#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
SDF4	51150	broad.mit.edu	37	1	1159219	1159219	+	Silent	SNP	G	G	A	rs180689912		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr1:1159219G>A	ENST00000360001.6	-	3	718	c.456C>T	c.(454-456)gaC>gaT	p.D152D	SDF4_ENST00000545427.1_Silent_p.D152D|SDF4_ENST00000263741.7_Silent_p.D152D			Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4	152	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion-dependent exocytosis (GO:0017156)|cerebellum development (GO:0021549)|fat cell differentiation (GO:0045444)|response to ethanol (GO:0045471)|UV protection (GO:0009650)|zymogen granule exocytosis (GO:0070625)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|late endosome (GO:0005770)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)	p.D152D(2)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		TACCGTCCCCGTCAGGGTCCA	0.697													N|||	1	0.000199681	0.0008	0.0	5008	,	,		7234	0.0		0.0	False		,,,				2504	0.0						uc001adh.3		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(454-456)GAC>GAT		stromal cell derived factor 4 isoform 2							70.0	56.0	60.0					1																	1159219		2202	4297	6499	SO:0001819	synonymous_variant	51150				cerebellum development|fat cell differentiation|response to ethanol|UV protection|zymogen granule exocytosis	bleb|Golgi lumen|late endosome|soluble fraction	calcium ion binding|calcium ion binding|identical protein binding|protein binding	g.chr1:1159219G>A		CCDS12.1, CCDS30553.1	1p36.33	2013-01-10			ENSG00000078808	ENSG00000078808		"""EF-hand domain containing"""	24188	protein-coding gene	gene with protein product	"""calcium binding protein"""	614282				9254016, 8609160	Standard	NM_016176		Approved	Cab45	uc001adh.4	Q9BRK5	OTTHUMG00000001812	ENST00000360001.6:c.456C>T	1.37:g.1159219G>A			Somatic				SDF4_uc001adg.2_5'Flank|SDF4_uc001adi.3_Silent_p.D152D|SDF4_uc009vjv.2_Silent_p.D30D|SDF4_uc009vjw.2_RNA|SDF4_uc001adj.1_Silent_p.D30D	p.D152D	NM_016176	NP_057260	WXS	Illumina HiSeq	Unspecified	Q9BRK5	CAB45_HUMAN		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)	3	785	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	152			EF-hand 2.|2 (Potential).		B1AME5|B1AME6|B2RDF1|B4DSM1|Q53G52|Q53HQ9|Q8NBQ3|Q96AA1|Q9NZP7|Q9UN53	Silent	SNP	ENST00000360001.6	37	c.456C>T	CCDS30553.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	g	0.796	-0.757184	0.03019	.	.	ENSG00000078808	ENST00000403997	.	.	.	4.24	-7.54	0.01332	.	.	.	.	.	T	0.45776	0.1359	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60021	-0.7344	4	.	.	.	-33.3221	12.5708	0.56337	0.7141:0.0:0.2859:0.0	.	.	.	.	W	87	.	.	R	-	1	2	SDF4	1149082	0.046000	0.20272	0.371000	0.25978	0.038000	0.13279	-0.537000	0.06128	-1.265000	0.02449	-0.493000	0.04662	CGG		0.697	SDF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005064.1	NM_016176		7	22	0	0	0	0.001984	0	7	22				
NOL9	79707	broad.mit.edu	37	1	6610657	6610657	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr1:6610657T>A	ENST00000377705.5	-	2	447	c.415A>T	c.(415-417)Atc>Ttc	p.I139F		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	139					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)	p.I139F(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		ACACGACAGATCCCACTAAAA	0.403																																							uc001ans.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(415-417)ATC>TTC		nucleolar protein 9							66.0	67.0	66.0					1																	6610657		2203	4300	6503	SO:0001583	missense	79707				maturation of 5.8S rRNA	nucleolus	ATP binding|polynucleotide 5'-hydroxyl-kinase activity|RNA binding	g.chr1:6610657T>A	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.415A>T	1.37:g.6610657T>A	ENSP00000366934:p.Ile139Phe		Somatic				NOL9_uc010nzs.1_RNA	p.I139F	NM_024654	NP_078930	WXS	Illumina HiSeq	Unspecified	Q5SY16	NOL9_HUMAN		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)	2	434	-	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)	139					Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	c.415A>T	CCDS80.1	.	.	.	.	.	.	.	.	.	.	T	8.123	0.781374	0.16120	.	.	ENSG00000162408	ENST00000377705	T	0.49432	0.78	5.37	0.351	0.16042	.	0.712275	0.12470	N	0.466140	T	0.33847	0.0877	L	0.57536	1.79	0.09310	N	0.999998	P	0.45283	0.855	B	0.35859	0.212	T	0.17137	-1.0379	10	0.25751	T	0.34	-14.0664	5.0937	0.14721	0.0:0.1737:0.313:0.5133	.	139	Q5SY16	NOL9_HUMAN	F	139	ENSP00000366934:I139F	ENSP00000366934:I139F	I	-	1	0	NOL9	6533244	0.956000	0.32656	0.000000	0.03702	0.001000	0.01503	0.932000	0.28884	-0.091000	0.12440	-0.321000	0.08615	ATC		0.403	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654		15	108	0	0	0	0.00245	0	15	108				
ZNF687	57592	broad.mit.edu	37	1	151260444	151260444	+	Missense_Mutation	SNP	C	C	G	rs199980156		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr1:151260444C>G	ENST00000368879.2	+	2	1775	c.1677C>G	c.(1675-1677)atC>atG	p.I559M		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	559					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I559M(2)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCATGCGCATCGAGGTCACCT	0.627																																							uc001exq.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(3)|ovary(1)	4						c.(1675-1677)ATC>ATG		zinc finger protein 687							69.0	64.0	66.0					1																	151260444		2203	4300	6503	SO:0001583	missense	57592				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding	g.chr1:151260444C>G		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.1677C>G	1.37:g.151260444C>G	ENSP00000357874:p.Ile559Met		Somatic				ZNF687_uc001exp.1_Missense_Mutation_p.I568M|ZNF687_uc009wmo.2_Missense_Mutation_p.I559M|ZNF687_uc009wmp.2_Missense_Mutation_p.I559M	p.I559M	NM_020832	NP_065883	WXS	Illumina HiSeq	Unspecified	Q8N1G0	ZN687_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		2	1775	+	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		559					D3DV17|Q68DQ8|Q9H937|Q9P2A7	Missense_Mutation	SNP	ENST00000368879.2	37	c.1677C>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.66|16.66	3.183616|3.183616	0.57800|0.57800	.|.	.|.	ENSG00000143373|ENSG00000143373	ENST00000336715;ENST00000324048;ENST00000368879|ENST00000426871	T;T;T|.	0.41400|.	1.0;1.0;1.0|.	5.12|5.12	-5.61|-5.61	0.02489|0.02489	.|.	0.000000|.	0.36200|.	N|.	0.002727|.	T|T	0.39064|0.39064	0.1064|0.1064	L|L	0.58428|0.58428	1.81|1.81	0.52099|0.52099	D|D	0.99994|0.99994	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;1.0;1.0|.	T|T	0.54675|0.54675	-0.8258|-0.8258	10|5	0.66056|.	D|.	0.02|.	.|.	7.6418|7.6418	0.28298|0.28298	0.1041:0.3866:0.0:0.5093|0.1041:0.3866:0.0:0.5093	.|.	559;559;559|.	Q8N1G0-2;Q8N1G0;F8WCX2|.	.;ZN687_HUMAN;.|.	M|W	559|162	ENSP00000336620:I559M;ENSP00000319829:I559M;ENSP00000357874:I559M|.	ENSP00000319829:I559M|.	I|S	+|+	3|2	3|0	ZNF687|ZNF687	149527068|149527068	0.060000|0.060000	0.20803|0.20803	0.928000|0.928000	0.36995|0.36995	0.997000|0.997000	0.91878|0.91878	-0.536000|-0.536000	0.06135|0.06135	-0.980000|-0.980000	0.03524|0.03524	0.561000|0.561000	0.74099|0.74099	ATC|TCG		0.627	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832		63	112	0	0	0	0.01441	0	63	112				
ARHGEF2	9181	broad.mit.edu	37	1	155932776	155932776	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr1:155932776C>A	ENST00000361247.4	-	8	1022	c.923G>T	c.(922-924)gGc>gTc	p.G308V	ARHGEF2_ENST00000462460.2_Missense_Mutation_p.G353V|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.G309V|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.G307V|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.G280V|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.G280V	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	308	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.G280V(2)		breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCGGGTGCTGCCAGGGCACAG	0.597																																					Melanoma(178;35 2768 6610 28839)	Melanoma(178;35 2768 6610 28839)	uc001fmt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(922-924)GGC>GTC		Rho/Rac guanine nucleotide exchange factor 2							67.0	65.0	65.0					1																	155932776		2203	4300	6503	SO:0001583	missense	9181				actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding	g.chr1:155932776C>A	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.923G>T	1.37:g.155932776C>A	ENSP00000354837:p.Gly308Val		Somatic				ARHGEF2_uc001fmr.2_Missense_Mutation_p.G280V|ARHGEF2_uc001fms.2_Missense_Mutation_p.G307V|ARHGEF2_uc001fmu.2_Missense_Mutation_p.G352V|ARHGEF2_uc010pgt.1_Missense_Mutation_p.G281V|ARHGEF2_uc010pgu.1_Missense_Mutation_p.G353V	p.G308V	NM_001162383	NP_001155855	WXS	Illumina HiSeq	Unspecified	Q92974	ARHG2_HUMAN			8	1041	-	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		308			DH.		D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	37	c.923G>T	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.999879	0.54147	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000435736;ENST00000543433;ENST00000313667	T;T;T;T;T	0.68181	-0.31;-0.19;-0.19;-0.31;-0.31	4.93	4.02	0.46733	Dbl homology (DH) domain (5);	0.000000	0.49305	D	0.000156	T	0.55162	0.1903	M	0.62266	1.93	0.80722	D	1	P;B;B;B	0.37636	0.603;0.005;0.014;0.012	B;B;B;B	0.41764	0.366;0.114;0.016;0.043	T	0.62996	-0.6735	10	0.59425	D	0.04	-26.3336	11.5432	0.50677	0.0:0.912:0.0:0.088	.	353;352;308;307	B7Z977;D3DVA5;Q92974;Q92974-2	.;.;ARHG2_HUMAN;.	V	280;308;309;280;353;281;307	ENSP00000315325:G280V;ENSP00000354837:G308V;ENSP00000357298:G309V;ENSP00000357299:G280V;ENSP00000314787:G307V	ENSP00000314787:G307V	G	-	2	0	ARHGEF2	154199400	0.996000	0.38824	0.998000	0.56505	0.913000	0.54294	2.292000	0.43549	1.431000	0.47355	0.609000	0.83330	GGC		0.597	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723		23	151	1	0	9.95505e-16	0.014323	1.12275e-15	23	151				
PDC	5132	broad.mit.edu	37	1	186413131	186413131	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr1:186413131C>A	ENST00000391997.2	-	4	808	c.721G>T	c.(721-723)Gaa>Taa	p.E241*	PDC_ENST00000456239.2_Nonsense_Mutation_p.E189*|PDC_ENST00000497198.1_Nonsense_Mutation_p.E189*|PDC_ENST00000340129.5_Nonsense_Mutation_p.E241*	NM_002597.4	NP_002588.3	P20941	PHOS_HUMAN	phosducin	241	Thioredoxin fold. {ECO:0000250}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of catalytic activity (GO:0043086)|phototransduction (GO:0007602)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	phospholipase inhibitor activity (GO:0004859)	p.E241*(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7		Breast(1374;1.53e-05)		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)		TCTTCTTCTTCTATTTTGGTA	0.353																																							uc001gsa.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(721-723)GAA>TAA		phosducin isoform a							118.0	119.0	119.0					1																	186413131		2203	4300	6503	SO:0001587	stop_gained	5132				G-protein coupled receptor protein signaling pathway|phototransduction|visual perception	actin cytoskeleton|cytosol|nucleus|photoreceptor inner segment|photoreceptor outer segment	phospholipase inhibitor activity	g.chr1:186413131C>A	AF076464	CCDS1370.1, CCDS41447.1	1q25.2	2013-01-08			ENSG00000116703	ENSG00000116703			8759	protein-coding gene	gene with protein product		171490				8288249	Standard	NM_022576		Approved	MEKA	uc001gsa.4	P20941	OTTHUMG00000035575	ENST00000391997.2:c.721G>T	1.37:g.186413131C>A	ENSP00000375855:p.Glu241*		Somatic				PDC_uc001grz.2_Nonsense_Mutation_p.E189*	p.E241*	NM_002597	NP_002588	WXS	Illumina HiSeq	Unspecified	P20941	PHOS_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)	4	794	-		Breast(1374;1.53e-05)	241					Q14816|Q9UP22|Q9UP23	Nonsense_Mutation	SNP	ENST00000391997.2	37	c.721G>T	CCDS1370.1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160004	0.38119	.	.	ENSG00000116703	ENST00000391997;ENST00000497198;ENST00000456239;ENST00000340129	.	.	.	5.61	4.71	0.59529	.	0.240544	0.48767	D	0.000171	.	.	.	.	.	.	0.43814	D	0.996374	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.2953	14.4752	0.67541	0.0:0.9297:0.0:0.0703	.	.	.	.	X	241;189;189;241	.	ENSP00000342033:E241X	E	-	1	0	PDC	184679754	1.000000	0.71417	0.952000	0.39060	0.380000	0.30137	7.288000	0.78691	1.369000	0.46134	0.650000	0.86243	GAA		0.353	PDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086347.2	NM_022577		8	221	1	0	0.000157383	0.00308	0.000171069	8	221				
PIK3C2B	5287	broad.mit.edu	37	1	204410669	204410669	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr1:204410669T>C	ENST00000367187.3	-	22	3735	c.3179A>G	c.(3178-3180)aAt>aGt	p.N1060S	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.N1032S	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1060					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)	p.N1060S(2)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GGGGACAGCATTGGAGTTGAA	0.507																																							uc001haw.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7						c.(3178-3180)AAT>AGT		phosphoinositide-3-kinase, class 2 beta							113.0	109.0	110.0					1																	204410669		2203	4300	6503	SO:0001583	missense	5287				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding	g.chr1:204410669T>C	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.3179A>G	1.37:g.204410669T>C	ENSP00000356155:p.Asn1060Ser		Somatic				PIK3C2B_uc010pqv.1_Missense_Mutation_p.N1032S	p.N1060S	NM_002646	NP_002637	WXS	Illumina HiSeq	Unspecified	O00750	P3C2B_HUMAN	GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)		22	3658	-	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		1060					O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	c.3179A>G	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.836894	0.91117	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.80909	-1.43;-1.43	5.73	5.73	0.89815	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.87748	0.6255	L	0.56769	1.78	0.50467	D	0.999876	D;D	0.89917	1.0;0.997	D;D	0.80764	0.994;0.985	D	0.88518	0.3094	10	0.62326	D	0.03	.	15.6894	0.77439	0.0:0.0:0.0:1.0	.	1032;1060	F5GWN5;O00750	.;P3C2B_HUMAN	S	1060;1032	ENSP00000356155:N1060S;ENSP00000400561:N1032S	ENSP00000356155:N1060S	N	-	2	0	PIK3C2B	202677292	1.000000	0.71417	0.966000	0.40874	0.987000	0.75469	7.996000	0.88334	2.173000	0.68751	0.528000	0.53228	AAT		0.507	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646		16	82	0	0	0	0.006122	0	16	82				
OBSCN	84033	broad.mit.edu	37	1	228404762	228404762	+	Missense_Mutation	SNP	C	C	G	rs375281001	byFrequency	TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr1:228404762C>G	ENST00000422127.1	+	8	2470	c.2426C>G	c.(2425-2427)gCc>gGc	p.A809G	OBSCN_ENST00000570156.2_Missense_Mutation_p.A809G|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.A809G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	809	Ig-like 8.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.A809G(4)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGTGTGGATGCCGTGGCTGGG	0.647																																							uc009xez.1		NA																	4	Substitution - Missense(4)		lung(4)	stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(2425-2427)GCC>GGC		obscurin, cytoskeletal calmodulin and							27.0	35.0	33.0					1																	228404762		2128	4237	6365	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228404762C>G	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.2426C>G	1.37:g.228404762C>G	ENSP00000409493:p.Ala809Gly		Somatic				OBSCN_uc001hsn.2_Missense_Mutation_p.A809G	p.A809G	NM_001098623	NP_001092093	WXS	Illumina HiSeq	Unspecified	Q5VST9	OBSCN_HUMAN			8	2470	+		Prostate(94;0.0405)	809			Ig-like 8.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.2426C>G	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	6.158	0.397374	0.11638	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.69685	-0.42;-0.42	4.79	1.84	0.25277	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.251746	0.33572	N	0.004769	T	0.63165	0.2488	M	0.71036	2.16	0.09310	N	0.999994	P;P	0.52316	0.822;0.952	B;P	0.44811	0.423;0.461	T	0.57081	-0.7872	10	0.49607	T	0.09	.	7.1637	0.25679	0.0:0.6213:0.0:0.3787	.	809;809	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	809	ENSP00000284548:A809G;ENSP00000409493:A809G	ENSP00000284548:A809G	A	+	2	0	OBSCN	226471385	0.003000	0.15002	0.001000	0.08648	0.003000	0.03518	0.458000	0.21892	0.217000	0.20800	-0.136000	0.14681	GCC		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		6	23	0	0	0	0.00499	0	6	23				
CAPN9	10753	broad.mit.edu	37	1	230931001	230931001	+	Silent	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr1:230931001C>T	ENST00000271971.2	+	18	2076	c.1963C>T	c.(1963-1965)Ctg>Ttg	p.L655L	CAPN9_ENST00000366666.2_Silent_p.L592L|CAPN9_ENST00000480004.1_3'UTR|RP11-99J16__A.2_ENST00000428480.1_RNA|CAPN9_ENST00000354537.1_Silent_p.L629L|RP11-99J16__A.2_ENST00000412344.1_RNA|RP11-99J16__A.2_ENST00000452640.1_RNA	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	655	Domain IV.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				CCTCAACTGCCTGGTCCGGCT	0.597																																							uc001htz.1		NA																	0				ovary(1)	1						c.(1963-1965)CTG>TTG		calpain 9 isoform 1							43.0	36.0	38.0					1																	230931001		2203	4300	6503	SO:0001819	synonymous_variant	10753				digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity	g.chr1:230931001C>T	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.1963C>T	1.37:g.230931001C>T			Somatic				CAPN9_uc009xfg.1_Silent_p.L592L|CAPN9_uc001hua.1_Silent_p.L629L	p.L655L	NM_006615	NP_006606	WXS	Illumina HiSeq	Unspecified	O14815	CAN9_HUMAN			18	2076	+	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)	655			Domain IV.		B1APS1|B1AQI0|Q9NS74	Silent	SNP	ENST00000271971.2	37	c.1963C>T	CCDS1586.1																																																																																				0.597	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615		3	49	0	0	0	0.004672	0	3	49				
GATA3	2625	broad.mit.edu	37	10	8106012	8106012	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr10:8106012G>A	ENST00000346208.3	+	4	1287	c.832G>A	c.(832-834)Ggc>Agc	p.G278S	GATA3_ENST00000379328.3_Missense_Mutation_p.G279S|GATA3_ENST00000461472.1_Intron			P23771	GATA3_HUMAN	GATA binding protein 3	278					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.G279S(2)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GCGGCGAGATGGCACGGGACA	0.557			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																uc001ika.2		NA		Rec	yes		10	10p15	2625	F|N|S	GATA binding protein 3	yes	HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)	E			breast		2	Substitution - Missense(2)		lung(2)	breast(17)|ovary(3)|central_nervous_system(2)	22						c.(832-834)GGC>AGC		GATA binding protein 3 isoform 2							149.0	113.0	125.0					10																	8106012		2203	4300	6503	SO:0001583	missense	2625				aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr10:8106012G>A	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.832G>A	10.37:g.8106012G>A	ENSP00000341619:p.Gly278Ser		Somatic				GATA3_uc001ijz.2_Missense_Mutation_p.G279S	p.G278S	NM_002051	NP_002042	WXS	Illumina HiSeq	Unspecified	P23771	GATA3_HUMAN			4	1389	+			278			GATA-type 1.		Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	37	c.832G>A	CCDS7083.1	.	.	.	.	.	.	.	.	.	.	G	32	5.173328	0.94807	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.99458	-5.93;-5.93	5.39	5.39	0.77823	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (5);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	L	0.41492	1.28	0.80722	D	1	D;P	0.56746	0.977;0.575	P;B	0.61722	0.893;0.343	D	0.99901	1.1162	10	0.62326	D	0.03	-25.0866	19.165	0.93553	0.0:0.0:1.0:0.0	.	278;279	P23771;P23771-2	GATA3_HUMAN;.	S	279;278	ENSP00000368632:G279S;ENSP00000341619:G278S	ENSP00000341619:G278S	G	+	1	0	GATA3	8146018	1.000000	0.71417	0.953000	0.39169	0.649000	0.38597	9.869000	0.99810	2.519000	0.84933	0.655000	0.94253	GGC		0.557	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295		34	137	0	0	0	0.003271	0	34	137				
ITGA8	8516	broad.mit.edu	37	10	15697389	15697389	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr10:15697389C>A	ENST00000378076.3	-	11	1318	c.965G>T	c.(964-966)gGa>gTa	p.G322V		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	322					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.G322V(2)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AACGGTATATCCAAAATAAGA	0.318																																							uc001ioc.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(3)	6						c.(964-966)GGA>GTA		integrin, alpha 8 precursor							141.0	134.0	136.0					10																	15697389		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15697389C>A	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.965G>T	10.37:g.15697389C>A	ENSP00000367316:p.Gly322Val		Somatic				ITGA8_uc010qcb.1_Missense_Mutation_p.G307V	p.G322V	NM_003638	NP_003629	WXS	Illumina HiSeq	Unspecified	P53708	ITA8_HUMAN			11	965	-			322			Extracellular (Potential).|FG-GAP 5.		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.965G>T	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.694002	0.88735	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.76448	-1.02	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.93321	0.7871	H	0.97829	4.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94968	0.8114	10	0.87932	D	0	.	20.3789	0.98926	0.0:1.0:0.0:0.0	.	307;322	F5H818;P53708	.;ITA8_HUMAN	V	322;307	ENSP00000367316:G322V	ENSP00000367316:G322V	G	-	2	0	ITGA8	15737395	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	7.625000	0.83145	2.826000	0.97356	0.563000	0.77884	GGA		0.318	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		14	120	1	0	4.3838e-07	0.001855	4.87089e-07	14	120				
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	RNA	SNP	A	A	G	rs2257765		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr10:38654432A>G	ENST00000494540.1	+	0	599					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TCATCTCGCAATGCAAGGAAA	0.453																																							uc010qex.1		NA																	0					0						c.(523-525)AAT>AGT		SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);																																						158160							g.chr10:38654432A>G			10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38654432A>G			Somatic				HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Missense_Mutation_p.N173S	p.N175S			WXS	Illumina HiSeq	Unspecified					5	599	+									Missense_Mutation	SNP	ENST00000494540.1	37	c.524A>G																																																																																					0.453	HSD17B7P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000047631.2	NR_003086		4	99	0	0	0	0.009096	0	4	99				
PARG	8505	broad.mit.edu	37	10	51093329	51093329	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr10:51093329C>T	ENST00000402038.3	-	4	294	c.295G>A	c.(295-297)Gca>Aca	p.A99T		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	584	A-domain.				carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)	p.A584T(1)		endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		TGAGCTTCTGCTTCTTCAAGT	0.318																																							uc001jif.2		NA																	1	Substitution - Missense(1)		kidney(1)	ovary(2)	2						c.(1750-1752)GCA>ACA		poly (ADP-ribose) glycohydrolase							235.0	183.0	198.0					10																	51093329		692	1589	2281	SO:0001583	missense	8505				carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity	g.chr10:51093329C>T	AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.295G>A	10.37:g.51093329C>T	ENSP00000384408:p.Ala99Thr		Somatic				PARG_uc001jih.2_Missense_Mutation_p.A584T|PARG_uc001jig.2_Missense_Mutation_p.A170T|PARG_uc010qgv.1_Intron|PARG_uc009xoi.2_Intron|PARG_uc010qgw.1_Missense_Mutation_p.A475T|PARG_uc009xoj.2_Missense_Mutation_p.A135T|PARG_uc010qgx.1_Missense_Mutation_p.A502T	p.A584T	NM_003631	NP_003622	WXS	Illumina HiSeq	Unspecified	Q86W56	PARG_HUMAN		Epithelial(53;0.213)	8	2011	-			584					A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Missense_Mutation	SNP	ENST00000402038.3	37	c.1750G>A		.	.	.	.	.	.	.	.	.	.	C	12.89	2.073258	0.36566	.	.	ENSG00000227345	ENST00000402038	.	.	.	3.88	2.96	0.34315	.	.	.	.	.	T	0.46678	0.1405	M	0.61703	1.905	.	.	.	B;B;P;P;P;B	0.41947	0.002;0.003;0.574;0.766;0.766;0.006	B;B;B;B;B;B	0.38616	0.006;0.006;0.191;0.179;0.277;0.01	T	0.56631	-0.7947	7	0.18710	T	0.47	-4.0352	11.9338	0.52862	0.0:0.9123:0.0:0.0877	.	502;584;135;99;124;584	Q86W56-2;Q86W56;A5YBK3;Q5SQP4;B4DX76;Q0MQR4	.;PARG_HUMAN;.;.;.;.	T	99	.	ENSP00000384408:A99T	A	-	1	0	PARG	50763335	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.907000	0.39897	0.952000	0.37798	0.407000	0.27541	GCA		0.318	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631		4	100	0	0	0	0.009096	0	4	100				
