS	Illumina HiSeq	Unspecified	Q9NRV9	HEBP1_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.153)	2	376_377	-		Prostate(47;0.183)	68					A8K1G2|Q9Y5Z5	Frame_Shift_Ins	INS	ENST00000014930.4	37	c.203_204insG	CCDS31749.1																																																																																				0.554	HEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401001.1			10	958	NA	NA	NA	NA	NA	10	958	---	---	---	---
GRIN2B	2904	broad.mit.edu	37	12	14019043	14019044	+	Frame_Shift_Ins	INS	-	-	G	rs77738206|rs398122823		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:14019043_14019044insG	ENST00000609686.1	-	2	308_309	c.99_100insC	c.(97-102)cccagcfs	p.S34fs		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	34					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ATGCCAATGCTGGGGGGGCTCT	0.589																																							uc001rbt.2		NA																	0				central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(97-102)CCCAGCfs		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)																																			SO:0001589	frameshift_variant	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:14019043_14019044insG		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.100dupC	12.37:g.14019050_14019050dupG	ENSP00000477455:p.Ser34fs		Somatic					p.P33fs	NM_000834	NP_000825	WXS	Illumina HiSeq	Unspecified	Q13224	NMDE2_HUMAN			2	278_279	-			33_34			Extracellular (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Frame_Shift_Ins	INS	ENST00000609686.1	37	c.99_100insC	CCDS8662.1																																																																																				0.589	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			9	163	NA	NA	NA	NA	NA	9	163	---	---	---	---
H3F3C	440093	broad.mit.edu	37	12	31945092	31945093	+	Frame_Shift_Ins	INS	-	-	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:31945092_31945093insA	ENST00000340398.3	-	1	82_83	c.8_9insT	c.(7-9)cgafs	p.R3fs		NM_001013699.2	NP_001013721.2	Q6NXT2	H3C_HUMAN	H3 histone, family 3C	3					positive regulation of cell growth (GO:0030307)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	nucleosomal DNA binding (GO:0031492)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	18						TCTGCTTGGTTCGGGCCATTTT	0.609										HNSCC(67;0.2)																													uc001rkr.2		NA																	0					0						c.(7-9)CGAfs		histone H3-like																																				SO:0001589	frameshift_variant	440093				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr12:31945092_31945093insA	BC066906	CCDS31769.1	12p11.21	2012-02-15			ENSG00000188375	ENSG00000188375		"""Histones / Replication-independent"""	33164	protein-coding gene	gene with protein product						21274551	Standard	NM_001013699		Approved	H3.5	uc001rkr.3	Q6NXT2	OTTHUMG00000157811	ENST00000340398.3:c.8_9insT	12.37:g.31945092_31945093insA	ENSP00000339835:p.Arg3fs	HNSCC(67;0.2)	Somatic					p.R3fs	NM_001013699	NP_001013721	WXS	Illumina HiSeq	Unspecified	Q6NXT2	H3C_HUMAN			1	83_84	-			3					E9P281	Frame_Shift_Ins	INS	ENST00000340398.3	37	c.8_9insT	CCDS31769.1																																																																																				0.609	H3F3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349653.1	NM_001013699		19	40	NA	NA	NA	NA	NA	19	40	---	---	---	---
PDE1B	5153	broad.mit.edu	37	12	54971059	54971060	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:54971059_54971060insC	ENST00000243052.3	+	15	1994_1995	c.1558_1559insC	c.(1558-1560)gccfs	p.A520fs	PPP1R1A_ENST00000547431.1_3'UTR|PDE1B_ENST00000550620.1_Frame_Shift_Ins_p.A500fs|PDE1B_ENST00000538346.1_Frame_Shift_Ins_p.A479fs|PDE1B_ENST00000394277.3_3'UTR	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	520					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TGAAGAAGAGGCCCCCCCATCC	0.559																																							uc001sgd.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1558-1560)GCCfs		phosphodiesterase 1B isoform 1																																				SO:0001589	frameshift_variant	5153				activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:54971059_54971060insC	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1565dupC	12.37:g.54971066_54971066dupC	ENSP00000243052:p.Ala520fs		Somatic				PDE1B_uc010soz.1_Frame_Shift_Ins_p.A383fs|PDE1B_uc010spa.1_Frame_Shift_Ins_p.A479fs|PDE1B_uc001sgf.2_Frame_Shift_Ins_p.A383fs|PDE1B_uc001sge.2_Frame_Shift_Ins_p.A500fs|PDE1B_uc009znq.2_Frame_Shift_Ins_p.A316fs	p.A520fs	NM_000924	NP_000915	WXS	Illumina HiSeq	Unspecified	Q01064	PDE1B_HUMAN			15	1724_1725	+			520					Q92825|Q96KP3	Frame_Shift_Ins	INS	ENST00000243052.3	37	c.1558_1559insC	CCDS8882.1																																																																																				0.559	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1			10	338	NA	NA	NA	NA	NA	10	338	---	---	---	---
DGKA	1606	broad.mit.edu	37	12	56347513	56347514	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:56347513_56347514insC	ENST00000331886.5	+	24	2623_2624	c.2169_2170insC	c.(2170-2172)cccfs	p.P724fs	DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000394147.1_Frame_Shift_Ins_p.P724fs|DGKA_ENST00000551156.1_Frame_Shift_Ins_p.P724fs	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	724					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	TCATGGGCCCACCCCCCCGCTC	0.579																																							uc001sij.2		NA																	0				ovary(3)|pancreas(1)	4						c.(2167-2172)CCACCCfs		diacylglycerol kinase, alpha 80kDa	Vitamin E(DB00163)																																			SO:0001589	frameshift_variant	1606				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity	g.chr12:56347513_56347514insC	AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.2176dupC	12.37:g.56347520_56347520dupC	ENSP00000328405:p.Pro724fs		Somatic				DGKA_uc001sik.2_Frame_Shift_Ins_p.P723fs|DGKA_uc001sil.2_Frame_Shift_Ins_p.P723fs|DGKA_uc001sim.2_Frame_Shift_Ins_p.P723fs|DGKA_uc001sin.2_Frame_Shift_Ins_p.P723fs|DGKA_uc009zof.2_Frame_Shift_Ins_p.P369fs|DGKA_uc001sio.2_Frame_Shift_Ins_p.P465fs	p.P723fs	NM_001345	NP_001336	WXS	Illumina HiSeq	Unspecified	P23743	DGKA_HUMAN			24	2433_2434	+			723_724					O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Frame_Shift_Ins	INS	ENST00000331886.5	37	c.2169_2170insC	CCDS8896.1																																																																																				0.579	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1			9	308	NA	NA	NA	NA	NA	9	308	---	---	---	---
DCTN2	10540	broad.mit.edu	37	12	57927805	57927806	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:57927805_57927806insG	ENST00000548249.1	-	7	866_867	c.599_600insC	c.(598-600)ccafs	p.P200fs	DCTN2_ENST00000543672.1_Frame_Shift_Ins_p.P205fs|DCTN2_ENST00000551400.1_5'Flank|DCTN2_ENST00000537439.1_Frame_Shift_Ins_p.P177fs|DCTN2_ENST00000434715.3_Frame_Shift_Ins_p.P205fs	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)	200					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						GGCTGCTATCTGGGGGGGTCCC	0.5																																							uc001som.1		NA																	0				ovary(1)	1						c.(598-600)CCAfs		dynactin 2																																				SO:0001589	frameshift_variant	10540				cell proliferation|G2/M transition of mitotic cell cycle|mitosis	centrosome|cytosol|dynactin complex|dynein complex|kinetochore|membrane|microtubule|vesicle	motor activity|protein binding	g.chr12:57927805_57927806insG	U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.600dupC	12.37:g.57927812_57927812dupG	ENSP00000447824:p.Pro200fs		Somatic				DCTN2_uc009zpu.1_Frame_Shift_Ins_p.P205fs|DCTN2_uc009zpv.1_Frame_Shift_Ins_p.P113fs|DCTN2_uc009zpw.1_Frame_Shift_Ins_p.P113fs|DCTN2_uc001soo.1_RNA|DCTN2_uc001son.1_Frame_Shift_Ins_p.P113fs|DCTN2_uc001sop.1_Frame_Shift_Ins_p.P113fs|DCTN2_uc001soq.1_RNA|DCTN2_uc009zpx.1_Frame_Shift_Ins_p.P200fs	p.P200fs	NM_006400	NP_006391	WXS	Illumina HiSeq	Unspecified	Q13561	DCTN2_HUMAN			7	731_732	-			200					B2RBK5|Q86YN2|Q9BW17	Frame_Shift_Ins	INS	ENST00000548249.1	37	c.599_600insC	CCDS58245.1																																																																																				0.500	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407393.2	NM_006400		7	99	NA	NA	NA	NA	NA	7	99	---	---	---	---
TMTC3	160418	broad.mit.edu	37	12	88553910	88553910	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:88553910delG	ENST00000266712.6	+	5	748	c.528delG	c.(526-528)ttgfs	p.L176fs		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	176					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						CAATTGCCTTGACAGTGTTTT	0.308																																							uc001tau.2		NA																	0				skin(1)	1						c.(526-528)TTGfs		transmembrane and tetratricopeptide repeat							115.0	120.0	118.0					12																	88553910		2203	4300	6503	SO:0001589	frameshift_variant	160418					integral to membrane	binding	g.chr12:88553910delG		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.528delG	12.37:g.88553910delG	ENSP00000266712:p.Leu176fs		Somatic				TMTC3_uc009zsm.2_RNA	p.L176fs	NM_181783	NP_861448	WXS	Illumina HiSeq	Unspecified	Q6ZXV5	TMTC3_HUMAN			5	748	+			176			Helical; (Potential).		Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Frame_Shift_Del	DEL	ENST00000266712.6	37	c.528delG	CCDS9032.1																																																																																				0.308	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1	NM_181783		155	321	NA	NA	NA	NA	NA	155	321	---	---	---	---
PLA2G1B	5319	broad.mit.edu	37	12	120763693	120763694	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:120763693_120763694insC	ENST00000308366.4	-	2	199_200	c.164_165insG	c.(163-165)ggcfs	p.G55fs	PLA2G1B_ENST00000423423.3_Frame_Shift_Ins_p.G55fs|PLA2G1B_ENST00000549767.1_Frame_Shift_Ins_p.G26fs	NM_000928.2	NP_000919.1	P04054	PA21B_HUMAN	phospholipase A2, group IB (pancreas)	55					actin filament organization (GO:0007015)|activation of MAPK activity (GO:0000187)|activation of phospholipase A2 activity (GO:0032431)|antibacterial humoral response (GO:0019731)|arachidonic acid secretion (GO:0050482)|cellular response to insulin stimulus (GO:0032869)|defense response to Gram-positive bacterium (GO:0050830)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response in mucosa (GO:0002227)|interleukin-8 production (GO:0032637)|intracellular signal transduction (GO:0035556)|leukotriene biosynthetic process (GO:0019370)|multicellular organismal lipid catabolic process (GO:0044240)|neutrophil chemotaxis (GO:0030593)|neutrophil mediated immunity (GO:0002446)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine metabolic process (GO:0046470)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of immune response (GO:0050778)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	bile acid binding (GO:0032052)|calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|phospholipase A2 activity (GO:0004623)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)				Niflumic Acid(DB04552)|Sulfasalazine(DB00795)	GGGTGCCTGAGCCCCCCAAGCC	0.604											OREG0022189	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(64;1781 1795 22266 42732)|Esophageal Squamous(30;459 829 25326 35148)	NSCLC(64;1781 1795 22266 42732)|Esophageal Squamous(30;459 829 25326 35148)	uc001tyd.2		NA																	0				skin(1)	1						c.(163-165)GGCfs		phospholipase A2 group IB precursor																																				SO:0001589	frameshift_variant	5319				actin filament organization|activation of MAPK activity|activation of phospholipase A2 activity|arachidonic acid secretion|cellular response to insulin stimulus|glucose transport|interleukin-8 production|leukotriene biosynthetic process|multicellular organismal lipid catabolic process|neutrophil chemotaxis|neutrophil mediated immunity|phosphatidylcholine metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of DNA replication|positive regulation of immune response|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein secretion|positive regulation of transcription from RNA polymerase II promoter	extracellular space	bile acid binding|calcium ion binding|calcium-dependent phospholipase A2 activity|cell surface binding|receptor binding	g.chr12:120763693_120763694insC		CCDS9195.1	12q24.31	2013-09-19			ENSG00000170890	ENSG00000170890	3.1.1.4		9030	protein-coding gene	gene with protein product		172410		PLA2, PPLA2, PLA2A		8175726	Standard	NM_000928		Approved		uc001tyd.3	P04054	OTTHUMG00000169343	ENST00000308366.4:c.165dupG	12.37:g.120763699_120763699dupC	ENSP00000312286:p.Gly55fs		Somatic	OREG0022189	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1506	PLA2G1B_uc009zwx.2_Frame_Shift_Ins_p.G55fs	p.G55fs	NM_000928	NP_000919	WXS	Illumina HiSeq	Unspecified	P04054	PA21B_HUMAN			2	200_201	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		55					B2R4H5|Q3KPI1	Frame_Shift_Ins	INS	ENST00000308366.4	37	c.164_165insG	CCDS9195.1																																																																																				0.604	PLA2G1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403626.1			7	195	NA	NA	NA	NA	NA	7	195	---	---	---	---
MSI1	4440	broad.mit.edu	37	12	120800902	120800903	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:120800902_120800903insC	ENST00000257552.2	-	6	433_434	c.345_346insG	c.(343-348)gggctgfs	p.L116fs	MSI1_ENST00000546622.1_5'Flank	NM_002442.3	NP_002433.1	O43347	MSI1H_HUMAN	musashi RNA-binding protein 1	116	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				epithelial cell differentiation (GO:0030855)|nervous system development (GO:0007399)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(4)|central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTCACCGACAGCCCCCCCACAA	0.564																																							uc001tye.1		NA																	0				central_nervous_system(2)|breast(1)	3						c.(343-348)GGGCTGfs		musashi 1																																				SO:0001589	frameshift_variant	4440				nervous system development	cytoplasm|nucleus	nucleotide binding	g.chr12:120800902_120800903insC	AB012851	CCDS9196.1	12q24	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	7330	protein-coding gene	gene with protein product		603328	"""Musashi (Drosophila) homolog 1"", ""musashi homolog 1 (Drosophila)"""			9790759	Standard	NM_002442		Approved		uc001tye.2	O43347	OTTHUMG00000169344	ENST00000257552.2:c.346dupG	12.37:g.120800909_120800909dupC	ENSP00000257552:p.Leu116fs		Somatic					p.G115fs	NM_002442	NP_002433	WXS	Illumina HiSeq	Unspecified	O43347	MSI1H_HUMAN			6	409_410	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		115_116			RRM 2.		Q96PU0|Q96PU1|Q96PU2|Q96PU3	Frame_Shift_Ins	INS	ENST00000257552.2	37	c.345_346insG	CCDS9196.1																																																																																				0.564	MSI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403629.1	NM_002442		7	151	NA	NA	NA	NA	NA	7	151	---	---	---	---
PGAM5	192111	broad.mit.edu	37	12	133294121	133294121	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr12:133294121delC	ENST00000498926.2	+	3	525	c.467delC	c.(466-468)accfs	p.T157fs	PGAM5_ENST00000317555.2_Frame_Shift_Del_p.T157fs|PGAM5_ENST00000543955.1_Frame_Shift_Del_p.T8fs|PGAM5_ENST00000454808.2_Frame_Shift_Del_p.T8fs|PXMP2_ENST00000545677.1_3'UTR	NM_001170543.1|NM_001170544.1	NP_001164014.1|NP_001164015.1	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5	157					dephosphorylation (GO:0016311)|necroptotic process (GO:0070266)|positive regulation of GTPase activity (GO:0043547)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein complex binding (GO:0032403)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		GCCATAGAGACCACCGATATC	0.632																																							uc009zyv.2		NA																	0					0						c.(466-468)ACCfs		phosphoglycerate mutase family member 5							57.0	62.0	60.0					12																	133294121		2203	4299	6502	SO:0001589	frameshift_variant	192111					integral to membrane|mitochondrial outer membrane	phosphoprotein phosphatase activity	g.chr12:133294121delC	BC008196	CCDS9280.1, CCDS53845.1	12q24.33	2011-07-28			ENSG00000247077	ENSG00000247077			28763	protein-coding gene	gene with protein product		614939				11283018	Standard	NM_001170543		Approved	MGC5352, BXLBv68	uc009zyv.3	Q96HS1	OTTHUMG00000168021	ENST00000498926.2:c.467delC	12.37:g.133294121delC	ENSP00000438465:p.Thr157fs		Somatic				PGAM5_uc010tbr.1_RNA|PGAM5_uc001uku.2_Frame_Shift_Del_p.T156fs	p.T156fs	NM_138575	NP_612642	WXS	Illumina HiSeq	Unspecified	Q96HS1	PGAM5_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)	3	494	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		156					A9LN06|C9IZY7|Q96JB0	Frame_Shift_Del	DEL	ENST00000498926.2	37	c.467delC	CCDS53845.1																																																																																				0.632	PGAM5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397562.1	NM_138575		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
ATP12A	479	broad.mit.edu	37	13	25262563	25262564	+	Frame_Shift_Ins	INS	-	-	G	rs35191129		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr13:25262563_25262564insG	ENST00000381946.3	+	4	502_503	c.335_336insG	c.(334-339)gtggggfs	p.VG112fs	ATP12A_ENST00000218548.6_Frame_Shift_Ins_p.VG112fs			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	112					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)	p.V112V(1)		breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		AAGCAGATGGTGGGGGGGTTCT	0.584																																					Pancreas(156;1582 1935 18898 22665 26498)	Pancreas(156;1582 1935 18898 22665 26498)	uc001upp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6						c.(334-336)GTGfs		hydrogen/potassium-exchanging ATPase 12A	Esomeprazole(DB00736)|Pantoprazole(DB00213)		,	1,4263		0,1,2131					,	5.0	1.0		dbSNP_126	234	5,8249		0,5,4122	no	frameshift,frameshift	ATP12A	NM_001676.5,NM_001185085.1	,	0,6,6253	A1A1,A1R,RR		0.0606,0.0235,0.0479	,	,		6,12512				SO:0001589	frameshift_variant	479				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding	g.chr13:25262563_25262564insG	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.342dupG	13.37:g.25262570_25262570dupG	ENSP00000371372:p.Val112fs		Somatic				ATP12A_uc010aaa.2_Frame_Shift_Ins_p.V112fs	p.V112fs	NM_001676	NP_001667	WXS	Illumina HiSeq	Unspecified	P54707	AT12A_HUMAN		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	4	522_523	+		Lung SC(185;0.0225)|Breast(139;0.077)	112			Helical; (Potential).		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Frame_Shift_Ins	INS	ENST00000381946.3	37	c.335_336insG	CCDS31948.1																																																																																				0.584	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676		21	697	NA	NA	NA	NA	NA	21	697	---	---	---	---
KBTBD6	89890	broad.mit.edu	37	13	41705321	41705322	+	Frame_Shift_Ins	INS	-	-	C	rs147771080|rs370605552	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr13:41705321_41705322insC	ENST00000379485.1	-	1	1560_1561	c.1326_1327insG	c.(1324-1329)gggcgafs	p.R443fs	KBTBD6_ENST00000499385.2_Frame_Shift_Ins_p.R377fs	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	443										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		ATAGGGTCTCGCCCCCCCAAAA	0.47																																							uc001uxu.1		NA																	0				ovary(1)|skin(1)	2						c.(1324-1329)GGGCGAfs		kelch repeat and BTB (POZ) domain-containing 6																																				SO:0001589	frameshift_variant	89890						protein binding	g.chr13:41705321_41705322insC	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1327dupG	13.37:g.41705328_41705328dupC	ENSP00000368799:p.Arg443fs		Somatic				KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Frame_Shift_Ins_p.G376fs|uc001uxv.1_5'Flank	p.G442fs	NM_152903	NP_690867	WXS	Illumina HiSeq	Unspecified	Q86V97	KBTB6_HUMAN		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)	1	1615_1616	-		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)	442_443			Kelch 2.		Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Frame_Shift_Ins	INS	ENST00000379485.1	37	c.1326_1327insG	CCDS9376.1																																																																																				0.470	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903		8	235	NA	NA	NA	NA	NA	8	235	---	---	---	---
TEP1	7011	broad.mit.edu	37	14	20852646	20852647	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:20852646_20852647insC	ENST00000262715.5	-	23	3282_3283	c.3242_3243insG	c.(3241-3243)ggtfs	p.G1081fs	TEP1_ENST00000556935.1_Frame_Shift_Ins_p.G973fs|TEP1_ENST00000545983.1_5'Flank	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1081					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)	p.V1082fs*47(1)		NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CAGCTGCCACACCCCCCCACTC	0.584																																							uc001vxe.2		NA																	1	Insertion - Frameshift(1)		large_intestine(1)	ovary(5)	5						c.(3241-3243)GGTfs		telomerase-associated protein 1																																				SO:0001589	frameshift_variant	7011				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding	g.chr14:20852646_20852647insC		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.3243dupG	14.37:g.20852653_20852653dupC	ENSP00000262715:p.Gly1081fs		Somatic				TEP1_uc010ahk.2_Frame_Shift_Ins_p.G431fs|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Frame_Shift_Ins_p.G973fs|TEP1_uc010tlh.1_5'Flank	p.G1081fs	NM_007110	NP_009041	WXS	Illumina HiSeq	Unspecified	Q99973	TEP1_HUMAN	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)	23	3282_3283	-	all_cancers(95;0.00123)	all_lung(585;0.235)	1081					A0AUV9	Frame_Shift_Ins	INS	ENST00000262715.5	37	c.3242_3243insG	CCDS9548.1																																																																																				0.584	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		14	245	NA	NA	NA	NA	NA	14	245	---	---	---	---