C10orf12	26148	broad.mit.edu	37	10	98742267	98742267	+	Missense_Mutation	SNP	G	G	A	rs373519273		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr10:98742267G>A	ENST00000286067.2	+	1	1227	c.1120G>A	c.(1120-1122)Gat>Aat	p.D374N		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	374								p.D374N(2)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AGTCAGTGAAGATGTCATTTC	0.517																																							uc001kmv.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)	2						c.(1120-1122)GAT>AAT		hypothetical protein LOC26148		G	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	84.0	84.0	84.0		1120	2.8	0.4	10		84	0,8600		0,0,4300	no	missense	C10orf12	NM_015652.2	23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	374/1248	98742267	1,13005	2203	4300	6503	SO:0001583	missense	26148							g.chr10:98742267G>A	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.1120G>A	10.37:g.98742267G>A	ENSP00000286067:p.Asp374Asn		Somatic				C10orf12_uc009xvg.1_Missense_Mutation_p.D684N	p.D374N	NM_015652	NP_056467	WXS	Illumina HiSeq	Unspecified	Q8N655	CJ012_HUMAN		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)	1	1227	+		Colorectal(252;0.172)	374					Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	c.1120G>A	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	G	7.252	0.603499	0.14002	2.27E-4	0.0	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.09073	3.02	6.05	2.82	0.32997	.	0.598474	0.13669	N	0.371010	T	0.07279	0.0184	L	0.27053	0.805	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.12156	0.007;0.007	T	0.29058	-1.0024	10	0.59425	D	0.04	0.2316	11.102	0.48179	0.2285:0.0:0.7715:0.0	.	208;374	A0PJI9;Q8N655	.;CJ012_HUMAN	N	374;208	ENSP00000286067:D374N	ENSP00000286067:D374N	D	+	1	0	C10orf12	98732257	0.004000	0.15560	0.405000	0.26409	0.267000	0.26476	1.157000	0.31724	0.910000	0.36722	-0.768000	0.03414	GAT		0.517	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652		20	224	0	0	0	0.008871	0	20	224				
MUC5B	727897	broad.mit.edu	37	11	1265999	1265999	+	Missense_Mutation	SNP	T	T	C	rs371763448	byFrequency	TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr11:1265999T>C	ENST00000529681.1	+	31	7947	c.7889T>C	c.(7888-7890)cTt>cCt	p.L2630P	MUC5B_ENST00000447027.1_Missense_Mutation_p.L2633P|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2630	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.|RTL -> LTP (in Ref. 4; CAA96577). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.L2630P(1)|p.L2609P(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCACGCACGCTTCCAGTGTGG	0.637													N|||	3	0.000599042	0.0	0.0014	5008	,	,		18926	0.001		0.001	False		,,,				2504	0.0						uc009ycr.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(9802-9804)CTT>CCT		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							149.0	179.0	169.0					11																	1265999		2124	4236	6360	SO:0001583	missense	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1265999T>C	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.7889T>C	11.37:g.1265999T>C	ENSP00000436812:p.Leu2630Pro		Somatic				MUC5B_uc001ltb.2_Missense_Mutation_p.L2633P	p.L3268P	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	48	9929	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	2630	Missing (in Ref. 6; AAB61398).|RTL -> LTP (in Ref. 4; CAA96577).		7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	c.9803T>C	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	N	2.858	-0.236815	0.05944	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000537836	T;T	0.24350	1.86;2.05	1.88	-3.77	0.04346	.	.	.	.	.	T	0.15262	0.0368	L	0.33485	1.01	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.29822	-0.9999	9	0.87932	D	0	.	3.6655	0.08254	0.21:0.3112:0.0:0.4788	.	3268;2633	A7Y9J9;E9PBJ0	.;.	P	2630;2633;2602;2645;171	ENSP00000436812:L2630P;ENSP00000415793:L2633P	ENSP00000343037:L2602P	L	+	2	0	MUC5B	1222575	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.943000	0.03917	-0.876000	0.04017	0.172000	0.16884	CTT		0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		4	100	0	0	0	0.000602	0	4	100				
OR51B5	282763	broad.mit.edu	37	11	5364346	5364346	+	Missense_Mutation	SNP	T	T	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr11:5364346T>A	ENST00000300773.2	-	1	463	c.409A>T	c.(409-411)Act>Tct	p.T137S	HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	NM_001005567.2	NP_001005567.2	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B, member 5	137					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T137S(2)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	28		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTACTCGAGTATTAGTAAGT	0.458																																							uc001map.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(409-411)ACT>TCT		olfactory receptor, family 51, subfamily B,							52.0	56.0	54.0					11																	5364346		2201	4297	6498	SO:0001583	missense	282763				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5364346T>A	BK004430	CCDS31378.1	11p15.4	2012-08-09			ENSG00000242180	ENSG00000242180		"""GPCR / Class A : Olfactory receptors"""	19599	protein-coding gene	gene with protein product							Standard	NM_001005567		Approved		uc001maq.2	Q9H339	OTTHUMG00000066676	ENST00000300773.2:c.409A>T	11.37:g.5364346T>A	ENSP00000300773:p.Thr137Ser		Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Missense_Mutation_p.T137S	p.T137S	NM_001005567	NP_001005567	WXS	Illumina HiSeq	Unspecified	Q9H339	O51B5_HUMAN		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	409	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	137			Cytoplasmic (Potential).		B2RN59	Missense_Mutation	SNP	ENST00000300773.2	37	c.409A>T	CCDS31378.1	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.870516	0.00542	.	.	ENSG00000242180	ENST00000300773	T	0.36520	1.25	4.76	-8.98	0.00754	GPCR, rhodopsin-like superfamily (1);	1.100010	0.07139	N	0.846942	T	0.07683	0.0193	N	0.02129	-0.67	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.22521	-1.0214	10	0.02654	T	1	.	1.7719	0.03013	0.4474:0.2281:0.0839:0.2406	.	137	Q9H339	O51B5_HUMAN	S	137	ENSP00000300773:T137S	ENSP00000300773:T137S	T	-	1	0	OR51B5	5320922	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-6.381000	0.00068	-1.151000	0.02836	-0.262000	0.10625	ACT		0.458	OR51B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142975.1	NM_001005567		34	87	0	0	0	0.013726	0	34	87				
SF1	7536	broad.mit.edu	37	11	64534716	64534716	+	Nonsense_Mutation	SNP	G	G	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr11:64534716G>T	ENST00000377390.3	-	11	1687	c.1350C>A	c.(1348-1350)taC>taA	p.Y450*	SF1_ENST00000334944.5_Nonsense_Mutation_p.Y450*|SF1_ENST00000422298.2_Nonsense_Mutation_p.Y335*|SF1_ENST00000433274.2_Nonsense_Mutation_p.Y424*|SF1_ENST00000377394.3_Missense_Mutation_p.P452T|SF1_ENST00000377387.1_Nonsense_Mutation_p.Y575*|SF1_ENST00000227503.9_Nonsense_Mutation_p.Y450*|SF1_ENST00000489544.1_5'Flank	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	450	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.Y450*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						TACTTCCCAGGTACTGATCTT	0.542											OREG0021062	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001obb.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(1348-1350)TAC>TAA		splicing factor 1 isoform 1							139.0	120.0	127.0					11																	64534716		2201	4297	6498	SO:0001587	stop_gained	7536				nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding	g.chr11:64534716G>T	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1350C>A	11.37:g.64534716G>T	ENSP00000366607:p.Tyr450*		Somatic	OREG0021062	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1077	SF1_uc010rnm.1_Nonsense_Mutation_p.Y142*|SF1_uc010rnn.1_Nonsense_Mutation_p.Y424*|SF1_uc001oaz.1_Nonsense_Mutation_p.Y575*|SF1_uc001oba.1_Nonsense_Mutation_p.Y450*|SF1_uc001obc.1_Nonsense_Mutation_p.Y450*|SF1_uc001obd.1_Missense_Mutation_p.P452T|SF1_uc001obe.1_Missense_Mutation_p.P337T|SF1_uc010rno.1_Nonsense_Mutation_p.Y335*	p.Y450*	NM_004630	NP_004621	WXS	Illumina HiSeq	Unspecified	Q15637	SF01_HUMAN			11	1727	-			450			Pro-rich.		B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Nonsense_Mutation	SNP	ENST00000377390.3	37	c.1350C>A	CCDS31599.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	38|38|38	7.284240|7.284240|7.284240	0.98186|0.98186|0.98186	.|.|.	.|.|.	ENSG00000168066|ENSG00000168066|ENSG00000168066	ENST00000377394;ENST00000486867|ENST00000413725|ENST00000377387;ENST00000377390;ENST00000227503;ENST00000334944;ENST00000422298;ENST00000443908;ENST00000433274	T;T|.|.	0.58506|.|.	0.33;0.49|.|.	5.34|5.34|5.34	5.34|5.34|5.34	0.76211|0.76211|0.76211	.|.|.	.|.|0.000000	.|.|0.49916	.|.|D	.|.|0.000128	T|T|.	0.35508|0.35508|.	0.0934|0.0934|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	P|.|.	0.51449|.|.	0.945|.|.	P|.|.	0.56648|.|.	0.803|.|.	T|T|.	0.31752|0.31752|.	-0.9932|-0.9932|.	7|3|.	0.40728|.|0.02654	T|.|T	0.16|.|1	.|.|.	14.5526|14.5526|14.5526	0.68078|0.68078|0.68078	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	452|.|.	Q15637-6|.|.	.|.|.	T|N|X	452;170|20|575;450;450;450;335;102;424	ENSP00000366611:P452T;ENSP00000419062:P170T|.|.	ENSP00000366611:P452T|.|ENSP00000227503:Y450X	P|T|Y	-|-|-	1|2|3	0|0|2	SF1|SF1|SF1	64291292|64291292|64291292	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	5.517000|5.517000|5.517000	0.67061|0.67061|0.67061	2.516000|2.516000|2.516000	0.84829|0.84829|0.84829	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	CCT|ACC|TAC		0.542	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630		34	139	1	0	2.48696e-23	0.003271	2.9144e-23	34	139				
TULP3	7289	broad.mit.edu	37	12	3047432	3047432	+	Silent	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr12:3047432G>A	ENST00000448120.2	+	10	1227	c.1176G>A	c.(1174-1176)caG>caA	p.Q392Q	TULP3_ENST00000397132.2_Silent_p.Q392Q	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	392					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)	p.Q392Q(1)		endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			AGAACTTCCAGATAGTCCACA	0.532																																							uc010seh.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1174-1176)CAG>CAA		tubby like protein 3 isoform 1							79.0	80.0	80.0					12																	3047432		2203	4300	6503	SO:0001819	synonymous_variant	7289				G-protein coupled receptor protein signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|extracellular region|nucleus|plasma membrane	phosphatidylinositol-4,5-bisphosphate binding	g.chr12:3047432G>A	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.1176G>A	12.37:g.3047432G>A			Somatic				TULP3_uc009zec.1_Silent_p.Q119Q|TULP3_uc010seg.1_RNA|TULP3_uc001qlj.2_Silent_p.Q392Q|TULP3_uc010sei.1_Silent_p.Q216Q	p.Q392Q	NM_003324	NP_003315	WXS	Illumina HiSeq	Unspecified	O75386	TULP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000818)		10	1257	+			392					B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Silent	SNP	ENST00000448120.2	37	c.1176G>A	CCDS8519.1	.	.	.	.	.	.	.	.	.	.	g	8.548	0.874890	0.17395	.	.	ENSG00000078246	ENST00000541678;ENST00000538704	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	T	0.73814	0.3635	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73020	-0.4114	4	.	.	.	-9.706	17.7366	0.88395	0.0:0.0:1.0:0.0	.	.	.	.	N	69;58	.	.	D	+	1	0	TULP3	2917693	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.715000	0.74697	2.413000	0.81919	0.651000	0.88453	GAT		0.532	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324		5	123	0	0	0	0.001984	0	5	123				
DDX12P	440081	broad.mit.edu	37	12	9574020	9574020	+	IGR	SNP	T	T	C	rs200847155		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr12:9574020T>C								RP13-735L24.1 (23807 upstream) : SNORA75 (23633 downstream)														p.L672L(1)									ACGTGAATTCTAGCGGCTGGT	0.597																																							uc010sgs.1		NA																	1	Substitution - coding silent(1)		endometrium(1)		0						c.(2014-2016)CTA>CTG		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12							53.0	57.0	55.0					12																	9574020		692	1591	2283	SO:0001628	intergenic_variant	440081							g.chr12:9574020T>C																													12.37:g.9574020T>C			Somatic				DDX12_uc001qvx.3_5'Flank|DDX12_uc001qvy.1_5'Flank	p.L672L	NM_004400	NP_004391	WXS	Illumina HiSeq	Unspecified					20	2211	-									Silent	SNP		37	c.2016A>G																																																																																				0	0.597									4	37	0	0	0	0.001984	0	4	37				
ARID2	196528	broad.mit.edu	37	12	46246594	46246594	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr12:46246594G>C	ENST00000334344.6	+	15	4860	c.4688G>C	c.(4687-4689)aGc>aCc	p.S1563T	ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Missense_Mutation_p.S1414T|ARID2_ENST00000444670.1_Missense_Mutation_p.S1173T|ARID2_ENST00000457135.1_Missense_Mutation_p.S171T	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1563					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1563T(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GCAGATCCAAGCACTGTAGCT	0.448			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.(4687-4689)AGC>ACC		AT rich interactive domain 2 (ARID, RFX-like)							65.0	54.0	57.0					12																	46246594		2203	4300	6503	SO:0001583	missense	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46246594G>C		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4688G>C	12.37:g.46246594G>C	ENSP00000335044:p.Ser1563Thr		Somatic				ARID2_uc001ror.2_Missense_Mutation_p.S1563T|ARID2_uc009zkg.1_Missense_Mutation_p.S1019T|ARID2_uc009zkh.1_Missense_Mutation_p.S1190T|ARID2_uc001rou.1_Missense_Mutation_p.S897T	p.S1563T	NM_152641	NP_689854	WXS	Illumina HiSeq	Unspecified	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	15	4688	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	1563					Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	c.4688G>C	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109473	0.56398	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	T;T	0.46063	0.88;1.4	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.55000	0.1893	L	0.32530	0.975	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.78314	0.991;0.991;0.98	T	0.35425	-0.9789	10	0.20046	T	0.44	-7.1387	20.5407	0.99260	0.0:0.0:1.0:0.0	.	1563;1173;1563	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	T	1563;680;680;1414;1173;171	ENSP00000335044:S1563T;ENSP00000388357:S171T	ENSP00000335044:S1563T	S	+	2	0	ARID2	44532861	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.617000	0.83032	2.865000	0.98341	0.655000	0.94253	AGC		0.448	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		4	95	0	0	0	0.009096	0	4	95				
CNOT2	4848	broad.mit.edu	37	12	70704789	70704789	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr12:70704789G>A	ENST00000418359.3	+	4	614	c.163G>A	c.(163-165)Gaa>Aaa	p.E55K	CNOT2_ENST00000229195.3_Missense_Mutation_p.E55K	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	55					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)	p.E55K(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			ACATCGGTCAGAAAAAGATGT	0.393																																							uc001svv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(163-165)GAA>AAA		CCR4-NOT transcription complex, subunit 2							103.0	94.0	97.0					12																	70704789		2203	4300	6503	SO:0001583	missense	4848				nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity	g.chr12:70704789G>A	AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.163G>A	12.37:g.70704789G>A	ENSP00000412091:p.Glu55Lys		Somatic				CNOT2_uc009zro.2_Missense_Mutation_p.E55K|CNOT2_uc009zrp.2_Missense_Mutation_p.E35K|CNOT2_uc009zrq.2_Missense_Mutation_p.E55K	p.E55K	NM_014515	NP_055330	WXS	Illumina HiSeq	Unspecified	Q9NZN8	CNOT2_HUMAN	GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)		3	742	+	Renal(347;0.236)		55					Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	ENST00000418359.3	37	c.163G>A	CCDS31857.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703085	0.88924	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000550160;ENST00000551132;ENST00000552915;ENST00000552483;ENST00000550641;ENST00000548159;ENST00000549750;ENST00000551043;ENST00000547867;ENST00000550194	T;T;T;T	0.49720	0.77;0.77;0.8;0.77	6.16	6.16	0.99307	.	0.043759	0.85682	D	0.000000	T	0.39963	0.1098	L	0.29908	0.895	0.80722	D	1	B	0.31318	0.319	B	0.21917	0.037	T	0.16837	-1.0389	10	0.49607	T	0.09	-9.3824	20.8598	0.99761	0.0:0.0:1.0:0.0	.	55	Q9NZN8	CNOT2_HUMAN	K	55;55;55;55;35;55;46;35;46;55;55;46;55	ENSP00000229195:E55K;ENSP00000412091:E55K;ENSP00000449659:E46K;ENSP00000449260:E55K	ENSP00000229195:E55K	E	+	1	0	CNOT2	68991056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GAA		0.393	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1			4	112	0	0	0	0.001168	0	4	112				
UHRF1BP1L	23074	broad.mit.edu	37	12	100466570	100466570	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr12:100466570G>A	ENST00000279907.7	-	12	1641	c.1429C>T	c.(1429-1431)Cgt>Tgt	p.R477C	UHRF1BP1L_ENST00000356828.3_Missense_Mutation_p.R477C|UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.R127C	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	477								p.R477C(4)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GGGGAAGAACGACATTGTTCC	0.343																																							uc001tgq.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(1429-1431)CGT>TGT		UHRF1 (ICBP90) binding protein 1-like isoform a							80.0	86.0	84.0					12																	100466570		2203	4300	6503	SO:0001583	missense	23074							g.chr12:100466570G>A		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1429C>T	12.37:g.100466570G>A	ENSP00000279907:p.Arg477Cys		Somatic				UHRF1BP1L_uc001tgr.2_Missense_Mutation_p.R477C|UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.R127C	p.R477C	NM_015054	NP_055869	WXS	Illumina HiSeq	Unspecified	A0JNW5	UH1BL_HUMAN			12	1658	-			477					A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	37	c.1429C>T	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	G	32	5.117451	0.94385	.	.	ENSG00000111647	ENST00000279907;ENST00000545232;ENST00000356828;ENST00000548045;ENST00000551973;ENST00000550544	T;T;T;T	0.40476	2.79;2.75;1.43;1.03	5.76	5.76	0.90799	.	0.051315	0.85682	D	0.000000	T	0.64216	0.2578	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;0.995	P;P	0.62014	0.897;0.582	T	0.66035	-0.6023	10	0.87932	D	0	-8.6684	19.9658	0.97266	0.0:0.0:1.0:0.0	.	477;477	A0JNW5-2;A0JNW5	.;UH1BL_HUMAN	C	477;127;477;66;127;66	ENSP00000279907:R477C;ENSP00000444824:R127C;ENSP00000349285:R477C;ENSP00000448226:R127C	ENSP00000279907:R477C	R	-	1	0	UHRF1BP1L	98990701	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.750000	0.98875	2.721000	0.93114	0.591000	0.81541	CGT		0.343	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947		22	90	0	0	0	0.003954	0	22	90				
MYL2	4633	broad.mit.edu	37	12	111352074	111352074	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr12:111352074C>T	ENST00000228841.8	-	4	237	c.190G>A	c.(190-192)Gaa>Aaa	p.E64K	MYL2_ENST00000548438.1_Missense_Mutation_p.E50K	NM_000432.3	NP_000423.2	P10916	MLRV_HUMAN	myosin, light chain 2, regulatory, cardiac, slow	64					cardiac muscle contraction (GO:0060048)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle cell fate specification (GO:0042694)|muscle fiber development (GO:0048747)|muscle filament sliding (GO:0030049)|negative regulation of cell growth (GO:0030308)|post-embryonic development (GO:0009791)|regulation of striated muscle contraction (GO:0006942)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|myofibril (GO:0030016)|myosin complex (GO:0016459)|sarcomere (GO:0030017)	actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)	p.E64K(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	12						TCAATTTCTTCATTTTTCACG	0.468																																					GBM(14;268 426 18829 21617 25540)	GBM(14;268 426 18829 21617 25540)	uc001try.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(190-192)GAA>AAA		slow cardiac myosin regulatory light chain 2							125.0	114.0	118.0					12																	111352074		2203	4300	6503	SO:0001583	missense	4633				cardiac myofibril assembly|heart contraction|muscle filament sliding|negative regulation of cell growth|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	cytosol|myosin complex|sarcomere	actin monomer binding|calcium ion binding|myosin heavy chain binding|structural constituent of muscle	g.chr12:111352074C>T		CCDS31901.1	12q24.11	2014-09-17	2006-09-29		ENSG00000111245	ENSG00000111245		"""Myosins / Light chain"", ""EF-hand domain containing"""	7583	protein-coding gene	gene with protein product	"""cardiac ventricular myosin light chain 2"""	160781	"""myosin, light polypeptide 2, regulatory, cardiac, slow"""			1386340	Standard	NM_000432		Approved	CMH10	uc001try.4	P10916	OTTHUMG00000169535	ENST00000228841.8:c.190G>A	12.37:g.111352074C>T	ENSP00000228841:p.Glu64Lys		Somatic				MYL2_uc001trx.3_Missense_Mutation_p.E45K	p.E64K	NM_000432	NP_000423	WXS	Illumina HiSeq	Unspecified	P10916	MLRV_HUMAN			4	261	-			64					Q16123	Missense_Mutation	SNP	ENST00000228841.8	37	c.190G>A	CCDS31901.1	.	.	.	.	.	.	.	.	.	.	C	31	5.062210	0.93846	.	.	ENSG00000111245	ENST00000228841;ENST00000548438;ENST00000550439	T;T	0.79554	-1.28;-1.28	4.88	4.88	0.63580	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.82259	0.4998	L	0.46614	1.455	0.80722	D	1	P	0.45672	0.864	P	0.51229	0.663	T	0.82139	-0.0605	10	0.40728	T	0.16	.	16.7959	0.85602	0.0:1.0:0.0:0.0	.	64	P10916	MLRV_HUMAN	K	64;50;45	ENSP00000228841:E64K;ENSP00000447154:E50K	ENSP00000228841:E64K	E	-	1	0	MYL2	109836457	1.000000	0.71417	0.989000	0.46669	0.990000	0.78478	7.161000	0.77505	2.270000	0.75569	0.561000	0.74099	GAA		0.468	MYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404677.2	NM_000432		9	89	0	0	0	0.004482	0	9	89				
GOLGA3	2802	broad.mit.edu	37	12	133381541	133381541	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr12:133381541A>C	ENST00000450791.2	-	6	1541	c.1358T>G	c.(1357-1359)gTg>gGg	p.V453G	GOLGA3_ENST00000537452.1_Missense_Mutation_p.V453G|GOLGA3_ENST00000204726.3_Missense_Mutation_p.V453G|GOLGA3_ENST00000545875.1_Missense_Mutation_p.V453G|GOLGA3_ENST00000456883.2_Missense_Mutation_p.V453G			Q08378	GOGA3_HUMAN	golgin A3	453					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GCTGCACTCCACCTGCGCCTG	0.597																																							uc001ukz.1		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(1357-1359)GTG>GGG		Golgi autoantigen, golgin subfamily a, 3							34.0	33.0	33.0					12																	133381541		2198	4292	6490	SO:0001583	missense	2802				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity	g.chr12:133381541A>C	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.1358T>G	12.37:g.133381541A>C	ENSP00000410378:p.Val453Gly		Somatic				GOLGA3_uc001ula.1_Missense_Mutation_p.V453G|GOLGA3_uc001ulb.2_Missense_Mutation_p.V453G	p.V453G	NM_005895	NP_005886	WXS	Illumina HiSeq	Unspecified	Q08378	GOGA3_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)	7	1917	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)	453			Potential.		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	c.1358T>G	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	A	11.01	1.514085	0.27123	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	5.31	2.86	0.33363	.	0.398948	0.28538	N	0.014994	T	0.62974	0.2472	N	0.24115	0.695	0.80722	D	1	B;B;B	0.32573	0.328;0.328;0.376	B;B;B	0.36766	0.232;0.079;0.156	T	0.53027	-0.8496	10	0.34782	T	0.22	.	6.5977	0.22683	0.7861:0.0:0.0783:0.1356	.	453;453;453	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	G	453	ENSP00000204726:V453G;ENSP00000410378:V453G;ENSP00000409303:V453G;ENSP00000442143:V453G;ENSP00000442603:V453G	ENSP00000204726:V453G	V	-	2	0	GOLGA3	131891614	0.145000	0.22656	0.898000	0.35279	0.742000	0.42306	1.063000	0.30567	0.285000	0.22329	0.459000	0.35465	GTG		0.597	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895		7	27	0	0	0	0.006122	0	7	27				
PDS5B	23047	broad.mit.edu	37	13	33225967	33225967	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr13:33225967G>A	ENST00000315596.10	+	3	321	c.135G>A	c.(133-135)atG>atA	p.M45I		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	45					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.M45I(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TTATGGATATGGACCAGGACT	0.318																																							uc010abf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|pancreas(1)	4						c.(133-135)ATG>ATA		PDS5, regulator of cohesion maintenance, homolog							78.0	77.0	77.0					13																	33225967		1813	4066	5879	SO:0001583	missense	23047				cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding	g.chr13:33225967G>A	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.135G>A	13.37:g.33225967G>A	ENSP00000313851:p.Met45Ile		Somatic				PDS5B_uc001uun.2_Missense_Mutation_p.M45I|PDS5B_uc001uuo.2_Missense_Mutation_p.M45I|PDS5B_uc010abg.2_RNA	p.M45I	NM_015032	NP_055847	WXS	Illumina HiSeq	Unspecified	Q9NTI5	PDS5B_HUMAN		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)	3	293	+		Lung SC(185;0.0367)	45					Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	37	c.135G>A	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	G	32	5.186583	0.94885	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	T	0.67865	-0.29	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	M	0.72894	2.215	0.80722	D	1	D;D;D	0.65815	0.995;0.988;0.976	D;D;D	0.81914	0.995;0.981;0.98	T	0.75411	-0.3327	10	0.22109	T	0.4	-3.5561	19.961	0.97250	0.0:0.0:1.0:0.0	.	45;45;45	Q9NTI5;Q9NTI5-3;Q9NTI5-4	PDS5B_HUMAN;.;.	I	45	ENSP00000313851:M45I	ENSP00000313851:M45I	M	+	3	0	PDS5B	32123967	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.655000	0.98512	2.783000	0.95769	0.655000	0.94253	ATG		0.318	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032		13	210	0	0	0	0.013537	0	13	210				
RCBTB2	1102	broad.mit.edu	37	13	49076005	49076005	+	Splice_Site	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr13:49076005C>T	ENST00000344532.3	-	12	1541		c.e12-1		RCBTB2_ENST00000430805.2_Splice_Site|RCBTB2_ENST00000544492.1_Splice_Site	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2						positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.?(1)		breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		TCATCAGGTTCTAGGAGAATA	0.433																																							uc001vch.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|lung(2)|skin(1)	5						c.e12-1		regulator of chromosome condensation and BTB							69.0	61.0	64.0					13																	49076005		2203	4300	6503	SO:0001630	splice_region_variant	1102						Ran guanyl-nucleotide exchange factor activity	g.chr13:49076005C>T	AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.1118-1G>A	13.37:g.49076005C>T			Somatic				RCBTB2_uc010tgg.1_Splice_Site_p.E378_splice|RCBTB2_uc001vci.2_Splice_Site_p.E349_splice|RCBTB2_uc010tgh.1_Splice_Site_p.E99_splice|RCBTB2_uc001vcj.2_Splice_Site_p.E325_splice|RCBTB2_uc010acv.1_Splice_Site	p.E373_splice	NM_001268	NP_001259	WXS	Illumina HiSeq	Unspecified	O95199	RCBT2_HUMAN		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)	12	1489	-		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)						B2RDW8	Splice_Site	SNP	ENST00000344532.3	37	c.1118_splice	CCDS9411.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971390	0.74246	.	.	ENSG00000136161	ENST00000344532;ENST00000450343;ENST00000452987;ENST00000430805;ENST00000544492	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3241	0.94254	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RCBTB2	47974006	1.000000	0.71417	0.999000	0.59377	0.719000	0.41307	7.040000	0.76551	2.629000	0.89072	0.563000	0.77884	.		0.433	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044888.2	NM_001268	Intron	4	63	0	0	0	0.009096	0	4	63				
ADAM21	8747	broad.mit.edu	37	14	70924778	70924778	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr14:70924778G>C	ENST00000603540.1	+	2	820	c.562G>C	c.(562-564)Gaa>Caa	p.E188Q	ADAM21_ENST00000267499.3_Missense_Mutation_p.E188Q|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	188					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E188Q(4)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GTTGGAATTTGAAGAGGCTGA	0.438																																							uc001xmd.2		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(1)|skin(1)	2						c.(562-564)GAA>CAA		ADAM metallopeptidase domain 21 preproprotein							64.0	68.0	66.0					14																	70924778		2203	4300	6503	SO:0001583	missense	8747				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr14:70924778G>C	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.562G>C	14.37:g.70924778G>C	ENSP00000474385:p.Glu188Gln		Somatic					p.E188Q	NM_003813	NP_003804	WXS	Illumina HiSeq	Unspecified	Q9UKJ8	ADA21_HUMAN		all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)	1	562	+			188					O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	c.562G>C	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.211374	0.00024	.	.	ENSG00000139985	ENST00000267499	T	0.01178	5.22	3.86	-1.56	0.08532	.	0.767098	0.11023	U	0.608220	T	0.00637	0.0021	N	0.11789	0.175	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.46359	-0.9197	10	0.02654	T	1	.	5.5833	0.17262	0.4228:0.1388:0.4383:0.0	.	188	Q9UKJ8	ADA21_HUMAN	Q	188	ENSP00000267499:E188Q	ENSP00000267499:E188Q	E	+	1	0	ADAM21	69994531	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.761000	0.04751	-0.181000	0.10619	0.557000	0.71058	GAA		0.438	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3			13	124	0	0	0	0.001855	0	13	124				
AHNAK2	113146	broad.mit.edu	37	14	105412632	105412632	+	Silent	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr14:105412632G>A	ENST00000333244.5	-	7	9275	c.9156C>T	c.(9154-9156)ccC>ccT	p.P3052P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3052						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P3052P(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CAGCTCCCTCGGGAACGTGGC	0.607																																							uc010axc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(9154-9156)CCC>CCT		AHNAK nucleoprotein 2							107.0	112.0	110.0					14																	105412632		1929	4107	6036	SO:0001819	synonymous_variant	113146					nucleus		g.chr14:105412632G>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9156C>T	14.37:g.105412632G>A			Somatic				AHNAK2_uc001ypx.2_Silent_p.P2952P	p.P3052P	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	9276	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	3052					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	c.9156C>T	CCDS45177.1																																																																																				0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		31	205	0	0	0	0.010818	0	31	205				
OR4N3P	390539	broad.mit.edu	37	15	22414053	22414053	+	IGR	SNP	C	C	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr15:22414053C>A								RP11-69H14.6 (30245 upstream) : RP11-2F9.4 (19836 downstream)																							GGTGGAGCTTCTGATGGTCTT	0.507																																							uc001yuf.2		NA																	0					0						c.(352-354)CTG>ATG		RecName: Full=Olfactory receptor 4N2; AltName: Full=Olfactory receptor OR14-8; AltName: Full=Olfactory receptor OR14-13;																																				SO:0001628	intergenic_variant	390539							g.chr15:22414053C>A																													15.37:g.22414053C>A			Somatic					p.L118M	NM_001080841	NP_001074310	WXS	Illumina HiSeq	Unspecified					1	352	+									Missense_Mutation	SNP		37	c.352C>A																																																																																				0	0.507									8	303	1	0	3.07112e-06	0.010729	3.38726e-06	8	303				
NPAP1	23742	broad.mit.edu	37	15	24922679	24922679	+	Silent	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr15:24922679C>T	ENST00000329468.2	+	1	2139	c.1665C>T	c.(1663-1665)tcC>tcT	p.S555S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	555					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S555S(1)									CAGTCATTTCCACTGTCACAA	0.488																																							uc001ywo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(1663-1665)TCC>TCT		hypothetical protein LOC23742							169.0	156.0	160.0					15																	24922679		2203	4300	6503	SO:0001819	synonymous_variant	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24922679C>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1665C>T	15.37:g.24922679C>T			Somatic					p.S555S	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	2139	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	555						Silent	SNP	ENST00000329468.2	37	c.1665C>T	CCDS10015.1																																																																																				0.488	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		13	247	0	0	0	0.003163	0	13	247				
AQR	9716	broad.mit.edu	37	15	35198842	35198842	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr15:35198842G>A	ENST00000156471.5	-	18	1960	c.1735C>T	c.(1735-1737)Cgg>Tgg	p.R579W		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	579					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GGTCTCCTCCGGTCAAACTTA	0.408																																							uc001ziv.2		NA																	0				large_intestine(1)	1						c.(1735-1737)CGG>TGG		aquarius							124.0	114.0	117.0					15																	35198842		1914	4153	6067	SO:0001583	missense	9716					catalytic step 2 spliceosome	RNA binding	g.chr15:35198842G>A	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1735C>T	15.37:g.35198842G>A	ENSP00000156471:p.Arg579Trp		Somatic					p.R579W	NM_014691	NP_055506	WXS	Illumina HiSeq	Unspecified	O60306	AQR_HUMAN		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)	18	1916	-		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)	579					A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	c.1735C>T	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.851188	0.71719	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93763	-3.28	5.39	4.45	0.53987	.	0.000000	0.85682	D	0.000000	D	0.94315	0.8173	M	0.75447	2.3	0.44073	D	0.996827	D	0.61080	0.989	P	0.50860	0.652	D	0.94109	0.7369	10	0.59425	D	0.04	-14.7644	14.0725	0.64868	0.0:0.0:0.6327:0.3673	.	579	O60306	AQR_HUMAN	W	579	ENSP00000156471:R579W	ENSP00000156471:R579W	R	-	1	2	AQR	32986134	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.661000	0.54503	1.210000	0.43336	0.591000	0.81541	CGG		0.408	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691		4	147	0	0	0	0.009096	0	4	147				
LMAN1L	79748	broad.mit.edu	37	15	75115013	75115013	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr15:75115013G>A	ENST00000309664.5	+	11	1301	c.1162G>A	c.(1162-1164)Gga>Aga	p.G388R	LMAN1L_ENST00000379709.3_Missense_Mutation_p.G376R|RP11-414J4.2_ENST00000564823.1_RNA	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	388						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.G388R(2)		NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCTGCTCCATGGACAGTGGAC	0.607																																							uc002ayt.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1162-1164)GGA>AGA		lectin, mannose-binding, 1 like precursor							53.0	52.0	53.0					15																	75115013		2197	4296	6493	SO:0001583	missense	79748					ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding	g.chr15:75115013G>A	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.1162G>A	15.37:g.75115013G>A	ENSP00000310431:p.Gly388Arg		Somatic				LMAN1L_uc010bke.1_Missense_Mutation_p.G376R	p.G388R	NM_021819	NP_068591	WXS	Illumina HiSeq	Unspecified	Q9HAT1	LMA1L_HUMAN			11	1164	+			388			Lumenal (Potential).		Q6UWN2	Missense_Mutation	SNP	ENST00000309664.5	37	c.1162G>A	CCDS10270.1	.	.	.	.	.	.	.	.	.	.	G	8.181	0.793755	0.16327	.	.	ENSG00000140506	ENST00000309664;ENST00000379709	T;T	0.39997	1.14;1.05	4.85	3.94	0.45596	.	1.257090	0.05894	N	0.628735	T	0.38639	0.1048	L	0.35854	1.095	0.38457	D	0.947106	B;B	0.27498	0.18;0.113	B;B	0.31442	0.13;0.061	T	0.14364	-1.0475	10	0.45353	T	0.12	.	9.3656	0.38223	0.0978:0.0:0.9022:0.0	.	376;388	Q9HAT1-3;Q9HAT1	.;LMA1L_HUMAN	R	388;376	ENSP00000310431:G388R;ENSP00000369031:G376R	ENSP00000310431:G388R	G	+	1	0	LMAN1L	72902066	0.992000	0.36948	0.866000	0.34008	0.037000	0.13140	2.681000	0.46926	1.420000	0.47138	0.462000	0.41574	GGA		0.607	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286397.4			19	114	0	0	0	0.007413	0	19	114				
MAN2A2	4122	broad.mit.edu	37	15	91449666	91449666	+	Silent	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr15:91449666C>G	ENST00000559717.1	+	6	1233	c.774C>G	c.(772-774)tcC>tcG	p.S258S	MAN2A2_ENST00000360468.3_Silent_p.S258S|MAN2A2_ENST00000431652.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	258					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.S258S(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			AGGCCAATTCCCACTACTTTG	0.572																																							uc010bnz.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(2)|ovary(1)	3						c.(772-774)TCC>TCG		mannosidase, alpha, class 2A, member 2							130.0	117.0	122.0					15																	91449666		2198	4298	6496	SO:0001819	synonymous_variant	4122				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding	g.chr15:91449666C>G	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.774C>G	15.37:g.91449666C>G			Somatic				MAN2A2_uc010boa.2_Silent_p.S300S|MAN2A2_uc002bqc.2_Silent_p.S258S|MAN2A2_uc010uql.1_5'Flank|MAN2A2_uc010uqm.1_5'Flank	p.S258S	NM_006122	NP_006113	WXS	Illumina HiSeq	Unspecified	P49641	MA2A2_HUMAN	Lung(145;0.229)		6	889	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		258			Lumenal (Potential).		A6NH12|A8K1E8|Q13754	Silent	SNP	ENST00000559717.1	37	c.774C>G	CCDS32332.1																																																																																				0.572	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122		23	105	0	0	0	0.00278	0	23	105				
RHBDL1	9028	broad.mit.edu	37	16	726739	726739	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr16:726739A>G	ENST00000219551.2	+	2	491	c.464A>G	c.(463-465)gAc>gGc	p.D155G	LA16c-313D11.9_ENST00000567091.1_RNA|LA16c-313D11.9_ENST00000571933.1_RNA|RHBDL1_ENST00000352681.3_Missense_Mutation_p.D90G			O75783	RHBL1_HUMAN	rhomboid, veinlet-like 1 (Drosophila)	155					signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.D155G(1)		endometrium(1)|kidney(1)|lung(4)|urinary_tract(3)	9		Hepatocellular(780;0.0218)				CTGCCCCGGGACGGGCCGCTG	0.647																																							uc002cis.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(463-465)GAC>GGC		rhomboid protease 1							74.0	69.0	70.0					16																	726739		2201	4298	6499	SO:0001583	missense	9028				proteolysis|signal transduction	integral to plasma membrane|membrane fraction	calcium ion binding|serine-type endopeptidase activity	g.chr16:726739A>G	Y17108	CCDS61779.1	16p13.3	2008-02-05	2001-11-28	2003-04-11	ENSG00000103269	ENSG00000103269			10007	protein-coding gene	gene with protein product		603264	"""rhomboid (veinlet, Drosophila)-like"""	RHBDL		9662444	Standard	NM_001278720		Approved	RRP	uc002cis.1	O75783	OTTHUMG00000121141	ENST00000219551.2:c.464A>G	16.37:g.726739A>G	ENSP00000219551:p.Asp155Gly		Somatic				RHBDL1_uc002cir.1_Missense_Mutation_p.D90G|RHBDL1_uc010uun.1_Missense_Mutation_p.D90G	p.D155G	NM_003961	NP_003952	WXS	Illumina HiSeq	Unspecified	O75783	RHBL1_HUMAN			2	491	+		Hepatocellular(780;0.0218)	155					A2IDC0|A2IDC1|Q0VAX4|Q9NQ85	Missense_Mutation	SNP	ENST00000219551.2	37	c.464A>G	CCDS10418.1	.	.	.	.	.	.	.	.	.	.	A	9.531	1.110785	0.20714	.	.	ENSG00000103269	ENST00000352681;ENST00000450775;ENST00000219551	T;T	0.32272	1.51;1.46	3.91	2.79	0.32731	.	0.209082	0.39210	N	0.001433	T	0.15349	0.0370	N	0.14661	0.345	0.44469	D	0.997407	B;B;B	0.31968	0.349;0.349;0.332	B;B;B	0.26094	0.059;0.059;0.066	T	0.08006	-1.0743	10	0.32370	T	0.25	-21.9448	9.3132	0.37919	0.8181:0.1819:0.0:0.0	.	90;155;90	B4DFK3;O75783;O75783-2	.;RHBL1_HUMAN;.	G	90;90;155	ENSP00000344206:D90G;ENSP00000219551:D155G	ENSP00000219551:D155G	D	+	2	0	RHBDL1	666740	0.992000	0.36948	0.990000	0.47175	0.974000	0.67602	3.285000	0.51716	0.547000	0.28938	0.379000	0.24179	GAC		0.647	RHBDL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241619.1	NM_003961		31	140	0	0	0	0.003755	0	31	140				
GRIN2A	2903	broad.mit.edu	37	16	9858028	9858028	+	Nonsense_Mutation	SNP	C	C	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr16:9858028C>A	ENST00000396573.2	-	14	3682	c.3373G>T	c.(3373-3375)Gag>Tag	p.E1125*	GRIN2A_ENST00000404927.2_Nonsense_Mutation_p.E1125*|GRIN2A_ENST00000562109.1_Nonsense_Mutation_p.E1125*|GRIN2A_ENST00000330684.3_Nonsense_Mutation_p.E1125*|GRIN2A_ENST00000396575.2_Nonsense_Mutation_p.E1125*|GRIN2A_ENST00000535259.1_Nonsense_Mutation_p.E968*	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1125					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.E1125*(2)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AAACCAGGCTCCTTCTCACCA	0.507																																							uc002czo.3		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(3373-3375)GAG>TAG		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						134.0	133.0	133.0					16																	9858028		2197	4300	6497	SO:0001587	stop_gained	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9858028C>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3373G>T	16.37:g.9858028C>A	ENSP00000379818:p.Glu1125*		Somatic				GRIN2A_uc010uym.1_Nonsense_Mutation_p.E1125*|GRIN2A_uc010uyn.1_Nonsense_Mutation_p.E968*|GRIN2A_uc002czr.3_Nonsense_Mutation_p.E1125*	p.E1125*	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			13	3921	-			1125			Cytoplasmic (Potential).		O00669|Q17RZ6	Nonsense_Mutation	SNP	ENST00000396573.2	37	c.3373G>T	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	39	7.460809	0.98299	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	.	.	.	5.42	5.42	0.78866	.	0.049289	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2268	0.89920	0.0:1.0:0.0:0.0	.	.	.	.	X	1125;1125;968;1125;1125	.	.	E	-	1	0	GRIN2A	9765529	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	4.324000	0.59228	2.543000	0.85770	0.650000	0.86243	GAG		0.507	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			33	369	1	0	1.42033e-22	0.004289	1.65155e-22	33	369				
DNAH3	55567	broad.mit.edu	37	16	20996932	20996932	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr16:20996932C>G	ENST00000261383.3	-	48	7131	c.7132G>C	c.(7132-7134)Gag>Cag	p.E2378Q	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2378					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.E2378Q(4)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TCAGTGATCTCATCGTAGATT	0.443																																							uc010vbe.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(7132-7134)GAG>CAG		dynein, axonemal, heavy chain 3							143.0	129.0	134.0					16																	20996932		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:20996932C>G	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7132G>C	16.37:g.20996932C>G	ENSP00000261383:p.Glu2378Gln		Somatic				DNAH3_uc010vbd.1_5'Flank	p.E2378Q	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	48	7132	-			2378					O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.7132G>C	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051223	0.75960	.	.	ENSG00000158486	ENST00000261383	T	0.26957	1.7	4.79	4.79	0.61399	.	0.187921	0.36066	N	0.002803	T	0.53965	0.1829	M	0.88450	2.955	0.80722	D	1	D	0.61697	0.99	P	0.58391	0.838	T	0.63001	-0.6734	10	0.48119	T	0.1	.	18.2085	0.89863	0.0:1.0:0.0:0.0	.	2378	Q8TD57	DYH3_HUMAN	Q	2378	ENSP00000261383:E2378Q	ENSP00000261383:E2378Q	E	-	1	0	DNAH3	20904433	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.741000	0.84997	2.381000	0.81170	0.655000	0.94253	GAG		0.443	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		13	279	0	0	0	0.001855	0	13	279				
NPIPB6	728741	broad.mit.edu	37	16	28354463	28354463	+	Missense_Mutation	SNP	T	T	C	rs372413321		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr16:28354463T>C	ENST00000532254.1	-	7	1428	c.743A>G	c.(742-744)tAc>tGc	p.Y248C	NPIPB6_ENST00000533640.1_Missense_Mutation_p.Y230C	NM_001282524.1	NP_001269453.1	E9PJ23	NPIB6_HUMAN	nuclear pore complex interacting protein family, member B6	248																	GTAGGGCCAGTAGGGCAATCC	0.478																																							uc010vcq.1		NA																	0					NA						c.(688-690)TAC>TGC		SubName: Full=LOC728741 protein;																																				SO:0001583	missense	0							g.chr16:28354463T>C		CCDS61892.1	16p11.2	2013-06-11			ENSG00000198156	ENSG00000198156			37454	protein-coding gene	gene with protein product							Standard	XM_005255741		Approved			E9PJ23	OTTHUMG00000166319	ENST00000532254.1:c.743A>G	16.37:g.28354463T>C	ENSP00000431871:p.Tyr248Cys		Somatic				uc010vcr.1_Missense_Mutation_p.Y248C	p.Y230C			WXS	Illumina HiSeq	Unspecified					7	742	-									Missense_Mutation	SNP	ENST00000532254.1	37	c.689A>G		.	.	.	.	.	.	.	.	.	.	-	1.282	-0.610091	0.03690	.	.	ENSG00000198156	ENST00000533640;ENST00000532254	T;T	0.56611	0.45;0.45	0.167	0.167	0.15006	.	.	.	.	.	T	0.43255	0.1239	L	0.51422	1.61	0.09310	N	1	B;B	0.19200	0.034;0.024	B;B	0.22152	0.022;0.038	T	0.40496	-0.9560	8	0.49607	T	0.09	.	.	.	.	.	248;230	E9PJ23;E9PS57	.;.	C	230;248	ENSP00000435924:Y230C;ENSP00000431871:Y248C	ENSP00000431871:Y248C	Y	-	2	0	RP11-57A19.3	28261964	0.001000	0.12720	0.029000	0.17559	0.030000	0.12068	-0.992000	0.03724	0.237000	0.21200	0.234000	0.17832	TAC		0.478	NPIPB6-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389133.1	XM_001717652		5	116	0	0	0	0.00308	0	5	116				
C16orf58	64755	broad.mit.edu	37	16	31502203	31502203	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr16:31502203C>G	ENST00000327237.2	-	13	1399	c.1360G>C	c.(1360-1362)Gag>Cag	p.E454Q	AC026471.6_ENST00000565137.1_RNA|C16orf58_ENST00000567994.1_Missense_Mutation_p.E409Q|C16orf58_ENST00000570164.1_Missense_Mutation_p.E452Q			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	454						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.E454Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						GCCCTCCACTCATCCACCTCT	0.607																																							uc002eci.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1360-1362)GAG>CAG		hypothetical protein LOC64755							96.0	82.0	87.0					16																	31502203		2197	4300	6497	SO:0001583	missense	64755					integral to membrane		g.chr16:31502203C>G	AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.1360G>C	16.37:g.31502203C>G	ENSP00000317579:p.Glu454Gln		Somatic				C16orf58_uc002ecg.2_5'Flank|C16orf58_uc002ech.1_Missense_Mutation_p.E192Q	p.E454Q	NM_022744	NP_073581	WXS	Illumina HiSeq	Unspecified	Q96GQ5	CP058_HUMAN			13	1372	-			454					Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Missense_Mutation	SNP	ENST00000327237.2	37	c.1360G>C	CCDS10715.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428204	0.83667	.	.	ENSG00000140688	ENST00000327237;ENST00000452223	T	0.48201	0.82	5.7	5.7	0.88788	.	0.097389	0.64402	D	0.000002	T	0.62877	0.2464	L	0.56769	1.78	0.80722	D	1	P;D	0.76494	0.861;0.999	B;D	0.74674	0.391;0.984	T	0.55661	-0.8106	10	0.22109	T	0.4	-10.7607	15.3472	0.74346	0.0:1.0:0.0:0.0	.	454;192	Q96GQ5;Q96GQ5-2	CP058_HUMAN;.	Q	454;408	ENSP00000317579:E454Q	ENSP00000317579:E454Q	E	-	1	0	C16orf58	31409704	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	3.001000	0.49488	2.688000	0.91661	0.655000	0.94253	GAG		0.607	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255629.2	NM_022744		9	181	0	0	0	0.006214	0	9	181				
UBBP4	23666	broad.mit.edu	37	17	21730847	21730847	+	Missense_Mutation	SNP	G	G	T	rs570609187	byFrequency	TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr17:21730847G>T	ENST00000578713.1	+	1	153	c.149G>T	c.(148-150)cGg>cTg	p.R50L	UBBP4_ENST00000583708.1_Intron|UBBP4_ENST00000584755.1_Missense_Mutation_p.R50L|UBBP4_ENST00000584398.1_Intron					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						GGCAAGCAGCGGGAAGATGGC	0.522													.|||	3	0.000599042	0.0008	0.0	5008	,	,		21142	0.002		0.0	False		,,,				2504	0.0						uc002gyy.3		NA																	0					NA						c.(148-150)CGG>CTG		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001583	missense	0							g.chr17:21730847G>T	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.149G>T	17.37:g.21730847G>T	ENSP00000464265:p.Arg50Leu		Somatic					p.R50L			WXS	Illumina HiSeq	Unspecified					2	274	+									Missense_Mutation	SNP	ENST00000578713.1	37	c.149G>T																																																																																					0.522	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444589.2			3	49	1	0	0.004672	0.004672	0.00500571	3	49				
CDK12	51755	broad.mit.edu	37	17	37619172	37619172	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr17:37619172C>T	ENST00000447079.4	+	1	881	c.848C>T	c.(847-849)tCg>tTg	p.S283L	CDK12_ENST00000430627.2_Missense_Mutation_p.S283L	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	283					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.S283L(2)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						AAGGAGCCTTCGGCCTACCAG	0.552			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													uc010cvv.2		NA		Rec	yes		17	17q12	51755		cyclin-dependent kinase 12			E					2	Substitution - Missense(2)		lung(2)	ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						c.(847-849)TCG>TTG		Cdc2-related kinase, arginine/serine-rich							61.0	63.0	62.0					17																	37619172		2203	4300	6503	SO:0001583	missense	51755				mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr17:37619172C>T	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.848C>T	17.37:g.37619172C>T	ENSP00000398880:p.Ser283Leu	TCGA Ovarian(9;0.13)	Somatic				CDK12_uc010wef.1_Missense_Mutation_p.S283L|CDK12_uc002hrw.3_Missense_Mutation_p.S283L	p.S283L	NM_016507	NP_057591	WXS	Illumina HiSeq	Unspecified	Q9NYV4	CDK12_HUMAN			1	1434	+			283					A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	c.848C>T	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.381091	0.61845	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.41758	0.99;1.55	5.3	5.3	0.74995	.	0.000000	0.42821	D	0.000646	T	0.45155	0.1328	N	0.22421	0.69	0.32278	N	0.567936	D;D;D	0.71674	0.985;0.998;0.989	P;D;P	0.66602	0.535;0.945;0.791	T	0.44513	-0.9323	10	0.18710	T	0.47	-7.3771	12.7648	0.57386	0.0:0.915:0.0:0.085	.	283;283;283	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	L	283	ENSP00000407720:S283L;ENSP00000398880:S283L	ENSP00000407720:S283L	S	+	2	0	CDK12	34872698	0.598000	0.26882	0.986000	0.45419	0.998000	0.95712	1.497000	0.35649	2.490000	0.84030	0.655000	0.94253	TCG		0.552	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507		13	149	0	0	0	0.00245	0	13	149				