ARHGEF40	55701	broad.mit.edu	37	14	21546603	21546604	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:21546603_21546604insG	ENST00000298694.4	+	10	2329_2330	c.2202_2203insG	c.(2203-2205)gggfs	p.G735fs	ARHGEF40_ENST00000298693.3_Frame_Shift_Ins_p.G735fs			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	735						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						TGCAGAGGGATGGGGGGGCCAT	0.629																																							uc001vzp.2		NA																	0					0						c.(2200-2205)GATGGGfs		hypothetical protein LOC55701																																				SO:0001589	frameshift_variant	55701				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity	g.chr14:21546603_21546604insG		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.2209dupG	14.37:g.21546610_21546610dupG	ENSP00000298694:p.Gly735fs		Somatic				FLJ10357_uc001vzo.1_Intron|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_Frame_Shift_Ins_p.D20fs	p.D734fs	NM_018071	NP_060541	WXS	Illumina HiSeq	Unspecified	Q8TER5	ARH40_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)	10	2231_2232	+	all_cancers(95;0.00185)		734_735					A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Frame_Shift_Ins	INS	ENST00000298694.4	37	c.2202_2203insG	CCDS32041.1																																																																																				0.629	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1			13	259	NA	NA	NA	NA	NA	13	259	---	---	---	---
CHD8	57680	broad.mit.edu	37	14	21896303	21896304	+	Frame_Shift_Ins	INS	-	-	C	rs553367989		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:21896303_21896304insC	ENST00000557364.1	-	4	1588_1589	c.1325_1326insG	c.(1324-1326)ggafs	p.G442fs	RN7SL650P_ENST00000583681.1_RNA|CHD8_ENST00000430710.3_Frame_Shift_Ins_p.G163fs|CHD8_ENST00000555962.1_Intron|CHD8_ENST00000399982.2_Frame_Shift_Ins_p.G442fs			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	442					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TTCCTGTCTTTCCCCCCGAATG	0.54																																							uc001was.1		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10						c.(487-489)GGAfs		chromodomain helicase DNA binding protein 8																																				SO:0001589	frameshift_variant	57680				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding	g.chr14:21896303_21896304insC	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.1326dupG	14.37:g.21896309_21896309dupC	ENSP00000451601:p.Gly442fs		Somatic				CHD8_uc001war.1_Frame_Shift_Ins_p.G59fs	p.G163fs	NM_020920	NP_065971	WXS	Illumina HiSeq	Unspecified	Q9HCK8	CHD8_HUMAN	Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)	4	582_583	-	all_cancers(95;0.00121)		442					Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Frame_Shift_Ins	INS	ENST00000557364.1	37	c.488_489insG	CCDS53885.1																																																																																				0.540	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920		8	532	NA	NA	NA	NA	NA	8	532	---	---	---	---
SALL2	6297	broad.mit.edu	37	14	21992275	21992276	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:21992275_21992276insG	ENST00000327430.3	-	2	1880_1881	c.1586_1587insC	c.(1585-1587)ccafs	p.P529fs	SALL2_ENST00000450879.2_Frame_Shift_Ins_p.P392fs|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	529					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CCTCACTCCCTGGGGGGGTGTT	0.53																																							uc001wbe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1585-1587)CCAfs		sal-like 2																																				SO:0001589	frameshift_variant	6297						DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:21992275_21992276insG	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.1587dupC	14.37:g.21992282_21992282dupG	ENSP00000333537:p.Pro529fs		Somatic				SALL2_uc010tly.1_Frame_Shift_Ins_p.P527fs|SALL2_uc010tlz.1_Frame_Shift_Ins_p.P392fs|SALL2_uc001wbf.3_Intron|SALL2_uc010tma.1_Frame_Shift_Ins_p.P394fs|SALL2_uc001wbg.1_Intron	p.P529fs	NM_005407	NP_005398	WXS	Illumina HiSeq	Unspecified	Q9Y467	SALL2_HUMAN		GBM - Glioblastoma multiforme(265;0.0151)	2	1868_1869	-	all_cancers(95;0.000662)		529					B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Frame_Shift_Ins	INS	ENST00000327430.3	37	c.1586_1587insC	CCDS32045.1																																																																																				0.530	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407		14	258	NA	NA	NA	NA	NA	14	258	---	---	---	---
OR10G2	26534	broad.mit.edu	37	14	22102924	22102925	+	Frame_Shift_Ins	INS	-	-	G	rs150140072	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:22102924_22102925insG	ENST00000542433.1	-	1	171_172	c.74_75insC	c.(73-75)ccafs	p.P25fs		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		TTCTTAGATTTGGGGGGTGAGA	0.48																																							uc010tmc.1		NA																	0				skin(1)	1						c.(73-75)CCAfs		olfactory receptor, family 10, subfamily G,																																				SO:0001589	frameshift_variant	26534				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22102924_22102925insG		CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.75dupC	14.37:g.22102930_22102930dupG	ENSP00000445383:p.Pro25fs		Somatic					p.P25fs	NM_001005466	NP_001005466	WXS	Illumina HiSeq	Unspecified	Q8NGC3	O10G2_HUMAN		GBM - Glioblastoma multiforme(265;0.0142)	1	74_75	-	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	25			Extracellular (Potential).		B2RPD0	Frame_Shift_Ins	INS	ENST00000542433.1	37	c.74_75insC	CCDS32047.1																																																																																				0.480	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401525.1			9	414	NA	NA	NA	NA	NA	9	414	---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	32902724	32902725	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:32902724_32902725insC	ENST00000280979.4	+	2	195_196	c.25_26insC	c.(25-27)tccfs	p.S9fs	AKAP6_ENST00000554449.1_3'UTR|AKAP6_ENST00000557272.1_Frame_Shift_Ins_p.S9fs|AKAP6_ENST00000557354.1_Frame_Shift_Ins_p.S9fs	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	9					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CGTGACACTTTCCCCCCTGAGG	0.505																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	0				breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(25-27)TCCfs		A-kinase anchor protein 6																																				SO:0001589	frameshift_variant	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:32902724_32902725insC	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.31dupC	14.37:g.32902730_32902730dupC	ENSP00000280979:p.Ser9fs		Somatic				AKAP6_uc010aml.2_Frame_Shift_Ins_p.S6fs	p.S9fs	NM_004274	NP_004265	WXS	Illumina HiSeq	Unspecified	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	2	195_196	+	Breast(36;0.0388)|Prostate(35;0.15)		9					A7E242|A7E2D4|O15028	Frame_Shift_Ins	INS	ENST00000280979.4	37	c.25_26insC	CCDS9644.1																																																																																				0.505	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		8	971	NA	NA	NA	NA	NA	8	971	---	---	---	---
KCNH5	27133	broad.mit.edu	37	14	63174302	63174303	+	Frame_Shift_Ins	INS	-	-	G	rs35940222		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:63174302_63174303insG	ENST00000322893.7	-	11	3158_3159	c.2890_2891insC	c.(2890-2892)cagfs	p.Q964fs	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	964					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		ACATGGTATCTGGGGGGGTACT	0.391																																							uc001xfx.2		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(2890-2892)CAGfs		potassium voltage-gated channel, subfamily H,			,	5,4259		0,5,2127					,	4.2	1.0		dbSNP_126	119	5,8249		0,5,4122	no	utr-3,frameshift	KCNH5	NM_172375.1,NM_139318.3	,	0,10,6249	A1A1,A1R,RR		0.0606,0.1173,0.0799	,	,		10,12508				SO:0001589	frameshift_variant	27133				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity	g.chr14:63174302_63174303insG	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2891dupC	14.37:g.63174309_63174309dupG	ENSP00000321427:p.Gln964fs		Somatic				KCNH5_uc001xfy.2_3'UTR	p.Q964fs	NM_139318	NP_647479	WXS	Illumina HiSeq	Unspecified	Q8NCM2	KCNH5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)	11	2941_2942	-			964			Cytoplasmic (Potential).		C9JP98	Frame_Shift_Ins	INS	ENST00000322893.7	37	c.2890_2891insC	CCDS9756.1																																																																																				0.391	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318		10	210	NA	NA	NA	NA	NA	10	210	---	---	---	---
YLPM1	56252	broad.mit.edu	37	14	75248518	75248519	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr14:75248518_75248519insC	ENST00000552421.1	+	4	1896_1897	c.1772_1773insC	c.(1771-1776)ctccccfs	p.LP591fs	YLPM1_ENST00000238571.3_Intron|YLPM1_ENST00000325680.7_Frame_Shift_Ins_p.LP591fs			P49750	YLPM1_HUMAN	YLP motif containing 1	0					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CCACCAGTTCTCCCCCCACCTT	0.599																																							uc001xqj.3		NA																	0				ovary(2)|pancreas(1)	3						c.(1771-1773)CTCfs		YLP motif containing 1																																				SO:0001589	frameshift_variant	56252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck		g.chr14:75248518_75248519insC	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.1778dupC	14.37:g.75248524_75248524dupC	ENSP00000447921:p.Leu591fs		Somatic				YLPM1_uc001xql.3_RNA	p.L591fs	NM_019589	NP_062535	WXS	Illumina HiSeq	Unspecified	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)	4	1896_1897	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					P49752|Q96I64|Q9P1V7	Frame_Shift_Ins	INS	ENST00000552421.1	37	c.1772_1773insC																																																																																					0.599	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589		7	341	NA	NA	NA	NA	NA	7	341	---	---	---	---
OR4M2	390538	broad.mit.edu	37	15	22369023	22369024	+	Frame_Shift_Ins	INS	-	-	G	rs570771230|rs571384652	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:22369023_22369024insG	ENST00000332663.2	+	1	546_547	c.448_449insG	c.(448-450)aggfs	p.R150fs	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R150M(2)|p.R150W(1)		NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCTCTCCTGGAGGGGGGGCTTC	0.5													tgggggg|GGGGGGG|GGGGGGGG|complex_insertion	8	0.00159744	0.0045	0.0	5008	,	,		35803	0.0		0.0	False		,,,				2504	0.002						uc010tzu.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(448-450)AGGfs		olfactory receptor, family 4, subfamily M,																																				SO:0001589	frameshift_variant	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22369023_22369024insG	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.455dupG	15.37:g.22369030_22369030dupG	ENSP00000329467:p.Arg150fs		Somatic				LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.R150fs	NM_001004719	NP_001004719	WXS	Illumina HiSeq	Unspecified	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	448_449	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	150			Helical; Name=4; (Potential).		B9EH16|Q6IEY2	Frame_Shift_Ins	INS	ENST00000332663.2	37	c.448_449insG	CCDS32172.1																																																																																				0.500	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			15	406	NA	NA	NA	NA	NA	15	406	---	---	---	---
MAPKBP1	23005	broad.mit.edu	37	15	42092080	42092080	+	Frame_Shift_Del	DEL	C	C	-	rs367612663		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:42092080delC	ENST00000456763.2	+	3	370	c.174delC	c.(172-174)gacfs	p.D58fs	MAPKBP1_ENST00000260357.7_Intron|MAPKBP1_ENST00000514566.1_Frame_Shift_Del_p.D58fs|MAPKBP1_ENST00000457542.2_Frame_Shift_Del_p.D58fs|MAPKBP1_ENST00000507762.1_3'UTR|MAPKBP1_ENST00000221214.6_Frame_Shift_Del_p.D58fs	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	58										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		TTGCCTGTGACCCCCGATCAG	0.502																																							uc001zok.3		NA																	0				central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10						c.(172-174)GACfs		mitogen-activated protein kinase binding protein							169.0	146.0	154.0					15																	42092080		2203	4300	6503	SO:0001589	frameshift_variant	23005							g.chr15:42092080delC	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.174delC	15.37:g.42092080delC	ENSP00000393099:p.Asp58fs		Somatic				MAPKBP1_uc001zoj.3_Frame_Shift_Del_p.D58fs|MAPKBP1_uc010bcj.2_5'UTR|MAPKBP1_uc010bci.2_Frame_Shift_Del_p.D58fs|MAPKBP1_uc010udb.1_Intron|MAPKBP1_uc010bck.2_5'UTR	p.D58fs	NM_001128608	NP_001122080	WXS	Illumina HiSeq	Unspecified	O60336	MABP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)	3	460	+		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)	58					A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Frame_Shift_Del	DEL	ENST00000456763.2	37	c.174delC	CCDS45239.1																																																																																				0.502	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994		80	227	NA	NA	NA	NA	NA	80	227	---	---	---	---
PRTG	283659	broad.mit.edu	37	15	55912218	55912219	+	Frame_Shift_Ins	INS	-	-	G	rs370777308		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:55912218_55912219insG	ENST00000389286.4	-	20	3491_3492	c.3444_3445insC	c.(3442-3447)cccaacfs	p.N1149fs		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AATCAGAGGTTGGGGGGTGTGG	0.49																																							uc002adg.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(3442-3447)CCCAACfs		protogenin precursor																																				SO:0001589	frameshift_variant	283659				multicellular organismal development	integral to membrane		g.chr15:55912218_55912219insG	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.3445dupC	15.37:g.55912224_55912224dupG	ENSP00000373937:p.Asn1149fs		Somatic					p.P1148fs	NM_173814	NP_776175	WXS	Illumina HiSeq	Unspecified	Q2VWP7	PRTG_HUMAN		all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)	20	3492_3493	-			1148_1149						Frame_Shift_Ins	INS	ENST00000389286.4	37	c.3444_3445insC	CCDS42040.1																																																																																				0.490	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814		7	246	NA	NA	NA	NA	NA	7	246	---	---	---	---
UACA	55075	broad.mit.edu	37	15	70991941	70991942	+	Frame_Shift_Ins	INS	-	-	C	rs139520381		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr15:70991941_70991942insC	ENST00000322954.6	-	2	321_322	c.136_137insG	c.(136-138)gatfs	p.D46fs	UACA_ENST00000539319.1_Frame_Shift_Ins_p.D46fs|UACA_ENST00000560441.1_Frame_Shift_Ins_p.D33fs|UACA_ENST00000379983.2_Frame_Shift_Ins_p.D33fs	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	46					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TTTTTCTACATCCCCCCTTTCT	0.371																																							uc002asr.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(136-138)GATfs		uveal autoantigen with coiled-coil domains and																																				SO:0001589	frameshift_variant	55075					cytoskeleton|extracellular region		g.chr15:70991941_70991942insC	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.137dupG	15.37:g.70991947_70991947dupC	ENSP00000314556:p.Asp46fs		Somatic				UACA_uc010uke.1_Frame_Shift_Ins_p.D46fs|UACA_uc002asq.2_Frame_Shift_Ins_p.D33fs|UACA_uc010bin.1_Frame_Shift_Ins_p.D32fs	p.D46fs	NM_018003	NP_060473	WXS	Illumina HiSeq	Unspecified	Q9BZF9	UACA_HUMAN			2	240_241	-			46			ANK 1.		G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Frame_Shift_Ins	INS	ENST00000322954.6	37	c.136_137insG	CCDS10235.1																																																																																				0.371	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2			7	903	NA	NA	NA	NA	NA	7	903	---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	10273964	10273964	+	Frame_Shift_Del	DEL	T	T	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:10273964delT	ENST00000396573.2	-	3	614	c.305delA	c.(304-306)gacfs	p.D103fs	GRIN2A_ENST00000330684.3_Frame_Shift_Del_p.D103fs|GRIN2A_ENST00000562109.1_Frame_Shift_Del_p.D103fs|GRIN2A_ENST00000396575.2_Frame_Shift_Del_p.D103fs|GRIN2A_ENST00000404927.2_Frame_Shift_Del_p.D103fs	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	103					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTCCGTGTCGTCCCCAAACAC	0.602																																							uc002czo.3		NA																	0				skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(304-306)GACfs		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						93.0	89.0	90.0					16																	10273964		2197	4300	6497	SO:0001589	frameshift_variant	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:10273964delT		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.305delA	16.37:g.10273964delT	ENSP00000379818:p.Asp103fs		Somatic				GRIN2A_uc010uym.1_Frame_Shift_Del_p.D102fs|GRIN2A_uc002czr.3_Frame_Shift_Del_p.D102fs|GRIN2A_uc010buk.2_Frame_Shift_Del_p.D102fs	p.D102fs	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			2	853	-			102			Extracellular (Potential).		O00669|Q17RZ6	Frame_Shift_Del	DEL	ENST00000396573.2	37	c.305delA	CCDS10539.1																																																																																				0.602	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			31	142	NA	NA	NA	NA	NA	31	142	---	---	---	---
NOMO1	23420	broad.mit.edu	37	16	14980694	14980695	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:14980694_14980695insC	ENST00000287667.7	+	28	3470_3471	c.3299_3300insC	c.(3298-3303)ttccccfs	p.FP1100fs		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	1100						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						TTCTTCCATTTCCCCCCACTGC	0.475																																							uc002dcv.2		NA																	0				ovary(1)	1						c.(3298-3300)TTCfs		nodal modulator 1 precursor																																				SO:0001589	frameshift_variant	23420					integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding	g.chr16:14980694_14980695insC	X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.3305dupC	16.37:g.14980700_14980700dupC	ENSP00000287667:p.Phe1100fs		Somatic					p.F1100fs	NM_014287	NP_055102	WXS	Illumina HiSeq	Unspecified	Q15155	NOMO1_HUMAN			28	3365_3366	+			1100			Extracellular (Potential).		P78421|Q8IW21|Q96DG0	Frame_Shift_Ins	INS	ENST00000287667.7	37	c.3299_3300insC	CCDS10556.1																																																																																				0.475	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207065.1			9	453	NA	NA	NA	NA	NA	9	453	---	---	---	---
POLR3E	55718	broad.mit.edu	37	16	22339833	22339834	+	Frame_Shift_Ins	INS	-	-	C	rs200740325	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:22339833_22339834insC	ENST00000299853.5	+	19	2036_2037	c.1869_1870insC	c.(1870-1872)cccfs	p.P624fs	POLR3E_ENST00000359210.4_Frame_Shift_Ins_p.P624fs|POLR3E_ENST00000418581.2_Frame_Shift_Ins_p.P588fs|POLR3E_ENST00000564209.1_Frame_Shift_Ins_p.P624fs	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	624					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		TTGGTCAGTTTCCCCCCCAGAC	0.574																																							uc002dkk.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1867-1872)TTTCCCfs		RNA polymerase III polypeptide E																																				SO:0001589	frameshift_variant	55718				innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity	g.chr16:22339833_22339834insC	AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.1876dupC	16.37:g.22339840_22339840dupC	ENSP00000299853:p.Pro624fs		Somatic				POLR3E_uc002dkj.1_3'UTR|POLR3E_uc002dkm.2_Frame_Shift_Ins_p.F587fs|POLR3E_uc010vbr.1_Frame_Shift_Ins_p.F623fs|POLR3E_uc002dkl.2_Frame_Shift_Ins_p.F623fs|POLR3E_uc010vbs.1_Frame_Shift_Ins_p.F587fs|POLR3E_uc010vbt.1_Frame_Shift_Ins_p.F567fs	p.F623fs	NM_018119	NP_060589	WXS	Illumina HiSeq	Unspecified	Q9NVU0	RPC5_HUMAN		GBM - Glioblastoma multiforme(48;0.012)	19	2025_2026	+			623_624					B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Frame_Shift_Ins	INS	ENST00000299853.5	37	c.1869_1870insC	CCDS10605.1																																																																																				0.574	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211590.1	NM_018119		7	122	NA	NA	NA	NA	NA	7	122	---	---	---	---
MT4	84560	broad.mit.edu	37	16	56602768	56602769	+	Frame_Shift_Ins	INS	-	-	C	rs543306573	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr16:56602768_56602769insC	ENST00000219162.3	+	3	193_194	c.113_114insC	c.(112-117)tgccccfs	p.CP38fs		NM_032935.2	NP_116324	P47944	MT4_HUMAN	metallothionein 4	38					cellular metal ion homeostasis (GO:0006875)		metal ion binding (GO:0046872)			ovary(1)|upper_aerodigestive_tract(1)	2						TGTCCCTGCTGCCCCCCGGGCT	0.599													CCCcCC|CCCCCC|CCCCCCC|insertion	3	0.000599042	0.0023	0.0	5008	,	,		18016	0.0		0.0	False		,,,				2504	0.0						uc002eje.1		NA																	0				ovary(1)	1						c.(112-114)TGCfs		metallothionein 4																																				SO:0001589	frameshift_variant	84560					cytoplasm	copper ion binding|zinc ion binding	g.chr16:56602768_56602769insC	BC113442	CCDS42165.1	16q13	2014-09-04	2007-01-26		ENSG00000102891	ENSG00000102891		"""Metallothioneins"""	18705	protein-coding gene	gene with protein product		606206	"""metallothionein IV"""			8003488	Standard	NM_032935		Approved	MTIV	uc002eje.1	P47944	OTTHUMG00000176863	ENST00000219162.3:c.119dupC	16.37:g.56602774_56602774dupC	ENSP00000219162:p.Cys38fs		Somatic					p.C38fs	NM_032935	NP_116324	WXS	Illumina HiSeq	Unspecified	P47944	MT4_HUMAN			3	193_194	+			38				Divalent metal cation; cluster A (By similarity).	Q14DA1	Frame_Shift_Ins	INS	ENST00000219162.3	37	c.113_114insC	CCDS42165.1																																																																																				0.599	MT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434118.1	NM_032935		7	510	NA	NA	NA	NA	NA	7	510	---	---	---	---