MTMR4	9110	broad.mit.edu	37	17	56573109	56573109	+	Missense_Mutation	SNP	C	C	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr17:56573109C>A	ENST00000323456.5	-	16	2518	c.2394G>T	c.(2392-2394)atG>atT	p.M798I	MTMR4_ENST00000579925.1_Missense_Mutation_p.M741I	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	798					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.M798I(2)		breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCACACCTAGCATGGAGTCTG	0.527																																							uc002iwj.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(2392-2394)ATG>ATT		myotubularin related protein 4							121.0	117.0	118.0					17																	56573109		2203	4300	6503	SO:0001583	missense	9110					cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity	g.chr17:56573109C>A	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.2394G>T	17.37:g.56573109C>A	ENSP00000325285:p.Met798Ile		Somatic					p.M798I	NM_004687	NP_004678	WXS	Illumina HiSeq	Unspecified	Q9NYA4	MTMR4_HUMAN			16	2504	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		798					D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	37	c.2394G>T	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.410288	0.01145	.	.	ENSG00000108389	ENST00000323456	D	0.92495	-3.05	4.81	3.79	0.43588	.	4.134150	0.00166	N	0.000012	D	0.87341	0.6153	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.72228	-0.4354	10	0.22109	T	0.4	.	9.935	0.41545	0.0:0.8989:0.0:0.1011	.	798	Q9NYA4	MTMR4_HUMAN	I	798	ENSP00000325285:M798I	ENSP00000325285:M798I	M	-	3	0	MTMR4	53928108	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.113000	0.15499	1.285000	0.44548	-0.345000	0.07892	ATG		0.527	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687		56	209	1	0	6.3237e-29	0.01441	7.52821e-29	56	209				
OR1M1	125963	broad.mit.edu	37	19	9204692	9204692	+	Missense_Mutation	SNP	G	G	A	rs144608760		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr19:9204692G>A	ENST00000429566.3	+	1	838	c.772G>A	c.(772-774)Gtc>Atc	p.V258I		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V258I(2)		breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CACCATTGGCGTCTATCTGTG	0.557																																							uc010xkj.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)	3						c.(772-774)GTC>ATC		olfactory receptor, family 1, subfamily M,			ILE/VAL	0,4406		0,0,2203	164.0	148.0	153.0		772	3.7	0.0	19	dbSNP_134	153	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR1M1	NM_001004456.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	258/314	9204692	1,13005	2203	4300	6503	SO:0001583	missense	125963				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9204692G>A		CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.772G>A	19.37:g.9204692G>A	ENSP00000401966:p.Val258Ile		Somatic					p.V258I	NM_001004456	NP_001004456	WXS	Illumina HiSeq	Unspecified	Q8NGA1	OR1M1_HUMAN			1	772	+			258			Helical; Name=6; (Potential).		B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	ENST00000429566.3	37	c.772G>A	CCDS32896.1	.	.	.	.	.	.	.	.	.	.	g	16.75	3.208312	0.58343	0.0	1.16E-4	ENSG00000170929	ENST00000305465;ENST00000429566	T	0.00091	8.74	3.71	3.71	0.42584	GPCR, rhodopsin-like superfamily (1);	0.151400	0.31507	N	0.007525	T	0.00271	0.0008	L	0.38175	1.15	0.09310	N	1	D	0.76494	0.999	D	0.79784	0.993	T	0.57165	-0.7858	10	0.72032	D	0.01	.	8.6151	0.33826	0.1093:0.0:0.8907:0.0	.	258	Q8NGA1	OR1M1_HUMAN	I	261;258	ENSP00000401966:V258I	ENSP00000303195:V261I	V	+	1	0	OR1M1	9065692	0.000000	0.05858	0.039000	0.18376	0.478000	0.33099	0.054000	0.14205	2.083000	0.62718	0.580000	0.79431	GTC		0.557	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448993.1			67	300	0	0	0	0.01441	0	67	300				
SMARCA4	6597	broad.mit.edu	37	19	11132627	11132627	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr19:11132627C>T	ENST00000429416.3	+	20	3124	c.2843C>T	c.(2842-2844)gCc>gTc	p.A948V	SMARCA4_ENST00000450717.3_Missense_Mutation_p.A948V|SMARCA4_ENST00000358026.2_Missense_Mutation_p.A948V|SMARCA4_ENST00000589677.1_Missense_Mutation_p.A948V|SMARCA4_ENST00000444061.3_Missense_Mutation_p.A948V|SMARCA4_ENST00000590574.1_Missense_Mutation_p.A948V|SMARCA4_ENST00000344626.4_Missense_Mutation_p.A948V|SMARCA4_ENST00000541122.2_Missense_Mutation_p.A948V|SMARCA4_ENST00000413806.3_Missense_Mutation_p.A948V	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	948					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GCACCCTTTGCCATGACCGGG	0.587			"""F, N, Mis"""		NSCLC																																		uc002mqf.3		NA		Rec	yes		19	19p13.2	6597	F|N|Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""			E			NSCLC		1	Unknown(1)	p.?(1)	lung(1)	lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67						c.(2842-2844)GCC>GTC		SWI/SNF-related matrix-associated							96.0	82.0	87.0					19																	11132627		2203	4300	6503	SO:0001583	missense	6597	Rhabdoid_Predisposition_syndrome			chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	g.chr19:11132627C>T	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2843C>T	19.37:g.11132627C>T	ENSP00000395654:p.Ala948Val		Somatic				SMARCA4_uc010dxp.2_Missense_Mutation_p.A948V|SMARCA4_uc010dxo.2_Missense_Mutation_p.A948V|SMARCA4_uc002mqg.1_Missense_Mutation_p.A948V|SMARCA4_uc010dxq.2_Missense_Mutation_p.A948V|SMARCA4_uc010dxr.2_Missense_Mutation_p.A948V|SMARCA4_uc002mqj.3_Missense_Mutation_p.A948V|SMARCA4_uc010dxs.2_Missense_Mutation_p.A948V|SMARCA4_uc010dxt.1_Missense_Mutation_p.A168V|SMARCA4_uc002mqh.3_Missense_Mutation_p.A71V|SMARCA4_uc002mqi.1_Missense_Mutation_p.A151V	p.A948V	NM_003072	NP_003063	WXS	Illumina HiSeq	Unspecified	P51532	SMCA4_HUMAN			19	3127	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	948					B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	c.2843C>T	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.345405	0.61073	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2;-3.2;-3.2;-3.2	4.51	4.51	0.55191	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.94175	0.8131	L	0.41079	1.255	0.80722	D	1	P;P;P;P;D;P;P;P	0.56287	0.904;0.904;0.904;0.95;0.975;0.927;0.904;0.904	P;P;P;P;P;P;P;P	0.60541	0.869;0.869;0.869;0.876;0.843;0.809;0.869;0.869	D	0.94975	0.8120	10	0.87932	D	0	-34.4948	16.1519	0.81629	0.0:1.0:0.0:0.0	.	948;948;948;948;948;168;948;948	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	V	948;948;1012;948;948;948;948;948	ENSP00000395654:A948V;ENSP00000350720:A948V;ENSP00000343896:A948V;ENSP00000445036:A948V;ENSP00000392837:A948V;ENSP00000397783:A948V;ENSP00000414727:A948V	ENSP00000343896:A948V	A	+	2	0	SMARCA4	10993627	1.000000	0.71417	0.999000	0.59377	0.089000	0.18198	7.623000	0.83113	2.348000	0.79779	0.655000	0.94253	GCC		0.587	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		4	132	0	0	0	0.009096	0	4	132				
PRKCG	5582	broad.mit.edu	37	19	54387495	54387495	+	Missense_Mutation	SNP	G	G	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr19:54387495G>T	ENST00000263431.3	+	3	565	c.283G>T	c.(283-285)Gac>Tac	p.D95Y	PRKCG_ENST00000542049.1_Missense_Mutation_p.G19V|PRKCG_ENST00000540413.1_Missense_Mutation_p.D95Y|PRKCG_ENST00000536044.1_Missense_Mutation_p.D95Y	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	95					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)	p.D95Y(1)		large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CCCCCAGACGGACGTGAGTGC	0.582																																							uc002qcq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9						c.(283-285)GAC>TAC		protein kinase C, gamma							71.0	66.0	68.0					19																	54387495		2203	4300	6503	SO:0001583	missense	5582				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding	g.chr19:54387495G>T	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.283G>T	19.37:g.54387495G>T	ENSP00000263431:p.Asp95Tyr		Somatic				PRKCG_uc010eqz.1_Missense_Mutation_p.D95Y|PRKCG_uc010yef.1_Missense_Mutation_p.D95Y|PRKCG_uc010yeg.1_Missense_Mutation_p.D95Y|PRKCG_uc010yeh.1_Missense_Mutation_p.G19V	p.D95Y	NM_002739	NP_002730	WXS	Illumina HiSeq	Unspecified	P05129	KPCG_HUMAN		GBM - Glioblastoma multiforme(134;0.0521)	3	565	+	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)		95					B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	c.283G>T	CCDS12867.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.272711|4.272711	0.80580|0.80580	.|.	.|.	ENSG00000126583|ENSG00000126583	ENST00000536044;ENST00000540413;ENST00000263431;ENST00000419486|ENST00000542049	T;T;T|T	0.79554|0.70516	-1.28;-0.59;-0.59|-0.49	4.54|4.54	4.54|4.54	0.55810|0.55810	.|.	.|.	.|.	.|.	.|.	T|T	0.73071|0.73071	0.3540|0.3540	M|M	0.91872|0.91872	3.25|3.25	0.58432|0.58432	D|D	0.999994|0.999994	D;D;D;D|P	0.89917|0.37466	1.0;0.997;1.0;0.991|0.596	D;D;D;P|B	0.76071|0.26517	0.987;0.947;0.971;0.864|0.07	T|T	0.79135|0.79135	-0.1928|-0.1928	9|9	0.87932|0.45353	D|T	0|0.12	.|.	15.1517|15.1517	0.72706|0.72706	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	95;95;95;95|19	F5H5C4;B7Z870;B7Z3W6;P05129|B7Z8Q0	.;.;.;KPCG_HUMAN|.	Y|V	95;95;95;118|19	ENSP00000440541:D95Y;ENSP00000443493:D95Y;ENSP00000263431:D95Y|ENSP00000438090:G19V	ENSP00000263431:D95Y|ENSP00000438090:G19V	D|G	+|+	1|2	0|0	PRKCG|PRKCG	59079307|59079307	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	6.748000|6.748000	0.74877|0.74877	2.244000|2.244000	0.73946|0.73946	0.313000|0.313000	0.20887|0.20887	GAC|GGA		0.582	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739		5	144	1	0	4.096e-09	0.001168	4.58507e-09	5	144				
CCT4	10575	broad.mit.edu	37	2	62104098	62104098	+	Missense_Mutation	SNP	T	T	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:62104098T>G	ENST00000394440.3	-	7	1030	c.734A>C	c.(733-735)aAg>aCg	p.K245T	CCT4_ENST00000538252.1_Missense_Mutation_p.K189T|CCT4_ENST00000544185.1_Missense_Mutation_p.K95T|CCT4_ENST00000461540.2_5'UTR|CCT4_ENST00000544079.1_Missense_Mutation_p.K215T|AC107081.5_ENST00000425779.1_RNA	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	245					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.K245T(2)		breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			AAGCCCAATCTTGGCCTTTTC	0.398																																							uc002sbo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(733-735)AAG>ACG		chaperonin containing TCP1, subunit 4 (delta)							95.0	102.0	100.0					2																	62104098		2203	4300	6503	SO:0001583	missense	10575				'de novo' posttranslational protein folding	melanosome|microtubule organizing center|nucleus	ATP binding|unfolded protein binding	g.chr2:62104098T>G		CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.734A>C	2.37:g.62104098T>G	ENSP00000377958:p.Lys245Thr		Somatic				CCT4_uc010ypp.1_Missense_Mutation_p.K189T|CCT4_uc010ypq.1_Missense_Mutation_p.K95T|CCT4_uc010ypr.1_Missense_Mutation_p.K189T|CCT4_uc010yps.1_Missense_Mutation_p.K215T	p.K245T	NM_006430	NP_006421	WXS	Illumina HiSeq	Unspecified	P50991	TCPD_HUMAN	LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)		7	883	-	Lung NSC(7;0.035)|all_lung(7;0.0691)		245					B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	ENST00000394440.3	37	c.734A>C	CCDS33206.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.982856	0.93044	.	.	ENSG00000115484	ENST00000394440;ENST00000544079;ENST00000544185;ENST00000538252	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.48	5.48	0.80851	.	0.090181	0.85682	D	0.000000	D	0.85613	0.5737	M	0.90425	3.115	0.80722	D	1	D;D	0.60160	0.987;0.987	P;P	0.62014	0.888;0.897	D	0.88838	0.3310	10	0.87932	D	0	-12.331	15.5478	0.76123	0.0:0.0:0.0:1.0	.	215;245	F5H5W3;P50991	.;TCPD_HUMAN	T	245;215;95;189	ENSP00000377958:K245T;ENSP00000443061:K215T;ENSP00000443451:K95T;ENSP00000442174:K189T	ENSP00000377958:K245T	K	-	2	0	CCT4	61957602	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.814000	0.86154	2.205000	0.71048	0.533000	0.62120	AAG		0.398	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325548.2			28	237	0	0	0	0.010818	0	28	237				
MRPL53	116540	broad.mit.edu	37	2	74699752	74699752	+	Silent	SNP	A	A	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:74699752A>T	ENST00000258105.7	-	1	697	c.36T>A	c.(34-36)ccT>ccA	p.P12P	MRPL53_ENST00000409710.1_Silent_p.P12P	NM_053050.4	NP_444278.1	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53	12						mitochondrion (GO:0005739)|ribosome (GO:0005840)				central_nervous_system(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5						CCTGTTTGACAGGCCGCAGAC	0.602																																							uc002sln.2		NA																	0					0						c.(34-36)CCT>CCA		mitochondrial ribosomal protein L53 precursor							78.0	70.0	72.0					2																	74699752		2203	4300	6503	SO:0001819	synonymous_variant	116540					mitochondrion|ribosome		g.chr2:74699752A>T	BC012163	CCDS1944.1	2p13.1	2012-09-13			ENSG00000204822	ENSG00000204822		"""Mitochondrial ribosomal proteins / large subunits"""	16684	protein-coding gene	gene with protein product		611857				11551941	Standard	NM_053050		Approved		uc002sln.3	Q96EL3	OTTHUMG00000129961	ENST00000258105.7:c.36T>A	2.37:g.74699752A>T			Somatic				CCDC142_uc002slo.2_RNA	p.P12P	NM_053050	NP_444278	WXS	Illumina HiSeq	Unspecified	Q96EL3	RM53_HUMAN			1	176	-			12						Silent	SNP	ENST00000258105.7	37	c.36T>A	CCDS1944.1																																																																																				0.602	MRPL53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252225.2	NM_053050		3	97	0	0	0	0.004672	0	3	97				
SCTR	6344	broad.mit.edu	37	2	120209616	120209616	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:120209616G>C	ENST00000019103.5	-	9	1158	c.891C>G	c.(889-891)atC>atG	p.I297M		NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor	297					digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)	p.I297M(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	GACCACGAATGATCCACCAGA	0.597																																							uc002tma.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(889-891)ATC>ATG		secretin receptor precursor	Secretin(DB00021)						146.0	104.0	118.0					2																	120209616		2203	4300	6503	SO:0001583	missense	6344				digestion|excretion	integral to plasma membrane	secretin receptor activity	g.chr2:120209616G>C		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407	ENST00000019103.5:c.891C>G	2.37:g.120209616G>C	ENSP00000019103:p.Ile297Met		Somatic				SCTR_uc002tlz.2_Missense_Mutation_p.I119M	p.I297M	NM_002980	NP_002971	WXS	Illumina HiSeq	Unspecified	P47872	SCTR_HUMAN			9	1117	-			297			Helical; Name=5; (Potential).		Q12961|Q13213|Q53T00	Missense_Mutation	SNP	ENST00000019103.5	37	c.891C>G	CCDS2127.1	.	.	.	.	.	.	.	.	.	.	G	19.27	3.796195	0.70567	.	.	ENSG00000080293	ENST00000019103	T	0.54071	0.59	5.33	4.43	0.53597	GPCR, family 2-like (1);	0.245285	0.28499	N	0.015127	T	0.81009	0.4734	H	0.97758	4.07	0.34673	D	0.723892	D	0.57257	0.979	D	0.64687	0.928	D	0.91570	0.5271	10	0.87932	D	0	.	15.1062	0.72324	0.0:0.1419:0.8581:0.0	.	297	P47872	SCTR_HUMAN	M	297	ENSP00000019103:I297M	ENSP00000019103:I297M	I	-	3	3	SCTR	119926086	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.672000	0.37523	1.435000	0.47434	0.655000	0.94253	ATC		0.597	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2			4	27	0	0	0	0.009096	0	4	27				
TMEM163	81615	broad.mit.edu	37	2	135215671	135215671	+	Silent	SNP	C	C	G	rs17852356		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:135215671C>G	ENST00000281924.6	-	7	805	c.741G>C	c.(739-741)tcG>tcC	p.S247S		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	247						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)	p.S247S(1)		endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		ACCAGACCGCCGAGTCATGCT	0.537																																							uc002ttx.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(739-741)TCG>TCC		transmembrane protein 163							143.0	128.0	133.0					2																	135215671		2203	4300	6503	SO:0001819	synonymous_variant	81615					integral to membrane		g.chr2:135215671C>G		CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.741G>C	2.37:g.135215671C>G			Somatic				TMEM163_uc002tty.2_RNA	p.S247S	NM_030923	NP_112185	WXS	Illumina HiSeq	Unspecified	Q8TC26	TM163_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.154)	7	807	-			247					Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Silent	SNP	ENST00000281924.6	37	c.741G>C	CCDS2172.1																																																																																				0.537	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254631.2	NM_030923		7	207	0	0	0	0.00308	0	7	207				
LRP1B	53353	broad.mit.edu	37	2	141072616	141072616	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:141072616C>G	ENST00000389484.3	-	83	13664	c.12693G>C	c.(12691-12693)gaG>gaC	p.E4231D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4231	EGF-like 17. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.E4231D(2)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AATCACCTTTCTCATTTAAAA	0.383										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(12691-12693)GAG>GAC		low density lipoprotein-related protein 1B							138.0	125.0	129.0					2																	141072616		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141072616C>G	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12693G>C	2.37:g.141072616C>G	ENSP00000374135:p.Glu4231Asp	TSP Lung(27;0.18)	Somatic					p.E4231D	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	83	13665	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4231			Extracellular (Potential).|EGF-like 10.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.12693G>C	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.55|15.55	2.867044|2.867044	0.51588|0.51588	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977	T|.	0.41758|.	0.99|.	6.06|6.06	5.18|5.18	0.71444|0.71444	Growth factor, receptor (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);|.	0.139095|.	0.46442|.	D|.	0.000299|.	T|T	0.54095|0.54095	0.1837|0.1837	L|L	0.51422|0.51422	1.61|1.61	0.35781|0.35781	D|D	0.821672|0.821672	D|.	0.69078|.	0.997|.	D|.	0.72625|.	0.978|.	T|T	0.62586|0.62586	-0.6823|-0.6823	10|5	0.14252|.	T|.	0.57|.	.|.	9.6066|9.6066	0.39637|0.39637	0.0:0.7923:0.0:0.2077|0.0:0.7923:0.0:0.2077	.|.	4231|.	Q9NZR2|.	LRP1B_HUMAN|.	D|T	4231;4169|463	ENSP00000374135:E4231D|.	ENSP00000374135:E4231D|.	E|R	-|-	3|2	2|0	LRP1B|LRP1B	140789086|140789086	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	1.458000|1.458000	0.35223|0.35223	1.581000|1.581000	0.49865|0.49865	-0.140000|-0.140000	0.14226|0.14226	GAG|AGA		0.383	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		6	110	0	0	0	0.001168	0	6	110				
ACVR2A	92	broad.mit.edu	37	2	148677879	148677879	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:148677879A>G	ENST00000241416.7	+	8	1679	c.1043A>G	c.(1042-1044)gAg>gGg	p.E348G	ACVR2A_ENST00000404590.1_Missense_Mutation_p.E348G|ACVR2A_ENST00000535787.1_Missense_Mutation_p.E240G	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	348	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			E -> V (in Ref. 4; BAA06548). {ECO:0000305}.	activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TTAAAATTTGAGGCTGGCAAG	0.368																																							uc002twg.2		NA																	0				stomach(8)|large_intestine(2)|lung(1)|breast(1)|kidney(1)	13						c.(1042-1044)GAG>GGG		activin A receptor, type IIA precursor							91.0	94.0	93.0					2																	148677879		2203	4300	6503	SO:0001583	missense	92				activin receptor signaling pathway|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of erythrocyte differentiation|positive regulation of osteoblast differentiation|positive regulation of protein phosphorylation	cytoplasm|inhibin-betaglycan-ActRII complex|integral to plasma membrane	ATP binding|coreceptor activity|inhibin beta-A binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity	g.chr2:148677879A>G		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1043A>G	2.37:g.148677879A>G	ENSP00000241416:p.Glu348Gly		Somatic				ACVR2A_uc010zbn.1_Missense_Mutation_p.E240G|ACVR2A_uc002twh.2_Missense_Mutation_p.E348G	p.E348G	NM_001616	NP_001607	WXS	Illumina HiSeq	Unspecified	P27037	AVR2A_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0969)	9	1312	+			348	E -> V (in Ref. 4; BAA06548).		Cytoplasmic (Potential).|Protein kinase.		B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	37	c.1043A>G	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.516631	0.85495	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	D;D;D	0.93189	-3.18;-3.18;-3.18	5.53	5.53	0.82687	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94208	0.8141	L	0.43152	1.355	0.80722	D	1	D	0.59357	0.985	P	0.58620	0.842	D	0.94584	0.7782	10	0.59425	D	0.04	.	15.9669	0.79979	1.0:0.0:0.0:0.0	.	348	P27037	AVR2A_HUMAN	G	348;240;348	ENSP00000241416:E348G;ENSP00000439988:E240G;ENSP00000384338:E348G	ENSP00000241416:E348G	E	+	2	0	ACVR2A	148394349	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.252000	0.78309	2.236000	0.73375	0.533000	0.62120	GAG		0.368	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616		3	168	0	0	0	0.009096	0	3	168				
WDSUB1	151525	broad.mit.edu	37	2	160139521	160139521	+	Silent	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:160139521G>A	ENST00000409990.3	-	2	316	c.60C>T	c.(58-60)ttC>ttT	p.F20F	WDSUB1_ENST00000392796.3_Silent_p.F20F|WDSUB1_ENST00000359774.4_Silent_p.F20F|WDSUB1_ENST00000409124.1_Silent_p.F20F|WDSUB1_ENST00000358147.4_Silent_p.F20F	NM_001128213.1	NP_001121685	Q8N9V3	WSDU1_HUMAN	WD repeat, sterile alpha motif and U-box domain containing 1	20							ubiquitin-protein transferase activity (GO:0004842)	p.F20F(2)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|stomach(3)	16						GGGAAAAGGAGAAGGCACAGC	0.408																																							uc002uaj.3		NA																	2	Substitution - coding silent(2)		lung(1)|breast(1)		0						c.(58-60)TTC>TTT		WD repeat, sterile alpha motif and U-box domain							115.0	110.0	112.0					2																	160139521		2203	4300	6503	SO:0001819	synonymous_variant	151525					ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr2:160139521G>A	AK093494	CCDS2208.1	2q24.2	2013-01-28	2006-02-17	2005-03-25	ENSG00000196151	ENSG00000196151		"""WD repeat domain containing"", ""Sterile alpha motif (SAM) domain containing"", ""U-box domain containing"""	26697	protein-coding gene	gene with protein product			"""WD repeat and SAM domain containing 1"", ""WD repeat, SAM and U-box domain containing 1"""	WDSAM1		12477932	Standard	NM_152528		Approved	UBOX6, FLJ36175	uc002ual.4	Q8N9V3	OTTHUMG00000132028	ENST00000409990.3:c.60C>T	2.37:g.160139521G>A			Somatic				WDSUB1_uc002uak.3_Silent_p.F20F|WDSUB1_uc002ual.3_Silent_p.F20F|WDSUB1_uc002uam.3_Silent_p.F20F|WDSUB1_uc010foo.2_Silent_p.F20F	p.F20F	NM_152528	NP_689741	WXS	Illumina HiSeq	Unspecified	Q8N9V3	WSDU1_HUMAN			2	209	-			20			WD 1.		Q53TI9|Q8N6N8	Silent	SNP	ENST00000409990.3	37	c.60C>T	CCDS2208.1																																																																																				0.408	WDSUB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333339.1	NM_152528		4	144	0	0	0	0.009096	0	4	144				
DNAH7	56171	broad.mit.edu	37	2	196642529	196642529	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:196642529C>T	ENST00000312428.6	-	59	11159	c.11059G>A	c.(11059-11061)Ggt>Agt	p.G3687S	DNAH7_ENST00000409063.1_Missense_Mutation_p.G170S	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3687					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CTTACATCACCAGAAGGAGGA	0.358																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(11059-11061)GGT>AGT		dynein, axonemal, heavy chain 7							111.0	103.0	105.0					2																	196642529		1921	4123	6044	SO:0001583	missense	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196642529C>T	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11059G>A	2.37:g.196642529C>T	ENSP00000311273:p.Gly3687Ser		Somatic				DNAH7_uc002uti.3_Missense_Mutation_p.G170S	p.G3687S	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			59	11160	-			3687					B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.11059G>A	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410008	0.62399	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.07444	3.19;3.19	4.98	4.98	0.66077	Dynein heavy chain (1);	2.761840	0.01959	N	0.043232	T	0.15046	0.0363	L	0.39692	1.235	0.80722	D	1	B	0.29212	0.237	B	0.35114	0.196	T	0.33752	-0.9856	10	0.22706	T	0.39	.	18.0378	0.89309	0.0:1.0:0.0:0.0	.	3687	Q8WXX0	DYH7_HUMAN	S	3687;170	ENSP00000311273:G3687S;ENSP00000386912:G170S	ENSP00000311273:G3687S	G	-	1	0	DNAH7	196350774	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.480000	0.73604	2.583000	0.87209	0.655000	0.94253	GGT		0.358	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		3	129	0	0	0	0.009096	0	3	129				
DNAH7	56171	broad.mit.edu	37	2	196664038	196664038	+	Silent	SNP	T	T	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:196664038T>A	ENST00000312428.6	-	55	10435	c.10335A>T	c.(10333-10335)ctA>ctT	p.L3445L		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3445	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.L3445L(2)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CAGCAAATTTTAGAAGGGCAG	0.408																																							uc002utj.3		NA																	2	Substitution - coding silent(2)		lung(2)	skin(10)|ovary(2)	12						c.(10333-10335)CTA>CTT		dynein, axonemal, heavy chain 7							123.0	122.0	122.0					2																	196664038		1878	4118	5996	SO:0001819	synonymous_variant	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196664038T>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.10335A>T	2.37:g.196664038T>A			Somatic					p.L3445L	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			55	10436	-			3445			AAA 6 (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	c.10335A>T	CCDS42794.1																																																																																				0.408	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		53	243	0	0	0	0.01441	0	53	243				
ANKMY1	51281	broad.mit.edu	37	2	241451413	241451413	+	Silent	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr2:241451413G>A	ENST00000272972.3	-	10	2098	c.1884C>T	c.(1882-1884)gaC>gaT	p.D628D	ANKMY1_ENST00000361678.4_Intron|ANKMY1_ENST00000373318.2_Silent_p.D487D|ANKMY1_ENST00000403283.1_Silent_p.D566D|ANKMY1_ENST00000406958.1_Silent_p.D389D|ANKMY1_ENST00000401804.1_Silent_p.D717D|ANKMY1_ENST00000391987.1_Silent_p.D628D|ANKMY1_ENST00000373320.4_Silent_p.D398D	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	628							metal ion binding (GO:0046872)	p.D628D(1)		central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		AGGGCAGCAGGTCCAGCTGTG	0.672																																							uc002vyz.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1882-1884)GAC>GAT		ankyrin repeat and MYND domain containing 1							55.0	56.0	56.0					2																	241451413		2203	4300	6503	SO:0001819	synonymous_variant	51281						zinc ion binding	g.chr2:241451413G>A	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1884C>T	2.37:g.241451413G>A			Somatic				ANKMY1_uc002vza.1_Intron|ANKMY1_uc010fzd.1_Silent_p.D717D|ANKMY1_uc002vzb.1_Silent_p.D389D|ANKMY1_uc002vzc.1_Silent_p.D487D|ANKMY1_uc002vzd.1_Silent_p.D487D	p.D628D	NM_016552	NP_057636	WXS	Illumina HiSeq	Unspecified	Q9P2S6	ANKY1_HUMAN		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)	10	2113	-		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	628					B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	ENST00000272972.3	37	c.1884C>T	CCDS2536.1																																																																																				0.672	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844		12	64	0	0	0	0.013537	0	12	64				
CFAP61	26074	broad.mit.edu	37	20	20322542	20322542	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr20:20322542C>T	ENST00000245957.5	+	26	3566	c.3490C>T	c.(3490-3492)Cgc>Tgc	p.R1164C	C20orf26_ENST00000377309.2_3'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		1164								p.R1164C(2)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		GAAAGAGTTACGCCAAATCTT	0.443																																							uc002wru.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|pancreas(1)	4						c.(3490-3492)CGC>TGC		hypothetical protein LOC26074							103.0	96.0	98.0					20																	20322542		2203	4300	6503	SO:0001583	missense	26074							g.chr20:20322542C>T																												ENST00000245957.5:c.3490C>T	20.37:g.20322542C>T	ENSP00000245957:p.Arg1164Cys		Somatic				C20orf26_uc002wrw.2_RNA	p.R1164C	NM_015585	NP_056400	WXS	Illumina HiSeq	Unspecified	Q8NHU2	CT026_HUMAN		READ - Rectum adenocarcinoma(2;0.171)	26	3566	+			1164					A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	c.3490C>T	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.771832	0.49680	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.12465	2.68	5.16	5.16	0.70880	.	0.249318	0.35585	N	0.003113	T	0.33760	0.0874	L	0.61387	1.9	0.80722	D	1	D	0.76494	0.999	P	0.60886	0.88	T	0.05784	-1.0864	10	0.87932	D	0	.	18.6462	0.91410	0.0:1.0:0.0:0.0	.	1164	Q8NHU2	CT026_HUMAN	C	1104;1130;1164	ENSP00000245957:R1164C	ENSP00000245957:R1164C	R	+	1	0	C20orf26	20270542	1.000000	0.71417	0.995000	0.50966	0.955000	0.61496	5.848000	0.69458	2.406000	0.81754	0.603000	0.83216	CGC		0.443	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3			21	60	0	0	0	0.010504	0	21	60				
NFATC2	4773	broad.mit.edu	37	20	50139845	50139845	+	Missense_Mutation	SNP	G	G	A	rs376937921		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr20:50139845G>A	ENST00000396009.3	-	2	1154	c.935C>T	c.(934-936)aCg>aTg	p.T312M	NFATC2_ENST00000609507.1_Missense_Mutation_p.T93M|NFATC2_ENST00000414705.1_Missense_Mutation_p.T292M|NFATC2_ENST00000371564.3_Missense_Mutation_p.T312M|NFATC2_ENST00000610033.1_Missense_Mutation_p.T93M|NFATC2_ENST00000609943.1_Missense_Mutation_p.T292M	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	312					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					AGGCGAGTCCGTGGCGAGGCT	0.687																																							uc002xwd.2		NA																	0				ovary(2)	2						c.(934-936)ACG>ATG		nuclear factor of activated T-cells,		G	MET/THR,MET/THR,MET/THR	0,4394		0,0,2197	15.0	20.0	18.0		875,935,935	3.6	0.0	20		18	1,8581		0,1,4290	no	missense,missense,missense	NFATC2	NM_001136021.1,NM_012340.3,NM_173091.2	81,81,81	0,1,6487	AA,AG,GG		0.0117,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	292/902,312/922,312/926	50139845	1,12975	2197	4291	6488	SO:0001583	missense	4773				B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity	g.chr20:50139845G>A	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.935C>T	20.37:g.50139845G>A	ENSP00000379330:p.Thr312Met		Somatic				NFATC2_uc002xwc.2_Missense_Mutation_p.T312M|NFATC2_uc010zyv.1_Missense_Mutation_p.T93M|NFATC2_uc010zyw.1_Missense_Mutation_p.T93M|NFATC2_uc010zyx.1_Missense_Mutation_p.T292M|NFATC2_uc010zyy.1_Missense_Mutation_p.T93M|NFATC2_uc010zyz.1_Missense_Mutation_p.T93M|NFATC2_uc002xwe.2_Missense_Mutation_p.T292M	p.T312M	NM_173091	NP_775114	WXS	Illumina HiSeq	Unspecified	Q13469	NFAC2_HUMAN			2	1155	-	Hepatocellular(150;0.248)		312					B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	c.935C>T	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.912194	0.33721	0.0	1.17E-4	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000371567;ENST00000414705	T;T;T	0.16897	2.31;2.31;2.32	5.57	3.58	0.41010	.	1.071840	0.07237	N	0.863533	T	0.28300	0.0699	M	0.68317	2.08	0.09310	N	1	P;P;P;P	0.46064	0.872;0.581;0.752;0.872	B;B;B;B	0.42555	0.391;0.293;0.198;0.391	T	0.40440	-0.9563	10	0.66056	D	0.02	-0.3081	16.2345	0.82363	0.0:0.2504:0.7496:0.0	.	292;292;312;312	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	M	312;312;93;292	ENSP00000360619:T312M;ENSP00000379330:T312M;ENSP00000396471:T292M	ENSP00000360619:T312M	T	-	2	0	NFATC2	49573252	0.058000	0.20735	0.030000	0.17652	0.956000	0.61745	2.408000	0.44574	0.679000	0.31345	0.305000	0.20034	ACG		0.687	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340		3	28	0	0	0	0.009096	0	3	28				
SPO11	23626	broad.mit.edu	37	20	55909089	55909089	+	Missense_Mutation	SNP	G	G	A	rs141106732	byFrequency	TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr20:55909089G>A	ENST00000371263.3	+	5	557	c.448G>A	c.(448-450)Gtc>Atc	p.V150I	SPO11_ENST00000345868.4_Missense_Mutation_p.V112I|SPO11_ENST00000371260.4_Missense_Mutation_p.V112I	NM_012444.2	NP_036576.1	Q9Y5K1	SPO11_HUMAN	SPO11 meiotic protein covalently bound to DSB	150					DNA catabolic process, endonucleolytic (GO:0000737)|female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|ovarian follicle development (GO:0001541)|protein localization to chromosome (GO:0034502)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|hydrolase activity (GO:0016787)	p.V150I(2)		autonomic_ganglia(1)|breast(3)|large_intestine(4)|lung(8)|skin(2)	18	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			CCAGACTGTCGTCGACAATAT	0.274								Editing and processing nucleases																															uc002xye.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|skin(1)	3						c.(448-450)GTC>ATC	Editing_and_processing_nucleases	meiotic recombination protein SPO11 isoform a		G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	37.0	40.0	39.0		448,334	5.4	1.0	20	dbSNP_134	39	4,8588	3.7+/-12.6	0,4,4292	yes	missense,missense	SPO11	NM_012444.2,NM_198265.1	29,29	0,4,6495	AA,AG,GG		0.0466,0.0,0.0308	probably-damaging,probably-damaging	150/397,112/359	55909089	4,12994	2203	4296	6499	SO:0001583	missense	23626				female gamete generation|reciprocal meiotic recombination	chromosome|nucleus	ATP binding|DNA binding|hydrolase activity	g.chr20:55909089G>A	AF169385	CCDS13456.1, CCDS13457.1	20q13.31	2013-06-05	2013-06-05		ENSG00000054796	ENSG00000054796			11250	protein-coding gene	gene with protein product	"""cancer/testis antigen 35"", ""spermatogenesis associated 43"""	605114	"""SPO11, meiotic protein covalently bound to DSB (S. cerevisiae)-like"", ""SPO11 meiotic protein covalently bound to DSB-like (S. cerevisiae)"", ""SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)"""			10534401	Standard	NM_012444		Approved	CT35, SPATA43, TOPVIA	uc002xye.3	Q9Y5K1	OTTHUMG00000032817	ENST00000371263.3:c.448G>A	20.37:g.55909089G>A	ENSP00000360310:p.Val150Ile		Somatic				SPO11_uc002xyf.2_Missense_Mutation_p.V112I	p.V150I	NM_012444	NP_036576	WXS	Illumina HiSeq	Unspecified	Q9Y5K1	SPO11_HUMAN	BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)		5	541	+	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		150					Q5TCI1|Q8N4V0|Q9NQM7|Q9NQM8	Missense_Mutation	SNP	ENST00000371263.3	37	c.448G>A	CCDS13456.1	.	.	.	.	.	.	.	.	.	.	G	31	5.064747	0.93898	0.0	4.66E-4	ENSG00000054796	ENST00000371263;ENST00000345868;ENST00000371260;ENST00000418127	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	5.39	5.39	0.77823	Spo11/DNA topoisomerase VI, subunit A, N-terminal (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.054690	0.64402	D	0.000001	T	0.61123	0.2322	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.68192	0.843;0.956	T	0.58370	-0.7648	10	0.38643	T	0.18	-23.0085	19.5198	0.95180	0.0:0.0:1.0:0.0	.	112;150	Q9Y5K1-2;Q9Y5K1	.;SPO11_HUMAN	I	150;112;112;128	ENSP00000360310:V150I;ENSP00000316034:V112I;ENSP00000360307:V112I;ENSP00000413185:V128I	ENSP00000316034:V112I	V	+	1	0	SPO11	55342496	1.000000	0.71417	0.975000	0.42487	0.983000	0.72400	6.204000	0.72143	2.683000	0.91414	0.655000	0.94253	GTC		0.274	SPO11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079836.2	NM_012444		11	40	0	0	0	0.013537	0	11	40				
SLC17A9	63910	broad.mit.edu	37	20	61588916	61588916	+	Silent	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr20:61588916C>G	ENST00000370351.4	+	3	512	c.381C>G	c.(379-381)ctC>ctG	p.L127L	SLC17A9_ENST00000370349.3_Silent_p.L121L|SLC17A9_ENST00000488738.1_3'UTR	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	127					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						CACGCATCCTCATGGGCTTGC	0.647																																							uc002yea.3		NA																	0				ovary(1)|skin(1)	2						c.(379-381)CTC>CTG		vesicular nucleotide transporter SLC17A9							47.0	50.0	49.0					20																	61588916		2107	4229	6336	SO:0001819	synonymous_variant	63910				exocytosis|transmembrane transport	integral to membrane	transporter activity	g.chr20:61588916C>G	AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.381C>G	20.37:g.61588916C>G			Somatic				SLC17A9_uc002ydz.3_Silent_p.L121L|SLC17A9_uc011aap.1_Silent_p.L147L	p.L127L	NM_022082	NP_071365	WXS	Illumina HiSeq	Unspecified	Q9BYT1	S17A9_HUMAN			3	565	+			127			Helical; (Potential).		B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Silent	SNP	ENST00000370351.4	37	c.381C>G	CCDS42901.1																																																																																				0.647	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080100.1	NM_022082		3	82	0	0	0	0.004672	0	3	82				
LCA5L	150082	broad.mit.edu	37	21	40778294	40778294	+	Silent	SNP	G	G	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr21:40778294G>T	ENST00000358268.2	-	10	2055	c.1527C>A	c.(1525-1527)ggC>ggA	p.G509G	LCA5L_ENST00000288350.3_Silent_p.G509G|LCA5L_ENST00000495240.1_5'UTR|LCA5L_ENST00000380671.2_Silent_p.G509G|WRB_ENST00000541890.1_Intron			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	509								p.G509G(4)		breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				AGGGAGCAGTGCCTTTGCCAA	0.453																																							uc002yxu.2		NA																	4	Substitution - coding silent(4)		lung(4)		0						c.(1525-1527)GGC>GGA		Leber congenital amaurosis 5-like							140.0	112.0	121.0					21																	40778294		2203	4300	6503	SO:0001819	synonymous_variant	150082							g.chr21:40778294G>T	AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1527C>A	21.37:g.40778294G>T			Somatic				LCA5L_uc002yxv.2_Silent_p.G509G	p.G509G	NM_152505	NP_689718	WXS	Illumina HiSeq	Unspecified	O95447	LCA5L_HUMAN			10	1840	-		Prostate(19;1.2e-06)	509					D3DSI0|Q3ZCT0	Silent	SNP	ENST00000358268.2	37	c.1527C>A	CCDS13665.1																																																																																				0.453	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141807.2	NM_152505		23	58	1	0	1.90627e-21	0.012319	2.19954e-21	23	58				
U2AF1	7307	broad.mit.edu	37	21	44524456	44524456	+	Missense_Mutation	SNP	G	G	A	rs371769427		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr21:44524456G>A	ENST00000291552.4	-	2	193	c.101C>T	c.(100-102)tCt>tTt	p.S34F	U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F|U2AF1_ENST00000486519.1_5'UTR|U2AF1_ENST00000398137.1_5'UTR	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	34					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S34F(45)|p.S34Y(12)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						GTGCAACCGAGAGCACCTGTC	0.358			Mis		"""CLL, MDS"""																																		uc002zda.1		NA		Dom	yes		21	21q22.3	7307		U2 small nuclear RNA auxiliary factor 1			L					57	Substitution - Missense(57)		haematopoietic_and_lymphoid_tissue(43)|lung(12)|endometrium(2)		0						c.(100-102)TCT>TTT		U2 small nuclear RNA auxillary factor 1 isoform		G	PHE/SER,PHE/SER,	1,4405		0,1,2202	67.0	64.0	65.0		101,101,	5.5	1.0	21		65	0,8600		0,0,4300	no	missense,missense,utr-5	U2AF1	NM_001025203.1,NM_006758.2,NM_001025204.1	155,155,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,	34/241,34/241,	44524456	1,13005	2203	4300	6503	SO:0001583	missense	7307				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	Cajal body|catalytic step 2 spliceosome|nuclear speck	nucleotide binding|RNA binding|zinc ion binding	g.chr21:44524456G>A	BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.101C>T	21.37:g.44524456G>A	ENSP00000291552:p.Ser34Phe		Somatic				U2AF1_uc002zcy.1_5'UTR|U2AF1_uc002zcz.1_5'UTR|U2AF1_uc002zdb.1_Missense_Mutation_p.S34F|U2AF1_uc010gpi.1_Missense_Mutation_p.S34F|U2AF1_uc002zdc.1_Missense_Mutation_p.S34F	p.S34F	NM_001025203	NP_001020374	WXS	Illumina HiSeq	Unspecified	Q01081	U2AF1_HUMAN			2	185	-			34			C3H1-type 1.		Q701P4|Q71RF1	Missense_Mutation	SNP	ENST00000291552.4	37	c.101C>T	CCDS13694.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025187	0.93518	2.27E-4	0.0	ENSG00000160201	ENST00000380276;ENST00000291552	T;T	0.46063	0.88;0.88	5.47	5.47	0.80525	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.77239	0.4101	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	D	0.84864	0.0821	10	0.87932	D	0	-15.7954	19.3169	0.94218	0.0:0.0:1.0:0.0	.	34;34;34	Q69YM7;Q01081;Q701P4	.;U2AF1_HUMAN;.	F	34	ENSP00000369629:S34F;ENSP00000291552:S34F	ENSP00000291552:S34F	S	-	2	0	U2AF1	43397525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.864000	0.92294	2.560000	0.86352	0.563000	0.77884	TCT		0.358	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195541.1	NM_006758		26	48	0	0	0	0.008361	0	26	48				
GGT1	2678	broad.mit.edu	37	22	25010819	25010819	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr22:25010819C>G	ENST00000400382.1	+	6	996	c.241C>G	c.(241-243)Cac>Gac	p.H81D	GGT1_ENST00000406383.2_Missense_Mutation_p.H81D|GGT1_ENST00000400383.1_Missense_Mutation_p.H81D|GGT1_ENST00000248923.4_Missense_Mutation_p.H81D|GGT1_ENST00000400380.1_Missense_Mutation_p.H81D			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	81					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.H81D(2)		breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	CATGAATGCCCACAGCATGGG	0.622																																							uc003aan.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(241-243)CAC>GAC		gamma-glutamyltransferase 1 precursor	Glutathione(DB00143)						36.0	39.0	38.0					22																	25010819		2022	4166	6188	SO:0001583	missense	2678				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding	g.chr22:25010819C>G	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.241C>G	22.37:g.25010819C>G	ENSP00000383232:p.His81Asp		Somatic				GGT1_uc003aas.1_Missense_Mutation_p.H81D|GGT1_uc003aat.1_Missense_Mutation_p.H81D|GGT1_uc003aau.1_Missense_Mutation_p.H81D|GGT1_uc003aav.1_Missense_Mutation_p.H81D|GGT1_uc003aaw.1_Missense_Mutation_p.H81D|GGT1_uc003aax.1_Missense_Mutation_p.H81D	p.H81D	NM_013430	NP_038347	WXS	Illumina HiSeq	Unspecified	P19440	GGT1_HUMAN			6	728	+			81			Extracellular (Potential).		Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000400382.1	37	c.241C>G	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	.	23.7	4.442219	0.83993	.	.	ENSG00000100031	ENST00000248923;ENST00000411974;ENST00000412658;ENST00000419133;ENST00000400382;ENST00000452551;ENST00000400383;ENST00000400380;ENST00000455483;ENST00000430289;ENST00000447416;ENST00000432867;ENST00000451366;ENST00000406383;ENST00000428855	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.07688	3.17;3.17;3.17;3.17;3.17;3.17;3.17;3.17;3.17;3.17;3.17;3.17;3.17;3.17;3.17	3.89	3.89	0.44902	.	0.000000	0.85682	D	0.000000	T	0.19485	0.0468	M	0.78344	2.41	0.54753	D	0.999988	P	0.41624	0.757	P	0.46419	0.516	T	0.04191	-1.0970	10	0.72032	D	0.01	-5.727	15.7009	0.77541	0.0:1.0:0.0:0.0	.	81	P19440	GGT1_HUMAN	D	81	ENSP00000248923:H81D;ENSP00000389935:H81D;ENSP00000393537:H81D;ENSP00000395271:H81D;ENSP00000383232:H81D;ENSP00000415553:H81D;ENSP00000383233:H81D;ENSP00000383231:H81D;ENSP00000415024:H81D;ENSP00000417044:H81D;ENSP00000400621:H81D;ENSP00000398589:H81D;ENSP00000387796:H81D;ENSP00000385975:H81D;ENSP00000415068:H81D	ENSP00000248923:H81D	H	+	1	0	GGT1	23340819	1.000000	0.71417	0.985000	0.45067	0.959000	0.62525	7.325000	0.79124	2.100000	0.63781	0.555000	0.69702	CAC		0.622	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430		12	109	0	0	0	0.013537	0	12	109				
ATP2B2	491	broad.mit.edu	37	3	10401606	10401606	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr3:10401606G>A	ENST00000352432.4	-	12	1930	c.1861C>T	c.(1861-1863)Cgc>Tgc	p.R621C	ATP2B2_ENST00000343816.4_Missense_Mutation_p.R607C|ATP2B2_ENST00000397077.1_Missense_Mutation_p.R576C|ATP2B2_ENST00000383800.4_Missense_Mutation_p.R576C|ATP2B2_ENST00000360273.2_Missense_Mutation_p.R621C			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	621					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.R576C(2)|p.R621C(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CTGTACATGCGGAAGCTCTCG	0.597																																					Ovarian(125;1619 1709 15675 19819 38835)	Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1861-1863)CGC>TGC		plasma membrane calcium ATPase 2 isoform 1							91.0	79.0	83.0					3																	10401606		2203	4300	6503	SO:0001583	missense	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10401606G>A	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1861C>T	3.37:g.10401606G>A	ENSP00000324172:p.Arg621Cys		Somatic				ATP2B2_uc003bvv.2_Missense_Mutation_p.R576C|ATP2B2_uc003bvw.2_Missense_Mutation_p.R576C|ATP2B2_uc010hdo.2_Missense_Mutation_p.R326C	p.R621C	NM_001001331	NP_001001331	WXS	Illumina HiSeq	Unspecified	Q01814	AT2B2_HUMAN			13	2300	-			621			Cytoplasmic (Potential).		O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	c.1861C>T	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492106	0.84962	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	T;T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58;-0.58	4.86	4.86	0.63082	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.86456	0.5937	M	0.87971	2.92	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.988;0.998	D	0.89294	0.3621	10	0.87932	D	0	-24.7216	18.0002	0.89196	0.0:0.0:1.0:0.0	.	556;588;621	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	C	621;576;576;621;607;556;477;621	ENSP00000324172:R621C;ENSP00000373311:R576C;ENSP00000380267:R576C;ENSP00000353414:R621C;ENSP00000344677:R607C;ENSP00000414854:R477C	ENSP00000342954:R621C	R	-	1	0	ATP2B2	10376606	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.172000	0.65003	2.237000	0.73441	0.543000	0.68304	CGC		0.597	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		64	117	0	0	0	0.01441	0	64	117				
FAM19A4	151647	broad.mit.edu	37	3	68802078	68802078	+	Silent	SNP	G	G	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr3:68802078G>C	ENST00000295569.7	-	4	714	c.222C>G	c.(220-222)gtC>gtG	p.V74V		NM_001005527.2|NM_182522.4	NP_001005527.1|NP_872328.1	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A4	74						extracellular region (GO:0005576)		p.V74V(2)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(5)|skin(2)	10		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		AAGAGCACTTGACCGTTTGTG	0.537																																							uc003dnh.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)	2						c.(220-222)GTC>GTG		family with sequence similarity 19 (chemokine							101.0	88.0	92.0					3																	68802078		2203	4300	6503	SO:0001819	synonymous_variant	151647					extracellular region		g.chr3:68802078G>C	AY325117	CCDS2907.1	3p14.1	2014-08-14			ENSG00000163377	ENSG00000163377			21591	protein-coding gene	gene with protein product						15028294, 25109685	Standard	NM_182522		Approved	TAFA-4	uc021xah.1	Q96LR4	OTTHUMG00000158744	ENST00000295569.7:c.222C>G	3.37:g.68802078G>C			Somatic				FAM19A4_uc003dni.1_Silent_p.V74V	p.V74V	NM_182522	NP_872328	WXS	Illumina HiSeq	Unspecified	Q96LR4	F19A4_HUMAN		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)	4	665	-		Lung NSC(201;0.0198)	74					A8MVT2	Silent	SNP	ENST00000295569.7	37	c.222C>G	CCDS2907.1																																																																																				0.537	FAM19A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352002.1	NM_182522		11	178	0	0	0	0.013537	0	11	178				
TBC1D23	55773	broad.mit.edu	37	3	100009497	100009497	+	Silent	SNP	T	T	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr3:100009497T>G	ENST00000394144.4	+	5	559	c.552T>G	c.(550-552)tcT>tcG	p.S184S	TBC1D23_ENST00000344949.5_Silent_p.S184S|TBC1D23_ENST00000475134.1_Silent_p.S47S|TBC1D23_ENST00000486274.1_3'UTR	NM_001199198.2	NP_001186127.1	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	184	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of interleukin-6 production (GO:0032755)|regulation of inflammatory response (GO:0050727)|regulation of tumor necrosis factor production (GO:0032680)		Rab GTPase activator activity (GO:0005097)	p.S184S(2)		breast(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(10)|ovary(1)|prostate(2)|skin(2)	25						AGCTTTGTTCTTATCTTGATA	0.363																																							uc003dtt.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|liver(1)	2						c.(550-552)TCT>TCG		TBC1 domain family, member 23							76.0	77.0	77.0					3																	100009497		2203	4300	6503	SO:0001819	synonymous_variant	55773					intracellular	Rab GTPase activator activity	g.chr3:100009497T>G	AK001908	CCDS2936.1, CCDS56265.1	3q12.2	2013-07-10			ENSG00000036054	ENSG00000036054			25622	protein-coding gene	gene with protein product						22312129	Standard	NM_001199198		Approved	FLJ11046	uc003dtt.4	Q9NUY8	OTTHUMG00000159067	ENST00000394144.4:c.552T>G	3.37:g.100009497T>G			Somatic				TBC1D23_uc003dts.2_Silent_p.S184S	p.S184S	NM_018309	NP_060779	WXS	Illumina HiSeq	Unspecified	Q9NUY8	TBC23_HUMAN			5	729	+			184			Rab-GAP TBC.		B9A6M5|Q8TCN8|Q8WUB7|Q96D90|Q9NV75	Silent	SNP	ENST00000394144.4	37	c.552T>G	CCDS56265.1																																																																																				0.363	TBC1D23-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353150.1	NM_018309		6	113	0	0	0	0.001168	0	6	113				