TMEM256-PLSCR3	100529211	broad.mit.edu	37	17	7294058	7294059	+	Frame_Shift_Ins	INS	-	-	C	rs534765323		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:7294058_7294059insC	ENST00000576362.1	-	6	810_811	c.653_654insG	c.(652-654)ggcfs	p.G218fs	C17orf61-PLSCR3_ENST00000573331.1_3'UTR|TMEM256-PLSCR3_ENST00000574401.1_Frame_Shift_Ins_p.G242fs|TMEM256-PLSCR3_ENST00000576201.1_Frame_Shift_Ins_p.G242fs|TMEM256-PLSCR3_ENST00000324822.11_Frame_Shift_Ins_p.G242fs|TMEM256-PLSCR3_ENST00000535512.1_Frame_Shift_Ins_p.G242fs					TMEM256-PLSCR3 readthrough (NMD candidate)																		CTCGGACCAGGCCCCCCCACTG	0.614																																							uc002ggm.1		NA																	0					0						c.(724-726)GGCfs		phospholipid scramblase 3																																				SO:0001589	frameshift_variant	57048				phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding	g.chr17:7294058_7294059insC			17p13.1	2013-09-25			ENSG00000187838	ENSG00000187838			49186	other	readthrough							Standard	NR_037719		Approved				OTTHUMG00000178150	ENST00000576362.1:c.654dupG	17.37:g.7294065_7294065dupC	ENSP00000460800:p.Gly218fs		Somatic				PLSCR3_uc002ggl.2_Frame_Shift_Ins_p.G218fs|PLSCR3_uc002ggq.1_Frame_Shift_Ins_p.G73fs|PLSCR3_uc002ggn.1_Frame_Shift_Ins_p.G242fs|PLSCR3_uc002ggo.1_Frame_Shift_Ins_p.G242fs|PLSCR3_uc002ggp.1_Frame_Shift_Ins_p.G73fs|PLSCR3_uc002ggr.1_Frame_Shift_Ins_p.G242fs|PLSCR3_uc010cmg.1_Frame_Shift_Ins_p.G242fs	p.G242fs	NM_020360	NP_065093	WXS	Illumina HiSeq	Unspecified	Q9NRY6	PLS3_HUMAN			7	934_935	-		Prostate(122;0.173)	242			Cytoplasmic (By similarity).			Frame_Shift_Ins	INS	ENST00000576362.1	37	c.725_726insG																																																																																					0.614	TMEM256-PLSCR3-008	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000440808.1			7	137	NA	NA	NA	NA	NA	7	137	---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578463	7578502	+	Frame_Shift_Del	DEL	CGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCA	CGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCA	-	rs371524413|rs137852790|rs137852791|rs137852793|rs563378859|rs587782705|rs137852789|rs28934874|rs587782197|rs72661116		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	CGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCA	CGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCA	-	-	CGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCA	CGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:7578463_7578502delCGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCA	ENST00000269305.4	-	5	617_656	c.428_467delTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCG	c.(427-468)gtgcagctgtgggttgattccacacccccgcccggcacccgcfs	p.VQLWVDSTPPPGTR143fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.VQLWVDSTPPPGTR143fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.VQLWVDSTPPPGTR143fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.VQLWVDSTPPPGTR143fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.VQLWVDSTPPPGTR143fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.VQLWVDSTPPPGTR143fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	143	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation; strong DNA binding ability at 32.5 degrees Celsius; strong reduction of transcriptional activity at 37.5 degrees Celsius; severely represses interaction with ZNF385A).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.W146*(72)|p.P151S(68)|p.P152L(66)|p.G154V(46)|p.Q144*(36)|p.P151H(31)|p.R156P(24)|p.T155N(22)|p.P152S(22)|p.V143A(18)|p.P152fs*18(18)|p.L145Q(17)|p.L145P(17)|p.T155P(17)|p.P151T(16)|p.T155I(14)|p.P151A(13)|p.G154G(12)|p.P151P(12)|p.R156fs*14(11)|p.P153fs*28(11)|p.R156H(10)|p.T155A(10)|p.G154S(9)|p.P151R(9)|p.L145L(8)|p.P152R(8)|p.0?(8)|p.Q144L(8)|p.P153S(8)|p.L145R(7)|p.P151fs*30(7)|p.P152T(7)|p.P151L(7)|p.P153P(7)|p.G154D(6)|p.T150fs*16(6)|p.V147G(6)|p.S149S(6)|p.S149F(6)|p.V147I(6)|p.P153L(6)|p.V147D(5)|p.P152fs*29(5)|p.V143E(5)|p.V147fs*23(5)|p.W146R(5)|p.T155T(5)|p.S149fs*32(5)|p.P152P(5)|p.P152fs*14(5)|p.?(5)|p.G154C(4)|p.P152Q(4)|p.T150I(4)|p.Q144H(4)|p.D148E(4)|p.Q144R(4)|p.Q144P(4)|p.D148N(4)|p.S149P(4)|p.W146S(4)|p.W14*(3)|p.P152fs*28(3)|p.G61V(3)|p.R156S(3)|p.R156fs*25(3)|p.R156G(3)|p.R156L(3)|p.Q144fs*25(3)|p.Q144fs*26(3)|p.G154I(3)|p.W53*(3)|p.T155_R156insDSTPPPGT(3)|p.S149fs*21(3)|p.G22V(3)|p.P153T(3)|p.G154fs*27(3)|p.V147V(3)|p.Q12*(2)|p.D148fs*33(2)|p.S149T(2)|p.T155fs*23(2)|p.L145V(2)|p.P58H(2)|p.P58A(2)|p.P58S(2)|p.V147A(2)|p.R156C(2)|p.G154fs*16(2)|p.G154fs*14(2)|p.R156_I162delRVRAMAI(2)|p.V143V(2)|p.P152A(2)|p.T155S(2)|p.Q51*(2)|p.Q144del(2)|p.V11A(2)|p.Q144K(2)|p.V50A(2)|p.P20L(2)|p.P59L(2)|p.D148V(2)|p.Q144Q(2)|p.P153fs*26(2)|p.P153fs*22(2)|p.D148fs*23(2)|p.D148fs*22(2)|p.W146C(2)|p.P19S(2)|p.P19H(2)|p.P19A(2)|p.L137_W146del10(1)|p.T23_R24insDSTPPPGT(1)|p.T150R(1)|p.R156_V157del(1)|p.D148fs*34(1)|p.D148fs*32(1)|p.L145del(1)|p.P152fs*27(1)|p.G154_R156delGTR(1)|p.T155fs*26(1)|p.T155fs*25(1)|p.W146fs*25(1)|p.W146fs*22(1)|p.W146fs*23(1)|p.T155_A161delTRVRAMA(1)|p.G61C(1)|p.W14S(1)|p.P58T(1)|p.P58R(1)|p.Q144_G154del11(1)|p.W146_V147insXXXXXXX(1)|p.P151del(1)|p.T150fs*31(1)|p.Q144fs*32(1)|p.D148_T155delDSTPPPGT(1)|p.R156_A161delRVRAMA(1)|p.R156del(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.T150fs*23(1)|p.W53S(1)|p.T57fs*16(1)|p.A138_V143delAKTCPV(1)|p.T150_P153delTPPP(1)|p.T62P(1)|p.G154A(1)|p.Q51fs*25(1)|p.P152del(1)|p.T62A(1)|p.V143G(1)|p.S149fs*72(1)|p.T62N(1)|p.T62I(1)|p.Q144fs*16(1)|p.P153_G154insX(1)|p.K139fs*4(1)|p.C141fs*5(1)|p.P152_P153del(1)|p.R156_R158delRVR(1)|p.P20R(1)|p.W146_S149>C(1)|p.T23P(1)|p.T150K(1)|p.T23A(1)|p.T23N(1)|p.S149fs*17(1)|p.T23I(1)|p.L145M(1)|p.V143_S149del(1)|p.P152_P153insXXX(1)|p.T155_R156delTR(1)|p.T150_P151delTP(1)|p.Q144fs*4(1)|p.P142_Q144delPVQ(1)|p.P153fs*16(1)|p.D148Y(1)|p.P151_V173del23(1)|p.D148D(1)|p.Q12fs*25(1)|p.D148H(1)|p.P59R(1)|p.D148del(1)|p.G22C(1)|p.R156_A161del(1)|p.P153fs*20(1)|p.W146fs*1(1)|p.T62_R63insDSTPPPGT(1)|p.S149fs*31(1)|p.W146G(1)|p.V147E(1)|p.G154fs*22(1)|p.V147F(1)|p.P19R(1)|p.P19T(1)|p.P153F(1)|p.T18fs*16(1)|p.P153A(1)|p.D148*(1)|p.P153H(1)|p.T155fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCGCGGACGCGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCACAGGGCAGGT	0.592		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		1015	Substitution - Missense(649)|Substitution - Nonsense(119)|Deletion - Frameshift(92)|Substitution - coding silent(63)|Insertion - Frameshift(43)|Deletion - In frame(26)|Insertion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Complex - frameshift(1)|Complex - deletion inframe(1)	p.P151S(61)|p.W146*(61)|p.P152L(57)|p.G154V(36)|p.Q144*(29)|p.P151H(25)|p.R156P(24)|p.P152S(21)|p.T155N(19)|p.L145Q(17)|p.L145P(17)|p.P152fs*18(17)|p.V143M(16)|p.V143A(15)|p.T155P(14)|p.P151T(13)|p.G154G(12)|p.P151P(12)|p.R156H(10)|p.T155I(10)|p.P151A(10)|p.P153fs*28(10)|p.G154S(9)|p.R156fs*14(8)|p.L145L(8)|p.Q144L(8)|p.P153S(8)|p.L145R(7)|p.P151fs*30(7)|p.T155A(7)|p.0?(7)|p.P152T(7)|p.P153P(7)|p.G154D(6)|p.V147G(6)|p.P151L(6)|p.P151R(6)|p.S149S(6)|p.S149F(6)|p.V147I(6)|p.P153L(6)|p.P152fs*29(5)|p.V147fs*23(5)|p.W146R(5)|p.T155T(5)|p.S149fs*32(5)|p.P152P(5)|p.V147D(4)|p.V143E(4)|p.P152fs*14(4)|p.V143L(4)|p.P152Q(4)|p.T150I(4)|p.Q144H(4)|p.D148E(4)|p.D148N(4)|p.Q144R(4)|p.Q144P(4)|p.S149P(4)|p.P152fs*28(3)|p.R156S(3)|p.R156fs*25(3)|p.R156G(3)|p.R156L(3)|p.Q144fs*26(3)|p.G154I(3)|p.T150fs*16(3)|p.P152R(3)|p.S149fs*21(3)|p.P153T(3)|p.G154fs*27(3)|p.V147V(3)|p.V143fs*27(2)|p.D148fs*33(2)|p.T155fs*23(2)|p.L145V(2)|p.R156C(2)|p.G154fs*16(2)|p.G154fs*14(2)|p.R156_I162delRVRAMAI(2)|p.V143V(2)|p.T155S(2)|p.Q144del(2)|p.Q144K(2)|p.P152A(2)|p.V147A(2)|p.D148V(2)|p.Q144Q(2)|p.P153fs*26(2)|p.S149T(2)|p.P153fs*22(2)|p.D148fs*23(2)|p.D148fs*22(2)|p.W146C(2)|p.L137_W146del10(1)|p.V143fs*29(1)|p.T150R(1)|p.D148fs*34(1)|p.D148fs*32(1)|p.L145del(1)|p.G154_R156delGTR(1)|p.T155fs*26(1)|p.T155fs*25(1)|p.W146fs*25(1)|p.W146fs*22(1)|p.W146fs*23(1)|p.T155_A161delTRVRAMA(1)|p.P58A(1)|p.Q144_G154del11(1)|p.W146_V147insXXXXXXX(1)|p.T150fs*31(1)|p.Q144fs*32(1)|p.D148_T155delDSTPPPGT(1)|p.R156_A161delRVRAMA(1)|p.R156del(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.T150fs*23(1)|p.T150_P153delTPPP(1)|p.G154A(1)|p.G154C(1)|p.P152del(1)|p.V143G(1)|p.S149fs*72(1)|p.Q144fs*16(1)|p.P153_G154insX(1)|p.K139fs*4(1)|p.V11A(1)|p.C141fs*5(1)|p.P152_P153del(1)|p.R156_R158delRVR(1)|p.V50A(1)|p.P151del(1)|p.W146_S149>C(1)|p.D148del(1)|p.T150K(1)|p.S149fs*17(1)|p.V143_S149del(1)|p.P152_P153insXXX(1)|p.T155_R156delTR(1)|p.T150_P151delTP(1)|p.Q144fs*4(1)|p.P142_Q144delPVQ(1)|p.P153fs*16(1)|p.D148Y(1)|p.P151_V173del23(1)|p.D148D(1)|p.D148H(1)|p.A138_V143delAKTCPV(1)|p.R156_A161del(1)|p.P153fs*20(1)|p.W146S(1)|p.W146fs*1(1)|p.S149fs*31(1)|p.W146G(1)|p.V147E(1)|p.G154fs*22(1)|p.V147F(1)|p.L145M(1)|p.P153F(1)|p.P153A(1)|p.D148*(1)|p.P19A(1)|p.P153H(1)|p.T155fs*15(1)	lung(150)|large_intestine(137)|upper_aerodigestive_tract(103)|breast(87)|oesophagus(84)|ovary(66)|haematopoietic_and_lymphoid_tissue(58)|stomach(55)|urinary_tract(49)|central_nervous_system(46)|skin(32)|liver(30)|prostate(27)|endometrium(23)|pancreas(15)|soft_tissue(14)|biliary_tract(9)|bone(9)|vulva(6)|thyroid(4)|adrenal_gland(3)|kidney(2)|pleura(1)|peritoneum(1)|cervix(1)|eye(1)|genital_tract(1)|small_intestine(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CD044990|CD090894|CI920955|CM012662|CM023462|CM941326|CM941327|CM942117|CM951223|CM984589	TP53	D|I|M	rs137852789|rs28934874	c.(427-468)GTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCfs	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a																																				SO:0001589	frameshift_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578463_7578502delCGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.428_467delTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCG	17.37:g.7578463_7578502delCGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCA	ENSP00000269305:p.Val143fs	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Frame_Shift_Del_p.V143fs|TP53_uc002gih.2_Frame_Shift_Del_p.V143fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.V11fs|TP53_uc010cng.1_Frame_Shift_Del_p.V11fs|TP53_uc002gii.1_Frame_Shift_Del_p.V11fs|TP53_uc010cnh.1_Frame_Shift_Del_p.V143fs|TP53_uc010cni.1_Frame_Shift_Del_p.V143fs|TP53_uc002gij.2_Frame_Shift_Del_p.V143fs|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Frame_Shift_Del_p.V50fs|TP53_uc002gio.2_Frame_Shift_Del_p.V11fs|TP53_uc010vug.1_Frame_Shift_Del_p.V104fs	p.V143fs	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	622_661	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	143_156		R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	c.428_467delTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCG	CCDS11118.1																																																																																				0.592	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		7	156	NA	NA	NA	NA	NA	7	156	---	---	---	---
SSH2	85464	broad.mit.edu	37	17	27959374	27959375	+	Frame_Shift_Ins	INS	-	-	G	rs376316249		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:27959374_27959375insG	ENST00000269033.3	-	15	2907_2908	c.2756_2757insC	c.(2755-2757)ccafs	p.P919fs	SSH2_ENST00000540801.1_Frame_Shift_Ins_p.P946fs|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	919					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ATGAATGTTCTGGGGGGGCTTC	0.48																																							uc002heo.1		NA																	0				skin(2)	2						c.(2755-2757)CCAfs		slingshot 2																																				SO:0001589	frameshift_variant	85464				actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr17:27959374_27959375insG	AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.2757dupC	17.37:g.27959381_27959381dupG	ENSP00000269033:p.Pro919fs		Somatic				SSH2_uc010wbh.1_Frame_Shift_Ins_p.P946fs	p.P919fs	NM_033389	NP_203747	WXS	Illumina HiSeq	Unspecified	Q76I76	SSH2_HUMAN			15	2756_2757	-			919					Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Frame_Shift_Ins	INS	ENST00000269033.3	37	c.2756_2757insC	CCDS11253.1																																																																																				0.480	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389		26	516	NA	NA	NA	NA	NA	26	516	---	---	---	---
ACACA	31	broad.mit.edu	37	17	35600370	35600371	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:35600370_35600371insG	ENST00000394406.2	-	22	2926_2927	c.2736_2737insC	c.(2734-2739)cccaatfs	p.N913fs	ACACA_ENST00000353139.5_Frame_Shift_Ins_p.N950fs|ACACA_ENST00000335166.5_Frame_Shift_Ins_p.N835fs|ACACA_ENST00000360679.3_Frame_Shift_Ins_p.N855fs	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	913					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TTCTCCACATTGGGGGGAATGC	0.47																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	uc002hnm.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(2734-2739)CCCAATfs		acetyl-Coenzyme A carboxylase alpha isoform 2	Biotin(DB00121)																																			SO:0001589	frameshift_variant	31				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding	g.chr17:35600370_35600371insG	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.2737dupC	17.37:g.35600376_35600376dupG	ENSP00000377928:p.Asn913fs		Somatic				ACACA_uc002hnk.2_Frame_Shift_Ins_p.P834fs|ACACA_uc002hnl.2_Frame_Shift_Ins_p.P854fs|ACACA_uc002hnn.2_Frame_Shift_Ins_p.P912fs|ACACA_uc002hno.2_Frame_Shift_Ins_p.P949fs|ACACA_uc010cuz.2_Frame_Shift_Ins_p.P912fs	p.P912fs	NM_198836	NP_942133	WXS	Illumina HiSeq	Unspecified	Q13085	ACACA_HUMAN			22	2927_2928	-		Breast(25;0.00157)|Ovarian(249;0.15)	912_913					B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Frame_Shift_Ins	INS	ENST00000394406.2	37	c.2736_2737insC	CCDS11317.1																																																																																				0.470	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836		7	702	NA	NA	NA	NA	NA	7	702	---	---	---	---
CA10	56934	broad.mit.edu	37	17	50008356	50008357	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:50008356_50008357insC	ENST00000285273.4	-	4	1383_1384	c.272_273insG	c.(271-273)ggcfs	p.G91fs	CA10_ENST00000442502.2_Frame_Shift_Ins_p.G91fs|CA10_ENST00000340813.6_Frame_Shift_Ins_p.G97fs|CA10_ENST00000570565.1_Frame_Shift_Ins_p.G16fs|CA10_ENST00000451037.2_Frame_Shift_Ins_p.G91fs	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	91					brain development (GO:0007420)			p.G91V(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	TTACCTTCCTGCCCCCCGTGTT	0.49																																							uc002itw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(271-273)GGCfs		carbonic anhydrase X																																				SO:0001589	frameshift_variant	56934				brain development			g.chr17:50008356_50008357insC	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.273dupG	17.37:g.50008362_50008362dupC	ENSP00000285273:p.Gly91fs		Somatic				CA10_uc002itv.3_Frame_Shift_Ins_p.G97fs|CA10_uc002itx.3_Frame_Shift_Ins_p.G91fs|CA10_uc002ity.3_Frame_Shift_Ins_p.G91fs|CA10_uc002itz.2_Frame_Shift_Ins_p.G91fs	p.G91fs	NM_020178	NP_064563	WXS	Illumina HiSeq	Unspecified	Q9NS85	CAH10_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		3	1258_1259	-			91					B2R7J0|B4DGL6	Frame_Shift_Ins	INS	ENST00000285273.4	37	c.272_273insG	CCDS32684.1																																																																																				0.490	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178		11	694	NA	NA	NA	NA	NA	11	694	---	---	---	---
MARCH10	162333	broad.mit.edu	37	17	60814265	60814266	+	Frame_Shift_Ins	INS	-	-	C	rs372503255		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:60814265_60814266insC	ENST00000311269.5	-	6	1237_1238	c.963_964insG	c.(961-966)gggacafs	p.T322fs	MARCH10_ENST00000583600.1_Frame_Shift_Ins_p.T360fs|RP11-156L14.1_ENST00000577270.1_RNA|MARCH10_ENST00000456609.2_Frame_Shift_Ins_p.T322fs|MARCH10_ENST00000544856.2_Frame_Shift_Ins_p.T321fs|RP11-156L14.1_ENST00000584597.1_RNA|RP11-156L14.1_ENST00000582564.1_RNA|RP11-156L14.1_ENST00000579201.1_RNA	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	322					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						GGGGTCGATGTCCCCCCAAATC	0.46																																							uc010ddr.2		NA																	0					0						c.(961-966)GGGACAfs		ring finger protein 190																																				SO:0001589	frameshift_variant	162333						ligase activity|zinc ion binding	g.chr17:60814265_60814266insC	AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.964dupG	17.37:g.60814271_60814271dupC	ENSP00000311496:p.Thr322fs		Somatic				MARCH10_uc002jag.3_Frame_Shift_Ins_p.G321fs|MARCH10_uc010dds.2_Frame_Shift_Ins_p.G359fs|MARCH10_uc002jah.2_Frame_Shift_Ins_p.G320fs|uc002jaj.1_RNA|uc002jak.2_RNA	p.G321fs	NM_001100875	NP_001094345	WXS	Illumina HiSeq	Unspecified	Q8NA82	MARHA_HUMAN			6	1201_1202	-			321_322					D3DU09|Q8IYS7|Q8N7Z7	Frame_Shift_Ins	INS	ENST00000311269.5	37	c.963_964insG	CCDS11635.1																																																																																				0.460	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598		8	620	NA	NA	NA	NA	NA	8	620	---	---	---	---
FAM104A	84923	broad.mit.edu	37	17	71223356	71223357	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr17:71223356_71223357insG	ENST00000403627.3	-	2	328_329	c.268_269insC	c.(268-270)cagfs	p.Q90fs	FAM104A_ENST00000405159.3_Frame_Shift_Ins_p.Q90fs|FAM104A_ENST00000580032.1_5'UTR|FAM104A_ENST00000581110.1_Intron|FAM104A_ENST00000583178.1_5'UTR|FAM104A_ENST00000583024.1_Intron	NM_032837.2	NP_116226.2	Q969W3	F104A_HUMAN	family with sequence similarity 104, member A	90										endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			LUSC - Lung squamous cell carcinoma(166;0.197)			TCTTTTGGTCTGGGGGGGAAGA	0.416																																							uc002jji.3		NA																	0					0						c.(268-270)CAGfs		hypothetical protein LOC84923 isoform 2																																				SO:0001589	frameshift_variant	84923							g.chr17:71223356_71223357insG	AK027681	CCDS11693.2, CCDS45766.1, CCDS74143.1, CCDS74144.1	17q25.1	2005-12-16			ENSG00000133193	ENSG00000133193			25918	protein-coding gene	gene with protein product							Standard	NM_032837		Approved	FLJ14775	uc002jjj.4	Q969W3	OTTHUMG00000150564	ENST00000403627.3:c.269dupC	17.37:g.71223363_71223363dupG	ENSP00000384648:p.Gln90fs		Somatic				FAM104A_uc002jjj.3_Frame_Shift_Ins_p.Q90fs	p.Q90fs	NM_032837	NP_116226	WXS	Illumina HiSeq	Unspecified	Q969W3	F104A_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.197)		2	356_357	-			90					B4E339	Frame_Shift_Ins	INS	ENST00000403627.3	37	c.268_269insC	CCDS11693.2																																																																																				0.416	FAM104A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318935.1	NM_032837		7	168	NA	NA	NA	NA	NA	7	168	---	---	---	---
ALPK2	115701	broad.mit.edu	37	18	56246441	56246442	+	Frame_Shift_Ins	INS	-	-	C	rs12606191	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:56246441_56246442insC	ENST00000361673.3	-	4	1779_1780	c.1566_1567insG	c.(1564-1569)ggaaagfs	p.K523fs	ALPK2_ENST00000587399.1_5'UTR	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	523						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CATAAGTCCTTTCCCCCCACTC	0.52											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(1564-1569)GGAAAGfs		heart alpha-kinase																																				SO:0001589	frameshift_variant	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56246441_56246442insC	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1566_1567insG	18.37:g.56246441_56246442insC	ENSP00000354991:p.Lys523fs		Somatic	OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1014		p.G522fs	NM_052947	NP_443179	WXS	Illumina HiSeq	Unspecified	Q86TB3	ALPK2_HUMAN			4	1780_1781	-			522_523					Q6ZUX0|Q8NAT5|Q96L95	Frame_Shift_Ins	INS	ENST00000361673.3	37	c.1566_1567insG	CCDS11966.2																																																																																				0.520	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		7	487	NA	NA	NA	NA	NA	7	487	---	---	---	---
SERPINB7	8710	broad.mit.edu	37	18	61449757	61449758	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:61449757_61449758delCT	ENST00000398019.2	+	2	476_477	c.151_152delCT	c.(151-153)ctcfs	p.L51fs	SERPINB7_ENST00000336429.2_Frame_Shift_Del_p.L51fs|SERPINB7_ENST00000546027.1_Frame_Shift_Del_p.L51fs|SERPINB7_ENST00000540675.1_Frame_Shift_Del_p.L51fs	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	51					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				AGATGACTCCCTCTCTCAGATT	0.47																																							uc002ljl.2		NA																	0				lung(2)|central_nervous_system(1)	3						c.(151-153)CTCfs		serine (or cysteine) proteinase inhibitor, clade																																				SO:0001589	frameshift_variant	8710				regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity	g.chr18:61449757_61449758delCT	AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.151_152delCT	18.37:g.61449761_61449762delCT	ENSP00000381101:p.Leu51fs		Somatic				SERPINB7_uc002ljm.2_Frame_Shift_Del_p.L51fs|SERPINB7_uc010xet.1_Frame_Shift_Del_p.L51fs|SERPINB7_uc010dqg.2_Frame_Shift_Del_p.L51fs	p.L51fs	NM_001040147	NP_001035237	WXS	Illumina HiSeq	Unspecified	O75635	SPB7_HUMAN			2	247_248	+		Esophageal squamous(42;0.129)	51					B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Frame_Shift_Del	DEL	ENST00000398019.2	37	c.151_152delCT	CCDS11988.1																																																																																				0.470	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1	NM_003784		82	345	NA	NA	NA	NA	NA	82	345	---	---	---	---
CNDP2	55748	broad.mit.edu	37	18	72168667	72168668	+	Frame_Shift_Ins	INS	-	-	G	rs556124772		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr18:72168667_72168668insG	ENST00000324262.4	+	3	480_481	c.164_165insG	c.(163-168)ttggggfs	p.LG55fs	CNDP2_ENST00000579847.1_Frame_Shift_Ins_p.LG55fs|CNDP2_ENST00000324301.8_Frame_Shift_Ins_p.LG55fs	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	55					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		GTTAAGCAGTTGGGGGGCTCTG	0.52																																							uc002llm.1		NA																	0				ovary(2)|skin(1)	3						c.(163-165)TTGfs		CNDP dipeptidase 2																																				SO:0001589	frameshift_variant	55748					cytoplasm	carboxypeptidase activity|metal ion binding|metallopeptidase activity|protein binding|tripeptidase activity	g.chr18:72168667_72168668insG	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.170dupG	18.37:g.72168673_72168673dupG	ENSP00000325548:p.Leu55fs		Somatic				CNDP2_uc002lln.1_Frame_Shift_Ins_p.L55fs|CNDP2_uc002llo.2_Frame_Shift_Ins_p.L55fs	p.L55fs	NM_018235	NP_060705	WXS	Illumina HiSeq	Unspecified	Q96KP4	CNDP2_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.22)	3	326_327	+		Esophageal squamous(42;0.131)|Prostate(75;0.173)	55					B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Frame_Shift_Ins	INS	ENST00000324262.4	37	c.164_165insG	CCDS12006.1																																																																																				0.520	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235		7	326	NA	NA	NA	NA	NA	7	326	---	---	---	---
C3	718	broad.mit.edu	37	19	6697480	6697481	+	Frame_Shift_Ins	INS	-	-	G	rs137956083	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:6697480_6697481insG	ENST00000245907.6	-	21	2762_2763	c.2670_2671insC	c.(2668-2673)cccaagfs	p.K891fs		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	891					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	AACGAGGACTTGGGGGGGATGG	0.574																																							uc002mfm.2		NA																	0				skin(3)|ovary(1)|pancreas(1)	5						c.(2668-2673)CCCAAGfs		complement component 3 precursor																																				SO:0001589	frameshift_variant	718				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding	g.chr19:6697480_6697481insG	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2671dupC	19.37:g.6697487_6697487dupG	ENSP00000245907:p.Lys891fs		Somatic					p.P890fs	NM_000064	NP_000055	WXS	Illumina HiSeq	Unspecified	P01024	CO3_HUMAN		GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	21	2732_2733	-			890_891					A7E236	Frame_Shift_Ins	INS	ENST00000245907.6	37	c.2670_2671insC	CCDS32883.1																																																																																				0.574	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064		9	296	NA	NA	NA	NA	NA	9	296	---	---	---	---
ZNF878	729747	broad.mit.edu	37	19	12155624	12155625	+	Frame_Shift_Ins	INS	-	-	T			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:12155624_12155625insT	ENST00000547628.1	-	4	728_729	c.591_592insA	c.(589-594)aaacccfs	p.P198fs	ZNF878_ENST00000602107.1_Frame_Shift_Ins_p.P245fs|CTD-2006C1.2_ENST00000591898.1_RNA|CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.10_ENST00000547473.1_Intron|CTD-2006C1.2_ENST00000591838.1_RNA	NM_001080404.2	NP_001073873.2	C9JN71	ZN878_HUMAN	zinc finger protein 878	198					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						CATTCATAGGGTTTTTTTGCAG	0.396																																							uc002mta.1		NA																	0					0						c.(730-735)AAACCCfs		zinc finger protein 878																																				SO:0001589	frameshift_variant	729747				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr19:12155624_12155625insT		CCDS45984.1, CCDS45984.2	19p13.2	2013-01-08				ENSG00000257446		"""Zinc fingers, C2H2-type"", ""-"""	37246	protein-coding gene	gene with protein product							Standard	NM_001080404		Approved		uc021upl.1	C9JN71		ENST00000547628.1:c.592dupA	19.37:g.12155631_12155631dupT	ENSP00000447931:p.Pro198fs		Somatic					p.K244fs	NM_001080404	NP_001073873	WXS	Illumina HiSeq	Unspecified	C9JN71	ZN878_HUMAN			5	732_733	-			197_198						Frame_Shift_Ins	INS	ENST00000547628.1	37	c.732_733insA	CCDS45984.2																																																																																				0.396	ZNF878-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403723.1	NM_001080404		8	362	NA	NA	NA	NA	NA	8	362	---	---	---	---
C19orf40	91442	broad.mit.edu	37	19	33464113	33464114	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:33464113_33464114insC	ENST00000588258.1	+	2	121_122	c.11_12insC	c.(10-15)aaccccfs	p.NP4fs	CEP89_ENST00000591863.1_5'Flank|C19orf40_ENST00000590179.1_Intron|CEP89_ENST00000305768.5_5'Flank|C19orf40_ENST00000590281.1_Frame_Shift_Ins_p.NP4fs|CEP89_ENST00000590597.2_5'Flank|C19orf40_ENST00000589646.1_Intron	NM_152266.3	NP_689479.1	Q9BTP7	FAP24_HUMAN	chromosome 19 open reading frame 40	4					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(2)|prostate(2)	7	Esophageal squamous(110;0.137)					ATGGAAAAGAACCCCCCTGATG	0.609								Direct reversal of damage																															uc002nud.3		NA																	0					0						c.(10-12)AACfs	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia-associated protein, 24 kDa																																				SO:0001589	frameshift_variant	91442				DNA repair	Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding	g.chr19:33464113_33464114insC	AK128668	CCDS12426.1, CCDS74327.1	19q13.11	2011-11-24			ENSG00000131944	ENSG00000131944			28467	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 24kDa"""	610884				17289582	Standard	XM_005259393		Approved	FLJ46828, MGC32020, FAAP24	uc002nud.4	Q9BTP7		ENST00000588258.1:c.17dupC	19.37:g.33464119_33464119dupC	ENSP00000466121:p.Asn4fs		Somatic				CCDC123_uc002nty.2_5'Flank|CCDC123_uc010edg.2_5'Flank|CCDC123_uc002ntz.1_5'Flank|CCDC123_uc002nua.2_5'Flank|CCDC123_uc002nuc.1_5'Flank	p.N4fs	NM_152266	NP_689479	WXS	Illumina HiSeq	Unspecified	Q9BTP7	FAP24_HUMAN			2	129_130	+	Esophageal squamous(110;0.137)		4					B3KY46|Q8WUJ7|Q96FX6	Frame_Shift_Ins	INS	ENST00000588258.1	37	c.11_12insC	CCDS12426.1																																																																																				0.609	C19orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450823.2	NM_152266		8	1451	NA	NA	NA	NA	NA	8	1451	---	---	---	---
AXL	558	broad.mit.edu	37	19	41743932	41743933	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:41743932_41743933insC	ENST00000301178.4	+	7	1057_1058	c.867_868insC	c.(868-870)cccfs	p.P290fs	AXL_ENST00000359092.3_Frame_Shift_Ins_p.P290fs|AXL_ENST00000593513.1_Frame_Shift_Ins_p.P22fs	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	290	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						AAGCATCCGTGCCCCCCCATCA	0.649																																							uc010ehj.2		NA																	0		p.V289M(1)		lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						c.(865-870)GTGCCCfs		AXL receptor tyrosine kinase isoform 1																																				SO:0001589	frameshift_variant	558					integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr19:41743932_41743933insC	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.874dupC	19.37:g.41743939_41743939dupC	ENSP00000301178:p.Pro290fs		Somatic				CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Frame_Shift_Ins_p.V289fs|AXL_uc010ehk.2_Frame_Shift_Ins_p.V289fs	p.V289fs	NM_021913	NP_068713	WXS	Illumina HiSeq	Unspecified	P30530	UFO_HUMAN			7	1057_1058	+			289_290			Extracellular (Potential).|Fibronectin type-III 1.		Q8N5L2|Q9UD27	Frame_Shift_Ins	INS	ENST00000301178.4	37	c.867_868insC	CCDS12575.1																																																																																				0.649	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2			8	219	NA	NA	NA	NA	NA	8	219	---	---	---	---
MARK4	57787	broad.mit.edu	37	19	45805663	45805664	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:45805663_45805664insC	ENST00000262891.4	+	17	2285_2286	c.1954_1955insC	c.(1954-1956)gccfs	p.A652fs	MARK4_ENST00000300843.4_Frame_Shift_Ins_p.P679fs	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	652					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		AACGGAAACCGCCCCCCGGCTG	0.639																																							uc002pbb.1		NA																	0				central_nervous_system(2)|large_intestine(1)	3						c.(1954-1956)GCCfs		RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;																																				SO:0001589	frameshift_variant	57787				microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding	g.chr19:45805663_45805664insC	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1960dupC	19.37:g.45805669_45805669dupC	ENSP00000262891:p.Ala652fs		Somatic				MARK4_uc002pba.1_Frame_Shift_Ins_p.P678fs	p.A652fs			WXS	Illumina HiSeq	Unspecified	Q96L34	MARK4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0102)	17	1959_1960	+		all_neural(266;0.224)|Ovarian(192;0.231)	652					Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Frame_Shift_Ins	INS	ENST00000262891.4	37	c.1954_1955insC	CCDS56097.1																																																																																				0.639	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417		7	182	NA	NA	NA	NA	NA	7	182	---	---	---	---
CARD8	22900	broad.mit.edu	37	19	48737669	48737670	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:48737669_48737670insC	ENST00000359009.4	-	3	378_379	c.66_67insG	c.(64-69)gggacafs	p.T23fs	CARD8_ENST00000447740.2_Frame_Shift_Ins_p.D64fs|CARD8_ENST00000519940.1_Frame_Shift_Ins_p.D114fs|CARD8_ENST00000520153.1_Frame_Shift_Ins_p.D64fs|CARD8_ENST00000357778.5_5'UTR|CARD8_ENST00000391898.3_Frame_Shift_Ins_p.D114fs|CARD8_ENST00000520753.1_Frame_Shift_Ins_p.D114fs|CARD8_ENST00000521613.1_Frame_Shift_Ins_p.D64fs|CARD8_ENST00000520015.1_Frame_Shift_Ins_p.D114fs|ZNF114_ENST00000597695.1_Intron			Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8	23					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)|NLRP3 inflammasome complex (GO:0072559)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|NACHT domain binding (GO:0032089)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	15		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		CCTGGGAATGTCCCCCCCAGAT	0.436																																							uc002pie.3		NA																	0					0						c.(64-69)GGGACAfs		caspase recruitment domain family, member 8																																				SO:0001589	frameshift_variant	22900				negative regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion	cytoplasm|nucleus	caspase activator activity|NACHT domain binding|protein homodimerization activity	g.chr19:48737669_48737670insC	AB023172	CCDS12712.1, CCDS12712.2, CCDS54287.1, CCDS54288.1, CCDS54289.1	19q13.33	2011-05-24			ENSG00000105483	ENSG00000105483			17057	protein-coding gene	gene with protein product		609051				10231032, 11408476	Standard	NM_001184900		Approved	TUCAN, KIAA0955, CARDINAL, NDPP, Dakar	uc010xzj.2	Q9Y2G2	OTTHUMG00000165047	ENST00000359009.4:c.67dupG	19.37:g.48737676_48737676dupC	ENSP00000351901:p.Thr23fs		Somatic				CARD8_uc002pii.3_Frame_Shift_Ins_p.D114fs|CARD8_uc010xzi.1_Frame_Shift_Ins_p.G22fs|CARD8_uc010els.2_5'Flank|CARD8_uc010xzj.1_Frame_Shift_Ins_p.D114fs|CARD8_uc010xzk.1_Frame_Shift_Ins_p.G46fs|CARD8_uc002pif.3_Frame_Shift_Ins_p.G22fs|CARD8_uc002pig.3_5'UTR|CARD8_uc002pih.3_Frame_Shift_Ins_p.D64fs|CARD8_uc010xzl.1_Frame_Shift_Ins_p.D64fs|CARD8_uc010xzm.1_Frame_Shift_Ins_p.D114fs	p.G22fs	NM_014959	NP_055774	WXS	Illumina HiSeq	Unspecified	Q9Y2G2	CARD8_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)	3	379_380	-		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)	22_23					B5KVR6|B7Z496|B7Z4A2|E9PEM7|G3XAM9|Q6PGP8|Q96P82	Frame_Shift_Ins	INS	ENST00000359009.4	37	c.66_67insG																																																																																					0.436	CARD8-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014959		8	269	NA	NA	NA	NA	NA	8	269	---	---	---	---
HRC	3270	broad.mit.edu	37	19	49657097	49657098	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:49657097_49657098insG	ENST00000252825.4	-	1	1583_1584	c.1397_1398insC	c.(1396-1398)ccafs	p.P466fs	HRC_ENST00000595625.1_Frame_Shift_Ins_p.P466fs	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	466					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CTGTGTGTCCTGGGGGGTGATG	0.55																																					Melanoma(37;75 1097 24567 25669 30645)	Melanoma(37;75 1097 24567 25669 30645)	uc002pmv.2		NA																	0				ovary(1)	1						c.(1396-1398)CCAfs		histidine rich calcium binding protein																																				SO:0001589	frameshift_variant	3270				muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding	g.chr19:49657097_49657098insG		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1398dupC	19.37:g.49657103_49657103dupG	ENSP00000252825:p.Pro466fs		Somatic					p.P466fs	NM_002152	NP_002143	WXS	Illumina HiSeq	Unspecified	P23327	SRCH_HUMAN		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)	1	1584_1585	-		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	466					Q504Y6	Frame_Shift_Ins	INS	ENST00000252825.4	37	c.1397_1398insC	CCDS12759.1																																																																																				0.550	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152		7	303	NA	NA	NA	NA	NA	7	303	---	---	---	---
ZNF160	90338	broad.mit.edu	37	19	53571731	53571732	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr19:53571731_53571732delAG	ENST00000429604.1	-	7	2470_2471	c.2055_2056delCT	c.(2053-2058)gtcttcfs	p.F686fs	ZNF160_ENST00000599056.1_Frame_Shift_Del_p.F686fs|ZNF160_ENST00000418871.1_Frame_Shift_Del_p.F686fs|ZNF160_ENST00000601421.1_Frame_Shift_Del_p.F650fs	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	686					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		TTCTGAGTGAAGACCTTGCCAC	0.441																																							uc010eqk.2		NA																	0				central_nervous_system(1)	1						c.(2053-2058)GTCTTCfs		zinc finger protein 160																																				SO:0001589	frameshift_variant	90338				hemopoiesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53571731_53571732delAG	X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.2055_2056delCT	19.37:g.53571731_53571732delAG	ENSP00000406201:p.Phe686fs		Somatic				ZNF160_uc002qaq.3_Frame_Shift_Del_p.V685fs|ZNF160_uc002qar.3_Frame_Shift_Del_p.V685fs	p.V685fs	NM_001102603	NP_001096073	WXS	Illumina HiSeq	Unspecified	Q9HCG1	ZN160_HUMAN		GBM - Glioblastoma multiforme(134;0.02)	7	2471_2472	-			685_686			C2H2-type 16.		Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Frame_Shift_Del	DEL	ENST00000429604.1	37	c.2055_2056delCT	CCDS12859.1																																																																																				0.441	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288		32	375	NA	NA	NA	NA	NA	32	375	---	---	---	---
NFU1	27247	broad.mit.edu	37	2	69659083	69659084	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:69659083_69659084delCT	ENST00000410022.2	-	2	321_322	c.116_117delAG	c.(115-117)cagfs	p.Q39fs	NFU1_ENST00000471185.1_5'UTR|NFU1_ENST00000303698.3_Frame_Shift_Del_p.Q15fs|NFU1_ENST00000394305.1_De_novo_Start_InFrame	NM_001002755.2	NP_001002755.1	Q9UMS0	NFU1_HUMAN	NFU1 iron-sulfur cluster scaffold	39					iron-sulfur cluster assembly (GO:0016226)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron ion binding (GO:0005506)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	7						TTTGTACAAACTGATGCAGAGG	0.371																																							uc002sfk.2		NA																	0					0						c.(115-117)CAGfs		HIRA interacting protein 5 isoform 2																																				SO:0001589	frameshift_variant	27247				iron-sulfur cluster assembly	cytosol|mitochondrion|nucleus	4 iron, 4 sulfur cluster binding|iron ion binding|protein binding	g.chr2:69659083_69659084delCT	AJ132584	CCDS33217.1, CCDS42694.1, CCDS46315.1	2p15-p13	2014-07-03	2014-07-03	2006-10-24	ENSG00000169599	ENSG00000169599			16287	protein-coding gene	gene with protein product		608100	"""HIRA interacting protein 5"", ""NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)"""	HIRIP5		11342215, 12886008	Standard	NR_045631		Approved	CGI-33, NifU, NIFUC	uc002sfk.3	Q9UMS0	OTTHUMG00000152668	ENST00000410022.2:c.116_117delAG	2.37:g.69659083_69659084delCT	ENSP00000387219:p.Gln39fs		Somatic				NFU1_uc002sfj.2_Frame_Shift_Del_p.Q15fs|NFU1_uc002sfl.2_5'UTR|NFU1_uc002sfm.2_5'UTR|NFU1_uc010fdi.2_RNA|NFU1_uc002sfn.1_Frame_Shift_Del_p.Q39fs	p.Q39fs	NM_001002755	NP_001002755	WXS	Illumina HiSeq	Unspecified	Q9UMS0	NFU1_HUMAN			2	315_316	-			39					B4DUL9|Q53QE5|Q6VNZ8|Q7Z5B1|Q7Z5B2|Q9Y322	Frame_Shift_Del	DEL	ENST00000410022.2	37	c.116_117delAG	CCDS33217.1																																																																																				0.371	NFU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327279.3	NM_015700		23	77	NA	NA	NA	NA	NA	23	77	---	---	---	---
ALMS1	7840	broad.mit.edu	37	2	73678333	73678333	+	Frame_Shift_Del	DEL	C	C	-	rs536081096		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:73678333delC	ENST00000264448.6	+	8	4787	c.4676delC	c.(4675-4677)acafs	p.T1560fs	ALMS1_ENST00000409009.1_Frame_Shift_Del_p.T1518fs|ALMS1_ENST00000377715.1_Frame_Shift_Del_p.T1560fs	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1560	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GCTGACCAGACAACTGGCATA	0.468																																							uc002sje.1		NA																	0				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(4681-4683)ACAfs		Alstrom syndrome 1							100.0	103.0	102.0					2																	73678333		1878	4111	5989	SO:0001589	frameshift_variant	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73678333delC	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.4676delC	2.37:g.73678333delC	ENSP00000264448:p.Thr1560fs		Somatic				ALMS1_uc002sjf.1_Frame_Shift_Del_p.T1517fs|ALMS1_uc002sjg.2_Frame_Shift_Del_p.T947fs|ALMS1_uc002sjh.1_Frame_Shift_Del_p.T947fs	p.T1561fs	NM_015120	NP_055935	WXS	Illumina HiSeq	Unspecified	Q8TCU4	ALMS1_HUMAN			10	4793	+			1559			22.|34 X 47 AA approximate tandem repeat.		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Frame_Shift_Del	DEL	ENST00000264448.6	37	c.4682delC	CCDS42697.1																																																																																				0.468	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		47	233	NA	NA	NA	NA	NA	47	233	---	---	---	---
IL1R2	7850	broad.mit.edu	37	2	102638681	102638682	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:102638681_102638682insC	ENST00000332549.3	+	6	950_951	c.721_722insC	c.(721-723)tccfs	p.S241fs	IL1R2_ENST00000393414.2_Frame_Shift_Ins_p.S241fs|IL1R2_ENST00000441002.1_Frame_Shift_Ins_p.S241fs	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	241	Ig-like C2-type 3.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						TGTGATCATTTCCCCCCTCAAG	0.49																																					Pancreas(106;189 1628 2302 5133 12295)	Pancreas(106;189 1628 2302 5133 12295)	uc002tbm.2		NA																	0				ovary(1)|breast(1)	2						c.(721-723)TCCfs		interleukin 1 receptor, type II precursor	Anakinra(DB00026)																																			SO:0001589	frameshift_variant	7850				immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity	g.chr2:102638681_102638682insC	X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.727dupC	2.37:g.102638687_102638687dupC	ENSP00000330959:p.Ser241fs		Somatic				IL1R2_uc002tbn.2_Frame_Shift_Ins_p.S241fs|IL1R2_uc002tbo.1_Frame_Shift_Ins_p.S241fs	p.S241fs	NM_004633	NP_004624	WXS	Illumina HiSeq	Unspecified	P27930	IL1R2_HUMAN			6	950_951	+			241			Extracellular (Potential).|Ig-like C2-type 3.		D3DVJ5|Q6LCE6|Q9UE68	Frame_Shift_Ins	INS	ENST00000332549.3	37	c.721_722insC	CCDS2054.1																																																																																				0.490	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253191.1	NM_004633		7	442	NA	NA	NA	NA	NA	7	442	---	---	---	---
SLC9A2	6549	broad.mit.edu	37	2	103324745	103324746	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:103324745_103324746insC	ENST00000233969.2	+	12	2378_2379	c.2236_2237insC	c.(2236-2238)accfs	p.T746fs		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	746					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						TATGCCCAGCACCCCCCCAACA	0.53																																							uc002tca.2		NA																	0				central_nervous_system(3)|skin(3)|breast(2)	8						c.(2236-2238)ACCfs		solute carrier family 9 (sodium/hydrogen																																				SO:0001589	frameshift_variant	6549					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity	g.chr2:103324745_103324746insC		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.2243dupC	2.37:g.103324752_103324752dupC	ENSP00000233969:p.Thr746fs		Somatic					p.T746fs	NM_003048	NP_003039	WXS	Illumina HiSeq	Unspecified	Q9UBY0	SL9A2_HUMAN			12	2378_2379	+			746			Cytoplasmic (Potential).		B2RMS2	Frame_Shift_Ins	INS	ENST00000233969.2	37	c.2236_2237insC	CCDS2062.1																																																																																				0.530	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2			14	288	NA	NA	NA	NA	NA	14	288	---	---	---	---
R3HDM1	23518	broad.mit.edu	37	2	136389448	136389449	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:136389448_136389449insC	ENST00000264160.4	+	9	945_946	c.575_576insC	c.(574-579)ttccccfs	p.FP192fs	R3HDM1_ENST00000409478.1_Frame_Shift_Ins_p.FP148fs|R3HDM1_ENST00000409606.1_Frame_Shift_Ins_p.FP192fs|R3HDM1_ENST00000410054.1_Frame_Shift_Ins_p.FP136fs|R3HDM1_ENST00000329971.3_Frame_Shift_Ins_p.FP148fs	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	192	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.						poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		CGTAAAAAATTCCCCCCAATGA	0.396																																							uc002tuo.2		NA																	0				skin(1)	1						c.(574-576)TTCfs		R3H domain containing 1																																				SO:0001589	frameshift_variant	23518						nucleic acid binding	g.chr2:136389448_136389449insC	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.581dupC	2.37:g.136389454_136389454dupC	ENSP00000264160:p.Phe192fs		Somatic				R3HDM1_uc010fni.2_Frame_Shift_Ins_p.F190fs|R3HDM1_uc002tup.2_Frame_Shift_Ins_p.F136fs|R3HDM1_uc010zbh.1_Frame_Shift_Ins_p.F24fs	p.F192fs	NM_015361	NP_056176	WXS	Illumina HiSeq	Unspecified	Q15032	R3HD1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.127)	9	945_946	+			192			R3H.		A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Frame_Shift_Ins	INS	ENST00000264160.4	37	c.575_576insC	CCDS2177.1																																																																																				0.396	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361		8	326	NA	NA	NA	NA	NA	8	326	---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168099957	168099958	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:168099957_168099958insG	ENST00000409195.1	+	9	2144_2145	c.2055_2056insG	c.(2056-2058)gggfs	p.G686fs	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Frame_Shift_Ins_p.G464fs|XIRP2_ENST00000295237.9_Frame_Shift_Ins_p.G686fs|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	511					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGGACATAACTGGGGGGGATGT	0.421																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(2053-2058)ACTGGGfs		xin actin-binding repeat containing 2 isoform 1																																				SO:0001589	frameshift_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168099957_168099958insG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2062dupG	2.37:g.168099964_168099964dupG	ENSP00000386840:p.Gly686fs		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Frame_Shift_Ins_p.T510fs|XIRP2_uc010fpq.2_Frame_Shift_Ins_p.T463fs|XIRP2_uc010fpr.2_Intron	p.T685fs	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	2073_2074	+			510_511					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Frame_Shift_Ins	INS	ENST00000409195.1	37	c.2055_2056insG	CCDS42769.1																																																																																				0.421	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		11	321	NA	NA	NA	NA	NA	11	321	---	---	---	---