HHLA2	11148	broad.mit.edu	37	3	108076844	108076844	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr3:108076844A>G	ENST00000357759.5	+	6	1253	c.839A>G	c.(838-840)aAt>aGt	p.N280S	HHLA2_ENST00000489514.2_Missense_Mutation_p.N280S|HHLA2_ENST00000467761.1_Missense_Mutation_p.N280S|HHLA2_ENST00000491820.1_Missense_Mutation_p.N280S|HHLA2_ENST00000467562.1_Missense_Mutation_p.N216S	NM_007072.2	NP_009003.1	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2	280	Ig-like V-type 2.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)		p.N280S(2)		endometrium(2)|large_intestine(1)|lung(14)|ovary(1)	18						TCCTCACAAAATACAATTATC	0.378																																							uc003dwy.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(838-840)AAT>AGT		HERV-H LTR-associating 2 precursor							149.0	146.0	147.0					3																	108076844		1845	4097	5942	SO:0001583	missense	11148					integral to membrane		g.chr3:108076844A>G	AF126162	CCDS46883.1, CCDS63713.1, CCDS74975.1	3q13.13	2013-01-11			ENSG00000114455	ENSG00000114455		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	4905	protein-coding gene	gene with protein product		604371				10444326	Standard	NM_007072		Approved	B7H7	uc003dwz.3	Q9UM44	OTTHUMG00000159224	ENST00000357759.5:c.839A>G	3.37:g.108076844A>G	ENSP00000350402:p.Asn280Ser		Somatic				HHLA2_uc011bhl.1_Missense_Mutation_p.N216S|HHLA2_uc010hpu.2_Missense_Mutation_p.N280S|HHLA2_uc003dwz.2_Missense_Mutation_p.N280S	p.N280S	NM_007072	NP_009003	WXS	Illumina HiSeq	Unspecified	Q9UM44	HHLA2_HUMAN			6	1006	+			280			Ig-like V-type 2.		B4DKN2|D3DN60|Q9NWQ6	Missense_Mutation	SNP	ENST00000357759.5	37	c.839A>G	CCDS46883.1	.	.	.	.	.	.	.	.	.	.	A	10.58	1.390160	0.25118	.	.	ENSG00000114455	ENST00000491820;ENST00000467562;ENST00000357759;ENST00000467761;ENST00000489514	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	5.31	-1.54	0.08584	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.839833	0.09940	N	0.736066	T	0.41373	0.1156	N	0.24115	0.695	0.09310	N	1	B;B;B	0.26445	0.149;0.149;0.149	B;B;B	0.25140	0.058;0.058;0.058	T	0.25012	-1.0144	10	0.37606	T	0.19	-0.3359	4.7973	0.13279	0.4653:0.2795:0.2551:0.0	.	216;280;280	B4DKN2;C9J7D0;Q9UM44	.;.;HHLA2_HUMAN	S	280;216;280;280;280	ENSP00000418284:N280S;ENSP00000418345:N216S;ENSP00000350402:N280S;ENSP00000419207:N280S;ENSP00000417856:N280S	ENSP00000350402:N280S	N	+	2	0	HHLA2	109559534	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.068000	0.14531	-0.160000	0.11002	-0.256000	0.11100	AAT		0.378	HHLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353924.1	NM_007072		7	219	0	0	0	0.004482	0	7	219				
SEC61A1	29927	broad.mit.edu	37	3	127785935	127785935	+	Nonsense_Mutation	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr3:127785935C>T	ENST00000243253.3	+	9	1100	c.916C>T	c.(916-918)Caa>Taa	p.Q306*	SEC61A1_ENST00000483956.1_3'UTR|RUVBL1_ENST00000464873.1_Intron|SEC61A1_ENST00000424880.2_Nonsense_Mutation_p.Q186*|SEC61A1_ENST00000464451.1_Nonsense_Mutation_p.Q312*	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	306					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)	p.Q306*(2)		central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						TGTCATCTCCCAAATGCTCTC	0.527																																							uc003ekb.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(916-918)CAA>TAA		Sec61 alpha 1 subunit							220.0	180.0	193.0					3																	127785935		2203	4300	6503	SO:0001587	stop_gained	29927				protein targeting to ER	integral to endoplasmic reticulum membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity|protein binding|ribosome binding	g.chr3:127785935C>T	AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.916C>T	3.37:g.127785935C>T	ENSP00000243253:p.Gln306*		Somatic				RUVBL1_uc003eke.2_Intron|RUVBL1_uc003ekf.2_Intron|SEC61A1_uc003ekc.2_Nonsense_Mutation_p.Q253*|SEC61A1_uc003ekd.2_Nonsense_Mutation_p.Q186*|SEC61A1_uc003ekg.2_5'UTR	p.Q306*	NM_013336	NP_037468	WXS	Illumina HiSeq	Unspecified	P61619	S61A1_HUMAN			9	1100	+			306			Helical; (Potential).		P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Nonsense_Mutation	SNP	ENST00000243253.3	37	c.916C>T	CCDS3046.1	.	.	.	.	.	.	.	.	.	.	C	34	5.398551	0.96030	.	.	ENSG00000058262	ENST00000464451;ENST00000243253;ENST00000424880	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.7202	0.91689	0.0:1.0:0.0:0.0	.	.	.	.	X	312;306;186	.	ENSP00000243253:Q306X	Q	+	1	0	SEC61A1	129268625	1.000000	0.71417	1.000000	0.80357	0.336000	0.28762	7.818000	0.86416	2.411000	0.81874	0.563000	0.77884	CAA		0.527	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356541.2	NM_013336		60	206	0	0	0	0.01441	0	60	206				
RAB7A	7879	broad.mit.edu	37	3	128514237	128514237	+	Silent	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr3:128514237G>A	ENST00000265062.3	+	2	273	c.27G>A	c.(25-27)ctG>ctA	p.L9L	RAB7A_ENST00000482525.1_Silent_p.L9L|RAB7A_ENST00000485280.1_Silent_p.L9L	NM_004637.5	NP_004628.4	P51149	RAB7A_HUMAN	RAB7A, member RAS oncogene family	9					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|bone resorption (GO:0045453)|cell death (GO:0008219)|early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|epidermal growth factor catabolic process (GO:0007174)|GTP catabolic process (GO:0006184)|phagosome acidification (GO:0090383)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein targeting to lysosome (GO:0006622)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	alveolar lamellar body (GO:0097208)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8				GBM - Glioblastoma multiforme(114;0.231)		AAGTGTTGCTGAAGGTTATCA	0.453											OREG0015781	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003eks.1		NA																	0					0						c.(25-27)CTG>CTA		RAB7, member RAS oncogene family							165.0	153.0	157.0					3																	128514237		2203	4300	6503	SO:0001819	synonymous_variant	7879				endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding	g.chr3:128514237G>A	X93499	CCDS3052.1	3q21	2014-09-17	2007-01-15	2007-01-15	ENSG00000075785	ENSG00000075785		"""RAB, member RAS oncogene"""	9788	protein-coding gene	gene with protein product		602298	"""RAB7, member RAS oncogene family"""	RAB7		9126495, 9428630	Standard	NM_004637		Approved		uc003eks.1	P51149	OTTHUMG00000159812	ENST00000265062.3:c.27G>A	3.37:g.128514237G>A			Somatic	OREG0015781	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1565	RAB7A_uc010hsv.1_Silent_p.L9L|RAB7A_uc003ekt.2_5'Flank	p.L9L	NM_004637	NP_004628	WXS	Illumina HiSeq	Unspecified	P51149	RAB7A_HUMAN		GBM - Glioblastoma multiforme(114;0.231)	2	259	+			9					A8K3V6|Q9NWJ0|Q9UPB0	Silent	SNP	ENST00000265062.3	37	c.27G>A	CCDS3052.1																																																																																				0.453	RAB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357479.1			6	165	0	0	0	0.001168	0	6	165				
SENP5	205564	broad.mit.edu	37	3	196613336	196613336	+	Silent	SNP	T	T	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr3:196613336T>C	ENST00000323460.5	+	2	1533	c.1284T>C	c.(1282-1284)ccT>ccC	p.P428P	SENP5_ENST00000445299.2_Silent_p.P428P|SENP5_ENST00000419026.1_Intron	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	428					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		TAGATGGGCCTGTGTCCCAAA	0.468																																					Ovarian(47;891 1095 11174 13858 51271)	Ovarian(47;891 1095 11174 13858 51271)	uc003fwz.3		NA																	0				breast(2)|lung(1)	3						c.(1282-1284)CCT>CCC		SUMO1/sentrin specific peptidase 5							99.0	97.0	98.0					3																	196613336		2203	4300	6503	SO:0001819	synonymous_variant	205564				cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity	g.chr3:196613336T>C	BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.1284T>C	3.37:g.196613336T>C			Somatic				SENP5_uc011bty.1_Silent_p.P428P	p.P428P	NM_152699	NP_689912	WXS	Illumina HiSeq	Unspecified	Q96HI0	SENP5_HUMAN	Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)	2	1533	+	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		428					B4DY82|Q96SA5	Silent	SNP	ENST00000323460.5	37	c.1284T>C	CCDS3322.1																																																																																				0.468	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	NM_152699		3	131	0	0	0	0.004672	0	3	131				
MTTP	4547	broad.mit.edu	37	4	100532564	100532564	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr4:100532564T>C	ENST00000265517.5	+	14	2146	c.1943T>C	c.(1942-1944)cTg>cCg	p.L648P	MTTP_ENST00000457717.1_Missense_Mutation_p.L648P|MTTP_ENST00000511045.1_Missense_Mutation_p.L675P|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	648	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)	p.L648P(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	AGAAGTAACCTGAACATCTTT	0.433																																							uc003hvc.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(1)	4						c.(1942-1944)CTG>CCG		microsomal triglyceride transfer protein large	Hesperetin(DB01094)						182.0	168.0	172.0					4																	100532564		2203	4300	6503	SO:0001583	missense	4547				lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity	g.chr4:100532564T>C		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1943T>C	4.37:g.100532564T>C	ENSP00000265517:p.Leu648Pro		Somatic				MTTP_uc011cej.1_Missense_Mutation_p.L675P	p.L648P	NM_000253	NP_000244	WXS	Illumina HiSeq	Unspecified	P55157	MTP_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	15	2199	+			648			Vitellogenin.		A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	ENST00000265517.5	37	c.1943T>C	CCDS3651.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.525865	0.44969	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	T;T;T	0.64085	-0.08;-0.06;-0.06	5.62	5.62	0.85841	Lipid transport protein, N-terminal (1);	0.100357	0.64402	D	0.000004	T	0.73892	0.3645	M	0.68317	2.08	0.80722	D	1	D;D	0.67145	0.965;0.996	P;P	0.57548	0.541;0.823	T	0.77335	-0.2626	10	0.72032	D	0.01	-32.5017	15.8181	0.78621	0.0:0.0:0.0:1.0	.	675;648	E9PBP6;P55157	.;MTP_HUMAN	P	675;648;648	ENSP00000427679:L675P;ENSP00000400821:L648P;ENSP00000265517:L648P	ENSP00000265517:L648P	L	+	2	0	MTTP	100751587	1.000000	0.71417	0.999000	0.59377	0.100000	0.18952	7.363000	0.79516	2.139000	0.66308	0.533000	0.62120	CTG		0.433	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3			104	185	0	0	0	0.01441	0	104	185				
TACR3	6870	broad.mit.edu	37	4	104640578	104640578	+	Silent	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr4:104640578G>A	ENST00000304883.2	-	1	395	c.255C>T	c.(253-255)atC>atT	p.I85I		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	85					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)	p.I85I(2)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		ACCAGAGCGCGATGCGCCAGG	0.647																																							uc003hxe.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|lung(2)|breast(1)|skin(1)	7						c.(253-255)ATC>ATT		tachykinin receptor 3							91.0	88.0	89.0					4																	104640578		2203	4300	6503	SO:0001819	synonymous_variant	6870					integral to plasma membrane	tachykinin receptor activity	g.chr4:104640578G>A	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.255C>T	4.37:g.104640578G>A			Somatic					p.I85I	NM_001059	NP_001050	WXS	Illumina HiSeq	Unspecified	P29371	NK3R_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)	1	398	-		Hepatocellular(203;0.217)	85			Helical; Name=1; (Potential).		Q0P510	Silent	SNP	ENST00000304883.2	37	c.255C>T	CCDS3664.1																																																																																				0.647	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059		14	171	0	0	0	0.004007	0	14	171				
CDH6	1004	broad.mit.edu	37	5	31317961	31317961	+	Silent	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr5:31317961G>A	ENST00000265071.2	+	11	2077	c.1812G>A	c.(1810-1812)gcG>gcA	p.A604A	CDH6_ENST00000514738.1_Silent_p.A549A	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	604	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						ATGCGGAGGCGCTCATCCACC	0.582																																							uc003jhe.1		NA																	0				ovary(4)|skin(2)|large_intestine(1)	7						c.(1810-1812)GCG>GCA		cadherin 6, type 2 preproprotein							63.0	59.0	60.0					5																	31317961		2203	4300	6503	SO:0001819	synonymous_variant	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31317961G>A	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1812G>A	5.37:g.31317961G>A			Somatic				CDH6_uc003jhd.1_Silent_p.A604A	p.A604A	NM_004932	NP_004923	WXS	Illumina HiSeq	Unspecified	P55285	CADH6_HUMAN			11	2138	+			604			Extracellular (Potential).|Cadherin 5.		A8K5H5|Q9BWS0	Silent	SNP	ENST00000265071.2	37	c.1812G>A	CCDS3894.1																																																																																				0.582	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		5	172	0	0	0	0.000602	0	5	172				
BDP1	55814	broad.mit.edu	37	5	70837459	70837459	+	Missense_Mutation	SNP	A	A	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr5:70837459A>C	ENST00000358731.4	+	29	6464	c.6201A>C	c.(6199-6201)agA>agC	p.R2067S	BDP1_ENST00000380675.2_Missense_Mutation_p.R203S	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2067					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R2067S(2)		NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAAGTTCCAGAGAAGAAATAA	0.313																																							uc003kbp.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)	2						c.(6199-6201)AGA>AGC		transcription factor-like nuclear regulator							73.0	71.0	72.0					5																	70837459		1809	4076	5885	SO:0001583	missense	55814				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding	g.chr5:70837459A>C	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.6201A>C	5.37:g.70837459A>C	ENSP00000351575:p.Arg2067Ser		Somatic				BDP1_uc003kbo.2_Missense_Mutation_p.R2067S|BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_RNA	p.R2067S	NM_018429	NP_060899	WXS	Illumina HiSeq	Unspecified	A6H8Y1	BDP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)	29	6464	+		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)	2067					Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	c.6201A>C	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	A	9.302	1.053418	0.19907	.	.	ENSG00000145734	ENST00000358731;ENST00000451951;ENST00000380675;ENST00000545546	T;T	0.49139	3.69;0.79	5.81	3.32	0.38043	.	0.789790	0.11996	N	0.509305	T	0.32315	0.0825	L	0.38175	1.15	0.27123	N	0.962088	B;P	0.41848	0.021;0.763	B;B	0.33392	0.009;0.163	T	0.16158	-1.0412	10	0.59425	D	0.04	.	6.3917	0.21591	0.6769:0.1653:0.0:0.1578	.	2067;2067	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	S	2067;1615;203;203	ENSP00000351575:R2067S;ENSP00000370050:R203S	ENSP00000351575:R2067S	R	+	3	2	BDP1	70873215	0.978000	0.34361	0.331000	0.25455	0.051000	0.14879	1.691000	0.37721	0.417000	0.25871	0.377000	0.23210	AGA		0.313	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429		34	120	0	0	0	0.003271	0	34	120				
PCDHGA11	56105	broad.mit.edu	37	5	140801620	140801620	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr5:140801620G>A	ENST00000398587.2	+	1	859	c.826G>A	c.(826-828)Ggg>Agg	p.G276R	PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.G276R|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	276	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G276R(2)		breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGAATCAACGGGGAAGTAAT	0.463																																							uc003lkq.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(826-828)GGG>AGG		protocadherin gamma subfamily A, 11 isoform 1							141.0	141.0	141.0					5																	140801620		1866	4103	5969	SO:0001583	missense	56105				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140801620G>A	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.826G>A	5.37:g.140801620G>A	ENSP00000381589:p.Gly276Arg		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Missense_Mutation_p.G276R|PCDHGA11_uc003lkp.1_Missense_Mutation_p.G276R	p.G276R	NM_018914	NP_061737	WXS	Illumina HiSeq	Unspecified	Q9Y5H2	PCDGB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1084	+			276			Extracellular (Potential).|Cadherin 3.		B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	37	c.826G>A	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	g	17.32	3.359774	0.61403	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.53423	0.62;0.62	5.82	4.9	0.64082	Cadherin (4);Cadherin-like (1);	229.351000	0.02392	U	0.079788	T	0.77598	0.4154	M	0.87682	2.9	0.33388	D	0.57569	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.989;0.991;0.973	T	0.64262	-0.6449	10	0.72032	D	0.01	.	15.3802	0.74648	0.0:0.0:0.86:0.14	.	276;276;276	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	R	276	ENSP00000381589:G276R;ENSP00000428333:G276R	ENSP00000381589:G276R	G	+	1	0	PCDHGA11	140781804	0.994000	0.37717	0.969000	0.41365	0.671000	0.39405	2.819000	0.48049	2.752000	0.94435	0.655000	0.94253	GGG		0.463	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914		68	357	0	0	0	0.01441	0	68	357				
ARSI	340075	broad.mit.edu	37	5	149677361	149677361	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr5:149677361C>T	ENST00000328668.7	-	2	1705	c.1126G>A	c.(1126-1128)Gcc>Acc	p.A376T		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	376					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCGCTGATGGCCGGCCACACG	0.637																																							uc003lrv.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1126-1128)GCC>ACC		arylsulfatase family, member I precursor							41.0	44.0	43.0					5																	149677361		2203	4300	6503	SO:0001583	missense	340075					endoplasmic reticulum|extracellular region	arylsulfatase activity|metal ion binding	g.chr5:149677361C>T	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1126G>A	5.37:g.149677361C>T	ENSP00000333395:p.Ala376Thr		Somatic					p.A376T	NM_001012301	NP_001012301	WXS	Illumina HiSeq	Unspecified	Q5FYB1	ARSI_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		2	1715	-			376					A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	37	c.1126G>A	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	C	1.754	-0.488544	0.04352	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.96300	-3.97;-3.97	4.76	3.9	0.45041	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.105242	0.64402	N	0.000003	D	0.88514	0.6457	N	0.10685	0.025	0.45883	D	0.998739	B	0.14012	0.009	B	0.18871	0.023	T	0.82538	-0.0407	10	0.02654	T	1	.	12.9896	0.58612	0.0:0.922:0.0:0.078	.	376	Q5FYB1	ARSI_HUMAN	T	376;233	ENSP00000333395:A376T;ENSP00000426879:A233T	ENSP00000333395:A376T	A	-	1	0	ARSI	149657554	0.089000	0.21612	0.969000	0.41365	0.594000	0.36715	0.632000	0.24583	1.226000	0.43582	0.561000	0.74099	GCC		0.637	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301		5	192	0	0	0	0.001168	0	5	192				
WWC1	23286	broad.mit.edu	37	5	167850949	167850949	+	Silent	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr5:167850949C>T	ENST00000265293.4	+	11	2188	c.1686C>T	c.(1684-1686)ctC>ctT	p.L562L	WWC1_ENST00000521089.1_Silent_p.L562L	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	562					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)	p.L562L(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		ATGCCTTCCTCAACTCCTTGG	0.587																																							uc003lzu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)|breast(1)	5						c.(1684-1686)CTC>CTT		WW and C2 domain containing 1 isoform 3							70.0	65.0	67.0					5																	167850949		2203	4300	6503	SO:0001819	synonymous_variant	23286				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity	g.chr5:167850949C>T	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.1686C>T	5.37:g.167850949C>T			Somatic				WWC1_uc003lzv.2_Silent_p.L562L|WWC1_uc011den.1_Silent_p.L562L|WWC1_uc003lzw.2_Silent_p.L361L	p.L562L	NM_015238	NP_056053	WXS	Illumina HiSeq	Unspecified	Q8IX03	KIBRA_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)	11	1779	+	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	562					B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Silent	SNP	ENST00000265293.4	37	c.1686C>T	CCDS4366.1	.	.	.	.	.	.	.	.	.	.	C	0.055	-1.239338	0.01493	.	.	ENSG00000113645	ENST00000393895;ENST00000524228	.	.	.	4.98	2.23	0.28157	.	.	.	.	.	.	.	.	.	.	.	0.44995	D	0.998011	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4209	0.27071	0.0805:0.1452:0.662:0.1123	.	.	.	.	X	524;339	.	.	Q	+	1	0	WWC1	167783527	1.000000	0.71417	0.428000	0.26697	0.108000	0.19459	2.842000	0.48230	0.160000	0.19432	-0.731000	0.03576	CAA		0.587	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238		32	176	0	0	0	0.013726	0	32	176				
BLOC1S5-TXNDC5	100526836	broad.mit.edu	37	6	7986912	7986912	+	Intron	SNP	T	T	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr6:7986912T>C	ENST00000439343.2	-	4	372				TXNDC5_ENST00000539054.1_Intron					BLOC1S5-TXNDC5 readthrough (NMD candidate)																		GGCATGCCCATCAAGAAAACA	0.522																																							uc003mxx.3		NA																	0					0						c.(142-144)ATC>ACC		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																				SO:0001627	intron_variant	206426							g.chr6:7986912T>C			6p24.3	2013-05-09	2013-05-09	2012-08-01	ENSG00000259040	ENSG00000259040			42001	other	readthrough			"""MUTED-TXNDC5 readthrough (non-protein coding)"""	MUTED-TXNDC5			Standard	NR_037616		Approved				OTTHUMG00000171453	ENST00000439343.2:c.372+39687A>G	6.37:g.7986912T>C			Somatic				TXNDC5_uc003mxw.2_Intron	p.I48T	NR_027712		WXS	Illumina HiSeq	Unspecified					1	578	+									Missense_Mutation	SNP	ENST00000439343.2	37	c.143T>C																																																																																					0.522	BLOC1S5-TXNDC5-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000413472.1	NR_037616.1		3	44	0	0	0	0.009096	0	3	44				
TRIM15	89870	broad.mit.edu	37	6	30140065	30140065	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr6:30140065G>A	ENST00000376694.4	+	7	1806	c.1337G>A	c.(1336-1338)gGc>gAc	p.G446D	TRIM15_ENST00000376688.1_Intron	NM_033229.2	NP_150232.2	Q9C019	TRI15_HUMAN	tripartite motif containing 15	446	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|mesodermal cell fate determination (GO:0007500)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	14						TCTTTCTCCGGCAAAGTCTTC	0.632																																							uc010jrx.2		NA																	0					0						c.(1336-1338)GGC>GAC		tripartite motif protein 15							32.0	35.0	34.0					6																	30140065		1509	2707	4216	SO:0001583	missense	89870				mesodermal cell fate determination	intracellular	zinc ion binding	g.chr6:30140065G>A	AF220132, U34249	CCDS4677.1	6p21.33	2013-01-09	2011-01-25		ENSG00000204610	ENSG00000204610		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16284	protein-coding gene	gene with protein product			"""zinc finger protein 178"", ""tripartite motif-containing 15"""	ZNF178		11331580, 8304341, 8812418	Standard	NM_033229		Approved	ZNFB7, RNF93	uc010jrx.3	Q9C019	OTTHUMG00000031031	ENST00000376694.4:c.1337G>A	6.37:g.30140065G>A	ENSP00000365884:p.Gly446Asp		Somatic					p.G446D	NM_033229	NP_150232	WXS	Illumina HiSeq	Unspecified	Q9C019	TRI15_HUMAN			7	1816	+			446			B30.2/SPRY.		A2BEC9|O95604|Q8IUX9|Q9C018	Missense_Mutation	SNP	ENST00000376694.4	37	c.1337G>A	CCDS4677.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214793	0.58452	.	.	ENSG00000204610	ENST00000376695;ENST00000376694	T	0.62941	-0.01	4.54	1.76	0.24704	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.328565	0.21908	N	0.067351	T	0.28962	0.0719	L	0.55990	1.75	0.09310	N	1	B	0.17268	0.021	B	0.15052	0.012	T	0.27123	-1.0083	10	0.22109	T	0.4	.	6.88	0.24168	0.3873:0.0:0.6127:0.0	.	446	Q9C019	TRI15_HUMAN	D	377;446	ENSP00000365884:G446D	ENSP00000365884:G446D	G	+	2	0	TRIM15	30248044	0.000000	0.05858	0.006000	0.13384	0.491000	0.33493	0.258000	0.18387	0.045000	0.15804	0.478000	0.44815	GGC		0.632	TRIM15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076026.2	NM_033229		4	89	0	0	0	0.009096	0	4	89				
PPP1R10	5514	broad.mit.edu	37	6	30574350	30574350	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr6:30574350C>G	ENST00000376511.2	-	8	1081	c.529G>C	c.(529-531)Gag>Cag	p.E177Q		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	177	Interaction with TOX4. {ECO:0000250}.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)	p.E177Q(2)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						GCCTTCACCTCTGTCAAAGGT	0.488																																							uc003nqn.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|kidney(1)	4						c.(529-531)GAG>CAG		protein phosphatase 1, regulatory subunit 10							102.0	94.0	97.0					6																	30574350		2203	4300	6503	SO:0001583	missense	5514				protein import into nucleus|transcription, DNA-dependent	PTW/PP1 phosphatase complex	DNA binding|protein phosphatase inhibitor activity|RNA binding|zinc ion binding	g.chr6:30574350C>G	Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.529G>C	6.37:g.30574350C>G	ENSP00000365694:p.Glu177Gln		Somatic				PPP1R10_uc010jsc.1_5'UTR	p.E177Q	NM_002714	NP_002705	WXS	Illumina HiSeq	Unspecified	Q96QC0	PP1RA_HUMAN			8	1081	-			177			Interaction with TOX4 (By similarity).		O00405	Missense_Mutation	SNP	ENST00000376511.2	37	c.529G>C	CCDS4681.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843334	0.71488	.	.	ENSG00000204569	ENST00000376511;ENST00000537132	T	0.50548	0.74	5.82	5.82	0.92795	.	0.159847	0.53938	D	0.000049	T	0.41488	0.1161	N	0.24115	0.695	0.58432	D	0.999995	D	0.61697	0.99	P	0.57204	0.815	T	0.15263	-1.0443	10	0.33940	T	0.23	-22.0881	18.8625	0.92278	0.0:1.0:0.0:0.0	.	177	Q96QC0	PP1RA_HUMAN	Q	177	ENSP00000365694:E177Q	ENSP00000365694:E177Q	E	-	1	0	PPP1R10	30682329	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	4.502000	0.60400	2.755000	0.94549	0.591000	0.81541	GAG		0.488	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714		11	171	0	0	0	0.008291	0	11	171				