MYO3B	140469	broad.mit.edu	37	2	171240258	171240259	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:171240258_171240259insC	ENST00000408978.4	+	12	1367_1368	c.1224_1225insC	c.(1225-1227)cccfs	p.P409fs	MYO3B_ENST00000409044.3_Frame_Shift_Ins_p.P409fs|MYO3B_ENST00000334231.6_Frame_Shift_Ins_p.P418fs|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	409	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						GCGCCTCCAATCCCCCCCACAT	0.465																																							uc002ufy.2		NA																	0				lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						c.(1222-1227)AATCCCfs		myosin IIIB isoform 2																																				SO:0001589	frameshift_variant	140469				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity	g.chr2:171240258_171240259insC		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.1231dupC	2.37:g.171240265_171240265dupC	ENSP00000386213:p.Pro409fs		Somatic				MYO3B_uc002ufv.2_Frame_Shift_Ins_p.N395fs|MYO3B_uc010fqb.1_Frame_Shift_Ins_p.N395fs|MYO3B_uc002ufz.2_Frame_Shift_Ins_p.N408fs|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	p.N408fs	NM_138995	NP_620482	WXS	Illumina HiSeq	Unspecified	Q8WXR4	MYO3B_HUMAN			12	1367_1368	+			408_409			Myosin head-like.		B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Frame_Shift_Ins	INS	ENST00000408978.4	37	c.1224_1225insC	CCDS42773.1																																																																																				0.465	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1			7	387	NA	NA	NA	NA	NA	7	387	---	---	---	---
NEUROD1	4760	broad.mit.edu	37	2	182542971	182542972	+	Frame_Shift_Ins	INS	-	-	G	rs201174472|rs387906384		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr2:182542971_182542972insG	ENST00000295108.3	-	2	1073_1074	c.616_617insC	c.(616-618)cacfs	p.H206fs	CERKL_ENST00000479558.1_Intron|NEUROD1_ENST00000496876.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	206					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CGTCGGCAGGTGGGGGGGCATG	0.619																																							uc002uof.2		NA																	0				ovary(1)	1	GRCh37	CI992797	NEUROD1	I		c.(616-618)CACfs		neurogenic differentiation 1																																				SO:0001589	frameshift_variant	4760				amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding	g.chr2:182542971_182542972insG	U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.617dupC	2.37:g.182542978_182542978dupG	ENSP00000295108:p.His206fs		Somatic				CERKL_uc002uod.1_Intron	p.H206fs	NM_002500	NP_002491	WXS	Illumina HiSeq	Unspecified	Q13562	NDF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.088)		2	852_853	-			206					B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Frame_Shift_Ins	INS	ENST00000295108.3	37	c.616_617insC	CCDS2283.1																																																																																				0.619	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500		10	173	NA	NA	NA	NA	NA	10	173	---	---	---	---
CST1	1469	broad.mit.edu	37	20	23729753	23729754	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:23729753_23729754insC	ENST00000304749.2	-	2	311_312	c.241_242insG	c.(241-243)gtgfs	p.V81fs	CST1_ENST00000398402.1_Frame_Shift_Ins_p.V81fs	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	81					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					GAAGTAATTCACCCCCCCAACG	0.554																																							uc002wtp.2		NA																	0				ovary(1)	1						c.(241-243)GTGfs		cystatin SN precursor																																				SO:0001589	frameshift_variant	1469					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23729753_23729754insC	M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.242dupG	20.37:g.23729760_23729760dupC	ENSP00000305731:p.Val81fs		Somatic					p.V81fs	NM_001898	NP_001889	WXS	Illumina HiSeq	Unspecified	P01037	CYTN_HUMAN			2	312_313	-	Lung NSC(19;0.0676)|all_lung(19;0.148)		81					Q96LE6|Q9UCQ6	Frame_Shift_Ins	INS	ENST00000304749.2	37	c.241_242insG	CCDS13160.1																																																																																				0.554	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078351.2	NM_001898		13	378	NA	NA	NA	NA	NA	13	378	---	---	---	---
RALGAPB	57148	broad.mit.edu	37	20	37146232	37146233	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:37146232_37146233insC	ENST00000262879.6	+	8	1419_1420	c.1135_1136insC	c.(1135-1137)accfs	p.T379fs	RALGAPB_ENST00000397042.3_Frame_Shift_Ins_p.T379fs|RALGAPB_ENST00000537204.1_Frame_Shift_Ins_p.T379fs|MIR548O2_ENST00000583129.1_RNA|RALGAPB_ENST00000397040.1_Frame_Shift_Ins_p.T379fs|RALGAPB_ENST00000397038.1_Frame_Shift_Ins_p.T157fs			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	379					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.H382fs*2(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TGTCAGTACCACCCCCCCACAT	0.446																																							uc002xiw.2		NA																	1	Insertion - Frameshift(1)		lung(1)	pancreas(1)|skin(1)	2						c.(1135-1137)ACCfs		Ral GTPase activating protein, beta subunit																																				SO:0001589	frameshift_variant	57148				activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity	g.chr20:37146232_37146233insC	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.1142dupC	20.37:g.37146239_37146239dupC	ENSP00000262879:p.Thr379fs		Somatic				RALGAPB_uc010zvz.1_Frame_Shift_Ins_p.T379fs|RALGAPB_uc002xix.2_Frame_Shift_Ins_p.T379fs|RALGAPB_uc002xiy.1_Frame_Shift_Ins_p.T379fs|RALGAPB_uc002xiz.2_Frame_Shift_Ins_p.T157fs|RALGAPB_uc002xja.1_Frame_Shift_Ins_p.T106fs	p.T379fs	NM_020336	NP_065069	WXS	Illumina HiSeq	Unspecified	Q86X10	RLGPB_HUMAN			8	1392_1393	+			379					A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Frame_Shift_Ins	INS	ENST00000262879.6	37	c.1135_1136insC	CCDS13305.1																																																																																				0.446	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336		7	123	NA	NA	NA	NA	NA	7	123	---	---	---	---
SLPI	6590	broad.mit.edu	37	20	43881730	43881731	+	Frame_Shift_Ins	INS	-	-	G	rs559154076	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:43881730_43881731insG	ENST00000338380.2	-	3	326_327	c.306_307insC	c.(304-309)cccaatfs	p.N103fs		NM_003064.2	NP_003055.1	P03973	SLPI_HUMAN	secretory leukocyte peptidase inhibitor	103	Elastase inhibitory domain.|WAP 2. {ECO:0000255|PROSITE- ProRule:PRU00722}.				negative regulation of protein binding (GO:0032091)|negative regulation of viral genome replication (GO:0045071)	extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			lung(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				TCACAGAAATTGGGGGGGTTAA	0.535																																					GBM(64;162 1089 31780 33427 34538)	GBM(64;162 1089 31780 33427 34538)	uc002xnm.1		NA																	0				ovary(1)	1						c.(304-309)CCCAATfs		secretory leukocyte peptidase inhibitor																																				SO:0001589	frameshift_variant	6590					extracellular region	serine-type endopeptidase inhibitor activity	g.chr20:43881730_43881731insG	X04502	CCDS13347.1	20q13.12	2013-01-21	2005-08-17		ENSG00000124107	ENSG00000124107		"""WAP four-disulfide core domain containing"""	11092	protein-coding gene	gene with protein product	"""antileukoproteinase"""	107285	"""secretory leukocyte protease inhibitor (antileukoproteinase)"""			3640338, 12206714	Standard	NM_003064		Approved	HUSI-I, ALK1, ALP, BLPI, HUSI, WAP4, WFDC4	uc002xnm.1	P03973	OTTHUMG00000033075	ENST00000338380.2:c.307dupC	20.37:g.43881737_43881737dupG	ENSP00000342082:p.Asn103fs		Somatic					p.P102fs	NM_003064	NP_003055	WXS	Illumina HiSeq	Unspecified	P03973	SLPI_HUMAN			3	328_329	-		Myeloproliferative disorder(115;0.0122)	102_103			Elastase inhibitory domain.|WAP 2.		B2R5H8|P07757	Frame_Shift_Ins	INS	ENST00000338380.2	37	c.306_307insC	CCDS13347.1																																																																																				0.535	SLPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080494.3			11	318	NA	NA	NA	NA	NA	11	318	---	---	---	---
OSBPL2	9885	broad.mit.edu	37	20	60854257	60854258	+	Frame_Shift_Ins	INS	-	-	C	rs79735057		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr20:60854257_60854258insC	ENST00000313733.3	+	7	738_739	c.536_537insC	c.(535-540)caccccfs	p.HP179fs	OSBPL2_ENST00000358053.2_Frame_Shift_Ins_p.HP167fs|OSBPL2_ENST00000439951.2_Frame_Shift_Ins_p.HP87fs	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	179					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			GTCAGTCACCACCCCCCCATCA	0.465																																							uc002yck.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(535-537)CACfs		oxysterol-binding protein-like protein 2 isoform			,	18,4246		0,18,2114					,	4.9	1.0			111	7,8247		0,7,4120	no	frameshift,frameshift	OSBPL2	NM_144498.1,NM_014835.2	,	0,25,6234	A1A1,A1R,RR		0.0848,0.4221,0.1997	,	,		25,12493				SO:0001589	frameshift_variant	9885				lipid transport		lipid binding	g.chr20:60854257_60854258insC	AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.543dupC	20.37:g.60854264_60854264dupC	ENSP00000316649:p.His179fs		Somatic				OSBPL2_uc002ycl.1_Frame_Shift_Ins_p.H167fs|OSBPL2_uc011aah.1_Frame_Shift_Ins_p.H87fs|OSBPL2_uc002ycm.1_5'UTR	p.H179fs	NM_144498	NP_653081	WXS	Illumina HiSeq	Unspecified	Q9H1P3	OSBL2_HUMAN	BRCA - Breast invasive adenocarcinoma(19;1.33e-06)		7	738_739	+	Breast(26;7.76e-09)		179					A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Frame_Shift_Ins	INS	ENST00000313733.3	37	c.536_537insC	CCDS13495.1																																																																																				0.465	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080021.1	NM_014835		9	176	NA	NA	NA	NA	NA	9	176	---	---	---	---
GRIK1	2897	broad.mit.edu	37	21	30959772	30959772	+	Frame_Shift_Del	DEL	G	G	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:30959772delG	ENST00000399907.1	-	12	2118	c.1707delC	c.(1705-1707)tccfs	p.S569fs	GRIK1_ENST00000309434.7_Frame_Shift_Del_p.S571fs|GRIK1_ENST00000389124.2_Frame_Shift_Del_p.S569fs|GRIK1_ENST00000399914.1_Frame_Shift_Del_p.S554fs|GRIK1_ENST00000535441.1_Frame_Shift_Del_p.S571fs|GRIK1_ENST00000327783.4_Frame_Shift_Del_p.S569fs|GRIK1_ENST00000399909.1_Frame_Shift_Del_p.S554fs|GRIK1_ENST00000399913.1_Frame_Shift_Del_p.S569fs|GRIK1_ENST00000389125.3_Frame_Shift_Del_p.S554fs	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	569					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	GGTTGAGGAAGGAGAAAACGC	0.483																																							uc002yno.1		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(1705-1707)TCCfs		glutamate receptor, ionotropic, kainate 1	L-Glutamic Acid(DB00142)|Topiramate(DB00273)						98.0	83.0	88.0					21																	30959772		2203	4300	6503	SO:0001589	frameshift_variant	2897				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity	g.chr21:30959772delG		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1707delC	21.37:g.30959772delG	ENSP00000382791:p.Ser569fs		Somatic				GRIK1_uc002ynn.2_Frame_Shift_Del_p.S554fs|GRIK1_uc011acs.1_Frame_Shift_Del_p.S569fs|GRIK1_uc011act.1_Frame_Shift_Del_p.S430fs|GRIK1_uc010glq.1_Frame_Shift_Del_p.S412fs	p.S569fs	NM_000830	NP_000821	WXS	Illumina HiSeq	Unspecified	P39086	GRIK1_HUMAN			12	2171	-			569			Extracellular (Potential).		Q13001|Q86SU9	Frame_Shift_Del	DEL	ENST00000399907.1	37	c.1707delC	CCDS42913.1																																																																																				0.483	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1			44	84	NA	NA	NA	NA	NA	44	84	---	---	---	---
SH3BGR	6450	broad.mit.edu	37	21	40823994	40823995	+	Frame_Shift_Ins	INS	-	-	G	rs35950439		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:40823994_40823995insG	ENST00000333634.4	+	1	239_240	c.161_162insG	c.(160-165)ttggggfs	p.LG54fs	SH3BGR_ENST00000380634.1_Intron|SH3BGR_ENST00000458295.1_Intron|SH3BGR_ENST00000380637.3_Intron|SH3BGR_ENST00000380631.1_Intron	NM_007341.2	NP_031367	P55822	SH3BG_HUMAN	SH3 domain binding glutamate-rich protein	54					positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(2)	8		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		AGGGGTGTGTTGGGGGGAGTCC	0.554																																							uc002yya.2		NA																	0					0						c.(160-162)TTGfs		SH3-binding domain and glutamic acid-rich																																				SO:0001589	frameshift_variant	6450				protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity	g.chr21:40823994_40823995insG		CCDS13666.1, CCDS33560.1	21q22.3	2014-02-19	2014-02-19		ENSG00000185437	ENSG00000185437			10822	protein-coding gene	gene with protein product	"""21-glutamic acid-rich protein"""	602230	"""SH3 domain binding glutamic acid-rich protein"""			9050928	Standard	NM_007341		Approved	21-GARP	uc002yya.3	P55822	OTTHUMG00000074113	ENST00000333634.4:c.167dupG	21.37:g.40824000_40824000dupG	ENSP00000332513:p.Leu54fs		Somatic				SH3BGR_uc002yxz.2_Intron	p.L54fs	NM_007341	NP_031367	WXS	Illumina HiSeq	Unspecified	P55822	SH3BG_HUMAN		STAD - Stomach adenocarcinoma(101;0.00151)	1	215_216	+		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)	54					A6ND59|D3DSI2|Q9BRB8	Frame_Shift_Ins	INS	ENST00000333634.4	37	c.161_162insG	CCDS13666.1																																																																																				0.554	SH3BGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157377.6	NM_007341		7	582	NA	NA	NA	NA	NA	7	582	---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41514614	41514615	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr21:41514614_41514615insG	ENST00000400454.1	-	18	3753_3754	c.3276_3277insC	c.(3274-3279)cccgaafs	p.E1093fs		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1093	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E1093K(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGGACATTTTCGGGGGGGTAAC	0.406																																					Melanoma(134;970 1778 1785 21664 32388)	Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	1	Substitution - Missense(1)		skin(1)	ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(3274-3279)CCCGAAfs		Down syndrome cell adhesion molecule isoform																																				SO:0001589	frameshift_variant	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:41514614_41514615insG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3277dupC	21.37:g.41514621_41514621dupG	ENSP00000383303:p.Glu1093fs		Somatic				DSCAM_uc002yyr.1_RNA	p.P1092fs	NM_001389	NP_001380	WXS	Illumina HiSeq	Unspecified	O60469	DSCAM_HUMAN			18	3728_3729	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	1092_1093			Extracellular (Potential).|Fibronectin type-III 3.		O60468	Frame_Shift_Ins	INS	ENST00000400454.1	37	c.3276_3277insC	CCDS42929.1																																																																																				0.406	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		12	826	NA	NA	NA	NA	NA	12	826	---	---	---	---
CECR2	27443	broad.mit.edu	37	22	18022285	18022286	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:18022285_18022286insC	ENST00000400585.2	+	16	2402_2403	c.1964_1965insC	c.(1963-1968)gtccccfs	p.VP655fs	CECR2_ENST00000400573.5_Frame_Shift_Ins_p.VP796fs|CECR2_ENST00000262608.8_Frame_Shift_Ins_p.VP797fs			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	838					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		AGACCACCTGTCCCCCCCAACC	0.609																																							uc010gqw.1		NA																	0				ovary(1)|skin(1)	2						c.(2386-2388)GTCfs		cat eye syndrome chromosome region, candidate 2																																				SO:0001589	frameshift_variant	27443				chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding	g.chr22:18022285_18022286insC	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1971dupC	22.37:g.18022292_18022292dupC	ENSP00000383428:p.Val655fs		Somatic				CECR2_uc010gqv.1_Frame_Shift_Ins_p.V655fs|CECR2_uc002zml.2_Frame_Shift_Ins_p.V655fs	p.V796fs	NM_031413	NP_113601	WXS	Illumina HiSeq	Unspecified	Q9BXF3	CECR2_HUMAN		Lung(27;0.146)	15	2513_2514	+		all_epithelial(15;0.139)	838					A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Frame_Shift_Ins	INS	ENST00000400585.2	37	c.2387_2388insC																																																																																					0.609	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413		8	171	NA	NA	NA	NA	NA	8	171	---	---	---	---
MTMR3	8897	broad.mit.edu	37	22	30408493	30408494	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:30408493_30408494insC	ENST00000401950.2	+	13	1600_1601	c.1258_1259insC	c.(1258-1260)accfs	p.T420fs	CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000333027.3_Frame_Shift_Ins_p.T420fs|MTMR3_ENST00000351488.3_Frame_Shift_Ins_p.T420fs|MTMR3_ENST00000406629.1_Frame_Shift_Ins_p.T420fs|MTMR3_ENST00000323630.5_Frame_Shift_Ins_p.T284fs	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	420	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CTGGGACCGCACCCCCCAGATT	0.545																																							uc003agv.3		NA																	0				breast(3)|ovary(1)|skin(1)	5						c.(1258-1260)ACCfs		myotubularin-related protein 3 isoform c																																				SO:0001589	frameshift_variant	8897				phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chr22:30408493_30408494insC	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.1264dupC	22.37:g.30408499_30408499dupC	ENSP00000384651:p.Thr420fs		Somatic				MTMR3_uc003agu.3_Frame_Shift_Ins_p.T420fs|MTMR3_uc003agw.3_Frame_Shift_Ins_p.T420fs	p.T420fs	NM_021090	NP_066576	WXS	Illumina HiSeq	Unspecified	Q13615	MTMR3_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)		13	1586_1587	+			420			Myotubularin phosphatase.		A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Frame_Shift_Ins	INS	ENST00000401950.2	37	c.1258_1259insC	CCDS13870.1																																																																																				0.545	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090		9	1197	NA	NA	NA	NA	NA	9	1197	---	---	---	---
DDX17	10521	broad.mit.edu	37	22	38895454	38895455	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:38895454_38895455insC	ENST00000396821.3	-	3	587_588	c.488_489insG	c.(487-489)ggafs	p.G163fs	DDX17_ENST00000381633.3_Frame_Shift_Ins_p.G84fs|DDX17_ENST00000432525.1_5'UTR	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	163					ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)	p.G163fs*20(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					GACAAACATCTCCCCCCCTCAC	0.381																																					Ovarian(55;1085 1454 6392 21425)	Ovarian(55;1085 1454 6392 21425)	uc003avy.3		NA																	1	Deletion - Frameshift(1)		lung(1)	skin(3)|upper_aerodigestive_tract(1)	4						c.(487-489)GGAfs		DEAD box polypeptide 17 isoform 3																																				SO:0001589	frameshift_variant	10521				RNA processing	nucleus	ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity|RNA-dependent ATPase activity	g.chr22:38895454_38895455insC	U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.489dupG	22.37:g.38895461_38895461dupC	ENSP00000380033:p.Gly163fs		Somatic				DDX17_uc003avx.3_Frame_Shift_Ins_p.G163fs|DDX17_uc011anu.1_Frame_Shift_Ins_p.G76fs	p.G163fs	NM_001098504	NP_001091974	WXS	Illumina HiSeq	Unspecified	Q92841	DDX17_HUMAN			3	591_592	-	Melanoma(58;0.0286)		84					B1AHM0|Q69YT1|Q6ICD6	Frame_Shift_Ins	INS	ENST00000396821.3	37	c.488_489insG	CCDS46706.1																																																																																				0.381	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321476.2	NM_030881		8	152	NA	NA	NA	NA	NA	8	152	---	---	---	---
TCF20	6942	broad.mit.edu	37	22	42610947	42610948	+	Frame_Shift_Ins	INS	-	-	G	rs138734341		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr22:42610947_42610948insG	ENST00000359486.3	-	1	500_501	c.364_365insC	c.(364-366)cagfs	p.Q122fs	TCF20_ENST00000335626.4_Frame_Shift_Ins_p.Q122fs	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	122				Q -> R (in Ref. 1). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GCTGCTCCCCTGGGGGGGTCCA	0.564																																							uc003bcj.1		NA																	0				ovary(4)|skin(1)	5						c.(364-366)CAGfs		transcription factor 20 isoform 1																																				SO:0001589	frameshift_variant	6942				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chr22:42610947_42610948insG	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.365dupC	22.37:g.42610954_42610954dupG	ENSP00000352463:p.Gln122fs		Somatic				TCF20_uc003bck.1_Frame_Shift_Ins_p.Q122fs|TCF20_uc003bnt.2_Frame_Shift_Ins_p.Q122fs	p.Q122fs	NM_005650	NP_005641	WXS	Illumina HiSeq	Unspecified	Q9UGU0	TCF20_HUMAN			1	498_499	-			122	Q -> R (in Ref. 1).				A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Frame_Shift_Ins	INS	ENST00000359486.3	37	c.364_365insC	CCDS14033.1																																																																																				0.564	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492		11	299	NA	NA	NA	NA	NA	11	299	---	---	---	---
SETD5	55209	broad.mit.edu	37	3	9517294	9517295	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:9517294_9517295insC	ENST00000406341.1	+	22	4038_4039	c.3848_3849insC	c.(3847-3852)aaccccfs	p.NP1283fs	SETD5_ENST00000407969.1_Frame_Shift_Ins_p.NP1302fs|SETD5_ENST00000402198.1_Frame_Shift_Ins_p.NP1283fs|SETD5_ENST00000402466.1_Frame_Shift_Ins_p.NP1185fs|SETD5_ENST00000302463.6_Frame_Shift_Ins_p.NP1185fs			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1283	Ser-rich.									NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		AGACCTGGAAACCCCCCCTCTC	0.55																																							uc003brt.2		NA																	0				ovary(2)	2						c.(3847-3849)AACfs		SET domain containing 5																																				SO:0001589	frameshift_variant	55209							g.chr3:9517294_9517295insC	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.3855dupC	3.37:g.9517301_9517301dupC	ENSP00000383939:p.Asn1283fs		Somatic				SETD5_uc003bru.2_Frame_Shift_Ins_p.N1185fs|SETD5_uc003brv.2_Frame_Shift_Ins_p.N1172fs|SETD5_uc010hck.2_Frame_Shift_Ins_p.N765fs|SETD5_uc003brx.2_Frame_Shift_Ins_p.N952fs	p.N1283fs	NM_001080517	NP_001073986	WXS	Illumina HiSeq	Unspecified	Q9C0A6	SETD5_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.112)	23	4283_4284	+	Medulloblastoma(99;0.227)		1283			Ser-rich.		Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Frame_Shift_Ins	INS	ENST00000406341.1	37	c.3848_3849insC	CCDS46741.1																																																																																				0.550	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614		7	184	NA	NA	NA	NA	NA	7	184	---	---	---	---
MLH1	4292	broad.mit.edu	37	3	37070348	37070349	+	Frame_Shift_Ins	INS	-	-	C	rs63750855|rs63751031		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:37070348_37070349insC	ENST00000231790.2	+	13	1699_1700	c.1483_1484insC	c.(1483-1485)accfs	p.T495fs	MLH1_ENST00000435176.1_Frame_Shift_Ins_p.T397fs|MLH1_ENST00000455445.2_Frame_Shift_Ins_p.T254fs|MLH1_ENST00000458205.2_Frame_Shift_Ins_p.T254fs|MLH1_ENST00000539477.1_Frame_Shift_Ins_p.T254fs|MLH1_ENST00000536378.1_Frame_Shift_Ins_p.T254fs	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	495	Interaction with EXO1.				ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.T495A(1)|p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						TGCAGCTTGTACCCCCCGGAGA	0.47		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc003cgl.2		1	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	D|Mis|N|F|S	E.coli MutL homolog gene			"""E, O"""		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		2	Substitution - Missense(1)|Whole gene deletion(1)	p.T495A(1)|p.0?(1)	ovary(1)|breast(1)	large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						c.(1483-1485)ACCfs	MMR	MutL protein homolog 1																																				SO:0001589	frameshift_variant	4292	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	g.chr3:37070348_37070349insC	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.1489dupC	3.37:g.37070354_37070354dupC	ENSP00000231790:p.Thr495fs		Somatic				MLH1_uc011aye.1_Frame_Shift_Ins_p.T254fs|MLH1_uc011ayb.1_Frame_Shift_Ins_p.T254fs|MLH1_uc010hge.2_Frame_Shift_Ins_p.T495fs|MLH1_uc003cgn.3_Frame_Shift_Ins_p.T254fs|MLH1_uc011ayc.1_Frame_Shift_Ins_p.T397fs|MLH1_uc011ayd.1_Frame_Shift_Ins_p.T254fs|MLH1_uc003cgo.2_Frame_Shift_Ins_p.T254fs|MLH1_uc010hgi.1_Frame_Shift_Ins_p.T137fs|MLH1_uc010hgj.1_Frame_Shift_Ins_p.T137fs|MLH1_uc010hgk.2_Frame_Shift_Ins_p.T137fs|MLH1_uc010hgl.1_Frame_Shift_Ins_p.T70fs|MLH1_uc010hgn.2_Frame_Shift_Ins_p.T137fs|MLH1_uc010hgm.2_RNA|MLH1_uc010hgo.2_Frame_Shift_Ins_p.T137fs	p.T495fs	NM_000249	NP_000240	WXS	Illumina HiSeq	Unspecified	P40692	MLH1_HUMAN			13	1543_1544	+			495			Interaction with EXO1.		B4DI13|B4DQ11|E9PCU2	Frame_Shift_Ins	INS	ENST00000231790.2	37	c.1483_1484insC	CCDS2663.1																																																																																				0.470	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249		7	374	NA	NA	NA	NA	NA	7	374	---	---	---	---
MUC13	56667	broad.mit.edu	37	3	124646628	124646629	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:124646628_124646629insG	ENST00000311075.3	-	2	299_300	c.261_262insC	c.(259-264)cccatafs	p.I88fs	MUC13_ENST00000497378.1_5'Flank	NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	89	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						GTACTAATTATGGGGGGAGCAG	0.441																																							uc003ehq.1		NA																	0					0						c.(259-264)CCCATAfs		mucin 13, epithelial transmembrane																																				SO:0001589	frameshift_variant	56667					extracellular region|integral to membrane|plasma membrane		g.chr3:124646628_124646629insG	AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.262dupC	3.37:g.124646634_124646634dupG	ENSP00000312235:p.Ile88fs		Somatic					p.P87fs	NM_033049	NP_149038	WXS	Illumina HiSeq	Unspecified	Q9H3R2	MUC13_HUMAN			2	285_286	-			87_88			Thr-rich.|Extracellular (Potential).		Q6UWD9|Q9NXT5	Frame_Shift_Ins	INS	ENST00000311075.3	37	c.261_262insC																																																																																					0.441	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1	NM_033049		7	713	NA	NA	NA	NA	NA	7	713	---	---	---	---
ATP13A3	79572	broad.mit.edu	37	3	194169249	194169250	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr3:194169249_194169250delTC	ENST00000439040.1	-	12	1877_1878	c.1086_1087delGA	c.(1084-1089)gggacafs	p.T364fs	ATP13A3_ENST00000256031.4_Frame_Shift_Del_p.T364fs			Q9H7F0	AT133_HUMAN	ATPase type 13A3	364						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		ATAACAGTTGTCCCACAAAACA	0.351																																							uc003fty.3		NA																	0				ovary(1)	1						c.(1084-1089)GGGACAfs		ATPase type 13A3																																				SO:0001589	frameshift_variant	79572				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:194169249_194169250delTC	AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.1086_1087delGA	3.37:g.194169249_194169250delTC	ENSP00000416508:p.Thr364fs		Somatic				ATP13A3_uc003ftz.1_Frame_Shift_Del_p.G68fs	p.G362fs	NM_024524	NP_078800	WXS	Illumina HiSeq	Unspecified	Q9H7F0	AT133_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)	11	1488_1489	-	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	362_363					Q8NC11|Q96KS1	Frame_Shift_Del	DEL	ENST00000439040.1	37	c.1086_1087delGA	CCDS43187.1																																																																																				0.351	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524		370	461	NA	NA	NA	NA	NA	370	461	---	---	---	---
FAM193A	8603	broad.mit.edu	37	4	2661592	2661593	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:2661592_2661593insC	ENST00000324666.5	+	8	1034_1035	c.683_684insC	c.(682-687)gaccccfs	p.DP228fs	FAM193A_ENST00000502458.1_Frame_Shift_Ins_p.DP252fs|FAM193A_ENST00000505311.1_Frame_Shift_Ins_p.DP228fs|FAM193A_ENST00000382839.3_Frame_Shift_Ins_p.DP228fs|FAM193A_ENST00000545951.1_Frame_Shift_Ins_p.DP228fs	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	228										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GGTATCATGGACCCCCCCGTCA	0.525																																							uc010icl.2		NA																	0				ovary(3)	3						c.(682-684)GACfs		hypothetical protein LOC8603																																				SO:0001589	frameshift_variant	8603							g.chr4:2661592_2661593insC	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.690dupC	4.37:g.2661599_2661599dupC	ENSP00000324587:p.Asp228fs		Somatic				FAM193A_uc010ick.2_Frame_Shift_Ins_p.D428fs|FAM193A_uc003gfd.2_Frame_Shift_Ins_p.D228fs|FAM193A_uc011bvm.1_Frame_Shift_Ins_p.D252fs|FAM193A_uc011bvn.1_Frame_Shift_Ins_p.D228fs|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Frame_Shift_Ins_p.D82fs	p.D228fs	NM_003704	NP_003695	WXS	Illumina HiSeq	Unspecified	P78312	F193A_HUMAN			8	1034_1035	+			228					B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Frame_Shift_Ins	INS	ENST00000324666.5	37	c.683_684insC	CCDS58875.1																																																																																				0.525	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704		18	584	NA	NA	NA	NA	NA	18	584	---	---	---	---
LGI2	55203	broad.mit.edu	37	4	25005320	25005321	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:25005320_25005321insC	ENST00000382114.4	-	8	1575_1576	c.1390_1391insG	c.(1390-1392)gccfs	p.A464fs		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	464						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				CAGGGTCATGGCCCCCCGGGAT	0.515																																							uc003grf.2		NA																	0					0						c.(1390-1392)GCCfs		leucine-rich repeat LGI family, member 2																																				SO:0001589	frameshift_variant	55203					extracellular region		g.chr4:25005320_25005321insC	AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.1391dupG	4.37:g.25005326_25005326dupC	ENSP00000371548:p.Ala464fs		Somatic					p.A464fs	NM_018176	NP_060646	WXS	Illumina HiSeq	Unspecified	Q8N0V4	LGI2_HUMAN			8	1489_1490	-		Breast(46;0.173)	464			EAR 6.		Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Frame_Shift_Ins	INS	ENST00000382114.4	37	c.1390_1391insG	CCDS3431.1																																																																																				0.515	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214978.1			7	212	NA	NA	NA	NA	NA	7	212	---	---	---	---
ABCG2	9429	broad.mit.edu	37	4	89052270	89052271	+	Frame_Shift_Ins	INS	-	-	T	rs376137682|rs150450599	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:89052270_89052271insT	ENST00000237612.3	-	5	1018_1019	c.473_474insA	c.(472-474)aacfs	p.N158fs	ABCG2_ENST00000515655.1_Frame_Shift_Ins_p.N158fs	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	158	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	TAATCCGTTCGTTTTTTTCATG	0.426																																							uc003hrg.2		NA																	0				central_nervous_system(1)	1						c.(472-474)AACfs		ATP-binding cassette, sub-family G, member 2	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)																																			SO:0001589	frameshift_variant	9429				cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity	g.chr4:89052270_89052271insT	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.474dupA	4.37:g.89052277_89052277dupT	ENSP00000237612:p.Asn158fs		Somatic				ABCG2_uc003hrh.2_Frame_Shift_Ins_p.N158fs|ABCG2_uc003hrf.2_Frame_Shift_Ins_p.N28fs	p.N158fs	NM_004827	NP_004818	WXS	Illumina HiSeq	Unspecified	Q9UNQ0	ABCG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	5	966_967	-		Hepatocellular(203;0.114)	158			ABC transporter.|Cytoplasmic (Potential).		A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Frame_Shift_Ins	INS	ENST00000237612.3	37	c.473_474insA	CCDS3628.1																																																																																				0.426	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827		8	699	NA	NA	NA	NA	NA	8	699	---	---	---	---
UNC5C	8633	broad.mit.edu	37	4	96140293	96140294	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:96140293_96140294insG	ENST00000453304.1	-	9	1819_1820	c.1471_1472insC	c.(1471-1473)caafs	p.Q491fs	UNC5C_ENST00000506749.1_Frame_Shift_Ins_p.Q510fs	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	491					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GAGGTCATCTTGGGGGGTGACA	0.505																																							uc003htp.1		NA																	0				ovary(3)|pancreas(1)	4						c.(1471-1473)CAAfs		unc5C precursor																																				SO:0001589	frameshift_variant	8633				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity	g.chr4:96140293_96140294insG	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1472dupC	4.37:g.96140299_96140299dupG	ENSP00000406022:p.Gln491fs		Somatic				UNC5C_uc010ilc.1_Frame_Shift_Ins_p.Q510fs|UNC5C_uc003htq.2_Frame_Shift_Ins_p.Q510fs	p.Q491fs	NM_003728	NP_003719	WXS	Illumina HiSeq	Unspecified	O95185	UNC5C_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)	9	1625_1626	-		Hepatocellular(203;0.114)	491			Cytoplasmic (Potential).		Q8IUT0	Frame_Shift_Ins	INS	ENST00000453304.1	37	c.1471_1472insC	CCDS3643.1																																																																																				0.505	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		7	378	NA	NA	NA	NA	NA	7	378	---	---	---	---
CFI	3426	broad.mit.edu	37	4	110662158	110662159	+	Frame_Shift_Ins	INS	-	-	C	rs7437875	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:110662158_110662159insC	ENST00000394634.2	-	13	1849_1850	c.1642_1643insG	c.(1642-1644)gaafs	p.E548fs	CFI_ENST00000394635.3_Frame_Shift_Ins_p.E556fs|CFI_ENST00000512148.1_Frame_Shift_Ins_p.E541fs	NM_000204.3	NP_000195	P05156	CFAI_HUMAN	complement factor I	548	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|skin(2)|stomach(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		TCCACAGTTTTCCCCCCAACTC	0.465																																							uc003hzr.3		NA																	0					0						c.(1642-1644)GAAfs		complement factor I preproprotein																																				SO:0001589	frameshift_variant	3426				complement activation, classical pathway|innate immune response|proteolysis	extracellular space|membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr4:110662158_110662159insC	J02770	CCDS34049.1	4q25	2014-09-17	2006-02-10	2006-02-10		ENSG00000205403	3.4.21.45	"""Complement system"""	5394	protein-coding gene	gene with protein product	"""Konglutinogen-activating factor"", ""C3b-inactivator"""	217030	"""I factor (complement)"""	IF		2956252	Standard	NM_000204		Approved	FI, C3b-INA, KAF	uc003hzr.4	P05156		ENST00000394634.2:c.1643dupG	4.37:g.110662164_110662164dupC	ENSP00000378130:p.Glu548fs		Somatic				CFI_uc003hzq.2_Frame_Shift_Ins_p.E345fs|CFI_uc011cft.1_Frame_Shift_Ins_p.E556fs|CFI_uc003hzs.3_Frame_Shift_Ins_p.E541fs	p.E548fs	NM_000204	NP_000195	WXS	Illumina HiSeq	Unspecified	P05156	CFAI_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000331)	13	1850_1851	-		Hepatocellular(203;0.217)	548			Peptidase S1.		O60442	Frame_Shift_Ins	INS	ENST00000394634.2	37	c.1642_1643insG	CCDS34049.1																																																																																				0.465	CFI-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_000204		8	429	NA	NA	NA	NA	NA	8	429	---	---	---	---
EGF	1950	broad.mit.edu	37	4	110909773	110909774	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr4:110909773_110909774insC	ENST00000265171.5	+	18	3087_3088	c.2642_2643insC	c.(2641-2646)tgccccfs	p.CP881fs	EGF_ENST00000509793.1_Frame_Shift_Ins_p.CP839fs|EGF_ENST00000503392.1_Frame_Shift_Ins_p.CP881fs	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	881	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	GTCCCAGTGTGCCCCCCTGCCT	0.47																																							uc003hzy.3		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(2641-2643)TGCfs		epidermal growth factor precursor	Sulindac(DB00605)																																			SO:0001589	frameshift_variant	1950				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity	g.chr4:110909773_110909774insC	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.2648dupC	4.37:g.110909779_110909779dupC	ENSP00000265171:p.Cys881fs		Somatic				EGF_uc011cfu.1_Frame_Shift_Ins_p.C839fs|EGF_uc011cfv.1_Frame_Shift_Ins_p.C881fs|EGF_uc010imk.2_Intron	p.C881fs	NM_001963	NP_001954	WXS	Illumina HiSeq	Unspecified	P01133	EGF_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	18	3094_3095	+		Hepatocellular(203;0.0893)	881			EGF-like 7; calcium-binding (Potential).|Extracellular (Potential).		B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Frame_Shift_Ins	INS	ENST00000265171.5	37	c.2642_2643insC	CCDS3689.1																																																																																				0.470	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1			7	551	NA	NA	NA	NA	NA	7	551	---	---	---	---
FYB	2533	broad.mit.edu	37	5	39202090	39202091	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:39202090_39202091insC	ENST00000351578.6	-	2	1162_1163	c.972_973insG	c.(970-975)gggccafs	p.P325fs	FYB_ENST00000512982.1_Frame_Shift_Ins_p.P325fs|FYB_ENST00000505428.1_Frame_Shift_Ins_p.P325fs|FYB_ENST00000540520.1_Frame_Shift_Ins_p.P335fs|FYB_ENST00000515010.1_Frame_Shift_Ins_p.P325fs	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	325					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)	p.P325A(3)|p.P335A(1)		endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			TGGCCCCATGGCCCCCCCACTG	0.54																																							uc003jls.2		NA																	4	Substitution - Missense(4)		kidney(4)	ovary(2)	2						c.(970-975)GGGCCAfs		FYN binding protein (FYB-120/130) isoform 2																																				SO:0001589	frameshift_variant	2533				cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding	g.chr5:39202090_39202091insC	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.973dupG	5.37:g.39202097_39202097dupC	ENSP00000316460:p.Pro325fs		Somatic				FYB_uc003jlt.2_Frame_Shift_Ins_p.G324fs|FYB_uc003jlu.2_Frame_Shift_Ins_p.G324fs|FYB_uc011cpl.1_Frame_Shift_Ins_p.G334fs	p.G324fs	NM_199335	NP_955367	WXS	Illumina HiSeq	Unspecified	O15117	FYB_HUMAN	Epithelial(62;0.235)		1	1039_1040	-	all_lung(31;0.000343)		324_325					A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Frame_Shift_Ins	INS	ENST00000351578.6	37	c.972_973insG	CCDS47200.1																																																																																				0.540	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465		9	166	NA	NA	NA	NA	NA	9	166	---	---	---	---
C6	729	broad.mit.edu	37	5	41181559	41181560	+	Frame_Shift_Ins	INS	-	-	C	rs372345940		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:41181559_41181560insC	ENST00000263413.3	-	7	1092_1093	c.828_829insG	c.(826-831)gggagcfs	p.S277fs	C6_ENST00000337836.5_Frame_Shift_Ins_p.S277fs|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	277	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTGAAAGAGCTCCCCCCCTGAC	0.376																																							uc003jmk.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7	GRCh37	CD982526	C6	D		c.(826-831)GGGAGCfs		complement component 6 precursor																																				SO:0001589	frameshift_variant	729				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding	g.chr5:41181559_41181560insC	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.829dupG	5.37:g.41181566_41181566dupC	ENSP00000263413:p.Ser277fs		Somatic				C6_uc003jml.1_Frame_Shift_Ins_p.G276fs	p.G276fs	NM_000065	NP_000056	WXS	Illumina HiSeq	Unspecified	P13671	CO6_HUMAN			7	1038_1039	-		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)	276_277			MACPF.			Frame_Shift_Ins	INS	ENST00000263413.3	37	c.828_829insG	CCDS3936.1																																																																																				0.376	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1			11	181	NA	NA	NA	NA	NA	11	181	---	---	---	---
MAP1B	4131	broad.mit.edu	37	5	71495076	71495077	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:71495076_71495077insC	ENST00000296755.7	+	5	6192_6193	c.5894_5895insC	c.(5893-5898)agccccfs	p.SP1965fs		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1965					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AAGACCACCAGCCCCCCCGAAG	0.485																																					Melanoma(17;367 822 11631 31730 47712)	Melanoma(17;367 822 11631 31730 47712)	uc003kbw.3		NA																	0				large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5						c.(5893-5895)AGCfs		microtubule-associated protein 1B																																				SO:0001589	frameshift_variant	4131					microtubule|microtubule associated complex	structural molecule activity	g.chr5:71495076_71495077insC	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.5901dupC	5.37:g.71495083_71495083dupC	ENSP00000296755:p.Ser1965fs		Somatic				MAP1B_uc010iyw.1_Frame_Shift_Ins_p.S1982fs|MAP1B_uc010iyx.1_Frame_Shift_Ins_p.S1839fs|MAP1B_uc010iyy.1_Frame_Shift_Ins_p.S1839fs	p.S1965fs	NM_005909	NP_005900	WXS	Illumina HiSeq	Unspecified	P46821	MAP1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)	5	6135_6136	+		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)	1965			MAP1B 6.		A2BDK5	Frame_Shift_Ins	INS	ENST00000296755.7	37	c.5894_5895insC	CCDS4012.1																																																																																				0.485	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909		9	241	NA	NA	NA	NA	NA	9	241	---	---	---	---
RASGRF2	5924	broad.mit.edu	37	5	80369227	80369228	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr5:80369227_80369228insC	ENST00000265080.4	+	5	910_911	c.843_844insC	c.(844-846)cccfs	p.P282fs	RASGRF2_ENST00000502677.1_3'UTR	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	282	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GCTCCAAGAAGCCCCCCATCAG	0.49																																							uc003kha.1		NA																	0				breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12						c.(841-846)AAGCCCfs		Ras protein-specific guanine																																				SO:0001589	frameshift_variant	5924				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr5:80369227_80369228insC	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.849dupC	5.37:g.80369233_80369233dupC	ENSP00000265080:p.Pro282fs		Somatic				RASGRF2_uc011ctn.1_RNA|RASGRF2_uc003khb.1_Frame_Shift_Ins_p.K109fs	p.K281fs	NM_006909	NP_008840	WXS	Illumina HiSeq	Unspecified	O14827	RGRF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)	5	843_844	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	281_282			DH.		B9EG89|Q9UK56	Frame_Shift_Ins	INS	ENST00000265080.4	37	c.843_844insC	CCDS4052.1																																																																																				0.490	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		13	68	NA	NA	NA	NA	NA	13	68	---	---	---	---
EXOC2	55770	broad.mit.edu	37	6	637793	637794	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:637793_637794insG	ENST00000230449.4	-	2	160_161	c.25_26insC	c.(25-27)cttfs	p.L9fs	EXOC2_ENST00000448181.3_Intron	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	9	IPT/TIG.				cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.Q6fs*28(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		GCCGGTCACAAGGGGGGGTTGT	0.485																																							uc003mtd.2		NA																	1	Deletion - Frameshift(1)		ovary(1)	breast(4)|ovary(2)|pancreas(1)	7						c.(25-27)CTTfs		Sec5 protein																																				SO:0001589	frameshift_variant	55770				exocytosis|protein transport			g.chr6:637793_637794insG	AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.26dupC	6.37:g.637800_637800dupG	ENSP00000230449:p.Leu9fs		Somatic				EXOC2_uc003mte.2_Frame_Shift_Ins_p.L9fs|EXOC2_uc011dho.1_Intron	p.L9fs	NM_018303	NP_060773	WXS	Illumina HiSeq	Unspecified	Q96KP1	EXOC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)	2	159_160	-	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)	9			IPT/TIG.		B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Frame_Shift_Ins	INS	ENST00000230449.4	37	c.25_26insC	CCDS34327.1																																																																																				0.485	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303		10	305	NA	NA	NA	NA	NA	10	305	---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	13206134	13206135	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:13206134_13206135insG	ENST00000379350.1	+	7	881_882	c.752_753insG	c.(751-756)gtggggfs	p.VG251fs	PHACTR1_ENST00000332995.7_Frame_Shift_Ins_p.VG251fs|PHACTR1_ENST00000379345.2_Intron|PHACTR1_ENST00000457702.2_Frame_Shift_Ins_p.VG106fs			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	251					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TGTATGCCCGTGGGGGGGCCAG	0.599																																							uc010jpc.2		NA																	0					0						c.(751-753)GTGfs		phosphatase and actin regulator 1																																				SO:0001589	frameshift_variant	221692					cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity	g.chr6:13206134_13206135insG	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.759dupG	6.37:g.13206141_13206141dupG	ENSP00000368655:p.Val251fs		Somatic				PHACTR1_uc011dir.1_Frame_Shift_Ins_p.V320fs|PHACTR1_uc003nag.1_Frame_Shift_Ins_p.V251fs|PHACTR1_uc003nah.1_Frame_Shift_Ins_p.V251fs	p.V251fs	NM_030948	NP_112210	WXS	Illumina HiSeq	Unspecified	Q9C0D0	PHAR1_HUMAN	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)		8	1084_1085	+	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	251					A8K1V2|Q3MJ93|Q5JSJ2	Frame_Shift_Ins	INS	ENST00000379350.1	37	c.752_753insG																																																																																					0.599	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1	XM_166420		7	206	NA	NA	NA	NA	NA	7	206	---	---	---	---