USP49	25862	broad.mit.edu	37	6	41774070	41774070	+	Missense_Mutation	SNP	C	C	T	rs548556992		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr6:41774070C>T	ENST00000394253.3	-	3	981	c.652G>A	c.(652-654)Gac>Aac	p.D218N	USP49_ENST00000297229.2_Missense_Mutation_p.D218N|USP49_ENST00000373006.1_Missense_Mutation_p.D218N|USP49_ENST00000373010.1_Missense_Mutation_p.D218N|USP49_ENST00000373009.3_Missense_Mutation_p.D218N			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	218					histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.D218N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			gggcccgcgtcgcggggcgTG	0.771													C|||	1	0.000199681	0.0	0.0	5008	,	,		9830	0.0		0.0	False		,,,				2504	0.001						uc003ori.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(652-654)GAC>AAC		ubiquitin thioesterase 49							5.0	6.0	6.0					6																	41774070		1472	3174	4646	SO:0001583	missense	25862				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding	g.chr6:41774070C>T	AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.652G>A	6.37:g.41774070C>T	ENSP00000377797:p.Asp218Asn		Somatic					p.D218N	NM_018561	NP_061031	WXS	Illumina HiSeq	Unspecified	Q70CQ1	UBP49_HUMAN	STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)		4	874	-	Ovarian(28;0.0919)|Colorectal(47;0.121)		218					Q5T3D9|Q5T3E0|Q96CK4	Missense_Mutation	SNP	ENST00000394253.3	37	c.652G>A		.	.	.	.	.	.	.	.	.	.	C	0.004	-2.289900	0.00248	.	.	ENSG00000164663	ENST00000394253;ENST00000373010;ENST00000373009;ENST00000373006;ENST00000297229	T;T;T;T;T	0.06608	3.77;3.28;3.77;3.55;3.55	1.23	-0.876	0.10624	.	1.937020	0.03588	U	0.231298	T	0.01092	0.0036	N	0.22421	0.69	0.09310	N	1	B	0.23442	0.085	B	0.25987	0.065	T	0.45848	-0.9233	10	0.14656	T	0.56	0.0087	2.6755	0.05080	0.0:0.4697:0.3072:0.2231	.	218	Q70CQ1-2	.	N	218	ENSP00000377797:D218N;ENSP00000362101:D218N;ENSP00000362100:D218N;ENSP00000362097:D218N;ENSP00000297229:D218N	ENSP00000297229:D218N	D	-	1	0	USP49	41882048	0.997000	0.39634	0.001000	0.08648	0.000000	0.00434	2.367000	0.44213	-0.361000	0.08125	-0.892000	0.02923	GAC		0.771	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000316513.3	NM_018561		6	13	0	0	0	0.00308	0	6	13				
CUL9	23113	broad.mit.edu	37	6	43184061	43184061	+	Silent	SNP	C	C	T	rs376792971		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr6:43184061C>T	ENST00000252050.4	+	31	6186	c.6102C>T	c.(6100-6102)ggC>ggT	p.G2034G	RP3-330M21.5_ENST00000500590.1_RNA|CUL9_ENST00000354495.3_Silent_p.G1924G|CUL9_ENST00000372647.2_Silent_p.G2006G	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	2034					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.G2034G(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CCCACTGGGGCGCTGAACAGC	0.597																																							uc003ouk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						c.(6100-6102)GGC>GGT		p53-associated parkin-like cytoplasmic protein		C		0,4406		0,0,2203	50.0	43.0	45.0		6102	-11.6	0.0	6		45	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CUL9	NM_015089.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		2034/2518	43184061	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23113				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding	g.chr6:43184061C>T	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.6102C>T	6.37:g.43184061C>T			Somatic				CUL9_uc003oul.2_Silent_p.G2006G|CUL9_uc010jyk.2_Silent_p.G1186G|CUL9_uc003oun.2_5'UTR	p.G2034G	NM_015089	NP_055904	WXS	Illumina HiSeq	Unspecified	Q8IWT3	CUL9_HUMAN			31	6177	+			2034					O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	c.6102C>T	CCDS4890.1																																																																																				0.597	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		25	89	0	0	0	0.004656	0	25	89				
HTR1B	3351	broad.mit.edu	37	6	78172847	78172847	+	Missense_Mutation	SNP	C	C	A	rs200352111		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr6:78172847C>A	ENST00000369947.2	-	1	643	c.274G>T	c.(274-276)Gcg>Tcg	p.A92S		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	92					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.A92S(2)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TCGGTGACCGCCAGAGAGGCG	0.597																																							uc003pil.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(274-276)GCG>TCG		5-hydroxytryptamine (serotonin) receptor 1B	Almotriptan(DB00918)|Dexfenfluramine(DB01191)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Pindolol(DB00960)|Propranolol(DB00571)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Venlafaxine(DB00285)|Zolmitriptan(DB00315)						151.0	135.0	140.0					6																	78172847		2203	4300	6503	SO:0001583	missense	3351				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cAMP biosynthetic process|synaptic transmission	integral to plasma membrane	protein binding|serotonin receptor activity	g.chr6:78172847C>A	BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.274G>T	6.37:g.78172847C>A	ENSP00000358963:p.Ala92Ser		Somatic					p.A92S	NM_000863	NP_000854	WXS	Illumina HiSeq	Unspecified	P28222	5HT1B_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.205)	1	274	-		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)	92			Helical; Name=2; (By similarity).		Q4VAY7	Missense_Mutation	SNP	ENST00000369947.2	37	c.274G>T	CCDS4986.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426930	0.83667	.	.	ENSG00000135312	ENST00000369947	T	0.51325	0.71	4.85	4.85	0.62838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.68320	0.2988	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73030	-0.4111	9	.	.	.	.	17.1254	0.86712	0.0:1.0:0.0:0.0	.	92	P28222	5HT1B_HUMAN	S	92	ENSP00000358963:A92S	.	A	-	1	0	HTR1B	78229566	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.567000	0.82357	2.522000	0.85027	0.561000	0.74099	GCG		0.597	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041292.1	NM_000863		55	243	1	0	7.36392e-32	0.01441	8.83671e-32	55	243				
SNAP91	9892	broad.mit.edu	37	6	84270599	84270599	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr6:84270599C>G	ENST00000439399.2	-	27	2826	c.2510G>C	c.(2509-2511)gGa>gCa	p.G837A	SNAP91_ENST00000195649.6_Missense_Mutation_p.G832A|SNAP91_ENST00000520302.1_Missense_Mutation_p.G807A|SNAP91_ENST00000437520.1_Missense_Mutation_p.G530A|SNAP91_ENST00000369694.2_Missense_Mutation_p.G837A|SNAP91_ENST00000521485.1_Missense_Mutation_p.G832A|SNAP91_ENST00000520213.1_Missense_Mutation_p.G530A|SNAP91_ENST00000428679.2_Missense_Mutation_p.G837A|SNAP91_ENST00000521743.1_Missense_Mutation_p.G837A	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	837	Pro-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)	p.G837A(4)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AAATCCTGCTCCAGGTTGTCC	0.418																																							uc011dze.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(1)	1						c.(2509-2511)GGA>GCA		synaptosomal-associated protein, 91kDa homolog							45.0	45.0	45.0					6																	84270599		1936	4142	6078	SO:0001583	missense	9892				clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding	g.chr6:84270599C>G	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2510G>C	6.37:g.84270599C>G	ENSP00000400459:p.Gly837Ala		Somatic				SNAP91_uc011dzd.1_Missense_Mutation_p.G335A|SNAP91_uc003pkb.2_Missense_Mutation_p.G746A|SNAP91_uc003pkc.2_Missense_Mutation_p.G807A|SNAP91_uc003pkd.2_Missense_Mutation_p.G530A|SNAP91_uc003pka.2_Missense_Mutation_p.G835A	p.G837A	NM_014841	NP_055656	WXS	Illumina HiSeq	Unspecified	O60641	AP180_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0967)	26	2827	-		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)	837			Pro-rich.		A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	37	c.2510G>C	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.802783	0.31869	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000523448	T;T;T;T;T;T;T;T;T;T	0.24350	2.39;2.39;2.39;2.39;2.38;2.42;2.39;2.39;2.42;1.86	5.51	3.72	0.42706	.	0.479696	0.24220	N	0.040455	T	0.24431	0.0592	L	0.43152	1.355	0.21579	N	0.999635	B;D;D;D;D	0.76494	0.002;0.999;0.999;0.999;0.999	B;D;D;D;D	0.79108	0.003;0.992;0.987;0.987;0.987	T	0.08166	-1.0735	10	0.40728	T	0.16	-3.9846	10.9209	0.47163	0.1377:0.5968:0.2655:0.0	.	713;530;807;837;835	B7Z2N2;O60641-3;E5RI02;O60641;E1P549	.;.;.;AP180_HUMAN;.	A	832;837;837;832;837;530;807;837;530;178	ENSP00000429776:G832A;ENSP00000358708:G837A;ENSP00000400459:G837A;ENSP00000195649:G832A;ENSP00000412492:G837A;ENSP00000413277:G530A;ENSP00000428511:G807A;ENSP00000428215:G837A;ENSP00000428026:G530A;ENSP00000430255:G178A	ENSP00000195649:G832A	G	-	2	0	SNAP91	84327318	1.000000	0.71417	0.973000	0.42090	0.092000	0.18411	2.278000	0.43426	0.681000	0.31386	-0.373000	0.07131	GGA		0.418	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1			8	45	0	0	0	0.008291	0	8	45				
FBXO30	84085	broad.mit.edu	37	6	146126568	146126568	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr6:146126568G>A	ENST00000237281.4	-	2	1140	c.974C>T	c.(973-975)tCa>tTa	p.S325L		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	325							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S325L(2)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		GGAAGGTTTTGAAGTGCCATC	0.428																																							uc003qla.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|large_intestine(1)	3						c.(973-975)TCA>TTA		F-box only protein 30							126.0	117.0	120.0					6																	146126568		2203	4300	6503	SO:0001583	missense	84085						ubiquitin-protein ligase activity|zinc ion binding	g.chr6:146126568G>A	AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.974C>T	6.37:g.146126568G>A	ENSP00000237281:p.Ser325Leu		Somatic				uc003qky.1_Intron	p.S325L	NM_032145	NP_115521	WXS	Illumina HiSeq	Unspecified	Q8TB52	FBX30_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)	2	1173	-		Ovarian(120;0.0776)	325					Q9BXZ7	Missense_Mutation	SNP	ENST00000237281.4	37	c.974C>T	CCDS5208.1	.	.	.	.	.	.	.	.	.	.	G	1.536	-0.543061	0.04053	.	.	ENSG00000118496	ENST00000237281	T	0.18174	2.23	5.66	1.73	0.24493	.	1.416560	0.03946	N	0.287724	T	0.05960	0.0155	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35500	-0.9786	10	0.38643	T	0.18	-1.4462	8.1892	0.31357	0.5463:0.0:0.4537:0.0	.	325	Q8TB52	FBX30_HUMAN	L	325	ENSP00000237281:S325L	ENSP00000237281:S325L	S	-	2	0	FBXO30	146168261	0.301000	0.24444	0.003000	0.11579	0.548000	0.35241	1.406000	0.34646	0.381000	0.24851	0.655000	0.94253	TCA		0.428	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042570.2			34	90	0	0	0	0.012213	0	34	90				
SCRN1	9805	broad.mit.edu	37	7	30008662	30008662	+	Missense_Mutation	SNP	A	A	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr7:30008662A>G	ENST00000426154.1	-	2	198	c.22T>C	c.(22-24)Tac>Cac	p.Y8H	SCRN1_ENST00000434476.2_Missense_Mutation_p.Y28H|SCRN1_ENST00000242059.5_Missense_Mutation_p.Y8H|SCRN1_ENST00000409497.1_Missense_Mutation_p.Y8H|SCRN1_ENST00000425819.2_Intron|SCRN1_ENST00000494620.1_Intron|SCRN1_ENST00000409570.1_Missense_Mutation_p.Y8H	NM_001145513.1	NP_001138985.1	Q12765	SCRN1_HUMAN	secernin 1	8					exocytosis (GO:0006887)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	dipeptidase activity (GO:0016805)	p.Y28H(2)|p.Y8H(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(2)|prostate(2)|skin(2)	25						ACAAAACAGTAACTTGGAGGA	0.478																																							uc010kvp.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(22-24)TAC>CAC		secernin 1 isoform c							82.0	64.0	70.0					7																	30008662		2203	4300	6503	SO:0001583	missense	9805				exocytosis|proteolysis	cytoplasm|nuclear membrane	dipeptidase activity	g.chr7:30008662A>G	D83777	CCDS5422.1, CCDS47567.1, CCDS47568.1	7p14.3-p14.1	2006-09-06			ENSG00000136193	ENSG00000136193			22192	protein-coding gene	gene with protein product		614965				12221138	Standard	NM_014766		Approved	KIAA0193	uc011kaa.2	Q12765	OTTHUMG00000097093	ENST00000426154.1:c.22T>C	7.37:g.30008662A>G	ENSP00000409068:p.Tyr8His		Somatic				SCRN1_uc011jzy.1_Intron|SCRN1_uc003tak.2_Missense_Mutation_p.Y8H|SCRN1_uc011jzz.1_Missense_Mutation_p.Y8H|SCRN1_uc011kaa.1_Missense_Mutation_p.Y28H|SCRN1_uc011jzx.1_Intron	p.Y8H	NM_001145515	NP_001138987	WXS	Illumina HiSeq	Unspecified	Q12765	SCRN1_HUMAN			1	226	-			8					A8K0E9|B4DHM0|B4DIP5|C9JPG0|Q25QX7|Q8IWD1	Missense_Mutation	SNP	ENST00000426154.1	37	c.22T>C	CCDS5422.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.842564	0.51057	.	.	ENSG00000136193	ENST00000242059;ENST00000426154;ENST00000409497;ENST00000434476;ENST00000421434;ENST00000438497;ENST00000409570	T;T;T;T;T;T;T	0.30182	3.28;3.28;3.28;3.25;2.28;1.57;1.54	5.63	5.63	0.86233	.	0.177914	0.40064	N	0.001186	T	0.37156	0.0993	L	0.44542	1.39	0.80722	D	1	P;P	0.43973	0.823;0.646	P;P	0.49561	0.615;0.492	T	0.04915	-1.0918	9	.	.	.	-4.9679	14.6565	0.68835	1.0:0.0:0.0:0.0	.	28;8	C9JPG0;Q12765	.;SCRN1_HUMAN	H	8;8;8;28;8;8;8	ENSP00000242059:Y8H;ENSP00000409068:Y8H;ENSP00000386872:Y8H;ENSP00000388942:Y28H;ENSP00000413184:Y8H;ENSP00000406289:Y8H;ENSP00000387052:Y8H	.	Y	-	1	0	SCRN1	29975187	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.185000	0.72013	2.139000	0.66308	0.454000	0.30748	TAC		0.478	SCRN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214231.2	NM_014766		22	38	0	0	0	0.012319	0	22	38				
STAG3	10734	broad.mit.edu	37	7	99796183	99796183	+	Missense_Mutation	SNP	G	G	A	rs149765159		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr7:99796183G>A	ENST00000426455.1	+	13	1737	c.1330G>A	c.(1330-1332)Gca>Aca	p.A444T	STAG3_ENST00000440830.1_3'UTR|GATS_ENST00000543273.1_RNA|STAG3_ENST00000317296.5_Missense_Mutation_p.A444T|STAG3_ENST00000394018.2_Missense_Mutation_p.A386T	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	444					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)		p.A444T(2)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGCCTCTGCCGCAGGCGAATT	0.547																																							uc003utx.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|lung(1)|kidney(1)	8						c.(1330-1332)GCA>ACA		stromal antigen 3		G	THR/ALA	2,4404		0,2,2201	87.0	81.0	83.0		1330	5.1	1.0	7	dbSNP_134	83	0,8600		0,0,4300	no	missense	STAG3	NM_012447.2	58	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	444/1226	99796183	2,13004	2203	4300	6503	SO:0001583	missense	10734				chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding	g.chr7:99796183G>A	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.1330G>A	7.37:g.99796183G>A	ENSP00000400359:p.Ala444Thr		Somatic				STAG3_uc010lgs.1_Missense_Mutation_p.A232T|STAG3_uc011kjk.1_Missense_Mutation_p.A386T|STAG3_uc003uub.1_5'Flank	p.A444T	NM_012447	NP_036579	WXS	Illumina HiSeq	Unspecified	Q9UJ98	STAG3_HUMAN			13	1485	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		444					A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	37	c.1330G>A	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	.	25.0	4.588665	0.86851	4.54E-4	0.0	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000339784;ENST00000317296	T;T;T	0.38722	1.12;1.19;1.12	5.09	5.09	0.68999	Armadillo-type fold (1);	0.136616	0.33327	N	0.005030	T	0.66752	0.2821	M	0.81682	2.555	0.80722	D	1	D;D	0.89917	1.0;0.996	D;P	0.80764	0.994;0.791	T	0.70550	-0.4841	10	0.87932	D	0	-5.9027	16.3629	0.83275	0.0:0.0:1.0:0.0	.	386;444	B4DZ10;Q9UJ98	.;STAG3_HUMAN	T	444;386;402;444	ENSP00000400359:A444T;ENSP00000377586:A386T;ENSP00000319318:A444T	ENSP00000319318:A444T	A	+	1	0	STAG3	99634119	1.000000	0.71417	0.983000	0.44433	0.288000	0.27193	7.443000	0.80521	2.809000	0.96659	0.555000	0.69702	GCA		0.547	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447		30	159	0	0	0	0.00632	0	30	159				
COG5	10466	broad.mit.edu	37	7	107013191	107013191	+	Silent	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr7:107013191G>A	ENST00000347053.3	-	8	827	c.777C>T	c.(775-777)gtC>gtT	p.V259V	COG5_ENST00000393603.2_Silent_p.V259V|COG5_ENST00000297135.3_Silent_p.V259V|COG5_ENST00000475638.2_5'UTR	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	259					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.V259V(2)		breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						GAGCTGTTCCGACTTGAGTTG	0.343																																							uc003ved.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(2)|skin(2)	4						c.(775-777)GTC>GTT		component of oligomeric golgi complex 5 isoform							52.0	52.0	52.0					7																	107013191		2203	4300	6503	SO:0001819	synonymous_variant	10466				intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding	g.chr7:107013191G>A	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.777C>T	7.37:g.107013191G>A			Somatic				COG5_uc003vec.2_Silent_p.V259V|COG5_uc003vee.2_Silent_p.V259V	p.V259V	NM_181733	NP_859422	WXS	Illumina HiSeq	Unspecified	Q9UP83	COG5_HUMAN			8	1302	-			259					A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Silent	SNP	ENST00000347053.3	37	c.777C>T	CCDS5743.1																																																																																				0.343	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060216.4			15	82	0	0	0	0.003163	0	15	82				
LRGUK	136332	broad.mit.edu	37	7	133943059	133943059	+	Missense_Mutation	SNP	C	C	T	rs544247071		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr7:133943059C>T	ENST00000285928.2	+	19	2318	c.2249C>T	c.(2248-2250)cCg>cTg	p.P750L		NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	750						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)	p.P750L(2)		breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						CGGTTCTGTCCGTGGTCAAAA	0.453																																							uc003vrm.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(2)|kidney(1)	5						c.(2248-2250)CCG>CTG		leucine-rich repeats and guanylate kinase domain							143.0	135.0	138.0					7																	133943059		2203	4300	6503	SO:0001583	missense	136332						ATP binding|kinase activity	g.chr7:133943059C>T	AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.2249C>T	7.37:g.133943059C>T	ENSP00000285928:p.Pro750Leu		Somatic					p.P750L	NM_144648	NP_653249	WXS	Illumina HiSeq	Unspecified	Q96M69	LRGUK_HUMAN			19	2265	+			750					Q2M3I1	Missense_Mutation	SNP	ENST00000285928.2	37	c.2249C>T	CCDS5830.1	.	.	.	.	.	.	.	.	.	.	C	8.518	0.868192	0.17250	.	.	ENSG00000155530	ENST00000285928	T	0.35973	1.28	3.73	-1.47	0.08772	.	1.110130	0.06813	N	0.790783	T	0.20495	0.0493	N	0.20986	0.625	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.22103	-1.0226	10	0.30854	T	0.27	-0.2081	3.4862	0.07620	0.1805:0.3765:0.0:0.443	.	750	Q96M69	LRGUK_HUMAN	L	750	ENSP00000285928:P750L	ENSP00000285928:P750L	P	+	2	0	LRGUK	133593599	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.269000	0.08596	-0.330000	0.08514	0.650000	0.86243	CCG		0.453	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339442.1	NM_144648		11	153	0	0	0	0.013537	0	11	153				
ST18	9705	broad.mit.edu	37	8	53071617	53071617	+	Silent	SNP	G	G	A	rs200320573	byFrequency	TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr8:53071617G>A	ENST00000276480.7	-	15	2330	c.1647C>T	c.(1645-1647)ggC>ggT	p.G549G		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	549					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G549G(2)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				GGGTGTGGGCGCCTGCACTAG	0.483													G|||	15	0.00299521	0.0	0.0	5008	,	,		16993	0.0		0.0	False		,,,				2504	0.0153						uc003xqz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|skin(1)	5						c.(1645-1647)GGC>GGT		suppression of tumorigenicity 18							85.0	93.0	90.0					8																	53071617		2203	4300	6503	SO:0001819	synonymous_variant	9705					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:53071617G>A	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1647C>T	8.37:g.53071617G>A			Somatic				ST18_uc011ldq.1_Silent_p.G196G|ST18_uc011ldr.1_Silent_p.G514G|ST18_uc011lds.1_Silent_p.G454G|ST18_uc003xra.2_Silent_p.G549G|ST18_uc003xrb.2_Silent_p.G549G	p.G549G	NM_014682	NP_055497	WXS	Illumina HiSeq	Unspecified	O60284	ST18_HUMAN			10	1803	-		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)	549					Q17RY1	Silent	SNP	ENST00000276480.7	37	c.1647C>T	CCDS6149.1																																																																																				0.483	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1			57	198	0	0	0	0.01441	0	57	198				
MSC	9242	broad.mit.edu	37	8	72756065	72756065	+	Missense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr8:72756065G>A	ENST00000325509.4	-	1	638	c.349C>T	c.(349-351)Cgt>Tgt	p.R117C	RP11-383H13.1_ENST00000537896.1_Intron|MSC_ENST00000518440.1_5'Flank|RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000521467.1_Intron	NM_005098.3	NP_005089.2	O60682	MUSC_HUMAN	musculin	117	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branchiomeric skeletal muscle development (GO:0014707)|diaphragm development (GO:0060539)|palate development (GO:0060021)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(4)|skin(2)	26	Breast(64;0.176)		Epithelial(68;0.137)|BRCA - Breast invasive adenocarcinoma(89;0.203)			ATCCGGGCACGCTCACGGGCG	0.687											OREG0018826	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003xyx.1		NA																	0					0						c.(349-351)CGT>TGT		musculin							22.0	23.0	23.0					8																	72756065		2202	4299	6501	SO:0001583	missense	9242				transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr8:72756065G>A		CCDS43746.1	8q13.3	2013-06-07	2010-04-28		ENSG00000178860	ENSG00000178860		"""Basic helix-loop-helix proteins"""	7321	protein-coding gene	gene with protein product	"""activated B-cell factor-1"""	603628	"""musculin (activated B-cell factor-1)"""			9584154, 10198176	Standard	NM_005098		Approved	ABF-1, bHLHa22	uc003xyx.1	O60682	OTTHUMG00000164489	ENST00000325509.4:c.349C>T	8.37:g.72756065G>A	ENSP00000321445:p.Arg117Cys		Somatic	OREG0018826	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1140	uc011lff.1_Intron|uc003xyy.2_5'Flank	p.R117C	NM_005098	NP_005089	WXS	Illumina HiSeq	Unspecified	O60682	MUSC_HUMAN	Epithelial(68;0.137)|BRCA - Breast invasive adenocarcinoma(89;0.203)		1	667	-	Breast(64;0.176)		117			Basic motif.		O75946|Q53XZ2|Q9BRE7	Missense_Mutation	SNP	ENST00000325509.4	37	c.349C>T	CCDS43746.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022092	0.75275	.	.	ENSG00000178860	ENST00000325509	D	0.94138	-3.36	4.87	2.83	0.33086	Helix-loop-helix DNA-binding (5);	0.047909	0.85682	D	0.000000	D	0.97848	0.9293	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.98550	1.0636	10	0.87932	D	0	.	13.4636	0.61241	0.0:0.0:0.601:0.399	.	117	O60682	MUSC_HUMAN	C	117	ENSP00000321445:R117C	ENSP00000321445:R117C	R	-	1	0	MSC	72918619	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.276000	0.33156	1.034000	0.39945	0.555000	0.69702	CGT		0.687	MSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378974.1	NM_005098		4	77	0	0	0	0.009096	0	4	77				
HEY1	23462	broad.mit.edu	37	8	80677881	80677881	+	Nonsense_Mutation	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr8:80677881G>A	ENST00000354724.3	-	5	656	c.457C>T	c.(457-459)Cga>Tga	p.R153*	HEY1_ENST00000337919.5_Nonsense_Mutation_p.R157*|HEY1_ENST00000435063.2_5'UTR|HEY1_ENST00000523976.1_Nonsense_Mutation_p.R63*|RP11-27N21.3_ENST00000607172.1_lincRNA	NM_012258.3	NP_036390.3	Q9Y5J3	HEY1_HUMAN	hes-related family bHLH transcription factor with YRPW motif 1	153	Orange. {ECO:0000255|PROSITE- ProRule:PRU00380}.				angiogenesis (GO:0001525)|anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular valve formation (GO:0003190)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac septum morphogenesis (GO:0060411)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to glucocorticoid stimulus (GO:0071385)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion morphogenesis (GO:0003203)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve morphogenesis (GO:0003184)|regulation of vasculogenesis (GO:2001212)|transcription from RNA polymerase II promoter (GO:0006366)|umbilical cord morphogenesis (GO:0036304)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R157*(1)|p.R153*(1)	HEY1/NCOA2(10)	cervix(1)|kidney(2)|large_intestine(5)|lung(14)	22	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			GAAACCAGTCGAACTCGAAGC	0.582			T	NCOA2	mesenchymal chondrosarcoma						OREG0018837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003ybm.2		NA		Dom	yes		8	8q21	23462		hairy/enhancer-of-split related with YRPW motif 1			M					2	Substitution - Nonsense(2)		lung(2)	lung(3)	3						c.(457-459)CGA>TGA		hairy/enhancer-of-split related with YRPW motif							53.0	55.0	54.0					8																	80677881		2203	4300	6503	SO:0001587	stop_gained	23462				angiogenesis|negative regulation of Notch signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|transcription, DNA-dependent	nucleus	DNA binding|protein binding	g.chr8:80677881G>A	AF151522	CCDS6225.1, CCDS43749.1, CCDS64915.1	8q21	2013-10-17	2013-10-17					"""Basic helix-loop-helix proteins"""	4880	protein-coding gene	gene with protein product		602953	"""hairy/enhancer-of-split related with YRPW motif 1"""			10415358, 10403790	Standard	NM_001040708		Approved	HESR-1, CHF2, HESR1, HRT-1, CHF-2, HERP2, BHLHb31	uc003ybl.3	Q9Y5J3		ENST00000354724.3:c.457C>T	8.37:g.80677881G>A	ENSP00000346761:p.Arg153*		Somatic	OREG0018837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1200	HEY1_uc010lzq.2_Nonsense_Mutation_p.R34*|HEY1_uc003ybl.2_Nonsense_Mutation_p.R157*	p.R153*	NM_012258	NP_036390	WXS	Illumina HiSeq	Unspecified	Q9Y5J3	HEY1_HUMAN	Epithelial(68;0.076)|all cancers(69;0.179)		5	657	-	all_lung(9;5.1e-05)		153			Orange.		B2R883|Q5TZS3|Q8NAM2|Q9NYP4	Nonsense_Mutation	SNP	ENST00000354724.3	37	c.457C>T	CCDS6225.1	.	.	.	.	.	.	.	.	.	.	G	36	5.920210	0.97105	.	.	ENSG00000164683	ENST00000354724;ENST00000542205;ENST00000337919;ENST00000523976;ENST00000518733	.	.	.	4.98	3.05	0.35203	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.9516	13.6178	0.62120	0.0:0.0:0.6876:0.3124	.	.	.	.	X	153;157;157;63;115	.	ENSP00000338272:R157X	R	-	1	2	HEY1	80840436	1.000000	0.71417	0.285000	0.24819	0.922000	0.55478	6.161000	0.71868	0.498000	0.27948	0.561000	0.74099	CGA		0.582	HEY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379516.1	NM_012258		9	137	0	0	0	0.004482	0	9	137				