DCDC2	51473	broad.mit.edu	37	6	24205282	24205283	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:24205282_24205283insC	ENST00000378454.3	-	8	1271_1272	c.970_971insG	c.(970-972)gcafs	p.A324fs	DCDC2_ENST00000378450.3_Frame_Shift_Ins_p.A77fs	NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	324					cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				GACTTCTGCTGCCCCCCGTGTT	0.411																																							uc003ndx.2		NA																	0				ovary(1)	1						c.(970-972)GCAfs		doublecortin domain containing 2			,	0,4262		0,0,2131					,	6.1	1.0			246	1,8253		0,1,4126	no	frameshift,frameshift	DCDC2	NM_016356.3,NM_001195610.1	,	0,1,6257	A1A1,A1R,RR		0.0121,0.0,0.0080	,	,		1,12515				SO:0001589	frameshift_variant	51473				cellular defense response|intracellular signal transduction|neuron migration			g.chr6:24205282_24205283insC	AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.971dupG	6.37:g.24205288_24205288dupC	ENSP00000367715:p.Ala324fs		Somatic				DCDC2_uc003ndy.2_Frame_Shift_Ins_p.A324fs|DCDC2_uc003ndw.2_Frame_Shift_Ins_p.A75fs	p.A324fs	NM_016356	NP_057440	WXS	Illumina HiSeq	Unspecified	Q9UHG0	DCDC2_HUMAN			8	1272_1273	-		Ovarian(999;0.101)	324					Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Frame_Shift_Ins	INS	ENST00000378454.3	37	c.970_971insG	CCDS4550.1																																																																																				0.411	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043604.1	NM_016356		14	1246	NA	NA	NA	NA	NA	14	1246	---	---	---	---
OR5V1	81696	broad.mit.edu	37	6	29323407	29323407	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:29323407delC	ENST00000377154.1	-	4	865	c.566delG	c.(565-567)tgtfs	p.C189fs	OR5V1_ENST00000543825.1_Frame_Shift_Del_p.C189fs			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AGTGTTTCCACAAGACAAGAT	0.443																																					Ovarian(32;43 883 21137 32120 42650)	Ovarian(32;43 883 21137 32120 42650)	uc011dlo.1		NA																	0				ovary(3)|kidney(1)	4						c.(565-567)TGTfs		olfactory receptor, family 5, subfamily V,							94.0	87.0	89.0					6																	29323407		2203	4299	6502	SO:0001589	frameshift_variant	81696				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29323407delC		CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.566delG	6.37:g.29323407delC	ENSP00000366359:p.Cys189fs		Somatic					p.C189fs	NM_030876	NP_110503	WXS	Illumina HiSeq	Unspecified	Q9UGF6	OR5V1_HUMAN			1	648	-			189			Extracellular (Potential).		A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Frame_Shift_Del	DEL	ENST00000377154.1	37	c.566delG	CCDS4657.1																																																																																				0.443	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3			138	496	NA	NA	NA	NA	NA	138	496	---	---	---	---
MOG	4340	broad.mit.edu	37	6	29627216	29627217	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:29627216_29627217insC	ENST00000376917.3	+	2	438_439	c.209_210insC	c.(208-213)cgccccfs	p.RP70fs	MOG_ENST00000494692.1_Frame_Shift_Ins_p.RP70fs|MOG_ENST00000396701.2_Frame_Shift_Ins_p.RP70fs|MOG_ENST00000376894.4_Frame_Shift_Ins_p.RP70fs|MOG_ENST00000376891.4_Frame_Shift_Ins_p.RP70fs|MOG_ENST00000483013.1_Intron|MOG_ENST00000376902.3_Frame_Shift_Ins_p.RP70fs|MOG_ENST00000431798.2_Frame_Shift_Ins_p.RP70fs|MOG_ENST00000490427.1_Intron|MOG_ENST00000376898.3_Frame_Shift_Ins_p.RP70fs|MOG_ENST00000396704.3_Frame_Shift_Ins_p.RP70fs|MOG_ENST00000416766.2_Frame_Shift_Ins_p.RP70fs|MOG_ENST00000376888.2_Intron|MOG_ENST00000469603.1_3'UTR|MOG_ENST00000533330.2_Frame_Shift_Ins_p.RP70fs	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein	70	Ig-like V-type.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F73fs*29(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						GGGTGGTACCGCCCCCCCTTCT	0.569																																							uc003nnf.2		NA																	1	Deletion - Frameshift(1)		lung(1)	ovary(1)	1						c.(208-210)CGCfs		myelin oligodendrocyte glycoprotein isoform																																				SO:0001589	frameshift_variant	4340				cell adhesion|central nervous system development|positive regulation of MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane		g.chr6:29627216_29627217insC		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099	ENST00000376917.3:c.216dupC	6.37:g.29627223_29627223dupC	ENSP00000366115:p.Arg70fs		Somatic				MOG_uc003qzk.1_Frame_Shift_Ins_p.R70fs|MOG_uc010kle.1_Intron|MOG_uc010klf.1_Intron|MOG_uc003nmy.1_Frame_Shift_Ins_p.R70fs|MOG_uc003nmz.2_Frame_Shift_Ins_p.R70fs|MOG_uc011dlt.1_Intron|MOG_uc003nna.2_Intron|MOG_uc011dlu.1_Intron|MOG_uc011dlv.1_Intron|MOG_uc003nnd.2_Frame_Shift_Ins_p.R70fs|MOG_uc003nne.2_Frame_Shift_Ins_p.R70fs|MOG_uc003nng.2_Frame_Shift_Ins_p.R70fs|MOG_uc003nnh.2_Frame_Shift_Ins_p.R70fs|MOG_uc003nni.2_Frame_Shift_Ins_p.R70fs|MOG_uc003nnj.2_Frame_Shift_Ins_p.R70fs|MOG_uc003nnk.2_Frame_Shift_Ins_p.R70fs	p.R70fs	NM_206809	NP_996532	WXS	Illumina HiSeq	Unspecified	Q16653	MOG_HUMAN			2	387_388	+			70			Ig-like V-type.|Extracellular (Potential).		A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Frame_Shift_Ins	INS	ENST00000376917.3	37	c.209_210insC	CCDS34370.1																																																																																				0.569	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433		9	209	NA	NA	NA	NA	NA	9	209	---	---	---	---
UHRF1BP1	54887	broad.mit.edu	37	6	34791081	34791082	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:34791081_34791082insC	ENST00000192788.5	+	4	465_466	c.294_295insC	c.(295-297)cccfs	p.P99fs	Y_RNA_ENST00000383990.1_RNA|UHRF1BP1_ENST00000452449.2_Frame_Shift_Ins_p.P99fs	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	99							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						AGGATCCTCGGCCCCCCAATGG	0.446																																							uc003oju.3		NA																	0				ovary(3)	3						c.(292-297)CGGCCCfs		ICBP90 binding protein 1																																				SO:0001589	frameshift_variant	54887							g.chr6:34791081_34791082insC	AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.300dupC	6.37:g.34791087_34791087dupC	ENSP00000192788:p.Pro99fs		Somatic				UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA	p.R98fs	NM_017754	NP_060224	WXS	Illumina HiSeq	Unspecified	Q6BDS2	URFB1_HUMAN			4	528_529	+			98_99					Q9NXE0	Frame_Shift_Ins	INS	ENST00000192788.5	37	c.294_295insC	CCDS43455.1																																																																																				0.446	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754		18	886	NA	NA	NA	NA	NA	18	886	---	---	---	---
MAPK14	1432	broad.mit.edu	37	6	36068005	36068006	+	Intron	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:36068005_36068006insC	ENST00000229794.4	+	10	1150				MAPK14_ENST00000229795.3_Frame_Shift_Ins_p.P242fs|MAPK14_ENST00000310795.4_Intron|MAPK14_ENST00000468133.1_Intron	NM_139012.2|NM_139014.2	NP_620581.1|NP_620583.1	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14						3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cartilage condensation (GO:0001502)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to ionizing radiation (GO:0071479)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chemotaxis (GO:0006935)|chondrocyte differentiation (GO:0002062)|DNA damage checkpoint (GO:0000077)|fatty acid oxidation (GO:0019395)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoclast differentiation (GO:0030316)|p38MAPK cascade (GO:0038066)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to muramyl dipeptide (GO:0032495)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|signal transduction in response to DNA damage (GO:0042770)|skeletal muscle tissue development (GO:0007519)|stress-activated MAPK cascade (GO:0051403)|stress-induced premature senescence (GO:0090400)|striated muscle cell differentiation (GO:0051146)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|MAP kinase kinase activity (GO:0004708)|NFAT protein binding (GO:0051525)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|stomach(1)	16						TGACAGGAACACCCCCCGCTTA	0.426																																					Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)	Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)	uc003olp.2		NA																	0				ovary(2)|stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	6						c.(721-726)ACACCCfs		mitogen-activated protein kinase 14 isoform 1																																				SO:0001627	intron_variant	1432				activation of MAPK activity|cellular component movement|cellular response to ionizing radiation|chemotaxis|innate immune response|mRNA metabolic process|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of muscle cell differentiation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|signal transduction in response to DNA damage|stress-activated MAPK cascade|stress-induced premature senescence|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|MAP kinase kinase activity|protein binding	g.chr6:36068005_36068006insC	L35263	CCDS4815.1, CCDS4816.1, CCDS4817.1	6p21.3-p21.2	2011-06-09			ENSG00000112062	ENSG00000112062		"""Mitogen-activated protein kinase cascade / Kinases"""	6876	protein-coding gene	gene with protein product	"""p38 MAP kinase"""	600289		CSPB1, CSBP1, CSBP2		7997261	Standard	NM_139012		Approved	PRKM14, p38, Mxi2, PRKM15	uc003olq.3	Q16539	OTTHUMG00000159806	ENST00000229794.4:c.763-2342->C	6.37:g.36068011_36068011dupC			Somatic				MAPK14_uc003olo.2_Intron|MAPK14_uc003olq.2_Intron|MAPK14_uc003olr.2_Intron|MAPK14_uc011dti.1_Intron	p.T241fs	NM_001315	NP_001306	WXS	Illumina HiSeq	Unspecified	Q16539	MK14_HUMAN			9	1204_1205	+			241_242			Protein kinase.		A6ZJ92|A8K6P4|B0LPH0|B5TY32|O60776|Q13083|Q14084|Q8TDX0	Frame_Shift_Ins	INS	ENST00000229794.4	37	c.723_724insC	CCDS4816.1																																																																																				0.426	MAPK14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357450.1	NM_001315		13	368	NA	NA	NA	NA	NA	13	368	---	---	---	---
RUNX2	860	broad.mit.edu	37	6	45514855	45514856	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:45514855_45514856insG	ENST00000371438.1	+	8	1737_1738	c.1379_1380insG	c.(1378-1383)ccggggfs	p.PG460fs	RUNX2_ENST00000576263.1_Intron|RUNX2_ENST00000541979.1_Frame_Shift_Ins_p.PG506fs|RUNX2_ENST00000359524.5_Frame_Shift_Ins_p.PG446fs|RUNX2_ENST00000371436.6_Frame_Shift_Ins_p.PG438fs|RUNX2_ENST00000371432.3_Frame_Shift_Ins_p.PG424fs|RUNX2_ENST00000465038.2_Frame_Shift_Ins_p.PG460fs|RUNX2_ENST00000352853.5_Frame_Shift_Ins_p.PG528fs	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	460	Interaction with KAT6B.|Pro/Ser/Thr-rich.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G462fs*22(1)|p.G530fs*22(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CCCATGGTGCCGGGGGGAGACC	0.545																																							uc011dvx.1		NA																	2	Deletion - Frameshift(2)		breast(2)	ovary(2)|skin(1)	3	GRCh37	CI993282	RUNX2	I		c.(1378-1380)CCGfs		runt-related transcription factor 2 isoform a																																				SO:0001589	frameshift_variant	860				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr6:45514855_45514856insG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.1385dupG	6.37:g.45514861_45514861dupG	ENSP00000360493:p.Pro460fs		Somatic				RUNX2_uc011dvy.1_Frame_Shift_Ins_p.P438fs|RUNX2_uc003oxt.2_Frame_Shift_Ins_p.P446fs	p.P460fs	NM_001024630	NP_001019801	WXS	Illumina HiSeq	Unspecified	Q13950	RUNX2_HUMAN			9	1589_1590	+			460			Pro/Ser/Thr-rich.|Interaction with MYST4.		O14614|O14615|O95181	Frame_Shift_Ins	INS	ENST00000371438.1	37	c.1379_1380insG	CCDS43467.2																																																																																				0.545	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348		8	208	NA	NA	NA	NA	NA	8	208	---	---	---	---
REV3L	5980	broad.mit.edu	37	6	111693903	111693904	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr6:111693903_111693904insG	ENST00000358835.3	-	14	6108_6109	c.5654_5655insC	c.(5653-5655)ccafs	p.P1885fs	REV3L_ENST00000435970.1_Frame_Shift_Ins_p.P1807fs|REV3L_ENST00000368802.3_Frame_Shift_Ins_p.P1885fs|REV3L_ENST00000368805.1_Frame_Shift_Ins_p.P1885fs			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1885	Mediates interaction with MAD2L2.				DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CTTCCCTACTTGGGGGGGACAT	0.431								DNA polymerases (catalytic subunits)																															uc003puy.3		NA																	0				large_intestine(2)|ovary(2)|skin(2)	6						c.(5653-5655)CCAfs	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA polymerase zeta																																				SO:0001589	frameshift_variant	5980				DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding	g.chr6:111693903_111693904insG	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.5655dupC	6.37:g.111693910_111693910dupG	ENSP00000351697:p.Pro1885fs		Somatic				REV3L_uc003pux.3_Frame_Shift_Ins_p.P1807fs|REV3L_uc003puz.3_Frame_Shift_Ins_p.P1807fs	p.P1885fs	NM_002912	NP_002903	WXS	Illumina HiSeq	Unspecified	O60673	DPOLZ_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)	13	5977_5978	-		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)	1885			Mediates interaction with MAD2L2.		O43214|Q5TC33	Frame_Shift_Ins	INS	ENST00000358835.3	37	c.5654_5655insC	CCDS5091.2																																																																																				0.431	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912		8	317	NA	NA	NA	NA	NA	8	317	---	---	---	---
GRM3	2913	broad.mit.edu	37	7	86415681	86415682	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:86415681_86415682insC	ENST00000361669.2	+	3	1672_1673	c.573_574insC	c.(574-576)cccfs	p.P192fs	GRM3_ENST00000394720.2_Frame_Shift_Ins_p.P190fs|GRM3_ENST00000536043.1_Frame_Shift_Ins_p.P64fs|GRM3_ENST00000439827.1_Frame_Shift_Ins_p.P192fs|GRM3_ENST00000546348.1_Intron|AC005009.2_ENST00000452471.1_RNA|AC005009.2_ENST00000418031.1_RNA	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	192					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					CCAGGACCGTGCCCCCCGACTT	0.564																																					GBM(52;969 1098 3139 52280)	GBM(52;969 1098 3139 52280)	uc003uid.2		NA																	0				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13						c.(571-576)GTGCCCfs		glutamate receptor, metabotropic 3 precursor	Acamprosate(DB00659)|Nicotine(DB00184)																																			SO:0001589	frameshift_variant	2913				synaptic transmission	integral to plasma membrane		g.chr7:86415681_86415682insC		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.579dupC	7.37:g.86415687_86415687dupC	ENSP00000355316:p.Pro192fs		Somatic				GRM3_uc010lef.2_Frame_Shift_Ins_p.V189fs|GRM3_uc010leg.2_Frame_Shift_Ins_p.V63fs|GRM3_uc010leh.2_Intron	p.V191fs	NM_000840	NP_000831	WXS	Illumina HiSeq	Unspecified	Q14832	GRM3_HUMAN			3	1672_1673	+	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)		191_192			Extracellular (Potential).		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Frame_Shift_Ins	INS	ENST00000361669.2	37	c.573_574insC	CCDS5600.1																																																																																				0.564	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2			7	211	NA	NA	NA	NA	NA	7	211	---	---	---	---
ZCWPW1	55063	broad.mit.edu	37	7	100000150	100000151	+	Frame_Shift_Ins	INS	-	-	T	rs375737733		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:100000150_100000151insT	ENST00000398027.2	-	16	1706_1707	c.1459_1460insA	c.(1459-1461)accfs	p.T487fs	ZCWPW1_ENST00000490721.1_Frame_Shift_Ins_p.T367fs|ZCWPW1_ENST00000360951.4_Intron|ZCWPW1_ENST00000324725.6_Frame_Shift_Ins_p.T367fs	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	487							zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCTTGGCTTGGTTTTTTGGGTC	0.48																																							uc003uut.2		NA																	0					0						c.(1459-1461)ACCfs		zinc finger, CW type with PWWP domain 1																																				SO:0001589	frameshift_variant	55063						zinc ion binding	g.chr7:100000150_100000151insT	AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.1460dupA	7.37:g.100000156_100000156dupT	ENSP00000381109:p.Thr487fs		Somatic				ZCWPW1_uc011kjq.1_Frame_Shift_Ins_p.T367fs|ZCWPW1_uc003uur.2_Intron|ZCWPW1_uc003uus.2_Frame_Shift_Ins_p.T367fs|ZCWPW1_uc011kjr.1_Intron|ZCWPW1_uc011kjp.1_Intron	p.T487fs	NM_017984	NP_060454	WXS	Illumina HiSeq	Unspecified	Q9H0M4	ZCPW1_HUMAN			16	1707_1708	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		487					A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Frame_Shift_Ins	INS	ENST00000398027.2	37	c.1459_1460insA	CCDS43623.1																																																																																				0.480	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356083.1	NM_017984		7	2142	NA	NA	NA	NA	NA	7	2142	---	---	---	---
SRRT	51593	broad.mit.edu	37	7	100479331	100479332	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:100479331_100479332insG	ENST00000347433.4	+	4	461_462	c.303_304insG	c.(304-306)gggfs	p.G102fs	SRRT_ENST00000388793.4_Frame_Shift_Ins_p.G102fs|SRRT_ENST00000457580.2_Frame_Shift_Ins_p.G102fs|SRRT_ENST00000432932.1_Frame_Shift_Ins_p.G102fs			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	102					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.G104fs*45(1)		breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TGCCCTATGCTGGGGGGGGTGG	0.609																																							uc003uwy.2		NA																	1	Deletion - Frameshift(1)		ovary(1)	ovary(2)	2						c.(301-306)GCTGGGfs		arsenate resistance protein 2 isoform a																																				SO:0001589	frameshift_variant	51593				cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding	g.chr7:100479331_100479332insG		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.311dupG	7.37:g.100479339_100479339dupG	ENSP00000314491:p.Gly102fs		Somatic				SRRT_uc010lhl.1_Frame_Shift_Ins_p.A101fs|SRRT_uc003uxa.2_Frame_Shift_Ins_p.A101fs|SRRT_uc003uwz.2_Frame_Shift_Ins_p.A101fs	p.A101fs	NM_015908	NP_056992	WXS	Illumina HiSeq	Unspecified	Q9BXP5	SRRT_HUMAN			5	571_572	+			101_102					A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Frame_Shift_Ins	INS	ENST00000347433.4	37	c.303_304insG	CCDS34709.1																																																																																				0.609	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908		8	83	NA	NA	NA	NA	NA	8	83	---	---	---	---
AP1S1	1174	broad.mit.edu	37	7	100802404	100802405	+	Frame_Shift_Ins	INS	-	-	G	rs571529719		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:100802404_100802405insG	ENST00000337619.5	+	4	474_475	c.356_357insG	c.(355-360)atggggfs	p.MG119fs	MIR4653_ENST00000585107.1_RNA	NM_001283.3	NP_001274.1	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1 subunit	119					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor-mediated endocytosis (GO:0006898)|regulation of defense response to virus by virus (GO:0050690)|response to virus (GO:0009615)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|coated pit (GO:0005905)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)	protein transporter activity (GO:0008565)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)	8	Lung NSC(181;0.168)|all_lung(186;0.215)					GAGTTTTTGATGGGGGGGGATG	0.564																																							uc003uxv.3		NA																	0					0						c.(355-357)ATGfs		adaptor-related protein complex 1, sigma 1																																				SO:0001589	frameshift_variant	1174				intracellular protein transport|post-Golgi vesicle-mediated transport|receptor-mediated endocytosis|regulation of defense response to virus by virus|response to virus|viral reproduction	AP-1 adaptor complex|coated pit|cytosol|lysosomal membrane	protein binding|protein transporter activity	g.chr7:100802404_100802405insG	AB015319	CCDS47669.1	7q22.1	2014-02-04			ENSG00000106367	ENSG00000106367			559	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, small 1 (19kD)"", ""clathrin coat assembly protein AP19"", ""sigma1A subunit of AP-1 clathrin adaptor complex"", ""AP-1 complex subunit sigma-1A"", ""sigma1A-adaptin"", ""golgi adaptor HA1/AP1 adaptin sigma-1A subunit"", ""clathrin assembly protein complex 1 sigma-1A small chain"", ""HA1 19 kDa subunit"""	603531	"""erythrokeratodermia variabilis 3 (Kamouraska type)"""	CLAPS1, EKV3		9653655, 9733768, 19057675	Standard	NM_001283		Approved	AP19, SIGMA1A, WUGSC:H_DJ0747G18.2	uc003uxv.4	P61966	OTTHUMG00000157103	ENST00000337619.5:c.364dupG	7.37:g.100802412_100802412dupG	ENSP00000336666:p.Met119fs		Somatic					p.M119fs	NM_001283	NP_001274	WXS	Illumina HiSeq	Unspecified	P61966	AP1S1_HUMAN			4	466_467	+	Lung NSC(181;0.168)|all_lung(186;0.215)		119					B2R5D8|P82267|Q00382|Q53YA7|Q9BTN4|Q9UDW9	Frame_Shift_Ins	INS	ENST00000337619.5	37	c.356_357insG	CCDS47669.1																																																																																				0.564	AP1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347439.1	NM_001283		7	49	NA	NA	NA	NA	NA	7	49	---	---	---	---