SLC39A4	55630	broad.mit.edu	37	8	145640272	145640272	+	Silent	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr8:145640272C>T	ENST00000301305.3	-	5	918	c.813G>A	c.(811-813)ctG>ctA	p.L271L	SLC39A4_ENST00000276833.5_Silent_p.L246L|SLC39A4_ENST00000531013.1_5'Flank	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	271					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)	p.L246L(1)|p.L271L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			CCCTGGCACTCAGGCATACCT	0.672																																							uc003zcq.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(811-813)CTG>CTA		solute carrier family 39 (zinc transporter),							69.0	72.0	71.0					8																	145640272		2203	4300	6503	SO:0001819	synonymous_variant	55630					cytoplasmic membrane-bounded vesicle|integral to membrane|recycling endosome membrane	zinc ion transmembrane transporter activity	g.chr8:145640272C>T	AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.813G>A	8.37:g.145640272C>T			Somatic				SLC39A4_uc003zcm.1_5'Flank|SLC39A4_uc003zcn.2_5'Flank|SLC39A4_uc003zco.2_5'UTR|SLC39A4_uc003zcp.2_Silent_p.L246L	p.L271L	NM_130849	NP_570901	WXS	Illumina HiSeq	Unspecified	Q6P5W5	S39A4_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)		5	913	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		271			Extracellular (Potential).		Q7L5S5|Q9H6T8|Q9NXC4	Silent	SNP	ENST00000301305.3	37	c.813G>A	CCDS6424.1																																																																																				0.672	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382688.1			43	215	0	0	0	0.01441	0	43	215				
TLR4	7099	broad.mit.edu	37	9	120475310	120475310	+	Missense_Mutation	SNP	G	G	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr9:120475310G>C	ENST00000355622.6	+	3	1005	c.904G>C	c.(904-906)Gac>Cac	p.D302H	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.D262H	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	302					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TGATATTATTGACTTATTTAA	0.348																																							uc004bjz.2		NA																	0				lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(904-906)GAC>CAC		toll-like receptor 4 precursor							85.0	91.0	89.0					9																	120475310		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120475310G>C	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.904G>C	9.37:g.120475310G>C	ENSP00000363089:p.Asp302His		Somatic				TLR4_uc004bka.2_Missense_Mutation_p.D262H|TLR4_uc004bkb.2_Missense_Mutation_p.D102H	p.D302H	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			3	1195	+			302			Extracellular (Potential).		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.904G>C	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	7.220	0.597150	0.13875	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.22539	1.95;1.95	5.78	1.89	0.25635	.	1.237010	0.05290	N	0.520998	T	0.20700	0.0498	L	0.61218	1.895	0.09310	N	1	B	0.18013	0.025	B	0.17979	0.02	T	0.33752	-0.9856	10	0.17832	T	0.49	.	3.7737	0.08652	0.4511:0.0:0.3821:0.1668	.	302	O00206	TLR4_HUMAN	H	262;302	ENSP00000377997:D262H;ENSP00000363089:D302H	ENSP00000363089:D302H	D	+	1	0	TLR4	119515131	0.001000	0.12720	0.001000	0.08648	0.072000	0.16883	1.202000	0.32271	0.357000	0.24183	0.655000	0.94253	GAC		0.348	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		8	162	0	0	0	0.00308	0	8	162				
NAIF1	203245	broad.mit.edu	37	9	130829073	130829073	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr9:130829073C>G	ENST00000373078.4	-	1	527	c.308G>C	c.(307-309)gGa>gCa	p.G103A	SLC25A25_ENST00000373068.2_5'Flank|SLC25A25_ENST00000373069.5_5'Flank|NAIF1_ENST00000488519.1_5'Flank	NM_197956.3	NP_931045.1	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	103	Gly-rich.				negative regulation of cell growth (GO:0030308)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G103A(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCCCCCAGCTCCGTCCTCCTC	0.682																																							uc004bta.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(307-309)GGA>GCA		nuclear apoptosis inducing factor 1							33.0	35.0	34.0					9																	130829073		2200	4298	6498	SO:0001583	missense	203245				apoptosis|induction of apoptosis	nucleus		g.chr9:130829073C>G	AK122729	CCDS6889.1	9q34.11	2008-04-10	2008-04-10	2008-04-10	ENSG00000171169	ENSG00000171169			25446	protein-coding gene	gene with protein product	"""nuclear apoptosis-inducing factor 1"""	610673	"""chromosome 9 open reading frame 90"""	C9orf90		14702039, 16378748	Standard	NM_197956		Approved	DKFZp762G199, bA379C10.2	uc004bta.3	Q69YI7	OTTHUMG00000020727	ENST00000373078.4:c.308G>C	9.37:g.130829073C>G	ENSP00000362170:p.Gly103Ala		Somatic				NAIF1_uc004bsz.2_Intron|SLC25A25_uc004btb.2_5'Flank	p.G103A	NM_197956	NP_931045	WXS	Illumina HiSeq	Unspecified	Q69YI7	NAIF1_HUMAN			1	527	-			103			Gly-rich.		B3KV81|Q8WU12	Missense_Mutation	SNP	ENST00000373078.4	37	c.308G>C	CCDS6889.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.031958	0.54790	.	.	ENSG00000171169	ENST00000373078	.	.	.	5.0	5.0	0.66597	.	0.079486	0.52532	D	0.000061	T	0.52725	0.1752	N	0.14661	0.345	0.34660	D	0.722567	D	0.67145	0.996	D	0.73708	0.981	T	0.53315	-0.8456	9	0.12430	T	0.62	-17.7663	15.5988	0.76609	0.0:1.0:0.0:0.0	.	103	Q69YI7	NAIF1_HUMAN	A	103	.	ENSP00000362170:G103A	G	-	2	0	NAIF1	129868894	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.815000	0.48018	2.607000	0.88179	0.655000	0.94253	GGA		0.682	NAIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054330.1	NM_197956		7	60	0	0	0	0.006214	0	7	60				
VAV2	7410	broad.mit.edu	37	9	136671295	136671295	+	Silent	SNP	G	G	A			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr9:136671295G>A	ENST00000371850.3	-	9	775	c.744C>T	c.(742-744)atC>atT	p.I248I	VAV2_ENST00000371851.1_Silent_p.I243I|VAV2_ENST00000406606.3_Silent_p.I243I	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	248	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I243I(1)|p.I248I(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GATGCACCTTGATCAGGTCCT	0.592																																							uc004ces.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						c.(742-744)ATC>ATT		vav 2 guanine nucleotide exchange factor isoform							74.0	46.0	55.0					9																	136671295		2199	4298	6497	SO:0001819	synonymous_variant	7410				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity	g.chr9:136671295G>A		CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.744C>T	9.37:g.136671295G>A			Somatic				VAV2_uc004cer.2_Silent_p.I243I	p.I248I	NM_001134398	NP_001127870	WXS	Illumina HiSeq	Unspecified	P52735	VAV2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)	9	790	-			248			DH.		A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Silent	SNP	ENST00000371850.3	37	c.744C>T	CCDS48053.1																																																																																				0.592	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1			4	35	0	0	0	0.009096	0	4	35				
FAM47A	158724	broad.mit.edu	37	X	34150227	34150227	+	Missense_Mutation	SNP	C	C	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chrX:34150227C>T	ENST00000346193.3	-	1	220	c.169G>A	c.(169-171)Gac>Aac	p.D57N		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	57										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TAGCGGAAGTCGTCCATGCCC	0.562																																							uc004ddg.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(169-171)GAC>AAC		hypothetical protein LOC158724							75.0	73.0	73.0					X																	34150227		2202	4300	6502	SO:0001583	missense	158724							g.chrX:34150227C>T	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.169G>A	X.37:g.34150227C>T	ENSP00000345029:p.Asp57Asn		Somatic					p.D57N	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	202	-			57					A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.169G>A	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.283623	0.23392	.	.	ENSG00000185448	ENST00000346193	T	0.21191	2.02	1.17	0.248	0.15526	.	.	.	.	.	T	0.32466	0.0830	M	0.83953	2.67	0.09310	N	1	D	0.63046	0.992	P	0.52672	0.706	T	0.15206	-1.0445	9	0.46703	T	0.11	.	3.3597	0.07182	0.0:0.6982:0.0:0.3018	.	57	Q5JRC9	FA47A_HUMAN	N	57	ENSP00000345029:D57N	ENSP00000345029:D57N	D	-	1	0	FAM47A	34060148	0.005000	0.15991	0.024000	0.17045	0.094000	0.18550	0.156000	0.16382	0.020000	0.15106	0.544000	0.68410	GAC		0.562	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		4	94	0	0	0	0.009096	0	4	94				
FAM47C	442444	broad.mit.edu	37	X	37028662	37028662	+	Missense_Mutation	SNP	T	T	C			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chrX:37028662T>C	ENST00000358047.3	+	1	2231	c.2179T>C	c.(2179-2181)Tgc>Cgc	p.C727R		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	727										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						ATCTCATCTCTGCCCGGAGCC	0.637													N|||	1	0.000264901	0.0008	0.0	3775	,	,		11117	0.0		0.0	False		,,,				2504	0.0						uc004ddl.1		NA																	0				ovary(3)	3						c.(2179-2181)TGC>CGC		hypothetical protein LOC442444							49.0	47.0	47.0					X																	37028662		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37028662T>C	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2179T>C	X.37:g.37028662T>C	ENSP00000367913:p.Cys727Arg		Somatic					p.C727R	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	2193	+			727					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.2179T>C	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	0.010	-1.745406	0.00669	.	.	ENSG00000198173	ENST00000358047	T	0.07688	3.17	1.06	-2.11	0.07187	.	.	.	.	.	T	0.02267	0.0070	N	0.03177	-0.4	0.09310	N	1	P	0.46020	0.871	B	0.34824	0.19	T	0.42916	-0.9423	9	0.15066	T	0.55	.	5.1766	0.15139	0.0:0.0:0.2924:0.7076	.	727	Q5HY64	FA47C_HUMAN	R	727	ENSP00000367913:C727R	ENSP00000367913:C727R	C	+	1	0	FAM47C	36938583	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	-0.294000	0.08309	-0.760000	0.04677	-0.800000	0.03216	TGC		0.637	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		4	71	0	0	0	0.009096	0	4	71				
FAM47C	442444	broad.mit.edu	37	X	37028695	37028695	+	Missense_Mutation	SNP	C	C	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chrX:37028695C>G	ENST00000358047.3	+	1	2264	c.2212C>G	c.(2212-2214)Ctc>Gtc	p.L738V		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	738								p.L738V(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGTGTCCCATCTCCGCCCAGA	0.632																																							uc004ddl.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(2212-2214)CTC>GTC		hypothetical protein LOC442444							48.0	47.0	47.0					X																	37028695		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37028695C>G	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2212C>G	X.37:g.37028695C>G	ENSP00000367913:p.Leu738Val		Somatic					p.L738V	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	2226	+			738					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.2212C>G	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	1.164	-0.642964	0.03531	.	.	ENSG00000198173	ENST00000358047	T	0.21031	2.03	0.929	0.929	0.19449	.	.	.	.	.	T	0.33323	0.0859	M	0.79475	2.455	0.09310	N	1	P	0.49696	0.927	P	0.56563	0.801	T	0.14671	-1.0464	9	0.28530	T	0.3	.	3.882	0.09082	0.0:0.6818:0.0:0.3182	.	738	Q5HY64	FA47C_HUMAN	V	738	ENSP00000367913:L738V	ENSP00000367913:L738V	L	+	1	0	FAM47C	36938616	0.001000	0.12720	0.006000	0.13384	0.006000	0.05464	-0.321000	0.08018	0.253000	0.21552	0.257000	0.18616	CTC		0.632	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		6	80	0	0	0	0.001984	0	6	80				
DMBT1	1755	broad.mit.edu	37	10	124399784	124399786	+	In_Frame_Del	DEL	TCC	TCC	-	rs267602398		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	TCC	TCC	-	-	TCC	TCC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr10:124399784_124399786delTCC	ENST00000338354.3	+	52	6890_6892	c.6784_6786delTCC	c.(6784-6786)tccdel	p.S2264del	DMBT1_ENST00000368956.2_In_Frame_Del_p.S1636del|DMBT1_ENST00000368909.3_In_Frame_Del_p.S2264del|DMBT1_ENST00000330163.4_In_Frame_Del_p.S1636del|DMBT1_ENST00000344338.3_In_Frame_Del_p.S2254del|DMBT1_ENST00000368955.3_In_Frame_Del_p.S2254del|DMBT1_ENST00000359586.6_In_Frame_Del_p.S984del			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2264	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CTTTTATACTTCCTCATCTTTCT	0.453																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	0				central_nervous_system(7)	7						c.(6784-6786)TCCdel		deleted in malignant brain tumors 1 isoform b																																				SO:0001651	inframe_deletion	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124399784_124399786delTCC		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.6784_6786delTCC	10.37:g.124399784_124399786delTCC	ENSP00000342210:p.Ser2264del		Somatic				DMBT1_uc001lgl.1_In_Frame_Del_p.S2254del|DMBT1_uc001lgm.1_In_Frame_Del_p.S1636del|DMBT1_uc009xzz.1_In_Frame_Del_p.S2263del|DMBT1_uc010qtx.1_In_Frame_Del_p.S984del|DMBT1_uc009yab.1_In_Frame_Del_p.S967del|DMBT1_uc009yac.1_In_Frame_Del_p.S558del	p.S2264del	NM_007329	NP_015568	WXS	Illumina HiSeq	Unspecified	Q9UGM3	DMBT1_HUMAN			52	6890_6892	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	2264			ZP.		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	In_Frame_Del	DEL	ENST00000338354.3	37	c.6784_6786delTCC																																																																																					0.453	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		53	146	NA	NA	NA	NA	NA	53	146	---	---	---	---
CLSTN3	9746	broad.mit.edu	37	12	7286327	7286328	+	Frame_Shift_Ins	INS	-	-	A	rs149627692		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr12:7286327_7286328insA	ENST00000266546.6	+	3	796_797	c.346_347insA	c.(346-348)gagfs	p.E116fs	CLSTN3_ENST00000537408.1_Frame_Shift_Ins_p.E128fs|RP11-273B20.1_ENST00000538062.1_RNA	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	116	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						TGACTGTGGCGAGGGCCCCGAC	0.629																																							uc001qsr.2		NA																	0				large_intestine(1)	1						c.(346-348)GAGfs		calsyntenin 3 precursor																																				SO:0001589	frameshift_variant	9746				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr12:7286327_7286328insA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.347dupA	12.37:g.7286328_7286328dupA	ENSP00000266546:p.Glu116fs		Somatic				CLSTN3_uc001qss.2_Frame_Shift_Ins_p.E128fs	p.E116fs	NM_014718	NP_055533	WXS	Illumina HiSeq	Unspecified	Q9BQT9	CSTN3_HUMAN			3	624_625	+			116			Extracellular (Potential).|Cadherin 1.		D3DUT6|O94831|Q2T9J5|Q5UE57	Frame_Shift_Ins	INS	ENST00000266546.6	37	c.346_347insA	CCDS8575.1																																																																																				0.629	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718		7	144	NA	NA	NA	NA	NA	7	144	---	---	---	---
MIS18BP1	55320	broad.mit.edu	37	14	45693722	45693722	+	Frame_Shift_Del	DEL	T	T	-			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr14:45693722delT	ENST00000310806.4	-	11	2526	c.2068delA	c.(2068-2070)agtfs	p.S690fs		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	690					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						CTGATGGGACTTTTTTTTTGA	0.373																																						Ovarian(187;620 2054 7273 12043 20532)	uc001wwf.2		NA																	0					0						c.(2068-2070)AGTfs		chromosome 14 open reading frame 106				10,4254		2,6,2124	97.0	100.0	99.0			-1.0	0.0	14		100	20,8234		2,16,4109	no	frameshift	MIS18BP1	NM_018353.4		4,22,6233	A1A1,A1R,RR		0.2423,0.2345,0.2397			45693722	30,12488	2203	4300	6503	SO:0001589	frameshift_variant	55320				cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm	DNA binding	g.chr14:45693722delT	AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2068delA	14.37:g.45693722delT	ENSP00000309790:p.Ser690fs		Somatic					p.S690fs	NM_018353	NP_060823	WXS	Illumina HiSeq	Unspecified	Q6P0N0	M18BP_HUMAN			11	2527	-			690					D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Frame_Shift_Del	DEL	ENST00000310806.4	37	c.2068delA	CCDS9684.1																																																																																				0.373	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2			7	179	NA	NA	NA	NA	NA	7	179	---	---	---	---
RAPGEF6	51735	broad.mit.edu	37	5	130815368	130815369	+	Frame_Shift_Ins	INS	-	-	T			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr5:130815368_130815369insT	ENST00000509018.1	-	16	2123_2124	c.1918_1919insA	c.(1918-1920)agtfs	p.S640fs	CTC-432M15.3_ENST00000514667.1_Frame_Shift_Ins_p.S690fs|RAPGEF6_ENST00000308008.6_Frame_Shift_Ins_p.S640fs|RAPGEF6_ENST00000510071.1_Frame_Shift_Ins_p.S640fs|RAPGEF6_ENST00000296859.6_Frame_Shift_Ins_p.S640fs|RAPGEF6_ENST00000307984.5_Frame_Shift_Ins_p.S640fs|RAPGEF6_ENST00000512052.1_Frame_Shift_Ins_p.S355fs|RAPGEF6_ENST00000507093.1_Frame_Shift_Ins_p.S640fs	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	640					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		ATGGCGATTACTTTTTTTTTCA	0.366																																					Melanoma(168;435 1955 13113 13877 23213)	Melanoma(168;435 1955 13113 13877 23213)	uc003kvn.1		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(1918-1920)AGTfs		PDZ domain-containing guanine nucleotide																																				SO:0001589	frameshift_variant	51735				Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding	g.chr5:130815368_130815369insT	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.1919dupA	5.37:g.130815377_130815377dupT	ENSP00000421684:p.Ser640fs		Somatic				RAPGEF6_uc003kvp.1_Frame_Shift_Ins_p.S690fs|RAPGEF6_uc003kvo.1_Frame_Shift_Ins_p.S640fs|RAPGEF6_uc010jdi.1_Frame_Shift_Ins_p.S640fs|RAPGEF6_uc010jdj.1_Frame_Shift_Ins_p.S640fs|RAPGEF6_uc003kvq.2_Frame_Shift_Ins_p.S357fs|RAPGEF6_uc003kvr.2_Frame_Shift_Ins_p.S640fs|RAPGEF6_uc011cxe.1_RNA|RAPGEF6_uc010jdk.2_Frame_Shift_Ins_p.S640fs	p.S640fs	NM_016340	NP_057424	WXS	Illumina HiSeq	Unspecified	Q8TEU7	RPGF6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)	16	2124_2125	-			640					A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Frame_Shift_Ins	INS	ENST00000509018.1	37	c.1918_1919insA	CCDS34225.1																																																																																				0.366	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340		10	291	NA	NA	NA	NA	NA	10	291	---	---	---	---
PBX2	5089	broad.mit.edu	37	6	32155055	32155056	+	Frame_Shift_Ins	INS	-	-	G	rs143029272		TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr6:32155055_32155056insG	ENST00000375050.4	-	6	1257_1258	c.987_988insC	c.(985-990)cacagcfs	p.S330fs	AGER_ENST00000375070.3_5'Flank|AGER_ENST00000375076.4_5'Flank|XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	330					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						CTGGTGCGGCTGTGGCCCCCCT	0.554																																							uc003oav.1		NA																	0				ovary(1)	1						c.(985-990)CACAGCfs		pre-B-cell leukemia homeobox 2																																				SO:0001589	frameshift_variant	5089						transcription factor binding	g.chr6:32155055_32155056insG		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.988dupC	6.37:g.32155056_32155056dupG	ENSP00000364190:p.Ser330fs		Somatic				PBX2_uc003oaw.2_Frame_Shift_Ins_p.H329fs	p.H329fs	NM_002586	NP_002577	WXS	Illumina HiSeq	Unspecified	P40425	PBX2_HUMAN			6	1258_1259	-			329_330					A2BFJ2	Frame_Shift_Ins	INS	ENST00000375050.4	37	c.987_988insC	CCDS4748.1																																																																																				0.554	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4			8	149	NA	NA	NA	NA	NA	8	149	---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82595145	82595146	+	Frame_Shift_Ins	INS	-	-	G			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr7:82595145_82595146insG	ENST00000333891.9	-	4	4295_4296	c.3958_3959insC	c.(3958-3960)cagfs	p.Q1320fs	PCLO_ENST00000423517.2_Frame_Shift_Ins_p.Q1320fs	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGGCTGTGGCTGTTCTTTTATT	0.406																																							uc003uhx.2		NA																	0				ovary(7)	7						c.(3958-3960)CAGfs		piccolo isoform 1																																				SO:0001589	frameshift_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82595145_82595146insG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3959dupC	7.37:g.82595146_82595146dupG	ENSP00000334319:p.Gln1320fs		Somatic				PCLO_uc003uhv.2_Frame_Shift_Ins_p.Q1320fs	p.Q1320fs	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			4	4247_4248	-			1259						Frame_Shift_Ins	INS	ENST00000333891.9	37	c.3958_3959insC	CCDS47630.1																																																																																				0.406	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		9	243	NA	NA	NA	NA	NA	9	243	---	---	---	---
KDM7A	80853	broad.mit.edu	37	7	139791810	139791810	+	Frame_Shift_Del	DEL	C	C	-			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chr7:139791810delC	ENST00000397560.2	-	19	2622	c.2525delG	c.(2524-2526)agtfs	p.S842fs	Y_RNA_ENST00000515919.1_RNA	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		842					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					ATAATTCCTACTTTGTACCCT	0.448																																							uc003vvm.2		NA																	0				ovary(1)	1						c.(2524-2526)AGTfs		jumonji C domain containing histone demethylase							135.0	119.0	124.0					7																	139791810		1915	4137	6052	SO:0001589	frameshift_variant	80853				midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr7:139791810delC																												ENST00000397560.2:c.2525delG	7.37:g.139791810delC	ENSP00000380692:p.Ser842fs		Somatic				JHDM1D_uc010lng.2_RNA	p.S842fs	NM_030647	NP_085150	WXS	Illumina HiSeq	Unspecified	Q6ZMT4	KDM7_HUMAN			19	2529	-	Melanoma(164;0.0142)		842					A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Frame_Shift_Del	DEL	ENST00000397560.2	37	c.2525delG	CCDS43658.1																																																																																				0.448	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1			39	70	NA	NA	NA	NA	NA	39	70	---	---	---	---
DNASE1L1	1774	broad.mit.edu	37	X	153631085	153631087	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-64-1680-01A-02D-0969-08	TCGA-64-1680-10A-01D-1040-01	AGC	AGC	-	-	AGC	AGC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	6b4cde89-2c2e-4ede-b48b-48d9e7423c45	f4b8b2d5-acc7-4fd6-b852-c80fd79be99e	g.chrX:153631085_153631087delAGC	ENST00000393638.1	-	8	1156_1158	c.870_872delGCT	c.(868-873)ctgcta>cta	p.290_291LL>L	SNORA70_ENST00000384436.1_RNA|DNASE1L1_ENST00000369809.1_In_Frame_Del_p.290_291LL>L	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1	290					DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAGGAGTGATAGCAGCAACAGAA	0.645																																							uc004fks.1		NA																	0					0						c.(868-873)CTGCTA>CTA		deoxyribonuclease I-like 1 precursor																																				SO:0001651	inframe_deletion	1774				DNA catabolic process	endoplasmic reticulum	DNA binding|endodeoxyribonuclease activity, producing 5'-phosphomonoesters	g.chrX:153631085_153631087delAGC	L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188	ENST00000393638.1:c.870_872delGCT	X.37:g.153631088_153631090delAGC	ENSP00000377255:p.Leu291del		Somatic				RPL10_uc004fkq.1_Intron|RPL10_uc004fkr.1_Intron|DNASE1L1_uc004fkt.1_In_Frame_Del_p.290_291LL>L|DNASE1L1_uc004fku.1_In_Frame_Del_p.290_291LL>L|DNASE1L1_uc004fkv.1_In_Frame_Del_p.290_291LL>L|DNASE1L1_uc004fkw.1_In_Frame_Del_p.290_291LL>L	p.290_291LL>L	NM_006730	NP_006721	WXS	Illumina HiSeq	Unspecified	P49184	DNSL1_HUMAN			8	1061_1063	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		290_291					D3DWW7|Q5HY41	In_Frame_Del	DEL	ENST00000393638.1	37	c.870_872delGCT	CCDS14747.1																																																																																				0.645	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080928.2			18	32	NA	NA	NA	NA	NA	18	32	---	---	---	---