CPED1	79974	broad.mit.edu	37	7	120911387	120911388	+	Frame_Shift_Ins	INS	-	-	A	rs141494536	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:120911387_120911388insA	ENST00000310396.5	+	22	3238_3239	c.2771_2772insA	c.(2770-2775)gcaaaafs	p.AK924fs		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	924						endoplasmic reticulum (GO:0005783)											CTGGATACTGCAAAAAAACATG	0.351																																							uc003vjq.3		NA																	0				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(2770-2772)GCAfs		hypothetical protein LOC79974 isoform 1																																				SO:0001589	frameshift_variant	79974					endoplasmic reticulum		g.chr7:120911387_120911388insA		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2778dupA	7.37:g.120911394_120911394dupA	ENSP00000309772:p.Ala924fs		Somatic					p.A924fs	NM_024913	NP_079189	WXS	Illumina HiSeq	Unspecified	A4D0V7	CG058_HUMAN			22	3218_3219	+	all_neural(327;0.117)		924					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Frame_Shift_Ins	INS	ENST00000310396.5	37	c.2771_2772insA	CCDS34739.1																																																																																				0.351	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		8	259	NA	NA	NA	NA	NA	8	259	---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133682284	133682285	+	Frame_Shift_Ins	INS	-	-	C	rs34608222	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:133682284_133682285insC	ENST00000253861.4	+	15	2275_2276	c.2246_2247insC	c.(2245-2250)ctccccfs	p.LP749fs	EXOC4_ENST00000541309.1_Frame_Shift_Ins_p.LP37fs|EXOC4_ENST00000539845.1_Frame_Shift_Ins_p.LP648fs|EXOC4_ENST00000545148.1_Frame_Shift_Ins_p.LP359fs	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	749					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				AACACGGATCTCCCCCCAGTGT	0.46																																							uc003vrk.2		NA																	0				ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9						c.(2245-2247)CTCfs		SEC8 protein isoform a																																				SO:0001589	frameshift_variant	60412				vesicle docking involved in exocytosis	exocyst	protein N-terminus binding	g.chr7:133682284_133682285insC	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.2252dupC	7.37:g.133682290_133682290dupC	ENSP00000253861:p.Leu749fs		Somatic				EXOC4_uc011kpo.1_Frame_Shift_Ins_p.L648fs|EXOC4_uc003vrl.2_Frame_Shift_Ins_p.L359fs|EXOC4_uc011kpp.1_Frame_Shift_Ins_p.L281fs|EXOC4_uc011kpq.1_Frame_Shift_Ins_p.L37fs	p.L749fs	NM_021807	NP_068579	WXS	Illumina HiSeq	Unspecified	Q96A65	EXOC4_HUMAN			15	2281_2282	+		Esophageal squamous(399;0.129)	749					E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Frame_Shift_Ins	INS	ENST00000253861.4	37	c.2246_2247insC	CCDS5829.1																																																																																				0.460	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807		8	355	NA	NA	NA	NA	NA	8	355	---	---	---	---
UBN2	254048	broad.mit.edu	37	7	138946363	138946364	+	Frame_Shift_Ins	INS	-	-	G	rs150369714|rs140343844	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:138946363_138946364insG	ENST00000473989.3	+	6	1271_1272	c.1271_1272insG	c.(1270-1275)tcggggfs	p.SG424fs	UBN2_ENST00000288561.8_Frame_Shift_Ins_p.SG341fs	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	424						extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						CTATCTGAGTCGGGGGGTGAAA	0.49																																							uc011kqr.1		NA																	0				ovary(1)|skin(1)	2						c.(1270-1272)TCGfs		ubinuclein 2																																				SO:0001589	frameshift_variant	254048							g.chr7:138946363_138946364insG	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.1277dupG	7.37:g.138946369_138946369dupG	ENSP00000418648:p.Ser424fs		Somatic				UBN2_uc003vuv.2_Frame_Shift_Ins_p.S147fs	p.S424fs	NM_173569	NP_775840	WXS	Illumina HiSeq	Unspecified	Q6ZU65	UBN2_HUMAN			6	1271_1272	+			424					A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Frame_Shift_Ins	INS	ENST00000473989.3	37	c.1271_1272insG	CCDS43655.2																																																																																				0.490	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569		7	208	NA	NA	NA	NA	NA	7	208	---	---	---	---
TRPV5	56302	broad.mit.edu	37	7	142612493	142612494	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr7:142612493_142612494insC	ENST00000265310.1	-	10	1617_1618	c.1269_1270insG	c.(1267-1272)gggccafs	p.P424fs		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	424					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					ACATGGAATGGCCCCCCAAGAA	0.505																																							uc003wby.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.(1267-1272)GGGCCAfs		transient receptor potential cation channel,				0,4264		0,0,2132						4.4	0.1			148	2,8252		0,2,4125	no	frameshift	TRPV5	NM_019841.4		0,2,6257	A1A1,A1R,RR		0.0242,0.0,0.016				2,12516				SO:0001589	frameshift_variant	56302				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	g.chr7:142612493_142612494insC	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1270dupG	7.37:g.142612499_142612499dupC	ENSP00000265310:p.Pro424fs		Somatic					p.G423fs	NM_019841	NP_062815	WXS	Illumina HiSeq	Unspecified	Q9NQA5	TRPV5_HUMAN			10	1533_1534	-	Melanoma(164;0.059)		423_424			Helical; (Potential).		A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Frame_Shift_Ins	INS	ENST00000265310.1	37	c.1269_1270insG	CCDS5875.1																																																																																				0.505	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		8	420	NA	NA	NA	NA	NA	8	420	---	---	---	---
ENTPD4	9583	broad.mit.edu	37	8	23294483	23294484	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:23294483_23294484insC	ENST00000358689.4	-	10	1572_1573	c.1337_1338insG	c.(1336-1338)ggafs	p.G446fs	ENTPD4_ENST00000417069.2_Frame_Shift_Ins_p.G438fs|ENTPD4_ENST00000356206.6_Frame_Shift_Ins_p.G438fs|ENTPD4_ENST00000521321.1_5'UTR	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	446					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		CATTGTAGTCTCCCCCCATTCG	0.5																																							uc003xdl.2		NA																	0				ovary(1)|kidney(1)	2						c.(1336-1338)GGAfs		ectonucleoside triphosphate diphosphohydrolase 4																																				SO:0001589	frameshift_variant	9583				UDP catabolic process	autophagic vacuole membrane|cytoplasmic vesicle|integral to Golgi membrane	uridine-diphosphatase activity	g.chr8:23294483_23294484insC	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1338dupG	8.37:g.23294489_23294489dupC	ENSP00000351520:p.Gly446fs		Somatic				ENTPD4_uc011kzu.1_Frame_Shift_Ins_p.G438fs|ENTPD4_uc003xdm.2_Frame_Shift_Ins_p.G438fs|ENTPD4_uc011kzv.1_Frame_Shift_Ins_p.G446fs	p.G446fs	NM_004901	NP_004892	WXS	Illumina HiSeq	Unspecified	Q9Y227	ENTP4_HUMAN		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)	10	1501_1502	-		Prostate(55;0.114)	446			Lumenal (Potential).		D3DSS3|O15092	Frame_Shift_Ins	INS	ENST00000358689.4	37	c.1337_1338insG	CCDS6041.1																																																																																				0.500	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	NM_004901		14	441	NA	NA	NA	NA	NA	14	441	---	---	---	---
ARFGEF1	10565	broad.mit.edu	37	8	68128855	68128856	+	Frame_Shift_Ins	INS	-	-	G	rs142098461	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:68128855_68128856insG	ENST00000262215.3	-	33	5044_5045	c.4655_4656insC	c.(4654-4656)ccafs	p.P1552fs	ARFGEF1_ENST00000518230.1_Frame_Shift_Ins_p.P390fs|ARFGEF1_ENST00000520381.1_Frame_Shift_Ins_p.P1006fs	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1552					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GAGATGGAGGTGGGGGGGCAGT	0.421																																							uc003xxo.1		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8						c.(4654-4656)CCAfs		brefeldin A-inhibited guanine																																				SO:0001589	frameshift_variant	10565				exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding	g.chr8:68128855_68128856insG	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.4656dupC	8.37:g.68128862_68128862dupG	ENSP00000262215:p.Pro1552fs		Somatic				ARFGEF1_uc003xxl.1_Frame_Shift_Ins_p.P1006fs|ARFGEF1_uc003xxn.1_Frame_Shift_Ins_p.P535fs	p.P1552fs	NM_006421	NP_006412	WXS	Illumina HiSeq	Unspecified	Q9Y6D6	BIG1_HUMAN	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)		33	5045_5046	-	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	1552					Q9NV46|Q9UFV2|Q9UNL0	Frame_Shift_Ins	INS	ENST00000262215.3	37	c.4655_4656insC	CCDS6199.1																																																																																				0.421	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421		23	267	NA	NA	NA	NA	NA	23	267	---	---	---	---
KCNB2	9312	broad.mit.edu	37	8	73480396	73480397	+	Frame_Shift_Ins	INS	-	-	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr8:73480396_73480397insA	ENST00000523207.1	+	2	1015_1016	c.427_428insA	c.(427-429)caafs	p.Q143fs		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	143					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.Q143K(1)|p.E146fs*3(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CAGATATCATCAAAAAAAAGAA	0.446																																							uc003xzb.2		NA																	2	Substitution - Missense(1)|Deletion - Frameshift(1)		ovary(1)|lung(1)	skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(427-429)CAAfs		potassium voltage-gated channel, Shab-related																																				SO:0001589	frameshift_variant	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73480396_73480397insA	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.435dupA	8.37:g.73480404_73480404dupA	ENSP00000430846:p.Gln143fs		Somatic					p.Q143fs	NM_004770	NP_004761	WXS	Illumina HiSeq	Unspecified	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		2	1015_1016	+	Breast(64;0.137)		143			Cytoplasmic (Potential).		Q7Z7D0|Q9BXD3	Frame_Shift_Ins	INS	ENST00000523207.1	37	c.427_428insA	CCDS6209.1																																																																																				0.446	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		7	614	NA	NA	NA	NA	NA	7	614	---	---	---	---
ABCA1	19	broad.mit.edu	37	9	107593322	107593323	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:107593322_107593323insC	ENST00000374736.3	-	14	2169_2170	c.1775_1776insG	c.(1774-1776)ggcfs	p.G592fs	ABCA1_ENST00000494467.1_5'Flank	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	592					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	AGTAGGCGAAGCCCCCCCAGAC	0.54																																							uc004bcl.2		NA																	0				large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17						c.(1774-1776)GGCfs		ATP-binding cassette, sub-family A member 1	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)																																			SO:0001589	frameshift_variant	19				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding	g.chr9:107593322_107593323insC	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.1776dupG	9.37:g.107593329_107593329dupC	ENSP00000363868:p.Gly592fs		Somatic					p.G592fs	NM_005502	NP_005493	WXS	Illumina HiSeq	Unspecified	O95477	ABCA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.023)	14	2088_2089	-			592			Extracellular.		Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Frame_Shift_Ins	INS	ENST00000374736.3	37	c.1775_1776insG	CCDS6762.1																																																																																				0.540	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502		10	227	NA	NA	NA	NA	NA	10	227	---	---	---	---
PRRC2B	84726	broad.mit.edu	37	9	134349850	134349851	+	Frame_Shift_Del	DEL	CT	CT	-	rs373788614		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chr9:134349850_134349851delCT	ENST00000357304.4	+	15	2389_2390	c.2334_2335delCT	c.(2332-2337)agctctfs	p.SS778fs	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Intron|PRRC2B_ENST00000405995.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	778							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GGAATGAAAGCTCTTTCTCTGC	0.475																																							uc004can.3		NA																	0					0						c.(2332-2337)AGCTCTfs		HLA-B associated transcript 2-like																																				SO:0001589	frameshift_variant	84726						protein binding	g.chr9:134349850_134349851delCT	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.2334_2335delCT	9.37:g.134349852_134349853delCT	ENSP00000349856:p.Ser778fs		Somatic				BAT2L1_uc010mzj.1_Frame_Shift_Del_p.S361fs|BAT2L1_uc004cao.3_Frame_Shift_Del_p.S136fs	p.S778fs	NM_013318	NP_037450	WXS	Illumina HiSeq	Unspecified	Q5JSZ5	PRC2B_HUMAN			15	2389_2390	+			778_779					O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Frame_Shift_Del	DEL	ENST00000357304.4	37	c.2334_2335delCT	CCDS48044.1																																																																																				0.475	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				21	87	NA	NA	NA	NA	NA	21	87	---	---	---	---
PRRG1	5638	broad.mit.edu	37	X	37312610	37312611	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:37312610_37312611insC	ENST00000542554.1	+	5	665_666	c.393_394insC	c.(394-396)cccfs	p.P132fs	PRRG1_ENST00000491253.1_3'UTR|PRRG1_ENST00000449135.2_Frame_Shift_Ins_p.P132fs|PRRG1_ENST00000543642.1_Frame_Shift_Ins_p.P132fs|TM4SF2_ENST00000465127.1_Intron|PRRG1_ENST00000378628.4_Frame_Shift_Ins_p.P132fs	NM_001173489.1	NP_001166960.1	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1	132	Poly-Pro.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P135fs*3(1)|p.P134fs*19(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	15						TTATCACCCCACCCCCCCCACC	0.485																																							uc004ddn.2		NA																	2	Deletion - Frameshift(1)|Insertion - Frameshift(1)		ovary(2)	ovary(1)|breast(1)	2						c.(391-396)CCACCCfs		proline rich Gla (G-carboxyglutamic acid) 1																																				SO:0001589	frameshift_variant	5638					extracellular region|integral to plasma membrane	calcium ion binding	g.chrX:37312610_37312611insC	AF009242	CCDS14239.1, CCDS55397.1	Xp21.1	2010-08-13	2004-05-27		ENSG00000130962	ENSG00000130962			9469	protein-coding gene	gene with protein product		604428	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 1"""			9256434	Standard	NM_000950		Approved	PRGP1	uc004ddo.3	O14668	OTTHUMG00000021360	ENST00000542554.1:c.401dupC	X.37:g.37312618_37312618dupC	ENSP00000444278:p.Pro132fs		Somatic				PRRG1_uc004ddo.2_Frame_Shift_Ins_p.P131fs	p.P131fs	NM_000950	NP_000941	WXS	Illumina HiSeq	Unspecified	O14668	TMG1_HUMAN			5	646_647	+			131_132			Cytoplasmic (Potential).|Poly-Pro.		B2R7A3|C9JXL7|D3DWA9|Q5JT66	Frame_Shift_Ins	INS	ENST00000542554.1	37	c.393_394insC	CCDS14239.1																																																																																				0.485	PRRG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056228.2	NM_000950		8	105	NA	NA	NA	NA	NA	8	105	---	---	---	---
USP9X	8239	broad.mit.edu	37	X	40982956	40982957	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:40982956_40982957insC	ENST00000324545.8	+	2	708_709	c.75_76insC	c.(76-78)cccfs	p.P26fs	USP9X_ENST00000378308.2_Frame_Shift_Ins_p.P26fs	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	26					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GACAGTCTCAGCCCCCCCTCCA	0.54																																					Ovarian(172;1807 2695 35459 49286)	Ovarian(172;1807 2695 35459 49286)	uc004dfb.2		NA																	0				lung(3)|breast(2)|ovary(1)	6						c.(73-78)CAGCCCfs		ubiquitin specific protease 9, X-linked isoform																																				SO:0001589	frameshift_variant	8239				BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity	g.chrX:40982956_40982957insC	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.82dupC	X.37:g.40982963_40982963dupC	ENSP00000316357:p.Pro26fs		Somatic				USP9X_uc004dfc.2_Frame_Shift_Ins_p.Q25fs	p.Q25fs	NM_001039590	NP_001034679	WXS	Illumina HiSeq	Unspecified	Q93008	USP9X_HUMAN			2	708_709	+			25_26					O75550|Q8WWT3|Q8WX12	Frame_Shift_Ins	INS	ENST00000324545.8	37	c.75_76insC	CCDS43930.1																																																																																				0.540	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652		9	138	NA	NA	NA	NA	NA	9	138	---	---	---	---
SSX9	280660	broad.mit.edu	37	X	48159107	48159108	+	RNA	INS	-	-	G	rs41305745		TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:48159107_48159108insG	ENST00000608568.1	-	0	580					NR_073393.1		Q7RTT3	SSX9_HUMAN	synovial sarcoma, X breakpoint 9						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	8						TTGGTTTTCCCGGGGGGCACAG	0.49																																							uc010nib.1		NA																	0					NA						c.(424-426)CCGfs		synovial sarcoma, X breakpoint 9																																						0							g.chrX:48159107_48159108insG	BK000689		Xp11.23	2013-01-16			ENSG00000204648	ENSG00000204648			19655	other	unknown		300544				12216073	Standard	NR_073393		Approved		uc031tjk.1	Q7RTT3	OTTHUMG00000021490		X.37:g.48159113_48159113dupG			Somatic					p.P142fs	NM_174962	NP_777622	WXS	Illumina HiSeq	Unspecified					6	512_513	-									Frame_Shift_Ins	INS	ENST00000608568.1	37	c.425_426insC																																																																																					0.490	SSX9-002	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000472372.1	NR_073393		9	344	NA	NA	NA	NA	NA	9	344	---	---	---	---
SSX3	10214	broad.mit.edu	37	X	48209462	48209463	+	Frame_Shift_Ins	INS	-	-	G	rs6651589	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:48209462_48209463insG	ENST00000298396.2	-	6	477_478	c.425_426insC	c.(424-426)ccgfs	p.P142fs	SSX3_ENST00000376895.1_Frame_Shift_Ins_p.P54fs|SSX3_ENST00000376893.3_Frame_Shift_Ins_p.P142fs	NM_021014.2	NP_066294.1	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3	142					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.P142Q(2)		endometrium(3)|large_intestine(1)|lung(9)	13						TTGGTTTTCCCGGGGGGCACAG	0.495																																					Colon(37;227 826 19399 40970 48007)	Colon(37;227 826 19399 40970 48007)	uc004djd.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(424-426)CCGfs		synovial sarcoma, X breakpoint 3 isoform a																																				SO:0001589	frameshift_variant	10214				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding	g.chrX:48209462_48209463insG	U90840	CCDS14291.1	Xp11.23	2009-06-17			ENSG00000165584	ENSG00000165584			11337	protein-coding gene	gene with protein product		300325				8697803, 9378559	Standard	NM_021014		Approved	CT5.3	uc004djd.1	Q99909	OTTHUMG00000021489	ENST00000298396.2:c.426dupC	X.37:g.48209468_48209468dupG	ENSP00000298396:p.Pro142fs		Somatic				SSX3_uc004dje.2_Frame_Shift_Ins_p.P142fs	p.P142fs	NM_021014	NP_066294	WXS	Illumina HiSeq	Unspecified	Q99909	SSX3_HUMAN			6	519_520	-			142					O60223|Q5JQZ3|Q9BRW7	Frame_Shift_Ins	INS	ENST00000298396.2	37	c.425_426insC	CCDS14291.1																																																																																				0.495	SSX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056486.1	NM_021014		8	462	NA	NA	NA	NA	NA	8	462	---	---	---	---
KIAA2022	340533	broad.mit.edu	37	X	73963268	73963269	+	Frame_Shift_Ins	INS	-	-	C			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:73963268_73963269insC	ENST00000055682.6	-	3	1734_1735	c.1123_1124insG	c.(1123-1125)gagfs	p.E375fs		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	375					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTTATCTTCCTCCCCCCAGATG	0.475																																							uc004eby.2		NA																	0				ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(1123-1125)GAGfs		hypothetical protein LOC340533																																				SO:0001589	frameshift_variant	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73963268_73963269insC		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1124dupG	X.37:g.73963274_73963274dupC	ENSP00000055682:p.Glu375fs		Somatic					p.E375fs	NM_001008537	NP_001008537	WXS	Illumina HiSeq	Unspecified	Q5QGS0	K2022_HUMAN			3	1740_1741	-			375					A7YY87|Q5JUX9|Q8IVE9	Frame_Shift_Ins	INS	ENST00000055682.6	37	c.1123_1124insG	CCDS35337.1																																																																																				0.475	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		13	642	NA	NA	NA	NA	NA	13	642	---	---	---	---
BCORL1	63035	broad.mit.edu	37	X	129146962	129146963	+	Frame_Shift_Ins	INS	-	-	G	rs141901231	byFrequency	TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:129146962_129146963insG	ENST00000218147.7	+	4	411_412	c.214_215insG	c.(214-216)cggfs	p.R72fs	BCORL1_ENST00000303743.5_Frame_Shift_Ins_p.R72fs|BCORL1_ENST00000359304.2_Frame_Shift_Ins_p.R72fs|BCORL1_ENST00000540052.1_Frame_Shift_Ins_p.R72fs			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	72					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CAGCAATGCCCGGGGGGCAGAC	0.569																																							uc004evb.1		NA																	0				ovary(4)|breast(2)|lung(1)	7						c.(214-216)CGGfs		BCL6 co-repressor-like 1																																				SO:0001589	frameshift_variant	63035				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chrX:129146962_129146963insG	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.220dupG	X.37:g.129146968_129146968dupG	ENSP00000218147:p.Arg72fs		Somatic				BCORL1_uc010nrd.1_5'UTR	p.R72fs	NM_021946	NP_068765	WXS	Illumina HiSeq	Unspecified	Q5H9F3	BCORL_HUMAN			4	328_329	+			72					B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Frame_Shift_Ins	INS	ENST00000218147.7	37	c.214_215insG	CCDS14616.1																																																																																				0.569	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		10	297	NA	NA	NA	NA	NA	10	297	---	---	---	---
GPR112	139378	broad.mit.edu	37	X	135426885	135426886	+	Frame_Shift_Ins	INS	-	-	A			TCGA-64-1678-01A-01W-0928-08	TCGA-64-1678-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	42e3b592-b57f-4b18-8f62-e7b0a9c0f1db	c705e3ce-3e8c-497a-8091-04fd4d369afd	g.chrX:135426885_135426886insA	ENST00000394143.1	+	6	1311_1312	c.1020_1021insA	c.(1021-1023)aaafs	p.K341fs	GPR112_ENST00000287534.4_Frame_Shift_Ins_p.K278fs|GPR112_ENST00000394141.1_Frame_Shift_Ins_p.K136fs|GPR112_ENST00000370652.1_Frame_Shift_Ins_p.K341fs|GPR112_ENST00000412101.1_Frame_Shift_Ins_p.K136fs	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	341					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CCAATTCCATGAAAAAAACGAA	0.386																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(1018-1023)ATGAAAfs		G-protein coupled receptor 112																																				SO:0001589	frameshift_variant	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135426885_135426886insA	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1027dupA	X.37:g.135426892_135426892dupA	ENSP00000377699:p.Lys341fs		Somatic				GPR112_uc010nsb.1_Frame_Shift_Ins_p.M135fs|GPR112_uc010nsc.1_Frame_Shift_Ins_p.M107fs	p.M340fs	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			6	1311_1312	+	Acute lymphoblastic leukemia(192;0.000127)		340_341			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Frame_Shift_Ins	INS	ENST00000394143.1	37	c.1020_1021insA	CCDS35409.1																																																																																				0.386	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			8	641	NA	NA	NA	NA	NA	8	641	---	---	---	---
